{"text": "Natural abundance 13C NMR was used to determine relative amounts of fatty acid subclasses present in fibroadipose tissue from the human breast in healthy and cancer patients and in breast carcinoma tissue. Resonances corresponding to the carbon atoms of triacylglycerides were obtained when adipose tissue constituted more than 10% of the carcinoma. Resonances corresponding to phospholipids and proteins were also observed when the percentage of adipose tissue was lower. No significant difference between the levels of unsaturated fatty acids in adipose tissue from cancer and non-cancer patients was found. However, significant differences in the levels of monounsaturated and saturated fatty acids of carcinoma compared to non-cancerous tissue was found, as was a nearly significant difference for the levels of polyunsaturated fatty acids in these two tissue types. These findings suggest an alteration of cellular lipid composition in neoplastic mammary tissue."}
{"text": "There is increasing evidence to indicate that O6-methyldeoxyguanosine (O6-MedG) formation in DNA is a critical cytotoxic event following exposure to certain anti-tumour alkylating agents and that the DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase) can confer resistance to these agents. We recently demonstrated a wide inter-individual variation in the depletion and subsequent regeneration of ATase in human peripheral blood lymphocytes following sequential DTIC (400 mg m-2) and fotemustine (100 mg m-2) treatment, with the nadir ATase activity occurring approximately 4 h after DTIC administration. We have now measured the formation and loss of O6-methyldeoxyguanosine (O6-MedG) in the DNA of peripheral leucocytes of eight patients receiving this treatment regimen. O6-MedG could be detected within 1 h and maximal levels occurred approximately 3-5 h after DTIC administration. Following the first treatment cycle, considerable inter-individual variation was observed in the peak O6-MedG levels, with values ranging from 0.71 to 14.3 mumol of O6-MedG per mol of dG . Inter- and intra-individual variation in the extent of O6-MedG formation was also seen in patients receiving additional treatment cycles. This may be a consequence of inter-patient differences in the capacity for metabolism of DTIC to release a methylating intermediate and could be one of the determinants of clinical response. Both the pretreatment ATase levels and the extent of ATase depletion were inversely correlated with the amount of O6-MedG formed in leucocyte DNA when expressed either as peak levels (r = -0.59 and -0.75 respectively) or as the area under the concentration-time curve (r = -0.72 and -0.73 respectively). One complete and one partial clinical response were seen, and these occurred in the two patients with the highest O6-MedG levels in the peripheral leucocyte DNA, although the true significance of this observation has yet to be established."}
{"text": "Worldwide, cancer in the esophagus ranks among the 10 most common cancers. Alterations of retinoic acid receptors  expression is considered to play an important role in development of squamous-cell carcinoma (SCC), which is the most common esophageal cancer. Alcohol consumption and smoking, which can alter retinoic acid receptor levels, have been identified as key risk factors in the development of carcinoma in the aero-digestive tract. Therefore, the aim of the present study was to evaluate protein levels of retinoic acid receptors  in esophageal SCC and surrounding normal tissue of patients with untreated SCC and controls.All study participants completed a questionnaire concerning smoking and alcohol drinking habits as well as anthropometrical parameters. Protein levels of RAR\u03b1, \u03b2, \u03b3, and RXR\u03b2 were determined by Western Blot in normal esophageal tissue and tissue obtained from SCC of 21 patients with newly diagnosed esophageal SCC and normal esophageal tissue of 10 controls.Protein levels of RAR\u03b3 were significantly lower by ~68% in SCC compared to normal surrounding tissue in patients with SCC that smoked and/or consumed elevated amounts of alcohol. Furthermore, RAR\u03b1 protein levels were significantly lower (~- 45%) in SCC in comparison to normal esophageal mucosa in patients with elevated alcohol intake. When comparing protein levels of retinoic acid receptors between normal tissue of patients with SCC and controls, RAR\u03b3 protein levels were found to be significantly higher (~2.7-fold) in normal esophageal tissue of SCC patients than in esophageal tissue obtained from controls. No differences were found for RAR\u03b1, \u03b2, and RXR\u03b2 protein levels between normal esophageal tissue of patients and that of controls.In conclusion, results of the present study suggest that alterations of retinoic acid receptors protein may contribute in the development of SCC in esophagus and that in some patients life style  may be a critical component in the alteration of retinoic acid receptor levels in esophagus. Worldwide esophageal cancer ranks among the ten most common cancers  and the Alterations of retinoid metabolism and retinoic acid receptor -mediated gene transcription have been proposed to play an important role in the pathogenesis of SCC -10. It iSince little is known about the abundance of RARs and RXRs protein in esophageal SCC in humans, the major focus of the present study was to determine protein levels of RAR\u03b1, \u03b2, \u03b3, and RXR\u03b2 in normal, macroscopically unaffected esophageal tissue and SCC of patients with untreated SCC and controls. In addition, alcohol intake and smoking habits of patients and controls were evaluated and related to retinoic acid receptor levels.The study was approved by the Ethics Committee of the Medical Clinic of the University of Cologne, Germany. Informed consent was obtained from all subjects included in the study. A total of 31 subjects, all of whom were undergoing endoscopies for medical reasons, were included in the study. Twenty-one patients had untreated SCC of the esophagus, and ten SCC-free subjects served as controls. Histopathological analysis of SCC was performed by an experienced physician. Tumor staging was based on a graded rating system and varied from G1 (well differentiated) to G3 (poorly differentiated). In controls, the presence or absence of SCC was confirmed macroscopically. All study participants completed a questionnaire concerning smoking and alcohol drinking habits as well as anthropometrical parameters. Using standard pinch forceps, two biopsies were obtained from macroscopically normal esophageal tissue and SCC of subjects with carcinoma and from the mucosa of healthy controls. Biopsies were placed immediately in liquid nitrogen and stored at -80\u00b0C until analysis.\u00ae West Dura . Blots were photographed  and immunoquantitation was accomplished by densitometric analysis using the software AIDA . To achieve standardization and comparability of blots, total protein derived from human liver was loaded on each gel at three concentrations  and blottet with the samples. To ensure equal loading, all blots were stained with Ponceau red; haptene signals were normalized to \u03b2-actin using a commercially available antibody .Total protein was isolated using Trizol reagent . Using SDS-polyacrylamide gel electrophoresis, 20\u201330 \u03bcg of total protein were separated in a 9% polyacrylamide gel (PAGE). Protein was transferred to a nitrocellulose membrane . Membranes were blocked in Tris-buffered saline (TBS) with 5% non-fat milk powder with Tween 20 , rinsed in TBST, and probed with primary antibodies dissolved in TBS followed by an incubation with the secondary antibody. Primary antibodies against RAR\u03b1, \u03b2, \u03b3, and RXR\u03b2 were obtained from Alexis , the secondary peroxidase-conjugated antibodies were purchased from Boehringer . Bands were visualized by enhanced chemiluminescence using SuperSignalt test was used to test for significance of differences in expression levels measured in both normal and malignant tissue of patients with SCC. Fisher's exact test was used for comparison of lifestyle data. Statistical comparison of values originating from separate groups was performed with the Mann-Whitney U-test. P < 0.05 was considered to represent a significant difference.Results are presented as mean \u00b1 standard error of the mean (SEM), unless otherwise stated. Wilcoxon Subject age ranged from 38\u201371 years and most were of normal weight Table .Figures To investigate whether smoking and alcohol consumption influences protein levels of esophageal retinoic acid receptors of patients with SCC were grouped by smoking habits (e.g. non-smoker or smoker) regardless of their alcohol consumption. In smokers, RAR\u03b3 protein levels were found to be significantly lower  in SCC in comparison to unaffected esophageal tissue in smoking patients (n = 10). Interestingly, a similar difference was not found in patients who were non-smokers . Similar, patients were than sub-grouped by alcohol intake regardless of their smoking habits into patients who (a) reported to consume no alcohol (= \"none\"), (b) who reported to be \"moderate\" alcohol consumers not exceeding alcohol intake more than once a week, or (c) who stated to consume alcohol more than 4-times a week or more than 30 g raw ethanol/ d  that basal levels of retinoic acid receptor mRNA expression in normal unaffected tissue might differ between patients with SCC and controls, protein levels of RAR\u03b1, \u03b2, \u03b3, and RXR\u03b2 were determined in esophageal tissue obtained form controls and compared with protein levels measured in normal esophageal tissue obtained from patients with esophageal SCC. Representative Western blots are depicted in Figure in situ studies a reduced mRNA expression of RAR\u03b1 was found in esophageal SCC compared with normal tissue [In the present study, the hypothesis was tested that altered protein levels of retinoic acid receptors might be involved in the development of esophageal SCC in humans. Indeed, protein levels of RAR\u03b3 were found to be significantly lower in SCC relative to normal tissue in patients who smoked and consumed alcohol. A similar difference was found for RAR\u03b1 in SCC patients who reported to consume \"elevated\" amounts of alcohol. However, diminished levels of RAR\u03b3 and RAR\u03b1 were only found in these sub-populations of patients with SCC in the esophagus, suggesting that underlying mechanism leading to the development of SCC may vary depending on life style of patients. Several groups have previously determined mRNA expression of RARs and RXRs in normal esophageal tissue and SCC. Zhang et al.  and Qiu l tissue . Howeverin vitro and in vivo studies [Due to the retrospective character of the present study it can only be speculated whether the association of cigarette smoking and reduced protein levels of RAR\u03b3 in SCC is a cause \u2013 and effect relationship or not. However, the action of tobacco carcinogens are believed to be mediated through covalent binding to DNA, RNA, or protein, forming DNA, RNA, and protein adducts . Further studies  suggest in vitro and in vivo by chlormethiazol, an inhibitor of cytochrome P4502E1 (CYP2E1). A significant induction of CYP2E1 was found after one week of chronic alcohol ingestion in human subjects [Several mechanism have been proposed to explain how alcohol ingestion may interfere with retinoid metabolism. First, it has been shown that alcohol may act as a competitive inhibitor of oxidation of retinal to retinoic acid in several organs (e.g. colon and esophagus) -23. Secosubjects . Therefosubjects . This, iUntill now, information on protein levels of retinoic acid receptors in normal unaffected esophageal tissue has been limited. Recently, in a study determining the role of RXR mRNA in Barett's esophagus mRNA levels of RXR\u03b2 were found to be higher in non-malignant tissue in patients with adenoma than in healthy controls . In the The results of the present study provide further evidence that a diminished abundance of retinoid acid receptors in esophagus is associated with the development of esophageal SCC in humans. Furthermore, in some patients life style  may contribute to the alteration of retinoic acid receptor levels in esophagus. Further studies will be required to elucidate this interaction of alcohol consumption, smoking, and retinoic acid receptor signaling with the development of SCC in the esophagus.The author(s) declare that they have no competing interest.IB has made substantial contributions to the biochemical analysis and the drafting of article. EW has substantially contributed to the acquisition of data, and conception as well as design of the study. EB, AHH, and CB have made substantial contributions to conception and design as well as the interpretation of data. AP has been involved in the design, the drafting of the article, and revised it critically for important intellectual content. All authors have given final approval of the version to be published."}
{"text": "Overexpression of HAI-1 and matriptase together changed the frequency of carcinoma formation to normal. This suggests that the ratio of matriptase to HAI-1 influences the malignant progression. The aim of this study has been to determine the ratio of matriptase and HAI-1 in colorectal cancer tissue (n = 9), severe dysplasia (n = 15), mild/moderate dysplasia (n = 21) and in normal tissue from the same individuals. In addition, corresponding tissue was examined from healthy volunteers (n = 10). Matriptase and HAI-1 mRNA levels were normalized to \u03b2-actin.Using quantitative RT-PCR, we have determined the mRNA levels for Matriptase mRNA level was lower in carcinomas compared to normal tissue from healthy individuals (p < 0.01). In accordance with this, the matriptase mRNA level was also lower in adenomas/carcinomas combined as compared to their adjacent normal tissue (p < 0.01). HAI-1 mRNA levels in both normal and affected tissue from individuals with severe dysplasia or carcinomas and in affected tissue with mild/moderate dysplasia were all significantly lower than mRNA levels observed in corresponding tissue from healthy control individuals. HAI-1 mRNA was lower in carcinomas as compared to normal tissue from healthy individuals (p < 0.001). HAI-1 mRNA levels were significantly lower in tissue displaying mild/moderate (p < 0.001) and severe (p < 0.01) dysplasia compared to normal tissue from the same patients. Both adenomas and carcinomas displayed a significantly different matriptase/HAI-1 mRNA ratio than corresponding normal tissue from healthy control individuals (p < 0.05). In addition statistically significant difference (p < 0.001) could be observed between mild/moderate and severe adenomas and their adjacent normal tissue.matriptase/HAI-1 mRNA ratio occurs early during carcinogenesis. Future studies are required to clarify whether the dysregulated matriptase/HAI-1 ratio was causing the malignant progression or is a consequence of the same.Our results show that dysregulation of the  It has e domain ,8. Matrie domain . Matripte domain -14. HAI-elopment .per se does not seem to be important.It has recently been shown that matriptase possesses a strong oncogenic potential since even a modest overexpression in the skin of transgenic mice caused 100% of the mice to develop tumors, 70% of which progressed into carcinomas . IncreasSeveral studies suggest that matriptase is over-expressed in a wide variety of malignant tumors including prostate, ovarian, uterine, colon, epithelial-type mesothelioma and cervical cell carcinoma ,12,18-22Prompted by the finding that a dysregulated ratio of matriptase to HAI-1 in mice results in tumor formation and carcinogenesis, we have analysed the ratio of matriptase/HAI-1 mRNA expression during colorectal cancer carcinogenesis in humans.\u03b2-actin, matriptase and HAI-1 and was therefore excluded from the study. Individuals with dysplasia, who developed carcinomas and were treated at the same hospital, were registered.The KAM cohort  is based on the screening group of the Norwegian Colorectal Cancer Prevention study (The NORCCAP study) in the county of Telemark, Norway . The ID 2 before RNA purification. RNA purification included a DNAse treatment. The cDNA synthesis was performed on approximately 200 ng RNA per 10 \u03bcl using Gold RT-RCR kit . Quantitative RT-PCR was performed on ABI7500 sequence detection system (Applied Biosystems) in Universal Mastermix (Applied Biosystems) using 160/140 nM probe and 600/300 nM primers for matriptase and HAI-1, respectively. Matriptase: primers were matrip F, 5'GCGCTCCCTGAAGTCCTTT3'; matrip R 5'GTCCTGGGTCCTCTGTACTGTTTT3'; probe, matrip t 5'FAM-TCACCTCAGTGGTGGCTTTCCCCA-BHQ-1-3'. HAI-1: primers were HAI 1 1532F 5'CGCGGCATCTCCAAGAAG3'; HAI 1 1651R 5'GAACACTGCGACAGCCATCTC3'; probe, HAI 1 1572T 5'FAM-AAATCCCCATTCCCAGCACAGGCTC-BHQ-1-3'. The HAI-1 primers detects both HAI-1 and the splice variant HAI-1B. Primers were designed using Primer Express v2.0 Software. Primers were designed within different exons and with probes covering the exon-exon border to prevent amplification of genomic DNA. 18S rRNA and \u03b2-actin primers and probes were obtained from Applied Biosystems. Matriptase and HAI-1 primers and probes were obtained from TAC Copenhagen. In a validation experiment using a control sample, a dilution series was produced and assayed for matriptase, HAI-1 and \u03b2-actin as described for the comparative Ct method [matriptase and HAI-1 and that the PCR reactions have similar efficiencies provided that a threshold of 0.2 is used for matriptase and \u03b2-actin while the threshold was 0.025 for HAI-1. The threshold is a fixed fluorescence signal level above the baseline. The Ct value of a sample is determined as the fractional cycle number when the samples fluorescence signal exceeds the threshold. The threshold is thus assay specific, determined in the validation experiment and depends on the background of the individual assay. This implies that even though the amplification curves for matriptase and HAI-1 were overlapping, indicating that the two genes had the same relative abundance, the normalised HAI-1 mRNA level seemed higher due to the lower threshold used.Total RNA was purified from tissue as recommended by the manufacturers using Qiagen kit . The tissue had been stored in liquid Nt method . When plMatriptase, HAI-1, \u03b2-actin and 18S were quantified separately in triplicates. The average standard deviation on triplicates was 6%. The standard deviation on repeated measurements of the same sample (the control) in separate experiments was 8% and 14% for matriptase and HAI-1 respectively, indicating the day-to-day variation of the assay. Independent PCR reactions of the same samples yielded a correlation coefficient of 0.88. Negative controls (where the RNA was not converted into cDNA) and positive controls were included in all sets. Essentially the same results were obtained whether the expression was normalised to \u03b2-actin or 18S (correlation coefficient of 0.921).MiniTab Statistical Software, Release 13.1 Xtra (Minitab Inc.) and GraphPad Prism 4 were used for the statistic calculations. The data were not adjusted for sex since the incidence ratio of colorectal cancer between the genders is 1.1 in Norway .matriptase and HAI-1 were measured in colon tissue samples from healthy control individuals (n = 10) and in healthy and affected tissue from individuals with mild/moderate dysplasia (n = 21), with severe dysplasia (n = 15) and with colorectal cancer (n = 9) by real-time RT-PCR. We chose to normalise the mRNA levels of matriptase and HAI-1 to the mRNA level of \u03b2-actin. Essentially identical results were obtained when normalized to 18S rRNA . We found that matriptase, HAI-1 and \u03b2-actin mRNA's are present with almost the same abundances  was observed  (Table The range and the interquartile range of mRNA expression of 1) Table .HAI-1 displayed a stronger general decrease in mRNA level with increasing tumor grade for both dysplastic and cancerous tissues as well as in normal tissue than matriptase  (Table 1) Table  in all g1) Table . A compaper se but the ratio of matriptase/HAI-1 expression that determines the frequency of carcinoma formation in a mouse model [matriptase/HAI-1 mRNA expression during colorectal carcinogenesis , severe dysplasia (p < 0.05) and in carcinomas (p < 0.05) when compared to corresponding tissue from healthy individuals. When compared to the ratio of matriptase/HAI-1 mRNA in normal tissue from the same individual there was a statistically significant difference for mild/moderate dysplasia (p < 0.001), for severe dysplasia (p < 0.001) and for all adenomas and carcinomas combined (p < 0.001). No statistically significant difference was seen in carcinoma tissue compared to unaffected tissue from the same person  [\u03b2-actin or that the translation frequency of the mRNAs is low. Indeed the half life of HAI-1 when recombinantly expressed in MDCK cells is in the range of a 1.5 hour .Our results have shown that the abundance of the protein) . Likewismatriptase/HAI-1 mRNA ratio as compared to the corresponding tissue in healthy control individuals, is an early event in colorectal cancer carcinogenesis that is maintained during all stages of malignant progression. Future studies are required to clarify whether the dysregulated matriptase/HAI-1 ratio was causing the malignant progression or is a consequence of the same.In conclusion, our study shows that dysregulation of the The author(s) declare that they have no competing interests.LV and UV conceived the idea of the study. EHK designed the cohort and collected the samples. MS and CFS extracted the RNA, carried out the cDNA synthesis and performed most of the statistical calculations. UV and LV designed and validated primers and probes. LV carried out the RT-PCR and drafted the manuscript. KA and EDKP helped writing the manuscript. All authors helped interpret the results, writing the manuscript and read and approved the final version.The pre-publication history for this paper can be accessed here:"}
{"text": "Prostasin is proteolytically activated by the serine protease, matriptase, which has a very high oncogenic potential. Prostasin is inhibited by protease nexin-1 (PN-1) and the two isoforms encoded by the mRNA splice variants of prostasin and PN-1 in colorectal cancer tissue (n = 116), severe dysplasia (n = 13), mild/moderate dysplasia (n = 93), and in normal tissue from the same individuals. In addition, corresponding tissues were examined from healthy volunteers (n = 23). A part of the cohort was further analysed for the mRNA levels of the two variants of HAI-1, here denoted HAI-1A and HAI-1B. mRNA levels were normalised to \u03b2-actin. Immunohistochemical analysis of prostasin and HAI-1 was performed on normal and cancer tissue.Using quantitative RT-PCR, we have determined the mRNA levels for PN-1 was more that two-fold elevated in colorectal cancer tissue as compared to healthy individuals (p < 0.001) and elevated in both mild/moderate dysplasia (p < 0.01), severe dysplasia (p < 0.05) and in colorectal cancer tissue (p < 0.001) as compared to normal tissue from the same individual. The mRNA levels of HAI-1A and HAI-1B mRNAs showed the same patterns of expression. Immunohistochemistry showed that prostasin is located mainly on the apical plasma membrane in normal colorectal tissue. A large variation was found in the degree of polarization of prostasin in colorectal cancer tissue.The mRNA level of prostasin was slightly but significantly decreased in both mild/moderate dysplasia (p < 0.001) and severe dysplasia (p < 0.01) and in carcinomas (p < 0.05) compared to normal tissue from the same individual. The mRNA level of PN-1 is significantly elevated in colorectal cancer tissue. Future studies are required to clarify whether down-regulation of prostasin activity via up regulation of PN-1 is causing the malignant progression or if it is a consequence of it.These results show that the mRNA level of  Extracellular proteases and protease inhibitors are believed to play an important role during carcinogenesis in many different ways such as degrading the extracellular matrix in order to facilitate invasive growth and activating signal molecules. In accordance with this, proteases were mostly thought of as promoters of carcinogenesis. However, clinical trials where cancer patients were treated with broad-range protease inhibitors have shown that proteases can act as tumour suppressors . StudiesHAI-1, here denoted HAI-1A, and HAI-1B [in vitro invasiveness in both prostate and mammary cancer cell lines [prostasin mRNA levels correlates with longer survival for gastric cancer patients [Prostasin is a glycosylphosphatidylinositol (GPI)-anchored trypsin-like protease expressed in most epithelial cells ,6. It isd HAI-1B . HAI-1B d HAI-1B . Prostasd HAI-1B . Matriptd HAI-1B ,15 and bd HAI-1B . The dowd HAI-1B ,17 and id HAI-1B . It has d HAI-1B  and clead HAI-1B  but may d HAI-1B ,12, and d HAI-1B . Using td HAI-1B . Simultad HAI-1B . Althougll lines ,24 and hpatients .HAI-1 mRNA levels are decreased during colorectal cancer carcinogenesis in both normal and affected tissue from individuals with colorectal cancer adenomas and carcinomas as compared to healthy individuals using an assay that does not differentiate between HAI-1A and HAI-1B [Prostasin is expressed in most epithelial cells and could potentially play a role in most types of cancer. Prostasin has been shown to be down-regulated in gastric cancers  and prosd HAI-1B . Likewisd HAI-1B  and in gd HAI-1B .prostasin and its inhibitors PN-1, HAI-1A, and HAI-1B, during colorectal cancer carcinogenesis in humans.In the present study we have investigated the mRNA levels of The KAM cohort  is based on the screening group of the Norwegian Colorectal Cancer Prevention study (the NORCCAP study) in the county of Telemark, Norway . Additio2 until RNA purification. RNA purification included a DNAse treatment. cDNA synthesis was performed on approximately 200 ng RNA per 20 \u03bcl using High-Capacity cDNA Archive Kit . Quantitative RT-PCR for prostasin was performed on the ABI7300 sequence detection system (Applied Biosystems) in Universal Mastermix (Applied Biosystems) using 160/100 nM probe and 600/200 nM primers for prostasin and PN-1, respectively. For detection of prostasin mRNA, primers and probes were: F, 5' GGCCTCCACTGCACTGTCA 3'; R,5' AGTTACACGTCTCACGACTGATCAG '3'; probe, 5'-FAM-CAGTGAGCCTCCTGACGCCCAAG-BHQ-3'. For detection of PN-1 mRNA, primer and probes were: F, 5' CCTCCATGTTTCTCATATCTTGCA 3'; R, 5' ACCAGGGAGGCGATGATCT 3'; probe, 5'FAM-AAGCTTCAGCAGCAACAACTGCAATTCTCA-BHQ-3'. Primers were designed within different exons and with probes covering the exon-exon border to prevent amplification of genomic DNA. DNA coding for HAI-1 gives rise to two mRNA's coding for two proteins where the amino acids sequence differs by 16 residues [HAI-1 mRNA using a probe/primer set that detects both HAI-1A and HAI-1B. For this study we have designed new sets of probe/primers specific for either HAI-1A or HAI-1B. Assays for HAI-1A and HAI-1B were performed using 300 nM probe and 100 nM primers. Primers and probes for detection of HAI-1A were: F, 5'AGA TCT GCA AGA GTT TCG TTT ATG G-3'; R, 5'-GGT GCC AGA GCA CAC TGG AT-3'; probe, 5'-FAM-TGT GCA AGG CCC CTC CAT GGA A-BHQ-1-3'. Primers and probes for detection of HAI-1B were: F, 5'-ATC TGC AAG AGT TTC GTT TAT GGA-3'; R, 5'-GGT GCC AGA GCA CAC TGG AT-3'; probe, FAM-CCT TTG AGA GGC AGC TC-MGBNFQ. HAI-1A and HAI-1B probes were obtained from Applied Biosystems. \u03b2-actin primers and probes were obtained as a pre-developed assay (cat. no. 4310881E). All other primers and probes were obtained from TAG Copenhagen (Denmark). In a validation experiment using a control sample, a dilution series was produced and assayed for prostasin, PN-1, HAI-1A, HAI-1B and \u03b2-actin as described for the comparative Ct method [t values were plotted against log dilution it was shown that the assays are quantitative over a range of 256-fold dilution and that the PCR reactions have similar efficiencies provided that a threshold of 0.02 is used for prostasin and 0.2 is used for PN-1, HAI-1A, HAI-1B, and \u03b2-actin. The threshold is a fixed fluorescence signal level above the baseline and the Ct value of a sample is determined as the fractional cycle number where the sample's fluorescence signal exceeds the threshold. Prostasin, PN-1, HAI-1A, HAI-1B, and \u03b2-actin were quantified separately in triplicates. The average standard deviation on the triplicates was 14% or less. The standard deviation on repeated measurements of the same sample (the control) in separate experiments was 20%, 11%, 14%, and 14% for prostasin, PN-1, HAI-1A and HAI-1B respectively, indicating the day-to-day variation of the assay. Independent PCR reactions of the same samples yielded a correlation coefficient of 0.85 for prostasin and 0.95 for PN-1. Negative controls (where the RNA was not converted into cDNA) and positive controls were included in all sets.Total RNA was purified from tissue as recommended by the manufacturers using E.Z.N.A. Total RNA Kit II . The tissue samples were frozen in liquid as soon as possible after surgery and were stored in liquid Nresidues . We havet method . When CtMiniTab Statistical Software, Release 13.1 Xtra (Minitab Inc.) and Graph Pad Prism 4 were used for the statistic calculations. The data were not adjusted for gender since the incidence ratio of colorectal cancer between the genders is 1:1 in Norway .Tissue specimens were fixed in 4% formalin, paraffin embedded and processed for routine histology. Tissue sections were cleared with xylene and rehydrated in a graded series of alcohols and boiled in T-EG buffer  for 20 min for antigen retrieval. The sections were blocked for 30 min in PBS containing 3% BSA and 0.1% Triton X-100 and then incubated at 4\u00b0C overnight with mouse anti-prostasin antibody  (0.02 \u03bcg/\u03bcl) and goat anti-hHAI-1 . The slides were washed 3 times for 5 min with 3% BSA in PBS and 0.1% Triton X-100 and incubated at room temperature for 45 min with the secondary antibody Alexa fluor 555 donkey anti-mouse and Alexa fluor 488 donkey anti-goat. Afterwards, tissue sections were washed 3 times for 5 min with 3% BSA in PBS and 0.1% Triton X-100, followed by 4 times in PBS and finally mounted with DAPI H-1500 (Vector Laboratories Inc.). The sections were examined for the localization of prostasin subjected to laser conventional fluorescence microscopy. Sections where the primary antibodies were omitted served as controls.PN-1 were measured in colon tissue samples from healthy individuals (n = 23), individuals with mild/moderate dysplasia (n = 93), individuals with severe dysplasia (n = 13), and individuals with colorectal cancer (n = 116) by real-time RT-PCR. From individuals with dysplasia a sample of histologically normal tissue was used as well. From individuals with colorectal cancer two sample of histologically normal tissue from the surgically removed tissue were used. Ole sample was obtained as far away from the cancer tissue as possible  and another sample obtained immediately adjacent to the cancer tissue . A good correlation between the mRNA and protein levels for both prostasin [PN-1 [prostasin, PN-1, HAI-1A and HAI-1B were normalised to the mRNA level of \u03b2-actin.The mRNA levels of prostasin and rostasin  and PN-1in [PN-1  has prevprostasin normalised to \u03b2-actin are shown in Figure prostasin mRNA level of healthy individuals was compared to normal or affected tissue from individuals with dysplasia or colorectal cancer no significant difference could be observed . There was also a significant difference when normal and affected tissue from the same individual were compared for individuals with mild/moderate dysplasia (p < 0.001), severe dysplasia (p < 0.01), and for colorectal cancer both compared to the normal distant (p < 0.05) and to the normal adjacent sample (p < 0.01). This shows that the prostasin mRNA level is slightly but significant lower in mild/moderate dysplasia, severe dysplasia and colorectal cancer tissue as compared to normal tissue.The range and the interquartile range of mRNA levels of d Figure . HoweverPN-1 normalised to \u03b2-actin are shown in Figure PN-1 mRNA level showed an increase with increasing tumour grade in dysplastic and cancerous tissues whereas the normal tissue was not affected. A significant almost 3-fold increase (p < 0.001) of PN-1 mRNA was found in carcinomas as compared to corresponding tissues in healthy individuals , severe dysplasia (p < 0.05) and in carcinomas both when compared to the normal distant sample and with normal adjacent sample (p < 0.001),  with carcinomas (p < 0.001) using a one-way ANOVA and Tukey's post test. The PN-1 mRNA levels thus seem to be upregulated both at the transition from normal tissue to mild/moderate dysplasia and then again at the transition between dysplasia and cancer tissue whereas normal tissue is not affected.The range and the interquartile range of mRNA levels of ), Table . In addiprostasin and PN-1 mRNA levels with the designated Dukes'stages. Likewise the adenomas were classified as either low-risk (n = 14) or high-risk (n = 91) adenomas using the criteria described in material and methods. No significant difference in the mRNA levels of either prostasin or PN-1 was seen when comparing high-risk and low-risk adenomas (one-way ANOVA and Tukey's post test for paired comparison). When the prostasin mRNA level in normal tissue from either healthy individuals or individuals with dysplasia or colorectal cancer was plotted against age we were unable to detect any age-related change in the prostasin mRNA level  whereas the PN-1 mRNA level showed a slight increase with higher age. We were unable to detect any gender-related differences in the prostasin or PN-1 mRNA expression levels.Colorectal cancer can be staged according to Dukes' stage A-D where D is the most advanced and metastatic stage. Among the carcinomas in this study 23 carcinomas were designated as Dukes'stage A, 47 carcinomas as stage B, 39 carcinomas as stage C and none of the samples were classified as stage D. No tendency and no significant difference (one-way ANOVA and Tukey's post test for paired comparison) were seen when comparing the HAI-1 transcripts differ by the coding region for 16 amino acids. We have previously shown that HAI-1 is significantly down-regulated in both normal and affected tissue from individuals with adenomas and carcinomas [HAI-1A and HAI-1B respectively. mRNA levels for HAI-1A and HAI-1B were determined in colon tissue samples from healthy individuals (n = 14), in healthy and affected tissue from individuals with mild/moderate dysplasia (n = 19) and in healthy and tumour tissue from patients with colorectal cancer (n = 24). Figure HAI-1A, HAI-1B and the radio of HAI-1A/HAI-1B normalised to \u03b2-actin. The levels of HAI-1A and HAI-1B mRNA found are virtually identical in all tissues examined with the levels of HAI-1 found previously [HAI-1A/HAI-1B in the different tissues tested. These data suggest that there is no regulation in the splicing of the HAI-1 transcript during colorectal cancer carcinogenesis.It is possible that prostasin activity is regulated by modulation of the ratio between HAI-1A and HAI-1B as it is not clear whether the two inhibitors have the same kinetic properties. The two rcinomas . In the eviously . Both HANormal and cancerous tissues from five colorectal cancer patients were analysed to investigate the sub-cellular localization of prostasin and HAI-1. Formalin-fixed paraffin-embedded tissue sections were immunohistochemically co-stained for prostasin and HAI-I. In normal colorectal tissue, prostasin was detected mainly on the apical plasma membrane \u2013 with only minor staining of the basolateral plasma membrane Figure  and 4D. prostasin, PN-1, HAI-1A and HAI-1B during colorectal cancer carcinogenesis. It has previously been shown that over-expression of prostasin in mammary and prostate cancer cells reduces the invasive properties of cancer cells [prostasin mRNA in mild/moderate dysplasia, severe dysplasia and colorectal cancer tissues combined as compared to corresponding normal tissues from healthy individuals. In a previous study a similar minor but significant down-regulation was seen when comparing normal and affected tissue from gastric cancer patients [prostasin accompanying the transition between severe dysplasia and colorectal cancer. However, the mRNA levels of the inhibitor of prostasin, PN-1 increase at both the transition between normal tissue and mild/moderate dysplasia and again at the transition between severe dysplasia and colorectal cancer.In the present study we have determined the mRNA levels of er cells ,24 and ter cells . It coulpatients . Our resFor PN-1 to be a physiologically relevant inhibitor of prostasin it is required that PN-1 and prostasin have physical access to each other. PN-1 belongs to the serpin family of secretory proteins. We have previously shown that five other members of the serpin family are secreted to both the apical and the basolateral side of the polarized epithelial cell line, MDCK, albeit at different ratios . SimilarHAI-1 mRNA is decreased by 3-fold during colorectal cancer carcinogenesis using an assay that does not distinguish between HAI-1A and HAI-1B [HAI-1A and HAI-1B have expression patterns virtually identical and indistinguishable from the expression pattern of HAI-1 previously found [HAI-1A/HAI-1B remains the same in all tissues investigated during colorectal cancer carcinogenesis. Therefore, the splicing of HAI-1 mRNA is not regulated during carcinogenesis. In the present study we found limited co-localization of prostasin and HAI-1 in normal tissue, as HAI-1 is located mainly on the basolateral plasma membrane and prostasin is located on the apical plasma membrane. This probably does not mean that their interactions is limited due to physical separation as we have previously shown that HAI-1 is transcytosed from the basolateral plasma membrane to the apical plasma membrane [Prostasin is inhibited not only by PN-1 but also by HAI-1A and HAI-1B. We have previously shown that the level of d HAI-1B . In the ly found  and thatmembrane . It is tin vivo. Likewise prostasin-HAI-1B complexes have been purified from a cell line [The enzymatic activity of prostasin is influenced both by the levels of PN-1, HAI-1A and HAI-1B and probably also by the expression levels of other as yet undiscovered inhibitors of prostasin. The relative physiological importance of PN-1, HAI-1A and HAI-1B as inhibitors of prostasin is at present unclear. PN-1 is an inhibitor of not only prostasin, but also of uPA, tPA, thrombin, plasmin, trypsin  and matrell line , suggestPN-1, coincides with acquisition of malignant properties, whereas the mRNA level of prostasin is relative stable during colorectal cancer carcinogenesis. However, further investigations are necessary to understand the role of prostasin, PN-1, HAI-1A and HAI-1B for invasive growth and malignant progression.Proteases have for a long time been thought to play an important role in the growth of cells both during tissue remodelling and invasive growth. However, the action of proteases may be regulated not necessarily by the expression of the protease but by regulating the expression of its inhibitors. Our data shows that elevated mRNA levels for prostasins inhibitor, The authors declare that they have no competing interests.LV conceived the idea of the study. EHK designed the cohort and collected the samples. LV and EHK extracted the RNA. LV and JB designed and validated primers and probes and performed the statistical analyses. JS-P performed the immunohistochemistry. IMBL evaluated the tissue sections. JS-P, SF and LV prepared the figures. KMT and EKH administrated the KAM study. LV and JS-P wrote the first draft of the manuscript. All authors helped interpret the results, writing the manuscript and read and approved the final version.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/9/201/prepub"}
{"text": "This virus is antigenically and phylogenetically distinct from rodent-borne hantaviruses. Thottapalayam virus (TPMV) has been placed in the genus Hantavirus of the family Bunyaviridae by virtue of its morphologic features and overall genetic similarities to well-characterized rodentborne hantaviruses. This virus has been isolated from the Asian house shrew (Suncus murinus); however, whether TPMV is naturally harbored by an insectivore host or represents spillover from a rodent reservoir host is unknown. Our analysis of published and unpublished data on the experimental host range, genetics, and molecular phylogeny of TPMV supports coevolution of TPMV with its nonrodent reservoir host. Future studies on the epizootiology of TPMV and investigations of new shrewborne hantaviruses will provide additional insights into the evolutionary origin of hantaviruses in their rodent and insectivore reservoir hosts. Such investigations may also provide clues about determinants of hantavirus pathogenicity and virulence. Hantavirus, similar to other members of the family Bunyaviridae, have a negative-sense, single-stranded RNA genome in 3 segments designated large (L), medium (M), and small (S), which encode an RNA-dependent RNA polymerase, envelope glycoproteins  and nucleocapsid (N) protein, respectively (Apodemus agrarius), Dobrava virus (DOBV) with the yellow-necked field mouse (Apodemus flavicollis), Seoul virus (SEOV) with the Norway rat (Rattus norvegicus), Thailand virus (THAIV) with the bandicoot rat (Bandicota indica), Puumala virus (PUUV) with the bank vole , Tula virus (TULV) with the European common vole , Prospect Hill virus (PHV) with the meadow vole (M. pennsylvanicus), and Sin Nombre virus (SNV) with the deer mouse (Peromyscus maniculatus).Viruses in the genus Hylomyscus simus) (Suncus murinus) captured in 1964 during a survey for Japanese encephalitis virus in southern India , by the intracerebral route with 6,000 PFU of TPMV  by using antisera from experimentally infected animals  or have low pathogenic potential (such as TULV). Among the HFRS- and HPS-causing pathogenic hantaviruses, differential use of \u03b2-3 integrins as cellular receptors on platelets and endothelial cells may account for vascular leakage and hemorrhage associated with HFRS and HPS , are present in India, the demonstrated seroreactivity to HTNV may represent cross-reactivity with another Apodemus-borne hantavirus. Alternatively, seroreactivity may indicate infection with a nonrodentborne hantavirus, such as TPMV. Because Asian house shrews are peridomestic, frequently living within or in close proximity to human dwellings, TPMV infection may occur in humans.Immmunoglobulin G (IgG) against HTNV has been detected in sera from persons in southern India  serum samples were reactive to TPMV (geometric mean titer 80.6), and 16 (4.4%) samples were reactive to SEOV (geometric mean titer 103.1). Attempts to verify the specificity of this immunoreactivity by PRNT were unsuccessful . More recently, however, evidence suggestive of TPMV infection was found in a Laotian immigrant with a febrile illness by using a Western immunoblot analysis and a newly developed ELISA. This ELISA used a recombinant TPMV N antigen that contained an E5/G6 epitope captured by MAb E5/G6 (Crocidura leucodon) , Eurasian water shrew (Neomys fodiens), and common mole  in the former Soviet Union (Blarina brevicauda) in the United States (Crocidura russula) (Anourosorex squamipes)    was correctly predicted. When this predictive paradigm is applied to insectivores, species of Crocidura and Sorex genera would be expected to serve as reservoir hosts of hantaviruses because of their close phylogenetic proximity to S. murinus (Crocidura theresae) in Guinea . These newly identified shrewborne hantaviruses provide new knowledge about the genetic diversity of hantaviruses as well as possible insights into their evolutionary origin through host-switching events.Another approach to the targeted discovery of new hantaviruses harbored by shrews relies on molecular phylogeny. By constructing phylogenetic trees based on mitochondrial or nuclear gene DNA sequences, existence of hantaviruses in the Korean field mouse  may be too low for virus transmission. However, this probability is true for most zoonotic microbes, which only rarely infect humans. Thus, in the absence of disease outbreaks, zoonotic diseases frequently go unrecognized. In this regard, HPS would have similarly gone undetected had cases not clustered in time and space and had a closely knit group of dedicated and astute healthcare workers not recognized that something unusual was happening. The long-awaited clue of finding IgG against TPMV in a febrile Laotian immigrant ("}
{"text": "Therefore, early assessment of treatment response would be beneficial. In this study, we investigated the in vitro with the MTT assay and in vivo on H727 xenograft tumors. The mice were scanned at baseline with 18F-FDG or 18F-FLT and then treated with either placebo or everolimus (5 mg/kg daily) for 10 days. PET/CT scans were repeated at day 1,3 and 10.The effect of everolimus on the human carcinoid cell line H727 was examined in vitro at concentrations above 1 nM. In vivo tumor volumes measured relative to baseline were significantly lower in the everolimus group compared to the control group at day 3 , day 7  and at day 10 . Uptake of 18F-FDG and 18F-FLT showed little differences between control and treatment groups, but individual mean uptake of 18F-FDG at day 3 correlated with tumor growth day 10 , 18F-FLT mean uptake at day 1 correlated with tumor growth day 7  and at day 3 18F-FLT correlated with tumor growth day 7  and day 10 .Everolimus showed significant inhibition of H727 cell proliferation in vitro and in vivo in human xenografts lung carcinoid NETs and especially early 18F-FLT uptake predicted subsequent tumor growth. We suggest that 18F-FLT PET can be used for tailoring therapy for neuroendocrine tumor patients through early identification of responders and non-responders.Everolimus was effective  Neuroendocrine tumors (NETs) are a heterogeneous group of tumors derived from neuroendocrine cells mainly from the gastrointestinal tract and the bronchopulmonary system. NETs have been considered a rare type of cancer but according to epidemiological data, the incidence has increased five-fold from 1.09 to 5.25/100.000 from 1973 to 2004. Since the survival has increased as well, gastrointestinal NET is now the second most prevalent cancer in the gastrointestinal tract The treatment of NETs has for many years been multifaceted including surgery, somatostatin analogs, interferon alfa, chemotherapy, and peptide receptor radionuclide therapy The gold standard to monitor chemotherapy response in solid tumors has for more than a decade been measurements of the tumor size by CT using the RECIST criteria At the same time, evidence gained from several tumor types show that additional information is obtained when Positron Emission Tomography (PET) is used for treatment monitoring compared to CT measurements alone 18F-fluorodeoxyglucose (FDG).Most widely used in cancer imaging and treatment monitoring is PET using FDG uptake reflects cancer cell glycolysis and has been shown to correlate with early treatment responses both in preclinical studies and patient studies although not in all cases 18F-fluorothymidine (FLT) Another hallmark of cancer, proliferation, can be measured using Everolimus is an inhibitor of the mammalian target of rapamycin (mTOR), a downstream component of the PI3K/AKT pathway involved in the regulation of cell proliferation, metabolism and angiogenesis.It is known that the mTOR pathway is dysregulated in some NETs due to aberrant events such as loss or down-regulation of the tumor suppressor gene PTEN or tuberous sclerosis 2 (TSC2). Low TSC2 and PTEN are linked to progression of the cancer In line with this, everolimus has recently been approved by FDA and EMA for the treatment of advanced pancreatic NETs.At the same time, it is becoming evident that subgroups of NET-patients for some reason have a worse prognosis than others. FDG has shown to be highly prognostic for NET-patients across the classification system Since everolimus has shown promising results in some NETs and the antitumor effect is mediated through inhibiting the mTOR complex, it seems likely that tracers detecting glycolysis and proliferation could serve as early predictors of a treatment response or failure.in vitro and in an animal model using FDG and FLT PET. The aim was to evaluate the effect of everolimus in NET and if FDG/FLT PET imaging could be used as an imaging biomarker for early prediction of the treatment response.In the present study, we monitored the response to everolimus treatment of NET Animal care and experimental procedures were approved by the Danish Animal Welfare Council (license no. 2011/561-14).2 at 370C.The human neuroendocrine tumor cell-line, lung bronchus carcinoid, NCI-H727 obtained from ATCC  was used. The cell line was tested to be free of Mycoplasma at Statens Serum Institute, Copenhagen, Denmark. The cells were cultured in RPMI Medium 1640 with GlutaMAX\u2122  containing 10% fetal calf serum  and 1% penicillin-streptomycin  in 5% COH727 cells were plated in flat bottom 96-well plates at 3000 cells/well and incubated overnight. Treatment with everolimus was done in triplicates at escalating concentrations from 1 to 1000 nM for 72 hours. The cell proliferation was monitored with the MTT assay according to manufacturer protocol  and the proliferation was normalized to the untreated cells.6 cells in 100 uL medium mixed with 100 uL Matrixgel\u2122 Basement Membrane Matrix; BD Sciences, San Jos\u00e9, CA, USA). The inoculates were injected subcutaneously on the left and right flank during anesthesia with 1\u22361 V/V HypnormR /DormicumR  i.p. Tumors were allowed to grow for 2 weeks. Half of the mice were FLT-PET scanned and the other half were FDG-PET scanned. At day 0 \u201cbaseline\u201d examinations with FDG or FLT PET-scans as well as CT-scans were performed. Thereafter we randomized the mice to treatment with everolimus (n\u200a=\u200a10) or vehicle (n\u200a=\u200a10). The mice were treated daily i.p with 0.250 ml solution, either vehicle consisting of 18 ml 5% glucose and 2 ml DMSO, or 10 mg of everolimus  diluted in 18 ml 5% glucose and 2 ml DMSO. Daily dose of everolimus was 5 mg/kg The study design is illustrated in 18F-FDG was acquired from daily productions for clinical use at our facility .18F-FLT was synthesized using 3-N-Boc-1-[5-O--3-O-nosyl-2-deoxy-b-D-lyxofuranosyl]thymine as precursor and synthesized on a GE TracerLab MX Synthesizer as previously described 2 in N2 and fixed on a bed compatible with both the PET and CT scanner. A 15 min PET scan was acquired using a MicroPET Focus 120  Mice were injected i.v. with approximately 10 MBq of FDG or FLT. Before each FDG scan, the mice were fasted overnight. The mice were anaesthetized with 3% sevoflurane  mixed with 35% 0The PET data were arranged into sinograms and subsequently reconstructed with the maximum a posteriori (MAP) reconstruction algorithm after data acquisition. The pixel size was 0.300\u00d70.300\u00d70.796 mm and average resolution was 1.4 mm full-width-at-half-maximum. The images were not corrected for attenuation or scatter Immediately following the microPET scan, a microCT scan was acquired using a MicroCAT II system  inj, where CT is radioactivity in the tissue, W is weight of the animal and Dinj is injected dose. SUVmean gives information of the mean concentration of tracer and SUVmax is a measure of the voxel within the ROI that have the highest tracer concentration. For tumor volume measurements, ROIs were drawn manually by delineation of the tumor boundary by qualitative assessment in several of the coronal planes on the microCT images. Summation of voxels from all the planes generated the tumor volume. Tumor volume can be correctly assessed by this method Fusion of microPET and microCT images was done in the Inveon software . Before fusion, region of interests (ROIs) were drawn on the CT pictures manually by qualitative assessment covering the whole tumors and subsequently tumor volume and tracer uptake, assessed by standardized uptake values (SUV) mean and maximum, were generated by summation of voxels within the tomographic planes. SUV was defined as (CT*W)/Dmean and tumor growth. Calculations were made in SPSS 20 . Data are reported as mean \u00b1 SEM and p<0.05 was considered statistically significant.Unpaired students t-test was used for comparison between treatment and control groups. Paired t-test was used for intra-group comparisons. Shapiro Wilk test for normality and Levenes test for equality of variances were used. Bonferroni correction of p-values for multiple comparisons was applied. Linear regression was used for calculation of correlations between early SUVin vitro at concentrations above 1 nM (Everolimus showed significant inhibition of H727 cell proliferation ove 1 nM .3). The relative size of the tumors, given as the percent of baseline, was used for evaluating the tumor growth.Treatment of H727 xenografts with everolimus 5 mg/kg daily for 10 days resulted in decreases in tumor sizes compared to the vehicle treated control group. There were 36 tumors evaluable for growth monitoring (n\u200a=\u200a18 in each group). No significant difference between the mean baseline tumor sizes of the groups was found. The tumor size at baseline was 185\u00b114 . Uptake of FDG and FLT were determined relative to baseline at day 1, 3 and 10 after treatment initiation with everolimus .mean or SUVmax FDG uptake was observed between the treatment and control group at any time. At day 10 FDG SUVmean and SUVmax were significantly increased in the control group when compared to baseline  whereas no difference in FDG uptake was observed in the treatment group on day 10 when compared to baseline.By groups, no significant difference in SUVSixteen tumors were evaluated by FLT PET (n\u200a=\u200a8 in each treatment group).mean and SUVmax uptake was significantly increased in both the control group  when compared to baseline. The relative FLT uptake in the control group was significantly raised on day 10 compared to baseline  whereas no difference in FLT uptake was observed in the treatment group. At day 10, the relative FLT SUVmean was significantly higher in the control group compared to the everolimus group  (On day 3 relative FLT SUV=\u200a0.010) .mean (day 1 and 3 ) and subsequent tumor growth (day 7 and 10) are shown for both FDG PET and FLT PET in The correlation between day 1 uptake of FLT PET and tumorvolume at day 10 is shown in Tumor growth was measured as the relative increase in tumor size from baseline to either day 7 or day 10.mean uptake day 1 did not correlate with tumor growth neither day 7 nor day 10. FDG SUVmean uptake at day 3 correlated with tumor growth day 10  and showed a trend towards correlation with day 7 .Within the everolimus treated group, FDG SUVmean of FLT within the everolimus treated group day 1 significantly correlated with tumor growth day 7 , and showed a trend toward correlation at day 10 . FLT SUVmean uptake day 3 was significantly correlated with tumor growth day 7  and day 10 .SUVmax showed same trend (data not shown).Correlations for SUVThe major finding of our study was that everolimus inhibited tumor growth of the human lung carcinoid H727 and that FLT PET performed early after treatment initiation could predict later tumor growth.In our study of human carcinoid lung NET xenografts, everolimus significantly inhibited tumor growth by almost 50% compared to placebo treated tumors, indicating an anti proliferative effect of everolimus on H727 NET.In accordance with this, it has been found that mTOR activation is involved in the proliferation of subtypes of NETs in patients. In pancreatic NET cells, autocrine activation of the pathway is mediated through insulin-like growth factor 1 (IGF1) A phase II trial among patients with progressive pancreatic NET disease showed promising results using everolimus or everolimus in combination with octreotide The subsequent phase III randomized double-blind placebo-controlled trial consisting of 410 patients with progressive well-differentiated pancreatic NET, found that the median progression free survival (PFS) was 11 months with everolimus and 4.6 months with placebo Based on these results, US and European health authorities approved the use of everolimus for advanced pancreatic NET.Everolimus has also been evaluated in a large placebo-controlled phase III trial (RADIANT 2) in different types of NETs  associated with the carcinoid syndrome (n\u200a=\u200a429). PFS was prolonged by 5.1 months for patients treated with both everolimus and octreotide LAR  compared to patients receiving placebo and octreotide LAR. The trial documented that everolimus can be used in a broad spectrum of NET patients In vitro studies have also shown that everolimus might be effective in the treatment of lung NETs. Accordingly, Zatelli et al. studied the effect of mTOR on bronchial carcinoids in 24 different bronchial carcinoids dispersed in cell cultures. In 15 of the cell cultures, everolimus significantly reduced cell viability, inhibited p706K activity and blocked IGF1 proliferative effects. The responding cell cultures were found to up-regulate mTOR expression indicating that bronchial carcinoids may be a suitable target for mTOR inhibition Although everolimus is effective in many NETs, the effect of this costly therapy is variable on an individual basis. Therefore, early detection of responders versus non-responders would be of great value. Since everolimus works by inhibiting the mTOR complex, an early detection of changes in mTOR pathway effects, like glycolysis and proliferation, might be visualized by FDG and FLT PET. To the best of our knowledge this has never been tested in NETs.2\u200a=\u200a0.63; P\u200a=\u200a0.019). Clinically this would translate into that FLT PET early (days) after initiation of everolimus therapy in NET, could be used to identify responders and non-responders rather than waiting 6\u20138 weeks to see tumor shrinkage according to RECIST. In this way, non-responders could then early after treatment initiation be changed to alternative therapies and spared to undergo non-effective and expensive treatments. In support of this, non-NETs studies also indicate that FDG and FLT can be used to detect effect of everolimus: Accordingly, Nogov\u00e1 et al. used FDG for detecting the response of everolimus treatment in 8 non-small cell lung cancer patients. They scanned the patients at baseline and after 8 and 28 days of therapy and measured FDG by SUVmax and SUVmean In our study of H727 NET we found that especially FLT was effective in early prediction of later tumor growth. Accordingly, FLT at day one, where no effect on tumor growth was present, could predict growth until day 7 (rOthers have described the use of FDG in a human gastric cell line to determine the optimal biological dose of everolimus soon after therapy initiation vivoWei et al. found that both FLT and FDG uptake decreased and reflected sensitivity towards mTOR inhibition in glioblastoma xenografts in Ours findings that early imaging with FLT rather than FDG predicts later tumor volume is supported by other preclinical studies demonstrating that mTOR-inhibition is better predicted by FLT than FDG in lymphoma cell lines The present study is based on a single bronchial carcinoid cell line. Therefore, we cannot prove that the concept of early prediction of everolimus effect on tumor growth using FLT or FDG holds for all NETs. However, we believe the proof of concept data, are important and final testing will anyhow need to be performed in patients.We found that everolimus was effective in vivo in a human xenografts lung carcinoid NET and that FLT PET could effectively be used for early prediction of tumor growth. We suggest that FLT PET may be used for tailoring therapy in NETs with everolimus through early identification of responders and non-responders. In patients with FLT negative tumors FDG may represent an alternative. Whether such an algorithm translates clinically into better outcome remains to be tested."}
{"text": "The aim of the study was to evaluate changes in cell proliferation and glucose uptake by use of 3\u2019-deoxy-3\u2019-[In vivo uptake of [18F]FLT and [18F]FDG in human ovary cancer xenografts in mice (A2780) were studied after treatment with belinostat. Mice were divided in 2 groups receiving either belinostat (40\u00a0mg/kg ip twice daily Day 0\u20134 and 6\u201310) or vehicle. Baseline [18F]FLT or [18F]FDG scans were made before treatment (Day 0) and repeated at Day 3, 6 and 10. Tracer uptake was quantified using small animal PET/CT.3) at Day 10 relative to baseline which was significantly different (P\u2009=\u20090.011) from the control group 769\u2009\u00b1\u200974% (926\u00a0mm3). [18F]FLT SUVmax increased from baseline to Day 10  in the control group. No increase was observed in the treatment group. [18F]FDG SUVmean was significantly different in the treatment group compared to the control group (P\u2009=\u20090.0023) at Day 10. Within treatment groups [18F]FDG uptake and to a lesser extent [18F]FLT uptake at Day 3 were significantly correlated with tumor growth at Day 10.Tumors in the belinostat group had volumes that were 462\u2009\u00b1\u200962% (640\u00a0mm[18F]FDG uptake early following treatment initiation predicted tumor sizes at Day 10, suggesting that [18F]FDG may be a valuable biomarker for non-invasive assessment of anti-tumor activity of belinostat. Changes in [18F]FDG uptake following anti-cancer treatment have been analyzed in several clinical studies; however, with variable results FLT and [18F]FDG PET can be used as non-invasive imaging biomarkers for monitoring of belinostat treatment. To do so, we analyzed [18F]FLT and [18F]FDG uptake in a human ovary cancer mouse model before and during treatment with belinostat. Tracer uptake was compared with Ki67, TK1 and glucose transporter 1 (GLUT1) gene expression.7 cells in 100 \u03bcL medium mixed with 100 \u03bcL Matrixgel\u2122 Basement Membrane Matrix  were injected subcutaneously into the left and right flank respectively during anesthesia with 1:1\u00a0v/v mixture of Hypnorm\u00ae  and Dormicum\u00ae . The cell line was tested free of mycoplasma. A2780 was cultured in RPMI  medium 1640\u2009+\u2009GlutaMAX  supplemented with 10% fetal calf serum  and 1% penicillin-streptomycin (Invitrogen) in 5% CO2 at 37\u00b0C.Animal care and all experimental procedures were performed under the approval of the Danish Animal Welfare Council (2006/561-1124). Female NMRI  nude mice (8\u00a0weeks old) were acquired from Taconic Europe  and allowed to acclimatize for one week in the animal facility before any intervention was initiated. The human ovarian carcinoma cell line A2780  was used. For establishment of xenografts, 10[18F]FLT was synthesized using 3-N-Boc-1-[5-O--3-O-nosyl-2-deoxy-\u03b2-D-lyxofuranosyl]thymine as precursor on a GE TracerLab MX Synthesizer as previously described . All reaIn vivo uptake of [18F]FLT and [18F]FDG in human ovary cancer xenografts in mice (A2780) was studied at various time points after treatment initiation. When tumor volumes were approximately 100\u00a0mm3 mice were divided in 2 groups receiving either belinostat (40\u00a0mg/kg ip) or vehicle  twice daily Day 0\u20134 and Day 6\u201310. Baseline [18F]FLT or [18F]FDG PET scans were made before treatment and repeated at Day 3, 6 and 10 after treatment initiation. Tumor volume was followed by CT during the experiments [eriments . Tumor v2 in N2 and fixed on a bed in presence of three fiducial markers allowing fusion of PET and CT pictures. A PET scan was acquired using a MicroPET Focus 120  followed by a microCT scan acquired with a MicroCAT\u00ae II system  as previously described [The mice were injected i.v. with 9.5\u2009\u00b1\u20090.2 (mean\u2009\u00b1\u2009SD) MBq [18F]FLT or 10.0\u2009\u00b1\u20090.3 (mean\u2009\u00b1\u2009SD) MBq [18F]FDG. Mice were fasted overnight before each [18F]FDG PET scan . One houescribed . PET datT*W)/Dinj, where CT is tissue radioactivity concentration, W is weight of the animal and Dinj is injected dose. SUVmean was calculated from the mean radioactivity concentration and SUVmax was calculated from the voxel with the highest tracer concentration.PET and microCT images were fused in the Inveon software . Before fusion region of interests (ROIs) were drawn on the CT pictures manually by qualitative assessment covering the whole tumors and subsequently tumor volume and tracer uptake, assessed by standard uptake value (SUV) was generated by summation of voxels within the tomographic planes. SUV was calculated according to the formula . The concentration of the RNA was determined by NanoDrop 1000 . Total RNA (0.3\u00a0\u03bcg) was reversed transcribed using the Affinityscript\u2122 QPCR cDNA Synthesis kit  according to the manufacturer\u2019s instructions. Samples were cooled down and stored at \u221220\u00b0C until further use.Primers were designed using Beacon Designer . Primer sequences were Ki67-FP: 5\u2019-tcccgcctgttttctttctgac-3\u2019, Ki67-RP: 5\u2019-ctctccaaggatgatgatgctttac-3\u2019, TK1-FP: 5\u2019-gccgatgttctcaggaaaaagc-3\u2019, TK1-RP: 5\u2019-gcgagtgtctttggcatacttg-3\u2019, GLUT1-FP: 5\u2019-catcatcttcatcccggc-3\u2019, GLUT1-RP: 5\u2019-ctcctcgttgcggttgat-3\u2019, GUSB-FP: 5\u2019-tgagcaagactgatacca-3\u2019, GUSB-RP: 5\u2019-gctagaatagatgaccacaa-3\u2019, HPRT-FP: 5\u2019-caaagcctaagatgagagt-3\u2019, HPRT-RP: 5\u2019-gccacagaactagaacat-3\u2019. For each gene the optimal primer concentration was found. All assays were optimized to have efficiencies between 95% and 105%. All samples were run in triplicate using one \u03bcl of cDNA. To each sample a no-reverse transcription control (NoRT) was included, and on each plate a no-template control (NTC) was included.Gene expression was quantified on a Mx3000P\u00ae real-time PCR system from Stratagene. All gene of interests (GOIs) and reference genes were quantified with Brilliant\u00ae SYBR\u00ae Green QPCR Master Mix (Stratagene). The following thermal profile was used in all experiments: 10\u00a0minutes of denaturation at 95\u00b0C followed by 45\u00a0cycles of 30\u00a0seconds denaturation at 95\u00b0C, 1\u00a0minute of annealing at 60\u00b0C and 1\u00a0minute extension at 72\u00b0C. A dissociation curve was afterward acquired by denaturation of the products for 1\u00a0minute at 95\u00b0C followed by a stepwise increase in temperature from 55\u00b0C to 95\u00b0C with steps of 0.5\u00b0C/cycle where the duration of each cycle was 18\u00a0seconds.QPCR data were analyzed in the qBase program. The relative quantification of the GOIs was calculated using two reference genes . Data art-test. Paired t-test was used for intra-group comparisons. Bonferroni correction of P-values for multiple comparisons was applied. Correlations between SUVmean or SUVmax and tumor growth were calculated using linear regression. Calculations were made in PASW 18.0 . Data are reported as mean\u2009\u00b1\u2009SEM unless stated otherwise and p\u2009<\u20090.05 was considered statistically significant.Comparison between the treatment and control group was calculated using unpaired student\u2019s 3) and control group (118\u2009\u00b1\u200919\u00a0mm3) were identical.Tumors in the control group had volumes that were 419\u2009\u00b1\u200939% at Day 6 and 769\u2009\u00b1\u200974% at Day 10 relative to baseline. In the belinostat group tumors were 282\u2009\u00b1\u200930% at Day 6 and 462\u2009\u00b1\u200962% at Day 10 relative to baseline which were significantly less than the control group both at Day 6 (p\u2009=\u20090.029) and Day 10 (p\u2009=\u20090.011)  in the control group. No increase in [18F]FLT SUVmax was observed in the treatment group at Day 10 Figures\u00a0, 3.2\u2009=\u20090.67; p\u2009=\u20090.02). [18F]FLT SUVmean Day 6 was correlated with tumor growth Day 10/baseline in the belinostat group  however not significant  and treatment group . No significant difference in SUVmax between treatment and control group was observed at any time point. [18F]FDG SUVmean was significant different in the treatment compared to the control group (p\u2009=\u20090.0023) at Day 10. Compared to baseline, [18F]FDG SUVmean uptake was increased at Day 6  and Day 10  in the control group. Compared to baseline, [18F]FDG SUVmean uptake was increased at Day 10  in the treatment group , however not significant. [18F]FDG SUVmean Day 6 was significantly correlated with tumor growth Day 10/baseline . [18F]FDG SUVmax Day 3 was significantly correlated with tumor growth Day10/baseline  as were [18F]FDG SUVmax Day 6   and hypoxanthine phosphoribosyltransferase 1 (HPRT). The levels of Ki67, TK1 and GLUT1 were normalized to the geometric mean of these two reference genes. The gene expression was measured at Day 10 in the treatment relative to the control group. Ki67 gene expression was unchanged in the treatment compared to the control group at Day 10. TK1 gene expression was higher in the treatment compared to the control group at Day 10 . GLUT1 gene expression was lower in the treatment group compared to the control group at Day 10  (Figure\u00a0In this study we found that 18F]FDG uptake following initiation of treatment with the HDAC inhibitor belinostat predicted tumor sizes at the end of treatment in a mouse model of human ovary cancer. We observed minor effects on [18F]FLT uptake following treatment with belinostat. In a previous study lower tumor uptake of [18F]FLT was observed following treatment with the HDAC inhibitor LAQ824 in a human colon carcinoma mouse model . LAQ824 FFDG uptaEven though we did not find a decrease in [18F]FLT uptake in the belinostat group, within the treatment group [18F]FLT SUVmean at Day 3 and 6 was correlated with tumor growth at Day 10. The tumors having the lowest uptake of [18F]FLT at Day 3 and 6 following initiation of treatment with belinostat were those in which the treatment was most effective.Previously we have observed that [18F]FLT uptake was reduced after initiation of effective anti-cancer therapy in the A2780 tumor model ,49. ThusCompared to the [18F]FLT data, we observed a higher influence on [18F]FDG uptake following treatment with belinostat. At Day 10 uptake of [18F]FDG was decreased in the treatment group compared to the control group. The difference at day 10 did only reach significant difference for SUVmean and not for SUVmax. SUVmean is the mean tracer concentration in tumor and SUVmax is a measure of the pixel within the tumor which has the highest tracer concentration. An explanation to the non-significant change in SUVmax despite changes in SUVmean could therefore be because the anti-cancer treatment is less effective and does not inhibit glucose uptake in the most aggressive parts of the tumor and therefore no significant difference between SUVmax for the treatment and control group was observed. Another explanation to the differences could be that the difference for SUVmax did not reach statistical significance due to a type II error because of the limited amount of animals included in the study.The difference in [18F]FDG uptake between the treatment and control group was supported by underlying changes in gene expression of GLUT1. At Day 10 GLUT1 expressions were lower in the treatment compared to the control group. Other HDAC inhibitors likewise decrease GLUT1 gene expression . GlucoseWithin the treatment group the level of [18F]FDG uptake at Day 3 and 6 was correlated with treatment effect at the end of the study. The tumors which had the lowest [18F]FDG uptake at Day 3 and 6 following treatment start were the tumors which responded best to the treatment. Projecting this into a clinical situation will allow identification of the patients responding best to the treatment. Advantage of this information can be taken in two ways. Firstly, selection of which patients to be included in a clinical trial can be determined depending on drug sensitivity determined early in the treatment course. This will make identification of new compounds which are effective in only a small subset of patients easier. Secondly, in clinical practice, treatment modifications in non-responding patients during a treatment course may be undertaken.Some of the main limitations of the present study were the lack of protein expression levels of molecular markers in tumor tissue. It is therefore unknown whether or not the gene expression levels of Ki67, TK1 and GLUT1 reflected the protein levels of the matching proteins. However, in other studies a positive correlation between Ki67 protein and gene expression has been observed ,56. FurtNo regression in tumor volume was observed following treatment with belinostat; however, the tumor growth was lower in the treatment compared to the control group, thus confirming the anti-cancer effect of belinostat. It is known, that the belinostat compound exerts tumor stasis rather than tumor shrinkage -28. IdenIn conclusion, we found that [18F]FDG uptake early following treatment initiation with belinostat predicted tumor sizes at Day 10, suggesting that [18F]FDG PET may be a biomarker for non-invasive assessment of anti-tumor activity of belinostat. The results from this study supports the addition of [18F]FDG PET scans during clinical trials with belinostat where it may also be used for selection of subjects that may enter such studies.18F]fluorothymidine; [18F]FDG: 2-deoxy-2-[18F]fluoro-D-glucose; PET: Positron emission tomography; CT: Computed tomography; TK1: Thymidine kinase 1; HDAC: Histone deacetylase; ROIs: Region of interests; SUV: Standard uptake value; GOI: Gene of interests; TS: Thymidylate synthease[18F]FLT: 3\u2019-deoxy-3\u2019-[The following co-authors have conflict of interests: Peter Buhl Jensen: Ownership Interests and Employment in Topotarget A/S. Maxwell Sehested: Ownership Interests and Employment in Topotarget A/S. Fredrik Bj\u00f6rkling: Employment in Topotarget A/S. Kamille Dumong Erichsen: Employment in Topotarget A/S. All other authors have no conflict of interests.Conceived and designed the experiments: MMJ KDE FB PBJ LH MS AK. Performed the experiments: MMJ KDE CBJ JM. Analyzed the data: MMJ KDE AK. Wrote the paper: MMJ AK. Revised and approved the paper: KDE CBJ FB JM PBJ LH MS AK. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/13/168/prepub"}
{"text": "The aim of this study was non-invasively to study effect of APO866 treatment on [18F]FLT and 2-deoxy-2-[18F]fluoro-D-glucose ([18F]FDG) uptake.APO866 is a new anti-tumor compound inhibiting nicotinamide phosphoribosyltransferase (NAMPT). APO866 has an anti-tumor effect in several pre-clinical tumor models and is currently in several clinical phase II studies. 3\u2032-deoxy-3\u2032-[18F]fluorothymidine ([18F]FLT) is a tracer used to assess cell proliferation In vivo uptake of [18F]FLT and [18F]FDG in human ovary cancer xenografts in mice (A2780) was studied at various time points after APO866 treatment. Baseline [18F]FLT or [18F]FDG scans were made before treatment and repeated after 24 hours, 48 hours and 7 days. Tumor volume was followed with computed tomography (CT). Tracer uptake was quantified using small animal PET/CT. One hour after iv injection of tracer, static PET scans were performed. Imaging results were compared with Ki67 immunohistochemistry.Tumors treated with APO866 had volumes that were 114% (24 h), 128% (48 h) and 130% (Day 7) relative to baseline volumes at Day 0. In the control group tumor volumes were 118% (24 h), 145% (48 h) and 339% (Day 7) relative to baseline volumes Day 0. Tumor volume between the treatment and control group was significantly different at Day 7 (P\u200a=\u200a0.001). Compared to baseline, [18F]FLT SUVmax was significantly different at 24 h (P<0.001), 48 h (P<0.001) and Day 7 (P<0.001) in the APO866 group. Compared to baseline, [18F]FDG SUVmax was significantly different at Day 7 (P\u200a=\u200a0.005) in the APO866 group.APO866 treatment caused a significant decrease in [18F]FLT uptake 24 and 48 hours after treatment initiation. The early reductions in tumor cell proliferation preceded decrease in tumor volume. The results show the possibility to use [18F]FLT and [18F]FDG to image treatment effect early following treatment with APO866 in future clinical studies. The use of positron emission tomography (PET) to discriminate between responders and non-responders early following treatment initiation is desirable. The PET technique allows for non-invasive characterization of biological functionality in tumor tissue. 3\u2032-deoxy-3\u2032-[18F]fluorothymidine ([18F]FLT) is used to assess cell proliferation in vitro and several pre-clinical human xenograft tumor models APO866 is a new anti-tumor compound which inhibits nicotinamide phosphoribosyltransferase (NAMPT), an enzyme involved in the biosynthesis of NAD. APO866 inhibits biosynthesis of cellular NAD from niacinamide by inhibiting NAMPT. Reduction in cellular NAD levels leads to ATP depletion and apoptosis APO866 treatment decreases cellular ATP content 2-deoxy-2-[18F]fluoro-D-glucose ([18F]FDG) has in several pre-clinical and clinical studies been tested for its ability to assess early effect of chemotherapeutics; however, with variable results. When new anti-cancer drugs are brought into clinical phase II and III studies, effective methods to discriminate between responders and non-responders are of great value. The aim of this study was therefore non-invasively to study the effect of APO866 treatment on [18F]FLT and [18F]FDG uptake and to evaluate if [18F]FLT or [18F]FDG PET could be used to monitor early effects of APO866 treatment.7 cells in 100 \u00b5L medium mixed with 100 \u00b5L Matrixgel\u2122 Basement Membrane Matrix  were injected subcutaneously into the left and right flank respectively during anesthesia with 1\u22361 v/v mixture of Hypnorm\u00ae  and Dormicum\u00ae . The cell line has been tested free of mycoplasma. Cells were cultured in RPMI  medium 1640+ GlutaMAX  supplemented with 10% fetal calf serum  and 1% penicillin-streptomycin (Invitrogen) in 5% CO2 at 37\u00b0C.Animal care and all experimental procedures were performed under the approval of the Danish Animal Welfare Council (2006/561\u20131124). Female NMRI  nude mice (6\u20138 weeks old) were acquired from Taconic Europe  and allowed to acclimatize for one week in the animal facility before any intervention was initiated. The human ovarian carcinoma cell line A2780 3. Mice in the treatment groups received APO866 (2).\u00bd receiving either APO866 or vehicle treatment and [18F]FLT or [18F]FDG scans. Treatment was started at day 14\u201316 after implantation of tumor cells, where tumor volumes were on average 265 mmd APO866  in salin[18F]FLT was synthesized using 3-N-Boc-1-[5-O--3-O-nosyl-2-deoxy-b-D-lyxofuranosyl]thymine as precursor on a GE TracerLab MX Synthesizer as described earlier 2 in N2 and fixed on a bed in presence of three fiducial markers allowing fusion of PET and CT pictures. A 10 min PET scan was acquired using a MicroPET Focus 120 . After data acquisition, PET data were arranged into sinograms and subsequently reconstructed with the maximum a posteriori (MAP) reconstruction algorithm. The pixel size was 0.866\u00d70.866\u00d70.796 mm and in the center field of view the resolution was 1.4 mm full-width-at-half-maximum. The images were not corrected for attenuation or scatter.Mice were injected i.v. with 10.3\u00b11.4 (mean\u00b1SD) MBq [18F]FDG or 9.5\u00b10.9 (mean\u00b1SD) MBq [18F]FLT. Mice were fasted overnight before each [18F]FDG scan Following the microPET scan, a microCT scan was acquired with a MicroCAT\u00ae II system . A 7 minute and 10 seconds CT scan was performed with parameter settings: 360 rotation steps, tube voltage 60 kV, tube current 500 \u00b5A, binning 4 and exposure time 310 ms. The pixel size was 0.091\u00d70.091\u00d70.091 mm.T*W)/Dinj, where CT is radioactivity in the tissue, W is weight of the animal and Dinj is injected dose. SUVmean gives information of the mean concentration of tracer and SUVmax is a measure of the voxel within the ROI which have the highest tracer concentration. For tumor volume measurements ROIs were drawn manually by delineation of the tumor boundary by qualitative assessment in several of the coronal planes on the microCT images. Summation of voxels from all the planes generated the tumor volume.PET and microCT images were fused in the Inveon software . Before fusion region of interests (ROIs) were drawn on the CT pictures manually by qualitative assessment covering the whole tumors and subsequently tumor volume and tracer uptake, assessed by standard uptake values (SUV) mean and maximum, were generated by summation of voxels within the tomographic planes. SUV was defined as  was used. The reactions were detected using standard polymer technique with few modifications. Negative controls were performed by omission of primary antibody. Sections were dewaxed in xylene, rehydrated and pre-treated before immunostaining. The slides were incubated with MIB-1 1:100 diluted in Power Block solution  for 30 min at room temperature. The sections were rinsed in TBST (3\u00d75 minutes) and incubated with rabbit anti-FITC  for 20 min at RT. The reactions were detected with Super Sensitive polymer-HRP reagent  and visualised with DAB ImmPACT Substrate chromogen solution (Vector laboratories cat. co. SK-4105) following the manufactures instructions. Finally, slides were counterstained with Mayers haematoxylin.The level of Ki67 present in the samples was measured as mean of three hot spots on one slide from each tumor. Hotspots were defined as areas with the highest Ki67 intensity and were identified by scanning the entire tumor slide in 10\u00d7magnification. Ki67 positive cells were defined as cells with positive nucleus staining. The Ki67 staining index was defined as the number of Ki67 positive cells divided by the total number of tumor cells in an area on the 60\u00d7magnification. Positive and negative controls from human tissue were placed on each slide for validation of the immunohistochemical procedure.Comparison of tumor volume between the treatment and control group were calculated using an unpaired student\u2019s t-test. For intra-group comparisons of tracer uptake ANOVA with Bonferroni post-hoc test was used. All data were tested to be normal distributed by means of Kolmogorov-Smirnov test. Correlations between SUVmax ratios and tumor growth were calculated using linear regression. Calculations were made in PASW 17.0 . Data are reported as mean\u00b1SEM (unless stated otherwise) and P<0.05 was considered statistically significant.2\u200a=\u200a0.98) and caliper   . APO866 \u200a=\u200a0.87) .Baseline levels of [18F]FLT uptake measured as SUVmean were 1.26\u00b10.16 (mean\u00b1SD) and SUVmax were 2.18\u00b10.20 (mean\u00b1SD). Baseline levels of [18F]FDG uptake measured as SUVmean were 0.67\u00b10.14 (mean\u00b1SD) and SUVmax were 1.23\u00b10.29 (mean\u00b1SD).Uptake of [18F]FLT measured as SUVmean in the APO866 group was 1.28\u00b10.03 at baseline, 0.98\u00b10.03 at 24 h, 0.90\u00b10.03 at 48 h and 0.96\u00b10.07 at Day 7. Compared to baseline [18F]FLT SUVmean was significantly decreased at 24 h (P<0.001), 48 h (P<0.001) and Day 7 (P<0.001) in the APO866 group. No significant changes in [18F]FLT SUVmean were observed in the control group. [18F]FLT SUVmax uptake in the APO866 group was 2.20\u00b10.03 at baseline, 1.64\u00b10.04 at 24 h, 1.49\u00b10.03 at 48 h and 1.54\u00b10.11 at Day 7. Compared to baseline [18F]FLT SUVmax was significantly different at 24 h (P<0.001), 48 h (P<0.001) and Day 7 (P<0.001) in the APO866 group  and 5. NUptake of [18F]FDG measured as SUVmean in the APO866 group was 0.70\u00b10.04 at baseline, 0.62\u00b10.03 at 24 h, 0.59\u00b10.04 at 48 h and 0.40\u00b10.08 at Day 7. Compared to baseline [18F]FDG SUVmean was significantly decreased at Day 7 (P<0.001) in the APO866 group. No significant changes in [18F]FDG SUVmean were observed in the control group. [18F]FDG SUVmax uptake in the APO866 group was 1.29\u00b10.09 at baseline, 1.11\u00b10.07 at 24 h, 1.08\u00b10.09 at 48 h and 0.77\u00b10.15 at Day 7. Compared to baseline [18F]FDG SUVmax was significantly decreased at Day 7 (P\u200a=\u200a0.005) in the APO866 group. In the control group [18F]FDG SUVmax was 1.16\u00b10.07 at baseline, 0.91\u00b10.03 at 24 h (P\u200a=\u200a0.007 vs. baseline), 1.12\u00b10.04 at 48 h and 1.47\u00b10.05 at Day 7 (P<0.001 vs. baseline)  and 5.2\u200a=\u200a0.44) and d7/d0  correlated significantly with final tumor growth and [18F]FDG SUVmax ratio 48 h/0 h  and d7/d0  correlated significantly with final tumor growth . Differences in expression of Ki67 protein between the treatment (28.3%) and control group (52.5%) were significant (P\u200a=\u200a0.022) (Expression of Ki67 protein measured by immunohistochemistry showed a significant correlation with [18F]FLT SUVmean (r=\u200a0.022) . Some ofIn this study we investigated the effect of APO866 treatment on tumor uptake of [18F]FLT and [18F]FDG by PET in the A2780 ovarian cancer tumor model. By groups, uptake of [18F]FLT decreased after initiation of treatment and was significantly different from baseline already at 24 hours after treatment initiation. By groups, uptake of [18F]FDG did not change on the first 1\u20132 days following treatment start, however at Day 7 uptake was significantly decreased to 50% of baseline uptake. At Day 7 we observed decreases in both [18F]FLT and [18F]FDG tracer uptake. On the PET images  it was mA measure of the maximal tracer uptake is often used when assessing treatment responses rather than the mean tracer uptake Lower uptake of tracer at Day 7 compared to baseline for both [18F]FLT and [18F]FDG in the treatment groups was most likely not due to partial volume effect because of a decrease in tumor volume as the tumors did not shrink during the treatment. The changes in tracer uptake were therefore assumed to be due to physiologic changes in the tumor tissue which were further confirmed by the difference in the quantity of Ki67 positive cells between the treatment and control groups. Positive correlation between [18F]FLT uptake and the amount of Ki67 positive cells have earlier been reported by others APO866 is a relatively slow acting anti-cancer drug without any immediate cytotoxicity leading to ATP depletion and apoptosis Anti-cancer drugs being cytostatic or having low cytotoxicity often require long treatment time before exerting their effect on tumor volume. The advantage of measuring physiological changes as we do in this study with [18F]FLT and [18F]FDG PET compared to the tumor volume criteria is that we are able to measure a treatment effect earlier than we can measure a change in tumor volume.When the tumors were studied individually, we found a significant positive correlation between the changes in SUVmax for both [18F]FLT and [18F]FDG between baseline and 48 hours and the tumor growth. Accordingly, those tumors which had the greatest decrease in SUVmax values for both [18F]FDG and [18F]FLT 48 hours after treatment initiation were those which had the lowest increase in tumor volume at the end of the experiment. It indicates that we, in addition to finding a decrease in the whole treatment groups, on the individual tumor level already at 48 hours after treatment initiation were able to identify the tumors that responded best to the treatment as it were those that had the greatest change in SUVmax values.In conclusion, we found a decrease in tumor [18F]FLT uptake following treatment with the nicotinamide phosphoribosyltransferase inhibitor APO866. After 7 days of treatment tumor uptake of [18F]FDG was half of baseline uptake. Additionally, we found that the tumors which responded best to the treatment were those that had the greatest change in both [18F]FLT and [18F]FDG at 48 hours after treatment initiation. These results show the possibility to use [18F]FLT and [18F]FDG to image treatment effect early following treatment with APO866 in future clinical studies."}
{"text": "To design ARC-111 analogues with improved efficiency, we constructed the QSAR of 22 ARC-111 analogues with RPMI8402 tumor cells. First, the optimized support vector regression (SVR) model based on the literature descriptors and the worst descriptor elimination multi-roundly (WDEM) method had similar generalization as the artificial neural network (ANN) model for the test set. Secondly, seven and 11 more effective descriptors out of 2,923 features were selected by the high-dimensional descriptor selection nonlinearly (HDSN) and WDEM method, and the SVR models (SVR3 and SVR4) with these selected descriptors resulted in better evaluation measures and a more precise predictive power for the test set. The interpretability system of better SVR models was further established. Our analysis offers some useful parameters for designing ARC-111 analogues with enhanced antitumor activity. N,N-dimethylaminoethyl)-2,3-methylenedioxy-5H-dibenzo,6 naphthet al. have compared QSAR modeling of antitumor activity of ARC-111 analogues using stepwise multiple linear regression (stepwise MLR), partial least squares (PLS) and artificial neural network (ANN), and the results showed the ANN model was the most powerful for the test  were reserved by 3 rounds of nonlinear selection. Then the two low-dimensional datasets with 9 and 6 descriptors, respectively, were trained by leave-one-out (LOO) cross-validation and modeled in five Kernel functions . The results of the independent test showed (1) the SVR1 model  with all literature features had higher predictive ability than stepwise MLR and PLS; and (2) the SVR2 model (t = 2) with MSE of 0.061, R2 of 0.950 and Rpred2 of 0.918 for the test set had comparable predictive ability with the ANN  model et = 2) and 10-fold cross-validation will be adopted in future feature selecting, and the Radial Basis Function (t = 2) and LOO cross-validation will be adopted in independent tests.The SVR model with 6 descriptors (SVR2) produced better results than the SVR model with all 9 descriptors (SVR1). We noted that the 6 descriptors were obtained with the WDEM from the 9 descriptors. This showed that the WDEM method might be effective to choose relevant descriptors for more accurate prediction of the activities of ARC-111 analogues. This property will be helpful for the modeling with high-dimensional features. Considering nonlinear function, predictive ability and computing time, the Radial Basis Function (50 (expt.) values] was used for modeling. Because the high-dimensional descriptors had more redundant information, we focused on how to select nonlinearly less but more critical descriptors using SVR. We have developed two novel methods that could select important descriptors from thousands of them. By initial coarse screening using the HDSN method to filter out irrelevant features, the data set would switch from high-dimensional into low-dimensional. Then further careful screening using the WDEM method would turn the data set with low-dimensional features into one with only important descriptors. Throughout the process, the descriptors in modeling with higher MSE values were removed gradually and nonlinearly until the model with the lowest MSE value was obtained. Finally, the SVR models for the test set based on the obtained descriptors were developed and evaluated.To improve drug design of ARC-111 analogues, the analysis of high-dimensional descriptors may result in better prediction. Using the software, PCLIENT, 2,923 molecular descriptors were calculated. Then the high-dimensional dataset containing the independent variables  and the dependent variables  values against RPMI8402 tumor cells ranged from 6.071 to 9.523. To obtain statistically robust QSAR models and compare with the results of MLR, PLS, and ANN in , 2 spatial  and 1 physicochemical (MolPol) descriptors as well as different topological parameters  from the literature were adopted to construct QSAR models. The 9 descriptors were obtained by molecule energy optimization using MM2 ChemOffice 2005, and then were calculated by MODEL and ChemOffice 2005 [First, to understand the QSAR reliability of modeling ARC-111 analogue activities using SVR technique, 4 electronic [http://www.vcclab.org/lab/pclient/) and classified under 24 groups  by our HDSN method [To reduce dimensionality and improve model robustness in QSAR analysis, high-dimensional features would be screened coarsely and nonlinearly into low-dimensional features with lower mean squared error  and the squared predictive correlation coefficient (Rpred2) values calculated by the following equations:The selection of descriptors and the optimization of Kernel functions parameters were examined by 10-fold or LOO validation with the minimum yi, \u0177i, \u0233, \u0177\u0304 and n, respectively, represented the experimental values, the predicted values, the mean values of the experimental values, the mean values of the predicted values and the number of compounds of the test set, and \u0233training was the mean activity value of the training set. Generally, an acceptable QSAR model was considered to have a higher predictive power only having the lower MSE [R2 [Rpred2 (at least >0.6) [Here ower MSE , the hig MSE [R2  and the st >0.6)  for the In our QSAR analysis, the structural information of 34 ARC-111 analogues was described using 2923 molecular descriptors obtained. Two groups of more important descriptors were obtained using two nonlinear descriptor selection methods, and then used to model the activities of these ARC-111 analogues based on SVR. The two SVR models demonstrated consistently better performance than reference models in terms of prediction accuracy for the test data. Our results offer new theoretical tools for drug design and development."}
{"text": "At this stocking rate, yak weight gain per ha was 88% of that achieved at higher stocking rates typically used by farmers, but with little or no evidence of land degradation.The Qinghai\u2013Tibetan Plateau is a very large land unit and an important terrestrial ecosystem within the Eurasian continent. Because of the harsh climate associated with the high altitude, alpine meadows on the plateau are susceptible to degradation from overgrazing. For this region, and for other alpine meadow pastures internationally, there is a need to define the sustainable stocking rate, to develop sound policy pertaining to future land use. Here we report biomass and liveweight gain per animal and per ha for pastures grazed by yaks at high, medium, or low stocking rates over 4 growing seasons from 2010 to 2013. Measures of herbage nutritive value are reported. The influence of inter-year variation in precipitation on standing herbage biomass was also evaluated. Higher precipitation increased standing herbage biomass and herbage nutritive value, indicating that vegetation suffered summer water deficit even in this environment. The sustainable stocking rate in this environment was determined to be approximately 1 yak ha Bos grunniens) and Tibetan sheep (Ovis aries). Global environmental changes are strongly affecting ecosystem functioning, and therefore, are affecting societies that rely on ecosystem services for subsistence [The Qinghai\u2013Tibetan Plateau grassland is the largest geomorphological unit and one of the most important terrestrial ecosystems on the Eurasian continent . Historisistence .The increase in the size of the human population has led to a greater pressure on land resources and demand for milk products and meat for human consumption, and has resulted in increases in stocking rates to levels that exceed the carrying capacity of the ecosystem . Since tGrassland degradation not only affects the resilience of ecosystems, but also jeopardizes the basic subsistence of dependent herdsmen. Overgrazing reduces herbage production  and alteOvergrazing on the Qinghai\u2013Tibetan Plateau is extremely common because the local grazing system aims to maximize animal liveweight gains per hectare (ha), which may produce higher economic returns in the short term. It has been reported that the local regulation of grazing activities of Tibetan Plateau yak herdsmen does not meet the targets for sustainable grassland-based animal production, from the view point of either ecology or economics . VariatiThe current management pattern of herdmen of continuously grazing the same grassland area each year with high stocking rates, combined with variation in precipitation, makes grasslands more susceptible to degradation . This poThe focus of this study was to examine how different stocking rates in the Tibetan Plateau grasslands affect yak performance and vegetation, as reflected by changes in the nutritive value and yield of herbage. Specifically, the aim of the present study was to determine the effects of stocking rate and precipitation on the biomass, nutritive value, and nutritive yield of herbage, as well as on yak performance measured as liveweight gain (LG) per yak and per ha. The study also aimed to determine the extent to which the ecosystem is either damaged or improved in terms of its productivity and quality under different stocking rates and precipitation regimes. The interaction between herbage and yak stocking rate was analyzed to determine how LG responds to increasing stocking rate, and whether the expected grazing-induced increase in herbage nutritive values compensate for the expected decrease in biomass. We conducted a restricted grazing experiment to analyze the effects of yak grazing at different intensities, from ungrazed to heavily grazed, over four consecutive years (2010\u20132013). Based on the results of this study, we recommend an optimal and sustainable level of grazing that avoids overgrazing and prevents further grassland degradation.Polygonum viviparum and Kobresia capillifolia contribute more than 50% to the herbage biomass yield. Stipa purpurea, Leontopodium nanum and Saussurea pumila are common accompanying species, and toxic plants include Stellera chamaejasme, Oxytropis coerulea, and Gentiana farreri. Soils are classified as Calcic Chernozems [-1 of the experimental paddock in July before grazing commenced.The study area is located in Nannigou Village, Zhuaxixiulong Town, Tianzhu County , Gansu Province, on the northeast edge of the Tibetan Plateau. This grassland area has an alpine climate with mean annual precipitation of 416 mm (1968\u20132013) and mean temperature of 0.7\u00b0C. Approximately 80% of the annual precipitation coincides with highest temperatures in warm season (May\u2013September). The evaporation rate is 1521 mm and snow cover is 107 d in one year. Data for long-term mean climate variables as obtained from the Wushaoling meteorological station. The growing season lasts for approximately 150 d from May to September. The grazing season is slightly shorter than the growing season because early season grazing is prohibited to protect the grassland. Due to climate conditions in the Qinghai-Tibetan plateau, herdsmen divide alpine meadows into warm (from June to September) and cold (from October to May) paddocks respectively; this experiment was conducted in a warm paddock. The perennial dominant species ernozems . The exp-1), (2) medium stocking rate , (3) low stocking rate  and (4) no grazing (C). These were repeated three times for each stocking rate to give a total of 12 plots. Each plot was 4 ha. Yak management followed traditional practice, with animals grazing through the day and returning to a barn overnight; grazing time was about 10 h day-1. The paddock was owned by a local farmer, who agreed to its use for this experimental study. There was no endangered or protected species within the paddock.The effects of yak grazing on herbage biomass, herbage nutritive value, and herbage nutritive yield, as well as on yak LG, were analyzed using an experiment with a randomized complete block design. Experimental grazing periods were consistent with the typical local grazing season and lasted from June to September. Animal welfare and experimental procedures were carried out in accordance with the Guide for the Care and Use of Laboratory Animals, Ministry of Science and Technology of China , and werA quadrat survey was conducted each year in the middle of July, August, and September. Nine quadrats (1 m \u00d7 1 m) were randomly placed in each plot, replicated three times for each stocking rate, ensuring that the distance to the edge of the plot was greater than 20 m. This gave a total of 1296 quadrats in four years. Plant species, height, and coverage were recorded within each quadrat. The plant samples from each quadrat were dried to constant weight at 85\u00b0C and then weighed. The samples were grounded in a mill through 0.25 mm sieve to minimize variation in nutritive values and yield arising from the effects of selective feeding by livestock at different sampling locations.-1) was calculated as follows: ME = TDN \u00d7 0.82 \u00d7 0.04409 \u00d7 4.182.Samples were analyzed in the laboratory to determine the concentration of nitrogen (N) and crude fat (CF) using AOAC methods . The con-1 d-1 (1) and seasonal LG per ha (LG ha) in g ha-1 d-1 (2) were calculated as follows:i is the mean liveweight of yak in each treatment (g yak-1) at the beginning (B) and end (E) of the grazing season, d is the number of grazing days, and SR is the stocking rate (yak ha-1 grazing season-1).The grazing animals were 16-month-old non-pregnant female yaks. All animals had free access to water and mineral lick stones and were given anthelmintic treatments at the beginning of June and the end of July each year, and shelters were provided. The average yak liveweight was 78, 77, 76, and 78 kg at the beginning of the grazing season in 2010, 2011, 2012, and 2013, respectively. According to yaks liveweight and intake, a standard yak with 200 kg equals to 4 sheep equivalents. The yaks in each plot had similar initial live weights, which were determined after a 15-d adaptation period. Yaks were weighed on two consecutive days, and the liveweight for each animal was calculated as the average of these two measurements. Seasonal LG per yak (LG yak) in g yakData were analyzed by ANOVA using the Mixed Model option in SPSS version 16.0  with an autoregressive covariance structure. \u201cStocking rate\u201d, \u201cblock\u201d, \u201cyear\u201d and their interactions were considered fixed effects with \u201cyear\u201d treated as a repeated effect and \u201cstocking rate \u00d7 block\u201d as the subject effect. Multiple comparisons of means were made by Tukey\u2019s test . StatistAnnual precipitation was 295, 486, 526, and 252 mm in 2010, 2011, 2012, and 2013, respectively. During the experimental period (2010\u20132013), average annual precipitation was 390 mm, the variation in annual precipitation was 33% . The pre-1, in seasons with recorded precipitation rates of 295, 486, 526, and 252 mm in 2010, 2011, 2012, and 2013, respectively. Regression analysis defined a positive linear relationship between precipitation and standing herbage biomass   .2 = 0.8, P<0.001) (-1) than in HS (925 kg ha-1). Herbage biomass reduction associated with grazing by yaks was 0%, 2%, 15%, and 27% in C, LS, MS, and HS, respectively. There was a negative quadratic  more than a negative linear  relationship between herbage biomass and stocking rate  . Herbageing rate .2 = 0.9, P<0.001) more than a negative linear relationship  with precipitation .The nutritive value of herbage improved with increasing stocking rate , that is-1 d-1 and 425, 405, 469, and 433 g ha-1 d-1, respectively. Therefore, maximum animal performance and productivity was in the wet year, 2012. However, stocking rate was the most important factor in determining LG per yak  and per ha . The daily LG per yak was significantly higher in LS than in MS and HS (P = 0.016) (-1). The function among stocking rate, biomass and animal production ha-1 was as LGha = 162+ 259SR+ 0.0114HB , then LGyak = 599- 178SR+ 0.0184HB  and was used to describe the relationship among SR, biomass and animal production per head.Precipitation significantly affected yak LG . In 2010S and HS . In cont= 0.016) . Therefo= 0.016) . The intOur results indicate that inter-annual variability in precipitation can explain the inter-year differences in herbage biomass. The standing biomass of herbage increased linearly with increasing annual precipitation. Because of the high variability in precipitation, herbage biomass varied markedly among the four years. Such a situation makes it difficult to predict the best stocking rate in any single year, which has led to the excessive stocking rate in this region. A yak growing from 80 kg to 120 kg would need around 360 kg DM biomass  per yak for a 90 day grazing season, then, we could image the utilization ratio of standing biomass is 33.5% in dry year (2013) and 30.2% in wet year (2012).The results of this study also demonstrate that stocking rate adversely affected herbage biomass. The herbage biomass after grazing, which was a useful indicator of whether herbage biomass production was adequate to support the applied stocking rate, indicated that the gradations in stocking rate were appropriately chosen. Herbage biomass showed a negative linear relationship with stocking rate; at the end of the four years, there was 27% lower herbage biomass in the high stocking rate (HS) treatment than in the ungrazed treatment (C). This appears to be a common herbage response in the alpine meadow ecosystem, at least in the short term, because comparatively small biomass reductions in successive years have a cumulative effect. There is an ongoing argument as to whether grazing at current stocking rates will increase or decrease the primary productivity of grasslands , 29.-1, lower than high-productive grassland (more than 10 sheep ha-1).There is no intrinsic contradiction between the results of our study and those of other studies , 31. OurHigh inter-year variability in precipitation explained most of the inter-annual variation in herbage nutritive values. Thus, not only the grassland biomass but also the nutritive values of herbage depended on the amount of precipitation. Our results suggest that herbage nutritive values increased with higher rainfall. In alpine meadows, precipitation directly determines the amounts of plant-absorbable water and available water. Because of accelerated mineralization, an increase in precipitation is associated with an increase in the amount of plant-available nitrogen. However, while higher moisture levels increase nitrogen availability, they also increase the nitrogen assimilation rate of plants. There are several explanations for the increase in nitrogen assimilation with increasing precipitation, including the increased activities of enzymes involved in nitrogen anabolism , increasThe herbage contained more fiber in the drier year, 2013, than in the other years. Plant maturation was accelerated by the drier in this year. Thus, water stress resulted in more fibrous, less digestible herbage, whereas higher precipitation rates increased herbage nutritive values, likely because of delayed maturation. Plant maturation can be delayed under moderate water stress, and so herbage nutritive values remain at higher levels . The lowOur result that herbage nutritive values increased with increasing stocking rate is consistent with the results of other studies \u201341. The P. viviparum or K. capillifolia, to unpalatable species (e.g. O. coerulea or S. chamaejasme), annual species (e.g. Artemisia annua), and subshrubs (e.g. Potentilla fruticosa).The results of this study indicate that grazing positively affected herbage nutritive values over the four-year short-term trial. However, long-term heavy grazing may negatively affect herbage nutritive values in alpine meadows, because there can be a shift from high- to poor-quality herbage species after long-term grazing , 47. TheOur results show that variations in precipitation among years affected LG per yak and per ha, as reported in other studies , 49. In -1 grazing season-1. Grazing at this intensity avoided the reductions in herbage biomass typically associated with grazing, and the LG per ha was 88% of that obtained in HS  can reduce herbage biomass by 27% . We founed in HS . This re-1, which provides 88% of the highest LG per ha, satisfies the demands for sustainable grazing management. However, other more developed grazing management strategies, such as rotation grazing, supplementary feeding in winter and yak turn over period from 4 years to 2 years, may also increase the biomass and nutritive value of herbage and animal LG in the winter. Implementation of such strategies may improve the sustainability of grassland use on the other parts of Qinghai-Tibetan Plateau with the similar conditions.Herbage biomass and herbage nutritive values were dependent on annual precipitation. Grazing also affected herbage performance, in that herbage biomass decreased and herbage nutritive values increased with increasing stocking rate. The increase in herbage nutritive values by grazing could not compensate for the decrease in herbage biomass. Both precipitation and stocking rate were important factors in determining livestock LG. We conclude from our results that a moderate stocking rate of 1 yak ha"}
{"text": "Vitexin induced apoptosis in a concentration-dependent manner, and caused up-regulations of Caspase-3, Cleave Caspase-3, and a down-regulation of Bcl-2. The expression of autophagy-related protein LC3 II was significantly decreased after vitexin treatment. Moreover, western blot analysis presented that vitexin markedly up-regulated the levels of p-JNK and down-regulated the levels of p-Erk1/2 in SK-Hep1 cells and Hepa1-6 cells. Cotreatment with JNK inhibitor SP600125, we demonstrated that apoptosis induced by vitexin was suppressed, while the inhibition of autophagy by vitexin was reversed. The results of colony formation assay and mouse model confirmed the growth inhibition role of vitexin on HCC in vitro and in vivo. In conclusion, vitexin inhibits HCC growth by way of apoptosis induction and autophagy suppression, both of which are through JNK MAPK pathway. Therefore, vitexin could be regarded as a potent therapeutic agent for the treatment of HCC.Vitexin, a flavonoids compound, is known to exhibit broad anti-oxidative, anti-inflammatory, analgesic, and antitumor activity in many cancer xenograft models and cell lines. The purpose of this study was to investigate the antitumor effects and underlying mechanisms of vitexin on hepatocellular carcinoma. In this study, we found that vitexin suppressed the viability of HCC cell lines (SK-Hep1 and Hepa1-6 cells) significantly. Vitexin showed cytotoxic effects against HCC cell lines  Hepatocellular carcinoma (HCC), the fifth most common cancer worldwide, is characterized as having a poor prognosis and high mortality . Liver tVitexin, (apigenin-8-C-D-glucopyranoside), a naturally-derived flavonoids compound, has been used as a traditional Chinese medicine for the treatment of a variety of diseases , 8. The Apoptosis, generally recognized as a form of programmed cell death, involves the suicide and disposal of cells in response to a number of stimuli, including growth factor deprivation, antitumor drugs and ionizing radiation . ApoptosAutophagy is a basic catabolic process through which damaged cytoplasmic constituents and organelles are delivered to lysosomes for proteolysis to maintain energy homeostasis . Increas2-terminal kinase (JNK), a stress-responsive kinase, plays a vital role in the regulation of cell growth, differentiation, apoptosis, tumorogenesis, and other signaling pathways [Recent findings have revealed that the c-Jun NHpathways . JNK is pathways , 25. In pathways . Of partpathways , 28. Bclpathways . In our P<0.001, Figure P<0.001, Figure P<0.001, Figure 50 values in SK-Hep1 and Hepa1-6 cells were approximately 100 \u03bcM, indicating that cell viability was significantly decreased at 100 \u03bcM concentration of vitexin treatment.The effects of vitexin on cell viability in human SK-Hep1 cells and mouse Hepa1-6 cells were examined in response to increasing concentrations of vitexin for 24 h. Vitexin exerted a dose-dependent inhibitory effect on the viability of SK-Hep1 and Hepa1-6 cells Figure . CompareP<0.001, Figure P<0.001, Figure To detect whether vitexin inhibited the viability by inducing apoptosis in liver cancer cells, apoptosis was determined by flow cytometry with Annexin V-FITC/PI Staining. Both SK-Hep1 and Hepa1-6 cells were treated with 100 or 150 \u03bcM vitexin for 24 h. As shown in Figure To further evaluate the molecular mechanisms of apoptosis induced by vitexin, we explored the expression of apoptosis-related proteins in response to different concentrations of vitexin for 24 h. As shown in Figure P<0.01, Figure P<0.001, Figure To determine whether the inhibition of autophagy was regulated by vitexin in SK-Hep1 and Hepa1-6 cells, levels of the proteins in autophagy pathway were measured by western blot. As shown in Figure P<0.05, Figure P<0.01, Figure In order to confirm the protective role of autophagy against vitexin-induced apoptosis, we investigated the effects of activating autophagy with use of rapamycin, a specific autophagy activator. The combination of rapamycin and vitexin significantly increased the survival rate of SK-Hep1 cells to 75.3% versus 56% with vitexin alone  was used to block JNK activity. We found that cotreatment with SP600125 (10 \u03bcM) reversed LC3II reduction caused by vitexin (100 \u03bcM) in both cell lines Figure . In SK-Hin vitro within liver cancer cells. In Figure in vivo within the established liver cancer C57BL/6 mouse model. As compared with tumor formation obtained in the non-vitexin treated group, vitexin pretreatment resulted in a significant suppression in tumor size . Vitexin, obtained from SelleckInc (USA), was dissolved in dimethylsulfoxide  at a concentration of 300 mmol/L stock solution and stored at -20\u00b0C. MTT , DAPI (6-diamidino-2-phenylindole dihydrochloride), and the Annexin V-FITC/PI Staining Apoptosis Detection Kit were purchased from Sigma-Aldrich. Rapamycin and SP600125 (JNK inhibitor) were purchased from Selleck Inc (USA). Antibodies for Beclin1, LC3, JNK, p-JNK, Erk1/2, p-Erk1/2, Bcl-2, Caspase-3, Cleave Caspase-3, Ki-67, MMP-2, GAPDH and HRP-conjugated secondary antibodies were purchased from Cell Signaling Technology Inc (USA). All other reagents were purchased from Sigma-Aldrich or as indicated.2.SK-Hep1 cells (a human liver cancer cell line) and Hepa1-6 cells (a mouse liver cancer cell line) were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences . Cells were incubated in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS) and 1% penicillin streptomycin (100 U/mL) at 37\u00b0C under 5% CO5 cells/mL in 6-well plates and divided into four groups: (1) Control group: Cells without treatment were served as the control condition. (2) Vitexin group: Cells were treated with different concentrations of vitexin for 24 h. (3) Rapamycin group: Cells were treated with 100 \u03bcM vitexin and 40 nM rapamycin for 24 h. (4) SP600125 group: Cells were treated with vitexin (100 \u03bcM) combined with SP600125 (10 \u03bcM) for 24 h.SK-Hep1 and Hepa1-6 cells cultured in DMEM were plated at a density of 2 \u00d7 104 cells/well) and after 24 h of incubation at 37\u00b0C, then treated with 0, 10, 20, 30, 40, 50, 75, 100, 150, 200, or 300 \u03bcM vitexin for 24 h. Fresh medium and 20 \u03bcL MTT solution (5 mg/mL) was added to each well and cultured for 4 h at 37\u00b0C and 5% CO2. After incubation, the medium was removed and 200 \u03bcL DMSO was added to each well to detect the absorbance. The OD values were determined at a wavelength of 570 nm. IC50 value represented the concentration of vitexin required to inhibit cell viability by 50% relative to untreated cells and were calculated by the logit method.The effects of vitexin on SK-Hep1 and Hepa1-6 cells viability were assessed with use of a MTT kit (Sigma-Aldrich). Cells were plated into 96-well plates (5 \u00d7 10The cells were placed in a 6-well plate and incubated with vitexin (100 or 150 \u03bcM) for 24 h. Cells without any deal served as control. Cells were harvested, washed in PBS and resuspended in annexin-binding buffer. Then 5 \u03bcl Annexin V-FITC and 10 \u03bcl PI Staining Solution were added and cells were cultured at room temperature in the dark for 20 min. Apoptotic cell death was analyzed after DAPI staining by flow cytometry. For quantification and distribution, the rate of cell apoptosis was determined under fluorescent microscope using 100\u00d7 magnification with an average from five different fields used to calculate this quantified value.Protein samples extracted from HCC cell lines were lysed with SDS-PAGE sample buffer. Protein samples were separated and transferred onto nitrocellulose membranes by 10% or 12% SDS-PAGE. The membranes were blocked with TBS containing 5% nonfat milk and then incubated with antibodies  at 4\u00b0C overnight. After washing, the membranes were incubated with HRP-conjugated antiIgG at room temperature for 1 h. Signal detection was performed with an ECL system .SK-Hep1 and Hepa1-6 cells were transfected with the GFP-LC3 plasmid using Lipofectamine 3000\u2122 (Invitrogen) according to the manufacturer's guidelines. After cells had been treated with or without 100 \u03bcM vitexin, the puncta formation of GFP-LC3 was determined under fluorescent microscopy (Olympus BX5). Cells were considered to have accumulated autophagosomes when five or more puncta were counted. This criteria was established as the small number of mock-treated cells rarely displayed more than one to four puncta.The single-cell suspensions of SK-Hep1 and Hepa1-6 cells were placed in a fresh 6-well plate in triplicate for each group in medium containing 10% FBS at 37\u00b0C. After 24 h, the cell lines were replaced with new medium together with 100 \u03bcM vitexin. Drugs were washed out at 48 hours after treatment, and fresh 10% FBS medium was added. After 14 days, cells were fixed with methanol and stained with 0.1% crystal violet. Dishes were washed with distilled water, and visible colonies were manually counted.7) were re-suspended in 200 \u03bcl serum-free culture medium and were subcutaneously injected into the left liver lobes of C57BL/6 mice [Male C57BL/6 mice were purchased at 6-7 weeks of age from the experimental animal center of the PLA Military Medical Science Academy. Animal experiments were performed according to the guidelines of the National Institute of Health (NIH). A mouse xenograft model of HCC was established as described previously [L/6 mice . The micSamples from the liver tumor tissues were fixed in 4% paraformaldehyde for 24 h, dehydrated and embedded in paraffin. Five micrometer-thick sections were cut from each paraffin embedded tissue and stained with hematoxylin and eosin (H&E) for histopathologic examination under a light microscope.2O2 for 15 min, sections were blocked with 5% goat serum, and incubated with antibodies (Ki-67 and MMP-2) at 4\u00b0C overnight. Sections were incubated at room temperature for 60 min with the HRP-conjugated secondary antibody, then DAB solution was used. Counterstaining was performed with hematoxylin.Tumor tissues samples were fixed in 4% paraformaldehyde for 24 h, dehydrated, embedded in paraffin, and sectioned at a 5-\u03bcm thickness. Tissue sections were deparaffinized and rehydrated with xylene and alcohol of gradient concentrations, then cultured in 5 mmol/L citrate buffer (pH 6.0) for 15 minutes to retrieve internal antigens by microwave. After blocking endogenous peroxidase activity by incubating in 3% HAfter retrieving internal antigens and blocking endogenous peroxidase activity as described above, tumor sections were treated with 5% goat serum and incubated with LC3 antibody at 4\u00b0C overnight. Sections were incubated with 20\u03bcl fluorophore-conjugated secondary antibody for 1 h at room temperature before imaging. After washing with PBS, sections were counterstained with DAPI (10 ng/mL) for 10 min. A fluorescence microscope was used for LC3 co-localization analysis.P<0.05. All statistical analysis were performed with SPSS 19.0 and GraphPad Prism Version 5.0 softwares.The results were expressed as the mean \u00b1 standard deviation (SD) of independent experiments. The data were analyzed using one-way analysis of variance (ANOVA) to determine statistically significant differences among groups. Differences were considered statistically significant for values of"}
{"text": "The status of \u201ctrying to become pregnant\u201d is complex and may last for years. Many female global health profession-als of reproductive age, if they heed the advice of the CDC, would avoid work-related travel to Central and South America. This could mean that for the current cohort of global health projects, women's input would be significantly reduced. Lack of gender balance is known to hamper effective implementation of global health initiatives.Women may be hesitant to express their concern about Zika. Citing Zika travel policies as a reason to avoid work-related international travel may signal to employers a woman's intention to have children. Many women worry about revealing their plans to have children to their employers. Women are aware that revealing an intention to become pregnant might be detrimental to their career advancement. For example, employers may prefer to hire and promote those they suspect less likely to have children, to avoid having to cover maternity leaves. While the practice is technically illegal in the United States, women are often discriminated against in hiring, such as by being asked in job interviews if they plan to have children.Women are aware that revealing an intention to become pregnant might be detrimental to their career advancement.Monitor and report on whether women's participation in global health programs and policies is decreasing. Compare measures of participation before and after Zika travel policies were in place.Mitigate the impact. Seek more flexible ways to involve women in global health projects. For example, I acted as gender consultant for a maternal health initiative in Guatemala by combining a shorter in-country trip with later teleconferencing for interviews with maternal health project staff based in Northern Guatemala.Consider increasing the participation of local as opposed to expatriate women. The reality is that most global health projects are funded and managed by international institutions headquartered in the North that employ many expatriates. If instead local professional women were brought to the fore, this could be a silver lining. Involving more local women would improve adaptation of the project to the local context and mitigate the overall loss of women's perspectives resulting from the Zika travel policies.Involving more local professional women in global health projects could be a silver lining.Know you are not alone. For women of reproductive age who are involved in global health, navigating adherence to Zika travel policies is complex. I hope this letter will stir reflection and push these issues from private dilemmas to public debate.Suggest to global health employers alternative ways for women to be involved. If your intention to become pregnant means you cannot risk travel to Zika-endemic areas, suggest to your employer alternatives such as teleconferencing or partnering with a local counterpart who is a woman.Zika travel policies may have the unintended consequence of reducing women's participation in global health programs. Addressing gender equity in global health projects is complex. Recognizing and dealing with gender imbalances in global health leadership is perhaps more subtle, but no less important."}
{"text": "Influenza A viruses are important human and animal pathogens. Seasonal influenza viruses cause infections every year, and occasionally zoonotic viruses emerge to cause pandemics with significantly higher morbidity and mortality rates. Three cases of laboratory confirmed human infection with avian influenza A (H7N9) virus were reported in 2013, and there have been several cases reported across South East Asia, and recently in North America. Most patients experience severe respiratory illness, with mortality rates approaching 40%. No vaccine is currently available and the use of antivirals is complicated due to the emergence of drug resistant strains. Thus, there is a need to identify new drugs for therapeutic intervention and disease control. In humans, following H7N9 infection, there is excessive expression of pro-inflammatory factors CCL2, IL-6, IL-8, IFN\u03b1, interferon-\u03b3, IP-10, MIG and macrophage inflammatory protein-1\u03b2, which has been shown to contribute to fatal disease outcomes in mouse models of infection. In the current study, the potent inhibitor of CCL2 synthesis, Bindarit, was examined as a countermeasure for H7N9-induced inflammation in a mouse model. Bindarit treatment of mice did not have any substantial therapeutic efficacy in H7N9 infection. Consequently, the results suggest that Bindarit may be ill-advised in the treatment of influenza H7N9 infection. Infected children typically suffer only mild disease,2 whereas elderly patients are generally more severely afflicted.3 This suggests that there is minimal heterologous immunity from previous influenza infections. Most patients infected with H7N9 experienced severe respiratory illness, such as pneumonia (97.3%) and acute respiratory distress syndrome (71.2%), leading to high rates of intensive care unit admissions.4 The mortality rate attributed to influenza H7N9 infection in human is >38%, with 175 deaths from 450 confirmed cases reported within a 20-month period.5 No evidence of sustained human-to-human transmission of H7N9 has been recorded. However, there is some evidence of limited person-to-person spread under rare circumstances.6 After human H7N9 infections were first reported in China, the virus spread rapidly to other countries.7 Recently, the first case of human H7N9 infected in North America was documented in Canada.8Despite vaccines and therapeutics for circulating strains, influenza A virus (IAV) remains a serious global health threat affecting humans, wildlife and agricultural species. Avian IAV H7N9 virus (H7N9) infections in humans were first reported in China in March 2013.9 There are several antivirals available for the treatment of IAV infections including the M2 ion channel inhibitors amantadine and rimantadine, and the neuraminidase inhibitors zanamivir and oseltamivir.11 Early treatment with these antiviral drugs reduces the duration of symptoms and recovery time. However, the use of antiviral drugs is complicated by the emergence of drug resistant viruses,13 and oseltamivir-resistant H7N9 strains have recently been described in Taiwan.14 In addition, the use of antiviral drugs may affect population vulnerability due to lack of seroconversion, as well as driving drug resistance among circulating strains.15 The development of new drugs and vaccines against H7N9 may take many years. Drug repurposing, or the use of clinical drug candidates, may help to overcome this lengthy process of drug development and reduce the impact of H7N9-induced disease. H7N9 disease results in a potent immune response believed to contribute to tissue destruction and pathology.16 The host's immune response towards H7N9 infection has not been fully characterized, which is an issue for the discovery of novel therapeutics and target identification for drug repurposing.No specific vaccine is currently available for H7N9.16 Proliferation of H7N9 in the lower respiratory tract causes excessive activation of the innate immune response.16 This leads to production of inflammatory mediators, many expressed by intrapulmonary macrophages and alveolar cells.16 Some of the major histological characteristics of H7N9 infection include diffuse alveolar damage, hyaline membrane and fibroproliferation in the lung, and spotty necrosis in the liver.16 Histological observations have shown a depletion of T cells, a fluctuating numbers of neutrophils, and highly abundant and activated macrophages which are characteristic of H7N9 infection in the alveoli.16 In addition, high levels of intrapulmonary inflammatory mediators, such as the interferon gamma-induced protein 10 (IP-10) and interleukin-6 (IL-6) have been detected.16 Plasma levels of IL-6 and IL-8 are sharply upregulated, whereas IL-10, macrophage inflammatory protein-1\u03b2, and interferon-\u03b3 are increased to intermediate levels.4 In contrast, IL-1\u03b2, tumor necrosis factor \u03b1 (TNF\u03b1), and MIP-1\u03b1 are found only at minimal concentrations. Whether the elevated cytokine and chemokine levels cause or contribute to the severity of H7N9 disease has yet to be determined.4 However, the upregulation of pro-inflammatory cytokines and chemokines, such as the monocyte chemoattractant protein-1 (MCP-1/CCL2), IL-6, IL-8, IFN-\u03b1, IP-10, MIG and macrophage inflammatory protein-1\u03b2 was described in H7N9-infected patients with lung injury and severe pneumonia.2 The cytokine levels in C57BL/6 and BALB/c mice infected with H7N9 (A/Anhui/A/2013 strain) were compared. C57BL/6 mice exhibited more severe lung injury, slower recovery from lung damage, less effective viral clearance, higher levels of CCL2, IL-6 and IL1\u03b2, and lower levels of TNF\u03b1 and interferon-\u03b3 than BALB/c mice. These data suggest that TNF\u03b1 and IFN\u03b3 may help to suppress viral gene expression and increase viral clearance, while CCL2 and IL-6 may contribute to lung injury during H7N9 disease.17In studies of fatal H7N9 infections in humans, there is evidence of immune pathological changes caused by a heightened innate immune response.18 Bindarit has been successfully used to alleviate virus-induced inflammation in several animal models of disease. For example, Bindarit was efficacious in mouse models of Chikungunya and Ross River virus infections, where it was shown to ameliorate infections and disease.20 Furthermore, Bindarit was able to reduce arthritic inflammation without showing any detrimental effect on virus clearance in these animal models of alphavirus infection.21 Therefore, the activity of Bindarit activity was determined to reduce pulmonary and serum CCL2 levels in a mouse model of H7N9 disease. Bindarit selectively inhibits CCL2. CCL2 is a critical mediator of neuroinflammation in myriad disease states, including multiple sclerosis,22 human immunodeficiency virus (HIV)-1-induced encephalitis,23 Guillain-Barr\u00e9 syndrome,24 Alzheimer's disease,25 ischemia,26 neurotrauma,27 epilepsy,28 neurogenic hypertension29 and alcoholism.30 Bindarit has also been studied for therapeutic intervention for these diseases. The clinical tolerability data for Bindarit in different CCL2-dependent illnesses demonstrated Bindarit safety up to a maximum dose of 2400\u2009mg per day for as long as 6 months, and suggests the potential of Bindarit to be beneficial for a range of diseases.31The focus of this study was to assess the effects of drug inhibition of the pro-inflammatory factor CCL2, which may have a pathogenic role during H7N9 disease. Bindarit represents a novel class of inhibitor that reduces CCL2 synthesis.This study aimed to explore the role of CCL2 in H7N9 disease and the potential of Bindarit to act as a countermeasure against H7N9-induced pathology in a mouse model. Intriguingly, the survival rate of Bindarit-treated mice was comparable to that of non-treated mice, while weight loss, cellular infiltration and viral titers were considerably increased with Bindarit treatment. Thus, the use of Bindarit as a therapeutic to treat H7N9 disease seems ill-advised.CCL2 gene expression during infection with A/Ca (H1N1), a representative, currently circulating IAV subtype, in a human epithelial cell (A549) line. CCL2 was considerably upregulated by 3.21-fold (P<0.01) in A/Ca (H1N1)-infected A549 cells compared to mock-infected controls at 24\u2009h\u2009pi (m), CCL2 gene expression was significantly (P<0.01) reduced to a level comparable to mock-infected controls.To evaluate the effectiveness of Bindarit in reducing CCL2 production, lung epithelial cells were infected (MOI=0.1) with A/California/04/09  virus and simultaneously treated with Bindarit. Quantitative reverse transcription PCR (RT-qPCR) was used to investigate the effect of Bindarit on  24\u2009h\u2009pi . When A55 PFU) and treated with Bindarit (70\u2009mg\u2009kg\u22121) twice daily starting at day 1 post-infection (pi). Mice were monitored for weight loss and survival. Bindarit treatment had no detectable impact on weight loss or survival of mice. Mice in both groups lost body weight to a similar extent, reaching a 25% reduction in body weight by day 5 (P<0.1) difference was noted in the survival rate between the two groups.The ability of Bindarit to protect mice from lethal H7N9 infection was investigated. Mice were intranasally (i.n.) infected with a lethal dose of H7N9  and orally treated with Bindarit (70\u2009mg\u2009kg\u22121) twice daily starting at day 1\u2009pi. Mice were killed at day 4\u2009pi and lungs were collected for histopathology. Lungs in both groups, mock- and Bindarit-treated, showed moderate to severe necrotic bronchitis and bronchiolitis. The peribronchiolar and perivascular infiltration was mild to moderate for both groups and animals showed mild to severe alveolitis (\u22121). All mice showed a lung score of 3  increase in total number of leukocytes was observed in mice orally treated with Bindarit (70\u2009mg\u2009kg\u22121) after lethal infection with H7N9 at day 4\u2009pi  fluid from infected mice. A significant . The lethal challenge may have been overwhelming and therefore the effect of Bindarit insufficient. Therefore, a study using a sub-lethal dose of virus was performed. Mice were infected 102.7 PFU with a sub-lethal dose of H7N9 and orally treated with Bindarit (70\u2009mg\u2009kg\u22121) twice daily starting at day 1\u2009pi. Mice in both groups lost body weight until day 4\u2009pi. However, on days 5, 6 and 8, Bindarit-treated mice showed a considerable increase in weight loss compared to mock-treated control mice  had higher lung virus titers compared to mock-treated control mice at day 8\u2009pi  increased when H7N9-infected mice were treated with Bindarit. Bindarit treatment did not appreciably change the level of other pro-inflammatory cytokines. Bindarit oral treatment also had minimal effect on cytokine expression levels in the lungs. Interestingly, CCL2 protein level was not reduced, but appeared enhanced after treatment with Bindarit.To corroborate the RT-qPCR results, a Luminex enzyme-linked immunosorbent assay platform was used to measure the pro-inflammatory cytokines IL-6, IL-15, CCL2, RANTES and TNF in the BAL at day 8\u2009pi . The IL-P<0.01) increased after Bindarit treatment, but were slightly higher than those in mock-treated mice  knockout mice showed increased virus titers and disease.35 In a different study on CHIKV a similar importance for the CCR2 was found. CCR2 deficiency promoted exacerbated chronic erosive neutrophil dominated CHIKV-induced arthritis in mice.40CCL2 is upregulated in several viral diseases in humans, such as HIV, hepatitis C virus, several herpes viruses, Japanes encephalitis virus and respiratory syncytial virus, and has been considered as a biomarker linked to disease severity in HIV.2 However, in this study, when H7N9-infected mice were treated with Bindarit, mice exhibited heightened disease signs as demonstrated by an increase in weight loss, pro-inflammatory factors, cellular infiltration and virus titers. Thus, blocking CCL2 dampened viral clearance and was associated with upregulation of pro-inflammatory cytokines and cellular infiltration. In earlier studies examining the effects of anti-CCL2 antibodies on IAV disease, mice exhibited enhanced pneumonitis compared to non-treated animals, despite reduced numbers of cellular infiltrates such as leukocytes, macrophages and neutrophils in the lungs.41 Furthermore, infection of CCL2 knockout mice with a non-lethal dose of a mouse-adapted strain of IAV resulted in a profound increase in weight loss, elevated viral loads and pro-inflammatory cytokines, and enhanced leukocyte recruitment into the infected lungs compared to wild-type mice.42 Interestingly, in that study, pro-inflammatory cytokines such as TNF\u03b1, IL-6 and IFN\u03b3 were enhanced, but cellular infiltrates into the lungs were reduced.42 However, one limitation of that study was the analysis of the cellular infiltrate in full lung homogenate as opposed to BAL, which may have influenced the outcome of the study. In the current study, we observed an increase in pro-inflammatory cytokine expression and cellular infiltration in the BAL.CCL2 is highly upregulated in patients suffering from H7N9 influenza infection, and has been linked to lung injury in mouse models.Ccl2 gene expression was not reduced in the lungs after oral treatment with Bindarit, despite its known capability in reducing CCL2 synthesis in vitro and in vivo from earlier studies by other groups.18 Oral administration of Bindarit may be a limitation in the treatment of pneumonia, as there are difficulties in reaching therapeutic concentrations of drugs in the lungs when administered by this route.43 It remains a possibility that oral delivery of Bindarit was not completely effective or led to a systemic reduction of CCL2 production that contributed to disease enhancement. In future studies this limitation will be addressed by i.n. administration of Bindarit, which may increase the concentration of the drug in the lungs. In addition, IL-15 was highly upregulated in the BAL of Bindarit-treated H7N9-infected mice. IL-15 has recently been described as a critical factor in the pathogenesis of IAV in mice with virus-induced acute lung injury.44 Whether there is a link between increased IL-15 production in the lung and a systemic inhibition of CCL2 synthesis remains a subject of further studies.Interestingly, 45 Due to increased drug resistance among circulating and novel IAV strains and the lack of specific vaccines against H7N9, there remains an imminent need for drug repurposing because the development of novel antivirals and specific vaccines will require many years of preclinical and clinical studies before their availability for clinical use.Various approaches have been investigated for the treatment of H7N9 infection in the recent years. Treatment with corticosteroids was evaluated, but it led to increased mortality in patients suffering from acute H7N9 infection.in vivo experiments were performed under the guidance of the Institutional Animal Care and Use Committee (IACUC) and Animal Resources at the Animal Health Research Center (AHRC), which has approved biosafety level 3 laboratories. Avian IAV A/Anhui/1/2013  was propagated in embryonated chicken eggs. Influenza A/California/04/09  was propagated in Madin-Darby canine kidney cells (ATCC CCL-34). Viruses were titrated on Madin-Darby canine kidney cells as described previously.46 The human type II respiratory epithelial cell line A549 (ATCC CCL-185) was maintained in Dulbecco's modified eagle's medium  supplemented with 5% heat-inactivated fetal bovine serum (HyClone) in a 37\u2009\u00b0C incubator with 5% CO2. Cell lines were regularly tested for mycoplasma contamination. Virus propagation in embryonated eggs was carried out in strict accordance with the recommendations by the University of Georgia IACUC. The protocol was approved by the University of Georgia IACUC.All m. After 24\u2009h, cells were collected in TRIzol (Thermo Fisher) for total RNA purification. Gene expression was assessed using RT-qPCR. All infections were performed in the presence of 1\u2009\u03bcg\u2009ml\u22121 (l-tosylamido-2-phenyl) ethyl chloro-methyl ketone (TPCK)-treated trypsin  in modified Eagle's medium (MEM) supplemented with 0.3% bovine serum albumin (Thermo Fisher Scientific).Bindarit (2-Methyl-2-[[1-(phenylmethyl)-1H-indazol-3-yl]methoxy]propanoic acid) was synthesized by Chemlin . Bindarit was dissolved in ultrapure water . A549 cells were grown to 80% confluency in a 48-well plate and infected with A/Ca (H1N1) at multiplicity of infection (MOI) of 0.1. After infection, Bindarit was added to the wells at a concentration of 100\u2009\u03bc\u22121 (maximum solubility). To evaluate the effect of Bindarit on disease burden, Bindarit was administered using 0.2\u2009ml  oral gavage twice daily starting at day 1\u2009pi. Mice were inoculated i.n. with influenza virus strain A/Anhui/1/13 (H7N9) with either a lethal dose (105 PFU) or a sub-lethal dose (102.7 PFU) of H7N9. BAL fluid was collected in phosphate-buffered saline (PBS) to determine cell number with flow cytometry and cytokine levels using multiplex enzyme-linked immunosorbent assay. Lungs were collected in 10% buffered formalin for histopathological analyses or homogenized in serum-free Dulbecco's modified eagle's medium and processed with TRIzol for RNA extraction and subsequent RT-qPCR.BALB/c female mice (6-to-8 weeks old) were obtained from the National Cancer Institute. All experiments and procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Georgia. All experiments were performed with 5\u20137 mice per group and repeated independently at least twice. Bindarit was dissolved in 0.5% methylcellulose (Thermo Fisher Scientific) at 7\u2009mg\u2009ml47 In brief, the concentration of total RNA was measured using a microplate spectrophotometer . RT-qPCR was used to validate mRNA expression changes and virus load using the Stratagene Mx3005P real-time PCR system . The reverse transcription reactions were performed using the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific) and 1000\u2009ng total RNA for each reaction. qPCR was performed using the GoTaq Green Master Mix  to determine mRNA levels, and data were normalized to 18S expression using the 2\u2212\u0394\u0394Ct method.48 Primer sequences for CCL2 were: 5\u2032-GAACACACTCAGCGCAGTTA-3\u2032 (forward primer) and 5\u2032-CACCCACCCTCTCTTTGATTAC-3\u2032 (reverse primer). The virus load was determined using 5\u2009ng of total RNA with a TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher Scientific). The standard curve was produced using an M gene plasmid.49Total RNA was isolated using TRIzol as previously described.50 The slides were evaluated by a pathologist without prior knowledge of the infection and treatment status.Lungs from infected mice were harvested at 4 days (pi), perfused with 10% buffered formalin, and fixed in 10% buffered formalin. The sections were embedded in paraffin, cut into 5\u2009\u03bcm sections, and stained with hematoxylin and eosin. The sections were evaluated using light microscopy. A histological score for each lung was determined according to the following criteria: 0=no lung abnormality; 1=<10% of airways inflamed; 2=10\u201330% of airways inflamed; 3=30\u201350% of airways inflamed and 4=>50% of airways inflamed.g for 5\u2009min at 4\u2009\u00b0C. The recovered supernatants were collected and stored at \u221280\u2009\u00b0C until assessed for cytokine concentration, and the cell pellet were resuspended in 200\u2009\u03bcl of 10% buffered formalin. Total cell numbers were counted using a hemocytometer. Cytokines in BAL supernatants were quantified with the Luminex xMAP system using a MILLIPLEX MAP mouse cytokine immunoassay  according to the manufacturer protocol. In brief, beads coupled with anti-CCL2, anti-IL-6, anti-interferon-\u03b3, anti-RANTES, anti-IL-15 and anti-TNF monoclonal antibodies were sonicated, mixed and diluted 1:50 in assay buffer. For the assay, 25\u2009\u03bcl of beads were mixed with 25\u2009\u03bcl of PBS, 25\u2009\u03bcl of assay buffer, and 25\u2009\u03bcl of BAL supernatant, and incubated overnight at 4\u2009\u00b0C. After washing, beads were incubated with biotinylated detection antibodies for 1\u2009h and the reaction mixture was then incubated with streptavidin-phycoerythrin (PE) conjugate for 30\u2009min at room temperature, washed and resuspended in PBS. The assay was analyzed on a Luminex 200 instrument  using the Luminex xPONENT 3.1 software.Eight days pi, mice were killed and tracheotomy was performed. The mouse lungs were flushed with 1\u2009ml of PBS, and the retained BAL was centrifuged at 400\u2009+ , CD45+SiglecF+CD11clow (eosinophils), CD45+SiglecF+CD11chigh , CD45+CD3+ , CD4 T cells (CD45+CD3+CD4+) and CD8 T cells (CD45+CD3+CD8+).For flow cytometry analysis, cell suspensions were incubated in FACS staining buffer (PBS containing 1% BSA) and subsequently stained for 30\u2009min at 4\u2009\u00b0C with an optimized concentration of antibodies : PE-conjugated anti-CD3, PerCPCy5.5-conjugated anti-CD8, PE Cy7-conjugated anti-CD4, PerCPCy5.5-conjugated anti-CD45, APC-conjugated anti-CD11c and PE-conjugated anti-SiglecF to determine cell types in the BAL. Cells were acquired on an LSRII flow cytometer (BD Bioscience) and the data were analyzed using the FlowJo software . Based on surface marker expression, six different cell types were identified: CD45t-test (two tailed). P-values of <0.05 were considered significant. All analysis was performed using Graphpad Prism Software .All experiments were performed in minimum in triplicate to ensure adequate power and the experiment independently repeated at least twice. Using power analysis, 12 animals in each group are required to give a 90% probability of detecting a treatment difference at a 5% significance level if the true difference between the treatments is one s.d. of the variation with each treatment group. However, decreasing the number of mice to five per group, gives a 90% probability of detecting a treatment difference if the true difference between the treatments is 1.63 s.d.'s of the variation with each treatment group. Further decreasing the treatment group size to three mice per group, gives a 90% probability of detecting a treatment difference only if the true difference between the treatments is 2.36 s.d.'s of the variation with each treatment group. Data are expressed as mean\u00b1s.e.m. Differences between groups were determined by one-way analysis of variance. Individual differences between groups were tested by multiple comparison and analysis using the Tukey post-test. Pairs of groups were compared by Student's"}
{"text": "CYC-B) could catalyze cyclization of lycopene to \u03b2-carotene. In this study, the differential accumulation patterns of loquat with different colors were analyzed and virus-induced gene silencing (VIGS) was utilized in order to verify CYC-B gene function. Using a cloning strategy of homologous genes, a CYC-B gene orthologue was successfully identified from the loquat. At a later stage of maturation, CYC-B gene expression and carotenoids concentrations in the \u2018Dawuxing\u2019 variety were higher than in \u2018Chuannong 1-5-9\u2032, possibly leading to the difference in pulp coloration of loquat. Interference of CYC-B gene expression in the loquat demonstrated clear visual changes. The green color in negative control fruits became yellow, while TRV2-CYC-B silenced fruits remained green. CYC-B gene expression and total carotenoid content in the pulp decreased by 32.5% and 44.1%, respectively. Furthermore, multiple key genes in the carotenoid metabolic pathway synergistically responded to downregulation of CYC-B gene expression. In summary, we provide direct evidences that CYC-B gene is involved in carotenoid accumulation and coloration in the loquat.Carotenoids are the principal pigments in the loquat. Although the metabolic pathway of plant carotenoids has been extensively investigated, few studies have been explored the regulatory mechanisms of loquat carotenoids because knowledge of the loquat genome is incomplete. The chromoplast-specific lycopene \u03b2-cyclase gene ( Eriobotrya japonica Lindl) is a member of the Rosaceae family and is native to the southeast of China [Loquat  is an effective tool for analyzing plant gene function over a short period of time , as succLoquat fruits with different colors were sampled from the loquat germplasm resource preservation garden during 2016\u20132017 . \u2018Dawuxing\u2019  and \u2018Chuannong 1-5-9\u2032  fruits of different developmental stages were harvested for experiments, including immature green (IG), breaker (B), degreening (D), yellow mature (YM), and fully mature (FM) . \u2018ZaozhocCYC-B_F: 5\u2032-CCACTTYCCTTTGACCTTCA-3\u2032 and cCYC-B_R: 5\u2032-GTGTTRCATTATTATGCAGCT-3\u2032) were designed by this laboratory. A high-fidelity enzyme was used to amplify the CYC-B gene from \u2018Dawuxing\u2019, with homology alignment verified after sequencing. A phylogenetic analysis of CYC-B proteins from different plants was constructed using MEGA software  with neighbor-joining method (testing of 1000 bootstrap replications).Loquat fruits were selected to extract total RNA, and first-strand cDNA was synthesized using a PrimeScript\u2122 RT reagent Kit with gDNA Eraser , used as the template. A homology-based cloning method was selected because genome information of the loquat is incomplete. Degenerate primers containing the complete coding region (TRV2-CYC-B plasmids were shown in EcoR I and BamH I restriction enzyme cutting sites (underlined) were designed in the conserved region of CYC-B gene sequence (pCYC-B_F: 5\u2032-CGGGATCCATGGAGTTTGGGTTGATGAA-3\u2032 and pCYC-B_R: 5\u2032-CGGAATTCGCCTACTAACAAGCGAAGTT-3\u2032). The fragment of CYC-B gene from \u2018Zaozhong 6\u2032 was inserted in an antisense orientation before the nopaline synthase (NOS) terminator and after the cauliflower mosaic virus (CaMV) 35S promoter. CYC-B fragment was purified using a SanPrep Column DNA gel extraction kit . The purified product and TRV2 plasmid were both digested by EcoR I and BamH I restriction enzymes. After ligating with T4 ligase overnight, it was transferred into DH5\u03b1 Escherichia coli (E. coli) competent cells. E. coli was spread using selective media containing kanamycin . After expansion, the quality of E. coli was ascertained by running PCR and agarose gel electrophoresis. A pair of detection primer for TRV2-CYC-B (S1_F: 5\u2032-CGGACGAGTGGACTTAGATTCTG-3\u2032 and S1_R: 5\u2032-GCCTATGGCTTCTGTTCATGTG-3\u2032) were synthesized. TRV2-CYC-B plasmid DNA was extracted using a SanPrep Column Plasmid Mini-Preps kit , as identified by EcoR I and BamH I digestion then verified by sequencing.Construct maps of the TRV1, TRV2, and TRV2-CYC-B and TRV1 and TRV2 plasmids were transfected into Agrobacterium tumefaciens GV3101 competent cells by freeze-thaw. The method of Chen et al. [Agrobacterium cells were spread in selective Luria Bertani (LB) solid medium containing Gentamicin , Kan (50 mg/L), and Rifampicin , then cultivated at 28 \u00b0C for 48 h\u201372 h. The growth of the colonies was observed. Recombinant, TRV1, and TRV2 colonies were inoculated with 50 mL of LB liquid medium containing 40 mg/L Gen, 50 mg/L Kan, 20 mg/L Rif, 10 mmol/L 2-morpholinoethanesulfonic acid (MES), and 20 \u03bcmol/L acetosyringone (AS), shaken at 28 \u00b0C until the OD 600 had risen to 1.2. The presence of the inserts was verified using 1 \u03bcL of bacterial solution as a template for PCR. TRV1 detection primers were created as described by Chen et al. [TRV2-CYC-B detection primers were the same as S1 primers. TRV2 detection primers were as follows: TRV2_F: 5\u2032-GCCATTAGCGACATCTAAAT-3\u2032 and TRV2_R: 5\u2032-CTAAGTCCACTCGTCCGTAA-3\u2032. The verified cells were collected by centrifugation at 4000 g for 15 min and resuspended in infection buffer  twice until the final OD-600 was 1.2. Finally, resuspended cells were gently shaken at 28 \u00b0C for 4 h.n et al.  and Zhain et al. . TRV2-CYTRV2-CYC-B and TRV2 were mixed with TRV1 bacterial solution at a ratio of 1:1, respectively, using the empty TRV2 plasmid as a negative control. In addition, groups in which sterile water was injected, or not, were used. Twelve fruits of \u2018Zaozhong 6\u2032 in each group were selected, using a single fruit as a repeat. A loquat fruit was injected with 300 \u03bcL of mixed bacterial solution using sterile syringes. After a week, the pulp of the injection area (no necrosis) was cut into small pieces and immediately frozen in liquid nitrogen, then stored at \u221280 \u00b0C. The primers for viral molecular detection (the TRV1 and TRV2 primers described above) were used to amplify samples, in order to verify whether the TRV virus had successfully invaded the loquat fruits.Disease-free fruits of uniform size and maturity at the breaker stage were selected as injection materials. In this study, recombinant TRV2-CYCB silenced) were selected to determine total carotenoid content, respectively. Total carotenoid content in loquat samples was conducted using acetone extraction. After extraction using 80% acetone for 24 h, the OD at 470 nm of the supernatant was measured, with 80% acetone used as the control. Every fruit sample was performed in three replicates.Twelve fruits of two groups (negative control or TRV2-CYCB silenced). Appropriate gene-specific primers of carotenoid biosynthesis were designed by Fu et al. [\u00aePremix Ex Taq\u2122 II  kit. The 2ct\u2212\u0394\u0394 values were computed to quantify relative gene expression levels [Real-time quantitative PCR (qRT-PCR) was performed to quantify gene expression levels in fruits of different developmental stages and the VIGS samples  was used to perform Duncan\u2019s pairwise comparison with a significance level of 5%  and Pearson bivariate correlation analysis.In this study, IBM SPSS statistical software  gene. Full-length cDNA of the CYC-B gene was successfully isolated from the loquat, nominated as EjCYC-B.In this study, the 1534 bp-length sequence of analysis . The loqCYC-B gene demonstrated a rising trend before the YM stage, which was downregulated at the FM stage except for the pulp of \u2018Dawuxing\u2019 (CYC-B gene were significantly different between loquats with different colors both in the pulp and peel after the B stage (p < 0.05). In the pulp, CYC-B gene expression of \u2018Dawuxing\u2019 and \u2018Chuannong 1-5-9\u2032 reached their maximum at the FM and YM stages, respectively. In the peel, CYC-B gene expression both reached its maximum at the YM stage. At the FM stage, the CYC-B gene expression level of \u2018Dawuxing\u2019 was approximately 3-fold higher than that of \u2018Chuannong 1-5-9\u2032 in the pulp, and approximately twice that of \u2018Chuannong 1-5-9\u2032 in the peel.The relative expression levels of the awuxing\u2019 . ExpressCYC-B gene expression levels in the pulp of \u2018Dawuxing\u2019 at different developmental stages (p < 0.05). This result indicated that the change in CYC-B gene expression level may affect differential accumulation of carotenoids and coloration in the loquat.The total carotenoid content of loquats with different colors at different developmental stages was detected in our previous study (doi: 10.13417/j.gab.037.004407). The content of total carotenoids of \u2018Dawuxing\u2019 and \u2018Chuannong 1-5-9\u2032 varied greatly at different maturity stages. Pearson correlation analysis found that there was a significant and positive correlation between carotenoid content and CCS gene sequence of the pear (Pyrus bretschneideri Rehd.) (GenBank accession number: XM_009379544.2) demonstrated that sequence similarity reached 98.34%, indicating that the CYC-B gene fragment from loquat was successfully cloned and linked next to the TRV2 plasmid.After PCR amplification of the conserved region, a 543-length sequence was obtained. Comparison of homology with the CYC-B gene obtained. The target gene region of the recombinant plasmid was sequenced, the result identical to that of the previous CYC-B gene cloned fragment. Therefore, one can conclude that the TRV2-CYC-B silencing vector had been successfully constructed.After double digestion of the recombinant plasmid, two distinct target bands appeared , and a tAgrobacterium, obvious phenotypic changes of the loquat fruits were observed. It was found that groups that were not injected or had been injected with sterile water and the negative control changed as normal from green to yellow, while the TRV2-CYC-B silenced fruits remained green . The results demonstrated that TRV-mediated CYC-B gene silencing resulted in a significant decrease in carotenoid accumulation in loquat pulp and interfered loquat coloration. The results also indicated that the VIGS system had been successfully constructed in the loquat.ng 35.2% C. Total ng 35.2% D. PearsoTRV2-CYC-B silenced and negative control fruits  mRNA levels also decreased significantly. To summarize, the expression of multiple structural genes involved in carotenoid accumulation changed after silencing the CYC-B gene.mRNA levels of 12 genes connected to carotenoid metabolism were analyzed in the pulp of l fruits . In linechromoplast-specific lycopene \u03b2-cyclase (CYC-B) gene by Ronen et al. [CYC-B gene become more widespread, finding that over-expression of CYC-B promoted formation of \u03b2-carotene in the tomato. Therefore, it is clear that the CYC-B gene plays an important role in the regulation of the accumulation of carotenoids. In this study, a CYC-B gene orthologue was successfully identified from the loquat using a homology-based cloning method, a simple, fast, and efficient method that uses highly conserved sequences to design degenerate primers to clone target genes. This has been used for carrots [Phalaenopsis Hybrida [Carotenoids are the principal pigments in loquat, regulated by multiple factors. Since the discovery of the n et al. , studies carrots , Phalaen Hybrida , and tob Hybrida , etc.CYC-B gene exhibited significant upregulation at the majority of developmental stages of yellow and white-fleshed loquats, as previously reported by Hadjipieri et al. [CYC-B gene was downregulated except in the pulp of \u2018Dawuxing\u2019. However, total carotenoid content increased at the FM stage in our previous study. We speculate that in addition to the CYC-B gene, other genes cooperate to regulate total carotenoid biosynthesis at the FM stage. Previous research has found that PSY, CYCB, and BCH genes have a synergistic effect on carotenoid accumulation [In this study, the transcription levels of the i et al. . At the mulation . In our mulation  have vermulation  also fouAgrobacterium, the in vitro loquat fruits changed color from the breaker stage, fruit phenotype demonstrating obvious changes. It was found that there was shrinkage in the infected region of the silenced fruits, which we speculate is caused by the pressure difference of the infected region caused by enlarged interstitial spaces after excessive bacterial liquid injection. Following CYC-B gene silencing, the infected part of the silenced fruits retained a green phenotype, suggesting a delay in fruit maturity and interfering loquat coloration. In this study, decreased expression levels of the CYC-B gene were found in the pulp, and as a result of VIGS, led to additional reduction in carotenoid content, indicating that the CYC-B gene could positively regulate carotenoid accumulation in the loquat. So, we further confirmed that the CYC-B gene was closely related to loquat coloration, as found in other studies [CYC-B gene silencing efficiency was 35.2%, while total carotenoid content reduced by 44.1%, indicating that the CYC-B gene played a key role in the regulation of carotenoid synthesis. Furthermore, this laboratory constructed the TRV-PSY silencing vector and found the silencing efficiency was 55.6%, total carotenoid content reducing by 46.8%. Additional experiments were conducted to explore why a lower silencing efficiency of CYC-B gene also caused a large drop in carotenoid concentration. After interfering with CYC-B expression, apart from the PDS, ZDS, and BCH genes, eight genes in the carotenoid metabolism pathway synergistically responded to downregulation of CYC-B gene expression, and the expression levels of seven genes  were downregulated, except for the ECH gene. We speculate that suppression of multiple key structural genes may lead to a large reduction in carotenoids. Although ECH gene expression levels were upregulated, metabolized substrate synthesis of ECH gene was downregulated, which would reduce the synthesis and accumulation of carotenoids from the source. Moreover, downregulation of PAP gene expression might affect the development of plasmid structure and disturb the accumulation of carotenoids. Leitner-Dagan et al. [CHRC (a cucumber PAP) expression by RNAi resulted in a 30% decrease in carotenoid content in tomato flowers.After injection with  studies ,24. In an et al.  also fouCYC-B gene after silencing was not complete. These factors influencing this are likely to be a selection of silencing vector [Nicotiana benthamiana, with a modified tobacco mosaic virus (TMV) vector used to silence the PDS gene of N. benthamiana [In this study, we found that the downregulation of the g vector , temperag vector ,42, lengg vector . VIGS wathamiana . A variethamiana ,42. Studthamiana . VIGS isOR transgene regulates the accumulation of carotenoids by controlling differentiation and formation of chromoplasts [OR gene regulates carotenoid biosynthesis by controlling PSY gene expression, revealing a novel regulatory mechanism of carotenoids. Phytochrome interacting factors (PIFs) are a central factor in light-mediated reactions [PSY gene expression and carotenoid accumulation by binding to G-Box element on PSY gene promoter, and transducing light signals [The biosynthesis of plant carotenoids is a complex process, regulated not only by structural genes . Moreovemoplasts . Zhou etmoplasts  discovereactions , which r signals . EnvironCYC-B gene, finding that the CYC-B gene positively regulated carotenoid accumulation and affects coloration in the loquat. Moreover, there was a multiple-gene synergistic response to the downregulation of CYC-B gene expression in the carotenoid metabolic pathway. These results directly indicate that the CYC-B gene plays a vital role in carotenoid accumulation and coloration in the loquat. Clarifying CYC-B gene function is of great significance for breeding new loquat varieties.TRV-mediated VIGS was used to cause effective silencing of the"}
{"text": "Most of real-world image distortions are multiply distortion rather than single distortion. To address this issue, in this paper we propose a quaternion wavelet transform (QWT) based full reference image quality assessment (FR IQA) metric for multiply distorted images, which jointly considers the local similarity of phase and magnitude of each subband via QWT. Firstly, the reference images and distorted images are decomposed by QWT, and then the similarity of amplitude and phase are calculated on each subband, thirdly the IQA metric is constructed by the weighting method considering human visual system (HVS) characteristics, and lastly the scores of each subband are averaged to get the quality score of test image. Experimental results show that the proposed method outperforms the state of art in multiply distorted IQA. With the large-scale use of intelligent mobile phone and computer in our modern society, evaluating the images after compression and transmission has become an increasingly important issue, and image quality assessment (IQA) has the great practical significance.IQA can be divided into three types: full-reference IQA, reduced-reference IQA, and no-reference IQA. The full reference IQA is developed earliest, which uses the original image as a reference. Full reference IQA can be roughly divided into error visibility and structural similarity methods. Peak signal-to-nosie (PSNR) is the simplest full reference IQA method. The structural similarity (SSIM)  index waIn recent years, quaternion wavelet transform (QWT) has been widely used in image processing. For example, Chen et al.  used hybMotivated by recent progress in IQA and QWT, in this paper we propose a QWT based full-reference IQA metric called QWT-IQA, which jointly takes into account the local similarity of phase and magnitude of each subband via quaternionic wavelet transform. In our QWT-IQA, we make use of a weighting method to compute the image quality score, inspired by human visual characteristics. A lot of experimental results demonstrate that our proposed QWT-IQA outperforms existing full-reference IQA method.The remaining part of the paper is organized as follows. In the section Background, we introduce the quaternion and QWT. In the section QWT-based full reference IQA metric, we propose a full-reference IQA metric based on QWT. Experiments on the LIVEMD and MDID2013 databases are carried out in the section Experimental results and analysis. At last, we give the conclusion in the section Conclusion.q is a quaternion, it can be expressed as , , and  respectively.A quaternion can also be expressed by amplitude and phase, i.e., \u03c6h and \u03c6g are scale functions, \u03c8h and \u03c8g are wavelet functions. According to \u03b4where thMagm(x) = max to make the IQA metric more consistent with human visual characteristics. Therefore, the SImilarity Metric in LL subband (SIMLL) considering HVS is calculated as following.After getting the similarity of each pixel, the similarity of the LL subband can be calculated. However, the human visual system has different perceptual effects on different regions of the picture. The more obvious the pixel amplitude is, the more prominent its corresponding phase is. The larger the amplitude is, the more important the corresponding pixel is, and the more likely it is to be in the texture changing structure. The smaller the amplitude is, the more likely it is to be in the smooth image region, and the value of the corresponding phase tends to be more unstable . In otheSIMLH, SIMHL, SIMHH can also been calculated in a similar form. Once the foregoing four similarity metrics are obtained, the QWT-based IQA metric (QWT-IQA) can be calculated by a weight sum of similarity metrics in all subbands as follows.a, b, c and d are used to adjust the importance of each subband.Following the same computation way in (10), the SImilarity Metrics in LH, HL and HH subbands, i.e., From a, b, c and d to 0.25, and the final IQA formula is defined as follows:So here we set all LIVE multiply distorted (LIVEMD) image database  consistsThere are several measures to evaluate the correlation between the quality scores and DMOS, such as Spearman rank order correlation coefficient (SROCC), Pearson linear correlation coefficient (PLCC), Kendall\u2019s rank order correlation coefficient (KROCC), and Root mean squared error (RMSE). Note that, the closer correlation coefficient is to 1 and the lower RMSE is, the better the algorithm performs.Experiments are carried out on two image subsets and the entire database, respectively. We compare our proposed QWT-IQA with the FR PSNR, SSIM, FSIM, MS-SSIM and NR SISBLIM, DIIVINE, BLIINDS-II, NIQE methods. The results are listed in Tables We also give the scatter plot of several FR IQA scores on the LIVEMD image database against DMOS in Multiply distorted image database (MDID2013)  consistsThe comparison results of FR QWT-IQA, PSNR, SSIM, FSIM and MS-SSIM are given in We also compare the QWT-SIM metric with some NR metrics such as SISBLIM, DIIVINE, BLIINDS-II and NIQE, listed in On the MDID2013 image database, we also plot the scatter of QWT-IQA scores against DMOS, as shown in LIVE IQA database  is singlFor further test our proposed QWT-IQA metric, we also compare several IQA algorithms on the LIVE single distortion IQA database, and the results are listed in time consuming than FR PSNR, SSIM and MS-SSIM, but also efficient for real time application.Time efficiency is another important index for algorithm. We give the time of compared algorithm listed in In this paper, we have proposed a QWT-based full reference IQA metric called QWT-IQA for multiply distorted images. It first calculates the local similarity of phase and magnitude of each subband via QWT, and then uses a weighting method to gain image quality score through considering human visual characteristics. Many experimental results have demonstrated that our QWT-IQA has a higher consistency with the subjective measurement on multiply distortion images, compared with the state-of-the-art full reference IQA methods."}
{"text": "Background: The May 2016 wildfire in Fort McMurray, Alberta, Canada forced evacuation of the population of 88,000 individuals and destroyed 10% of the homes. Youth are particularly impacted by disaster.Methods: Eighteen months after the wildfire, Fort McMurray Public and Catholic Schools surveyed 3,252 of the 4,407 students in Grades 7\u201312 to determine possible long-term psychological impacts. The survey included validated measurement scales for post-traumatic stress disorder (PTSD), depression, anxiety, use of drugs, alcohol, and tobacco, quality of life, self-esteem, and resilience. Data analysis was possible for only 3,070 students, i.e., 70% of the total student population. Anonymized data were analyzed to compare students who directly experienced lesser or greater impact from the wildfire, with greater impact defined as personally seeing the fire or having one\u2019s home destroyed. Also, students with greater or lesser scores on the Child and Youth Resilience Measure (CYRM-12) were compared.Results: Of the 3,070 students, 37% met criteria for probable PTSD; 31% met criteria for probable depression, and 17% for probable depression of at least moderate severity; 27% of students met criteria for probable anxiety, and 15% for probable alcohol or substance use disorder; 46% of all students met criteria for one or more probable diagnosis of PTSD, depression, anxiety, or alcohol/substance abuse, and this included students who were both present and not present in Fort McMurray at the time of the wildfire. Students with greater impact from the wildfire exhibited significantly higher scores on measures of PTSD, depression, anxiety, and alcohol/substance use. They also had lower self-esteem and quality of life scores. Students with lower resilience scores exhibited a similar pattern.Conclusions: These findings highlight first the negative impact of disasters on youth mental health, particularly for those who directly experience wildfire, and second the role of resilience on youth mental health, with lower resilience associated with substantially lower mental health outcomes. These results emphasize the need for long-term mental health supports for youth post-disaster, with specific focus on increasing youth resilience, which may serve as a protective factor against effects of disaster on mental health. On May 3, 2016, a large wildfire, called \u201cThe Beast\u201d in the popular media   and incrIn a broader context, non-wildfire disasters, including floods, earthquakes, and tsunamis, also have an adverse effect on mental health [see review in Goldmann and Galea  and Kar Despite mental health and well-being challenges resulting from disasters, resilience plays an important role in the lives of children and youth by serving as a protective factor that mitigates the effects of disaster on mental health. Resilience refers to an individual\u2019s capacity to handle adverse life experiences based on their mindset, resourcefulness, and support from family, friends, and community , 19. HigTo our knowledge, only one previous study prior to 2019 examined the impact of wildfires on youth mental health at a population level, focusing on PTSD and depression . Our goaBy analyzing school mental health survey data collected by Fort McMurray Public and Catholic School boards in November 2017 (18 months after the 2016 wildfire), we were able to help determine the overall population mental health effects in youth. This analysis allowed specific insights into measures of symptoms indicative of PTSD, depression, anxiety, alcohol and substance misuse, tobacco use, levels of self-esteem, quality of life, and resilience. In addition to capturing information on the mental health effects using standardized scales, the Fort McMurray schools were interested in understanding how other factors may influence these measurements. Therefore, in the survey, youth were also asked specific questions about their personal exposure to the wildfire and about the direct impact the wildfire had on their lives, including if they were present and witnessed the wildfire when it occurred, as well as if their own home was destroyed by the wildfire.We published an initial analysis  of the NThe current study presents an extended analysis of the Fort McMurray dataset, including an investigation of PTSD as well as examining the effects of severity of impacts from the 2016 wildfire experienced by different individuals on PTSD, depression, anxiety, alcohol/substance misuse, self-esteem, quality of life, and resilience.Based on previous research, our hypotheses were that more serious exposure to the wildfire and more direct impacts from the wildfire would have greater negative effects on youth\u2019s mental health. More specifically, we hypothesized that these youth would have higher risk of having clinically significant scores on measures of PTSD, depression, anxiety, and alcohol/substance misuse, while having lower scores on measures of self-esteem, quality of life, and resilience.th, 2017 (ethics protocol number Pro00072669).The two school boards in Fort McMurray\u2014Fort McMurray Public Schools and Fort McMurray Catholic Schools\u2014asked all students in Grade 7\u2013Grade 12 to complete a comprehensive survey of their mental health, in November 2017, 18 months after the 2016 wildfire. The survey was conducted to enable the school boards to evaluate the effectiveness of the programs that they put in place immediately following the wildfire  out of the survey if they desired. Students, themselves, had the option to participate or not in the survey, which was explained at the start of each survey data collection session  was a custom questionnaire assessing age, gender, the student\u2019s grade, and school.The Impact of Fire Questionnaire  was a custom questionnaire assessing the impact of the 2016 wildfire on the student, including whether they were present in Fort McMurray during the fire, whether they were evacuated, whether they personally saw the fire, and whether their home was destroyed.Child PTSD Symptom Scale  assesses symptoms of PTSD  and geneThe Patient Health Questionnaire, Adolescent version  assesses symptoms of depression and suicidality , 25 and The Hospital Anxiety and Depression Scale  assesses symptoms of anxiety  and geneThe CRAFFT Questionnaire  assesses symptoms of alcohol and substance misuse , 28 and Tobacco Use Questionnaire (2 questions) includes two questions on tobacco use: \u201cOver the past month: Do you smoke tobacco products? Do you use smokeless tobacco products?\u201dThe Rosenberg Self-Esteem Scale  assesses self-esteem  and geneThe Kidscreen Questionnaire  assesses quality of life  and geneThe Child and Youth Resilience Measure  assesses resilience to adverse experience or trauma  and genehttp://clojure.org).  Students either came to a computer laboratory or used laptops brought to their classroom, depending on their school. A survey description script was read to each class at the beginning of each survey session  Each participant used a laptop or desktop computer to fill in the survey. The survey website used an HTML/CSS front-end and a back-end server written in the Clojure programming language , depression (from PHQ-A), anxiety (from HADS), and alcohol/substance use disorder (from CRAFFT). We use the term \u201cprobable diagnosis\u201d because scores were based on self-report scales, not psychiatric clinical interviews, and scores on a specific scale are not clinically diagnostic. Nonetheless, existing literature reports good correspondence between psychiatric clinical diagnoses of PTSD, depression, anxiety, and alcohol/substance use disorder with probable diagnoses based on widely published cutoff scores for the above four scales , 32\u201335. We defined five pairs of subgroups from participants, namely: 1) no impact of fire vs. any impact of fire; 2) present during the fire vs. not present; 3) saw the fire in person vs. did not see it; 4) home destroyed by the fire vs. home not destroyed; and 5) high resilience vs. low resilience.No impact of fire vs. any impact of fire: The no impact of fire group was defined as those participants answering \u201cno\u201d to the following four questions: \u201cWere you in or near Fort McMurray during any part of the 2016 wildfire?,\u201d \u201cDid you evacuate because of the fire?,\u201d \u201cDid you see the fire in person?,\u201d \u201cWas your home destroyed by the fire?\u201d The any impact of fire group was defined as those participants who answered \u201cyes\u201d to any one or more of those four questions. Participants who did not provide an answer to all four questions were excluded from both the no impact of fire group and the any impact of fire group.Present during the fire vs. not present: The present and not present during the fire groups were defined as participants answering \u201cyes\u201d and \u201cno,\u201d respectively, to the question \u201cWere you in or near Fort McMurray during any part of the 2016 wildfire?\u201d Participants who did not answer that question were excluded from both groups.Personally witnessed the fire vs. did not see it: The personally witnessed the fire vs. did not personally witness the fire were defined as participants answering \u201cyes\u201d and \u201cno,\u201d respectively, to the question \u201cDid you see the fire in person?\u201d Participants who did not answer that question were excluded from both groups.Home destroyed by the fire vs. home not destroyed: The home destroyed vs. not destroyed by the fire groups were defined as participants answering \u201cyes\u201d and \u201cno,\u201d respectively, to the question \u201cWas your home destroyed by the fire?\u201d Participants who did not answer that question were excluded from both groups.High resilience vs. low resilience: Resilience was measured with the CYRM-12 questionnaire. High and low resilience groups were defined as participants whose CYRM-12 scores were, respectively, equal/above the median or below the median CYRM-12 score.For each of these five pairs of groups, we compared the following 15 measures: 1) mean CPSS score, 2) mean PHQ-A score, 3) mean HADS score, 4) mean CRAFFT score, 5) mean Rosenberg score, 6) mean Kidscreen score, 7) mean CYRM-12 score, 8) percent probable PTSD, 9) percent probable depression, 10) percent probable moderately severe depression, 11) percent suicidal thinking, 12) percent probable anxiety, 13) percent probable alcohol/substance use disorder, 14) percent tobacco use, and 15) percent any of four probable diagnoses. Details of groups are given above. Details of questionnaire scores and probable diagnoses are given above.  In analyzing data for a given measure , we included only those participants who provided answers for all questions in the relevant questionnaire or scale.5). Permutation testing is a nonparametric method, chosen for its robustness against non-normality. All tests were two-sided, two-sample tests, with a null hypothesis of no difference between the means of the two groups for the given comparison. In total, our analysis included 74 individual statistical tests. We addressed multiple comparisons using the Benjamini\u2013Hochberg method for false discovery rate (FDR) correction. This method computed a threshold of p = 0.027 for FDR correction. Effect sizes reported in tables are Cohen\u2019s d (mean difference divided by pooled standard deviation). We performed all analyses using in-house computer code in the Clojure programming language (http://clojure.org). The server for the questionnaire website was written in Clojure, and the server saved participants\u2019  questionnaire answers in Clojure data structures. It was therefore simplest to analyze the data in Clojure as well. In-house analysis code included data collating, sorting, filtering, and questionnaire scoring functions as well as the permutation testing and Benjamini\u2013Hochberg FDR algorithms, which are straightforward to implement. The code for statistical testing and FDR correction is available at http://github.com/mbrown/mrgbstats.Permutation testing was used for all statistical comparisons  or Catholic schools (52% of students) and who were attending their schools on the day the survey was conducted. Five public schools and two Catholics schools took part in the survey. In total, 3,252 students participated out of 4,407 students enrolled in both the public and Catholic systems in Grades 7\u201312. That is, a total of 72% of enrolled students participated in the survey. The results presented below are organized by comparison groups. For convenience, Of the 3,252 students who participated in the survey, data from 182 students were excluded due to one or more of the following exclusion criteria:Age less than or equal to 10 years.Age greater than or equal to 20 years.Inconsistent answers among the positive and negative questions from the Rosenberg questionnaire . There were 2,970 students for whom depression scores were available, and of these, 31% met criteria for probable depression (PHQ-A score \u2265 11), and 17% met criteria for probable depression of at least moderate severity (PHQ-A score \u2265 15). Of these 2,970 students, 16% exhibited suicidal thinking. Anxiety scores were available for 2,990 students, of whom 27% met criteria for probable anxiety (HADS score \u2265 11). Alcohol/substance use scores were available from 3,001 students, of whom 15% met criteria for probable alcohol/substance use (CRAFFT score \u2265 2). Tobacco use data were available from 3,011 students, and 13% exhibited tobacco use. Of the 3,070 students, 46% satisfied the \u201cany of 4 probable diagnoses\u201d criterion. .There were no statistically significant differences between the \u201cno impact of fire\u201d group and the \u201cany impact of fire\u201d group in 14 of the 15 measures compared Table 3.There were no statistically significant differences between the \u201cpresent in Fort McMurray during the fire\u201d group vs. the \u201cnot present\u201d group in 13 of the 15 measures compared Table 4.Comparison of participants who personally witnessed the fire vs. those who did not see the fire revealed significant differences in 13 of the 15 measures tested see Table 5.Participants whose homes were destroyed vs. not destroyed by the fire exhibited significant differences in 12 of the 15 measures tested see Table 6.The median resilience score (CYRM-12 score) across the 3,070 participants included in the statistical analysis was 48. High resilience was defined as having a CYRM-12 score of 48 or more, while low resilience was defined as having a CYRM-12 score of less than 48. There were significant differences between participants with high vs. low resilience scores on all 15 measures tested see Table 7.This study examined the impact of the wildfire on the mental health of youth in Fort McMurray, Alberta. The findings indicate rates of probable PTSD 37%), probable depression (31%), probable anxiety (27%), and probable alcohol/substance use disorder (15%) in the population of Grades 7\u201312 students in Fort McMurray, Alberta 18 months after the 2016 wildfire. By way of comparison with previous Canadian studies, the prevalence of probable diagnosis of PTSD in children has been reported as 15.5% ; prevale%, probabIt was anticipated that those students who had the greatest level of impact from the 2016 wildfire, in the form of personally seeing the fire (vs. not seeing it) or having their homes destroyed (vs. not destroyed), would have more frequent mental health symptomatology. The findings indicate that students directly impacted by the fire had significantly higher scores on scales measuring symptoms related to PTSD, depression, anxiety, and substance misuse. These students also had significantly lower scores for self-esteem, quality of life, and resilience. The findings indicate that students directly impacted by the fire had higher rates of probable PTSD, depression, anxiety, and substance use disorder and higher rates of suicidal thinking and tobacco use. These results suggest that mental health impacts are more severe with increased severity of impact from wildfire on the individual, in the form of personally seeing the fire or having one\u2019s home destroyed.Importantly, the findings also revealed an unexpected pattern in students who had no direct impact from the fire; that is, they were out of town during the fire for a variety of reasons or were not living in Fort McMurray during the fire. The scores on almost all scales and questionnaires for these students were very similar to those who had direct experience with any impact of the fire  in terms of mental health symptom scores, self-esteem, quality of life scores, and rates of probable diagnoses. These findings suggest that youth not directly impacted by the fire nonetheless experienced vicarious trauma as a result of the fire\u2019s large impact on the community, similar to secondary trauma experienced by first responders and researchers in post-disaster situations , 42. TheFinally, resilience also played an important role in the mental health of youth. Low resilience was linked with substantially more severe mental health impacts from the wildfire. Though we do not have survey data from Fort McMurray prior to the 2016 wildfire, we believe that having a higher baseline level of individual resilience prior to a disaster would have beneficial effects on youth\u2019s mental health. This is supported by previous research showing that higher resilience is associated with better mental health outcomes following disaster , 20, 21.In terms of interventions, there is often active discussion about whether to intervene in complete populations , even when only a subset of the population has issues, or whether is it better to be more focused  for those with the greatest need. The issue with the latter approach, however, is that it misses large numbers of individuals who have only mild or moderate symptoms. The approach we have previously advocated is a combined approach, and we have shown this to be successful , 44. NonThe results presented here are based on a large sample of 3,070 participants. One limitation of the study is that clinical measures were based on self-report questionnaires as opposed to clinical interviews. Conducting a full clinical interview with each participant would not have been feasible given the large sample size. It would have been useful to have data using the same questionnaire battery from the Fort McMurray student population from before the 2016 Wildfire. This would have allowed a before and after wildfire comparison with identical instruments. Instead, we have previously presented a comparison of the Fort McMurray mental health data with control data previously collected using a very similar battery in Red Deer, Alberta .In conclusion, the present results support existing findings that both youth and communities impacted by a wildfire, or similar major disaster, experience long-term mental health impacts. The present data extend this by examining all youth in grades 7\u201312 attending schools in Fort McMurray following the 2016 wildfire and identifying those groups who are most vulnerable and have the greatest risk. It is likely that providing additional assistance for all individuals to increase resilience, and also focusing on those with particularly severe wildfire impact, would be useful in terms of improving population mental health after a wildfire and other major disasters. Fort McMurray Public and Catholic Schools have put significant and ongoing work into establishing and maintaining mental health support programs for students in the aftermath of the 2016 wildfire. The findings presented here are consistent with the need for long-term mental health supports in disaster-affected communities such as Fort McMurray.The dataset analyzed in this study is available from the corresponding author on reasonable request.In November 2017, 18 months after the 2016 wildfire, the two school boards in Fort McMurray\u2014Fort McMurray Public Schools and Fort McMurray Catholic Schools\u2014asked all students in Grade 7\u2013Grade 12 to complete a comprehensive survey of their mental health. The survey was conducted to enable the school boards to evaluate the effectiveness of the programs they had put in place immediately following the wildfire. Researchers from the University of Alberta were asked to collaborate and provide assistance in designing the survey and analyzing the survey data. After the data were collected, the anonymized data were made available for analysis by the researchers from the University of Alberta. The analysis of the survey data was approved by the University of Alberta\u2019s Health Research Ethics Board on June 26th, 2017 (ethics protocol number Pro00072669).The survey included questions to determine demographics, mental health, resilience, personal exposure to, and direct impacts of the wildfire. All survey data were collected under the auspices and ethical guidelines of the two Fort McMurray school systems and were administered as part of their standard curriculum and as an ongoing assessment of the educational and support programs they had put in place after the wildfire. The selection of measurement instruments was determined by the school systems and was informed by the existing scholarly literature and findings. Parents and guardians were notified of the process by written letter 2 weeks prior to the administration of the survey in the schools, and they had the option to opt their child(ren) out of the survey. Students had the option to participate or not in the survey, and this was explained at the start of each survey data collection session. Survey participation was anonymous; participants were not asked for their names. This paper provides an analysis of the survey data that were collected from both school boards.Materials and Methods section, are shared with a separate manuscript by the authors .The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.CPSS, Child PTSD Symptom Scale; CRAFFT, CRAFFT Questionnaire (proper name of the questionnaire is CRAFFT); CYRM-12, Child and Youth Resilience Measure; EMPATHY, Empowering a Multimodal Pathway Towards Healthy Youth project; FDR, false discovery rate; HADS, Hospital Anxiety and Depression Scale; Kidscreen-10, Kidscreen Questionnaire; PHQ-A, The Patient Health Questionnaire, Adolescent version; PTSD, post-traumatic stress disorder; Rosenberg, Rosenberg Self-Esteem Scale."}
{"text": "A PubMed query run in June 2018 using the keyword \u2018blockchain\u2019 retrieved 40 indexed papers, a reflection of the growing interest in blockchain among the medical and healthcare research and practice communities. Blockchain\u2019s foundations of decentralisation, cryptographic security and immutability make it a strong contender in reshaping the healthcare landscape worldwide. Blockchain solutions are currently being explored for: (1) securing patient and provider identities; (2) managing pharmaceutical and medical device supply chains; (3) clinical research and data monetisation; (4) medical fraud detection; (5) public health surveillance; (6) enabling truly public and open geo-tagged data; (7) powering many Internet of Things-connected autonomous devices, wearables, drones and vehicles, via the distributed peer-to-peer apps they run, to deliver the full vision of smart healthy cities and regions; and (8) blockchain-enabled augmented reality in crisis mapping and recovery scenarios, including mechanisms for validating, crediting and rewarding crowdsourced geo-tagged data, among other emerging use cases. Geospatially-enabled blockchain solutions exist today that use a crypto-spatial coordinate system to add an immutable spatial context that regular blockchains lack. These geospatial blockchains do not just record an entry\u2019s specific time, but also require and validate its associated proof of location, allowing accurate spatiotemporal mapping of physical world events. Blockchain and distributed ledger technology face similar challenges as any other technology threatening to disintermediate legacy processes and commercial interests, namely the challenges of blockchain interoperability, security and privacy, as well as the need to find suitable and sustainable business models of implementation. Nevertheless, we expect blockchain technologies to get increasingly powerful and robust, as they become coupled with artificial intelligence (AI) in various real-word healthcare solutions involving AI-mediated data exchange on blockchains. In order to understand the utility and disruptive potential that blockchain technology offers, one must first review the fundamentals of the technology itself. Blockchain is a decentralised, immutable, and cryptographically secure distributed ledger technology (DLT), broadly used to eliminate the need for trust in data transfer, and well known for powering the Bitcoin cryptocurrency . Our goaThe distribution element of blockchain as a distributed ledger refers to the design of the system on which the blockchain is running  and the number of individuals or organisations that control or own said computers. DLTs are built on consensus utilising algorithms to find agreement among participants , data replication, and peer-to-peer P2P) networking. Decentralisation is a subset of distribution concerning ownership and control of the data on the system and decisions about the system itself  for up to $200 billion per year\u201d . EnsurinSubstandard, falsified, and counterfeit medications are often seen in developing countries, or those with low-income markets. The amount of medication importation also plays a role in the verifiable authenticity of the product, especially with a weak or nonexistent supply chain management system. However, the United States has also been on the receiving end of fraudulent medications. In response to the threat of obtaining more fake medications, the US has started to implement the Drug Supply Chain Security Act (DSCSA). Key requirements for supply chain management technologies compliant to DSCSA are product identification, product tracing, product verification, detection and response to non-standard medications, notification upon identifying a non-standard medication, and the ability to store relevant information including licensures, verification, and product information . BlockchWhile pharmaceutical supply chain management and integrity are incredibly important, safety and security of medical devices and supplies can also be improved through blockchain implementation. Devices including implanted cardiac pacemakers and medication pumps can be compromised and controlled. Blockchain technology can be implemented in this field by holding unique device identifiers for each medical device (a requirement by the US FDA (Food and Drug Administration) and the EU) and by keeping track and issuing firmware updates by utilising smart contracts. A partnership between Edinburgh Napier University, NHS  Scotland, and Spiritus Development is leading an effort to use blockchain technology to track medical devices through their lifecycle , 25. ThiBlockchain technology can improve supply chain management in a number of ways including: \u201c\u2026 reducing or eliminating fraud and errors, reducing delays from paperwork, improving inventory management, identifying issues more rapidly, minimising courier costs, and increasing consumer and partner trust\u201d , 26.A major benefit of blockchain technology is moving data ownership from institutions and corporations into the hands of the people who generated said data. This gives them control over who can see or interact with their data in any way. Not only does blockchain protect their data ownership, it also makes it easier to share data in a secure way while receiving benefits or payouts . Health Professor Andrew Lippman, associate director of the MIT Media Lab, recently spoke about MedRec at MIT Technology Review Conference. As he explained, full nodes act as the MedRec data server and maintain the blockchain. These nodes are themselves maintained by the entities generating data . Smart contracts define access and rights to data and is the \u201clanguage\u201d upon which the blockchain is defined. Patient wallets are how individuals interface with the blockchain. The wallets contain keys that provide access to the appropriate data , 14, 25.The MedRec blockchain sits somewhere in between the Bitcoin blockchain and a tradition database. In the Bitcoin blockchain, anyone can join and take part, which greatly increases complexity and expense to keep the chain running. MedRec restricts who can join the blockchain to medical providers and organisations. They run the full nodes, they maintain the data, and they keep the blockchain secure in a more efficient way than the Bitcoin blockchain could. The MedRec blockchain used to be maintained by medical researchers. As payment for maintaining the blockchain, they would gain access to random, anonymised health data for epidemiological research purposes. At the time of writing, MedRec has moved further to a proof of stake model. There are no transaction fees to move data around or use contracts. There is no coin that needs to be mined for transactions. It is maintained by the group of stakeholders made up by the healthcare organisations that take part in the MedRec blockchain.Claims processing has been identified as a target for blockchain disruption or enhancement, inclusive of streamlining preauthorisation submissions, health insurance claims adjudication, and eligibility management , 31. OneIn addition to the above-mentioned four major categories of blockchain use cases for healthcare, new categories are coalescing and individual use cases continue to emerge . These include, but are not limited to, public health surveillance , enhanciThe Internet of Things (IoT) is the foundation of the smart healthy cities and regions of today and tomorrow , 41. To Ellehauge  also expThe market for IoT devices and apps that negotiate with, and pay, each other for secure, safe operation and services, e.g., mobile and wearable devices that pay for public transportation , and autCitizen engagement in the crowdsourcing of geo-tagged data can be combined with augmented reality (AR) and blockchain technology (blockchain-enabled AR) in powerful new crisis mapping and recovery scenarios, e.g., in the production and real-time updating of an augmented crisis map for navigating a disaster-stricken area, in which geo-tagged AR objects providing critical contextual information and advice are superimposed onto the real world scene on user\u2019s smartphone . The crowdsourced data objects can be blockchain-validated, credited and rewarded .Implementation-wise, FOAM  is a gooAmong the challenges facing geospatial blockchain implementations today, there are three particularly pressing ones (besides the above-mentioned need for sustainable business models) upon which the future success and mainstream adoption of the technology will be hinging. These three challenges require careful consideration and innovative solutions  to address them. The first issue is interoperability, to have blockchains from different providers and services seamlessly talk to each other as appropriate . The secAt the time of writing, a PubMed query using the keyword \u2018blockchain\u2019 retrieved 40 indexed papers , a reflesecuring patient and provider identities;managing pharmaceutical and medical device supply chains;clinical research and data monetisation, e.g., \u201358;medical fraud detection;public health surveillance, e.g., by the US CDC (Centers for Disease Control and Prevention) for sharing public health data to help public health workers respond faster to a crisis ;enabling truly public and open geo-tagged data;powering many IoT-connected autonomous devices, wearables, drones and vehicles, via the distributed peer-to-peer apps they run, to deliver the full vision of smart healthy cities and regions; andblockchain-enabled augmented reality in crisis mapping and recovery scenarios, including mechanisms for validating, crediting and rewarding crowdsourced geo-tagged data, among other emerging blockchain use cases.Blockchain solutions are currently being explored for:Geospatially-enabled blockchain solutions exist today that use a crypto-spatial coordinate system to add an immutable spatial context that regular blockchains lack. These geospatial blockchains do not just record an entry\u2019s specific time, but also require and validate its associated proof of location, thus facilitating the accurate spatiotemporal mapping of physical world events.Blockchain and DLT have the potential to benefit all the above application areas and many more, but also face similar challenges as those faced by any other technology threatening to disintermediate legacy processes and commercial interests, namely the challenges of blockchain interoperability, security and privacy, as well as the need to find suitable and sustainable business models of implementation. Nevertheless, we expect blockchain technologies to get increasingly powerful and robust, as they become coupled with artificial intelligence (AI)  in vario"}
{"text": "Blockchain is a distributed, immutable ledger technology introduced as the enabling mechanism to support cryptocurrencies. Blockchain solutions are currently being proposed to address diverse problems in different domains. This paper presents a scoping review of the scientific literature to map the current research area of blockchain applications in the biomedical domain. The goal is to identify biomedical problems treated with blockchain technology, the level of maturity of respective approaches, types of biomedical data considered, blockchain features and functionalities exploited and blockchain technology frameworks used. The study follows the PRISMA-ScR methodology. Literature search was conducted on August 2018 and the systematic selection process identified 47 research articles for detailed study. Our findings show that the field is still in its infancy, with the majority of studies in the conceptual or architectural design phase; only one study reports real world demonstration and evaluation. Research is greatly focused on integration, integrity and access control of health records and related patient data. However, other diverse and interesting applications are emerging, addressing medical research, clinical trials, medicines supply chain, and medical insurance.  It firsThe blockchain is defined as a chain of blocks that are time-stamped and connected using cryptographic hashes. A block may contain transactions of many users and generally is publicly available to all users of the network. Additionally, each block contains the hash of the previous block and the transaction data, thus creating a secure and immutable, append-only chain. This chain continuously increases in length as each new block is being added in its end. The blockchain is organized in a peer-to-peer network  that conBased on the access and managing permissions, there are three types of blockchains: public, private and consortium blockchain. A public (or permissionless) blockchain is highly distributed and anyone can participate implementing a miner; this ensures maximum immutability, although limits efficiency due to consensus achieved collaboratively via the highly extended miner network. On the other end, in a private blockchain blocks are processed by miners of a single organization; immutability can be tampered with, but efficiency is maximized. A consortium (or federated) blockchain can provide the efficiency of a private one, while it combines a partially distributed miner network which includes nodes provided by selected organizations.https://en.bitcoinwiki.org/wiki/Blockchain_Projects_List, accessed on November 19, 2018). Blockchain infrastructures charge for each transaction a fee (known as \u2018gas\u2019) proportional to the computational burden that the execution will impose on the blockchain.A large number of blockchain technology frameworks exist ; publications not related to blockchain and publications not related to biomedical domain. When we were not able to discern the above information from the title or abstract, the paper was included for further study. The reviewers discussed their findings and agreed on a consolidated publication list.Subsequently, the two reviewers studied independently and in detail the full text of all the publications in the list retained after the first screening, in order to agree on a final list of papers related to blockchain technologies in biomedical domain. This final list was studied to identify and organize papers into three pools: (1) research papers; (2) reviews of any type; and (3) position papers. Papers in the first pool were included for this scoping review and further analyzed using the data charting approach presented in the following subsection. Papers in the second and third pool were retained for statistical analysis and further general reference.2.6A data charting form was developed jointly by the authors to determine which variables to extract. Subsequently, they independently charted the data and discussed the results. Minor discrepancies were resolved by discussion and a consolidated data chart was constructed (available upon request).-Year of publication: as this is stated in the citation exported by the database.-Source type: publication types considered include (a) journal paper; (b) conference proceedings paper; (c) magazine article; and (d) book chapter.-Article type: (a) research papers reporting novel applications of blockchain technologies in the biomedical domain; (b) reviews of any type ; and (c) position papers discussing general aspects of the field, but not reporting on novel research or systematically reviewing existing research.For each paper included in the list after the first screening, the following data items were extracted:-Application area: the specific biomedical area considered in the publication, e.g. health records, clinical trials, medicines, medical evidence databases, medical education.-Maturity of approach: using the following scale (a) research proposal of a novel blockchain application; (b) architectural design of a system or system component employing blockchain technologies; (c) implementation of a working prototype of the proposed blockchain system component, with details on the technical platforms and tools used; and (d) evaluation in the real setting.-Biomedical data: the type of data considered in the proposed blockchain application, e.g. medical health records, personal health records, consent forms, drug information, environmental data, location, medical evidence data, etc.-Reasons for using blockchain: to what end blockchain technology is exploited in each application, for example, access control, non-repudiation, data auditing, data provenance, data versioning and integrity.-Blockchain technology: the specific blockchain infrastructure (if any) used or proposed for the implementation, e.g. Bitcoin, Ethereum, Hyperledger Fabric, etc.For each research paper included in the scoping review, further data items where extracted in order to categorize the paper. Since we have not managed to identify another systematic or scoping review on the same topic and research questions, we opted for a topic-specific alternative for the classification of papers, as described in guidelines for systematic mapping studies in software engineering . The aut2.7We analyzed the overall results after the first screening to present an overview of existing literature in blockchain applications in the biomedical domain. Subsequently, we focused on literature presenting original research in order to identify the breath  and depth (maturity level) of existing research. The individual characteristics of each included publication are presented in tabular form. We have also computed and graphed summaries of charted data frequencies. Finally, we summarize and discuss scoping review finding for each of the identified application areas.33.1A total of 3647 abstracts were retrieved . After the first screening 3527 papers were excluded: 417 were not in English, 126 had no abstract, 50 were not scientific papers, 2917 were about blockchain technologies but not related to biomedical domain or they were not about blockchain technology at all. Thus, after the initial title and abstract screening, we retained 137 papers for further study. After removing 17 duplicates, 120 unique papers were identified for full paper analysis. During the second screening, 37 papers were further excluded as not relevant to blockchain applications in biomedical domain. From the remaining 83 papers, 5 papers were identified as reviews, 31 papers were identified as position papers, and 47 as research papers. The 47 research papers were included in the scoping review, while the reviews and position papers were retained for further study as papers related to blockchain applications in the biomedical domain. The source selection process is shown in Overall, 3% of the retrieved papers were found relevant to the topic of this study . Further analysis of the 83 papers related to blockchain applications in the biomedical domain shows that more than half (53%) are journal papers and around 41% are full papers in conference proceedings  present novel research; 37% are position papers presenting general discussions on the field and only 6% are reviews of different subdomains  or in conference proceedings. Journal papers were published in 13 different journals; only 4 journal titles have published more than one paper on biomedical applications of blockchain, namely Journal of Medical Systems (9 papers), Computational and Structural Biotechnology Journal (3 papers), IEEE Access (3 papers) and F1000 Research (2 papers). Conference papers were published in 19 different conference proceedings; only one conference proceedings title published more than one paper included in this scoping review, namely Studies in Health Technology and Informatics.https://www.goconqr.com).Based on the iterative identification of data charting keywords  used; a summary of data charted is shown in The most prevalent biomedical data type (81%) refers to medical data related to health records, including medical records (48%), personal biosensor data (22%), and personal health records (6%). The rest of proposed solutions consider diverse biomedical data types: clinical trial data (4%), biomedical database queries (4%), ambient measurements such as location and temperature (4%), and financial data (2%). A graph of frequencies for the different biomedical data types considered in the blockchain applications included in the scoping review is presented in Blockchain is employed to address several information security components . Most pa4Although several publications have presented an overview of blockchain applications in the biomedical domain, to the best of our knowledge this is the first systematic study covering a large part of the published literature in the biomedical domain. In particular, an earlier review of blockchain applications in 2017 identified some applications related to electronic and personal health care records ; the samMain findings of the scoping review show that blockchain technology has so far been proposed to address several security issues in a number of different biomedical applications as summarized in the following paragraphs.As defined by the International Organization for Standardization (ISO), electronic health records include any computer processable repository of information regarding the health status of an individual . AlthougBlockchains have been proposed to achieve integration of distributed personal health record segments in a unified personal health record ,52, ofteCritical appraisal of all health record related studies shows that main reasons for proposing blockchain technology in medical records relate to addressing long lasting medical record integration problems associated either with integrating record segments under a virtually common ledger (the blockchain) or providing a unified mechanism for controlling access to records or their segments. Another important application related to health records considers data integrity and unified logging of medical acts. However, we should note that very often there is a confusion of what data are put in the blockchain. Thus, in many cases, the blockchain is (mistakenly we believe) proposed to store the entire health record data, rather than used as is designed, i.e. to create a rigorous and tamper proof registry of data and of actions.Overall, blockchain applications in health records are at a rather initial stage of maturity. Less than half (42%) show some degree of implementation, which is limited to laboratory or simulation testing. No study presents a real-world demonstration or evaluation of the proposed solution. We anticipate that as technology matures and more industrial applications emerge, real world pilot demonstrations will help shape the field and will reveal the most suitable applications of blockchain in medical records. Indeed, in 2016, the Estonian Health and Welfare Information Systems Centre launched a project to create and secure a log file of all medical data processing activities in the national health record system using blockchain technology; the project, probably the first nationwide deployment, and is currently in pilot stages . The samThe recent trend of quantified self  brought A different, emerging field of blockchain applications in the biomedical domain refers to supporting research. One particular type involves clinical trials, where blockchain technology has been exploited in three different paradigms. A first application  involvesMedicines supply chain can potentially benefit from blockchain technology to store drug transaction data to immutably trace and track products from the producer to the consumer and thus combat counterfeit drugs ,55. AnotLimitations of this scoping review are linked to the literature databases included for publication retrieval. Our search considered some  of the most popular scientific literature indexing systems for information technology and biomedical research. Additionally, search was limited scientific literature, so applications described in grey literature might have been missed. Since the field is still in its infancy, our broad search based only on the term \u201cblockchain\u201d returned a manageable number of records for study. Considering the increasing popularity trends we have seen in this study, future repetitions of a similar scoping review would have to devise smarted search queries to narrow the retrieved records to blockchain applications in the biomedical domain.5In this paper we present the results of a scoping literature review into the current state of research in the application of blockchain technology in the biomedical domain. Our findings show that the field is still in its infancy. Research maturity of the papers included in this scoping review suggests that blockchain applications in the biomedical domain is still an emerging field. Yearly distribution of related publications supports this finding, showing that research activity in the field starts only in 2016 and is doubled during the first 8\u202fmonths of 2018, increasing at much higher rates than general position and concept papers in the same field.In this first 3\u202fyears, research is greatly focused on integration, integrity and access control of health records and related patient data. However, other diverse and interesting applications are emerging, addressing medical research, clinical trials, medicines supply chain, and medical insurance. As yet, blockchain has still to find its proper application paradigms, moving away from approaches that discuss storing actual health data chunks in the blockchain, to solutions that use the blockchain as a ledger storing mainly references to data or data hashes.Apart from identifying new, promising application areas, research should focus on real world evaluation based on large scale deployments that would highlight technology limitations and most likely indicate most suitable applications. Also, special attention should be drawn to privacy, which is not preserved by default in the common blockchain. One issue that is not fully addressed in current literature is the type of blockchain used, namely public, private or consortium. Only a few publications mention the specific type of blockchain used; even then, a proper justification is lacking. We believe that each different blockchain type has its own niche in biomedical applications and we expect that consortium blockchain (with carefully selected miner node owners) might prove the best solution to both guarantee high enough immutability and ensure required efficiency at a tolerable cost.It is evident that the field still has to find its own forum in the scientific publication realm. So far published literature is greatly scattered in different journals and conferences; the field could benefit from special issues in established scientific journals and dedicated workshops in biomedical conferences, and regular repetitions of similar scoping reviews.To conclude, this study can become a starting point for future research, demonstration and evaluation of blockchain applications in the biomedical domain, and also a guide for regular, systematic reviews of related research progress.European Commission FP7-ICT project CARRE (Grant No. 611140) and the corresponding Greek National Matching funds of the General Secretariat of Research and Technology (GSRT). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.This work was partly supported by the"}
{"text": "A blockchain is a system for storing and sharing information that is secure because of its transparency. Each block in the chain is both its own independent unit containing its own information, and a dependent link in the collective chain, and this duality creates a network regulated by participants who store and share the information, rather than a third party. Blockchain has many applications in healthcare, and can improve mobile health applications, monitoring devices, sharing and storing of electronic medical records, clinical trial data, and insurance information storage. Research about blockchain and healthcare is currently limited, but blockchain is on the brink of transforming the healthcare system; through its decentralized principles, blockchain can improve accessibility and security of patient information, and can therefore overturn the healthcare hierarchy and build a new system in which patients manage their own care. In the world of healthcare today, there are two major focuses that must be addressed: data security and data ownership. Sensitive medical records currently lack a secure structure, leading to data breaches with severe consequences. In 2018, the Department of Health and Human Services\u2019 Office for Civil Rights (OCR) received notifications of many data breaches that resulted in the exposure of 13 million total healthcare records [Blockchain technology may provide the answer.Invented in 2008 by Satoshi Nakomoto for the cryptocurrency Bitcoin, the technology offers a verifiable, permanent, and attack-resistant system for recording data . Next, tThis process involves using computation power to test random input strings until one produces an output string that meets the requirements. The first miner to succeed gets to add his block to the blockchain, thus completing the transaction, and the next round begins . BlockchMobile applications and remote monitoring machines are essential for patient care in today\u2019s technological age. Blockchain can be applied to these technologies and improve security and quality of machinery. For example, a group of researchers created and tested an mHealth  smart phone application for cognitive behavioral therapy for insomnia . The appFurthermore, another mobile application, called Healthcare Data Gateway (HGD), has been presented for organization of patient data . The appSecurity concerns are associated with mobile monitoring of healthcare, as patient health information is private and sensitive. Mobile malware has destroyed blockchain in the past, and the blockchain that controls mobile applications must be completely secure before it can be used to store health information. One study investigated root exploit, the most vicious type of mobile malware, and its interactions with blockchain . Root exMoreover, Logitboost was also found to predict root exploit in the Root Exploit Detection System (RODS) curated in the study. More studies need to investigate mobile health and remote monitoring security concerns to ensure that the blockchain can store patient information successfully within these types of devices.Blockchain technology can also be applied to the accessing and sharing of patient medical records. Medical records can be difficult to access because they are generally spread out across many different healthcare facilities, and blockchain can enable patients to have full and secure access to all of their records and medical history. A few systems based on blockchain have been proposed for organization of and access to patient medical records. MedBlock, a blockchain based information management system, enables efficient EMR access and retrieval through distributed blockchain principles . The impSimilarly, a blockchain based Data Preservation System (DPS) for medical data has been engineered . DPS useThis new cryptographic framework based on multiple levels of encryption maximizes security. Sharing of healthcare data in a secure way is also an integral part of healthcare. Zhang and Lin curated a patient information sharing plan, called a BSPP  scheme, that may improve diagnosis of patients in virtual health systems . Their sLikewise, Dubovitskaya et al.  created Blockchain technology has also been applied to clinical trials and, very recently, to medical insurance storage. Blockchains can easily detect fake information because of their transparency, and smart contracts in the blockchain can serve as security promoters for clinical trial data . These sWe propose a medical data management system using blockchain technology that is secure and allows patients to retain ownership over their own records while allowing hospitals to have easy access  contracts. Multisig requires multiple users, in this case the patient and the hospital, to both use their private keys to sign a transaction for authentication. This way, the patient cannot alter the record without permission of the hospital, but he still has control over who can access his record. A new swarm hash must be generated each time after the data has been accessed (since the old swarm hash is now known), so we add a \u201clast accessed\u201d timestamp. The change in the data will automatically change the swarm hash, which can then be secured once again until it receives the required permissions for access. This model not only provides the security and immutability provided by blockchain, but also offers a multisig solution to data ownership and accessibility.Although blockchains are extremely secure, they are by nature susceptible to a type of attack known as the 51% attack  . This occurs when a miner, or group of miners, controls over 50% of the total mining hash rate (computing power) in the network and becomes able to prevent new transactions or reverse completed transactions. By controlling over 50% of the computing power, the malicious user is able to form blocks at a faster rate than the rest of the network, and by the longest chain rule , the network is forced to switch to the attacker\u2019s desired chain. However, although 51% attacks are possible, the probability of a successful attack is extremely low, so blockchain remains one of the most secure forms of technology.EthereumPrice.org, 2019). The vast amount of transactions needed to be processed in hospital settings would amount to a sizable cost. However, the use of a blockchain system would replace current storage systems , personal medical records, disease registries, and other databases ) and eliminate costly data breaches and other errors, ultimately rendering the system cost-efficient.Another potential concern is the cost of implementing a blockchain system. When a transaction is requested, the user must pay for the computation. In the Ethereum network, the payment is calculated in \u201cgas\u201d and the gas is paid in \u201cETH,\u201d valued around $120 USD as of January 2019 (Because blockchain maximizes security and accessibility, the technology can be used in many different areas of the healthcare system, such as for storing and sharing medical records and insurance information both in healthcare venues and in mobile applications and remote monitoring systems, and for clinical trials. Research about blockchain\u2019s applications to healthcare is currently limited, but more research becomes available every day. Blockchain is one of the most active areas of software research currently, and it can change the hierarchy of healthcare by returning authority over medical records and health data to the patient. This transfer of authority may lead to an overall shift toward patient-centered care; the blockchain movement for patients is just beginning."}
{"text": "In their article entitled, \"Are high flow arteriovenous accesses associated with worsehaemodialysis\"-p value of 0.056.The authors are to be commended for conducting such a study and initiate a dialogue aboutthe impact of high flow fistulas on important dialysis parameters. Several investigatorshave provided the rationale for volume overload in patients with high flow fistulasversus 4 patients). Second, the confidence intervalis very large representing a small sample size. Third, the p value isslightly above significance (i.e. > 0.05). The evaluation of volume overload wasperformed by employing bioimpedance spectroscopy. From a clinical standpoint, volumeoverload is corrected by ultrafiltration. The authors do not provide information on theultrafiltration rate. In support of the study, it is worth pointing out that both normaland high flow fistulas received the same duration of dialysis therapy . Additionally, no informationis available on the weight gain for the high flow fistulas. It is conceivable that thehigh flow fistulas had a higher weight gain due to a higher fluid intake.While the study was a bold attempt, a few elements raise concerns regarding the findingsfrom both statistical and clinical standpoint. First of all, the sample size isextremely small (6 The study, however, raised important concerns about high flow fistulas including theircardiovascular impact. A large sample size should explore the volume overload in highflow fistulas to conclusively establish their adverse impact on volume status. In themeantime, in an effort to avoid high flow fistulas, we suggest an opinion-basedalgorithm as shown in"}
{"text": "The laying performance of hens plays a major role in the production of laying hens because it determines the economic benefits of farmers. Indole-3-acetate sodium is a derivative of indole-3-acetate (a major plant growth hormone). This study shows that indole-3-acetate sodium inclusion in diets improved the serum reproductive hormone levels and egg production performance of Danzhou chickens. We found that indole-3-acetate sodium could be considered as an effective feed additive to improve the laying performance of hens, but more comprehensive studies need to be performed in the future.p < 0.05) and egg yolk ratio (0.05 < p < 0.1), but also significantly reduced the feed:egg ratio (p < 0.05). In addition, the dietary supplementation of IAA-Na significantly increased the serum estradiol levels (p < 0.05) and decreased serum alkaline phosphatase activity (p < 0.05). Compared with the control group, the addition of IAA-Na to the diet had no significant effect on the intestinal tissue morphology or serum antioxidant capacity of Danzhou chickens. This study preliminarily provides evidence that dietary IAA-Na can improve laying performance, indicating that IAA-Na is a potentially effective feed additive for laying hens, but further studies are required before arriving at definite conclusions.This study was conducted to investigate the effects of indole-3-acetate sodium (IAA-Na) inclusion in diets on the egg production performance, egg quality, intestinal tissue morphology, serum hormone levels and biochemical parameters of Danzhou chickens to preliminarily explore the efficacy of IAA-Na as a feed additive. A total of 192 Danzhou chickens (50 weeks old) were randomly assigned to 2 groups of 96. The diets for the treatment group consisted of the basal diets, supplemented with IAA-Na (200 mg/kg). The formal feeding trial lasted for four weeks. The results showed that the feed supplemented with IAA-Na not only increased the laying rate ( Eggs are an important source of nutrients for humans. Although egg production is one of the most efficient industries in animal production nowadays, there remains great potential for further advancement. Therefore, improving the health status of poultry, improving laying performance and prolonging the peak production period have become a research field of great concern. A large number of antibiotic growth promoters are being used on laying hens to reduce the occurrence of diseases and improve the performance of laying hens . HoweverThe effects of plant hormones on various aspects of plant growth and development have been widely studied and commercialized. Previous studies have shown that plant hormones, such as gibberellin  and daidThe aim of this study was to test the effects of dietary IAA-Na supplementation on the laying performance, egg quality, ovary tissue morphology, intestinal tissue morphology, serum biochemical parameters and hormone levels of Danzhou chickens, as well as provide a theoretical basis for developing IAA-Na as a potential feed additive.All procedures and the use of animals in this experiment were carried out in accordance with the Hunan Normal University Animal Ethics Committee guidelines (AEC number 2019/230).A total of 192 Danzhou hens (50 weeks old) housed in wire cages were randomly allotted to 2 groups of 96. Each group was further divided into six replicate blocks of 8 cages with 2 hens per cages. The diets for the treatment group consisted of basal diets  supplemeThe health condition and laying performance were assessed daily. At the end of the trial, a single healthy laying hen was randomly selected from each group replicate, with 6 in each group, for a total of 12 hens, which were then sacrificed. Blood samples were collected from the axillary vein into vacuum tubes containing coagulant. After centrifugation, serum was collected and stored at \u221280 \u00b0C. The intestinal samples were fixed with a 4% formaldehyde-phosphate buffer and stored at room temperature for histological examination. Specimens of cross-sections of the intestinal segments were embedded in paraffin wax. The samples were then sectioned to a thickness of 5 mm and stained with hematoxylin and eosin. All tissue sections were determined under a microscope, using an image processing and analysis system . The villus height (VH), crypt depth (CD) and villus width (VW) of each intestine were measured by Program Image-pro Plus 6.0.Egg production as well as the egg mass and feed intake were recorded to calculate the average total egg weight, average laying rate, average daily feed intake (ADFI) and feed:egg ratio (grams of feed consumed per gram of egg) during the first two weeks after the formal experiment. At the end of the second week of the trial period, two eggs were randomly selected from each repetition to evaluate the egg quality and cholesterol content. The cholesterol content of the egg yolk was determined using a kit from the Nanjing Jiancheng Institute of Biological Engineering.An automatic biochemical analyzer was used to detect the serum biochemical indicators of the laying hens, including the total cholesterol (TC), high-density lipoprotein (HDL), low-density lipoprotein (LDL), total protein (TP), albumin (ALB), alanine aminotransferase (ALT), as well as the aspartate aminotransferase (AST) and alkaline phosphatase (ALP) activity and the triglyceride (TG), glucose (Glu), calcium (Ca) and urea nitrogen (BUN) contents. The total antioxidant capacity (T-AOC), catalase activity (CAT), superoxide dismutase activity (SOD) and malondialdehyde (MDA) contents in the serum were assayed by using commercial kits . The concentrations of the serum hormone parameters, including estradiol (E2), follicle-stimulating hormone (FSH) and luteinizing hormone (LH), were also assayed using Nanjing Jiancheng Bioengineering Institute assay kits .p \u2264 0.05 and highly significant at p \u2264 0.01, unless otherwise stated.Data analyses were performed by an independent-sample T-test using SPSS 20.0. Data were presented as means with a standard error (means \u00b1 SEM). Differences were considered as statically significant at p < 0.05), but also significantly reduced the feed:egg ratio (p < 0.05).The laying performance of hens plays a major role in the economic benefits of farmers. As shown in p < 0.1). The ratio of the egg yolk is known as an important indicator to measure the nutrition of eggs, and increasing the ratio of egg yolk is equivalent to increasing the overall nutritional level of eggs [Eggs are an important source of nutrients for humans, and it is well known that their composition can be modified through the manipulation of laying hen diets . As show of eggs .Antioxidative stress is one of the important factors affecting the performance and egg quality of laying hens. As shown in p < 0.05) and trended to significantly increased LH levels (0.05 < p < 0.1). However, there was no significant difference in the serum FSH concentrations. The variation of laying rates was mainly determined by the hypothalamic\u2013pituitary\u2013gonadal axis [The serum hormone level has been considered a sensitive indicator of laying performance . As showdal axis ,22. Prevdal axis . The impdal axis . It was p > 0.05) in the p < 0.05). The relationship between serum ALP and egg production remains obscure. The opposite relationship between dietary Ca and serum ALP has been revealed [Biochemical indicators in the blood can be used to display the health status of hens. No significant differences in ALB, AST, TP, BUN, TG, CHOL, HDL, LDL, GLU, ALB or Ca were found among the treatment group and the control group (revealed . The serrevealed . The valThe dietary IAA-Na had no significant effect on the intestinal tissue morphology and structure of Danzhou chickens .This study was conducted to investigate the effects of IAA-Na inclusion in diets on the egg production performance, egg quality, intestinal tissue morphology, serum hormone levels and biochemical parameters of Danzhou chickens. The results showed that the feed supplemented with IAA-Na had significant beneficial effects on the laying rate and the secretion of reproductive hormones. According to our findings, IAA-Na may be considered as a potential feed additive to improve the laying performance of hens. However, since this experiment is preliminary an exploration experiment with a relatively short experimental period, a longer experiment period and larger scale experiments need to be performed in the future."}
{"text": "We aimed to investigate if the effectiveness of Gla\u2010300 is reproducible in real\u2010world settings.Randomized controlled trials have shown that insulin glargine 300\u00a0U/mL (Gla\u2010300) has a more stable and prolonged glucose lowering effect among patients with type 2 diabetes (T2DM) compared to insulin glargine 100\u00a0U/mL (Gla\u2010100), resulting in a reduced risk of hypoglycaemia while maintaining a similar efficacy of lowering HbA1c levels, body weight and insulin dose were calculated from baseline period and over a follow\u2010up period of 180\u00a0days. Documented hypoglycaemia events were also explored.In this retrospective cohort study, data from a large state\u2010mandated health organization were used to identify adult T2DM patients who were previously on insulin and initiated Gla\u2010300 therapy between 6/ 2016 and 12/2017. Changes in HbA1c was 8.7\u00a0\u00b1\u00a01.6% and 42.5% were females. Among all patients with HbA1c measurement during follow\u2010up (n\u00a0=\u00a01508), HbA1c was significantly reduced by \u22120.6%  from baseline, with a significant reduction in body weight .A total of 1797 patients were included in this study with a mean age of 64.2 (SD\u00a0=\u00a0\u00b111.0y), baseline HbAP\u00a0=\u00a0.04) reduction of 40.5% in patients with hypoglycaemia events was recorded during follow\u2010up period, from 2.1% (n\u00a0=\u00a037) at the baseline period to 1.2% (n\u00a0=\u00a022).Additionally, a significant (This real\u2010world study supports evidence from RCTs regarding the effectiveness of Gla\u2010300 among T2DM patients by improving glycaemic control. In this real\u2010world study, the effectiveness and safety among 1797 type 2 diabetes patients were investigated. The article provides evidence that insulin glargine 300 is effective in reducing blood glucose levels without increasing body weight or hypoglycaemic events. This insulin is a new formulation of insulin glargine with a more stable and prolonged glucose lowering effect compared to insulin glargine 100\u00a0U/mL .In June 2016, insulin glargine 300\u00a0U/mL  decreasing the risk of hypoglycaemia for nocturnal hypoglycaemia events in patients with T2DM between 6 and 12\u2010month post\u2010treatment period in patients previously on basal insulin In the EDITION randomized clinical trial programme, glycaemic control and hypoglycaemia were evaluated by comparing the efficacy and safety of Gla\u2010300 versus Gla\u2010100 insulin in patients with T2DM. Gla\u2010300 was demonstrated its efficiency by lowering HbAFurthermore, in the head\u2010to\u2010head BRIGHT RCT, a 24\u00a0weeks treatment of Gla\u2010300 was compared to insulin degludec (IDeg) and demonstrated similar glycaemic control improvement, where Gla\u2010300 showed lower hypoglycaemic events during titration period.1c following 6\u00a0months of treatment with Gla\u2010300 insulin.Recently published real\u2010world retrospective and prospective evidence studies showed a significant reduction in HbAThe aims of this study are therefore to investigate the effectiveness and safety of a longer basal insulin, Gla\u2010300, in a real\u2010world setting to assist patients, clinicians and health care systems in making informed decisions on effective care and treatment for T2DM patients.22.1The study utilized de\u2010identified data from the Maccabi Healthcare Services (MHS) central computerized database, the second largest state\u2010mandated health provider in Israel, serving more than 2.2\u00a0million (25% of the population) members and is a representative sample of the Israeli population. This fully computerized database captures all information on patient interaction . Based on this information, MHS had developed daily updated registries for major chronic diseases, such as hypertension, cardiovascular diseases and diabetes in order to improve disease management and quality of care for MHS members. More than 180\u00a0000 patients were accounted for based on medication dispenses, laboratory measurements and diagnoses and defined as having diabetes. Specific inclusion criteria for the diabetes registry are available and are described elsewhere.2.21c measurement (last measurement within 180\u00a0days prior to index date). Patients who were not on insulin during baseline period were excluded from main analysis and were briefly described in the results. Baseline period was defined as 180\u00a0days prior to the index date and follow\u2010up period was defined as 180\u00a0days afterwards. Patients with continuality of less than year in MHS defined as having T1DM or with indication of pregnancy between 9\u00a0months prior to index date and 9\u00a0months after to end of study were excluded. Discontinuation was defined as the first time having a gap larger than 90\u00a0days between two dispenses dates, taking into account cover days.In this noninterventional retrospective cohort study, we identified adult MHS members (ages\u00a0>\u00a018\u00a0years) who initiated treatment with Gla\u2010300 from 1 June 2016 until 31 December 2017 (was defined as the index date), included in diabetes registry prior to index date and treated with Gla\u2010300 for at least 180\u00a0days. Additional inclusion criterion was having a baseline HbAReported hypoglycaemic events were based on any diagnoses documented through the MHS database and recorded per outpatient visitation or per hospitalization when necessary.Approval was obtained from the Institutional Review Board (IRB) and Ethics Committee of MHS for the purposes of accessing and analysing the data. Individual patient informed consent was not required because of the anonymized nature of the patient records.2.31c levels, blood lipids, antihyperglycaemic regimen and comorbidities (based on including in MHS registries prior to index date). Anthropometric measurements and laboratory measurements were defined as last measurement during baseline period, while antihyperglycaemic regimen was defined as having at least 1 medication containing the specific ingredient. Cardiovascular disease, hypertension CKD stage and cancer comorbidities were based on our highly validated chronic registries, while revascularization procedure (coronary artery bypass graft and percutaneous coronary intervention) was based on procedures conducted during baseline period.Study population was characterized at baseline and presented by patients' demographics, anthropometric measurements, HbAInternational Classification of Diseases version 9 (ICD\u20109) codes: 251.0, 251.2, 962.3) during baseline and follow\u2010up periods were evaluated. Changes in HbA1c, weight and BMI were evaluated from baseline (last measurement during baseline period) and follow\u2010up measurement (closest measurement within 180\u00a0\u00b1\u00a090\u00a0days after index date). Changes in insulin dosage  were evaluated from baseline period and follow\u2010up period and during follow\u2010up period (0\u201090 and 91\u2010180\u00a0days after the index date) among patients who were on insulin for at least 180\u00a0days prior to index date. The daily insulin dosage was evaluated by using information on actual dispenses, which included data on the amount of insulin dispensed in specific time frames.Differences in documented hypoglycaemia (based on recorded 2.4d) was calculated to assess the magnitude of change between baseline and follow\u2010up period as follows:Descriptive statistics for all baseline characteristics were presented as mean and standard deviation (SD) for continuous variables and as counts and percentages for categorical variables. For continuous variables, statistical analyses were performed by using the t test, or Wilcoxon\u2010signed rank test, as appropriate. Same procedures were used to compute means and percentages in the various subgroups of patients, as defined in the protocol. Standardized mean difference effect size  from 8.7\u00a0\u00b1\u00a01.6 to 8.1\u00a0\u00b1\u00a01.4. Higher reduction was observed among patients aged less than 65, patients with higher levels of baseline HbA1c and among patients who were on insulin for less than 5\u00a0years  and \u22120.1 , respectively).There were 1206 patients with valid body weight measurement during baseline and during follow\u2010up. Among them, statistical significance changes in body weight and in BMI were observed . When stratifying population by time on insulin, trends were similar; however, results were not statistically different. Among patients on insulin for <5\u00a0years prior to index date, six patients (7.8 per 1000) were reported with hypoglycaemic events during follow\u2010up compared to the 11 patients (14.3 per 1000) at baseline (P\u00a0=\u00a0.225). For those who were on insulin for over 5\u00a0years prior, 16 patients (15.6 per 1000) reported hypoglycaemic events at follow\u2010up in comparison with 26 (25.3 per 1000) at baseline (P\u00a0=\u00a0.096).During the study follow\u2010up period, a total of 22 patients reported hypoglycaemic events (12.2 per 1000) compared to 37 patients (20.6 per 1000) during the baseline period, representing a 40.5% reduction . Among these patients, the insulin daily dosage was increased during baseline and follow\u2010up periods by 7.8  and 0.3  units for basal and other insulin (mainly fast acting insulin), respectively. During the follow\u2010up period, both basal and other insulin (mainly fast acting insulin) dosage were decreased by \u22123.8  and \u22121.0  units per day for basal and other insulin, respectively, starting from the first 90\u00a0days of treatment initiation and then following 90\u00a0days after  in HbA1C and an increase of 1.1\u00a0kg  in body weight were observed. No reported hypoglycaemia events were reported during baseline and follow\u2010up periods.An additional 607 patients were excluded from the main analysis as they were insulin na\u00efve and therefore were evaluated separately. Their mean (SD) age at index date was 63.3\u00a0\u00b1\u00a012.4\u00a0years, 42.7% were female, and 57.0% were included in the diabetes registry for more than 10\u00a0years. At baseline, HbA41c levels and in reported hypoglycaemia events, with no increase in patients' body weight.The results of this real\u2010world data analysis indicate that treatment with Gla\u2010300 is associated with a significant reduction in both HbAAdherence to insulin therapy is critical to manage T2DM and to reduce the risk of complications. In an international cross\u2010sectional web survey of people with T2DM, those who discontinued treatment with basal insulin reported weight gain (48.4%) and hypoglycaemia 25.8%) as the main reason for discontinuation..8% as thOur study results are in accordance with a recent US study where severe hypoglycaemic events were up to 30% lower for a group patients who switched to Gla\u2010300 in comparison with first generation basal insulin analogues (Gla\u2010100 and detemir), where rates were similar with IDeg and Gla\u2010300 patient groups.1c levels, it was associated with a lower risk of glycaemic events, and it demonstrated no weight gain (participants in the Gla\u2010100 group had an average of 0.66\u00a0kg gain). 1c levels from the baseline period compared to the follow\u2010up period.A continued issue of the previously mentioned study was also published where researchers identified both daytime and nocturnal hypoglycaemic episodes with two comparison groups. The results indicated that Gla\u2010300 was just as effective at Gla\u2010100 in lowering HbA1c levels.In comparison with these results, a similar retrospective observational study suggested that patients switching to Gla\u2010300 from different basal insulin had significant lower daily doses of basal insulin, fewer hypoglycaemic events and significantly lowered HbA1c, body weight and reported hypoglycaemia events observed during follow\u2010up period were solely due to the larger Gla\u2010300 dosages or other concurrent factors. Another limitation in our study is lower amounts of hypoglycaemic events were observed compared to other research. This occurrence may be related to the fact that MHS data may not have a complete representation of all hypoglycaemic events that occurred; some events may not have been accounted for by patient reports.The study enjoys several strengths including a relatively large study population, no loss to follow\u2010up, cohort study design and a systematic data collection including data on repeated lab results, clinical history and purchased medications. Some limitations should be also discussed. In the current analysis, we did not have a comparison group; therefore, we are unable to assess if the changes in HbAA third limitation is therefore a potential surveillance bias where patients put on new insulin are more likely to attend clinician offices and report hypoglycaemic episodes. However, such bias would have resulted in an increase in hypoglycaemia rate during follow\u2010up period. Furthermore, our last limitation is the calculated dosage form of insulin based on purchases; we do not know the exact amount of insulin injected to the patients, but there was access to the amount dispensed at baseline and at follow\u2010up periods. From this information, the daily dosage of insulin was calculated.In conclusion, this real\u2010world study corroborates the findings of previous RCTs demonstrating the effectiveness and safety of Gla\u2010300 insulin among patients with T2DM.This work was funded by Sanofi. Cheli Melzer Cohen, Tamar Banon, Varda Shalev and Gabriel Chodick have nothing to declare.CMC, TB, VS and GC contributed to the development of the study concept, study design and interpretation of the data. CMC contributed to data collection and analysis. CMC, TB and GC contributed to writing the manuscript. VS contributed to the critical review and revision of the manuscript. All authors approved the final version and agreed to be accountable for all aspects of the work."}
{"text": "Nature Communications 10.1038/s41467-019-11181-1, published online 19 July 2019.Correction to: The original version of this Article contained an error in Fig.\u00a05 and Supplementary Fig. 12, in which the colours of the bar plots at the top of the heatmaps were incorrectly given, leading to incorrect mapping of the plots to the corresponding dataset based on the dataset legend. which replaces the previous incorrect version:This has been corrected in both the PDF and HTML versions of the Article.The correct version of Fig.\u00a05 is: which replaces the previous incorrect version:. The HTML has been updated to include a corrected version of the Supplementary Information.The correct version of Supplementary Fig. 12 is:"}
{"text": "Nature Communications 10.1038/s41467-020-17051-5, published online 3 July 2020.Correction to: ZCCHC12, +Y: EIF1AY, \u2212X: GABRA3, +21: PCP4, -22q11: MAPK1, -11p13: TRIM44.\u201d The correct version states \u201cFor example, the most extreme ranking CNV region gene relative to anatomical change in each CNV was: +X: ZCCHC12, +Y: EIF1AY, \u2212X: GABRA3, +21: PCP4, -22q11: SLC7A4, -11p13: TRIM44.\u201dThe original version of this Article contained an error in the \u201cResults\u201d section, which incorrectly read \u201cFor example, the most-extreme ranking CNV region gene relative to anatomical change in each CNV was; +X: The original version of this Article contained an error in the \u201cResults\u201d section, which incorrectly read \u201cMS increases in VCFS syndrome (-22q11) and MAPK1 expressing inhibitory neurons.\u201d The correct version removes this sentence.The original version of this Article contained an error in Figs.\u00a01b and\u00a02d.y-axis range was 0e+00 to 3e\u221204, the x-axis range was \u22123000 to 3000, and the values for the PRAND-Trans and PRAND-Cis were 0.0094 and 0.0018, respectively.In the original version of Fig.\u00a01b, the graph next to the Chr22 schematic reported the following: the The correct version of Fig. 1 is:which replaces the previous incorrect version:y-axis reported the following class of cells: OPC, Oligo, Neuro-In, Endo, Astro. Among the reported genes in the plot, MAPK1 is included.In the original version of Fig.\u00a02d, the The correct version of Fig.\u00a02 is:which replaces the previous incorrect version:All the errors above have been corrected in both the PDF and HTML versions of the Article.The original version of the Supplementary Information associated with this Article included an incorrect Supplementary Data 1 file, in which the CVN genes tab, column A (del22q11.2) reported 20 genes in total: DGCR6, PRODH, STK22B, ES2EL, GSCL, SLC25A1, ZDHHC8, RANBP1, HTF9C, DGCR8, T10, ARVCF, COMT, TBX1, GP1BB, UFD1L, HIRA, SNAP29, TMEM191A, MAPK1.The HTML has been updated to include a corrected version of Supplementary Data 1; the original incorrect version of Supplementary Data 1 can be found as Supplementary Information associated with this Correction.Supplementary Data 1"}
{"text": "Nature Communications 10.1038/s41467-020-15560-x, published online 20 April 2020.Correction to: The original version of this article contained several errors, listed below, resulting from an update to the Y chromosomal haplogroup assignments during the final revisions. These do not affect the results or conclusions of the work. which replaces the previous incorrect version: This has been corrected in both the PDF and HTML versions of the article.The original version of this article contained an error in Fig. 4, several labels of \u2018Y na\u2019 have now been replaced by \u2018Y\u2019 in the corrected figure, the colour of \u2018mt\u2019 has also been changed in the corrected figure. The correct version of Fig. 4 is below: The original version of the Supplementary Information associated with this article contained an error in Supplementary Note The original version of the Supplementary Table 5 in the Supplementary Information had several errors in column 16, as well as an error in column 9 (line 15). A line has also been added on line 31. The HTML has been updated to include a corrected version of the Supplementary Information; the original incorrect version can be found as Supplementary Information associated with this Correction.The original version of the Supplementary Data 1 file contained several errors in columns G, H and X. The HTML has been updated to include a corrected version of Supplementary Data 1; the original incorrect version of Supplementary Data 1 can be found associated with this Correction.Supplementary Information"}
{"text": "Researchers have begun delivering mindfulness and aerobic exercise training concurrently on the premise that a combination intervention will yield salutary outcomes over and above each intervention alone. An estimate of the effect of combination training on chronic psychosocial stress in a nonclinical population has not been established. The objective of this study was to establish protocol feasibility in preparation of a definitive RCT targeting healthy individuals, and to explore the preliminary effect of combination training on reducing chronic psychosocial stress in this population.Twenty-four participants were allocated to a single-arm pre-post study and subjected to 16 weeks of concurrent mindfulness psychoeducation and aerobic exercise training. Feasibility criteria were collected and evaluated. Within-group changes in chronic psychosocial stress, mindfulness, emotion regulation, and cardiorespiratory fitness were also assessed. Primary analyses were based on 17 participants.dpretest = \u22120.56, 95% CI ). With regard to secondary measures, there was an increase in the use of cognitive reappraisal, and a reduction in use of maladaptive emotion regulation strategies. We are insufficiently confident to comment on changes in mindfulness and aerobic capacity Retention rate, response rate, recruitment rate, and sample size analyses indicate a definitive trial is feasible for detecting most effects with precision. There was also a decline in our primary dependent measure of chronic psychosocial stress . Retrospectively registered December 9, 2019.ANZCTR . A growing body of research has implicated psychosocial stress with a range of deleterious health outcomes. At an individual level, this includes a greater incidence of depressive symptoms, anxiety, and a decline in wellbeing , 2, as wFew studies have examined the effect of combining aerobic exercise and mindfulness-based training on mental health outcomes. To our knowledge, an estimate of the range and direction of the effect of a combination intervention on chronic psychosocial stress in a nonclinical population, specifically, is also absent from the literature. This pilot and feasibility study was conducted to guide future research on combination training with respect to its effect on chronic psychosocial stress, as well as its potential mechanisms. To this end, we conducted a single-arm pre-post study in preparation for a future randomized controlled trial (RCT). This study comprised an aerobic exercise and mindfulness-based intervention delivered concurrently over 16 weeks, and was designed as a prevention-focused intervention to be used by healthy individuals rather than those presenting with specific mental health risk factors. In the following sections, we discuss the evidence and theorized mechanisms that link mindfulness, aerobic exercise, and combination training to salutary mental health outcomes. We conclude with our study rationale.Mindfulness is a mental practice that draws on contemplative traditions and evidence-based research, and which has been adopted as a therapeutic approach to promote mental and physical health . In a cld, reported in each publication). This includes a reduction in psychosocial stress , anxiety , and depressive symptoms  ) ) ) . There i \u22120.76]) .Aerobic exercise can be implicated in improvement in cardiorespiratory fitness, which in turn is associated with widespread physiological effects that enhance cardiovascular health. For example, this includes improved glucose tolerance, reduced low-grade chronic inflammation, and a lower prevalence of hypertension . With reSelf-reports of physical activity are a subjective construct that measure behaviors that may be associated with cardiorespiratory fitness. These constructs are often implicated in a reduction in psychosocial stress and the prevalence of stress-related disorders , 25. HowIn the exercise physiology literature, two objective measures include maximal aerobic capacity  economy , 27. \\dol health , 29, whil stress . MeanwhiImprovements in mental health outcomes are often observed in interventions that make use of mindfulness in combination with physical activity . One recUnfortunately, such studies tend to examine physical activity broadly, rather than through structured aerobic exercise conducted at a frequency and intensity sufficient to maintain or improve cardiorespiratory fitness. For example, in the above study, physical activity comprised a combination of (unspecified) aerobic and strength exercises. The authors also relied on a subjective measure of intensity  rather than objective assessments via One exception is mental and physical (MAP) training: an intervention involving focused-attention meditation in combination with aerobic exercise   and wave 2 . Recruitment was conducted across a 1-month time period prior to the intervention period of each wave. Pre-test (T0) and post-test (T1) measures were obtained 1 to 4 weeks prior to and after the intervention period. Participants were predominantly postgraduate and undergraduate students from a variety of disciplines, and these periods were selected to correspond to low-stress periods in the academic calendar . Responses to self-report measures were collected online via Qualtrics , and assessments of cardiorespiratory fitness were collected in an exercise laboratory at Monash University. Descriptions of each assessment are provided in the \u201cThis study was conducted across two waves: wave 1  pregnancy or suspected pregnancy. All participants reported no engagement in regular running training or meditation practice within 6 months prior to the first assessment.Participants self-selected into the study by responding to an advertisement posted to online community groups based in Melbourne, Australia. These advertisements described the study as a mental and physical training program for stress management. Young adults between the ages of 18 and 35 years were targeted to reduce age-related variance in assessment responses, and because this age group was considered less likely to experience an adverse exercise-related incident. Exclusion criteria were as follows: (1) age not within 18\u201335 years, (2) prior completion of an endurance event equivalent to a half-marathon (21.1 km), (3) prior completion of a formal meditation program, (4) current diagnosis of a neurological or mental disorder, (5) current diagnosis/history of chronic pain or musculoskeletal conditions, (6) current diagnosis/history of chronic disease of any kind, (7) current diagnosis of a heat or cold disorder, (8) current use of medication that influences the neuroendocrine or immune system, (9) current injury of any kind , (10) current diagnosis of an infectious disease, (11) BMI \u2265 30 kg/mPilot study methodologists suggest that 15\u201320 participants per cell of a pilot research design can provide a reasonable estimate for most medium to large standardized effects as defined by Cohen , withoutThe training program involved a mindfulness-based intervention (MBI) and aerobic exercise training program completed concurrently over a period of 16 weeks. Each component of the program is described in detail in Briefly, the MBI comprised eight group psychoeducation and reflection activity sessions (55 min each) and formal focused-attention meditation practice . All group training sessions followed a similar structure  Table 1 The exercise program comprised three runs per week over 16 weeks following a half-marathon training schedule  Table 3,http://connect.garmin.com).Adherence requirements for the MBI were that participants attend at least 50% of the group psychoeducation sessions and complete at least 50% of the formal meditation target . Compliance was monitored through attendance records and self-report of formal practice in an online spreadsheet . Adherence requirements for the exercise program were that participants complete at least 50% of all prescribed running sessions . Additional measures of dosage included total running distance (km), total running time (h), and mean exercise intensity  individuals reported a mean dropout rate of 17.0% . HoweverThis measure was quantified as the percentage of participants providing full pre-test (T0) and post-test (T1) data points across the study. An assessment response rate of 95% for our primary dependent variable  was considered an acceptable criterion to recommend proceeding with a definitive trial.n = 80 per trial). This meant that the total maximum number of participants across 10 trials would be n = 200 per treatment arm .Recruitment rate was quantified as the percentage of all applicants who satisfied the inclusion criteria and agreed to participate. The required sample size was computed for T1\u2013T0 gain scores on the chronic psychosocial stress measure (within-group changes), as well as for hypothetical differences between independent arms of a confirmatory trial (between-group changes) . Recruit\u03b1T0 =.93; \u03b1T1 =.80).The Perceived Stress Scale (PSS-10)  was the \u03b1T0 =.87, \u03b1T1 =.79; anxiety \u03b1T0 =.64, \u03b1T1 =.81; stress \u03b1T0 =.64, \u03b1T1 =.73; WHO-5: wellbeing \u03b1T0 =.86, \u03b1T1 =.83).To provide converging evidence that changes in this scale were reliable, we additionally assessed several secondary outcomes that should covary with PSS-10 scores. This included depression, anxiety, and stress symptoms using subscales of the Depression Anxiety Stress Scale (DASS-21) , and sub\u03b1T0 =.86; \u03b1T1 =.85).The Mindful Attention Awareness Scale (MAAS)  was used\u03b1T0 =.91; \u03b1T1 =.93).The cognitive reappraisal subscale of the Emotion Regulation Questionnaire (ERQ-CR)  was usedMaladaptive rumination (past-oriented) and worry (future-oriented) were used to assess the disposition to engage in self-focused, repetitive, and perseverative thought processes that maintain negative affect during times of psychosocial stress .\u03b1T0 =.88; \u03b1T1 =.86). Worry was examined using the 16-item Penn State Worry Questionnaire (PSWQ) , p =.024; see Fig.\u00a0pR =.020). Twelve participants reported a reduction on the PSS-10, and five participants reported no change or an increase. In common language, there was a 72.7% chance that a participant picked at random would report a lower PSS-10 score following the study compared to before the study. Because seven participants dropped out of the study, we also assessed whether survivorship bias was a threat to the validity of this test result. To this end, we conducted a last observation carried forward analysis which included the last known state of the subject in the analysis under the assumption they would report no change had they completed the study. This analysis yielded a small decline in effect size magnitude, but the test remained statistically significant .There was an overall reduction in our primary dependent measure of chronic psychosocial stress  and depressive symptoms , and an overall improvement in global wellbeing . These effects were also robust. However, we are insufficiently confident to comment on the direction of change in anxiety . A robust test did not change this conclusion.Reductions in PSS-10 were corroborated by improvement in several secondary stress measures. There was an overall reduction in stress symptoms . However, these data are compatible with a 0.17 unit decrease in mindfulness as well as a 0.60 unit increase in mindfulness. Therefore, we are insufficiently confident to comment on the direction of this change. A robust test did not change this conclusion.Participants reported an overall increase in dispositional mindfulness . This effect was robust. There was a mean reduction in the use of maladaptive rumination . However, this effect was not robust (pR =.051). Finally, there was an overall reduction in the disposition to worry . This effect was also robust.There was a mean improvement in the use of cognitive reappraisal . However, we are insufficiently confident to comment on the overall direction of this change. A robust test did not change this conclusion.There was a negligible change in ps <.001; see Summarized results of aerobic economy analyses are given in Table\u00a0F = 7.57, p =.007) and velocity  = 209.18, p <.001). We are insufficiently confident to comment on the presence of an interaction  = 1.20, p =.316). A pairwise (T1\u2013T0) contrast of the main effect of time indicated that, on average, there was a change in oxygen cost across all velocities of There was a statistically significant main effect of time  = 16.09, p <.001) and velocity  = 381.90, p <.001). We are insufficiently confident to comment on the presence of an interaction at a.05 threshold  = 1.90, p =.135). A pairwise (T1\u2013T0) contrast of the main effect of time indicated that, on average, there was a decrease in M= \u22124.37, 95% CI ; see Fig.\u00a0There was a statistically significant main effect of time  = 8.13, p =.005) and velocity  = 238.43, p <.001). We are insufficiently confident to comment on the presence of an interaction  = 0.26, p =.855). A pairwise (T1\u2013T0) contrast of the main effect of time indicated there was, on average, a decrease in heart rate across all velocities  = 13.93, p <.001) and velocity  = 237.52, p <.001). We are insufficiently confident to comment on the presence of an interaction  = 0.53, p =.666). A pairwise (T1\u2013T0) contrast of the main effect of time indicated there was, on average, a decrease in RPE across all velocities following the study  training in healthy individuals . This inper treatment arm of an RCT  may represent a reasonable estimate of recruitment feasibility. Based on our sample size analysis, precise estimation of within-group changes in PSS-10 gain scores requires between 89 (\u03b4z = \u22120.60) and 186 (\u03b4z = \u22120.37) paired observations. A precise estimate of differences in gain scores between each arm of an RCT will require between 84 (large difference: \u03b4s = 0.80) and 1098  observations per cell. These calculations reflect a retention rate of 70.8%.The study recruitment rate was 53.3%. Across a 2-month recruitment period  and with a total of 45 applicants, this is indicative of a recruitment potential of 12 participants per month for the combination trial arm of a future RCT. With an expanded research team for recruitment, assessment, and facilitation of the intervention, a recruitment potential of 12 participants per month n = 20 per treatment arm  across 10 trial repetitions over 5 years, the total maximum number of participants is n = 200 per treatment arm . A recruitment rate of n = 12 per treatment arm per month is therefore feasible to fill each trial run following the second month of the protocol (estimated sample at month 2: n = 24 per treatment arm) with a start date at month 3 following assessments. Assuming recruitment continues ongoing each month, each trial start date will satisfactorily attain n = 20 participants per treatment arm. Assuming a retention rate of 70.8%, a total recruitment of n = 200 per treatment arm by the end of the protocol is satisfactory to detect within-group changes in PSS-10 gain scores (with precision) as low as \u03b4z = \u22120.37, and between-group difference in gain scores (with precision) up to \u03b4s = 0.50. Differences in gain scores of \u03b4s = 0.40 will be detectable with 80% power, but these effects may have lower than desired precision. Estimation of very small differences in gain scores  is infeasible. Based on these criteria, we conclude that there is sufficient assurance of protocol feasibility to conduct a confirmatory RCT under the above assumptions and detect most effects precisely .Under the assumption that an RCT is only feasible with Of course, however, these above assumptions do not take into consideration additional uncertainties that may impact the capacity of a single research group to conduct a confirmatory trial. This includes uncertainty in future economic conditions, finances, and resource availability. Therefore, this confirmatory trial may be more appropriately suited to a large multisite clinical trial that spreads risk of conducting 10 trial repetitions across multiple research groups. This approach has the additional benefit of evaluating the trial treatment effect across large and heterogeneous populations in varied treatment settings, and will therefore mitigate multiple threats to the validity of observed effects.Additional considerations for a future definitive trial may also include ensuring that the effects of the intervention are not driven by differences in baseline stress levels or baseline cardiorespiratory fitness levels that differ across groups. While randomization ensures that these differences, on average, should be equal across treatment arms, one option would be to perform block stratified random assignment on factors that might bias results for each trial repetition. With regard to baseline stress, this could include block randomization based on a simple one-item question about overall stress levels that is embedded in the initial application to the intervention, as recommended by Shadish and colleagues . This isA further consideration for a future definitive trial may be to broaden the trial eligibility criteria to allow findings to be more generalizable. Currently, the eligibility criteria only allowed for young and relatively healthy adults as part of a prevention-focused intervention. While this population was the target of interest, it may not be the population that needs this intervention most. However, any deviation from the methods and protocol of this study may require further pilot testing prior to performing a definitive trial.d = \u22120.74   . If this7,\u22120.41] . Based oFurther support for the validity of a reduction in PSS-10 scores comes from changes in our secondary mental health outcome measures. This included a reduction in stress and depressive symptoms, and an improvement in global wellbeing. Indeed, mean improvement in wellbeing was of a magnitude of approximately 10 percentage points on the WHO-5 scale, which is indicative of a clinically relevant improvement with respect to the scale . Howeversomewhat frequently to somewhat infrequently, in response how frequent participants reported an absence of attention to or awareness of present moment experiences. However, the confidence intervals on these data are also compatible with a partial unit decrease in mindfulness, as well as a greater than half unit increase in mindfulness. Therefore, we are insufficiently confident to comment on the direction of change of this effect in the present study.Participants reported an overall increase in dispositional mindfulness. This represented a partial unit change from d = 0.60, 95% CI . The small magnitude of change in mindfulness in the present study is therefore unexpected . However, it must be noted that measures of mindfulness are not consistently reported for MBI interventions [Dispositional mindfulness represents the quality of attention and awareness with which one attends to the present moment experience, and is considered a core mechanistic component of how MBIs exert their effects , 60. In ventions .neither agree or disagree to agree, in response to questions evaluating the disposition to use this emotion regulation strategy. Evidence from intervention studies [pR =.051 . Notably, there were no outliers in this variable and no evidence of a strong deviation from normality, meaning that the standard  test may be a more appropriate reflection of the data. This interpretation is strengthened by observation that Alderman and colleagues [Participants reported an overall increase in use cognitive reappraisal. In descriptive terms, this represented a unit change from  studies , 63 demo studies , althoug studies . Beyond  studies . Howeverlleagues  reportedFinally, with respect to cardiorespiratory fitness, there was a negligible overall change in protocol  are mostprotocol . This inHowever, there were improvements in aerobic economy across steady-state  exercise velocities in our subgroup analyses. This included a reduction in absolute oxygen cost, relative oxygen cost, heart rate, and perceived exertion. Improvement in indices of aerobic economy is indicative of a cascade of metabolic and cardiopulmonary effects that result in better use of oxygen  relative to a given exercise intensity. This includes more efficient cardiorespiratory responses , thermoregulation , and substrate metabolism . The relNotable strengths of this study included the following: (1) use of a full mindfulness psychoeducation program in contrast to a single mindfulness component ; (2) use of an aerobic exercise program that prescribed exercise of a duration, frequency, and intensity that has been clinically shown to improve or maintain aerobic fitness; (3) complete individualization of aerobic exercise prescriptions through objective cardiorespiratory fitness assessments; (4) comprehensive monitoring of training compliance through GPS data; (5) provision of a detailed methodological protocol that is presented here in sufficient detail to allow for replication; and (6) extensive quantification of multiple protocol feasibility criteria.However, the clearest limitation is that a single-arm study design presents with difficulty in distinguishing between the effects of the treatment and several threats to validity. For example, the observed reduction in chronic psychosocial stress may be an effect of intervention exposure, but it may also be partly explained through a placebo effect, maturation, test effects, or regression to the mean. However, regression to the mean may be a less plausible explanation as this study was designed to coincide with low-stress periods with respect to our study population. Further limitations include that effects have been estimated with low precision . For these reasons, we must emphasize that all results should be treated as preliminary and for readers to avoid exaggerated generalizations of findings. Within the present study, the single-arm research design was an efficient use of limited resources to examine most uncertainties that may arise in each arm of a definitive trial, and to determine feasibility estimates for such a trial. Finally, it is important to note that the results of this study are mostly generalizable to nonclinical populations of young, healthy, and university educated adults.Retention rate and assessment response rate were acceptable, and a sample size analysis indicated that it is feasible to detect most effects in a definitive trial with precision. We recommend that a definitive randomized controlled trial is feasible and should proceed.Additional file 1 Supplementary Materials.Additional file 2 Supplementary Results."}
{"text": "This study revealed that higher proportions of women than men showed preference for most attributes of cassava flour quality. Kwon was 26% (women) and 15% (men). Ease of peeling and stickiness of Kwon were key processing traits. Heap fermented flour had higher pasting temperatures, but lower viscosities than sun\u2010dried flour, and had lower amylose content compared to fresh root starch. The results demonstrate the importance of gender sensitive participatory evaluation of breeding materials, in tandem with physicochemical evaluation during selection of best possible candidate breeding lines.Cassava breeding programmes in Uganda do not currently select materials based on flour making quality, explaining in part the low adoption rates of many released varieties. In this study, we describe end user trait preferences, processing qualities and physicochemical properties of cassava flour. We found that higher proportion of women than men showed preference for most attributes of cassava flour quality evaluated in this study. Preference for colour was 66% and 52% among women and men, respectively, while that for stickiness of  Manihot esculenta Crantz) is a major root crop grown and consumed in the tropical and sub\u2010tropical regions of the world  were used to collect quantitative data from Sixty\u2010two men and Sixty\u2010six women engaged in cassava production. Purposive sampling ensured respondents were from a range of ages, as well as balancing the number of women and men consulted.Eight focus group discussions (FGDs) led by a facilitator and guided by preset questions were used to collect qualitative data. Moreover, questionnaires  was formed.Eighteen women from the community were each supplied with cassava roots harvested from four genotypes, to process flour at their homes using the traditional heap fermentation practice with nine women processing roots from one replicate. In each woman\u2019s home, cassava roots were peeled and spread on tarpaulin under the sun. Cassava roots were left under the sun for four to six hours to reduce the moisture content of the roots without complete drying of the roots. Thereafter, whole partially dry roots were heaped in a corner inside the house and covered with polythene sacs. The roots were placed on bare ground in heaps to ferment. Fermentation ended within two to three days, when roots were soft and covered with black moulds. The fermented roots were cleaned with knives to remove black moulds. Clean roots were broken into small pieces by pounding them in a local motor with a local pounding pestle called Kwon (thick paste processed from heap fermented cassava flour). Consequently, a structured questionnaire with questions rated by a scale customised to the Likert scale  and stickiness of cassava et al., et al., et al., Physicochemical analyses were done for heap fermented, sun\u2010dried and fresh root starch samples. Fresh root starch was prepared following a method described by  indicated that gender and variety processed were independent implying that selection of a variety was largely influenced by its inherent attributes.The study showed that most popular cassava landraces processed by both men and women in Zombo are Nyapamitu, Nyarodota and Nyaronega, all of which are bitter Table\u00a0. Ferment\u2026fermenting removes bitterness, it gives cassava flour a nice smell and the ability to make sticky food\u2026 Cassava roots are commonly processed into flour following a stepwise procedure. In Zombo, the procedure of processing roots into flour was by heap fermentation. Apart from reducing levels of HCN, heap fermentation was purported to improve organoleptic attributes of cassava flour.et al. , respectively. Despite this, heavy flour and high dry matter content were preferred by more men than women, although they did not meet the cut\u2010off point. These flour quality attributes preferred by women and men are linked to cassava Kwon. This finding highlights both the importance of Kwon to the Zombo community and need for participatory product\u2010based evaluation and selection.A range of attributes were mentioned by men and women in describing their perception of high quality cassava flour Fig.\u00a0. ConsideP\u00a0<\u00a00.05) for ease of peeling and stickiness of Kwon . The ability of cassava flour to form a \u2018thick paste\u2019 referred to as \u2018stickiness\u2019 is a critical starch pasting property whose differences are reported to be genotype dependant   Table\u00a0. This fiKwon .5 (TableLactobacillus fermentum) which is a key organism involved in fermentation  than that from Nyacharitas. The relationship between amylose content, pasting properties and stickiness of cassava Kwon, if further investigated, could be key in evaluating genotypes for the important attribute \u2013 stickiness of cassava Kwon.Results for amylose content are presented in Table\u00a0et al.  while Nyacharitas had the lowest swellability of 30.20\u00a0g of water/g of starch ; Data curation (lead); Formal analysis (lead); Investigation (lead); Methodology ; Writing\u2010original draft (lead); Writing\u2010review & editing (lead). RoberT Sezi Kawuki: Conceptualization ; Formal analysis (supporting); Funding acquisition (supporting); Investigation (supporting); Methodology ; Project administration (lead); Resources (supporting); Supervision (lead); Writing\u2010review & editing . Florence Birungi Kyazze: Data curation (supporting); Formal analysis (supporting); Investigation (supporting); Methodology ; Supervision ; Writing\u2010review & editing . Williams Esuma: Data curation (supporting); Formal analysis ; Methodology (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing . Enoch Wembabazi: Data curation ; Formal analysis ; Investigation (supporting); Writing\u2010review & editing . Dominique Dufour: Conceptualization ; Formal analysis ; Investigation (supporting); Methodology ; Supervision ; Writing\u2010review & editing . Ephraim Nuwamanya: Conceptualization (supporting); Data curation (supporting); Formal analysis ; Investigation (supporting); Methodology ; Supervision ; Writing\u2010review & editing . Hale Tufan: Conceptualization (lead); Formal analysis (supporting); Funding acquisition (lead); Investigation (supporting); Methodology (lead); Project administration (supporting); Resources (lead); Writing\u2010original draft (supporting); Writing\u2010review & editing .Men and women were asked for their consent to participate and were assured of the anonymity of the information they gave. In addition, introduction of the study and its purpose was made. Indeed, respondents were free to cancel the interview any time if they lost interest to participate.https://publons.com/publon/10.1111/ijfs.14940.The peer review history for this article is available at"}
{"text": "Lycium barbarum; LB) is an important agricultural product with a high content of pharmacologically important secondary metabolites such as phenylpropanoids. A close relative, black wolfberry , endemic to the salinized deserts of northwestern China, is used only locally. The two fruits exhibit many morphological and phytochemical differences, but genetic mechanisms underlying them remain poorly explored. In order to identify the genes of interest for further studies, we studied transcriptomic (Illumina HiSeq) and metabolomic (LC-MS) profiles of the two fruits during five developmental stages (young to ripe). As expected, we identified much higher numbers of significantly differentially regulated genes (DEGs) than metabolites. The highest numbers were identified in pairwise comparisons including the first stage for both species, but total numbers were consistently somewhat lower for the LR. The number of differentially regulated metabolites in pairwise comparisons of developmental stages varied from 66 (stages 3 vs 4) to 133 (stages 2 vs 5) in both species. We identified a number of genes  and metabolites  that may be of interest to future functional studies of stress adaptation in plants. As LB is also highly suitable for combating soil desertification and alleviating soil salinity/alkalinity/pollution, its potential for human use may be much wider than its current, highly localized, relevance.Red wolfberry (or goji berry,  Although the clinical efficacy remains to be fully confirmed, there is some evidence that goji extracts may be beneficial for the prevention and treatment of age-related disorders, diabetes, hyperlipidaemia, cancer, hepatitis, immune disorders, thrombosis, and male infertility3. Specifically, Lycium fruits have relatively high content of bioactive components believed to be pharmacologically important, e.g. possessing immuno-enhancement and antioxidative activities, such as polyphenols, phenylpropanoids, carotenoids and polysaccharides6.Goji berry , used in China as food and medicine for millennia, recently achieved almost global popularity due to it being advertised as a healthy, ageing-preventing food. In the traditional Chinese medicine, goji is traditionally consumed for its alleged anti-aging, tranquilizing and Yin strengthening propertiesLycium barbarum and L. chinense (Chinese boxthorn) but nearly 90% of all commercially available goji berries belong to the former species2. Although the native range of this species is probably in the Mediterranean Basin, a majority of global commercial production takes place in arid and semi-arid areas of two provinces in Northwest China, Ningxia and Xinjiang1. Lycium ruthenicum (Russian box thorn or black wolfberry), a very close relative of L. barbarum and L. chinense7, is a wild perennial thorny shrub native to Northwest China, whose resistance to the harsh environment of saline deserts makes it a popular choice plant for combating soil desertification and for alleviating soil salinity/alkalinity9. It is also used in the local folk medicine and as food8, and studies indicate that it has notable pharmaceutical effects10. As these two species, and their fruits, are referred to by a range of (often overlapping) names1, to avoid confusion we refer to the fruit of L. barbarum (LB) as red wolfberry, and fruit of L. ruthenicum (LR) as black wolfberry. Despite their close phylogenetic relationship, the fruits of these two species exhibit distinct phenotypic profiles of during all developmental stages, including their shape, size, colour, taste, nutritional value and pharmacological properties11. As opposed to the red and elongated mature red wolfberry, black wolfberry is dark-purple or black, round, and smaller. It is also known that metabolic phenotypes of these two fruits differ significantly, particularly in the content of fatty acids, phenols and antioxidant capacities, which are much higher in black wolfberry, while the content of carotenoids, sugars, amino acids and osmolytes is higher in the red wolfberry4.Two closely related species are sometimes sold as goji berries, 12, so genetic mechanisms underpinning these phenotypic differences remain only partially understood. The objective of this study was to contribute to our understanding of the complexity of ripening processes of these two fruits in different environments. To achieve this, we collected L. barbarum and L. ruthenicum fruits at five developmental stages, from young to ripe fruit, and sequenced their transcriptomes and metabolomes. These data shall help us better understand genetic underpinnings of both within- and between-species phenotypic differences that fruits of these two species exhibit during their respective ripening processes.Fruit ripening is a complex developmental process, coordinated by a network of interacting genes and signalling pathwaysst and August 20th 2017 from nine wild L. ruthenicum (LR) shrubs growing in the vicinity of Bayan Taolaisu Wooden, Ejina, Alxa, Inner Mongolia, China  and nine 5-year-old cultured L. barbarum (LB) shrubs from the germplasm nursery of the Ningxia Academy of Agriculture and Forestry Science, Lu Hua Tai plantations, Xixia District, Yinchuan, Ningxia, China  . The extracted total RNA was treated with RQ1 DNase (Promega), and its quality and quantity then determined by measuring the absorbance at A260/A280 and A260/A230 using Smartspec plus (BioRad) spectrophotometer. RNA integrity was further verified by agarose gel electrophoresis. For each sample, 10\u2009\u03bcg of total RNA was used for RNA-seq library preparation. Polyadenylated mRNAs were purified and concentrated with oligo (dT)-conjugated magnetic beads (Invitrogen) before being used for directional RNA-seq library preparation. The cDNA libraries were prepared from the purified mRNAs using the TruSeq Stranded Total RNA LT Sample Prep Kit . Briefly: purified mRNAs were iron-fragmented at 95\u2009\u00b0C, followed by end repair and 5\u2032 adaptor ligation. Reverse transcription was then performed with RT primer included in the kit, harbouring a 3\u2032 adaptor sequence and a randomized hexamer. The cDNAs were purified and amplified, and PCR products in the range 200\u2013500\u2009bp were purified, quantified and stored at \u221280\u2009\u00b0C until the sequencing step. For high-throughput sequencing, the libraries were prepared following the manufacturer\u2019s instructions and Illumina HiSeq. 2000 system used for 150 nt single-end sequencing.13: firstly we discarded all reads containing more than two N bases, then reads were processed by clipping the adaptor, removing low quality bases, and discarding short (<16 nt) reads. Uniquely localized clean reads were used to analyse the data quality with dupRadar14 with default parameters, and to calculate the read number and FPKM value (fragments per kilobase of transcripts per million mapped fragments) for each unigene according to reads and their genomic location15. De novo transcriptome assembly was conducted using Trinity program16, with default settings. The assembled transcriptomes were clustered using Corset17, a software designed for obtaining gene-level counts from any de novo transcriptome assembly. Unigenes were annotated by querying them against several public databases: Nr (NCBI non-redundant protein sequences), Nt (NCBI non-redundant nucleotide sequences), Pfam (Protein family)18, KOG/COG (Clusters of Orthologous Groups of proteins)20, Swiss-Prot 21, KO (KEGG Ontology)22, and GO (Gene Ontology)23. To further analyse the metabolic pathways different between the two sets of samples, all unigenes were queried against the KEGG pathway database. All BLASTx24 searches were performed with the e-value of 1E\u22125.Raw reads were filtered using Cutadapt 1.7.125. The fold\u2013changes in gene expression were also estimated with this package, and False Discovery Rate (FDR) thresholds were set to 0.01 and 0.7 R2. After obtaining the expression level of all genes in all of the samples, differentially expressed genes (DEGs) between the two fruits in the same developmental stages were analysed using Edge R26 with TMM normalization27. The following parameters were used to set the threshold for identifying DEGs: FDR\u2009<\u20090.01 and |fold change|\u2009\u2265\u20092.0. For each gene, the p-value was obtained on the basis of the model of negative binomial distribution. Benjamini-Hochberg procedure28 was used to control the false discovery rate (FDR) and infer the q-value .As our samples represented a time-series experiment, to explore temporal profiles of DEGs during the fruit development, we analysed the gene expression patterns using a time-series analysis tool maSigPro, an R package designed for identification of significantly different temporal expression profiles in RNA-seq data and microarray experiments29 and Java Treeview30 software programs. To predict gene functions and calculate the functional category distribution frequency, KEGG analyses were employed using DAVID bioinformatics resources31. Functional networks were constructed by calculating the Pearson correlation coefficient (PCC) of the DEGs, and Cytoscape 3.0.2 was used to display the co-expression network32. Reliability of the RNA-seq data was corroborated by studying the expression of five randomly selected DEGs by qPCR , mass-to-charge ratio (MZ), observations (samples) and peak intensity were calculated. Multivariate analysis (PCA) was performed using SIMCA-P 13.0 software . Metabolites were assigned to pathways using the KEGG database. Significantly different metabolic pathways were identified using the PLS-DA , and the following criteria: VIP (Variable Importance in the Projection) value\u2009>\u20091 and P-value\u2009<\u20090.05.\u00a0Data were processed and analysed by the Wuhan Metware Biotechnology Co., Ltd. .Five fruit samples were used for each stage . About 100 mg of fruit tissue was crushed using a mixer mill  with a zirconia bead for 1.5 min at 30 Hz and extracted overnight at 4\u2009\u00b0C with 0.6 ml 70% aqueous methanol. Following centrifugation at 10,000 g for 10 min, the extracts were absorbed  and filtrated  before LCMS analysis. The sample extracts were analysed using an LC-ESI-MS/MS system . The analytical conditions were as follows: HPLC column, Waters ACQUITY UPLC HSS T3 C18 ; and the mobile phase consisted of solvent A (pure water with 0.04% acetic acid) and solvent B (acetonitrile with 0.04% acetic acid). Sample measurements were performed with a gradient program that employed the starting conditions of 95% of solvent A and 5% of B solvent. Within 10 min, a linear gradient to 5% A / 95% B was programmed, and 5% A / 95% B was maintained for 1 min. Subsequently, a composition of 95% A / 5.0 % B was adjusted within 0.1 min and maintained for 2.9 min. The column oven was set to 40\u2009\u00b0C, and the injection volume was 4 \u03bcl. The effluent was alternatively connected to an ESI-triple quadrupole-linear ion trap (QTRAP)-MS. LIT and triple quadrupole (QQQ) scans were acquired on a triple quadrupole-linear ion trap mass spectrometer (Q TRAP), API 4500 Q TRAP LC/MS/MS System, equipped with an ESI Turbo Ion-Spray interface, operating in positive and negative ion mode and controlled by Analyst 1.6.3 software (AB Sciex). The ESI source operation parameters were as follows: ion source, turbo spray; source temperature 550\u2009\u00b0C; ion spray voltage (IS) 5500 V (positive ion mode)/-4500 V (negative ion mode); ion source gas I, gas II, and curtain gas were set at 50, 60, and 30.0 psi, respectively. The collision gas was high. Instrument tuning and mass calibration were performed with 10 and 100 \u03bcmol/L polypropylene glycol solutions in QQQ and LIT modes, respectively. QQQ scans were acquired as MRM experiments with collision gas (nitrogen) set to 5 psi. DP and CE for individual MRM transitions was done with further DP and CE optimization. A specific set of MRM transitions were monitored for each period according to the metabolites eluted within this period. Feature extraction and pre-processing of the raw data were conducted using XCMSt-test, with P\u2009<\u20090.05 as the threshold.All values are presented as mean\u2009\u00b1\u2009SD. The significance of differences between means was determined in Excel using Student\u2019s L. barbarum and L. ruthenicum at five developmental stages, from young fruit (\u224810 days post-flowering) to mature (ripe) fruit (34\u201345 days post-flowering), and studied their transcriptome and metabolome.We collected fruits of L. barbarum and L. ruthenicum, with three biological replicates (three fruits from three trees) at each time point: 2 species\u2009\u00d7\u20095 time-points\u2009\u00d7\u20093 biological replicates. Samples were labelled LB/LR(1\u20135)-(1\u20133), where LB is L. barbarum and LR is L. ruthenicum, 1\u20135 are developmental stages of fruit ,\u20133,L. barAmong all 326,276 unigenes queried against public databases, a total of 193,021 (59.15%) matched genes and/or proteins in at least one database, and 12,171 (3.73%) were annotated in all databases. The largest number of unigenes  was annotated in the NT database, and the lowest number  in the KOG database.st stage, and in the 2nd vs. 5th stage comparison . Heatmap analysis of DEGs in LB shows that fairly different sets of genes were highly upregulated in the early developmental stages (1\u2009+\u20092) and in later stages (3 to 5)  Fig.\u00a0. Sample  5) Fig.\u00a0. Particu 5) Fig.\u00a0.Table 2TFor a more in-depth analysis of the data, we focused on the comparison of most significantly regulated pathways in successive developmental stages. In the first pairwise comparison  vs\u00a0S2, \u2018st and 2nd stage (117). These were assigned to a large number of pathways; with the largest number of metabolites assigned to \u2018b. of secondary metabolites\u2019 , followed by \u2018protein digestion and absorption\u2019 and \u2018b. of amino acids\u2019  to 129 (stages 2 vs 5). The largest number in successive stage comparisons was observed between 1ds\u2019 Fig.\u00a0 vs.\u00a0S3, As regards individual metabolites, in the\u00a0Heatmap analysis of DEGs in LR shows that almost completely different sets of genes were highly upregulated in the early developmental stages 1\u2009+\u20092) and in ripe fruit (stage 5), with an apparent transcriptomic reset occurring after the second stage Fig.\u00a0. Sample  and in rst and 2nd stage (117). These were assigned to a large number of pathways; with the largest number of metabolites assigned to \u2018b of secondary metabolites\u2019, followed by \u2018protein digestion and absorption\u2019, \u2018b. of amino acids\u2019, and \u2018flavonoid b\u2019. In the\u00a0The number of differentially regulated metabolites in pairwise comparisons of developmental stages in LR varied from 66 (stages 3 vs 4) to 133 (stages 2 vs 5)  shows that 928 DEGs were shared by all five pairs Fig.\u00a0. The hignd-highest in\u00a0th-highest in\u00a0rd-highest in\u00a0nd-highest in\u00a0th-highest in\u00a0th-highest in\u00a0rd-highest in\u00a0th-highest in\u00a0th-highest in\u00a0th-highest in\u00a0th-highest in\u00a0nd-highest in\u00a0th-highest in\u00a0th-highest in\u00a0rd to 4th-highest during stages 3 to 5). Linoleic acid metabolism was highly enriched in middle stages  was among the handful of most highly upregulated genes in the first three stages , but it was also not identified as DEG in later stages. CCR4-NOT transcription complex subunit 7/8 (CNOT7/8) also exhibited a very similar expression pattern: highly upregulated in first three stages, and not a DEG in stages 4 and 5. Several flavonoid and phenylpropanoid biosynthesis-associated genes exhibited a reversed developmental stage-specific expression pattern, with relatively low expression in early stages, and very high in later stages. Examples are: bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase (DFR), which was slightly upregulated in LR in\u00a0rd-highest upregulated gene in\u00a0th-highest upregulated DEG in\u00a0th in\u00a0flavonoid 3\u2032,5\u2032-hydroxylase (F3\u20325\u2032H) was not a DEG in the first two stages, highly upregulated in\u00a0th-highest upregulated gene in\u00a0th-highest in\u00a0Flavonoid O-methyltransferase (OMT) was not a DEG in the\u00a0Leucoanthocyanidin dioxygenase  was not a DEG in\u00a0chalcone synthase paralogues  were also not highly regulated in\u00a0CHS2: not a DEG, CHS: \u22121.14\u2009in\u00a0CHS2: 5.32, 7.84, 6.00; and CHS: 4.67, 7.01, 6.82; respectively). We selected these genes for qPCR analysis, and the results are highly congruent with the RNA-seq data .Among the most highly differentially expressed genes, some were developmental stage-specific , but some were consistently highly differentially regulated throughout all five studied stages  in\u00a0nd and 7th highest upregulated DEGs in\u00a0nd and 4th highest in\u00a0nd and 6th highest in\u00a0Plant disease resistance protein RPM1 was also highly upregulated in all five stages , with a temporal profile of increasingly high downregulation, starting from \u22127.0\u2009in the\u00a0Proline iminopeptidase, associated with arginine and proline metabolism, was highly downregulated in LR in all stages: rd-highest), th-highest), rd-highest). Finally, 5-methyltetrahydropteroyltriglutamate\u2013homocysteine methyltransferase (metE) was consistently extremely highly downregulated in LR in all stages: 2nd-highest in\u00a0rd-highest in\u00a0nd-highest in\u00a0GTP-binding nuclear protein Ran  and replication factor A1 (RFA1) (\u22128.0 to \u221212.0). Some growth and stress-related genes were also consistently highly downregulated in LR: heterogeneous nuclear ribonucleoprotein A1/A3  and heat shock 70\u2009kDa protein 1/8 (HSPA1_8)\u00a0nd-highest), shikimate hydroxycinnamoyltransferase (HCT), was also consistently highly downregulated in LR: rd-highest), th-highest). However, a key regulator of anthocyanin biosynthesis, transcription factor MYB114, was highly upregulated in LR during all five developmental stages: 6.11, 4.69, 7.47, 9.05, and 8.95  of most highly differentially regulated metabolites between the two species, exhibited some variation among the five fruit development stages. Intriguingly, Fructose 1-phosphate was the most highly upregulated metabolite in LR, compared to LB, during all five stages: log2 Fold change\u2009=\u20096.3, 7.6, 7.7, 8.1, and 6.5 (stages 1 to 5 respectively). As regards the metabolites highly upregulated in LB, there was more variation among stages: in the\u00a0The list  as our study . This similarity, high correlation coefficients among biological replicates, and additional confirmatory qPCR experiments, all corroborate that the transcriptome sequencing experiment and data analysis were conducted to a high standard. As gene expression (mRNA levels) can be variable over very short time-periods, RNA-seq often produces conflicting signals35, which is a likely explanation for some apparently simultaneously highly upregulated and highly downregulated pathways  in the interspecific pairwise comparisons. This relative volatility in gene expression levels is also the most likely explanation for several observed instances of incongruence between the transcriptomic and metabolomic data; such as much higher variability in the successive intraspecific pairwise comparisons observed in the transcriptomic dataset.Given the absence of a published genome for this species, almost 60% of unigenes matching against genes and/or proteins in at least one database is a satisfactory annotation rate. For example, a recent transcriptomic study of 12. Although we observed similar patterns in intraspecific pairwise comparisons of successive stages in the transcriptomic data, the total numbers of regulated DEGs were consistently smaller in LR, except for the 4th vs. 5th stage comparison, where a higher number of DEGs was identified (783). As this was not reflected in the metabolomic data, it is likely that this is an annotation artefact produced by a higher data availability for LB.A very large number of differentially regulated genes and metabolites belonging to a broad range of metabolic pathways reflects the fact that fruit ripening is a complex developmental process, characterized by a series of transitions that are coordinated by a network of interacting genes and signalling pathwaysL. barbarum. A major abiotic stressor, drought, has received ample scientific attention, as it is rather common, and affects the productivity and growth of numerous economically important plants38. Although we are far from a full understanding of the complexities of these mechanisms, some genes/metabolites/metabolic pathways have been singled out as particularly highly affected by abiotic stress, examples of which are abscisic acid (ABA), hormone signal transduction, metabolisms of proteins, carbohydrates, nucleic acids and lipids, etc.39. Salt stress can indirectly impair photosynthesis by depressing chlorophyll biosynthesis and the citrate cycle, so acetyl-CoA acyltransferase 1 (AAT1) is known to be strongly downregulated in response to salt stress40, which is in perfect agreement with very high downregulation in all stages observed in our results. A gene involved in the biosynthesis of amino acids, but also a number of important secondary metabolites in plants, metE, exhibited a temporal profile of increasingly high downregulation. Due to its varied metabolic roles there are multiple possible explanations for this, but as downregulation of this enzyme was observed in response to drought stress in other plants41, its regulatory pattern may also be related to the higher drought exposure of LR plants in our experimental setup.As LR is native to the salinized deserts of northwestern China, its genetics and physiology should bear strong markings of the evolution in an environment where drought and salt stress are very common. Indeed, it generally exhibits higher resistance to abiotic and biotic stressors common in that environment, such as high soil salinity, drought and local pests, than 43. Increased level of raffinose in post-colour breaking stages of fruit development in LR was observed recently, and associated with osmoregulation requirements3. In our study, raffinose was also increased in LR (3.6-fold), as was another raffinose family oligosaccharide, galactinol (11.7-fold). A heightened synthesis of galactinol has been reported in plants in response to a range of abiotic stressors, so it is believed to function as an osmoprotectant in drought-stress tolerance of plants44. Intriguingly, another carbohydrate highly enriched (8.09-fold) in LR, trehalose, is a disaccharide of glucose that functions as an osmoprotectant under abiotic stress in bacteria, fungi, and invertebrates, but it generally does not accumulate in detectable levels in most plants, with the exception of desiccation-tolerant \u201cresurrection plants\u201d46. Trehalose and galactinol also featured prominently in both species in the lists of most highly regulated metabolites in the intraspecific comparisons between different stages, suggesting a prominent role of these metabolites in both species. This is likely to be a reflection of a high level of adaptation to arid habitats in both species.In agreement with this observation are also the results of comparative interspecific individual metabolite analyses, where a number of metabolites associated with abiotic stress topped the list of most highly significantly differentially regulated metabolites between the ripe fruits of the two species . Plants counteract the deleterious effects of drought by accumulating osmolytes, such as amino acids, amines and some soluble carbohydrates , which have a vital role for the stability of cellular structures under adverse environmental conditions47. Sucrose is another highly significantly upregulated carbohydrate that  protects membranes and proteins in bacteria during drying48. A recent study found that sucrose was the most abundant sugar in both Lycium fruits before colour-breaking, but glucose and fructose were significantly elevated post colour-breaking in both fruits3. Therefore, the high levels of sucrose in ripe LR fruits observed in our study are likely to be a reflection of adaptation to drought and/or salinity stress.Among other examples of osmolytes abundant in LR are sucrose (37-fold) and betaine (28-fold). A member of the betaine family, glycine betaine, is an important organic osmolyte that protects cells against osmotic stress caused by drought or high soil salinityCitrullus lanatus)49. The authors suggested that the accumulation of citrulline during the drought stress is a unique phenomenon in C3-plants. Although reports of the association between high citrulline accumulation and drought appear to be limited to watermelon species49, citrulline accumulation was associated with higher disease resistance in citrus fruits50. Glutamate and arginine are both precursors for citrulline synthesis49, and arginine is believed to play a role in the fine-tuning of stress defense mechanisms51. Arginine is also a precursor for nitric oxide and polyamines, which are important metabolites in stress responses52. For example, high arginine accumulation in response to long-term drought stress was also observed in chickpea53. Intriguingly, we observed a strong accumulation of DL-arginine in the ripe fruit of both species, but further studies are needed to assess whether this may be related to abiotic stress adaptation in both species.Several metabolites related with amino acid metabolism- were also highly significantly more abundant in the ripe LR fruit: citrulline (31.1-fold), arginine (31.1-fold) and glutamate (29.5-fold). A massive accumulation of these three metabolites  in response to a drought stress was observed in wild watermelon (Proline iminopeptidase (pip), associated with arginine and proline metabolism, was highly downregulated in LR in all stages. As proline (and pip) concentrations tend to increase under stress in a broad range of living organisms55, we would expect the pip gene to be upregulated. It should be noted that we did observe a high accumulation of L-proline in the ripe LR fruit. However, a downregulation of pip in response to drought stress was also observed in Bombax ceiba36, and proline accumulation was triggered in Calotropis procera in response to salt stress, but not drought stress56, which indicates that this discrepancy may not be mere molecular noise, and might deserve further investigation.Expression patterns of some genes were (apparently) not in agreement with the hypothesis of increased stress-related gene expression in LR. 9. Flavonoids have high antioxidant potential and possess a number of properties putatively beneficial from the pharmacological perspective: antitumorigenic, anti-inflammatory, prevention and treatment of cardiovascular and neurodegenerative diseases, obesity, dental health, etc.60. Phenylpropanoids, a group of phenylalanine-derived physiologically active secondary metabolites, are the key mediators of plant responses towards abiotic  and biotic (pests) stimuli, also with important  antioxidant and free radical scavenging properties61. Many functional pathways, genes and metabolites associated with phenylpropanoid and flavonoid biosynthesis exhibited upregulation in LR berries, especially in later developmental stages. Developmental stage-specific expression pattern, with relatively low expression in early stages, and very high in later stages was exhibited by the paralogues of DFR and CHS, as well as F3\u20325\u2032H, OMT and LDOX genes, all of which take part in the biosynthesis of anthocyanin, natural pigment of plants, responsible for red, blue and purple colours63. These genes are commonly upregulated in later stages of fruit ripening62; for example, high expression of DFR increases the accumulation of anthocyanin content during fruit ripening64. Importantly, a key positive regulator of the anthocyanin biosynthesis, transcription factor MYB11465, was highly upregulated in LR during all five developmental stages. At the metabolomic level, a metabolite associated with flavone and flavonol biosynthesis pathway, rutin, was significantly more abundant in ripe LR fruits than in LB fruits (5.88-fold). Increased rutin content was observed in plants in response to a drought stress66, salinity stress67, and also to biotic stress (pests)68. Intriguingly, this metabolite was not mentioned in a recent comparative metabolomic study of these two Lycium fruits3. As rutin derivatives have antioxidant potential and show low cytotoxicity in human and animal cells, which makes them promising potential candidates for use as nutraceuticals69, and as there are indications that rutin may suppress lipid accumulation in humans70, high rutin content in LR berries may be interesting from the nutritional and pharmaceutical perspective.LB and LR fruits are generally relatively rich in pharmacologically important secondary metabolites synthesized via the phenylpropanoid/flavonoid pathway, such as anthocyanin, betalain, flavone, flavonoid, isoquinoline, etc.L. ruthenicum may exhibit higher resistance to abiotic  than L. barbarum11 and that berries of L. ruthenicum may have much greater medicinal value than berries of L. barbarum3. Although we can tentatively conclude only that our results are in agreement with these indications, it will be necessary to corroborate our comparative analyses results in future studies with different experimental setups before any conclusions about genetic and metabolic adaptations of these two species to environmental stress can be made with confidence. Regardless of this, our analyses enabled us to identify a number of genes  and metabolites  that may be of interest to future functional studies of stress adaptation in plants. In the light of the rapid growth in global popularity of \u201chealth food\u201d and \u201corganic food\u201d products71, we expect that both of these species shall continue to receive increasing scientific attention. Additionally, L. ruthenicum has high suitability for combating soil desertification and for alleviating soil salinity/alkalinity9, which is a major problem both in China and globally73, and there are indications that it may also have a very high capacity for removal of petroleum from contaminated soil74. Therefore, this indicates that L. ruthenicum may have much higher potential for human use, than its current, highly localized, relevance appears to imply.The interpretation of our findings is hampered by different environmental parameters at the two sampled locations, as well as by the fact that LB has undergone generations of anthropogenic selection for higher growth, whereas the genome of LR is likely to be shaped solely by non-anthropogenic factors. As it was difficult to disentangle genetic from environmental variables, and anthropogenic from non-anthropogenic variables in our study, we limited the discussion of our results to the most highly pronounced transcriptomic and metabolomic differences between the two species. Previous studies found indications that Supplementary Figures.Supplementary Results.Supplementary Dataset S1.Supplementary Dataset S2.Supplementary Dataset S3.Supplementary Dataset S4.Supplementary Dataset S5.Supplementary Dataset S6."}
{"text": "We investigated the ability of the ascorbic acid (AA) and menadione (MD) combination, the well-known reactive oxidative species- (ROS-) generating system, to induce autophagy in human U251 glioblastoma cells. A combination of AA and MD (AA+MD), in contrast to single treatments, induced necrosis-like cell death mediated by mitochondrial membrane depolarization and extremely high oxidative stress. AA+MD, and to a lesser extent MD alone, prompted the appearance of autophagy markers such as autophagic vacuoles, autophagosome-associated LC3-II protein, degradation of p62, and increased expression of beclin-1. While both MD and AA+MD increased phosphorylation of AMP-activated protein kinase (AMPK), the well-known autophagy promotor, only the combined treatment affected its downstream targets, mechanistic target of rapamycin complex 1 (mTORC1), Unc 51-like kinase 1 (ULK1), and increased the expression of several autophagy-related genes. Antioxidant N-acetyl cysteine reduced both MD- and AA+MD-induced autophagy, as well as changes in AMPK/mTORC1/ULK1 activity and cell death triggered by the drug combination. Pharmacological and genetic autophagy silencing abolished the toxicity of AA+MD, while autophagy upregulation enhanced the toxicity of both AA+MD and MD. Therefore, by upregulating oxidative stress, inhibiting mTORC1, and activating ULK1, AA converts MD-induced AMPK-dependent autophagy from nontoxic to cytotoxic. These results suggest that AA+MD or MD treatment in combination with autophagy inducers could be further investigated as a novel approach for glioblastoma therapy. Glioblastoma multiforme (GBM) represents the most prevalent and aggressive brain tumor in the adult population . The staMenadione  is a lipid-soluble synthetic analog of vitamin K, metabolized by the human body into menaquinone (vitamin K2). Numerous studies showed potent anticancer activity of MD in various cancer cell lines, with both antiproliferative and direct cytotoxic action resulting in caspase-dependent , caspaseMacroautophagy (hereafter autophagy) represents a lysosome-dependent cellular degradation program for the removal of superfluous and dysfunctional organelles and proteins. Cytoplasmic components and organelles are sequestered within autophagosomes that subsequently fuse with lysosomes into autolysosomes, where the engulfed content is degraded and recycled. During the process of sequestration, a lipidated form of microtubule-associated protein 1 light chain 3 protein (LC3-II) is formed and recruited to the autophagosomal membrane. Therefore, the amount of LC3-II protein in the cell serves as an early autophagy marker. Molecules and cellular components selectively targeted for autophagic degradation are labeled by p62  and delivered to autophagosomes through an LC3-interacting region of p62. Subsequent degradation of this cargo receptor and specific autophagy substrate in the autolysosomes represents another important determinant of the ongoing autophagic process. The autophagy pathway is tightly controlled by the serine/threonine kinase activity of the main autophagy repressor, mechanistic target of rapamycin complex 1 (mTORC1). mTORC1 inhibits autophagy during nutrient-rich conditions by suppressing the activity of the autophagosome biogenesis-initiating complex consisting of Unc-51-like autophagy-activating kinase 1 (ULK1), autophagy-related 13 (Atg13), and focal adhesion kinase family interacting protein of 200 kD . Their aThe ability of both MD \u201332 and cThe present study demonstrates, for the first time, that the treatment of U251 human glioblastoma cells with AA increased MD-mediated AMPK-dependent autophagy through oxidative stress-dependent mTORC1 inhibition and subsequent ULK1 activation. Moreover, using both pharmacological and genetic approaches, we show that, in contrast to mild nontoxic autophagy triggered by MD, its increase by AA cotreatment contributed to the necrotic demise of glioblastoma cells.4Cl), bafilomycin A1 (BAF), trehalose (TREH), and N-acetylcysteine (NAC) are all purchased from Sigma-Aldrich .Ascorbic acid, menadione, Z-VAD, Q-VAD, staurosporine (STS), 3-methyladenine (3MA), ammonium chloride (NHThe absorbance of colored substrates (CV and MTT) was measured in an automated microplate reader . Flow cytometric analyses of apoptosis/necrosis, caspase activation, mitochondrial membrane potential, total intracellular production of ROS, mitochondrial superoxide, and intracellular acidic vesicles were conducted using FACSCalibur flow cytometer equipped with CellQuest Pro software . SDS-PAGE electrophoresis was performed on Hoefer's  standard vertical protein electrophoresis unit, while proteins were transferred to nitrocellulose membranes using Bio-Rad's  transfer unit. RT-qPCR analysis was performed on a Realplex2 Mastercycler . Light microscopy was conducted using an universal inverted microscope  equipped with Leica Microsystems DFC320 camera, while ultrastructural morphology of cells was analysed by Morgagni 268D electron microscope  using a MegaView III CCD camera equipped with iTEM software .2, in the RPMI cell culture medium  supplemented with 5% fetal calf serum (FCS), 2\u2009mM L-glutamine, 10\u2009mM sodium pyruvate, and penicillin/streptomycin . Cells were prepared for experiments using the conventional trypsinization procedure with trypsin/EDTA and seeded in 96-well flat-bottom plates (1 \u00d7 104 cells/well) for the 5 cells/well) for flow cytometric analysis, or 60\u2009mm Petri dishes (1 \u00d7 106 cells) for the electron microscopy, immunoblot, and reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR).The human glioblastoma cell line U251 was obtained from the European Collection of Animal Cell Cultures . The cells were incubated at 37\u00b0C, in a humidified atmosphere with 5% CO4Cl, and BAF, autophagy inducer TREH, or antioxidant NAC as described in figure legends.The cells were rested in a cell culture medium for 24\u2009h and then treated with AA, MD, and their combination, in the presence or absence of caspase inhibitors (Z-VAD and Q-VAD), apoptosis inducer STS, autophagy inhibitors 3MA, NHThe number of adherent cells and mitochondrial dehydrogenase activity, as the indicators of cell viability, was assessed by crystal violet (CV) and 3--2,5-diphenyl-tetrazolium bromide (MTT) reduction assay, respectively.For the CV test, cell cultures were washed with phosphate buffer saline (PBS) to remove nonadherent dead cells. The adherent, viable cells were fixed with methanol and stained with 10% CV solution  at room temperature for 15 minutes. After rigorous washing with water, CV was dissolved in 33% acetic acid. The absorbance of dissolved dye, corresponding to the number of adherent (viable) cells, was measured in an automated microplate reader at 570\u2009nm .For the MTT assay, cells were washed with PBS to avoid nonspecific reaction of MTT with AA, MTT  solution was added at a final concentration of 0.5\u2009mg/ml, and cultures were incubated for an additional hour. The solution was then removed, and cells were lysed with DMSO . The absorbance of the purple-colored formazan, which is in direct proportion to the number of metabolically active cells, was monitored by the automated microplate reader at 570\u2009nm . The results of both assays were presented as % viability relative to untreated control cultures, taken as 100% viable.https://www.combosyn.com).To describe the type of interaction between ascorbate and menadione, cells were treated with each agent alone and their appropriate combinations. The number of viable cells was determined by the CV assay. The values of the combination index (CI) reflecting synergistic (CI < 1), additive (CI = 1), or antagonistic interactions (CI > 1) were calculated according to the method designed by Chou and Talalay  using Co\u03bcg/ml) and PI (20\u2009\u03bcg/ml), and incubated in the dark for 15 minutes at 37\u00b0C. The green (FL1) and red (FL2) fluorescence was measured using FACSCalibur flow cytometer equipped with CellQuest Pro software  to evaluate the number of viable (annexin\u2212/PI\u2212), early apoptotic (annexin+/PI\u2212), and late apoptotic/necrotic cells (annexin+/PI+).Apoptotic and necrotic cell death was analyzed by double staining with fluorescein isothiocyanate- (FITC-) conjugated annexin V  and propidium iodide . Annexin V-FITC binds to phosphatidylserine exposed on the external surface of the cell in the early stage of apoptosis, while PI is a cell impermeable DNA-intercalating dye that labels cells with the damaged cell membrane. Cells were detached by trypsinization, stained with annexin V-FITC (2\u2009\u03bcg/ml) for 30 minutes at 37\u00b0C. The increase in green fluorescence (FL1) as a measure of caspase activity was determined using FACSCalibur flow cytometer equipped with Cell Quest Pro software. The results were expressed as the % of cells containing active caspases.Activation of caspases, the cysteine proteases involved in the execution of apoptotic cell death, was measured by flow cytometry after staining the cells with a cell-permeable, FITC-conjugated pancaspase inhibitor ApoStat . Cells were detached by trypsinization and stained with ApoStat (0.5\u2009\u03bcg/ml in a JC-1 staining buffer) for 20 minutes at 37\u00b0C. The green monomers and red aggregates were detected by FACSCalibur flow cytometer and analyzed using CellQuest Pro software. The results were presented as the fold change in red/green fluorescence ratio , with the decrease in FL2/FL1 reflecting mitochondrial depolarization.Mitochondrial membrane potential was assessed using JC-1 . This lipophilic cation, capable of entering selectively into mitochondria, has the property of altering aggregation status depending on mitochondrial membrane potential\u2014it changes reversibly from green monomeric form to orange/red aggregates as the membrane potential increases. Cells were detached by trypsinization and stained with JC-1 (5\u2009\u03bcM) was added to the cell cultures at the beginning of treatment, while MitoSOX Red (5\u2009\u03bcM) was added during the last 10 minutes of treatment. At the end of incubation, the cells were detached by trypsinization and washed in PBS. The mean intensity of green (FL1) or red (FL2) fluorescence, corresponding to total ROS production or mitochondrial superoxide generation, respectively, was determined using a FACSCalibur flow cytometer and CellQuest Pro software. The results were presented as the fold change relative to the FL1 (DHR) or FL2 (MitoSOX Red) value of the untreated cells, which was arbitrarily set to 1.The total intracellular production of ROS and mitochondrial superoxide generation were determined using dihydrorhodamine 123 (DHR) and MitoSOX Red , respectively, as previously described . DHR is \u03bcM) for 1 hour at 37\u00b0C, washed in PBS, trypsinized, and analyzed using a FACSCalibur flow cytometer and CellQuest Pro software. The results were presented as a fold increase in the mean fluorescence intensity relative to the FL2 value obtained in untreated cells, which was arbitrarily set to 1.The intracellular acidic vesicles  were stained with LysoTracker Red DND-99  and analyzed by flow cytometry. LTR consists of a red fluorophore DND-99 linked to a weak base that is only partially protonated at neutral pH, allowing LTR to freely permeate cell membranes and selectively accumulate in acidic vesicles due to their low pH. The cells were incubated with LTR . Rabbit anti-human antibodies against microtubule-associated protein 1 light-chain 3B (LC3B), mTOR, phospho-mTOR (Ser2448), AMPK\u03b1, phospho-AMPK\u03b1 (Thr-172), p70S6 kinase (S6K), phospho-S6K (Thr389), ULK1, phospho-ULK1 (Ser317), beclin-1, cleaved caspase 3, poly (ADP-ribose) polymerase-1 (PARP1), and \u03b2-actin , mouse anti-human antibodies against p62/sequestosome 1 , and TFEB  were used as primary antibodies, whereas peroxidase-conjugated goat anti-rabbit IgG  and goat anti-mouse IgG  were used as secondary antibodies. The specific protein bands were visualized by chemiluminescence using the Amersham reagent  on a ChemiDoc Imaging System . The signal intensity was quantified by densitometry using ImageJ software , and the ratio between phosphorylated and corresponding total protein signals or actin  was calculated. The results were presented relative to the signal intensity of the untreated control, which was arbitrarily set to 1.Immunoblotting was used to assess the expression/activation of specific proteins. At the end of treatment, the dead cells were removed with cold PBS and the remaining adherent cells were lysed in lysis buffer  on ice for 30 minutes. The cell lysates were centrifuged at 14000\u03bcg of RNA was used in the reverse transcription reaction using M-MuLV reverse transcriptase and random hexamer primers  according to the manufacturer's instructions. RT-qPCR analysis was performed in a Realplex2 Mastercycler  using 96-well reaction plates , Maxima Hot start PCR Master Mix , and the TaqMan primers/probes for human ATG3 (Hs00223937_m1), ATG13 (Hs00207186_m1), forkhead box O1 , forkhead box O3F , UV radiation resistance-associated gene , Bax-interacting factor 1/endophilin-B1 , autophagy/beclin-1 regulator 1 , \u03b3-aminobutyric acid receptor-associated protein , phosphatidylinositol 3-kinase catalytic subunit type 3 , beclin-1 (Hs00186838_m1), p62/sequestosome 1 (Hs00177654_m1), and 18S ribosomal RNA  . The thermal cycle conditions were 95\u00b0C for 4\u2009min, followed by 40 cycles of 15\u2009s at 95\u00b0C and 1\u2009min at 60\u00b0C. All reactions were performed in triplicates. The average cycle of threshold (Ct) values of 18\u2009s RNA as housekeeping gene was subtracted from the Ct values of target genes to obtain \u0394Ct, and relative gene expression was determined as 2\u2212\u0394Ct. The results were presented relative to the control value, which was arbitrarily set to 1.RT-qPCR was used to determine the expression of ATG genes. Total RNA was extracted from cells with TRIzol Reagent , and 1\u2009For the analysis of ultrastructural morphology by TEM, cells were trypsinized, fixed in 3% glutaraldehyde in cacodylate buffer, postfixed in 1% osmium tetroxide, dehydrated in graded alcohols, and then embedded in epoxy medium . The ultrathin sections were stained in uranyl acetate and lead citrate and examined using a Morgagni 268D electron microscope . The images were acquired using a MegaView III CCD camera equipped with iTEM software .\u03bcl) and siRNA oligomers (100\u2009nM), as well as Lipofectamine 2000 (2.8\u2009\u03bcg/ml), were dissolved and incubated for 5 minutes in Opti-MEM medium without FCS and antibiotics. The equal amounts of medium with siRNA or plasmid and medium with Lipofectamine 2000 were mixed and incubated for 20 minutes, allowing the formation of RNA-liposome or plasmid-liposome complexes. Afterwards, the cells were incubated with siRNA/Lipofectamine 2000 or plasmid/Lipofectamine 2000 mixture for 8\u2009h. Cells were rested for 24\u2009h following transfection and then treated with AA and MD.Small interfering RNA (siRNA) targeting human LC3 and beclin-1, as well as scrambled control siRNA, were obtained from Santa Cruz Biotechnology . The empty control (pcDNA3) and transcription factor EB- (TFEB-) encoding plasmid vectors were kindly donated by Dr Viktor I. Korolchuk . The transfection of U251 cells with plasmids and siRNA was performed in 96-well microplates for cell viability assays, or in 6-well plates for flow cytometry, using Lipofectamine 2000 . The plasmids  for 24\u2009h  only slightly decreased the number of adherent viable cells and mitochondrial dehydrogenase activity measured by CV  and/or MD , RT-qPCR analysis demonstrated the ability of combined treatment to stimulate the expression of autophagy transcription factors FOXO1 and FOXO3, as well as proautophagic regulators ATG13, BIF, and UVRAG  and a decrease in levels of major oncometabolite succinate [2O2, 2-methoxyestradiol, and mitochondrial electron transport chain inhibitors) caused autophagy-mediated cell death in U87 GBM cells, but failed to significantly affect redox homeostasis and induce autophagy in primary mouse astrocytes [Numerous studies show that AA+MD combination selectively targets various cancer cells, including GBM , 71, oveuccinate , 40 appeuccinate , due to uccinate , thus enuccinate  and subsuccinate . The lowuccinate  and glutuccinate  could couccinate  or diffeuccinate , 78. Theuccinate  demonstrtrocytes , 78. OveIn conclusion, the present study demonstrates that ROS-dependent modulation of mTORC1 and ULK1 activity triggers an excessive autophagic response that contributes to the synergistic induction of necrotic death in U251 cells exposed to a combination of AA and MD . While t"}
{"text": "Current deep-learning models are mostly built upon neural networks, i.e. multiple layers of parameterized differentiable non-linear modules that can be trained by backpropagation. In this paper, we explore the possibility of building deep models based on non-differentiable modules such as decision trees. After a discussion about the mystery behind deep neural networks, particularly by contrasting them with shallow neural networks and traditional machine-learning techniques such as decision trees and boosting machines, we conjecture that the success of deep neural networks owes much to three characteristics, i.e. layer-by-layer processing, in-model feature transformation and sufficient model complexity. On one hand, our conjecture may offer inspiration for theoretical understanding of deep learning; on the other hand, to verify the conjecture, we propose an approach that generates deep forest holding these characteristics. This is a decision-tree ensemble approach, with fewer hyper-parameters than deep neural networks, and its model complexity can be automatically determined in a data-dependent way. Experiments show that its performance is quite robust to hyper-parameter settings, such that in most cases, even across different data from different domains, it is able to achieve excellent performance by using the same default setting. This study opens the door to deep learning based on non-differentiable modules without gradient-based adjustment, and exhibits the possibility of constructing deep models without backpropagation. Deep learning  has becoThough deep neural networks are powerful, they have many deficiencies. First, DNNs have too many hyper-parameters, and the learning performance depends seriously on careful parameter tuning. Indeed, even when several authors all use convolutional neural networks , they arIn order to tackle complicated learning tasks, learning models are likely to have to go deep. Current deep models, however, are always built upon neural networks. As discussed above, there are good reasons to explore non-NN-style deep models or, in other words, to consider whether deep learning can be realized with other modules, as they have their own advantages and may exhibit great potential if they are able to go deep. In particular, considering that neural networks are multiple layers of parameterized differentiable non-linear modules, whereas not all properties in the world are differentiable or best modeled as differentiable, in this paper we attempt to address the question of whether deep learning can be realized with non-differentiable modules.The answer to the question may help understand important issues such as (1) do deep models have to be DNNs, or must deep models be constructed with differentiable modules? Note that there is research involving non-differentiable activation functions in DNNs; however, it usually uses differentiable functions that give an upper bound to the non-differentiable ones for relaxation in the optimization/learning process, and thus they actually still work with differentiable modules. (2) Is it possible to train deep models without backpropagation? Note that backpropagation and gradient-based adjustment require differentiability. (3) Is it possible to enable deep models to win tasks on which other models such as random forest or XGBoost are now superior? Actually, the machine-learning community has developed lots of learning modules, but many of them are non-differentiable and can hardly be tuned by gradient-based adjustment; it would be interesting to know whether it is possible to construct deep models based on these modules.In this paper, we extend our preliminary research , which pThe section entitled \u2018Ensemble learning and diversity' briefly introduces ensemble learning and \u2018What is crucial for deep models?' explains our design motivations by analyzing why deep learning works. The section entitled \u2018The gcForest approach' proposes our approach, followed by experiments reported in the section entitled \u2018Experiments'. The section entitled \u2018Real application' briefly presents a real application and the following section discusses some related work. The section entitled \u2018Future issues' raises some issues for future exploration, followed by a section with some concluding remarks.Ensemble learning  is a macE denotes the error of an ensemble, To construct a good ensemble, the individual learners should be accurate and diverse. Combining only accurate learners is often inferior to combining some accurate learners with some relatively weaker ones, because the complementarity is more important than pure accuracy. Actually, a beautiful equation has been theoretically derived from error-ambiguity decomposition :(1)\\dociversity , and \u2018whIn practice, diversity enhancement is based on randomness injection during training. Roughly speaking, there are four major categories of strategies . The firIt is widely recognized that the representation learning ability is crucial for the success of deep neural networks. What is crucial for representation learning in DNNs? We believe that the answer is layer-by-layer processing. Figure\u00a0Considering that, if other issues are fixed, large model complexity  generally leads to strong learning ability, maybe it sounds reasonable to attribute the successes of DNNs to the huge model complexity. This, however, cannot explain the fact that shallow networks are not as successful as deep ones, as one can increase the complexity of shallow networks to almost arbitrarily high by adding a nearly infinite number of hidden units. Consequently, we believe that the model complexity itself cannot explain the success of DNNs. Instead, we conjecture that the layer-by-layer processing is one of the most important factors behind DNNs because shallow networks, no matter how large their complexity can be, cannot do layer-by-layer processing. This conjecture offers important inspiration for the design of gcForest.Then, how do we explain the fact that traditional learning models that can do layer-by-layer processing, e.g. decision trees and boosting machines, are not as successful as DNNs? We believe that the distinguishing factor lies in the fact that, in contrast to DNNs where new features are generated as illustrated in Fig.\u00a0Overall, we conjecture that behind the mystery of DNNs there are three crucial characteristics, i.e. layer-by-layer processing, in-model feature transformation, and sufficient model complexity. To verify our conjecture, in the next section we will try to endow non-NN-style deep models with these characteristics.To realize layer-by-layer processing, gcForest employs a cascade structure, as illustrated in Fig.\u00a0d is the number of input features) and selecting the one with the best Gini value for splitting. The number of trees in each forest is a hyper-parameter.Each level is an ensemble of decision-tree forests, i.e. an ensemble of ensembles. Here, we include different types of forests to encourage diversity. For simplicity, suppose that we use two completely random forests and two random forests . Each coGiven an instance, each forest can produce an estimate of class distribution, by counting the percentage of different classes of training examples at the leaf node where the concerned instance falls, and then averaging across all trees in the same forest, as illustrated in Fig.\u00a0The estimated class distribution forms a class vector, which is then concatenated with the original feature vector to input to the next level. For example, suppose there are three classes; each of the four forests will produce a 3D class vector; consequently, the next level will receive 12\u00a0(= 3 \u00d7 4) augmented features.Note that here we take the simplest form of class vectors, i.e. the class distribution at the leaf nodes into which the concerned instance falls. It is evident that such a small number of augmented features may deliver very limited augmented information, and it is very likely to be drowned out when the original feature vectors are high-dimensional. We will show in experiments that such a simple feature augmentation is already beneficial, and it is expected that more profit can be obtained if more augmented features are involved. Actually, it is apparent that more features may be incorporated, such as class distribution of the parent nodes, which express prior distribution, the sibling nodes, which express complementary distribution, etc. We leave these possibilities for future exploration.k-fold cross validation. In detail, each instance will be used as training data k \u2212 1\u00a0times, resulting in k \u2212 1 class vectors, which are then averaged to produce the final class vector as augmented features for the next level of the cascade. After expanding a new level, the performance of the whole cascade can be estimated on the validation set, and the training procedure will terminate if there is no significant performance gain; thus, the number of cascade levels can be automatically determined. Note that the training error rather than cross-validation error can also be used to control the cascade growth when the training cost is concerned or limited computation resources are available. In contrast to most deep neural networks whose model complexity is fixed, gcForest adaptively decides its model complexity by terminating training when adequate. This enables it to be applicable to different scales of training data, not limited to large-scale ones.To reduce the risk of overfitting, the class vector produced by each forest is generated by Deep neural networks are powerful in handling feature relationships, e.g. convolutional neural networks are effective on image data where spatial relationships among the raw pixels are critical; recurrent neural networks are effective on sequence data where sequential relationships are critical. Inspired by this recognition, we enhance the cascade forest with a procedure of multi-grained scanning.As Fig.\u00a0For instances extracted from the windows, we simply assign them with the label of the original training example. Some label assignments are inherently incorrect. For example, suppose that the original training example is a positive image about \u2018car'; it is clear that many extracted instances do not contain a car, and therefore they are incorrectly labeled as positive. This is actually related to flipping output , an apprNote that when transformed feature vectors are too long to be accommodated, feature sampling can be performed, e.g. by subsampling the instances generated by sliding window scanning, as completely random trees do not rely on feature split selection whereas random forests are quite insensitive to feature split selection. The feature sampling process is also related to random subspace , an apprFigure\u00a0m training examples, a window with a size of 100 features will generate a data set of 301 \u00d7 m 100D training examples. These data will be used to train a completely random forest and a random forest, each containing 500 trees. If there are three classes to be predicted, a 1806D feature vector will be obtained as described in the section entitled \u2018Cascade forest structure'. The transformed training set will then be used to train the first grade of the cascade forest.Figure\u00a0A to Level 1C in Fig.\u00a0Similarly, sliding windows with sizes of 200 and 300 features will generate 1206D and 606D feature vectors, respectively, for each original training example. The transformed feature vectors, augmented with the class vector generated by the previous grade, will then be used to train the second and third grades of the cascade forests, respectively. This procedure will be repeated till convergence of validation performance. In other words, the final model is actually a cascade of cascades, where each cascade consists of multiple levels each corresponding to a grain of scanning, e.g. the first cascade consists of Level 1Given a test instance, the multi-grained scanning procedure will be gone through to get the corresponding transformed feature representation, and then the cascade will be gone through till the last level. The final prediction will be obtained by aggregating the four 3D class vectors at the last level, and the class with the maximum aggregated value will be output.Table\u00a0We compare gcForest with deep neural networks and several other popular learning algorithms. The implementations are based on Python, with neural networks from Keras and traditional learning algorithms from Sklearn.d raw features, we use feature windows with sizes of \u230ad/16\u230b, \u230ad/8\u230b, \u230ad/4\u230b; if the raw features have panel structure (such as images), the feature windows also have panel structure, as shown in Fig.\u00a0In all experiments gcForest is using the same cascade structure: Each level consists of four completely random forests and four random forests, each containing 500 trees, as described in the section entitled \u2018Cascade forest structure'. Three-fold cross validation is used for class vector generation. The number of cascade levels is automatically determined. In detail, we split the training set into two parts, i.e. a growing set and an estimating set.  Then we use the growing set to grow the cascade, and the estimating set to estimate the performance. If growing a new level does not improve the performance, the growth of the cascade terminates and the estimated number of levels is obtained. Then, the cascade is retrained based on merging the growing and estimating sets. For all experiments we take 80% of the training data for the growing set and 20% for the estimating set. For multi-grained scanning, three window sizes are used. For For deep neural network configurations, we use ReLU for the activation function, cross-entropy for the loss function, Adadelta for optimization, and a dropout rate of 0.25 or 0.5 for hidden layers according to the scale of the training data. The network structure hyper-parameters, however, cannot be fixed across tasks, otherwise the performance will be embarrassingly unsatisfactory. For example, a network attained 80% accuracy on the ADULT dataset but achieved only 30% accuracy on YEAST with the same architecture (only the numbers of input/output nodes were changed to suit the data). Therefore, for DNNs, we examine a variety of architectures on the validation set and pick the one with the best performance, then re-train the network on the training set and report the test accuracy.We run experiments on a broad range of tasks, with data types of image, audio, time series, text, etc.The MNIST dataset  containskNN (k = 3) test accuracies are 76.00%/83.33%/92.50%, SVM (rbf kernel) 80.50%/82.50%/85.00%, and random forest 91.00%/93.33%/95.00%, whereas gcForest attains 91.00%/96.67%/97.50% by simply using the default settings.The ORL dataset  containsThe GTZAN dataset  containsThe sEMG dataset  consistsThe IMDB dataset  containsWe also evaluate gcForest on UCI datasets  with a rThe CIFAR-10 dataset  containsAs we discussed in the section entitled \u2018The gcForest approach', currently we include only a 10-dim augmented feature vector from each forest, and such a small number of augmented features will be easily drowned out by the original long feature vector. Nevertheless, though the test accuracy of gcForest with the default setting, 61.78%, is inferior to state-of-the-art DNNs, it is already the best among non-DNN approaches. Moreover, the performance of gcForest can be further improved via task-specific tuning, e.g. by including more grains (i.e. using more sliding window sizes in multi-grained scanning) like gcForest(5grains), which uses five grains and attains 63.37%. It is also interesting to see that the performance undergoes a significant improvement to 69.00% with gcForest(gbdt), which simply replaces the final level with GBDT . The secOur experiments use a PC with two Intel E5 2695 v4 CPUs (18 cores), and the running efficiency of gcForest is good. For example, for the IMDB dataset (25\u2009000 examples with 5000 features), it takes 267.1 seconds per cascade level, and automatically terminates with nine cascade levels, amounting to 2404 seconds or 40 minutes. In contrast, an MLP compared on the same dataset requires 50 epochs for convergence and 93 seconds per epoch, amounting to 4650 seconds or 77.5 minutes for training; 14 seconds per epoch (with a batch size of 32) if using a GPU , amounting to 700 seconds or 11.6 minutes. Multi-grained scanning will increase the cost of gcForest; however, the different grains of scanning are inherently parallel. Also, both completely random forest and random forest are parallel ensemble methods . Thus, tFigure\u00a0To study the separate contribution of the cascade forest structure and multi-grained scanning, we compare gcForest with a cascade forest on the MNIST, GTZAN and sEMG datasets. The test accuracies with/without multi-grained scanning are 99.26%/65.67%/71.30% and 98.02%/52.33%/48.15% on MNIST/GTZAN/sEMG, respectively. It is evident that, when there are spatial or sequential feature relationships, multi-grained scanning helps improve performance.To study the contribution of completely random forest, we compare gcForest with its variant, which replaces completely random forests by random forests. The test accuracies with/without completely random forests are 99.26%/89.16%/97.40% and 99.11%/87.62%/96.65% on MNIST/IMDB/LETTER, respectively. It shows that completely random forest helps no matter whether multi-grained scanning is applied (MNIST) or not (IMDB), or whether data are low-dimensional (LETTER).The final model structure of gcForest is a cascade of cascades, where each cascade consists of multiple levels each corresponding to a grain of scanning, as shown in Fig.\u00a0Table\u00a0Figure\u00a0Note that computational facilities are crucial for enabling the training of larger models; e.g. GPUs for DNNs. On one hand, some new computational devices, such as Intel KNL of the MIC (many integrated core) architecture, may offer acceleration for gcForest. On the other hand, some components of gcForest, e.g. multi-grained scanning, may be accelerated by GPUs. Moreover, there is plenty of room for improvement with distributed computing implementations.gcForest has been implemented in an industrial distributed-machine-learning platform and applied to real-world illegal cash-out fraud detection by a big unicorn enterprise . On a daThe gcForest is a decision-tree ensemble approach. There are studies showing that by using ensembles such as random forest facilitated with DNN features, the performance can be even better than simply using DNNs . Our purRandom forest , which hMany works have tried to connect random forest with neural networks, such as converting cascaded random forest to CNNs  and explThe multi-grained scanning procedure of gcForest uses different sizes of sliding windows to examine the data; this is somewhat related to wavelet and other multi-resolution examination procedures . For eacThe cascade procedure of gcForest is related to boosting , which iPassing outputs of one level of learners as inputs to another level of learners is related to stacking ,44. HoweAs a tree-based approach, gcForest might be potentially more useful for theoretical analysis than deep neural networks, although this is beyond the scope of this paper. Indeed, some recent theoretical studies about deep learning, e.g. , seem moOne important future issue is to enhance the feature re-representation process. The current implementation of gcForest takes the simplest form of class vectors, i.e. the class distribution at the leaf nodes into which the concerned instance falls. Such a small number of augmented features will be easily drowned out when the original feature vectors are high-dimensional. It is apparent that more features may be involved. Intuitively, more features may enable the incorporation of more information, although this is not always necessarily helpful for generalization. Moreover, a longer class vector may enable a joint multi-grained scanning process, leading to more flexibility of re-representation. Recently we have shown that a decision forest can serve as AutoEncoder . On one Another important future issue is to accelerate and reduce the memory consumption. Building larger models may lead to better performance, where computational facilities are crucial for enabling the training of larger models. The success of DNNs owes much to the acceleration offered by GPUs, but forest structure is unfortunately not suitable for GPUs. One possibility is to consider some new computational devices such as KNL; another is distributed computing implementation. Feature sampling can be executed when transformed feature vectors produced by multi-grained scanning are too long to be accommodated; this not only helps storage reduction, but also offers another channel to enhance the diversity. It is also possible to explore smarter sampling strategies such as BLB  or featuThe adoption of completely random forest not only helps diversity enhancement, but also provides an opportunity to exploit unlabeled data. Note that the growth of completely random trees does not require labels; label information is only needed for annotating leaf nodes. Intuitively, for each leaf node it might be possible to require only one labeled example if the node is to be annotated according to the majority cluster on the node, or one labeled example per cluster if all clusters in the node are non-negligible. This offers gcForest the opportunity of incorporating active learning  and/or sThe gcForest is able to achieve a performance highly competitive with DNNs on a broad range of tasks except some large-scale image tasks. Indeed, DNNs are very successful in image tasks, e.g. ,54. On oThis paper attempts to address the question of whether deep learning can be realized with non-differentiable modules. We conjecture that behind the mystery of deep neural networks there are three crucial characteristics, i.e. layer-by-layer processing, in-model feature transformation, and sufficient model complexity. To verify the conjecture, we try to endow a non-NN-style deep model with these characteristics, and our results show that it really works.The proposed gcForest approach  is ableThere are other possibilities for constructing deep forest. As a seminal study, we have only explored a little in this direction. Indeed, the most important value of this paper lies in the fact that it may open the door for non-NN-style deep learning, or deep models based on non-differentiable modules that do not rely on gradients."}
{"text": "Anomalous aortic origin of a coronary artery (AAOCA) is a rare congenital heart disease, characterized by the coronary artery inappropriately originates from the aorta. It is usually classified according to the sinus where the coronary artery arises from, while anomalous origin of the right coronary being the most common type.In this case report, we described a rare case of Tetralogy of Fallot (TOF) in a 1-year-old boy, who also had the anomalous right coronary artery that originated from the left coronary sinus without an intramural segment. Besides TOF repair, lateral pulmonary translocation was undertaken in order to avoid risks of myocardial ischemia.We successfully completed a one-stage operation consisting of TOF repair and pulmonary artery translocation in a 1-year-old boy. We advocated early operation of pulmonic translocation for AAOCA patients without an intramural segment instead of unroofing procedure. Anomalous aortic origin of a coronary artery (AAOCA) is a rare congenital heart condition, in which the origin of a coronary artery that arises from the aorta is abnormal, and the coronary artery usually has an intramural segment . The preAll types of AAOCA are associated with increased risks of myocardial ischemia and SAD, especially in young athletes . StudiesA 1-year-old boy presented to our center from a regional hospital for further assessment and management of TOF. The child was found to have structural abnormalities of the heart in his fetal stage. He presented with mild cyanosis, slight shortness of breath after activity, and poor feeding. Physical examination revealed a normal growth level at the height of 78\u00a0cm and the weight of 8.5\u00a0kg. On further investigation, the transoesophageal echocardiography (TEE) demonstrated the common features of TOF consisting of a 14-mm ventricular septal defect (VSD), pulmonary valve stenosis with a 5-mm valve ring, supravalvular pulmonary stenosis with a 4-mm local inner diameter, subvalvular pulmonary stenosis with a 5-mm infundibular pulmonary artery, 40% overriding of the aorta above VSD, and 6-mm-thickness right ventricular anterior wall. The Color Doppler assessment demonstrated a shunt flow mainly from the left ventricle to the right at the level of VSD, pulmonary valve stenosis and supravalvular pulmonary stenosis with a pressure gradient of 106\u00a0mmHg, infundibular pulmonary artery stenosis with a pressure gradient of 78\u00a0mmHg, and mild mitral and tricuspid regurgitation. Further assessment with computed tomography (CT) not only confirmed the diagnosis of TOF but also revealed both anomalous RCA and the normal LCA arose from the left coronary sinus, which coursed between the aorta and the pulmonary artery without an intramural segment Fig.\u00a0.Fig. 1CoGiven the clinical features and radiological findings, a one-stage operation was carried out, which consisted of TOF repair  and lateral pulmonary translocation that aimed to improve coronary flow. A median sternotomy was performed, and cardiopulmonary bypass was initiated through aortic and bi-caval cannulation. Antegrade cardioplegia was administrated to induce cardiac arrest. TOF repair was first performed, followed by pulmonary artery translocation by introducing an autologous blood vessel patch of the right pulmonary artery and inserting this patch in the lateral aspect of the main pulmonary artery. Postoperatively, the TEE showed no residual shunting, mitral or tricuspid regurgitation, with the CT revealed normal blood flow of RCA without inter-arterial compression. The boy was stable during the immediate postoperative period with no arrhythmia or cyanosis. He recovered uneventfully and was discharged from the hospital.Being a rare congenital cardiac disease, the reported prevalence of AAOCA in the general population varies widely, with the true incidence remains unknown . As prevThe clinical manifestations of patients with AAOCA also vary, ranging from complete lack of symptoms to obvious myocardial ischemia such as chest pain and SAD, though the exact mechanisms and the crucial risk factors leading to SAD have not been well understood . An incrAs the most accepted surgical procedure for AAOCA with intramural segments, unroofing could reduce the incidence of SAD. Alternatively, translocation and reimplantation can be performed for those without intramural segments , for thiIn summary, our case has demonstrated the feasibility and success of a one-stage operation consisting of TOF repair and pulmonary artery translocation for a patient presented with both the TOF and anomalous RCA that arose from the left coronary sinus without an intramural segment. Although rare, patients with such complex congenital heart disease should be considered for simultaneous repair of all the anomalies for the best possible long-term outcome."}
{"text": "The role of trimethylamine N-oxide (TMAO) in cardiovascular diseases has been highlighted. Nevertheless, the associations of large-artery atherosclerotic (LAA) stroke with TMAO and blood lipid-related indices are little investigated.  A cross-sectional comparative study was performed on 50 patients with LAA stroke and 50 healthy controls. Basic demographic data, common vascular risk factors, and blood lipid-related indices were collected. Plasma TMAO was detected through liquid chromatography tandem mass spectrometry. Multivariable unconditional logistic regression analyses were run to assess the associations of LAA stroke with plasma TMAO level and blood lipid-related indices. The area under the curve (AUC) of the receiver operating characteristic (ROC) was computed to assess the diagnostic performance of plasma TMAO level and blood lipid-related indices for LAA stroke. p < 0.01) and Apo-B  were observed in LAA stroke patients, while lower Apo-A1 , Apo-A1 to Apo-B ratio , and HDL-C  were found in LAA stroke patients after adjusted for age and gender. Moreover, plasma TMAO , Apo-A1 , Apo-B , Apo-A1 to Apo-B ratio , and HDL-C  showed good diagnostic values for LAA stroke in adjusted models.  Compared with healthy controls, the elevated plasma TMAO level (odds ratio [OR], 7.03; 95% confidence interval [CI], 2.86, 17.25;  The plasma TMAO level, Apo-A1, Apo-B, and HDL-C are important biomarkers for LAA stroke patients. Stroke is a significant cause of death worldwide , and larN-oxide (TMAO) with the pathogenesis of cardiovascular disease has been attracted [Recently, more attention on the association of plasma trimethylamine ttracted \u201310. Prevttracted , atherotttracted , ischemittracted , and strttracted . Plasma ttracted . It may ttracted . Moreovettracted \u201318, whicOn the above grounds, we speculate that plasma TMAO level and blood lipid-related indices may be associated with LAA stroke patients. Therefore, in this cross-sectional comparative study, we aimed to investigate whether circulating TMAO level and blood lipid-related indices are associated with LAA stroke.This comparative study was performed from October 2018 to November 2019. All subjects were enrolled from two research centers in China . The local Ethics Committees of Xuanwu Hospital, Capital Medical University (LYS2018008), and Dongyang People's Hospital, Wenzhou Medical University (2017-KY-036), approved the study protocols. All subjects and/or their legal representatives provided written informed consent.The 50 LAA stroke patients who suffered acute cerebral ischemia, meeting the stroke diagnostic criteria formulated by the Chinese cerebrovascular disease classification and were validated by magnetic resonance imaging (MRI) and/or computed tomography (CT) scan , were se50 healthy controls were recruited from relatives of outpatients or inpatients (including their immediate family members). Their inclusion criteria were as follows: (1) aged 18 years or older, (2) Han Chinese, (3) no limitation on gender, (4) no history of cerebrovascular diseases, (5) no history of atherosclerotic diseases in the carotid arteries, (6) no the atrial fibrillation, and (7) regular physical examinations. Exclusion criteria were not different from the exclusion criteria of the stroke patient group.\u03bcL, 10\u2009\u03bcmol/L d9-TMAO, and 20\u2009\u03bcL plasma was vortexed for 1 minute. The supernatant was centrifuged at 15,000 \u00d7 g at 4\u00b0C for 25\u2009min and then transferred to a new sample bottle for the check. The 10\u2009mL of supernatant was injected directly into a silica column at a flow rate of 0.8\u2009mL/min with 80% A (0.1% formic acid in water) and 20% B (methanol). TMAO and d9-TMAO were detected by the positive multiple reaction monitoring mass spectrometry mode by characteristic precursor\u2013production transitions including m/z 76/58 and m/z 85/66. For detection of TMAO concentration, a standard curve using multiknown concentrations of TMAO was used. The median (interquartile range) of healthy participants' reference values was 2.8 (1.9-4.8) \u03bcmol/L. The intra-assay and interassay coefficients of variation were 1.9%-5.6% and 2.9%-8.4%, respectively. Testers were blind to all subjects' clinical data.The overnight fasting blood samples were collected for routine blood lipid-related indices at 6: 00 to 7: 00\u2009AM before breakfast. Plasma was prepared from the blood of EDTA tube and kept at -80\u00b0C until examination. Plasma TMAO level was qualified via stable isotope dilution liquid chromatography tandem mass spectrometry, consistent with the previous reported , 13. In b = 1,000\u2009s/mm2, 2\u2009mm isotropic resolution, and 30 diffusion directions), and 3D time-of-flight angiography. The slice layer of MRI was 5\u2009mm, and the slice interval was 1.5\u2009mm. Acute cerebral infarction was defined as high signal intensity on the DWI sequence. Infarct areas were manually qualified on DWI sequences. The images were collected and analyzed by experienced stroke neurologists who were blind to the participants' other characteristics. Infarct volumes were computed by slice layer multiplied by infarct area in each slice.Imaging acquisition details were standardized in both sites. The area of carotid artery plaque was measured via the common color Doppler ultrasound system by measuring the areas of unstable and stable carotid artery plaques. All patients received MRI within 24 hours of hospitalization with a 1.5 T or 3.0 T scanner. The sequence includes axial spin-echo T1-weighted sequence, T2-weighted sequence, fluid-attenuated inversion recovery sequence, DWI sequence , apolipoprotein A1 (Apo-A1), apolipoprotein B (Apo-B), Apo-A1/B ratio, total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG), D-Dime, and thrombin time (TT)). Model 1 was unadjusted. Model 2 was adjusted for sex and age. The area under the curves (AUCs) of the receiver operating characteristic (ROC) were also calculated to assess their diagnostic performance of these abovementioned indices. Correlations between plasma TMAO and Lp-a, Apo-A1, Apo-B, Apo-A1/B ratio, TC, HDL-C, LDL-C, TG, D-Dimer, and TT were calculated using Spearman's correlation.Statistical tests were conducted using SAS, version 9.4 (SAS Institute Inc). Chi-square test or Fisher's exact test was used to compare group differences of categorical variables. Mann-Whitney p < 0.01). Significance was also observed between LAA stroke patients and healthy controls in age, gender, smoking, alcohol, diabetes, and hypertension, the volume of acute cerebral infarction, Lp-a, Apo-A1, Apo-B, the ratio of Apo-A1/B, HDL-C, and D-Dimer (p < 0.05), while no statistical differences were found in obesity, area of carotid artery plaque, TC, LDL-C, TG, and TT (p > 0.05).50 LAA stroke patients and 50 healthy controls were included in the study. p < 0.01), while lower Apo-A1 , lower Apo-A1 to Apo-B ratio , lower TC , and lower HDL-C  were associated with higher risks of LAA stroke patients in an unadjusted model.The multivariate unconditional logistic regression analyses revealed that elevated plasma TMAO was associated with higher risk of LAA stroke  and higher Apo-B  were associated with higher risks of LAA stroke, while lower Apo-A1 , lower Apo-A1 to Apo-B ratio , and lower HDL-C  were observed in LAA stroke patients.After adjusting for sex and age, logistic regression exhibited that higher plasma TMAO level  and lower Apo-A1 to Apo-B ratio  were found to have good diagnostic performance for vulnerable LAA stroke in an unadjusted model.While adjusted for sex and age in multivariate unconditional logistic regression, the elevated plasma TMAO  and the increased Apo-B  were of significant diagnostic values for vulnerable LAA stroke. By contrast, the lower Apo-A1 , the lower Apo-A1 to Apo-B ratio , and lower HDL-C  showed good diagnostic ability for suffering LAA stroke.\u03b2 = 4.49, p = 0.04) (p > 0.05)  . Further > 0.05) .The main findings of this study include plasma TMAO level in LAA stroke patients was significantly higher than that of the control group. Furthermore, for LAA stroke patients, the increased plasma TMAO level and Apo-B were risk factors, while lower Apo-A1, Apo-A1 to Apo-B ratio, and HDL-C were risk factors. Moreover, the increased plasma TMAO level and Apo-B were good diagnostic values for susceptible LAA stroke, but lower Apo-A1, Apo-A1 to Apo-B ratio, and HDL-C were good diagnostic values for suffering LAA stroke. Interestingly, the elevated plasma TMAO level was positively correlated with the area of carotid artery plaque in healthy controls, but not associated with the volume of acute cerebral infarction and area of carotid artery plaque in LAA stroke patients.Our results also replicated the previous reports on the risk factors included age, smoking, alcohol drinking, diabetes, and hypertension , 22 and In our study, the result that the elevated plasma TMAO and Apo-B were found to be risk factors for LAA stroke may be important manageable biological markers for exploring the potential of having LAA stroke in those with large-artery atherosclerosis. These markers combined with other factors on blood lipid-related indices, such as Apo-A1, Apo-A1 to Apo-B ratio, and HDL-C, may reflect the progress of pathogenesis of LAA stroke and be a panel of assessments for individuals with large-artery atherosclerosis without stroke. It has been reported that plasma TMAO is a potential mediator of the pathogenesis of atherosclerotic diseases, including stoke and myocardial infarction . Our finOur study did not reveal that the elevated plasma TMAO was positively correlated with the area of carotid artery plaque in healthy controls but not significantly correlated with volume of acute cerebral infarction and area of carotid artery plaque in LAA stroke patients. The previous study supported this point of our results . It showThe strengths of the study include a homogeneous LAA stroke population, blind evaluation on TMAO and imaging collection and analysis, and simultaneous detection of multiple blood lipid indicators. The study has limitations. Firstly, the sample was not big in both groups; the results of the current study should be confirmed in a large sample. Secondly, the positive control group, such as different stroke types, was a lack in this study. The positive control group of stroke, except for LAA stroke, should be designed for exploring the role of plasma TMAO and the associations of TMAO and blood lipid-related indices in various types of stroke, including different LAA strokes with various responsible large arteries. Lastly, the potential factors on plasma TMAO level, including diet, gut microbiota, drug management, and liver flavin monooxygenase , 28, 29,To be our best knowledge, we firstly explored the association of LAA stroke with plasma TMAO and blood lipid-related indices. We demonstrated that plasma TMAO level, Apo-A1, Apo-B, and HDL-C could be as the potential biomarkers on LAA stroke and in blood will be beneficial for early managing and preventing stroke , especia"}
{"text": "Fifteen healthy adult smokers participated in the two-part study to assess the distribution and accumulation of [11C]nicotine in the respiratory pathways and brain. Time-activity data for the respiratory pathways, lungs, oesophagus and brain were derived. 31\u201336% of both inhaled tracer formulations accumulated in the lung within 15\u201335 s. [11C]Nicotinefreebase exhibited higher uptake and deposition in the upper respiratory pathways. For [11C]nicotinelactate, brain deposition peaked at 4\u20135%, with an earlier peak and a steeper decline. A different kinetic profile was obtained for [11C]nicotinelactate with lower tracer uptake and accumulation in the upper respiratory pathways and an earlier peak and a steeper decline in lung and brain. Using nicotine lactate formulations in e-cigarettes may thus contribute to greater adult smoker acceptance and satisfaction compared to freebase formulations, potentially aiding a transition from combustible cigarettes and an acceleration of tobacco harm reduction initiatives.Smoking is a cause of serious disease in smokers. Electronic cigarettes, delivering aerosolized nicotine, offer adult smokers a potentially less harmful alternative to combustible cigarettes. This explorative PET/CT study investigated the distribution and deposition of inhaled [ Smoking tobacco is a cause of serious diseases in smokers, including lung cancer, heart disease and emphysema. The best action adult smokers can take to reduce these risks is to stop smoking or using nicotine products completely. However, for adult smokers who are neither interested nor willing to quit smoking, a growing number of regulators and public health bodies posit that encouraging them to transition to using non-combustible nicotine products, that are substantially less harmful than inhaled tobacco smoke, is the next best option ,2. This E-cigarettes are battery-powered devices that deliver aerosolised nicotine (if included in the formulation), propylene glycol and/or glycerol, and may contain flavorings from an e-liquid of known chemical composition. They do not contain tobacco nor require combustion and are available in two principal configurations: \u201copen\u201d systems, which can be refilled by the consumer  or \u201cclosed\u201d systems . When the user takes a puff on the product or activates via a push button, a heating element is activated, converting the e-liquid into an aerosol that the user inhales. A recent Cochrane Review concluded that (1) e-cigarettes help adult smokers to stop smoking (even among those who do not intend to quit smoking) and are more effective than traditional nicotine replacement therapies (NRT) or willpower alone, and (2) and are not associated with serious unwanted effects or harm with up to 2 years of usage . As e-ciAdult smokers are more likely to transition to less harmful products such as e-cigarettes if the product provides a satisfying experience. Thus, to maximize the public health benefits of e-cigarettes, it is important that e-cigarettes provide adult smokers with a similar experience to combustible tobacco smoking, but in a less harmful way . Traditimyblu\u2122 e-cigarette device, there was also a trend of dose proportionality for the pharmacokinetic parameters measured. All three pharmacokinetic endpoints thus indicated a more effective absorption profile for nicotine with the nicotine lactate formulation, and corresponding adult smoker satisfaction scores, than the freebase nicotine formulation with the same e-cigarette device under a controlled puffing regime.Freebase nicotine is more volatile than nicotine salt . As a re11C]nicotine, was designed to investigate the above absorption hypothesis, i.e., whether nicotine lactate has a more effective uptake than a nicotine freebase formulation. This PET imaging approach was used to explore the [11C]nicotine deposition and disposition in the oral cavity, lungs, and brain to better understand the principal absorption route and kinetics of nicotine in vivo following aerosol inhalation from the myblu\u2122 e-cigarette device.To complement this previously published pharmacokinetic study, and to gain a further mechanistic understanding of nicotine lactate deposition, an explorative, proof of concept, PET-study, using [11C]nicotinefreebase and [11C]nicotinelactate in summation images comprising the first image frame where the e-cigarette was removed from the field of view until 10 min after [11C]nicotine administration. The freebase formulation visually showed substantial accumulation in the oral cavity and upper respiratory pathways  and [11C]nicotinefreebase, the highest SUV was found in the oral cavity , followed by the oesophagus mouth (27.8 \u00b1 15.4)), the trachea mouth (19.1 \u00b1 3.65), and the upper lung region (6.88 \u00b1 3.82). The peak SUV was reached at 25 s for the upper lung and at 110 s and 165 s for the trachea mouth and for the oral cavity, respectively. By contrast, the TACs for the oesophagus mouth peaked at 1650 s (27.5 min.),For [11C]nicotinelactate were substantially lower than [11C]nicotinefreebase for the oral cavity , oesophagus mouth  and trachea mouth (3.99 \u00b1 5.41 79% *). An exception was the upper lung region that had a slightly higher SUV  for [11C]nicotinelactate. The TACs demonstrated a peak SUV at 15 s for the upper lung, 70 s for the trachea mouth, 90 s for the oral cavity, and 210 s for the oesophagus mouth. , 3.52 \u00b1 2.38% in the upper lung (at 25 s), 0.78 \u00b1 0.19% trachea mouth (at 110 s), and 0.31 \u00b1 0.12% oesophagus mouth (at 165 s). For the [11C]nicotinelactate the peak depositions were 5.49 \u00b1 1.33%, in the upper lung (at 15 s), 1.52 \u00b1 1.39% in the oral cavity (at 90 s), 0.14 \u00b1 0.17% in the trachea mouth (at 70 s) and 0.11 \u00b1 0.12 in the oesophagus mouth (at 210 s). The peak depositions for [11C]nicotinelactate were lower for the oral cavity 84% **, mouth trachea 82% ** and mouth oesophagus 66% but higher for the upper lung region 56%. , followed by the oesophagus lung (20.3 \u00b1 9.47) and the trachea lung (17.8 \u00b1 4.99) and the average SUV for lung and deep lung peaked at 8.38 \u00b1 0.86 and 6.95 \u00b1 2.34, respectively. Most regions reached their maximum SUV between 25 and 70 s after inhalation. However, the average TAC for the oesophagus lung reached a peak at 27.5 min.11C]nicotinelactate, the average peak SUVs were similar in the primary-secondary bronchi, , deep lung (8.38 \u00b1 8.42), and lung (7.95 \u00b1 4.39), i.e., all about 8), and lower for the oesophagus lung (4.06 \u00b1 1.51 80% lower* than freebase SUV) and the trachea lung .  peaked at 15 s after inhalation.For [11C]nicotine freebase and lactate formulations in the lung were 35.5 \u00b1 9.12 and 31.0 \u00b1 9.62%, respectively (p = 0.41). In the other regions , the [11C]nicotine deposition was low, 0.10\u20131.98% for [11C]nicotinefreebase and 0.10\u20130.31% for [11C]nicotinelactate. The deposition was highest at 35\u201370 s after inhalation for [11C]nicotinefreebase and at 15\u201325 s for [11C] nicotinelactate.  lung through inhalation of the e-cigarette aerosol.For the freebase formulation, the SUV values and the accumulation were higher in the oral cavity, respiratory pathways and the oesophagus. This deposition pattern is consistent with two modes of inhalation of nicotinelactate and 35 s for [11C]nicotinefreebase. Furthermore, the nicotine lactate formulation passed the respiratory pathways faster than freebase, most likely due to less surface deposition than the freebase formulation. [11C]Nicotinelactate also had a faster clearance from the lungs, which may indicate that the lactate formulation has a quicker and more complete redistribution into the circulating blood than the freebase formulation. This is along the line with the pharmacokinetic data reported by O\u2019Connell et al. nicotine was in the brain at 4.5 and 12.5 min after the inhalation of the lactate and freebase [11C]nicotine formulation, respectively, indicating slower kinetics for [11C]nicotinefreebase. Mukhin et al. [11C]nicotine enter and accumulate in the brain tissue via systemic blood circulation.The data shows that 4\u20135% of the inhaled [n et al.  reported11C]nicotine kinetics in arterial blood was observed with discrete arterial sampling over 30 min. The blood absorption was fast for both formulations, with the highest value observable after two min, decreasing quickly to a phase with slow elimination. No differences were discernible between the two formulations, possibly due to the data collecting timepoints chosen because of the technical limitations of the blood sampling method. However, the peak, irrespective of formulation, was probably earlier than two minutes as a study comparing e-cigarettes and combustible cigarettes reported that brain [11C]nicotine concentrations rose quickly (23 \u00b1 3 s) after a single puff of the e-cigarette, as did another study where [11C]nicotine was administered in a combustible cigarette nicotine solutions varied between 6\u20138; this is most likely due to a low buffering capacity of the added reference formulations. A regional difference in distribution and deposition was still observable for the two [11C]nicotine formulations as the data presented in the current study showed [11C]nicotine in the freebase formulation deposited in the mouth and upper respiratory tract and [11C]nicotine in the nicotine lactate formulation deposited in the alveoli. This result is in line with the hypothesis that freebase nicotine is indeed more volatile and thus more likely to off-gas from the aerosol droplets than the less volatile nicotine salt resulting in a different nicotine deposition profile [11C]nicotine via e-cigarette aerosols is sufficient for the evaluation of nicotine distribution to the lungs, circulating blood, and brain.The two formulations used in the present study had an identical chemical composition apart from the charged state of nicotine, rendering the pH values to be 3.98 for the lactate formulation and 9.98 for the freebase formulation see . The pH  profile ,19,27. MThis was a small, descriptive and explorative study conducted in a laboratory setting, that was not designed to fully evaluate freebase and nicotine salt deposition in lung and oral tissues. As such, the small number of study subjects does not allow for comprehensive statistical comparisons to be conducted. This may explain differences in individual results based on variations in e-cigarette inhalation technique and anatomy between the subjects.S)-Nornicotine bitartrate was bought from Pharma Synth . (S)-Nornicotine was obtained as freebase via basification of an aqueous solution and extraction by diethyl ether according to an established in-house method. Solutions of nicotine and nicotine lactate salt in glycerol and propylene glycol were supplied by the study sponsor. Other reagents and solvents were obtained from Sigma-Aldrich , Fresenius-Kabi, , Merck  and VWR  and used without further purification. The synthesis was automated using Synthia, an in-house built synthesis equipment.(w/w]). Furthermore, the formulations were optimized to ensure that the freebase nicotine formulation contained a minimal amount of protonated nicotine and the nicotine lactate formulation contained a minimal amount of freebase nicotine. Both formulations were also unflavored to ensure no flavoring compounds could influence nicotine protonation and hence possibly the deposition or absorption -nicotine ([11C]nicotine) was synthesized by methylation of 1\u20132 mg (S)-nornicotine with [11C]methyl iodide [11C]Nicotine was purified with semi-preparative HPLC, using an Agilent Infinity 1260 II system equipped with a C18  column using 50 mM ammonium formate pH 3.5 and acetonitrile as the mobile phase with UV detection at 254 nm and a Bioscan flowcount radiodetector. [11C]Nicotine was extracted from the collected fraction by adjusting pH > 10 by the addition of a 1 M sodium carbonate solution and retained on a tC18 (plus) SPE-column, which was washed with water. The SPE-column was flushed with 30 mL of air using a syringe. [11C]Nicotine was then eluted with diethyl ether, dried by passage through potassium carbonate SPE-column, into a septum equipped glass vial containing 20 \u00b5L of reference formulation . The solution was concentrated to about 20 \u00b5L under a stream of nitrogen and heated at 50 \u00b0C. 10 \u00b5L of sterile water and 220\u2013300 \u00b5L of reference formulation (the exact volume depended on the radioactivity) were added to the [11C]nicotine-solution giving a final formulation of [11C]nicotine in 2.5% nicotine as freebase or nicotine lactate in glycerol and propylene glycol without flavoring. A myblu\u2122 e-cigarette was specially designed with a piece of cotton wool to absorb the radioactive [11C]nicotine solution. Then 100 \u00b5L of the formulated [11C]nicotine was applied to the cotton wool, and the myblu\u2122 e-cigarette was reassembled. For each experiment, two myblu\u2122 devices were prepared. Determination of identity and radiochemical purity was performed by analytical reversed-phase HPLC on an Agilent 1290 Infinity II system with eluents 8.1 mM ammonium carbonate and acetonitrile and equipped with a C18 (Phenomenex Gemini NX C18 5 \u00b5m (4.6 \u00d7 100 mm)) column using UV detection at 254 nm and a Bioscan flowcount radiodetector. The radiochemical purity was >98% for all [11C]nicotine productions. were aerosolized and inhaled using the mybluTM e-cigarette. Each study subject inhaled one of the formulations. Hereafter, the mybluTM e-cigarette is referred to as the e-cigarette. In part A, the study subjects performed two 40 min [11C]nicotine PET/CT scans, one over the lungs and one over the mouth and upper respiratory pathways. The time between PET/CT sessions was at least three hours to allow for decay and washout of [11C]nicotine. In part B, subjects had one 30 min [11C]nicotine PET/CT scan over the brain. [11C]Nicotine was administered as 1\u20132 puffs, inhaled as deep draws from the e-cigarette. The subjects in part B of the study underwent a 3D T1-weighted (T1w) brain volume sequence for anatomical reference on the same day as the PET/CT scan. In part A, the ultra-low dose CT (ULDCT) scan for attenuation correction initiated before the PET scan was also used for anatomical information.This study was an exploratory PET-study in two parts. Part A was designed to elucidate the uptake and deposition of inhaled Fifteen healthy adult subjects , 51\u201365 (58 \u00b1 4.4 years old) with a body weight between 51 and 85 kg (average 71 kg), were enrolled in this study , oral cavity , or brain (B). The PET scans were performed on a digital Discovery MI PET/computed tomography (CT) system . The scanner enables the acquisition of 89 contiguous image planes (slices) with a 25 cm axial field of view, which allows imaging of the entire lung. The first two subjects had their scans on a 20 cm axial field of view scanner, prior to the upgrade to 25 cm.11C]nicotine (MBq) was inhaled and a PET acquisition , totaling 30 and 40 min for part B and A, respectively, was started simultaneously with the [11C]nicotine inhalation. Images were reconstructed to a 256 \u00d7 256 pixel matrix with a field of view 50 and 25 cm for lung and oral cavity or brain, respectively, using time-of-flight ordered subsets expectation maximization with 3 iterations and 16 subsets, including resolution recovery and a 4-mm Gaussian post-processing filter. The time of [11C]nicotine inhalation and inhaled amount of radioactivity were registered. The inhaled amount of radioactivity was corrected for activity remaining in the e-cigarette device after inhalation.First, an ultra low dose CT attenuation correction scan  was obtained, whereupon Nicotine was formulated with either 2.5% freebase nicotine ([11C]nicotinefreebase) or nicotine lactate ([11C]nicotinelactate). The e-cigarettes, filled with 100 \u00b5L of the specific formulation spiked with [11C]nicotine, were delivered just a few min before each PET/CT-scan session. [11C]Nicotine was administered as one to two puffs on the e-cigarette followed by inhalation of the aerosol into the lungs at the onset of the dynamic [11C]nicotine PET scan. For the freebase formulation, 20.0 \u00b1 4.8 MBq (n = 10) and 27.2 \u00b1 2.6 MBq (n = 3) was inhaled for the mouth and lung scan and for the brain scan, respectively. For the nicotine lactate formulations, the doses inhaled were 24.6 \u00b1 5.3 MBq (n = 10) and 35.0 MBq (n = 1) for the mouth and lung scan and for the brain scan, respectively. Use of the e-cigarette device was practiced with e-cigarettes containing the same formulation used in the study but with unlabelled nicotine  on the screening day to familiarize participants with both the inhalation technique and the aerosol generated by the e-cigarette. Inhalation was repeated with empty dummy devices (nicotine free) in the morning before the first PET session.nicotine inhalation until the end of the PET session. Consumption of alcohol was not allowed within 48 h prior to the first PET session or during the clinic stay. A breakfast was served before the first PET session and lunch before the second PET session.Smoking or use of nicotine, except the 11C]nicotine inhalation. The serial discrete arterial blood samples were analysed using an in-house developed well counter detector system cross-calibrated with the PET/CT scanner. Sample weight, number of counts and measurement time were recorded and the radioactivity concentrations, corrected for physical decay to the start of [11C]nicotine inhalation, were calculated.Arterial blood samples, approximately 2 mL, were collected at 2, 4, 6, 8, 10, 15, 20, and 30 min after nicotine PET summation images. The delineated VOIs were subsequently transferred to the corresponding individual dynamic [11C]nicotine PET scan for the generation of time-activity curves (TACs). Hermes software , was used for VOI delineation and extraction of time-activity data. An example of the resulting VOIs is shown in The lung, deep lung, and trachea were delineated using the anatomical information from the ULDCT scan. Primary, secondary bronchi, oral cavity, and oesophagus were outlined on a combination of the individual\u2019s ULDCT and [11C]nicotine PET image. The T1w MR images were segmented into grey and white matter. Both segmentation and co-registration were conducted using SPM8 . Subsequently, whole-brain (grey and white matter) VOIs were defined on the segmented and co-registered structural T1w images utilizing an automated probabilistic template as implemented in the PVElab software [11C]nicotine images.For analysis of brain scans (part B), the PET summation image was used for a co-registration of the T1w MR volume to the summed [software . TACs we11C]nicotine deposition, defined as the fraction of radioactivity measured in a delineated VOI related to the inhaled radioactivity, was calculated.TACs were converted to SUV curves by normalization to injected dose per kilogram body weight. Furthermore, the [11C]nicotine was fast and reached the peak value in the lungs after approximately 15 s (nicotine lactate) compared to 35 s (freebase) after [11C]nicotine aerosol inhalation using the e-cigarette device. Moreover, approximately 31\u201336% of the inhaled [11C]nicotine was disposed in the lung within the first 15\u201335 s after [11C]nicotine inhalation from the e-cigarette. [11C]nicotinelactate passed the upper respiratory pathways to a greater extent than [11C]nicotinefreebase, which showed a higher accumulation in the upper respiratory pathways, in line with previously reported blood nicotine delivery data.The exploratory study presented herein showed that the distribution of [11C]nicotine levels in arterial blood indicated an entry and accumulation of [11C]nicotine in the brain tissue via systemic blood circulation. Approximately 4\u20135% of the inhaled [11C]nicotine was distributed to the brain, where the nicotine lactate formulation showed an earlier peak and elimination compared to the freebase formulation. Although further studies are warranted as this study was based on a small number of subjects, this observation may explain greater adult smoker satisfaction and reductions in a desire to smoke combustible cigarettes with nicotine salt formulations compared to freebase in other e-cigarette studies [Furthermore, the [ studies ,21,22,23"}
{"text": "Frontiers in Aging Neuroscience Topic contains a series of high-quality original articles and updated reviews covering recent 2-year progression in various aspects of \u03b1-Syn expressions in blood, saliva, and cerebrospinal fluid (CSF), and pathological processes in regulating human neurodegenerative disorders as well as its feasibility as an early predictive biomarker. Parkinson's disease (PD) is a typical disease in \u03b1-synucleinopathies, presenting dominantly with clinical symptoms of motor impairment. PD is characterized by progressive chronic neurodegeneration and loss of dopaminergic (DA) neurons in brain, mainly substantia nigra. Meanwhile, dementia with Lewy bodies (DLB), and multiple system atrophy (MSA) belong to this devastating neurodegenerative category. Currently, PD cannot be completely cured or reversed, and existing treatment strategies have limited efficacy in the early stages. Therefore, there is an imperative need to clarify the pathogenesis of PD and find early identifications of it. However, the detailed etiology and pathogenesis remain no consensus. This Research Topic aims to generate a multidimensional discussion linking clinical analysis with basic experiment unveiling the fundamental mechanisms of PD. Then filtrate the current effective biomarkers for preclinical detection and clinical evaluation on this basis. As a result, building a predictive model contributes to a deeper understanding of the mechanism of PD, so as to better guide clinical applications.The recognition of Alpha-Synuclein (\u03b1-Syn) as an essential player in the pathobiology of human neurodegenerative diseases has spurred substantial efforts to understand its biochemical and pathological function. This Du et al. summarizes useful biomarkers for the diagnosis of PD, as well as how the biomarkers \u03b1-Syn could potentially be used as a biomarker for PD step by step from genetics, immunology, fluid and tissue, imaging, as well as neurophysiology. As a general overview, Ganguly et al. also evaluate the overall effectiveness of \u03b1-Syn in forecasting PD progression. In view of the overwhelming importance of \u03b1-Syn in the pathogenesis, a detailed analysis is then made of various studies to establish the biomarker potential of this protein in PD. Knowledge of the \u03b1-Syn-related novel biomarkers for preclinical detection and clinical evaluation serve to identify the disease-predictive biomarkers more effectively, which are critical for precise diagnosis and therapeutic approaches.Various attempts made by the researchers to develop preclinical and clinical investigations encompassing genetics, immunology, microbiology, neuroimaging, and neurophysiology to clarify the molecular mechanisms and identify useful biomarkers for the disease diagnosis. There are two valuable systematic reviews on this topic, which comprehensively describe the current research status. In the first place, Li et al. in this case by studying the role of neuroimaging in the diagnosis of MSA-P. Using a novel magnetic resonance technology, amide proton transfer (APT) imaging, which is a well-studied chemical exchange saturation transfer imaging for its sensitivity to mobile protons and peptides in tissues. Next, Xian et al. demonstrate the diagnostic value of co-registration analysis of 18F-flurodeoxyglucose (18F-FDG) and 18F-Dopa positron emission tomography (PET) for differentiating MSA-P from PD. Segmentation analysis of the rabbit-shaped appearance of the striatum segment of PET images not only could distinguish PD and MSA-P patients from healthy controls (HCs).Early warning biomarkers have become a hot topic recently due to the need for diagnosis and treatment in forepart. Inchoate detection and differential diagnosis of parkinsonism-type MSA (MSA-P) and PD are in great clinical need, as aging can lead to many diseases that are difficult to detect at early stage. This urgent issue is also addressed by Si et al. assess the clinical significance of magnetic resonance imaging (MRI)-visible enlarged perivascular space (EPVS) in patients with idiopathic RBD (iRBD) and PD. Their study indicates that iRBD patients had significantly greater EPVS burdens than PD patients. Specifically, higher EPVS burdens in centrum semiovale (CSO) and basal ganglia might be independent risk factors for iRBD, and the higher the value the more severe the clinical symptoms. Then, Chen et al. combine clinical assessments, dopamine transporter (DAT) imaging data, CSF and genetic data of PD patients to minister to develop a prognostic model for predicting mild cognitive impairment (MCI) in PD-RBD patients. As CI is one of the most common non-motor symptoms in PD, incidence of CI in PD patients increases as the disease progresses, thus investigating risk factors and predictive model for CI may contribute to a better understanding of the PD-RBD phenotype and help decelerate the MCI process in PD-RBD patients in clinical practice.Rapid eye movement sleep behavior disorder (RBD) is marked by repeated nocturnal sleep-related normal skeletal muscle atonia with remarkable motor disturbances and dream enactment behaviors, and the existence of RBD can be considered as an omnipotent precursor to PD. Therefore, scholars have started with exploring the interconnected mechanisms between RBD and PD and the course progression to identify early predictive indicators of PD. The article by Lian et al. tackles this issue and suggests that neuroinflammatory factors in CSF, especially tumor necrosis factor (TNF)-\u03b1, may cause damage to dopamine (DA) neurons and induce the depletion of DA, which is related to the occurrence and development in PD patients who accompanied with depression. Also, adaptive immune system, including lymphocyte subpopulations and cytokines, is involved in the PD pathogenesis. The article by Huang et al. analyzes integrated substantia nigra (SN) and gene expression by CIBERSPOT and identifies the function of key immune cell types in PD. They propose the immune response modifying the genetic background as a factor influencing the synaptic pathway in PD pathology. Another popular inflammation topic normally discussed in pathogenesis of neurodegenerative disease is gut-brain axis. The gut-brain axis is a two-way regulating axis for the interaction between gastrointestinal function and the CNS, and the nerve-endocrine-immune network is an important connection method. Following this clue, Bu, Huang, et al. assess \u03b1-Syn immune-neuron reactivity and expression patterns. Contrary to our expectations, they propose that gastrointestinal pathology couldn't be facilitated for diagnosing \u03b1-synucleinopathies, including PD. The deposit of \u03b1-Syn is age-dependent rather than neurodegenerative-unique in the enteric nervous system (ENS) of patients.The central nervous system (CNS) is so sophisticated and fragile that is vulnerable to injury, pathogen, or neurodegeneration. In the process of aging and degradation, the activation of the innate immune system occurs. The inflammasome is a signal complex that regulates immune cells, chiefly microglial, leading to the release of pro-inflammatory factors. Consequently, pro-inflammatory factors aggravate the neuro-inflammatory response, neurological degeneration, and eventually upset the brain metabolic balance. It can be deduced that analyzing the inflammatory factors in CSF is more meaningful to investigate brain neuroinflammation. For instance, studies have shown that immune dysfunction may lead to aberrant \u03b1-Syn aggregation and transmission in the brain. The article by SNCA) is the first identified pathogenic gene that causes autosomal dominant PD, and its abnormal protein aggregation is regarded as the main pathological symbol of patients. Based on this understanding, Guo et al. evaluates the associations between the SNCA gene variants and PD through conventional whole-exome sequencing (WES) and sanger sequencing. Beyond expectations, the result shows that variants located in the coding regions of the SNCA gene may have less or no role in the development of PD in the Han Chinese population, which implies the inescapable role of ethnic differences in PD development. Therefore, in order to verify the function of SNCA, it is necessary to carry out cohort comparisons with large samples of multiple races in the future. Neuro regulation is the result of multi-gene collaboration. Both \u03b1-Syn and Monoamine oxidase A (MAOA) are long deemed as the pivotal pathogenesis of PD, Jia et al. further explores the close crosstalk between these two co-regulation molecules. At the same time, Bu, Xie et al. reveal that overexpression of long non-coding RNA (lncRNA)-T199678 mitigates the \u03b1-Syn-induced dopaminergic neuron injury, including oxidative stress, abnormal cell cycle, and apoptosis, which contributed to promote PD. This study praises a new molecular target for further genetic pathway investigation in PD.Apart from aging, genetic dysfunction is widely considered to be a key risk factor of PD, and is repeatedly discussed when exploring the etiology and pathology of \u03b1-Syn. So far, at least 23 genes and independent risk signals related to PD have been discovered. Among them, it is indisputable that the \u03b1-synuclein gene  or osteopontin (OPN) could be candidate biomarkers in differentiating PD patients from HCs. Besides, inflammation may be involved in the interaction between these two bone-derived factors and PD, which partly explains the various modulating effects of bone physiological processes on the CNS.Multiple system diseases often occur in the elderly. It is often found that patients with neurodegenerative diseases are complicated by osteoporosis, and fractures are more likely to be found in the prodromal phase of PD in clinical practice. As the main supporting and protecting organs of our body, bone is also an active immune and endocrine organ. It can secrete a variety of bone-derived factors, interact with the brain through various bone-derived cells, and participate in the pathophysiology of various diseases. First, the article by Shim et al. supporting the occurrence of cholinergic dysfunction on motor deficits in PD. The mechanisms of progressive loss of DA neurons in PD include a variety of cellular processes such as \u03b1-Syn aggregation, mitochondrial damage, oxidative stress, calcium homeostasis dysfunction, interruption of axonal transport, and neuroinflammatory damage. These abnormal phenomena can disturb the balance of protein homeostasis in PD. In a review by Ren et al., the cross-linking mechanisms of endoplasmic reticulum (ER) stress-induced unfolded protein response (UPR) and the dysregulated autophagy in DA neurodegeneration are systematically addressed.New methods and molecules are gradually being tried for scientific research. Recently, exosomal biomarkers have been involved in embedding the acknowledgment and diagnosis of neurodegenerative disorders. Exosomes are small extracellular vesicles coming from different cell types and can contain different molecular components such as proteins, lipids, and RNA. Previous reports have demonstrated increased exosomal \u03b1-Syn in patients with PD in comparison to HCs. In this context, the exosomal acetylcholinesterase (AChE) and \u03b1-Syn are quantified and the inner relationships with clinical symptom are simultaneously scouted by Wang Z. et al. target at the amplitude of low-frequency fluctuations (ALFF) and discover that PD patients exhibited different tendencies in several brain regions, emphasizing the diversity of widespread abnormal brain activities related to PD, and suggesting that the abnormalities of ALFF in specific frequency bands would be helpful in detecting the neural changes in PD. Expect for traditional neuroimaging, nowadays researchers use more controllable electrophysiological tools, such as TMS, to reveal the conduction blocks caused by structural abnormalities or neurodegenerative diseases. The article by Xu et al. applies a more sensitive and accurate method, triple stimulation technique (TST), to quantitatively assess the integrity and impairment of corticospinal pathway in PD patients.Neuroimaging is also a traditional technique for detecting the connectivity of brain functions, which is often used in interpreting the static state and dynamic changes of patients in clinical research. Focusing on the brain imaging network in aging, it is wildly acknowledged that PD patients depict abnormal spontaneous neural activity in resting-state functional magnetic resonance imaging (r-fMRI). Wang Q. et al. summarizes recent research on EEG characterization related to the cognitive and motor functions in PD patients and discussed its potential to be used as diagnostic biomarkers. Abnormalities in \u03b2 and \u03b4 frequency bands are, respectively the main manifestation of dyskinesia and cognitive decline in PD. In conclude, the unique time-frequency characteristics of EEG could provide further insight into disrupted sensorimotor networks in PD with motor deficits, such as FOG, dyskinesia, and dystonia in a real-world environment. Several of the contributors to this topic recognized the need to promote cognition of older people. The exploration of specific brain regions for PD cognitive impairment is ongoing. The dorsolateral prefrontal cortex (DLPFC) transmits afferent projections to the caudate nucleus and putamen and participates in advanced cognitive functions, which is recognized as an important area related to CI. Furthermore, Cai et al. compare the posterior middle frontal gyrus-based functional connectivity differences between PD patients with MCI and normal cognitive PD patients. As discussed previously in this editorial, this topic accumulates growing evidence that cognitive dysfunction of PD patients is different from the cognitive function of normal aging people.Present research regards the electroencephalogram (EEG) as a promising method to study real-time brain dynamic changes in patients with PD. Compared with other functional imaging methods, EEG has high temporal resolution, in which specific frequency analysis enables accurately investigating connectivity fluctuations. Firstly, the review by In summary, PD is a neurodegenerative disease caused by the combined action of genes, age, and environment. The underlying pathological mechanism involves multiple circuits such as gene regulation, neuroimmune, biochemical factors, and neurophysiology, which requires further exploration by establishing multi-factor model. On the other hand, biomarkers can help clinicians reduce the chance of misdiagnosis and help them monitor the improvement of disease pathology during anti-Parkinson's disease drug trials. However, the inconsistent research conclusions in the same direction remind us that many methodological issues related to the detection and quantification of \u03b1-syn need to be further verified for their feasibility. At the same time, large sample of long-term follow-up studies comparing the motor dysfunction of different neurodegenerative diseases are needed.JL and PL decided on the basic framework of the editorial, and PL wrote the initial version of the manuscript. Also, JL and PX revised the work. All the authors approved of the final edition for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Access to the chemical inventory of an exoplanet requires high-precision observations, often inferred from individual molecular detections with low-resolution space-based5 and high-resolution ground-based8 facilities. Here we report the medium-resolution (R\u2009\u2248\u2009600) transmission spectrum of an exoplanet atmosphere between 3 and 5\u2009\u03bcm covering several absorption features for the Saturn-mass exoplanet WASP-39b (ref.\u20099), obtained with the Near Infrared Spectrograph (NIRSpec) G395H grating of JWST. Our observations achieve 1.46\u2009times photon precision, providing an average transit depth uncertainty of 221\u2009ppm per spectroscopic bin, and present minimal impacts from systematic effects. We detect significant absorption from CO2 (28.5\u03c3) and H2O (21.5\u03c3), and identify SO2 as the source of absorption at 4.1\u2009\u03bcm (4.8\u03c3). Best-fit atmospheric models range between 3 and 10\u2009times solar metallicity, with sub-solar to solar C/O ratios. These results, including the detection of SO2, underscore the importance of characterizing the chemistry in exoplanet atmospheres and showcase NIRSpec G395H as an excellent mode for time-series observations over this critical wavelength range10.Measuring the abundances of carbon and oxygen in exoplanet atmospheres is considered a crucial avenue for unlocking the formation and evolution of exoplanetary systems 2 and H2O and detection of SO2.The medium-resolution transmission spectrum of the exoplanet WASP-39b, described using observations from the Near Infrared Spectrograph G395H grating aboard JWST, shows significant\ufeff absorption from CO WASP-39b is a hot , low-density giant planet with an extended atmosphere. Previous spectroscopic observations have shown prominent atmospheric absorption by Na, K and H2O (refs.\u200915), with tentative evidence of CO2 from infrared photometry4. Atmospheric models fitted to the spectrum have inferred metallicities (amount of heavy elements relative to the host star) from 0.003 to 300\u2009times solar20, which makes it difficult to ascertain the formation pathway of the planet22. The host, WASP-39, is a G8-type star that shows little photometric variability23 and has nearly solar elemental abundance patterns24. The quiet host and extended planetary atmosphere make WASP-39b an ideal exoplanet for transmission spectroscopy25. The transmission spectrum of WASP-39b was observed as part of the JWST Transiting Exoplanet Community Director\u2019s Discretionary Early Release Science (JTEC ERS) Program27 , which uses four instrument configurations to test their capabilities and provide lessons learned for the community.We obtained a single-transit observation of WASP-39b using the NIRSpec28. The tilt event occurred mid-transit, affecting approximately three integrations and resulted in a noticeable step in the flux time series, the size of which is dependent on wavelength  and hence jumps in fluxgth Fig. . The tilR\u2009\u2248\u2009600), excluding the detector gap between 3.717\u20133.823\u2009\u03bcm. The light curves show a settling ramp during the first ten integrations (\u2248631.4\u2009s), with a linear slope across the entire observation for NRS1. We otherwise see no substantial systematic trends and achieve improvements in precision from raw uncorrected to fitted broadband light curves of 1.63 to 1.03\u2009times photon noise for NRS1 and 1.95 to 1.31\u2009times for NRS2. The flux jump caused by the mirror-tilt event could be corrected by detrending against the spectral trace x and y positional shifts, normalizing the light curves or fitting the light curves with a step function  of 1.08\u20131.20 for our 344-data-point transmission spectrum  can be attributed to CO2 (28.5\u03c3). H2O and CO2 are expected atmospheric constituents for near-solar atmospheric metallicities, with the CO2 abundance increasing nonlinearly with higher metallicity30. The spectral feature at 4.56\u2009\u03bcm (3.3\u03c3) is unidentified at present but does not correlate with any obvious detector artefacts and is reproduced by several independent analyses. The absorption feature at 4.1\u2009\u03bcm is also not seen in the RCTE model grids. After an exhaustive search for possible opacity sources , described in the corresponding NIRSpec PRISM analysis31, we interpret this feature as SO2 (4.8\u03c3), as it is the best candidate at this wavelength.We compared the weighted-average G395H transmission spectrum to three grids of 1D radiative\u2013convective\u2013thermochemical equilibrium (RCTE) atmosphere models of WASP-39b see\u00a0, contain2 would have volume mixing ratios (VMRs) of less than 10\u221210 throughout most of the observable atmosphere in thermochemical equilibrium, coupled photochemistry of H2S and H2O can produce SO2 on giant exoplanets, with the resulting SO2 mixing ratio expected to increase with increasing atmospheric metallicity34. We find that a VMR of approximately 10\u22126 of SO2 is required to fit the spectral feature at 4.1\u2009\u03bcm in the transmission spectrum of WASP-39b, consistent with lower-resolution NIRSpec PRISM observations of this planet31 and previous photochemical modelling of super-solar metallicity giant exoplanets35. Figure \u03c72/N best-fit model (PICASO 3.0) with VMR\u2009=\u200910\u22125.6 injected SO2. The inclusion of SO2 in the models results in an improved \u03c72/N and is detected at 4.8\u03c3  because their near-solar chemical equilibrium abundances could result in a contribution to the spectrum. We see no evidence of CH4 in our spectrum between 3.0 and 3.6\u2009\u03bcm (ref.\u200923), which is indicative of C/O\u2009<\u20091 (ref.\u200936) and/or photochemical destruction37. With regards to CO, H2S and OCS, we were unable to conclusively confirm their presence with these data. In particular, CO, H2O, OCS and our modelled cloud deck all have overlapping opacity, which creates a pseudo-continuum from 4.6 to 5.1\u2009\u03bcm , which has previously been proposed for gas-dominated accretion at wide orbital radii beyond the CO2 ice line at which the gas may be carbon-rich39. Our C/O upper limit, therefore, suggests that WASP-39b may have either formed at smaller orbital radii with gas-dominated accretion or that the accretion of solids enriched the atmosphere of WASP-39b with oxygen-bearing species2. The level of metal enrichment (3\u201310\u2009times solar) is consistent with similar measurements of Jupiter and Saturn41, potentially suggesting core-accretion formation scenarios42, and is consistent with upper limits from interior-structure modelling43. These NIRSpec G395H transmission spectroscopy observations demonstrate the promise of robustly characterizing the atmospheric properties of exoplanets with JWST unburdened by substantial instrumental systematics, unravelling the nature and origins of exoplanetary systems.We are able to strongly rule out an absolute C/O\u2009\u2265\u20091 scenario (44 (\u2018rateints\u2019 files) and by means of customized runs of the STScI JWST Calibration Pipeline with user-defined inputs and processes for steps such as the \u2018jump detection\u2019 and \u2018bias subtraction\u2019 steps.We produced several analyses of stellar spectra from the Stage 1 2D spectral images produced using the default STScI JWST Calibration PipelineEach pipeline starts with the raw \u2018uncal\u2019 2D images that contain group-level products. As we noticed that the default superbias images were of poor quality, we produced two customized runs of the JWST Calibration Pipeline, using either the default bias step or a customized version. The customized step built a pseudo-bias image by computing the median pixel value in the first group across all integrations and then subtracted the new bias image from all groups. We note that the poor quality of the default superbias images affects NRS1 more notably than NRS2, and this method could be revised once a better superbias is available.f noise\u2019 . Our group-level destriping step used a mask of the trace 15\u03c3 from the dispersion axis for all groups within an integration, ensuring that a consistent set of pixels is masked within a ramp. The median values of non-masked pixels in each column were then computed and subtracted for each group.Before ramp fitting, both our standard and custom bias step runs of the edited JWST Calibration Pipeline \u2018destriped\u2019 the group-level images to remove so-called \u20181/\u03c3 (as opposed to the default of 4\u03c3), as it produced the most consistent results at the integration level. In both custom runs of the JWST Calibration Pipeline, all other steps and inputs were left at the default values.The results of our customized runs of the JWST Calibration Pipeline are a set of custom group-level destriped products and custom bias-subtracted group-level destriped products. In both cases, the ramp-jump detection threshold of the JWST Calibration Pipeline was set to 15TDB were extracted from the image headers for use in producing light curves. None of our data-reduction pipelines performed a flat-field correction, as the available flat fields were of poor quality and unexpectedly removed portions of the spectral trace. In general, we found that 1/f noise can be corrected at either the group or integration levels to similar effect; however, correction at the group level with a repeated column-by-column cleaning step at the integration level probably results in cleaner 1D stellar spectra. This was particularly true for NRS2, owing to the limited number of columns in which the unilluminated region on the detector extends both above and below the spectral trace, as shown in Extended Data Fig. For all analyses, wavelength maps from the JWST Calibration Pipeline were used to produce wavelength solutions, verified against stellar absorption lines, for both detectors. The mid-integration times in BJDBelow we detail each of the independent data-reduction pipelines used to produce the time series of stellar spectra from our G395H observations.45) pipeline on our custom group-level destriped products, treating each detector separately. Using the data-quality flags produced by the JWST Calibration Pipeline, we replaced any pixels identified as bad, saturated, dead, hot, low quantum efficiency or no gain value with the median value of surrounding pixels. We also searched each integration for pixels that were spatial outliers from the median of the surrounding 20\u2009pixels in the same row by 6\u03c3 (to remove permanently affected \u2018bad\u2019 pixels) or outliers from the median of that pixel in the surrounding ten integrations in time by 20\u03c3 (to identify high-energy short-term effects such as cosmic rays) and replaced the outliers with the median values. To obtain the trace position and FWHM, we fitted a Gaussian to each column of an integration, finding a median standard deviation of 0.7\u2009pixels. A fourth-order polynomial was fitted through the trace centres and the widths, which were smoothed with a median filter, to obtain a simple aperture region. This region extended 5\u2009times the FWHM of the spectral trace, above and below the centre, corresponding to a median aperture width of 7\u2009pixels. To remove any remaining 1/f and background noise from each integration, we subtracted the median of the unilluminated region in each column by masking all pixels that were 5\u2009pixels away from the aperture. For each integration, the counts in each row and column of the aperture region were summed using an intrapixel extraction, taking the relevant fractional flux of the pixels at the edge of the aperture and cross-correlated to produce x-pixel and y-pixel shifts for detrending . We also measured the vertical shift in pixels of the spectrum from one integration to the other using cross-correlation and the average PSF width at each integration, obtained by adding all columns together and fitting a Gaussian to the profile to estimate its width. This reduction is henceforth denoted as Eureka! [V1].The first Eureka! reduction used our custom group-level destriped products and applied Stages 2 and 3 of Eureka! Stage 2, a wrapper of the JWST Calibration Pipeline, followed the default settings up to the flat fielding and photometric calibration steps, which were both skipped. Stage 3 of Eureka! was then used to perform the background subtraction and extraction of the 1D stellar spectra. We started by correcting for the curvature of NIRSpec G395H spectra by shifting the detector columns by whole pixels, to bring the peak of the distribution of the counts in each column to the centre of our subarray. To ensure that this curvature correction was smooth, we computed the shifts in each column for each integration from the median integration frame in each segment and applied a running median to the shifts obtained for each column. The pixel shifts were applied with periodic boundary conditions, such that pixels shifted upwards from the top of the subarray appeared at the bottom after the correction, ensuring no pixels were lost. We applied a column-by-column background subtraction by fitting and subtracting a flat line to each column of the curvature-corrected data frames, obtained by fitting all pixels further than six pixels from the central row. We also performed a double iteration of outlier rejection in time with a threshold of 10f noise by subtracting the mean from each column, excluding the region 6\u2009pixels away from the trace, sigma-clipping outliers at 3\u03c3. We extracted the 1D stellar spectra using a 4-pixel-wide aperture on either side of the trace centre.The second Eureka! reduction (Eureka! [V2]) used the \u2018rateints\u2019 outputs of the JWST Calibration Pipeline and applied Stage 2 of Eureka! as described above, with a modified version of Stage 3. In this reduction, we corrected the curvature of the trace using a spline and found the centre of the trace using the median of each column. We removed 1/51:Limb-darkening is a function of the physical structure of the star that results in variations in the specific intensity of the light from the centre of the star to the limb, such that the limb looks darker than the centre. This is because of the change in depth of the stellar atmosphere being observed. At the limb of the star, the region of the atmosphere being observed at slant geometry is at higher altitudes and lower density, and thus lower temperatures, compared with the deeper atmosphere observed at the centre of the star, at which hotter, denser layers are observed. The effect of limb-darkening is most prominent at shorter wavelengths, resulting in a more U-shaped light curve compared with the flat-bottomed light curves observed at longer wavelengths. To account for the effects of limb-darkening on the time-series light curves, we used analytical approximations for computing the ratio of the mean intensity to the central intensity of the star. The most commonly used limb-darkening laws for exoplanet transit light curves are the quadratic, square-root and nonlinear four-parameter lawsQuadratic:Square-root:Nonlinear four-parameter:I(1) is the specific intensity in the centre of the disk, u1, u2, s1, s2, c1, c2, c3 and c4 are the limb-darkening coefficients and \u03bc\u2009=\u2009cos(\u03b3), in which \u03b3 is the angle between the line of sight and the emergent intensity.in which 52 for Teff\u2009=\u20095,512\u2009K, log(g)\u2009=\u20094.47\u2009cgs and Fe/H\u2009=\u20090.0, along with the instrument throughput to determine I and \u03bc. As instrument commissioning showed that the throughput was higher than the pre-mission expectations53, a custom throughput was produced from the median of the measured ExoTiC-JEDI [V2] stellar spectra, divided by the stellar model and Gaussian smoothed.The limb-darkening coefficients depend on the particular stellar atmosphere and therefore vary from star to star. For consistency across all of the light-curve fitting, we used 3D stellar models55 package, which can compute the linear, quadratic and three-parameter and four-parameter nonlinear limb-darkening coefficients56. To compute and fit for the coefficients from the square-root law, we used previously outlined formalisms58. We highlight that we do not see any dependence in our transmission spectra on the limb-darkening procedure used across our independent reductions and analyses.For the limb-darkening coefficients that were held fixed, we used the values computed using the ExoTiC-LD37. In many of our analyses, we detrended the raw broadband and spectroscopic light curves using the time-dependent decorrelation parameters for the change in the FWHM of the spectral trace or the shift in x-pixel and y-pixel positions . We also tested wider and narrower binning schemes but found that 10-pixel-wide bins achieved the best compromise between the noise in the spectrum and showcasing the abilities of G395H across analyses. In our analyses, we treated the NRS1 and NRS2 light curves independently to account for differing systematics across the two detectors. To construct the full NIRSpec G395H transmission spectrum of WASP-39b, we fitted the NRS1 and NRS2 broadband and spectroscopic light curves using 11 independent light-curve-fitting codes, which are detailed below. When starting values were required, all analyses used the same system parametersT0) of T0\u2009=\u20092,459,791.612039\u2009\u00b1\u20090.000017\u2009BJDTDB and T0\u2009=\u20092,459,791.6120689\u2009\u00b1\u20090.000021\u2009BJDTDB computed from the NRS1 and NRS2 broadband light curves, respectively; most of the fitting pipelines obtained T0 within 1\u03c3 of the quoted uncertainty.Using fitting pipeline 1, we measured a centre of transit time (\u2212 on NRS1 and 17.75\u2009e\u2212 on NRS2), gain (1.42 for NRS1 and 1.62 for NRS2) and the background counts (which are found to be negligible after cleaning) and compared it to the final signal-to-noise ratio in our light curves  and calculating the signal-to-noise ratio achieved60. Extended Data Fig. 54).For each of our analyses, we computed the expected photon noise from the raw counts taking into account the instrument read noise . We simultaneously fitted a batman transit model62 with a constant baseline and systematics models for data pre-tilt and post-tilt event, fixing the centre of transit time T0, the ratio of the semi-major axis to stellar radius a/R\u22c6 and the inclination i to the broadband light-curve best-fit values. The systematics models included a linear regression on x and y, for which x and y are the measured trace positions in the dispersion and cross-dispersion directions, respectively. We accounted for the tilt event by normalizing the light curve pre-tilt by the median pre-transit flux and normalizing the light curve post-tilt by the median post-transit flux. We discarded the first 15 integrations and the three integrations during the tilt event. Fourteen-pixel columns were discarded owing to outlier pixels directly on the trace. We fixed the limb-darkening coefficients to the four-parameter nonlinear law.We fitted the broadband and spectroscopic light curves produced from the ExoTIC-JEDI [V3] stellar spectra using the least-squares optimizer, scipy.optimize lm 64, implemented through george65, and a Markov chain Monte Carlo method, implemented through emcee66. For our Tiberius spectroscopic light curves, we held a/R\u22c6, i and T0 fixed to the values determined from the broadband light-curve fits and applied a systematics correction from the broadband light-curve fit to aid in fitting the mirror-tilt event. We fitted the spectroscopic light curves using a GP with an exponential squared kernel for the same systematics detrending parameters detailed above. We used a Gaussian prior for a/R\u22c6 and uniform priors for all other fitted parameters.We used the broadband light curves generated from the Tiberius stellar spectra and fitted for the ratio of the planet to stellar radii 67. We fitted each light curve with a two-component function consisting of a transit model (generated using batman) multiplied by a systematics model. Our systematics model included the x-pixel and y-pixel positions on the detector . To capture the amplitude of the tilt event in our systematics model, we carried out piecewise linear regression on the out-of-transit baseline pre-tilt and post-tilt. We first fit the broadband light curve by fixing P and e and fitting for T0, a/R\u22c6, i, Rp/R\u22c6, stellar baseline flux and systematic trends using wide uniform priors. For the spectroscopic light curves, we fixed T0, a/R\u22c6 and i to the best-fit values from the broadband light curve and fit for Rp/R\u22c6. We held the nonlinear limb-darkening coefficients fixed.We used transit light curves from the ExoTiC-JEDI [V1] stellar spectra and fit the broadband and spectroscopic light curves using the least-squares minimizer LMFIT68 in parallel with the light-curve-fitting module of the transitspectroscopy pipeline48 with dynamic nested sampling through dynesty69 and analytical transit models computed using batman. We fit the broadband light curves for NRS1 and NRS2 individually, fixing P, e and \u03c9 and fitting for the impact parameter b, as well as T0, a/R\u22c6, Rp/R\u22c6, extra jitter and the mean out-of-transit flux. We also fitted two linear regressors, a simple slope and a \u2018jump\u2019 (a regressor with zeros before the tilt event and ones after the tilt event), scaled to fit the data. We fitted the square-root-law limb-darkening coefficients using the Kipping sampling scheme. We fitted the spectroscopic light curves at the native resolution of the instrument, fixing T0, a/R\u22c6 and b. We used the broadband light-curve systematics model for the spectroscopic light curve, with wide uniform priors for each wavelength bin, and set truncated normal priors for the square-root-law limb-darkening coefficients. We also fitted a jitter term added in quadrature to the error bars at each wavelength with a log-uniform prior between 10 and 1,000\u2009ppm. We computed the mean of the limb-darkening coefficients by first computing the nonlinear coefficients from ATLAS models70 and passing them through the SPAM algorithm71. We binned the data into 10-pixel-wavelength bins after fitting the native-resolution light curves.We fit the broadband and spectroscopic light curves produced from the transitspectroscopy stellar spectra, running juliet75. ExoTEP uses batman to generate analytical light-curve models, adds an analytical instrument systematics model along with a photometric scatter parameter and fits for the best-fit parameters and their uncertainties using emcee. Before fitting, we cleaned the light curves by running ten iterations of 5\u03c3 clipping using a running median of window length 20 on the flux, x-pixel and y-pixel shifts and the \u2018ydriftwidth\u2019 data product from Eureka! Stage 3 . Our systematics model consisted of a linear trend in time with a \u2018jump\u2019 (constant offset) after the tilt event. The \u2018ydriftwidth\u2019 was used before the fit to locate the tilt event. We used a running median of \u2018ydriftwidth\u2019 to search for the largest offset and flagged every data point after the tilt event so that they would receive a constant \u2018jump\u2019 offset in our systematics model. We also removed the first point of the tilt event in our fits, as it was not captured by the \u2018jump\u2019 model. We fitted the broadband light curves, fitting for Rp/R\u22c6, photometric scatter, T0, b, a/R\u22c6, the quadratic limb-darkening coefficients and the systematics model parameters . We used uninformative flat priors on all the parameters. The orbital parameters were fixed to the best-fit broadband light curve values for the subsequent spectroscopic light-curve fits.We fitted the transit light curves from the Eureka! [V1] stellar spectra using the ExoTEP analysis frameworkx-pixel and y-pixel shifts and an exponential ramp function. The tilt event was accounted for by decorrelating the light curves with the y-pixel shifts, using a (1\u2009+\u2009constant\u2009\u00d7\u2009y-shift) term with the constant fitted for in each light curve. For the broadband light-curve fits, we fixed P and fitted for T0, i, Rp/R\u22c6, a/R\u22c6, x-pixel and y-pixel shifts and the exponential ramp amplitude and timescale. We fixed the nonlinear limb-darkening coefficients. For the spectroscopic light-curve fits, we fixed the values of T0, i and a/R\u22c6 and the exponential ramp timescale to the broadband light-curve-fit values, and fitted for Rp/R\u22c6, the x-pixel and y-pixel shifts and the ramp amplitude. Wide, uniform priors were used on all the fitting parameters in both the broadband and spectroscopic light-curve fits.We fitted transit light curves from the ExoTiC-JEDI [V1] stellar spectra using a custom lmfit light-curve-fitting code. The final systematic detrending model included a batman analytical transit model multiplied by a systematics model consisting of a linear stellar baseline term, a linear term for the 75) to generate the transit model with emcee as the sampler. We calculated the nonlinear four-parameter limb-darkening coefficients using ExoTHETyS (ref.\u200976), which relies on PHOENIX 2012\u20132013 stellar models78, and fixed these in our fits to the precomputed theoretical values. Our full transit\u2009+\u2009systematics model included a transit model multiplied by a second-order polynomial in the time domain. We accounted for the tilt event by subtracting the mean of the last 30 integrations of the pre-transit data from the mean of the first 30 integrations of the post-transit data, to account for the jump in flux, shifting the post-transit light curve upwards by the jump value. We fitted for the systematics , Rp/R\u22c6 and T0. We used uniform priors for all the fitted parameters. We adopted the root mean square of the out-of-transit data as the error bars for the light-curve data points to account for the scatter in the data.We fitted transit light curves from the Eureka! [V2] stellar spectra, using PyLightcurve . We used a GP systematics model with a time-dependent Mat\u00e9rn (\u03bd\u2009=\u20093/2) kernel and a variable white-noise jitter term. The mean function consists of a linear trend in time plus a sigmoid function to account for the drop in measured flux that occurred mid-transit owing to the mirror-tilt event. For the transit model, we used the exoplanet package80, making use of previously developed light-curve models82. For the GP systematics component, a generalization of the algorithm used by the celerite package83 was adapted for JAX. We fixed both of the quadratic limb-darkening coefficients. For the initial broadband light-curve fit, both NRS1 and NRS2 were fitted simultaneously. All transit parameters were shared across both light curves, except for Rp/R\u22c6, which was allowed to vary for NRS1 and NRS2 independently. We fitted for T0, the transit duration b and both Rp/R\u22c6 values. For the spectroscopic light-curve fits, all transit parameters were then fixed to the maximum-likelihood values determined from the broadband fit, except for Rp/R\u22c6, which was allowed to vary for each wavelength bin. Uncertainties for the transit model parameters, including Rp/R\u22c6, were assumed to be Gaussian and estimated using the Fisher information matrix at the location of the maximum-likelihood solution, which was computed exactly using the JAX automatic differentiation framework.We fitted the transit light curves from the ExoTiC-JEDI [V2] stellar spectra and performed our model fitting using automatic differentiation implemented with JAX . A linear trend in time was used as a systematics model and a step function was used to account for the tilt event. We fixed On the basis of the independent light-curve fits described above, we produced 11 transmission spectra from our NIRSpec G395H observations using several analyses and fitting methods. Extended Data Table \u03c3 of each other, with the uncertainty per bin typically overestimated compared with the mean uncertainty across all reductions.We computed the standard deviation of the 11 spectra in each wavelength bin and compared this to the mean uncertainty obtained in that bin. The average standard deviation in each bin across all fitting pipelines was 199\u2009ppm, compared with an average uncertainty of 221\u2009ppm (which ranged from 131 to 625\u2009ppm across the bins). The computed standard deviation in each bin across all pipelines ranged from 85 to 1,040\u2009ppm, with greater than 98% of the bins having a standard deviation lower than 500\u2009ppm. We see an increase in scatter at longer wavelengths, with the structure of the scatter following closely with the measured stellar flux, for which throughput beyond 3.8\u2009\u03bcm combines with decreasing stellar flux. The unweighted mean uncertainty of all 11 transmission spectra follows a similar structure to the standard deviation, with the uncertainty increasing at longer wavelengths. The uncertainties from each fitting pipeline are consistent to within 3\u03c32, in which \u03c3 is the uncertainty on the data point from each reduction). For this weighted-average transmission spectrum, the unweighted mean of the uncertainties in each bin was used to represent the error bar on each point. By using the weighted average of all 11 independently obtained transmission spectra, we therefore do not apply infinite weight to any one reduction in our interpretation of the atmosphere. Although the weighted average could be sensitive to any one spectrum with underestimated uncertainties, we find that our uncertainties are typically overestimated compared with the average. Similarly, we chose to use the mean rather than the median of the transmission spectral uncertainties, as this results in a more conservative estimate of the uncertainties in each bin. We find that all of the 11 transmission spectra are within 2.95\u03c3 of the weighted-average transmission spectrum without applying offsets.From all 11 transmission spectra, we computed a weighted-average transmission spectrum using the transit depth values from all reductions in each bin weighted by 1/variance . We performed a Kolmogorov\u2013Smirnov test on each of the normalized residuals and found that they are all approximately symmetric around their means, with normal distributions. This confirms that they are Gaussian in shape, with the null hypothesis that they are not Gaussian strongly rejected in the majority of cases . The second cluster is positively offset from the mean by about 120\u2009ppm and contains most of the transmission spectra produced. We see no obvious trends in this group to any specific reduction or fitting process. The final cluster is centred around the mean but has a broad distribution, suggesting a larger scatter both above and below the average transmission spectrum. This is probably the result of uncleaned outliers or marginal offsets between NRS1 and NRS2. These transmission spectra demonstrate that the 11 independent fitting pipelines are able to accurately reproduce the same transmission spectral feature structures, further highlighting the minimized impact of systematics on the time-series light curves. We suspect that the minor differences resulting from different reduction products and fitting pipelines are linked to the superbias and treatment of 1/84. Each model transmission spectrum from the grids was binned to the same resolution as that of the observations to compute the \u03c72 per data point, with a wavelength-independent transit depth offset as the free parameter. In general, the forward model grids fit the main features of the data but are unable to place statistically significant constraints on many of the atmospheric parameters, owing to both the finite nature of the forward model grid spacing13 and the insensitivity of some of these parameters to the 3\u20135-\u03bcm transmission spectrum of WASP-39b .To identify spectral absorption features, we compared the resulting weighted-average transmission spectrum of WASP-39b to several 1D RCTE atmosphere models from three independent model grids. Each forward model is computed on a set of common physical parameters , shown in Extended Data Table 88, which consists of model transmission spectra for different day\u2013night energy redistribution factors, atmospheric metallicities, C/O ratios, haze factors and grey cloud factors with a range of line lists and pressure-broadening sources88. In total, there were 5,160 models. Within this grid, we find the best-fit model to have 3\u2009times solar metallicity, with a C/O ratio of 0.35 and a grey cloud opacity 5\u2009times the strength of H2 Rayleigh scattering at 350\u2009nm and a \u03c72/N\u2009=\u20091.098 for N\u2009=\u2009344 data points and only fitting for an absolute altitude change in y.We used the ATMO RCTE grid91, varying the heat redistribution of the planet, atmospheric metallicity, C/O ratio, internal temperature, the presence of aerosols and the atmospheric chemistry (equilibrium or rainout). Opacities used include the BT2 H2O line list92, as well as HITRAN for 129 other main molecular absorbers93 and Kurucz and Bell data for atomic species94. The HITRAN line lists available in this version of PHOENIX are often complete only at room temperature, which may be the cause of the apparent shift in the CO2 spectral feature compared with the other grids that primarily use HITEMP and ExoMol lists. This shift is the cause of the difference in \u03c72 between PHOENIX and the other model grids. In total, there were 1,116 models. Within this grid, the best-fit model has 10\u2009times solar metallicity, a C/O ratio of 0.3, an internal temperature of 400\u2009K, rainout chemistry and a cloud deck top at 0.3\u2009mbar. The best-fit model has a \u03c72/N\u2009=\u20091.203 for N\u2009=\u2009344 data points.We calculated a grid of transmission spectra using the PHOENIX atmosphere model96), which has its heritage in the Fortran-based EGP mode98, to compute a grid of 1D pressure\u2013temperature models for WASP-39b. The opacity sources included in PICASO 3.0 are listed in Extended Data Table 2O (ref.\u200999), CO2 (ref.\u2009100), CH4 (ref.\u2009101) and CO (ref.\u2009102). The parameters varied in this grid of models include the interior temperature of the planet (Tint), atmospheric metallicity, C/O ratio and the dayside-to-nightside heat redistribution factor . Virga requires a vertical mixing parameter, Kzz (cm2\u2009s\u22121), and a vertically constant sedimentation efficiency parameter, fsed. In general, fsed controls the vertical extent of the cloud opacity, with low values (fsed\u2009<\u20091) creating large, vertically extended cloud decks with small particle sizes. In total, there were 3,840 cloudy models. The best fit from our grid with Virga-computed clouds has 3\u2009times solar metallicity, solar C/O (0.458) and fsed\u2009=\u20090.6, which results in a \u03c72/N\u2009=\u20091.084.We used the open-source radiative\u2013convective equilibrium model PICASO 3.0  or we fit for the cloud-top pressure corresponding to a grey cloud deck with infinite opacity . These results are described in the following section.As well as the grid fit, we also use the PICASO framework to quantify the feature-detection significance. In this method, we are able to incorporate clouds on the fly using the fitting routine PyMultiNest2 and He (via continuum) and CO, H2O, H2S, CO2 and CH4. More minor sources of opacity with VMR abundances <1\u2009ppm are molecules such as OCS and NH3. For example, removing H2S, NH3 and OCS from the single best-fit PICASO 3.0 model increases the chi-square value by less than 0.002. Therefore, we focus on computing the statistical significance of only H2O, SO2, CO2, CH4 and CO.From the chemical equilibrium results of the single best-fit models, the molecules that could potentially contribute to the spectrum based on their abundances and 3\u20135-\u03bcm opacity sources are H31. In this method, we subtracted the best-fit model without a specific opacity source from the weighted-average spectrum of WASP-39b, isolating the supposed spectral feature. We then fit a three-parameter or four-parameter Gaussian curve to the residual data using a nested sampling algorithm to calculate the Bayesian evidence106. For H2O and CO, the extra transit depth offset parameter for the Gaussian fit was necessary to account for local mismatch of the fit to the continuum, whereas only a mean, standard deviation and scale parameter were required for a residual fit to the other molecules. We then compared this to the Bayesian evidence of a flat line to find the Bayes factor between a model that fits the spectral feature versus a model that excludes the spectral feature. These fits are shown in Extended Data Fig. To quantify the statistical significance, we performed two different tests. First, we used a Gaussian residual fitting analysis, as used in other JTEC ERS analyses107. Those values are shown in Extended Data Table Although the Gaussian residual fitting method is useful for quantifying the presence of potentially unknown spectral features, it cannot robustly determine the source of any given opacity. We therefore used the Bayesian fitting routine from PyMultiNest in the PICASO 3.0 framework to refit the grid parameters, while excluding the opacity contribution from the species in question. Then, we compared the significance of the molecule through a Bayes factor analysis\u03c3) for H2O, CO2 and SO2. In general, the two methods only agree well for molecules whose contribution has a Gaussian shape . For example, for CO2, we find decisive 28.5\u03c3 and 26.9\u03c3 detections for the Bayes factor and Gaussian analysis, respectively. Similarly, for H2O, we find 21.5\u03c3 and 16.5\u03c3 detections, respectively. The evidence for SO2 is less substantial, but both methods give significant detections of 4.8\u03c3 and 3.5\u03c3, respectively. Although the Gaussian fitting method found a broad 1-\u03bcm-wide residual in the region of CO , its shape was unlike that seen with the PRISM data31. CO remained undetected with the Bayesian fitting analysis and therefore we are unable to robustly confirm evidence of CO. Similarly, no evidence for CH4 was found23. Gaussian residual fitting in the region of CH4 absorption only found a very broad inverse Gaussian and so is not included in Extended Data Table We find significant evidence >3\u03c3 for H2O2 required to match the observations. We add SO2 opacity using the ExoMol line list108, without rerunning the RCTE model to self-consistently compute a new climate profile. Fitting for the cloud deck dynamically, without SO2, produces a single best estimate of 10\u2009times solar metallicity, sub-solar C/O (0.229), resulting in a marginally worse \u03c72/N\u2009=\u20091.11. With SO2, the single best fit tends back to 3\u2009times solar metallicity, solar C/O. This suggests that cloud treatment and the exclusion of spectrally active molecules have an effect on the resultant physical interpretation of bulk atmospheric parameters. Ultimately, if we fit for SO2 in our PyMultiNest framework with the Virga cloud treatment, we obtain 3\u2009times solar metallicity, solar C/O, log SO2\u2009=\u2009\u22125.6\u2009\u00b1\u20090.1 (SO2\u2009=\u20092.5\u2009\u00b1\u20090.65\u2009ppm) and \u03c72/N\u2009=\u20091.02, which is our single best-fit model .We performed an injection test with the PICASO best-fit model in the PyMultiNest fitting framework to determine the abundance of SO2 absorption to explain the 4.1-\u03bcm spectral feature, we also computed models with prescribed, vertically uniform SO2 VMRs of 0, 1, 5 and 10\u2009ppm using the structure from the best-fit PHOENIX model . We calculated ad hoc spectra using the gCMCRT radiative transfer code109 with the ExoMol SO2 line list108 , C2H2 (ref.\u2009111), C2H4 (ref.\u2009112), C2H6 (ref.\u2009113), CO (ref.\u2009114), CO2 (ref.\u2009100), CS2 (ref.\u2009113), CN (ref.\u2009115), HCN (ref.\u2009116), HCl (ref.\u2009113), H2S (ref.\u2009117), HF (ref.\u2009118), H3+ (ref.\u2009119), LiCl (ref.\u2009115), NH3 (ref.\u2009120), NO (ref.\u2009114), NO2 (ref.\u2009113), N2O (ref.\u2009114), N2 (ref.\u2009121), NaCl (ref.\u2009122), OCS (ref.\u2009113), PH3 (ref.\u2009123), PN (ref.\u2009124), PO (ref.\u2009125), SH (ref.\u2009126), SiS (ref.\u2009127), SiH4 (ref.\u2009128), SiO (ref.\u2009129), the X\u2013X state of SO (ref.\u2009130), SO2 (ref.\u2009108), SO3 (ref.\u2009108) and isotopologues of H2O, CH4, CO2 and CO, but did not find a convincing candidate that showed opacity at the correct wavelength or the correct width. The narrowness of the feature suggests that it could be a very distinct Q-branch, in which the rotational quantum number in the ground state is the same as the rotational quantum number in the excited state. However, of the molecules we explored, there were no candidates with a distinct Q-branch at this wavelength whose P-branch and R-branch did not obstruct the neighbouring CO2 and continuum-like CO\u2009+\u2009H2O opacity.A 0.08-\u03bcm-wide bump in transit depth centred at 4.56\u2009\u03bcm is not fit by any of the model grids. This feature, picked up by the resolution of G395H, is not clearly seen in other ERS observations of WASP-39b. Following the same Gaussian residual fitting procedure as described above, we found a feature significance of 3.32 are available in HITRAN2020 (ref.\u2009113) but not in ExoMol131. Furthermore, if photochemistry is important for WASP-39b, as indicated by the presence of SO2, then there may be many species out of equilibrium that may contribute to the transit spectrum, some of which do not have high-temperature opacity data at present . Future observations over this wavelength region of this and other planets may confirm or refute the presence of this unknown absorber.We also note that many of these species lack high-temperature line-list data, making it difficult to definitively rule out such species. For example, OCS, SO and CSAny methods, additional references, Nature Portfolio reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at 10.1038/s41586-022-05591-3.Peer Review File"}
{"text": "Now that JWST has commenced science operations, we are able to observe exoplanets at previously uncharted wavelengths and spectral resolutions. Here we report time-series observations of the transiting exoplanet WASP-39b using JWST\u2019s Near InfraRed Camera (NIRCam). The long-wavelength spectroscopic and short-wavelength photometric light curves span 2.0\u20134.0\u2009micrometres, exhibit minimal systematics and reveal well defined molecular absorption features in the planet\u2019s spectrum. Specifically, we detect gaseous water in the atmosphere and place an upper limit on the abundance of methane. The otherwise prominent carbon dioxide feature at 2.8\u2009micrometres is largely masked by water. The best-fit chemical equilibrium models favour an atmospheric metallicity of 1\u2013100-times solar  and a substellar C/O ratio. The inferred high metallicity and low C/O ratio may indicate significant accretion of solid materials during planet formation  or disequilibrium processes in the upper atmosphere .Measuring the metallicity and carbon-to-oxygen (C/O) ratio in exoplanet atmospheres is a fundamental step towards constraining the dominant chemical processes at work and, if in equilibrium, revealing planet formation histories. Transmission spectroscopy (for example, refs.  Time-series observations from the JWST of the transiting exoplanet WASP-39b show gaseous water in the planet\u2019s atmosphere and place an upper limit on the abundance of methane. The JWST director\u2019s discretionary Early Release Science (ERS) programme provides the scientific community with observations of typical targets quickly enough to inform planning for the telescope\u2019s second cycle of scheduled observations. The primary goals of the Transiting Exoplanet Community ERS programme  are to demonstrate instrument capabilities, quickly build community experience and seed initial discovery in transiting exoplanetary science9. The Panchromatic Transmission programme observed a single exoplanet, WASP-39b, in transmission using four different instrument modes. It included overlapping wavelength coverage to cross-compare and validate all three near-infrared instruments for time-series observations. The observations presented here form one-quarter of this programme, demonstrating the capacity of the JWST Near-InfraRed Camera (NIRCam) for transiting exoplanet atmospheric characterization.JWST has demonstrated the necessary precision and wavelength coverage to make bulk characterization of hot exoplanet atmospheres routine10. We selected WASP-39b for its inactive host star and prominent spectroscopic features, which trace the atmospheric composition of the planet. We confirmed the star\u2019s relative inactivity through a photometric monitoring campaign using the Next-Generation Transit Survey (NGTS)11 and Transiting Exoplanet Survey Satellite (TESS)12  and other Saturn-mass exoplanets.WASP-39b is a highly inflated exoplanet of roughly Saturn mass, orbiting its G7 main-sequence star with a 4.05-day period(TESS)12 . Reporteut). The Grism R and F322W2 filter in the long-wavelength (LW) channel dispersed light from 2.420\u20134.025\u2009\u00b5m at a spectral resolution R of 1,570\u20132,594 over 1,023 resolution elements. The short-wavelength (SW) channel allowed the simultaneous measurement of light, that is photometry, spanning 2.0\u20132.2\u2006\u00b5m using the WLP8 weak lens and F210M filter. See We observed a single transit of WASP-39b with JWST\u2019s NIRCam instrument on 22\u201323 July 2022 , customizing the JWST Science Calibration Pipeline (jwst) to allow for minor adaptations to default steps and values worked best . The wavf noise , which describes the detector\u2019s correlated read noise26. For NIRCam, this manifests as weak structures in the dispersion direction, as shown in Fig.\u2006f noise in the final LW reduction because it did not impact the precision reached by individual spectroscopic light curves . We removed structures due to 1/f noise in the SW reduction . The right-axis scale is in equivalent scale heights, where one scale height is approximately 800\u2009km.Figure\u2006To interpret the presence of other molecules within the planetary atmosphere, we compared the Eureka! transit spectrum with a set of independently computed atmospheric model grids that spanned a range of cloud properties, metallicity values and carbon-to-oxygen (C/O) ratios . Figure\u20062O), carbon dioxide (CO2) and methane (CH4). From our model grid search, we definitively confirm the presence of H2O at nearly 16\u03c3. Water vapour was previously identified in the atmosphere of WASP-39b using the Hubble Space Telescope (HST) Wide Field Camera 3 (WFC3) observations taken at shorter wavelengths  at 4.3\u2009\u00b5m (ref. 7), but the overlap between the CO2 feature at 2.8\u2009\u00b5m and the broad H2O feature  version 3.0 model  to determine an upper limit on the abundance of CH4 at 1\u2009mbar, where it contributes most strongly to the spectrum. Within our single best-fit model scaling, we find an upper limit on CH4 abundance at 1\u2009mbar of 5.5\u2009\u00d7\u200910\u22125 (or 55\u2009ppm) volume mixing ratio, above which the goodness of fit per free parameter, 4 abundances, but found they did not have any statistical significance.In a hot  solar-metallicity atmosphere with a stellar C/O ratio, CH4 upper limit, the single best fit from each grid favours the lowest C/O ratio  within that grid. These best-fit point values for C/O from the three grids agree well with the value of 13. We examined the effect of an even lower C/O grid point by computing the best-fit PICASO\u20093.0 model with a C/O of 0.115, but found no discernible difference in the transit spectrum. Comparing our inferred C/O ratio for WASP-39b\u2019s atmosphere with that of its host star, we see that it is substellar ). We also note that the C/O ratio shown here represents the C/O fraction of the planet\u2019s upper atmosphere rather than that of the whole atmosphere, as these NIRCam observations probe approximately the 0.1\u201310\u2009mbar pressure range. WASP-39b\u2019s temperature\u2013pressure profile is cool enough for the formation of silicate  cloud species at depth, which would deplete oxygen from the upper atmosphere and actually increase the C/O ratio aloft compared with the bulk planetary envelope28.Driven by this CH30). Similar measurements have been difficult to achieve from HST alone. Even in the Solar System gas giants, such constraints have proved difficult from both remote sensing and in situ missions, as the low temperatures of Jupiter, Saturn, Uranus and Neptune lead to condensation of most O-bearing species  at high altitudes, prohibiting accurate measurement of the O abundance .Figure\u20064 in the upper atmosphere could explain the absence of a CH4 peak at 3.3\u2009\u00b5m . The most likely immediate products of CH4 photolysis, such as hydrogen cyanide (HCN) or acetylene (C2H2), would be produced in abundances too small  to be robustly detected with a single NIRCam transit, even from complete CH4 conversion. Alternatively, much of the C available from CH4 photolysis could have been oxidized by photodissociated H2O to form carbon monoxide (CO) and CO2 (refs. 35), although the absolute abundances of these two C reservoirs would not have been meaningfully altered as their abundances under chemical equilibrium are already higher than that of CH4. Other proposed disequilibrium chemistry processes could reduce the CH4 abundance at the terminator without also decreasing the C/O ratio39. We defer the exploration of complex disequilibrium models to atmospheric retrieval analyses using the full set of data provided by the Transiting Exoplanet Community ERS programme. That dataset will also constrain the presence of additional O- and C-bearing species to provide a more robust constraint on the C/O ratio than we can obtain here. However, the C/O ratio estimate we report from NIRCam is broadly consistent with the C/O ratio found from the other individual ERS WASP-39b datasets, which range from best fits that are subsolar\u00a0(Near InfraRed Imager and\u00a0Slitless Spectrograph\u00a0(NIRISS)/Single Object Slitless Spectroscopy (SOSS)40; NIRSpec/PRISM 3.0\u20135.0\u2009\u00b5m (ref. 7); NIRSpec/G39541)\u00a0to a slightly super-solar upper limit (NIRSpec/PRISM 0.5\u20135.5\u2009\u00b5m\u00a0(ref. 42)).The apparent substellar C/O ratio inferred from chemical equilibrium models may trace photochemical processes in the planet\u2019s upper atmosphere. For example, photochemical destruction of CH44. Taken as such, JWST observations could offer important clues regarding the degree to which hot-Jupiter atmospheres undergo solid accretion during their early evolution.If disequilibrium chemistry is not prevalent in the planet\u2019s upper atmosphere, the inferred high metallicity and low C/O ratio can be tied back to the formation of WASP-39b. The most prominent scenario is that WASP-39b formed by core accretion exterior to the water-ice line and accreted low-C/O solid material in situ and/or while migrating inwards within the protoplanetary disk45, the future promises many exciting discoveries and major advancements in the formation, evolution and atmospheric chemistry of hot Jupiters.Here we have demonstrated the excellent performance of NIRCam for exoplanet transmission spectroscopy. With the first JWST exoplanet spectra now comparable to the first near-infrared Jupiter spectraAs part of this article\u2019s Reproducible Research Compendium, located on Zenodo at 10.5281/zenodo.7101283, we provide saved outputs from various pipeline stages and the data used to generate relevant figures, as well as a Jupyter Notebook with step-by-step data reduction instructions replicating our chosen analysis (10.5281/zenodo.7510106).11. Monitoring began at the end of April 2022 and continued until late August, spanning the JWST ERS transit observations of WASP-39b in July. We used one camera on most photometric nights to take a series of 10-s images lasting on average for 2\u2009h. The resulting monitoring light curve is plotted in Extended Data Fig. 12, which is binned to 2\u2009h to be comparable to NGTS. Both light curves have been detrended against sky brightness. They show evidence for stellar activity, but only with a low amplitude of 0.06% in NGTS.To confirm that WASP-39 is a relatively inactive star, and that the JWST observations were not adversely affected by stellar activity, we carried out photometric monitoring with the ground-based NGTS51, which is otherwise limited by atmospheric scintillation52. The transit models were generated from the system parameters listed in Extended Data Table Also plotted in Extended Data Fig. The transit observations in Extended Data Fig. 54. The LW channel used the Grism R\u2009+\u2009F322W2 filter to observe a wavelength range of 2.420\u20134.025\u2009\u00b5m with a spectroscopic resolving power of R\u2009\u2248\u20091,600 at 4\u2009\u00b5m , which we briefly summarize here. jwst is a Python software suite for processing data from all JWST instruments and observing modes, and is organized into three stages. Stage\u20061 takes in uncal.fits files and performs detector-level corrections and ramp fitting for individual exposures . Stage\u20062 takes in slope images (ramps) from Stage\u20061 and performs an assignment of the world coordinate system, flat fielding and assignment of a wavelength solution. Stage\u20063 takes in calibrated two-dimensional images from Stage\u20062 and extracts a time series of one-dimensional spectra. The default pipeline settings include a flux calibration step at Stage\u20062. In all data reductions presented below, we skipped that step, as it introduced scatter in the extracted spectral time series. This is justified because the transit depths we compute are relative, rather than absolute, flux measurements.Many of the reductions presented below used intermediate data products from or made minor edits to the JWST Science Calibration Pipeline \u00a0that\u00a0has tools to modify the jwst pipeline and performs\u00a0 photometric and optimal spectral extraction of light curves.tshirt is an open-source pipeline . The ROEBA correction happens after the bias subtraction step. First, the median of all even columns\u2019 background rates is subtracted from all even columns and the median of all odd columns\u2019 background rates is subtracted from all odd columns to remove most pre-amp reset offsets and odd/even pixel effects. Next, the median of each column\u2019s background rate is subtracted from each row to remove the 1/f noise for timescales longer than a row read time (5.24\u2009ms). The correction was applied to each group so that 1/f noise would not be detected as spurious jumps or cosmic rays by the pipeline. We used all pixels more than 201\u2009pixels from the source to estimate the background and 1/f noise, then subtracted the median of each row from all pixels in that row. Stage 2 of jwst was skipped, as it only changes the rates from analogue-to-digital units\u00a0(ADU) per second to physical units and conducts flat fielding. This does not affect the relative measurements of the light curve (due to the high pointing precision) and allows for comparison with detector-level effects.In the stage 1 SW analysis, tshirt applied a row-by-row, odd/even-by-amplifier (ROEBA) subtraction algorithm that used background pixels to reduce the 1/For the photometric extraction, we used a source radius of 79\u2009pixels and a background annulus of 79\u2009pixels to 100\u2009pixels. We performed a two-dimensional Gaussian fit to determine the centre of the aperture.We performed three independent LW data reductions, using the Eureka!, Atmospheric Transmission Spectroscopy Analysis Code (HANSOLO) and tshirt pipelines.x coordinate (the dispersion direction), but this is not strictly accurate at the blue end. For all methods, we use commissioning programme 1076 to derive a third-degree polynomial wavelength solution that uses the Pfund and Bracket hydrogen series in the planetary nebula IRAS\u200905248\u22127007. The residuals in this solution are \u22720.1\u2009nm and the stellar absorption lines in WASP-39 agree with the solution to within 1\u2009nm. The difference between the corrected wavelengths and the original wavelength solution is almost zero at the red end of the spectrum, but increases to about 50\u2009nm at the blue end.The reference files in the Calibration Reference Data System at the time of our analysis included a linear solution for wavelength as a function of We investigated several variations of the Eureka! LW data reduction to minimize the median absolute deviation (MAD) of the final extracted light curves, with different settings for cosmic-ray jump detection, identifying the spectral trace, the aperture size for spectral extraction, the region for background subtraction and limits for outlier rejection. Here we present details of the data reduction that produced the spectrum shown in the main body of the paper.\u03c3. In Stage 3, we first trimmed the data to a subarray extending from pixels 4\u201364 in the cross-dispersion direction and 4\u20131,704 in the spectral direction. We then masked any pixels with not a number\u00a0(NaN) values for the flux or error. We fit the spectral trace with a Gaussian profile and corrected for the curvature of the trace to the nearest integer pixel. We excluded a 14-pixels-wide region on either side of the spectral trace from the background calculation and performed a column-by-column linear fit to subtract the background. We used a double-iteration 7\u03c3 threshold for outlier rejection of the sky background along the time axis during background subtraction. In addition, we used a 7\u03c3 threshold for outlier rejection during the polynomial fit to the background. To obtain the spectrum, we constructed a normalized spatial profile using the median of all data frames, then used optimal extraction56 on an aperture with a half-width of 9\u2009pixels. For the optimal extraction, we rejected outliers above a 10\u03c3 threshold. Extended Data Fig. Stages 1 and 2 were identical to the jwst pipeline, with the exception of increasing the rejection threshold during jump detection to 658 and was adapted to enable its use on NIRCam data. HANSOLO begins with the calibrated rateints.fits outputs of jwst Stage 1.The HANSOLO pipeline was originally developed to analyse ground-based transmission spectra observed with 8-m-class telescopes59 to remove cosmic-ray effects from the two-dimensional images and identified the spectral trace using a Moffat function fit to each column. To remove the sky, we fitted and subtracted a linear trend from each column, excluding from the fit a region of 20\u2009pixels on either side of the trace centre. We then extracted the spectrum by summing over an aperture with a half-width of 3\u2009pixels. The spectra from different images were aligned with each other using cross-correlation. To correct outlier pixels, each spectrum was normalized to account for the effect of the transit on the time series. Outliers >3\u03c3 away from the mean were removed from the time series of each wavelength point in the normalized spectra and replaced with the median value over time. We then rescaled the spectra to their original amplitudes.We used the LACOSMIC algorithmf noise (described above for photometry); however, only pixels 1,847 to 2,044, which are on the rightmost amplifier, are available as low-illumination background.As with the SW reduction, a few modifications were made to the Stage 1 jwst ramps-to-slopes pipeline. ROEBA subtraction reduced 1/26. We used a spectral aperture centred at pixel 34 in the spatial direction with a half-width of 5\u2009pixels. We selected the background region to extend between pixels 5\u201324 and 44\u201365 in the spatial direction. The background was fit with a column-by-column linear trend with 3\u03c3 clipping. For the spectral extraction, we fit the spatial profile with a cubic spline with 20\u2009knots and an outlier rejection threshold of 30\u03c3. If a pixel was deemed an outlier either by the \u2018DO_NOT_USE\u2019 data quality flag or by the spatial profile outlier detection, the rest of the spatial profile was weighted by the reference profile to ensure that the flux was conserved. For the covariance weighting, a correlation of 8% was assumed between pixels as measured by background pixels\u2019 noise properties.For Stage 3, tshirt performed optimal spectral extraction weighted by the covariance between pixelsWe used both Eureka! and tshirt to fit the SW light curves. In both cases, the light curves were fit with models that included both the transit and the systematic noise. However, to investigate the effect of different systematic models on the resulting spectra, each fit used a slightly different noise model. Extended Data Table For the LW fits, we summed the data into 15\u2009nm bins (about 15\u2009pixels). We experimented with bins as small as 10\u2009nm, but found that reducing the bin size below 15\u2009nm led to poor constraints on the limb darkening and added additional scatter to the resulting spectrum. Extended Data Fig. https://github.com/catrionamurray/chromatic_fitting/) Python tool to perform light-curve fitting, built on the data visualizer chromatic . For this work, chromatic-fitting light-curve fitting was applied to a Eureka! data reduction. As with the SW fits, we fit the LW light curves with models that include different noise parameterizations. Extended Data Table We fit the LW light curves using four independent pipelines: chromatic-fitting, Eureka!, HANSOLO and tshirt. chromatic-fitting is an open-source (60 (for fits performed with Eureka!), the pymc3 Python package61  or the CONAN Python package58 (for fits performed with HANSOLO). The number of free parameters and the resulting differential MADs of the light curves from each fit are also listed in Extended Data Tables For all fits, the parameters were estimated with a Markov chain Monte Carlo fit, using either the emcee Python package66 could result in a biased planet spectrum and might present a higher level of time-correlated noise in the residuals. We attribute this to a combination of JWST\u2019s high-precision light curves and deficiencies in the stellar limb-darkening models to accurately represent WASP-3968. Therefore, the results presented here use the quadratic limb-darkening law, in its classical form or reparameterized by ref. 69, with one or both coefficients as free parameters. We confirmed that these parameterizations produce transmission spectra that are consistent both with each other and with the spectra resulting from using more complex limb-darkening parameterizations, such as a four-parameter law with either fixed or free parameters70. We therefore recommend that future transmission spectrum analyses with NIRCam use similar methods. Limb-darkening conclusions from the full Transiting Exoplanet Community ERS programme will be discussed further by N.\u00a0Espinoza et al. (manuscript in preparation).In the process of performing the fits to the LW data, we regularly found that the best-fit transmission spectra were shifted vertically for different limb-darkening parameterizations and, for some reductions, exhibited changes in the apparent size of the water feature. In particular, we found that light-curve fits with all limb-darkening coefficients fixed to outputs from ExoTiC-LD\u03c3 (using the maximum error at each point), which demonstrates a remarkable level of agreement. In addition, the residuals showed no evidence for time-correlated noise, as shown in Extended Data Fig. The final fitted light curves are shown in Extended Data Fig. For ease of interpretation, we compared our atmospheric models with only one transmission spectrum. We selected the Eureka! spectrum, as it was on average nearest the median spectrum (the median transit depth at each bin).\u03c72 fits to the transmission spectra using three grids of radiative\u2013convective equilibrium models: ATMO73, PHOENIX76 and PICASO\u20093.078. All models used a common set of planetary parameters, but had differing opacity sources, cloud treatments and grid points, described in detail below. Each model was binned to the resolution of the data to perform the \u03c72 fitting. We performed these three independent model grid fits to fully vet our inferences about the atmospheric metallicity and the presence of specific molecular features within the data.To interpret the LW data from NIRCAM/F322W2, we performed 77, version 3.078, which was developed from the Fortran-based Extrasolar Giant Planet (EGP) model81. We used PICASO\u20093.0 to generate one-dimensional temperature\u2013pressure profiles in thermochemical equilibrium. The base PICASO\u20093.0 forward model grid computes atmospheric mixing ratios using variations of planetary intrinsic temperatures (Tint) of 100\u2009K, 200\u2009K and 300\u2009K; C/O ratios of 0.229, 0.458, 0.687 and 0.916; and atmospheric solar metallicity values of 0.1\u00d7, 0.316\u00d7, 1.0\u00d7, 3.162\u00d7, 10.0\u00d7, 31.623\u00d7, 50.119\u00d7 and 100\u00d7 solar. The PICASO grid assumes full day\u2013night energy redistribution. To compute model transmission spectra from the atmospheric profiles, we used opacities described by ref. 81  from refs. 89.Our primary atmospheric model grid is built from the open-source radiative\u2013convective equilibrium code PICASO33 and the cloud modelling code Virga90, which is the Python implementation of the Eddysed cloud code91, to post-process disequilibrium chemistry from mixing and photochemical products as well as the effect of clouds. These additional post-processed grids also include vertically constant eddy diffusivities (Kzz) of 105\u20131011\u2009cm2\u2009s\u22121 in steps of 2\u2009dex, and both clear and cloudy models. For the Vulcan disequilibrium runs, we computed model grid points for only a select subset of metallicity values  and C/O ratios . We found that neither the cloudy nor the clear disequilibrium grids from VULCAN offered an improvement in the We then used the one-dimensional CHON-based chemical kinetics code VULCAN\u03c4cloud) between 1\u2009bar and 0.1\u2009bar ranging from \u03c4cloud\u2009=\u20093.2\u2009\u00d7\u200910\u22126 to 1 in steps of 0.1\u2009dex across all wavelengths. For clouds of specific condensates, we used Virga to compute log-normal particle size distributions using sedimentation efficiency (fsed) values of 0.6 to 10 for MnS, Na2S and MgSiO3 along the range of Kzz. Smaller sedimentation efficiencies, fsed, with larger eddy diffusivities, Kzz, generated more extended cloud decks and stronger cloud opacity.Within PICASO, clouds are implemented both as grey absorbers and as Mie scatterers using temperature-relevant cloud condensate species from Virga. For the grey clouds, the grid specified a cloud optical depth , bulk atmospheric metallicity  and C/O ratio (136 grid points from 0.3 to 1) were varied. Aerosol properties were parameterized through a haze factor (0 and 10\u00d7 multi-gas Rayleigh scattering) and a grey-cloud-deck pressure level . Models with molecular abundances quenched at 1\u2009bar to simulate vertical mixing were also calculated. The grid also included rainout to account for species sequestered as condensates in the deep atmosphere. Opacities are described by refs. 92 and taken from ref. 88.We also used a grid of atmosphere models from the PHOENIX radiative\u2013convective equilibrium code to fit the data93. The ATMO grid used similar atmospheric and aerosol parameterizations to those used in the PHOENIX grid and also included rainout that accounts for species condensed in the deep atmosphere. Also included are day\u2013night energy redistribution factors , atmospheric metallicity , interior temperature , C/O ratio , cloud scattering factor  and a haze scattering factor (1\u00d7 and 10\u00d7 multi-gas Rayleigh scattering). Opacities for H2O, CO2 and CH4 are taken from refs. 86 and for H2S from ref. 88.Similar to the model grids described above, we compared the data to a grid of models from the ATMO radiative\u2013convective\u2013thermochemical equilibrium code7), improving on the wider spread from previous HST-only94 or HST and ground-based optical interpretations16.We applied each of our three grids\u2014ATMO, PHOENIX and PICASO 3.0\u2014to fitting the NIRCam F322W2 spectrum (2.4\u20134.0\u2009\u00b5m). In doing so, we found that the models strongly favoured a solar- or super-solar-metallicity atmosphere (1\u2013100\u00d7 solar), a substellar C/O ratio (\u22640.35) and substantial contribution from clouds, which are parameterized differently by each model grid (see each grid description above). We show the best fits from each model grid in Extended Data Fig. fsed\u2009=\u20090.6 and Kzz\u2009=\u2009109\u2009cm\u2009s\u22122. This Virga best-fit model consists of clouds of MnS and MgSiO3 with deep (\u2265100\u2009bar) cloud bases and diminishing optical depth up to approximately millibar pressures.For the NIRCam-only fit, the PICASO grey-cloud scheme produced a slightly better best fit (95), as well as potentially the sparseness of the model grid.The best-fit equilibrium model from the PHOENIX grid had 100\u00d7 solar metallicity, a C/O ratio of 0.3 and a cloud deck at 3\u2009mbar. Cloudy models were generally preferred over clear models, but not with statistical significance  were preferred to clear models . High-altitude clouds or hazes can be inferred from their particle sizes, where small particles scatter shorter wavelengths more efficiently , thus enabling the disentanglement of a very cloudy, low-metallicity atmosphere from a less cloudy, high-metallicity atmosphere17.In Extended Data Fig. \u22123 from 1\u2009bar to 0.1\u2009bar), we used this as a base model to explore the significance of specific molecular detections. First, we tested whether we could improve the best fit in the presence or absence of H2O, CO2, CH4 or H2S. We re-ran the best-fit base model by zeroing out each of these species in turn, shown in Fig.\u2006\u03c72 analysis.Once we found the \u2018single best fit\u2019 for the PICASO grid to the NIRCam spectrum , of 123.2 between the Gaussian residual and constant models for H2O over the whole NIRCam wavelength range, corresponding to 15.9\u03c3, a strong detection. For CO2, we find ln(B) of 0.82 between the Gaussian residual and constant models between 2.4\u2009\u00b5m and 2.9\u2009\u00b5m, or 1.9\u03c3, which is a weak or non-detection98. CO2 is strongly detected at 4.3\u2009\u00b5m in the NIRSpec data for WASP-39b42, but the strong overlapping H2O band at 2.8\u2009\u00b5m prevents NIRCam from making a significant CO2 detection. Given our upper limit on CH4 abundance, we also performed the same Gaussian residual fitting for CH4 and find a weak or non-detection at approximately 2\u03c3.With the best fit in hand, we investigated the presence of individual molecular species. For molecular detection significances, we performed the same Gaussian residual fitting, shown in Extended Data Fig. 42 observed evidence for a molecular feature near 4.0\u2009\u00b5m, which is currently best explained by sulfur dioxide. The reddest data points (>4.025\u2009\u00b5m) from NIRCam also show an increase that is consistent with this feature seen in the NIRSpec data. However, as shown in Extended Data Fig. Both WASP-39b NIRSpec datasetsnts >4.02\u2009\u00b5m from Any methods, additional references, Nature Portfolio reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at 10.1038/s41586-022-05590-4."}
{"text": "When VO2 is in a metal state, the multi-frequency absorption and LTC polarization conversion can be achieved with different chemical potentials. When VO2 is in the insulator state and the polarization angle of incident wave is 45\u00b0, the device can be used to select or isolate the incident waves with different polarization states in the frequency region of 1.2\u20131.8 THz. Furthermore, when the chemical potentials are 0.05 eV and 1.2 eV, the corresponding transmissions of the TE-polarized wave demonstrate the opposite results, realizing the switching functions in the frequency region of 0.88\u20131.34 THz. In the frequency region above 2 THz, the multi-frequency rejection filter can be achieved. The designed switchable multifunctional metamaterial device can be widely implemented in radar monitoring and communication systems.Combining tunable properties and various functionalities into a single metamaterial structure has become a novel research hotspot and can be used to tackle great challenges. The multifunctional metamaterial structure that combines absorption, linear-to-circular (LTC) polarization conversion, filtering and switching functions into a single metamaterial device was designed and investigated in this study. The switching of different functions can be achieved based on the phase transition of vanadium dioxide (VO Thus, VO2 enables the switchable and tunable functionalities for smart devices since the conductivity is capable of 4\u20135 orders of magnitude change, and the phase-change process can be realized in several picoseconds [2 can be used as a promising candidate in several advanced devices, such as optical switches, modulators, absorbers, and polarization converters.Modulating the terahertz waves is particularly important in responding to the increasingly complex electromagnetic environment and communication needs. The absorber, polarization converter, and filter are especially essential devices in the fields of wave modulation. Metamaterials are artificially designed electromagnetic materials that are formed by periodic distribution of subwavelength microstructures. Traditional metamaterial devices, including absorbers, polarization converters, filters, etc., are usually designed for realizing a single function. In recent years, with the introduction of functional materials such as graphene, VOhotspots ,7,8,9,10hotspots . Graphenhotspots . One metoseconds . Inspire2 and graphene in multifunctional metamaterial structures have been put forward. By combing the VO2 and graphene, Zhu et al. designed a switchable terahertz metamaterial structure to realize wide-band and multi-band absorption [2 and graphene to realize dynamically tunable dual-wide-band absorption [2 switches from the metallic phase to the insulator phase, the operation frequency can be changed from the high-frequency to low-frequency region accordingly. By altering the Fermi energy level of graphene, its absorptivity can be continuously varied from 5.2% to 99.8%. Zhao et al. proposed a dynamically switched wide-band metamaterial polarization converter by treating the VO2 and graphene gratings in terahertz region [2 enables the polarization conversion switching between transmissive and reflective modes, and the introduction of double-layer graphene grating should improve the transmittance. Tang et al. designed a multifunctional terahertz metamaterial structure based on the hybrid VO2-graphene integrated structure [2, the asymmetric transmission and two different polarization conversions can be integrated into one device in the terahertz region. Wang et al. realized a dual-functional tunable wide-band absorber/reflector based on the periodic cross-shaped graphene array and a VO2 layer [2 and graphene.Advances toward the combination of VOsorption . Liu et sorption . When thz region . The phatructure . EnabledO2 layer . Most of2 material. Compared to the previously reported metamaterial devices, the proposed scheme here can provide three main advantages, which are as follows: (1) different functions, including multi-frequency absorption and linear-to-circular (LTC) polarization conversion, and different transmission characteristics can be integrated into a single metamaterial structure; (2) when VO2 is in the metal state, the designed structure works in reflection mode, and the functions of the metamaterial structure can switch between absorption (\u00b5c = 1.2 eV) and LTC polarization conversion (\u00b5c = 0.05 eV) by varying the graphene chemical potential; (3) when VO2 is in the insulator state, the structure works in the transmissive mode, which exhibits different transmission characteristics for different incidences. In addition, the effects of several structure geometrical parameters on the performances have also been investigated. The proposed scheme may pay a new route in designing tunable and switchable multifunctional terahertz metamaterial structures.Within the investigation of this study, we aimed to design a multifunctional metamaterial structure based on the manipulability of the chemical potential of graphene and the phase-transition properties of VO2\u2013graphene-integrated metamaterial structure, which is arranged periodically in the x- and y-direction. The unit cell of the proposed metamaterial structure is composed of five layers from top to bottom: metal split ring resonator, SiO2 spacer, metal split ring resonator, SO2 spacer, and VO2 layer. As depicted in px = py = 80 \u00b5m, t1 = 0.2 \u00b5m, t2 = 24 \u00b5m, t3 = 13 \u00b5m, R1 = 30 \u00b5m, R2 = 27 \u00b5m, and \u03b1 = 5\u00b0. The top and middle metal split rings are 0.2 \u00b5m\u2013thick gold microstructures with a conductivity of 4.561 \u00d7 107 S/m [2 material with a dielectric constant of \u03b5r = 3.75 [2 can be varied by using voltage and temperature, respectively. 107 S/m . The gap 107 S/m . In the r = 3.75  and elecThe fast-developing micro\u2013nano-fabrication technology can be used to fabricate the designed multifunctional structures . The des\u03c3g = \u03c3intra + \u03c3inter, can be characterized by the intra-band conductivity, \u03c3intra, and the inter-band conductivity, \u03c3inter [\u03c9 represents the angular frequency of the incident terahertz wave, \u00b5c represents the chemical potential or Fermi level of graphene [T denotes the temperature, e represents the electronic charge, kB denotes the Boltzmann constant, \u0393 = \u0127/2\u03c0 denotes the phenomenology scattering rate, \u0127 represents the reduced Plank constant, \u03c4 = \u00b5\u00b5c/\u03c3igraphene , T denotur study . Moreoveperature . The surperature  or bias perature . Based oBT << \u00b5c . Thus, tg\u03b5, of the graphene can be described by g\u03b5 = 1 + j\u03c3g/(\u03b50\u03c9dg) [\u03b50 represents the vacuum permittivity, and dg denotes the thickness of the graphene material, which is set as 1 nm in the investigation [The effective permittivity, /(\u03b50\u03c9dg) ,30, whertigation .2 is one of the important phase-transition materials. In general, the permittivity of VO2 in the terahertz region can be characterized by using the Drude model [\u03b5\u221e = 12 represents the permittivity at infinite frequency; \u03b3 = 5.75 \u00d7 1013 rad/s. p\u03c9(\u03c30)), where p\u03c9(\u03c30) = 1.4 \u00d7 1015 rad/s. To simulate the insulating-metal phase change characteristics of VO2, different conductivities are used to characterize the different optoelectronic characteristics of VO2. In this study, 5 S/m and 2, respectively. The conductivity of VO2 can be changed by laser radiation, external bias voltage, and thermal control.Besides graphene, VOde model :(4)\u03b5VO2== 10 S/m  were usex and y axes to mimic the infinite arrays, and the open boundaries are applied in the z axis. Linearly and circularly polarized terahertz waves transmitting along the -z direction are incident on the metamaterial structure.The metamaterial device was designed and the related simulations were performed by using the finite difference time-domain method. The unit cell boundary conditions are used in 2 and variation of graphene chemical potential, different functions can be integrated into a single metamaterial structure. When VO2 is in the metallic state (5 S/m), according to different chemical potentials, the designed structure can exhibit linear-to-circular (LTC) polarization conversion properties (\u00b5c = 0.05 eV) and absorption properties (\u00b5c = 1.2 eV), respectively. In 2017, Bezares et al. presented FeCl3-intrcalated graphene as a new plasmonic material with high stability under environmental conditions and carrier concentrations, corresponding to a Fermi energy of 1.21 eV on the two-monolayer sample and 1.4 eV for the bilayer graphene [n = 4 \u00d7 1014 cm\u22122 have been obtained for electrons and holes [14 cm\u22122 has been realized in experiments [2 is in the insulator state  or TM-polarized  incident terahertz waves with a polarization angle of 0\u00b0. In the x\u2013y-coordinate system, for realizing the LTC polarization conversion, the reflection coefficients for co-polarization (TE-to-TE), EEr, and cross-polarization (TE-to-TM), MEr, should be equal, providing a phase difference of \u0394\u03c6 = ME\u03c6 \u2212 EE\u03c6 = 2n\u03c0 \u00b1 \u03c0/2 (n represents an integer), and \u201c\u2212\u201d and \u201c+\u201d define the left-handed and right-handed circularly polarized terahertz waves [When the conductivity of VOtz waves ,39. As gtz waves :(5)S0=|\u03c7 = S3/S0 is further given to evaluate the polarization conversion degree. Specifically, \u03c7 = \u22121 and \u03c7 = +1 indicate that the reflective wave is a LHCP wave and RHCP wave, respectively. The normalized ellipticity of \u03b2) = S3/S0 and introduce the axis ratio AR = 10log(tan\u03b2) to evaluate the circular polarization characteristics [\u03b2 represents the ellipticity angle. As shown in \u03b7 = |MEr|2 + |EEr|2. The efficiency of the RHCP is higher than 0.8, and that of the LHCP is larger than 0.7. The results demonstrate that the designed metamaterial structure can realize the high-efficiency conversion operation.In addition, we define sin were studied when the other parameters are fixed as initial settings, and the results are given in R2 rises from 25 to 29 \u00b5m, the ellipticity of RHCP wave increases. At the same time, the corresponding bandwidth narrows slightly, which is caused by the red-shift of the overall LHCP frequency band with the augment of R2. Furthermore, as given in t2. The above results demonstrate that the variation of geometric parameters have a certain influence on the operating characteristics, but the influence is acceptable according to the fabricating error.In general, the geometry parameters of the metamaterial device have an effect on the operation performances. In addition, errors can be introduced in the structural dimensional parameters during the device processing. Therefore, the geometric parameters of the metamaterial structure were also investigated. The variations of the ellipticity spectrum of the LTC polarization conversion structure with the geometry parameters A=1\u2212Rx and y axes, and it is very helpful in many practical applications.Next, the absorption properties of the multi-band metamaterial absorber with different polarization angles are studied. t2 and R2 on the absorption performances. As illustrated in t2, the frequency bands around 1.78 THz and 3.35 THz show a slight red-shift trend. From R2 rises from 25 to 29 \u00b5m, the frequency band around 1.7 THz illustrates a more obvious change in the absorption performance than that of the other frequency bands. Moreover, the overall absorption spectrum demonstrates a red-shift trend. In addition, we also discussed the effects of the geometric parameters of 2 is 10 S/m and the chemical potentials of graphene are 0.05 and 1.2 eV, the designed metamaterial structure is able to act as a filter, which performs different filtering responses for TE- and TM-polarized incident terahertz waves with the polarization angle of 45\u00b0. The device contains a top layer pattern combining metal split ring and graphene filled in gaps, a first lossy SiO2 dielectric layer, a middle layer pattern with the same structure as the top layer, a second lossy SiO2 dielectric layer, and a base VO2 dielectric layer. For different graphene chemical potential values, the responses related to the TE- and TM-polarized terahertz waves are different. When the chemical potential is \u00b5c = 0.05 eV, the TE-polarized terahertz waves and TM-polarized terahertz waves have completely different transmission rates in the low frequency band, as depicted in fc, of 2.25 THz (TE-polarization), 2.34 THz (TM-polarization), and 2.54 THz (TM-polarization), the corresponding transmissions of the proposed metamaterial structure are 3.2%, 2.1%, and 5.8%, demonstrating good stop-band characteristics. The corresponding stop-band bandwidths \u2206f(\u22123 dB) are 120, 140, and 50 GHz, and the corresponding quality factors, Q = fc/\u2206f, are 18.75, 16.71, and 50.8. Moreover, the transmission properties can also enable the construction of a terahertz wave sensor, and the related investigation method can be found in our previous work [When the conductivity of VOous work .\u00b5c = 1.2 eV, the TE-polarized terahertz waves and TM-polarized terahertz waves exhibit similar transmission responses in the low frequency region, as given in \u00b5c is 1.2 eV, the transmittance of TE-polarized incident wave is lower than 10% in a narrow frequency range (0.88\u20131.34 THz). It should be noted that the bandwidth can be broadened by further optimization, including changing the structure size and material properties, etc. In practical applications, specific functions can be implemented according to the requirements. In the high frequency range, when \u00b5c augments from 0.05 to 1.2 eV, the metamaterial structure changes from a multi-frequency rejection filter to a single-frequency rejection filter. As given in \u00b5c rises from 0.05 to 1.2 eV, the structure also changes from a multi-frequency rejection filter to a single-frequency rejection filter.When the chemical potential is t2 and R2) on the filtering characteristics were also investigated. The conductivity of VO2 and chemical potential of graphene are \u00b5c = 0.05 eV, respectively, and the polarization angle of incident wave is 45\u00b0. As given in t2 result in only a slight effect on the transmission intensity. In the high frequency band, the change of t2 can affect the position of the resonant peaks, causing the transmission spectrum to show a red-shift trend with the augment of t2. As illustrated in R2 rises from 25 to 29 \u00b5m, the transmission of the frequency band 1.2\u20131.8 THz gradually increases, and the frequency band has a red-shift trend. In R2, and the position of the notch resonant frequency does not change significantly. The results demonstrate that the above transmission functions can also be realized when the geometric parameters perform a slight variation.In addition, the influences of geometric parameters (2 and graphene materials that performs the absorption, LTC polarization conversion, filtering, and switch functions in a single metamaterial device. The integration of different functions into a single metamaterial device was realized by using the insulator\u2013metal phase transition of VO2 and variation of graphene chemical potential. When VO2 is in metal state and the chemical potential is 0.05 eV, the RHCP and LHCP can be achieved in the frequency bands of 0.64\u20131.28 THz and 1.54\u20131.85 THz, respectively. When the chemical potential rises from 0.05 to 1.2 eV, three absorption peaks at 0.89, 1.78, and 3.31 THz with the corresponding absorptivity of 96.77%, 90.14%, and 97.44% can be obtained. When VO2 is in insulator state and the polarization angle of incident wave is 45\u00b0, the maximum transmission of the TE-polarized wave and TM-polarized wave are different in the range of 1.2\u20131.8 THz, which can be used to distinguish different polarized incident waves. The corresponding transmissions of the TE-polarized wave demonstrate the opposite results with the different chemical potential of graphene, realizing the switching functions in the frequency band of 0.88\u20131.34 THz. When the operation frequency is above 2 THz, the multi-frequency rejection filter can be achieved. The proposed metamaterial structure can be applied in many advanced fields, including the fronthaul of terahertz communication system, electromagnetic stealth, radar, etc.In conclusion, we proposed a novel kind of multifunctional metamaterial structure based on the combination of VO"}
{"text": "Case Description. A healthy female patient aged 25 years with a pigmented gingiva seeking gingival depigmentation. On examination, a dark brown ribbon of hyperpigmentation was observed within the mandibular attached gingiva. The case was diagnosed as physiological moderate gingival pigmentation (pigmentation\u2009index\u2009score = 3). The patient was interested in achieving aesthetic results with minimally invasive, nonexpensive procedures. Based on the patient's concerns, the microneedling technique using vitamin C was suggested and consented. We used a dermapen device to microneedle the gingiva until bleeding pinpoints were observed; then, topical ascorbic acid was applied. After 3 days, our outcomes revealed an excellent aesthetic pink gingival appearance. Conclusions and Practical Implications. Compared to other minimally invasive techniques, our technique is less expensive and more risk-free. Our novel technique of using dermapen and topical ascorbic acid has shown promising results to our case which gives new perspectives for its application in gingival depigmentation.A gingival depigmentation is a periodontal plastic procedure that is performed in order to remove melanocytic pigmentation. A variety of different modalities have been proposed for removing hyperpigmentation involving surgical scraping, gingival autograft, cryotherapy, electrosurgery, and lasers. However, the microneedling technique is a nonsurgical procedure that creates microholes to facilitate the penetration of topical medications across the connective tissues.  Since perioaesthetics have become a major demand in dentistry, treatment protocols should not only address functional and biological problems but also establish harmony between white and pink (teeth and gingiva). A typical macroanatomical feature of healthy gingiva is its pink colour which diverges into various shades depending on the degree of keratinization, the thickness of the gingiva, the degree of vascularization, reduction of haemoglobin, and the presence of melanocytic cells .Hyperpigmented gingiva is caused by a wide range of external or internal influences. It is maybe due to physiological or pathological factors, which cause the excessive deposition of melanin granules in melanocytes in the basal and suprabasal layers of the epithelium . GingivaGingival hyperpigmentation was classified according to melanin index by Hanioka et al.  into thrGingival depigmentation (GD) is considered a periodontal plastic procedure whereby melanocytic pigmentation is removed. A variety of different modalities have been proposed for removing hyperpigmentation involving bur abrasion, surgical scraping, gingival autograft, cryotherapy, electrosurgery, and laser . In addiHowever, the microneedling (MN) technique is a nonsurgical procedure that is known as collagen induction therapy involving repetitive punctures on the skin. In dermatology, MN has been utilized considerably in recent years as it is an effective, simple, economical, well-tolerated, and cosmetically and therapeutically beneficial procedure . The MN However, ascorbic acid (AA) has been demonstrated as a water-soluble antioxidant and an essential nutrient for collagen biosynthesis . It playWhile many clinical investigations have been documented, on the effectiveness of the MN technique in treating scars and wrinkles, promoting skin rejuvenation, and managing pigmentation disorders , 12\u201314, The purpose of the study was to assess the performance of the microneedling technique using dermapen with topical ascorbic acid paste on gingival depigmentation.A healthy 25-year-old female patient complained of aesthically unappealing dark colour in the lower front gum area . AccordiOn clinical examination, no abnormalities were identified extraorally. Intraoral examination revealed a minimal accumulation of plaque and supragingival calculus, indicating an acceptable level of oral hygiene. She had an average plaque index of 0.8 and an average gingival index of 1 with no bleeding upon probing. Neither clinical attachment loss nor radiographic bone loss was determined. There was only mild marginal gingival inflammation accompanied by rolled margins and blunted interdental papillae.A dark brown ribbon of hyperpigmentation was noticed within the gingival mucosa of the mandibular arch confined to the attached gingiva region from right to left 2nd premolars . The casThe patient was most concerned about achieving aesthetic results with minimally invasive, nonexpensive procedures. In light of the patient's concerns, the MN technique was suggested. The patient was provided with a detailed explanation of this off-label procedure, its instructions, and potential complications. Informed consent was established as well as permission for this off-label procedure, photos, and publication.th mode speed of 700 cycles/min. The dermapen was used in intermittent motion on the sextant gingival area for 30-40 seconds/tooth. When bleeding pinpoints were observed on all areas of pigmented gingiva, the gingival mucosa was irrigated with a saline solution and sterile gauze was applied to dry the area. Then, topical AA powder (1000\u2009mg/ml) was mixed with saline in a small glass dish forming a paste. The mixed slurry paste was applied to the gingival mucosa using for 10 minutes as shown in As a preliminary routine, supragingival scaling was performed and oral hygiene instructions were provided by the dental hygienist. We subsequently scheduled the procedure and performed it aseptically. Local anaesthesia 2% lignocaine  was administered by infiltration technique in the mandibular region. To microneedle the gingival mucosa, we used a dermapen device model M8 with 24 microneedles arranged in rows, which was adjusted with 1.5\u2009mm depth at the 6rd day of the second application. Clinical outcomes showed complete disappearance of gingival pigmentation. Generally, after the first and second application, healing was normal and satisfactory providing excellent aesthetic results where the pigmentation index score decreased to zero with reduction of melanin index (class 0) as presented in Figures th month of the follow-up period, repigmentation of the gingiva was detected showing light brown solitary pigmented areas as depicted in One day after the procedure, the attached gingiva exhibited an increase in volume and an alteration in texture as well as the appearance of white and red-coloured areas, indicating tissue inflammation . NeitherAlthough the GP does not exhibit any medical concerns, patients frequently complain of \u201cblack gums\u201d seeking cosmetic solutions. In this case presentation, the patient was diagnosed with physiological pigmentation based on the negative history of any pathological cause, since the physiologic pigmentation is probably genetic in nature.GD is considered a periodontal plastic procedure whereby the gingival hyperpigmentation is removed or reduced through various techniques such as scalpel scraping, bur abrasion, free gingival graft, cryosurgery, electrosurgery, and laser . In the To our knowledge, this is the first study to introduce NM with AA in gingival depigmentation. Nevertheless, there was a study done by Ozsagir et al.  who compAlthough, the FDA has legally authorized microneedling devices to improve the appearance of facial acne scars, facial wrinkles, and abdominal scars in patients aged 22 years or older, these devices are still considered as off-label procedures for oral use. However, there are various types of MN devices including dermaroller, dermastamp, and dermapen. Unlike other MN devices, dermapen is the only device that can be applied intraorally due to its small size, changeable head. This increases the accessibility inside the mouth and makes it easy to be used for a larger number of patients. This device is a wireless electric device with automated features that allow the operator to modify the speeds, pressures, and depth of penetration, thus reducing the probability of operator-related side effects.In the present study, the patient agreed and signed explicit written consent for this off-label procedure being used as a part of research. During the procedure, it was necessary to generate precise bleeding pinpoints by MN to achieve optimal results . These mThen, we used topical AA as a therapeutic medication that was reported to be effective in reducing melanogenesis directly and thus promoting depigmentation, because melanin acts as a reservoir for reactive oxygen species (ROS), Cu, and calcium within the cells. Following AA entry into the target tissue, it binds to melanin causing a deficiency of ROS, Cu, and Ca, resulting in the reduction in melanin production . As to sOur outcomes revealed excellent aesthetic results, and these were in agreement with Yussif et al.  who usedFurthermore, our findings were consistent with the results of Shimada et al.  who applFollowing the first day of the procedure, the gingiva showed an increase in volume and a change in texture with white and red-coloured areas representing gingival inflammation, oedema, and irritation. These results were corresponding with numerous clinical studies in dermatology which revealed that the MN technique can cause postoperative transit oedema and erythema that resolves usually after 1-3 days \u201325.In contrast to any other depigmentation procedure, the patient was able to see these excellent aesthetic results after 3 days . HoweverCompared to other minimally invasive techniques, our technique poses less risk of complications and is less expensive. However, lasers are considered easy, fast, and efficient modalities that have hemostasis and decontamination effects, but they are expensive and tissues heal within 1-2 weeks , 30. AddPigment recurrence is described as a spontaneous and recurrent process that occurs within 24 hours up to 8 years following the depigmentation procedure which poses a challenge to a dentist . MethodsIn our case report, repigmentation was observed after 6 months . This miHowever, our procedure is well tolerated by patients and can be repeated from time to time for more aesthetic results.Clinical experience, affordability, and personal preferences should be considered when selecting a technique for treating gingival hyperpigmentation. Our novel technique of using dermapen and topical ascorbic acid in the treatment of gingival pigmentation showed promising results, which gives new perspectives for its application. Although our technique is a simple and safe GD method, it should be performed cautiously; otherwise, tissue destruction and gingival recession may result. Our results were limited to this particular case. Therefore, the present findings should be confirmed in future randomized controlled clinical trials, including histological analysis."}
{"text": "To have enough financial literacy, an investor must be able to make intelligent investment choices, and on the other hand, the heuristic bias, the framing effect, cognitive illusions, and herd mentality are all variables that contribute to the formation of behavioral biases, also known as illogical conduct, in the decision-making process. The current research looks specifically at behavioral biases and financial literacy influence investment choices, particularly on stock market investment. For the research, a representative sample of 450 individual investors was evaluated. A structured questionnaire was designed using the Likert\u2019s scale method to elicit the research variables, and the data acquired were analyzed using the SEM method. According to the findings, there was a statistically significant link between heuristic bias and the development of behavioral bias in decision-making. Nevertheless, cognitive illusions, the herd mentality, and the framing effect all have a deleterious impact on behavioral biases. In addition, investors often adhere to heuristic biases rather than other irrational strategies when making investment judgments. Therefore, individual investors\u2019 financial literacy level greatly influences the choices made about investments in the stock market. Over the period, financial markets have evolved with technological development and the information accessible to consumers has also become more complicated since people can now choose from various alternatives in the financial markets . The conThe irrationality of investors and the biases that investors are prone to are considered in behavioral finance, a subfield of finance. Investors\u2019 incapacity causes these cognitive biases to forecast the market\u2019s movements, forcing them to make biased investing choices . The subChoosing investments is the result of a psychological and mental process known as decision making, which ultimately leads to the selection of those assets. When making investment judgments, the behavioral finance approach pays little attention to individual investors and does not consider fundamental or technical research. Those who subscribe to the behavioral hypothesis believe that investors act in fundamentally predictable ways whenever they make investing decisions. This demonstrates that investors often purchase equities when their value increases and sell the same stocks when their value decreases. Recently, academics and industry professionals have been trying to find out how emotions and biases influence the overall behavior of individual investors. They emphasized the significance of heuristics, cognitive illusions, the framing effect, and herd mentality in influencing irrational investment judgments .When taken into consideration as a whole, the level of financial literacy possessed by individual investors significantly influences investing choices. This investigation investigates the relationship between financial literacy and behavioral biases in investing choices. Financially savvy persons may, to some degree, prevent illogical conduct . FinanciIn the past, investors lacked the knowledge to analyze a company\u2019s fundamentals, industry, and economy. Ideally, people would mix technical considerations with irrational conduct while making financial decisions. Despite this, contemporary investors have access to enough information and a high degree of financial literacy, which they often use while making investment choices. Therefore, the influence of financial literacy and behavioral biases provides the necessary impetus for initiating such an important empirical study. This research assesses the investing decision-making aptitude of Indian investors. It is feasible to quantify the degree to which individuals prioritize financial literacy in decision-making and the effect of behavioral biases. In addition, it aids in determining if individual investors make sensible or irrational investing choices owing to a lack of financial literacy.The motivation of the study is to gauge the effects of financial literacy and behavioral Biases on investment decisions considering a sample of 450 small investors in India. The elasticities of explanatory variables on investor behavior have been derived with the implementation of structural equation modeling (SEM). Following the estimation output, the study revealed that financial literacy and cognitive behavior positively influenced investment decisions, while the impact of behavioral biases established averse assertion with framing effects. In terms of implication of the study findings, the study advocated that understanding and knowledge of financial information and jargon assist investors in making an appropriate decision with the trade-off between risk-return.The remaining study structure is as follows: section \u201cLiterature review and hypothesis development\u201d deals with a relevant literature survey and hypothesis development. The veritable definition and methodology are explained in section \u201cMethodology.\u201d Model estimation and interpretation are displayed in section \u201cEstimation and interpretation.\u201d Discussion and Conclusion are reported in section \u201cDiscussion,\u201d and Research Implication is available in section \u201cConclusion.\u201dThe heuristic bias, also known as a rule of thumb, is a method that simplifies the decision-making process for investors, particularly in uncertain and complex circumstances. This method reduces the complexity involved in evaluating the possibilities and predicting the benefits, enabling investors to reach decisions more quickly. This is particularly important for investors who must make judgments in complicated and unpredictable situations . There iIn a study, Only investors are willing to make a commitment of this kind, and representativeness may be characterized as the committed inclination to link new events to those with which one is already aware. Only investors are prepared to commit to this nature . In orde1: Anchoring bias, representativeness, and overconfidence collectively form the heuristic bias in investment decision-making.H2: Heuristic bias has a significant favorable influence on behavioral biases.HThe \u201cframing effect,\u201d which describes how investors cope with unpredictability and risk in their investments, is sometimes referred to by the phrase \u201cprospect theory,\u201d which is typically used to refer to that impact. According to the framing effect, deciding which investments to make may be divided into two stages: the phase in which the framing effect is considered and the phase in which the evaluation impact is considered . In addiCorporate financial activity is tracked and evaluated using traditional accounting methods in firms. In contrast, mental accounting relates to how individuals carry out these tasks in their own lives. According to In Regret aversion is a common psychological phenomenon that affects those who make mistakes in their decision-making process, such as investors. The psychological phenomenon known as regret aversion causes individuals who invest money to feel remorse about specific investing decision-making processes. This phenomenon is described as failing to generate the anticipated return . Neverth3: Mental accounting, the endowment effect, and regret aversion collectively form the framing effect in investment decision-making.H4: The framing effect has a significant favorable influence on behavioral biases.HBehavioral finance is a framework that augments and substitutes some elements of conventional finance. It portrays the interaction between investors and management in financial and capital markets. Investors make illogical investing choices because decision-making is the art of navigating difficult circumstances . TherefoCognitive illusion results from a person\u2019s sensitivity about what he already bought and what he could have bought and does not get as per expectations, therefore feeling bad about his choices. Learning cognitive theory is essential to apprehend as it offers investors to understand unimagined outliers in the rise and fall of stock markets. Cognitive illusions affect the willingness of investors to accept investment options and their ability to grasp and assess such choices . CognitiThe mental process known as conservatism is one in which investors rely on their previous perspectives to make predictions about new information and acquire new ideas. When it comes to investing, experience is much more valuable than acquiring new skills for most investors. The choice based on one\u2019s past experiences did not provide sufficient consistency; investors\u2019 preferences will be determined by their stringent conservative bias. The existence of conservatism demonstrates that financial market participants failed to assimilate new information by clinging to their previous forecasts . People For investors to make informed decisions, they need to have easy access to stock data, an in-depth grasp of the companies they are investing in, and the capacity to forecast the performance of other businesses. Confirmation bias causes investors to be more prone to look just at evidence that supports their prior opinions, which may lead to poor investment decisions. Confirmation bias may be what causes investment bubbles . People 5: Conservatism, confirmation, and hindsight bias form cognitive illusions in investment decision-making.H6: Cognitive illusions have a significant favorable influence on behavioral biases.HAmong the more recent subfields of economics, behavioral finance focuses on financial markets and investors. This method combines the conventional disciplines of economics and finance with psychology and the decision-making sciences. Behavioral finance is comprised of two subfields: macro behavioral finance and micro behavioral finance. Behavioral finance is an attempt to explain observed and verified market anomalies. The area of finance contains these findings and reports. Behavioral finance investigates how investors create opinions or \u201cmental mistakes\u201d in financial decisions . AccordiThe phrase \u201cherd mentality\u201d refers to the phenomena in which rational investors tend to act irrationally to emulate other investors\u2019 judgments in deciding how to invest their money. This occurs when investors are pressured to make investment decisions . Herd meThe bandwagon effect may impact the mental condition of market participants like traders and investors. The feeling investors get when they discover that their choice is consistent with others is known as the \u201cbandwagon effect,\u201d a term derived from \u201cjump on the bandwagon.\u201d However, the outcome of jumping on the bandwagon is often the motivation for these behaviors. When investors see a company\u2019s share price rise, they worry that they will lose out on the rewards. As a result, rather than focusing on the company\u2019s fundamentals, they begin purchasing shares because they think everyone else is doing the same thing . There i7: Information processing, bandwagon effect, and social groups collectively form herd mentality in investment decision making.H8: Herd mentality has a significant favorable influence on behavioral biases.H9: Behavioral biases have a significant favorable influence on the investment decisions of the individual investor.HThe act of decision-making is a convoluted and involved procedure, yet it plays an essential role in studying behavioral finance. The behavior of investors is determined by various variables in addition to the volatility of the market and the potential for profit maximization . The levIn the case of UAE investors, the study of The study\u2019s goal was to establish the extent to which different behavioral biases and financial literacy levels are associated with individual investors\u2019 investment decisions. The study contributes to a better understanding of the many shapes that behavioral biases may take, as well as the potential impact of such biases on investment decisions . In a si10: Financial literacy has a significant favorable influence on the investment decisions of the individual investor.HThis important research analyzes how behavioral biases and financial literacy influence the investment decisions of individual investors. The goal of this study is to gather information from individual investors. Individual investors were acknowledged at the offices of financial advisors, portfolio managers, and stock trading terminals. The study used a personal interview approach by distributing a questionnaire to investors. The questionnaire survey was conducted to enhance data precision and reduce interviewer bias since respondents were permitted to use their democratic rights while answering the questions. From September 2021 to January 2022, the method for gathering data was completed. The first sample consisted of 450 randomly selected individual investors from Northern Indian states. The terms and terminology used in the study were explained, and the suspicious replies were addressed in front of the participants, facilitating the collection of questionnaire responses with no omissions.Sample selection is mostly based on investors\u2019 experience and location, with a preference given to those with at least 2 years\u2019 worth of trading experience and a Northern state residence . The study utilized an experimental research methodology, and the sample was chosen using a basic random sampling procedure. The questionnaire was designed on a 5-point Likert scale, with a score of 5 indicating strong agreement and a score of 1 indicating strong disagreement, to ensure as much consistency as possible among the replies as possible. Investors were also assured that their responses to the questionnaire would be kept confidential. Additionally, 50 local investors were used as a pilot group to assess the poll\u2019s content and face validity before the main survey was conducted. Experts, academics, and investment advisers in the financial sector were consulted over the choice of terminology, the interpretation of terms, and the selection of metrics for the financial sector. Because of this, individual investors could complete the questionnaire with the help of clarification in questions and applicable directions.For investors to make intelligent, risk-free, and productive judgments, they need the knowledge and a grasp of a wide array of financial concepts and facts. Students will gain an understanding of economics and the many ways in which economic factors may play a role in individual decision-making via the completion of this course . FinanciEveryday investing decisions are impacted by various factors, including inclination, motivation, excitement, and social contact, in addition to the available cash, time horizon, and financial objectives . InvestoInvestors base their selections on their stock market expertise and experience. Behavioral finance studies people\u2019s real behaviors and how they process financial information to make informed judgments. Due to its substantial effect on their decisions, investors are starting to accord behavioral finance greater importance. Using hypothetical investment possibilities assists investors in selecting superior stocks . The preThe study administered Structural Equation Modeling (SEM) to concurrently assess and examine how the process of investors\u2019 decision-making was associated with financial literacy and behavioral biases. An amazing statistical tool for studying and measuring relationships between variables is the structural equation model (SEM). On the other hand, latent variables are often not directly observable and must be inferred from other variables. On the other hand, more aspects may be evaluated by empirical observation and measurement. Confirmatory modeling is where structural equation modeling shines, which is used more often in theoretical testing than in actual product development. The measurement model clarifies the relationship between the latent variables and their component indicators, whereas the structural equation model (SEM) conveys the causal relationships between the latent variables. The study has developed a conceptual model to describe investment evaluation and support investing behavior, allowing for predicting the impact of financial literacy and behavioral biases on investment decisions in the stock market .The study applied multivariate analysis, such as confirmatory factor analysis and structural equation modeling, using AMOS 22.0 software to scrutinize the research objectives. In SEM, the relationship between theoretical constructs is designated by the path or regression coefficients between the factors presented. Using SEM, data analysis was conducted in two phases. Overall measurement quality was evaluated by confirmatory factor analysis, and concurrently reliability and validity of the instrument had also been measured. Subsequently, structural equation modeling was applied to determine if the model fitted the results of the proposed theoretical models. The study also applied CFI, NFI, TLI, PNFI, PCFI, RFI, IFI, CMIN/DF, and RMSEA to measure the model\u2019s fit. Further, independent association between the different variables had also been investigated.The socio-economic background of individual investors is examined by using percentage analysis. The results are furnished in There are a total of 84% male investors and just 16% female investors, as shown in SEM offers a method for identifying the impact of an external component on investment decisions by laying out a path for the rapid examination of the whole model that seeks multiple hypothetical linkages. There are two components to the analysis: first, a measurement model with a latent construct is looked at, and then a structural equation model is looked at, which considers all constructs and their potential connections. With the theories mentioned above in mind, I use 15 independent variables to develop five latent constructs: heuristic bias, framing effect, cognitive illusions, herd mentality, and financial literacy. A measurement model was developed to evaluate the reliability and validity of the latent variables. The results may be seen in p = 0.000, CFI = 0.903, and RMSEA = 0.067. Additionally, the value of CFI is 0.903. In addition, the findings indicate that CFI = 0.903 and RMSEA = 0.067 respectively. As a direct result, the scores obtained from the goodness of fit test suggest a model almost perfectly suited to its data. After determining the reliability and validity of each component, the next step is to analyze the model as a whole.As shown in Because the suggested measurement model accords with the available data, the study hypotheses may be evaluated. The model results are shown in The results of the goodness-of-fit test for the SEM are shown in Coefficient values for anchoring bias (0.795), overconfidence (0.572), and representativeness (0.773) due to heuristic bias are shown in The confirmation bias coefficient for cognitive illusions is 0.311, the hindsight bias coefficient is 0.669, and the conservatism bias coefficient is 0.506. Evidence supports that cognitive illusions are strongly related to their contexts (H5). The correlation between cognitive illusions and prejudices in conduct is negative (-0.274), yet we still support the hypothesis (H6) about the relationship between cognitive illusions and behavioral biases. The results are consistent with The value of the coefficient for financial literacy is 0.48 when it comes to financial competence, -0.108 when it comes to financial proficiency, and 0.005 when it comes to financial opportunity. Although this hypothesis (H10) is accepted, it should be noted that the conceptions of financial literacy directly influence the level of sufficient financial knowledge required when making investment choices. The finding supports the accepted hypothesis that financial literacy has a coefficient value of 0.051 for investment decisions and has a favorable impact on investment decisions (H11). The results are consistent with those of The disparities between heuristic bias and framing effect are shown in This research investigates financial literacy and behavioral biases\u2019 role in the illogical behaviors people sometimes engage in while making decisions. A large amount of behavioral bias is included in investors\u2019 investment judgments. Financial literacy enables one to rationalize such illogical conduct and arrive at a conclusion that is more likely to bring about the intended increase in profit. In light of this fact, the research extends the application of behavioral economics to the process of decision-making about investments among individual investors . Eleven The study\u2019s findings demonstrated that three cognitive biases\u2014anchoring, representativeness, and overconfidence\u2014directly contribute to bad investment decisions based on incorrect perceptions about past success. The study finding is supported by the existing literature such as In the financial markets, emotional decision-making is common due largely to cognitive biases. Investment in a business is fraught with cognitive illusions due to factors such as conservativeness, confirmation bias, and hindsight bias. Our study findings are in line with Therefore, investors may better judge stock buy/sell timing, portfolio risk, and projected return with a firm knowledge of financial fundamentals. Understanding the financial markets and gaining the information, talent, and opportunity that come with it may boost an investor\u2019s likelihood of making profitable investment selections. Behavioral biases include heuristic bias, the framing effect, cognitive illusions, and herd mentality. It lends credence to the notion that investors depend on heuristics rather than frames, illusions, or herd mentality. When it comes to individual investors, however, the heuristic bias has a disproportionately negative effect on intelligence. As a result, investors rely heavily on the rule of thumb as a guiding principle for making important decisions. To some extent, investors form their expectations based on their market knowledge. Trusting and implementing previously known plans might be less of a mental strain for investors than developing novel ways of choosing equities. People sometimes fall prey to herd mentality rather than using their critical thinking abilities in the face of repeated losses or traumatic situations. It has been shown that behavioral biases significantly impact economic choices.Investing decisions are heavily influenced by people\u2019s lack of knowledge about finance and their susceptibility to various forms of prejudice. Behavioral biases may give some foundational ideas that might help investors make better investment choices, and investors may benefit from financial literacy coaching to comprehend the investing environment better. The significant independent connection between the variables indicates that heuristic bias substantially affects both the framing effect and cognitive illusions when making judgments. However, this has negative effects on the \u201cherd mentality.\u201d Cognitive illusions are bolstered by the framing effect, whereas the herd mentality is diminished. Investors should guard against the herd mentality that might arise from succumbing to cognitive illusions in the stock market. Individual investors\u2019 irrational conduct in the stock market is not surprising, given market participants\u2019 high level of financial knowledge.Investment decision-making is how investors weigh both logical and emotional factors. While it is true that investors do not always make the most logical decisions, standard financial theories assume that they do. Nevertheless, modern financial theories propose that one\u2019s gut rather than one\u2019s head should be the deciding factor when making financial decisions. Our study finding of financial literacy increases the accuracy in prediction for investment is supported by the existing literature . For exaInvestors\u2019 decision-making is a complex and complicated process governed by several behavioral facts, including understanding financial information, attitude to assessment, and the capacity to capitalize correctly. The motivation of the study is to evaluate the effects of financial literacy and the behavioral basis on investment decisions. As a sample for research data collection, the study considered 475 small investors, and with the application of SEM, the expected hypothesis has been evaluated and investigated.In terms of the hypothesis assessment, the study documented that financial literacy has positively connected to the investment decision, suggesting that investors\u2019 understanding of financial information is appropriately guided toward appropriate investment decisions. Further, the findings point to the following avenues for study and advancement in the field. The process of assigning value to an asset in the context of a purchasing decision is a challenging one for individual investors. Given that nobody can know which way stock prices will go in the future, successful traders must develop their methods or study those already proven effective. Rule of thumb, personal calculation, and past experiences have all been used by successful investors to construct their methods. By making the most educated choices feasible, investors may maximize their returns.Successful investing in the stock market requires knowledge of the ever-changing market and the ability to generate viable investment ideas. If investors have access to the correct data, stock market education might be more beneficial. Those who put their money into the stock market often have an irrational mindset since they have not been taught otherwise. While illogical wagers may provide short-term gains, they would ultimately prove costly. Academics, legislators, and experts need to provide more opportunities for training and growth so that investors may make better decisions.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.MQ: methodology, interpretation, first draft, and final draft. RK: introduction and data curation. SW: literature survey and methodology of the study. WR: literature survey, data curation, and final draft. All authors contributed to the article and approved the submitted version."}
{"text": "This study proposes an innovative use of a modified version of photovoice for cross\u2010national qualitative research that allows participants to express their ideas, experiences, and emotions about a topic through photographic language. We examine factors affecting social service providers' work on people experiencing homelessness in Europe. We highlight five advantages of using photovoice in cross\u2010national research: visual language, methodological flexibility, participatory data analysis, the bottom\u2010up process, and the promotion of social change. Moreover, we identify key stages of the process: writing a detailed protocol for the implementation and fidelity of the projects, using two levels of data analysis, and disseminating the results. This study provides lessons learned for others who may want to use photovoice in cross\u2010national research. Qualitative methods provide a detailed understanding of people's experiences across countries.This article offers an example of using photovoice to study homeless services in Europe.This study showed the benefit of using photovoice in comparative qualitative research across nations.This study provides recommendations for those who may want to use photovoice in cross\u2010national research. In an increasingly multi\u2010cultural world where interventions transcend national boundaries, international research collaborations involving multiple countries are increasing  to evidence\u2010based intervention practices such as Housing First  perspectives  multi\u2010method project funded by the program \u201cHorizon 2020\u201d .The number of service providers: ideally, at least four staff members from each program should be involved.Length of service: only staff members who have worked in the organization for at least 6 months (so that they had enough work experience to report on) and who worked together as a team, meeting regularly should be included.Direct service: participants should be engaged in direct service with users, not merely administration.The HOME_EU partners in each country selected organizations that worked with people experiencing homelessness. Although sampling was based on availability, we recommended specific criteria for the selection of organizations and participants. When, due to peculiarities of services in a specific country, it was not possible to respect one or more of these criteria, we asked partners to provide information about the choices made about sampling. The criteria were as follows:Before proceeding with the photovoice projects, we asked partners to tell us about any issues and update us on sampling and photovoice meetings. Throughout the project phase, we stayed in touch with HOME_EU Consortium partners via email, and we discussed projects together in face\u2010to\u2010face meetings every six months. One photovoice project in an HF service and a photovoice project in TS were conducted in most countries. Exceptions were Italy, where two HF and one TS photovoice projects were conducted, and Poland, where two TS photovoice projects occurred since there were no HF programs in the country yet.For each phase of the research, we provided templates of consent forms in English, which were translated and adapted by partners based on their country's laws. Informed consent forms were provided for the organizations involved, the research participants, and any individuals who could be photographed by the participants (to give consent to be photographed and to use the photograph in the project).Next, the protocol detailed the procedure for the photovoice groups, as summarized in Table lingua franca for the project. Then, professional translators performed back translations, which were checked by the local research partners. Translations were modified as necessary so that the original meaning and cultural nuances were retained.The translation procedure followed the best practices  were included in the data analysis.All countries successfully implemented the phases of the photovoice, producing rich data for cross\u2010national analysis. It was impossible to find organizations willing to participate in more than three meetings in one country. Therefore, both groups had three face\u2010to\u2010face meetings, and the sharing of results was done online. The changes were not as disruptive as to be considered in the analysis. We had no other reports of major changes to the protocol concerning photovoice meetings, but in most countries, groups stopped after analyzing their data and preparing a report, rather than using photovoice to move to action. Thus, the lack of social change actions could be because, at the country level, photovoice was considered more as a research method to investigate obstacles and facilitators of social service providers' work and not as a participatory action research methodology. As we will see in the results, in only three countries, the groups present their results to politicians and citizens. In one country, the project facilitated advocacy with respect to a new model of homeless services, and another participant developed operational proposals for change in their own organizations.Moreover, cross\u2010national data has enabled the identification of a European culture of homeless services and the development of policy guidelines to assist in transitioning from TS to evidence\u2010based programs such as HF.First, data analysis was conducted within each country and within each photovoice group in collaboration with participants , and this may have also influenced the style of conducting the photovoice projects. In addition, only the lead group in the study had experience with the photovoice methodology. Even though all team partners were experienced in homelessness, this was the first time they had used photography methodology. The lack of effort in producing social change may also be due to facilitators' lack of background and experience with participatory action research methodologies in most countries.The results of this study can be summarized in two main aspects:In Italy, Poland, and France, participants and researchers organized exhibitions in strategic places to present the photovoice results to the community and local politicians. These exhibitions have been an opportunity to raise community awareness of homelessness. The exhibitions were visited by citizens, providers in other community services, mass media, and local politicians. As is often the case with a photovoice project, dissemination has led to a change. For example, in an Italian photovoice project, the participants elaborated four proposals for change in their organization: internal communications, the relationship between providers and volunteers, the need for constant updates on the clients' process, and training and psychosocial supervision of the team. Photovoice results and proposals were presented during a meeting with the organization's leaders and shown in an exhibition associated with a conference with citizens and providers from other services. In a follow\u2010up evaluation one year later, most of the proposals identified through the photovoice had been implemented. Further, in Poland, reflection on photos contributed to the spread of advocacy initiatives that have led to the implementation of HF , while also bringing out their emotions  documented long\u2010term changes in an organization involved. More training to partners on the guiding principles of the methodology and the importance of participatory action research could have helped them understand the potential of photovoice. The project also contributed to change at a cross\u2010national level by contributing to the development of European guidelines for implementing services to tackle homelessness .Social change is the most fundamental aspect of photovoice, but it is also the most difficult to achieve because it requires time, resources, and a reflective approach from researchers  support in the process, (b) promotion of social change, (c) analysis of photographs, and (d) the comparison between nations.First, regarding the support in the process, this research was made possible by the continual interactions among the project's consortium members and was based on a common detailed protocol about planning , process (detailed explanation of each step of the photovoice method), and data analysis. This ensured that the research was methodologically solid, balancing the need for the research to be structured enough to allow cross\u2010national comparisons while ensuring that it was grounded in local contexts. Nevertheless, it was sometimes difficult to know in detail how photovoice projects were progressing. In addition, the country reports of themes varied considerably in length across the photovoice groups. It is possible that groups with short reports also discussed some of the themes apparent in the lengthier reports, but did not deem them sufficiently central to mention. It is also possible that facilitators who drafted the reports and translated them into English had different understandings of the amount of detail it would be valuable to include, or, because of differential levels of comfort in English, chose shorter or longer presentations.Moreover, regarding the second lesson learned, we note that not all countries fully realized the social change goal of photovoice. Future studies using this methodology would benefit from a better balance between research and action by using research findings to inform organizational and community changes based on scientific knowledge. Greater support in learning about the guiding principles of the methodology and how to support social change might have helped more countries realize this goal .In the future, we suggest starting with a workshop\u2014at least a one day workshop  was not shared with all photovoice project participants. Only a few participants saw the European exhibition in Padua. Member\u2010checking is an important way to assure the trustworthiness of qualitative research , and to promote shared guidelines for intervention between countries.As we pointed out in the introduction, cross\u2010national research poses some important challenges that concern sampling, study management, language, and cultural norms. As a participatory action research methodology that uses photographic language, photovoice can overcome these challenges through the use of visual language, flexibility, data analysis with participants, bottom\u2010up processes, and promotion of social change.The importance of sharing the guiding principles of photovoice, not just the methodology to promote social change;The need to provide local researchers with both a country report template that contains the results of the project and one to describe reflections of the researchers who conducted the project;The need to conduct frequent interpretation sessions with all the partners to discuss key concepts in\u2010depth;The importance of engaging all photovoice participants for confirmation of cross\u2010national results.Through our experience in social service providers of homeless services in eight European countries, we have reflected on the feasibility of using photovoice to increase knowledge on a European phenomenon, highlighting some strengths and providing recommendations for those who would like to use this method at a cross\u2010national level. Our recommendations start with the reflections made during the implementation of the European project and concern. The reflections include the following:Overall, the implementation of photovoice projects is not only about the adaptability of a method but also the reflective capacity of researchers on the importance of using this methodology to promote social change.In conclusion, implementing a photovoice in a cross\u2010national context involves challenges. Nevertheless, the study demonstrated the benefits and feasibility of using photographs in comparative qualitative research across nations, languages, and cultures, not only to facilitate local change but also to understand a common European culture of a phenomenon and to contribute to the elaboration of policy guidelines shared among countries.This research was funded by the European Commission through a grant, as part of H2020 research project HOME_EU: Reversing Homelessness in Europe H2020\u2010SC6\u2010REVINEQUAL\u20102016/GA726997. The grant agreement between the European Commission and each research unit involved allows complete liberty and autonomy of researchers in the design of the study; the European Commission will take no part in data collection procedures, analyses, interpretation of the data, or decision to submit results.The authors declare no conflict of interests."}
{"text": "There is an exponential growth in textual content generation every day in today's world. In-app messaging such as Telegram and WhatsApp, social media websites such as Instagram and Facebook, e-commerce websites like Amazon, Google searches, news publishing websites, and a variety of additional sources are the possible suppliers. Every instant, all these sources produce massive amounts of text data. The interpretation of such data can help business owners analyze the social outlook of their product, brand, or service and take necessary steps. The development of a consumer review summarization model using Natural Language Processing (NLP) techniques and Long short-term memory (LSTM) to present summarized data and help businesses obtain substantial insights into their consumers' behavior and choices is the topic of this research. A hybrid approach for analyzing sentiments is presented in this paper. The process comprises pre-processing, feature extraction, and sentiment classification. Using NLP techniques, the pre-processing stage eliminates the undesirable data from input text reviews. For extracting the features effectively, a hybrid method comprising review-related features and aspect-related features has been introduced for constructing the distinctive hybrid feature vector corresponding to each review. The sentiment classification is performed using the deep learning classifier LSTM. We experimentally evaluated the proposed model using three different research datasets. The model achieves the average precision, average recall, and average F1-score of 94.46%, 91.63%, and 92.81%, respectively. The Covid-19 threat has led to an exponential rise in online purchases of food, electronics, clothes, etc. , 23. As The approach of analyzing the behavior of emotions, opinions, and feelings for a specific entity or subject that is expressed in the form of text is known as opinion mining or sentiment analysis. The accomplishment of sentiment analysis can be achieved at the word, phrase, sentence & document level . PerformThe most widely employed approaches to perform sentiment analysis include the Machine Learning/Deep Learning based method, lexicon-based method, and hybrid methodology , 43, 49.In machine learning or deep learning-based approaches, the dataset is separated into training and testing datasets. A training data set is used during the training process so that the model discovers to associate the specific input text to the conforming yield to learn the documents. The testing dataset is used during the prediction process where the transformation of hidden textual inputs into feature vectors is done using a feature extractor. The model is then fed these vectors, which generate prediction tags for the corresponding vectors. The hybrid approach for sentiment analysis is the implementation of a Lexicon-based approach combined with a machine learning-based approach .All these techniques have demonstrated remarkable accomplishment in formal language, conventional text sources, and in well-specified fields where pre-labeled data is accessible for training or the lexicon coverage includes those words that convey specific sentiments within a corpus. But these approaches are incompetent to match up to the large quantity, diversity, and momentum with which the unstructured data is constantly posted online.The performance of sentiment analysis approaches utilizing machine learning techniques has recently improved because of the introduction of various kinds of feature extraction methods that are essential to produce accurate results , 45. As For instance, contemplate the review \u201cAlthough this mobile phone is too heavy, it is little cheap\u201d, includes implicit aspects: weight (implied by the term heavy), price (implied by the term cheap), and sentiment-bearing word relations. In general, sentiment appears neutral, however, aspects have both negative and positive polarities. Further, these implicit aspects are poorly described and are not articulated using standard terms and definitions. This issue can be solved by grouping very similar aspects into attributes and then analyzing them with the Aspect-based Sentiment Analysis (ABSA) approach , 18, 19.The functionality of the model suggested in this paper is divided into two stages: review mining and review summarization. Each user's reviews are categorized as either negative, positive, or neutral in review mining. In review summarization, a concise summary for corresponding reviews gets automatically formulated based on the results of the review mining step. The scope of this work is restricted to the development of a reliable, accurate, and robust review mining model  that can further result in building an effective consumer review summarization model.In this research, we present a unique sentiment analysis technique based on the robust hybrid analysis of sentiments which is used to solve the challenge of obtaining efficient review mining results for consumer review summarization. To begin, a straightforward and efficient pre-processing technique is used to eliminate stop words, digits, meaningless words, and other undesirable elements. Then, the preprocessed reviews are given as input to the robust and efficient hybrid feature engineering technique, which combines review-related features and aspect-related features and forms a hybrid feature vector (HFV). The hybrid feature extraction methodology suggested in this paper can deal with ambiguous and inconsistent sentences as well while performing sentiment analysis.The method proposed in this work is focused on analyzing sentiments efficiently, thus this segment comprises some recent studies categorized into three fields: Sentiment Analysis, Aspect-Based Sentiment Analysis (ABSA), and Deep Learning-based SA methods. Towards the end of this section, the motivation and contribution of this research are also discussed.This section focuses on the study of several recent works carried out in the sphere of sentiment analysis , 51, 53.The SentiDiff algorithm proposed by Wang et al.  combinesSentiVec, a kernel optimization method for sentiment word embedding, is suggested by Zhu et al. . The firA new method called the sentiment-based rating prediction method is suggested by Munuswamy et al.  to develA variety of classifiers and feature sets to perform sentiment quantification are explored by Ayyub et al. . Based oA unified framework that helps in bridging the gap between machine learning-based approaches and lexicon-based approaches is presented by Iqbal and Hashmi . The autChiong et al.  proposedAs a robust method for enhancing sentiment analysis accuracy, aspect terms extraction has attracted significant attention from researchers. This section discusses the numerous studies that have been recently suggested on ABSA , 46, 50.Schouten et al.  presenteWang et al.  proposedAn automatic method is presented by Parthi et al.  to calcuThe end-to-end ABSA is investigated by Bie and Yang , and a uAurangzeb et al.  presenteDeep learning-based methods have also been applied to the sentiment analysis domain recently to further improve efficiency , 30, 52.The first end-to-end SEmi-supervised Multi-task Learning framework (SEML) for performing ABSA on user reviews is presented by Li et al. . Both asThe aspect-based sentiment analysis for demonetization tweets is performed using the improved deep learning method by Datta and Chakrabarti . Pre-proKumar et al.  suggesteAn aspect-gated graph convolutional network (AGGCN) is proposed by Lu et al. , which cHuang et al.  introducAygun et al.  employedBased on tweets related to cryptocurrency, the work proposed by Aslam et al.  performsSentiment analysis has recently received substantial attention from researchers for a variety of applications, hence a framework to perform it efficiently while addressing scalability is needed. We investigated a variety of strategies employed to perform sentiment analysis, intended to improve the feature representation and classification using machine learning/deep learning-based techniques. The inclusion of fraudulent, sarcasm, spam, emoticons, negation and other types of content in a significant number of online reviews makes feature extraction challenging. The study carried out in this section shows that deep learning methods are more efficient than machine learning methods for sentiment classification. The accuracy of deep learning algorithms, we believe, is mostly determined by the feature set.According to the findings of the studies mentioned above, sentiment analysis-based approaches are insufficient to handle the issues of accurately representing sentiments, opinions, and emotions, from online reviews. As a result, the ABSA approaches recently proposed are studied, however, their scope or application is also limited as they address the challenge of ambiguity and sarcasm to some extent, but don't consider emotions, negations, and long-term dependencies for accurate classification.Aside from these issues, scalable review datasets have not been used to evaluate ABSA approaches. Some ABSA approaches relied primarily on unsupervised procedures, necessitating a significant number of manual data annotations. Because some SA/ABSA algorithms rely solely on symbolic feature extraction, their accuracy suffers. In comparison to machine learning and lexicon-based techniques, deep learning-based techniques provided superior scalability and efficiency.Based on our observations that hybrid feature sets accomplish effective results, we split the feature extraction phase into two parts: Review-Related Features (RRF) and Aspect-Related Features (ARF). After that, RRF and ARF numerical features are merged into a Hybrid Feature Vector (HFV).As part of RRF, various methods like term frequency-inverse document frequency (TF-IDF), n-gram features & emoticon polarities, are employed for making emotional representations more accurate.As part of ARF, we propose a novel way for extracting aspects terms employing co-occurrence frequencies and then assigning the polarities. The ARF method produces aspect terms with their polarities.For the classification task, a deep learning classifier LSTM is used for the classification of input reviews either into negative, positive, or neutral classes.We suggest a novel technique of SA with special reference to consumer review summarization, based on the above-mentioned concerns of the state-of-the-art approaches. The suggested method comprises three stages: pre-processing, feature extraction, and sentiment classification. To denoise input reviews, the pre-processing step employs a standard procedure. The feature extraction step is ingeniously built as a hybrid step to overcome the difficulties of accurately representing the features of input reviews. In particular, the proposed model has the following contributions:According to the findings of the aforementioned studies, sentiment analysis has become a popular study area due to several intriguing and challenging research topics. An enormous number of start-up organizations are aiming to provide sentiment analysis/review mining services due to their diverse functional uses. Every firm wants to know how its products and services are perceived by its customers. This domain will remain active and dynamic in the coming years due to scientific challenges and functional components. The goal of this work is to develop a hybrid model to perform sentiment analysis accurately from the perspective of consumer review summarization.The different steps followed in this study are shown in Fig.\u00a0The SemEval-2014 restaurant reviews data set , SentimeThe pre-processing of the dataset consisting of raw reviews is done by deleting & fixing the intricate and pointless text. The data pre-processing functionality used in the proposed work is beginning with tokenization and finishes with the removal of meaningless words, digits, and words less than three characters. Using the tokenization function, we subdivided the input reviews into tokens. Then we applied stemming to each token to cut it down to its singular form . Then, to limit the number of tokens, stop-words like \u2018I\u2019, 'a', 'an', 'am', and so on are deleted. Dates, special characters like #, @, etc., URLs, and meaningless words  are all found and eliminated. Furthermore, words with less than three letters and integers are also found and eliminated. This algorithm assures that the dimensional space of raw reviews is effectively reduced. Table There have been several attempts to represent input reviews as features. Precise, robust, & effective feature extraction, still, remains a difficult research challenge for review mining. As a result, developing an efficient and consistent feature set that can yield high categorization accuracy is an important aspect of any sentiment analysis system. Therefore, we propose a robust and effective sentiment analysis architecture employing hybrid feature extraction methodology. In the first step, the extraction of RRF features is done by employing various methods to achieve the polarity for every term within the preprocessed text including negations and emoticons. The aspect terms with their polarities are then extracted using the ARF method. Sarcastic and ambiguous reviews are also addressed and represented by the ARF. Finally, by integrating the results of ARF and RRF, every preprocessed review is expressed as HFV.RRF is a sentence-level feature representation strategy that considers emoticons as well along with text to describe feelings, opinions, and negations in the input reviews. To construct the hybrid form of features, traditional approaches like n-gram, TF-IDF, & emoticons-specific features have been combined. The TF-IDF approach uses BoWs, and the n-gram relies on word embeddings. The usage of solitary words for extracting features limits sentiment analysis in various ways. The negation problems don\u2019t get solved with a single-word feature, and at the same time, it can contribute to the inappropriate classification of sentiments.We addressed these issues first by obtaining a word list from the pre-processed reviews by n-gram feature extraction. The TF-IDF of n-gram words is then calculated using the TF-IDF on the n-gram yield. The combination of n-gram and TF-IDF technique is not just shrinking the dimensionality but resulting in an effective representation of each review as well. The emoticons-specific features are then retrieved for improving the sentiment analysis accuracy further. As a result, RRF is attained as a combination of n-gram, TF-IDF, & emoticons-specific features. The RRF procedure is described in detail below.i is the document comprising the ith review that has been pre-processed. We start with the application of the n-gram approach on a preprocessed document for blended n-gram and TF-IDF. An n-gram is a proximal series of n-words obtained from a given dataset. An n-gram model with n\u2009=\u20091 is known as a unigram, when n is 2, it is referred to as a bigram, when n is 3, it is referred to as a trigram, and so on. \"Bad\" and \"Very Bad,\" for example, are unigrams and bigrams, correspondingly. From the input sentence, the n-gram approach constructs a sequence of n consecutive words as follows:Ngrami denotes the set of n-grams derived from the preprocessed input document Ngramd We fixed the value of Let us assume that QNgrami signifies the list of words associated with the ith ith review and Ngramd signifies the list of words associated with the complete data set Ngrami consists of 60 terms and the term \u201cgood\u201d occurs 5 times, the result of TF is Following the results of the n-gram, TF-IDF is employed for getting the inverse document frequency for the word lists resulting from the training/testing datasets. Term Frequency (TF) indicates how repeatedly a term exists throughout the document and Inverse Document Frequency (IDF) is a measure that finds out if a term is unusual or common among all the documents in a corpus.From then on, the emoticons-specific features are then retrieved from the review dataset and represented as a vector for categorization and subsequent computations. Because every review may or may not contain emoticons, we set the value of the emoticons feature vector (EF) of size 1\u2009\u00d7\u20092 to zero for each review. The discrete probability distribution formula is used to count the emoticons for every review alongside the sentiment label. A positive emoji is represented as 1, while a negative emoji is represented as\u2009\u2212\u20091. Suppose the review comprises of six emoticons, three positive and three negative, then the outcome will be represented as 3,\u2009\u2212\u20093]. When positive, negative, or both emoticons are missing from a review, the emoticons-related features are given a value of zero. The emoticons-specific features are then joined with ,\u2009\u2212\u20093. WhWe apply the ARF extraction procedure to training and testing datasets after the extraction of the hybrid version of review-specific features, which uses the mechanism derived from Schouten et al.  solely tThe suggested ARF method is demonstrated in Algorithm I. Let Q denote the training set, which consists of m raw internet reviews. In each input review, we performed the extraction of the categories followed by the estimation of their co-occurrence rates against the lemmas and dependencies forms. The ARF algorithm's initial step is to identify each review's set of lemmas, dependencies, & categories. The lemma represents the dictionary form of a word, while dependencies show the binary grammatical relationship existing between a term called governor or head and another term called modifier or dependent in a sentence.The instance below demonstrates a review comprising dependency relations, with the words 'price' (governor) and 'okay' (dependent) making a dependency relation named nsubj (subject-predicate relation), and the words 'very' (governor) and 'attractive' (dependent) making one more dependency relation termed avdmod .S. For input review, the SC comprises a list of aspect categories. Each review is handled using the Standford CoreNLP framework's dependency parser, POS tagger, and lemmatizer functions as an NLP process [42]. The subsequent action is to count and add the lemma or dependency form's unique occurrences to vector The list of lemmas and dependence forms are contained in set Based on co-occurrence and occurrence frequency values in vectors The explanation of Algorithm I is given in Fig.\u00a0As demonstrated in Fig.\u00a0ith review.The primary issue with using neural network classifiers and conventional classifiers is the vanishing gradient or exploding gradient. The vanishing gradient problem hinders the learning of long data sequences. As a result of the exploding gradient problem, the weights oscillate, further degrading the network quality. Therefore, when neural networks like CNNs/RNNs attempt to store information over extended time intervals, it takes prolonged time due to inadequate, crumbling error backflow. LSTM network, on the other hand, is a kind of RNN proficient in learning order dependence in sequence prediction problems. To overcome the vanishing gradient problem, LSTM uses a distinctive additive gradient structure that incorporates direct access to the forget gates' activations at every time step of the learning process. Thus, it defeats the error backflow problems with the minimum computational complexity of O(1). In the proposed work, we use LSTM for the automatic sentiment analysis from the sequential features vector received for each sequential review. It accepts the training dataset and test sample features vector f, Wi, Wo, Wc, Uf, Ui, Uo, Uc) and biases  are not time-dependent which means that the outputs of different timesteps are calculated using the same weight matrices. The input and forget gates work together to refresh the memory cell. The forget gate examines the part of memory to be forgotten, while an input gate approximates new values corresponding to the view currently stored in the memory cell. As a result of the output gate and memory cell, the hidden description is estimated. Due to LSTM activation including summation over time and derivatives distributed over sums, the gradient in LSTM gets spread over extended periods and gets vanishes. The fully connected layer followed by the softmax layer works on classifying the input features into appropriate matching classes according to the training dataset. The output layer generates the final sentiment detection outcome.Let\u2019s suppose that the LSTM input layer receives the t gate f . In everWe used MATLAB tool, Windows 11 operating system with an i5 processor for investigational evaluation of the proposed work. The SemEval-2014 restaurant reviews dataset, Sentiment140, and STS-Gold datasets have been used to evaluate the proposed model and compare it to the recent state-of-the-art methods. We have divided all three datasets into 70% training and 30% testing datasets. To demonstrate the efficacy of the hybrid feature engineering methodology, HFV performance is first compared to the proposed RRF and ARF methods employing the LSTM classifier using the SemEval-2014 restaurant reviews dataset. In addition, the comparison of the proposed hybrid feature extraction approach with the recent state-of-the-art methods is also done using all three datasets. The different metrics used to evaluate performance of ARF, RRF, and HFV are F1-measure, accuracy, recall, precision, and Mean Sentiment Analysis Time (MSAT). The MSAT represents the average processing time, i.e., the computing time of the sentiment categorization. For the estimation of the MSAT evaluation parameter, we executed 50 instances of sentiment analysis classification.Based on SemEval-2014 restaurant reviews dataset, the performance evaluation of RRF, ARF, and HFV using LSTM is presented in this section Figs. It can be observed from the examination of F1-measure, accuracy, precision, and recall that the hybrid feature engineering method gave much better results for sentiment classification than ARF and RRF using LSTM. The HFV strategy encompasses the issues associated with sarcasm, negation, ambiguity, emotions, opinions, and feelings regarding restaurants and their aspects, which is the primary cause of this performance improvement. The combination of n-gram, TF-IDF, and emoticons-specific features results in the attainment of the RRF vector. It successfully constructs the hybrid feature vector, which conveys the frequency of words occurring in every review alongside emoticon-specific features. To further limit sentiment analysis errors, the ARF approach employs the co-occurrence frequency strategy for managing sarcastic and ambiguous phrases. The RRF outperformed the ARF in terms of results because it successfully addressed negations, opinions, and emotions.The performance of F1-measure and MSAT with varied training data set sizes is shown in Figs. Using the SemEval-2014, STS-Gold and Sentiment140 datasets, we compared the proposed hybrid feature extraction approach employing LSTM with the below-mentioned recent state-of-the-art methodologies for investigating its quantitative representation.Supervised ABSA (SABSA) [ (SABSA) : This meSentiVec [SentiVec : The newN-gram\u2009+\u2009TF-IDF\u2009+\u2009SVM [DF\u2009+\u2009SVM : Our perSEML [SEML : It's anMTMVN [MTMVN : Since iTables In comparison to SentiVec and N-gram\u2009+\u2009TF-IDF\u2009+\u2009SVM, the ABSA methods: SABSA, SEML, and MTMVN are found to exhibit poor performance since they lack negation handling and do not extract review-specific features. The model presented in this paper focuses on delivering an integrated solution that combines the advantages of both aspect-specific and review-specific features to increase performance.The paper aims to accurately perform sentiment analysis from the point of view of the consumer review summarization model for capitalists. We outlined several research concerns and possible solutions for the challenges that occur when performing sentiment analysis for raw online reviews. Using the hybrid feature extraction method proposed in this paper, the input pre-processed reviews can be transformed into meaningful feature vectors, allowing efficient, reliable, and robust sentiment analysis to take place. The results reveal that as compared to individual methodologies; the hybrid approach greatly improves sentiment analysis performance. We have also compared the proposed model\u2019s performance with the recent state-of-the-art methods for F-1 measure, accuracy, precision, recall, and AUC evaluation parameters. All five evaluation parameters are found to improve significantly. The HFV\u2009+\u2009LSTM model's future directions include (1) applying sentiment classification results to extend the proposed model for consumer review summarization, (2) investigating the proposed model's performance using diverse datasets, and (3) exploring more NLP techniques to make the model language independent."}
{"text": "Rapid and highly sensitive quantitative analysis of chlorpromazine (CPZ) in human whole blood is of great importance for human health. Herein, we utilize the screen-printed carbon electrodes (SPCE) as the electrode substrates for growth of highly electroactive and antifouling nanocomposite materials consisting of vertically ordered mesoporous silica films (VMSF) and electrochemically reduced graphene oxide (ErGO) nanosheets. The preparation of such VMSF/ErGO/SPCE could be performed by using an electrochemical method in a few seconds and the operation is controllable. Inner ErGO layer converted from graphene oxide (GO) in the growth process of VMSF provides oxygen-containing groups and two-dimensional \u03c0-conjugated planar structure for stable fabrication of outer VMSF layer. Owing to the \u03c0-\u03c0 enrichment and excellent electrocatalytic abilities of ErGO, electrostatic preconcentration and antifouling capacities of VMSF, and inherent disposable and miniaturized properties of SPCE, the proposed VMSF/ErGO/SPCE sensor could be applied for quantitative determination of CPZ in human whole blood with high accuracy and sensitivity, good stability, and low sample consumption. H-phenothiazin-10-yl)-N,N-dimethyl-propan-1-amine, CPZ), as a class of phenothiazine derivatives with aliphatic side chains, is an important antipsychotic drug, which has been widely used to treat personality disorders and various psychotic disorders, such as adult manic depression or schizophrenia ), potassium ferrocyanide (K4[Fe(CN)6]), sodium phosphate dibasic dodecahydrate (Na2HPO4\u00b712H2O), chlorpromazine (CPZ), citric acid (CA), glucose (Glu), L-threonine (Thr), L-leucine (Leu), hydroquinone (HQ), ascorbic acid (AA), uric acid (UA), 3-hydroxytyramine hydrochloride (DA), and bovine serum albumin (BSA) were obtained from Aladdin Chemistry Co. Ltd. . Sodium dihydrogen phosphate dehydrate (Na2H2PO4\u00b72H2O) was bought from Macklin . Screen-printed carbon electrodes (SPCE) (DRP-C110-U75) were received from Metrohm . Among them, the working electrode (4 mm in diameter) and counter electrode of the SPCE were prepared from carbon, and Ag was used as a pseudo-reference electrode. Human blood serum  was provided from Center for Disease Control and Prevention  for real sample analysis. All reagents used in the experiment were of analytical grade without further treatment. Deionized water (18.2 M\u03a9 cm) was prepared from Mill-Q system .Monolayer graphene oxide (GO) aqueous dispersion (1 mg/g) was purchased from Hangzhou GaoxiTech . Tetraethyl orthosilicate (TEOS), hexadecyl trimethyl ammonium bromide (CTAB), potassium ferricyanide (KX-ray photoelectron spectroscopy (XPS) was performed on PHI5300 electron spectrometer using 250 W, 14 kV, Mg K\u03b1 radiation . The surface morphology of VMSF was characterized by HT7700 Transmission electron microscope  at an acceleration voltage of 100 kV. VMSF was prepared by gently scraping from the surface of SPCE and was dispersed in the ethanol. The dispersion was further dropped onto the copper grids after ultrasonication for 2 h to obtain the TEM specimen. All electrochemical experiments, including cyclic voltammetry (CV), differential pulse voltammetry (DPV), and electrochemical impedance spectroscopy (EIS), were carried out on an Autolab  electrochemical workstation. In this article, the scan rate used in CV was 100 mV/s, and DPV parameters used were as follows: step, 0.005 V; modulation amplitude, 0.025 V; modulation time, 0.05 s; interval time, 0.2 s.2SO4 for 10 cycles. After being washed by ultrapure water and dried under nitrogen, 20 \u03bcL of GO (0.1 mg/mL) was dropped onto the SPCE and dried at 60 \u00b0C. The electrode was named as GO/SPCE. VMSF was grown onto the GO/SPCE surface according to the protocol reported previously [3 and EtOH (v/v = 1:1), 1.585 g CTAB, and 3050 \u03bcL TEOS under vigorous stirring for 2.5 h. Subsequently, GO/SPCE was placed into the above precursor solution and subjected to a constant voltage of \u20132.1 V for 5 s. Then, the electrode was quickly washed by deionized water, dried by nitrogen, and further aged at 80 \u00b0C. Thus, the resulting electrode with surfactant micelles (SM) inside the nanochannels was designed as SM@VMSF/ErGO/SPCE. In order to remove SM from the silica nanochannels, SM@VMSF/ErGO/SPCE was put into 0.1 M HCl-EtOH under stirring for 5 min. The obtained electrode was called VMSF/ErGO/SPCE.Prior to use, SPCE first underwent electrochemical pretreatment to remove the impurities absorbed on the electrode surface by applying a potential range of 0.4\u20131.0 V in 0.05 M Heviously . BrieflyThe received human whole blood was diluted or undiluted with 0.1 M PBS (pH 6.0) without any complex pretreatment. Upon the addition of known concentration of CPZ into the human whole blood samples, electrochemical responses of CPZ were determined by the VMSF/ErGO/SPCE sensor. The volume of samples is very small (<50 \u00b5L).In summary, we present a simple and efficient method for preparation of disposable VMSF/ErGO/SPCE electrochemical sensor and investigate its analytical performance of CPZ detection. Such VMSF/ErGO/SPCE could be obtained by a rapid and controllable one-step electrochemical method, which combines the reduction of GO and growth of VMSF. Arising from the electrostatic preconcentration ability of outer VMSF layer and electrocatalytic capacity and \u03c0-\u03c0 enrichment ability of inner ErGO layer, the proposed VMSF/ErGO/SPCE shows excellent analytical performance towards CPZ. Furthermore, combining the inherent characteristics of VMSF (antifouling ability) and SPCE (disposable property), direct electrochemical analysis of CPZ in human whole blood was successfully realized with rather low sample consumption and good anti-interference, stability, reproducibility, and regeneration abilities, which could be extended to detect various analytes related to diseases."}
{"text": "The sixth Total Diet Study (TDS) of China included a countrywide study to assess the health effects of MSG (monosodium glutamate). MSG detection, consumption analysis, and risk assessment were conducted on 168 samples from seven food categories of the most typical Chinese daily diet. The highest value of MSG in the daily diet of the Chinese population was 8.63 g/kg. An MSG intake of 17.63 mg/kg bw/d for the general population of China was obtained from content measurements combined with food consumption, while the data from the apparent consumption survey alone gave 40.20 mg/kg bw/d. The apparent consumption did not consider the loss of MSG during food cooking, resulting in an overestimate. To offer a global perspective, MSG content, food category contributions, and ingestion levels across nations were summarized and thoroughly investigated. A realistic, logical, and precise risk assessment protocol for MSG daily intake was developed in this article. Monosodium glutamate (MSG), a flavor enhancer, is typically utilized in food processing in homes and the catering sector worldwide. The dangers of excessive MSG consumption on human health have drawn researchers\u2019 attention repeatedly ,10,11,12Hence, the European Food Safety Authority (EFSA) re-evaluated the safety of glutamic acid and its derived glutamates in June 2017 and presented a population-acceptable daily intake (ADI) of 30 mg/kg bw/d, expressed as all inorganic salt forms of glutamic acid . AccordiIn this study, we investigated the types of daily diet and consumption in the general population of Chinese residents to obtain more exact information on the actual intake of MSG in the daily diet based on the sixth Total Diet Study (TDS) of China. The MSG content of all consumed foods in the ready-to-eat state was detected by our laboratory UPLC-MS/MS assay. The MSG daily intake was calculated by multiplying the food consumption and the related content. The daily intake of MSG in the general population of China was assessed at provincial and national levels based on an ADI value of 30 mg/kg bw/d for a standard Chinese man\u2019s bw of 63 kg, on the risk of human health effects. Meanwhile, to compare the variability of risk assessment results between apparent MSG consumption and actual intake, a 3-day, 24-h dietary survey was conducted using a CHNS-like survey of over 10,000 households in a selected area covering 70% of China\u2019s land area and 85% of its population and assessed in terms of apparent consumption. The real daily dietary intake of MSG in the general Chinese population was substantially lower than the apparent consumption, as shown by the comparison between the findings of the intake analysis and the apparent consumption analysis. This finding suggests that to appropriately assess the risk of MSG intake and prevent overestimation, losses of MSG during cooking and trans-oral processes should be taken into consideration.TDS, a continuous national study, monitors the levels of trace elements and harmful compounds in foods and is also used to estimate hazards of dietary exposure in Chinese populations. The China National Center for Food Safety and Risk Assessment (CFSA) conducted the sixth China TDS from 2016 to 2021 in twenty-four provinces, namely, Heilongjiang, Liaoning, Jilin, Hebei, Beijing, Henan, Shanxi, Shaanxi, Ningxia, Neimenggu, Qinghai, Gansu, Jiangxi, Fujian, Shanghai, Jiangsu, Zhejiang, Hubei, Sichuan, Guangxi, Hunan, Shandong, Guizhou, and Guangdong. In the sampling setting, provinces with a population above fifty million randomly set two different urban sampling points and four rural sampling points. Conversely, one urban sampling site and two rural sampling sites were randomly selected in provinces with a population of fifty million or fewer. The number of participants in each sampling site was not less than 30 households. According to the mixed food sample method used in the earlier TDS in China, the surveyed per capita food consumption was divided into thirteen categories, namely, cereals, legumes, potatoes, meats, eggs, aquatic foods, milk, vegetables, fruits, sugar, beverages, alcohol, and condiments (including cooking oil). The dietary composition of the surveyed areas or populations was collected by grouping the different food items consumed into the categories to which they belonged. Various food samples were collected from food purchasing points such as vegetable farms, side stores, grain stores, farmers\u2019 markets, or farmers\u2019 homes, near the neighborhood committee or village where each survey site was located. Food and condiments for cooking were prepared in designated restaurants, kitchens, or laboratories according to the cooking utensils and methods customarily used locally. All seasonings were added to other food groups as required by the recipe during the cooking process. Then, the ready-to-eat dietary samples were stored at \u221220 \u00b0C and shipped to CFSA.3\u00b7H2O was added for cartridge equilibration. After sample loading, water (4 \u00d7 0.5 mL) and methanol (2 \u00d7 0.5 mL) were used to remove impurities. Then, 0.5 mL of 2% formic acid (v/v) in methanol was used to elute the target. All eluent fractions were combined and dried by nitrogen flow, and the residue was reconstituted in 0.25 mL of 50% aqueous acetonitrile. Finally, depending on the level of MSG content in the dietary sample, 1 mL of the eluate was diluted 10\u22123 times and then detected for content. MSG identification and quantification were performed using Shimadzu LC 8050 UPLC-MS/MS . The positive ion mode was used in the ESI ionization. The ion spray voltage was +4.5 kV. Nitrogen was used as the atomization gas and the drying gas, with a flow rate of 3 L min\u22121 and 10 L min\u22121, respectively. The heating gas velocity was 10 L min\u22121 of air. Additionally, meanwhile, the desolvation line and heating module temperatures were 300 \u00b0C and 400 \u00b0C, respectively.One hundred and sixty-eight samples from twenty-four provinces of seven food items, namely, cereals, legumes, potatoes, meats, eggs, aquatic foods, and vegetables, were examined for MSG content determination. Following the local food recipe, these foods used MSG or other analogous flavors during the cooking procedure. MSG was extracted using 4 mL of 0.1 M HCl from 1.0 g of the dietary sample thawed at room temperature during the sample pretreatments. The extraction solution was centrifuged above 4000 rpm for 10 min. Before the sample was cleaned, 1 mL of supernatant was aliquoted from the extraction solution and neutralized with 1 mL of 0.1 M NaOH. An ion exchange cartridge  was used for sample clean-up. Firstly, 2 mL of 5% NH\u2122 UPLC HSS PFP column  was used for MSG chromatographic separation. The temperature of the column oven was 40 \u00b0C. The mobile phase was water (phase A) and acetonitrile (phase B) containing 0.2% formic acid (v/v). The steps of the gradient elution program were: 0\u20133 min: 50% phase B and 50% phase A, 3\u20136 min: phase B content increasing linearly to 100% and kept for 2 min. The flow rate was 0.20 mL/min, and the injection volume was 1 \u03bcL. The retention time of MSG was 2.748 min under these conditions.An ACQUITY+ > 84.05+ and 147.90+ > 56.05+, with collision energies of 16 eV and 23 eV, respectively, in MS separation.Quantitative and qualitative ion pairs on the multiple reaction monitor (MRM) scanning modes were 147.90The dietary intake of each food category was calculated by multiplying the MSG contents and their consumption. The whole MSG intake was the accumulated sum of every food intake. Additionally, then, the sum was divided by 63 kg of the standard Chinese man for MSG intake risk assessment. The items with \u201cnot detected\u201d data represented half of the Limits of Detection (LODs) when processing the dietary intake. The risk assessment was based on whether the general population\u2019s intake in each province was above 30 mg/kg bw/d, and areas where MSG intake exceeds this value need to be a cause for concern.The parameters of the assay, such as LODs, Limits of Quantitation (LOQs), and spiked recovery experiment, were jointly validated by three other national laboratories. All methodological sensitivities, reproducibility, and specificities are reflected in the additional information. The LODs of MSG in the food composites ranged from 1.5 to 3.5 \u03bcg/kg in different food matrices. Additionally, the LOQs of MSG were 5.0 \u03bcg/kg in cereals, legumes, and potato products and 10 \u03bcg/kg in meat, egg, aquatic, and vegetable products, respectively. In the recovery test, blank samples were selected from the seven food matrixes in which the MSG concentrations were below the LODs. Three spiking levels of 10, 100, and 1000 \u03bcg/kg were evaluated. The validation results of this determination method are seen in It is clear from There was a wide range of MSG intakes, from 4.27 to 32.35 mg/kg bw/d, among different regions in China. The mean (\u00b1SD) was 17.63 \u00b1 2.50 mg/kg bw/d at the national level. The top three highest intake provinces were Shanghai, Heilongjiang, and Hunan, with 32.35, 27.78, and 27.56 mg/kg bw/d. The province with the lowest intake was Shandong Province, with a value of only 4.27 mg/kg bw/d, as The risk evaluation included an investigation into the dietary contribution of MSG consumption. This data analysis enabled us to comprehend the variations in dietary practices between regions and to lower risk by limiting items with a high proportion of contaminants. Vegetables were the primary source of essential intake at the national level in our contribution margin analysis, contributing at a rate of 44%, as shown in Since MSG was first used in flavoring, there have been different opinions on its safety in various countries and institutions. The US Food and Drug Administration (FDA) considers the addition of MSG to foods to be \u201cgenerally recognized as safe\u201d (GRAS). In some countries and regions, MSG is even seen as the main alternative to reduce sodium salt intake. Although our group has reservations about the suitability of this ADI for the Chinese population, it has been used as a tentative evaluation criterion for the risk assessment of MSG. A uniform unit of measurement was needed for MSG intake to be consistent with the criteria used to determine results when comparing different regions of the world. The MSG intake units mentioned previously in In this study assessment, animal-based foods such as meats and aquatic had higher MSG levels than plant-based foods. Compared to plant foods, animal-based foods have more protein amino acid groups, and these free proteins may undergo hydrolysis to produce glutamate under complex external conditions. Many high-protein animal foods have high levels of MSG, and a large proportion of this should be contributed by these free glutamates . This fiWe also carried out a comparative analysis of the global MSG food content. As can be seen in To further explore the influence of the geographical distribution and dietary consumption habits of the Chinese general population on MSG intake, we mapped the geographical distribution of total dietary MSG in China . In geneIn addition, we conducted inter-country comparisons of MSG-related or similar data on the MSG dietary intake of the world population, and the results are shown in Comparatively, the European diet was dominated by high-quality baked goods, soups, broths, sauces, meat, meat products, seasonings, and condiments, all of which were high in MSG and consumed in significant amounts ,35. The In this study, we considered the intake derived by multiplying the food content and the corresponding consumption as the risk assessment value to be accurate. This strategy takes full account of factors such as the low levels of MSG added to fresh or home-cooked foods, and the fact that MSG is dissolved in the water of the dish during cooking and consumption of the food, and this water reduces the imported intake of MSG as a non-edible fraction in the actual intake. Therefore, a realistic approach to measuring MSG intake has the advantage of authenticity and precision. Although a risk assessment of health effects based on MSG consumption would lead to overestimation, high MSG consumption should be a concern in China.In summary, our group conducted a comparison of apparent MSG consumption surveys and real intake using the TDS study to analyze the risk of MSG quickly and accurately for the public using vast data covering over 70% of China\u2019s land and 85% of its population. This is the most representative and up-to-date MSG intake and risk assessment for China to date. We have, for the first time, examined the geographic variation of MSG intake for different food categories in China. This analysis will serve as a local point of reference and offer information on how to restructure diets healthily. However, in this paper, the results of our risk assessment were carried out mainly based on MSG intake in the general population. Therefore, we have shortcomings in the analysis of individual consumption and risk of MSG. In a subsequent study, we will reinforce the probabilistic assessment of the risk of MSG intake in the Chinese population on specific indicators such as gender, age group, and BMI for the individuals participating in the survey, to more precisely target the population groups at high risk of MSG intake.In summary, we conducted a comparison of apparent MSG consumption surveys and real intake using TDS study to analyze the risk of MSG quickly and accurately for the public using vast data covering over 70% of China\u2019s land and 85% of its population. A risk analysis of MSG intake in the general population of China was obtained from both assessments. This is the most representative and up-to-date MSG intake and risk assessment study for China to date. Additionally, considering the MSG loss caused by MSG in whole food cooking and non-edible parts of the dishes, we believe that the strategy of obtaining the maximum intake with MSG apparent consumption through a 3 d, 24 h room survey causes overestimation. This provides a more reliable technical solution for the future risk assessment of relevant condiments. We have, for the first time, examined the geographic variation of MSG intakes for different food categories in China. This analysis will serve as a local guideline and offer information on how to restructure diets healthily. Last but not least, a global comparative analysis of food content and population intake in dominant studies around the world was conducted. This provides a global view of MSG population intake and risk assessment for our colleagues around the world, providing a strategy for a rapid, accurate, and realistic MSG risk assessment of daily household dietary intakes for related work."}
{"text": "However, without reliable source identification,the origin of this decades old problem has been uncertain. Here, wetarget radiocesium contamination in wild boars from Bavaria. Our samples(2019\u20132021) range from 370 to 15,000 Bq\u00b7kg\u20131137Cs, thus exceeding the regulatory limits (600 Bq\u00b7kg\u20131) by a factor of up to 25. Using an emerging nuclearforensic fingerprint, 135Cs/137Cs, we distinguishedvarious radiocesium source legacies in their source composition. Allsamples exhibit signatures of mixing of Chornobyl and nuclear weaponsfallout, with 135Cs/137Cs ratios ranging from0.67 to 1.97. Although Chornobyl has been widely believed to be theprime source of 137Cs in wild boars, we find that \u201cold\u201d 137Cs from weapons fallout significantly contributes to thetotal level (10\u201368%) in those specimens that exceeded the regulatorylimit. In some cases, weapons-137Cs alone can lead to exceedancesof the regulatory limit, especially in samples with a relatively lowtotal 137Cs level. Our findings demonstrate that the superpositionof older and newer legacies of 137Cs can vastly surpassthe impact of any singular yet dominant source and thus highlightthe critical role of historical releases of 137Cs in currentenvironmental pollution challenges.Radionuclides released from nuclear accidents or explosionsposelong-term threats to ecosystem health. A prominent example is wildboar contamination in central Europe, which is notorious for its persistentlyhigh  137Cs from nuclear weapons falloutcontributes significantly to the notorious contamination levels inwild boars in Central Europe that were previously believed to be dominatedby Chornobyl.Sixtyyears old  It originates from the fallout of atmospheric nuclearexplosions from the mid-20th century (weapons-137Cs) andnuclear accidents, most prominently the Chornobyl4 and Fukushima6 nuclear accidents (reactor-137Cs). For safety regulations, many countries have employedstrict regulatory limits for 137Cs levels in general foodproducts .7 However, although routine radiation surveillance provides essentialquantitative information on 137Cs contamination levels,the attribution of a contamination to its origins remains poorly understoodas the ubiquitous weapons-137Cs cannot be distinguishedfrom any reactor-137Cs. This analytical challenge impedesthe comprehensive understanding of the origin of environmental 137Cs contamination, which is a critical prerequisite for aquantitative assessment of the responsibilities for certain 137Cs legacies and the establishment of more targeted strategies forenvironmental remediation and protection. More than ever, with threatsof nuclear strikes or accidental releases in the course of the Russo-Ukrainianwar, it is now imperative to be able to identify the source of anyrelease of 137Cs and evaluate their environmental consequences.In the face of climate change, nuclearenergy is experiencing arenaissance as a low-carbon option to feed humanity\u2019s hungerfor energy.9 radiocesium isotopic fingerprintshave not yet been applied routinely for source identification. Cesium-135is an ideal and long-lived candidate (T1/2 = 2.3 My) after a release, better suited than fast-fading 134Cs (T1/2 = 2.07 y). Also, the productionmechanism of 135Cs provides more detailed information onthe nuclear origin of a contamination, which hence allows attributionof a radiocesium contamination to its source via its distinct 135Cs/137Cs ratio. Its mother nuclide (135Xe) has a large cross-section for thermal neutron capture, resultingin suppressed onset of 135Cs under the high neutron fluxdensity of a reactor core.10 By contrast,despite the intense but short neutron flux at the moment of a nuclearexplosion, 135Xe mostly \u201csurvives\u201d the explosionbecause most primary fission products of the 135 isobar are 135Te and 135I, which have yet to decay to 135Xe.11 A nuclear explosion hence yieldsa relatively high 135Cs/137Cs ratio, whereasa reactor yields a low ratio. Nowadays, analytical protocols for commercialtriple quadrupole inductively coupled plasma mass spectrometry (ICP-QQQ-MS)as well as thermal ionization mass spectrometry (TIMS) are availablefor the precise determination of 135Cs/137Cs,thus allowing the application of the 135Cs/137Cs ratio as an isotopic fingerprint in nuclear forensics and environmentaltracing studies.19 In any case, the application of 135Cs/137Csas a forensic fingerprint is still far from routine as it requiresmeticulous chemical separation and sophisticated analytical procedures.While isotopic signatures of actinides have been used successfully to distinguish the contributions betweenvarious sources,137Cs contamination following the Chornobyl nuclear accident.20 It was reported that 137Cs inventoryin surface soil ranged from 102 to 105 Bq\u00b7m\u20132 in April 1986 . As a potent accumulator of 137Cs,22 regional wild boars (Susscrofa) were subsequently contaminated, and the 137Cs activity concentrations in their meat exceeded the regulatorylimit by approximately 1\u20132 orders of magnitude. However, unlikemost forest species, which initially also exhibited high 137Cs contamination in their bodies followed by a decline with time,24137Cs levels in wild boars have not shown a significant decline trendsince 1986.25 In certain locations and instances,the decline in contamination levels is even slower than the physicalhalf-life of 137Cs.26 This phenomenonhas been termed \u201cwild boar paradox\u201d and is generallyattributed to the ingestion of 137Cs accumulating hypogeousfungi  by wild boars.28 Depending on the soil composition,especially clay mineral content,29 theseunderground mushrooms are a critical repository of the downward migrating 137Cs. They are one major food item for wild boars, particularlyduring winter when food on the surface is scarce.30 However, due to the lack of convincing evidence for identifyingthe sources of 137Cs, the origins of the persistent contaminationin wild boars remains unclear.Bavaria, southeastern Germany, is notorious for its heavy 137Cs activities together with 135Cs/137Cs ratiosin wild boar meat samples, collectedfrom 11 Bavarian districts during 2019\u20132021. Reporting thelargest environmental sample set of 135Cs/137Cs to date (n = 48), we undertook a critical comparisonwith the published values and validated the feasibility of utilizing 135Cs/137Cs for source identification. Using a mixingmodel, we estimated the contribution of weapons-137Cs andreactor-137Cs, which not only deepens our understandingof the \u201cwild boar paradox\u201d but may also allow a futurelocation-specific prediction of the evolution of the 137Cs contamination in wild boars with time. Lastly, our method canbe applied for the traceability of 137Cs in any environmentalsamples in the future.Here, we analyzed the 137Cs fallout due to atmospheric nuclearexplosions led to local 137Cs deposition of about 103 Bq\u00b7m\u20132.31 However, in 1986, considerable additional 137Cs falloutfrom the Chornobyl nuclear accident was deposited on the ground inBavaria after a long-distance atmospheric dispersion, although thestudy area is located approximately 1300 km away from the accidentsite. The input of Chornobyl-137Cs immediately increasedregional 137Cs inventories to 0.5\u201350 kBq\u00b7m\u20132 . Additionally, the local alpine, pedological, and climaticcharacteristics created a favorable condition for slow 137Cs downward migration in the terrestrial environments. For instance,the topsoil classification map created by the Federal Institute forGeosciences and Natural Resources (BGR) showed that clay silt, sandyclay, loamy sand, and loam are the major topsoil textures in the investigatedregions.32 It is well-known that Cs+ ions are strongly bound to the soil\u2019s clay and finesilt fraction, thus preventing rapid vertical migration.33 In addition, the historical data recorded byGermany\u2019s national meteorological stations showed that theannual average local rainfall generally varied from about 630 to 1211mm (median: 776 mm) in the period from 2006 to 2017.34 In comparison to the rest of Germany, Southern Bavariaexperiences relatively high precipitation rates (>1000 mm) duetothe proximity to the Alps. This also caused increased wet deposition(washout of particles) after Chornobyl as well as during global fallout,resulting in a gradual increase of the radiocesium inventory fromnorth to south.Samples of wild boar meat were collectedfrom forested regions of 11 Bavarian districts in southern Germany1. At theFigure S1 in part 1 of the Supporting Information) was sampled by local Bavarianhunters between fall 2019 and spring 2020, as well as in early 2021.At each site, the fresh muscle samples from targeted wild boar wereseparated, frozen, and transported to Leibniz University, Hannover,after hunting. Most hunters submitted tongue tissue as an easily availabletype of tissue with high contamination levels.35 In our laboratory, the wild boar muscle samples were thawedat room temperature and then cut into smaller pieces (diameter <2 cm), while ensuring complete removal of any foreign matrix. In ouranalytical protocol, briefly, the samples were first dried at 110\u00b0C for 24 h and then heated to 420 \u00b0C for 36 h in an ovenfor final ashing. After necessary cooling, the ashed samples wereseparately transferred to sealed containers for further storage.Wild boars are traditional game animalsin Bavaria. The meat of wild boars  and guaranteedgrade regents, including HNO3 , HCl , and NH3 , were used to preparesolutions, which were then utilized in sample digestion and radiochemicalanalysis. Ammonium molybdophosphate powder  purchasedfromAlfa Aesar was used for the Cs extraction. To remove the potentiallyinterfering elements from the ashed samples, Dowex 1-X8 (100\u2013200mesh) anion exchange resin purchased from Alfa Aesar and the cationexchange resin AG 50 W-X8 (100\u2013200 mesh) from BioRad Laboratories,Inc. were prepared for sample purification.Two IAEA referencematerials, IAEA-330 (spinach) and IAEA-372 (grass), originating fromPolessko, Kyiv, Ukraine, were used for verifying the measured 137Cs activity was measuredby a high-purity germanium (HPGe) gamma detector, using the 661.7keV \u03b3-peak. Gamma ray efficiency calibration was performed usingEckert & Ziegler\u2019s certified \u201cMixed nuclide solution7601.\u201d The detector has a counting volume of 131 cm3 with a relative detection efficiencyof 28% and a resolution of 1.9 keV at the 1332 keV 60Co\u03b3-ray peak. The software Genie 2000 was used for evaluatingthe \u03b3-ray spectra of each sample. Based on the calibration filesprepared in our laboratory, the measured data were corrected withthe counting geometry and energy. Gamma-ray self-attenuation was correctedby using the \u201ctop-down method\u201d (see part 2 of the Supporting Information). Besides, a physicaldecay correction was also performed for all measured data to the samplingday.The ashed samplewas homogenized and filled into a plastic container for \u03b3-raymeasurement. The sample\u2019s 11 was used in this section, which mainly encompassesthree steps: (I) cesium extraction; (II) cesium purification; and(III) 135Cs/137Cs ratio determination by ICP-QQQ-MS.The detailed process is described in part 3 of the Supporting Information(Table S1). In part 4 of the Supporting Information, the amounts of referencesamples (IAEA-330 and IAEA-372) used for the analysis are listed (Table S2), and the cross-comparison of 135Cs/137Cs ratios in reference materials with publishedvalues39 (QA/QC) is described .The analysis protocol established by Zok et al.137Cs data. One-way analysis of variance (ANOVA) was appliedto evaluate the difference between significant differences in 137Cs activity concentration and 135Cs/137Cs among wild boar characteristics groups. All the statistical analysiswas implemented in SPSS v.22.\u201cMedian \u00b1 standarddeviation\u201d is used for the description of the data distribution.Spearman correlation analysis and linear regression analysis wereused to quantitatively study the relationship between variables and Tables S5 and S6 in part5 of the Supporting Information. Overall, the fresh weight activityconcentration of 137Cs in wild boar meat collected from11 Bavarian districts varied between 0.37 and 14 kBq\u00b7kg\u20131 , in which about 88% ofmeasured data were above the regulatory limit according to Germanlaw and all data exceeded the Japanese limit. In addition, a spatialheterogeneity of 137Cs contamination levels was observedbetween various Bavarian districts, with the range of coefficientsof variation (CVs) from 23 to 113% (excluding regions with a samplesize < 3). In the Garmisch-Partenkirchen region , we observed minimum and maximum 137Cs levelsin wild boars with the widest range (14 kBq\u00b7kg\u20131) and the highest CV . In northernBavaria , we found a relatively narrow 137Cs variability  and the lowest 137Cs contamination (0.67\u00b1 0.16 kBq\u00b7kg\u20131). By contrast, regionC  contributed the heaviest 137Cslevels in this study . From a temporal perspective, hardly anysignificant decline trend can be found in 137Cs activityconcentrations between our samples (2019\u20132021) and the historicalrecord of 137Cs contamination in wild boar during similarseasons since 2001 ,which is consistent with the observation of persistent 137Cs contamination in wild boars from Austria.25 To explore the potential sources responsible for the persistent 137Cs contamination in wild boars, we compared measured 137Cs with the inventories in the study regions. With negligiblecontributions from Fukushima,40 we consideredreactor-137Cs from Chornobyl and weapons-137Cs as the major sources in Bavaria. For weapons-137Cs,the cessation of atmospheric tests resulted in no noteworthy new weapons-137Cs fallout after the last test in 1980. Nowadays, the baselineof airborne 137Cs (<10 \u03bcBq\u00b7m\u20133 in Germany) contributes insignificantly to the relatively high inventoryin soil41 and consequently in wild boars. Consideringthat the above-mentioned contamination level is orders of magnitudegreater than the 137Cs inventories reported in less contaminatedregions,42 it suggests a substantial impact of Chornobyl-137Cs on the Bavarian ecosystem. This is consistent with reportsof Chornobyl-137Cs dominating the total 137Csinventory in Austria by 90%.43 Besides,we found notable geographical differences in 137Cs inventoriesamong investigated districts with a declining trend from south tonorth . Moreover, these inhomogeneous 137Cs spatial patternsare also discovered in any specific district with a range of CVs from12%  to 63% . However, a simpleregression analysis showed no latitudinal pattern for 137Cs levels in wild boars and no obvious correlation between the 137Cs activity concentrations and topsoil inventories ,47 animal access to agricultural areas with lower 137Cslevels in crops than in wild plants or mushrooms growing in forests,20 heterogeneity of deposition, season of sampling,30 etc.,48 no simplemodel can correlate topsoil 137Cs inventories and the resultingactivity concentration in the animal tissue.The detailed information about sampling and the measured resultsare summarized in kBq\u00b7kg\u20131 2a, withentories 2b. This 135Cs/137Cs studies. The measured 135Cs/137Cs ratios ranged from 0.67 to 1.97 , with the highestratio found in the northern region  and the lowestratio from the central part of Bavaria . Similarly,like the radiocesium inventory in Bavaria decreasing from south tonorth, there is a pronounced geographical pattern in 135Cs/137Cs ratios, in which the latitude-dependent declineis confirmed , whereas a relatively poor significantcorrelation between the topsoil 137Cs inventories and 135Cs/137Cs ratios  is apparent. Unlike the measured 137Cs activity concentrations, the 135Cs/137Cs ratio\u2019s variability is relatively narrow, with the CV varyingfrom 4 to 24% (median: 9%). More interestingly, correlation analysisshowed a significant positive relationship between the 135Cs/137Cs ratio\u2019s CV and topsoil 137Csinventories\u2019 CV in these regions , suggestingthe dependence of 135Cs/137Cs ratios\u2019difference on the non-uniform spatial distribution of topsoil 137Cs inventories. Considering that such non-uniform patternsare typically attributed to the deposition of Chornobyl-137Cs, we here used the map of Chornobyl-derived 137Cs fromMeusburger et al.49 and found a significantheterogeneity in Chornobyl-derived 137Cs in our study regions,with the CV ranging from 48 to 105%. The great variability of the 135Cs/137Cs ratios in this study is thus thoughtto reflect the variable contributions of 137Cs sourcesin Bavaria.For a convenient comparison, allratios were corrected to March 11, 2011, which is the date of thelast major radiocesium source affecting the environment (Fukushimanuclear accident). We propose this date as the reference for decaycorrection in 135Cs/137Csratios for the discrimination of the two radiocesium sources, we systematicallycompared our values with all reported 135Cs/137Cs ratios over the last decades  and plotted the measuredvalue with their locations, as shown in 135Cs/137Cs ratios obtained from countries that experiencedmajor nuclear accidents  are much lower with a narrowrange than those obtained from regions far away from any locationswith releases from nuclear accidents . By contrast, the 135Cs/137Cs ratios in samples from other European countries  were in between the fingerprint signature ofweapons-137Cs and reactor-137Cs , thus indicating mixing.In the case of the present study, there is a significant gap in therange of 135Cs/137Cs ratios between the minimumvalue (0.67) and the maximum value (1.97) measured in Bavarian wildboars. This inconsistency may be explained by the uptake of radiocesiumfrom mixed sources.To better apply the measured 135Cs/137Cs ratioin different countriesmay be affected by the weapons\u2019 and test\u2019s characteristics.53 For instance,the median ratio in the USA  is about 41% higher than that in Canada . Therefore, we here adopted the ratio obtained fromthe historical human lung tissue (Vienna)54 as the 135Cs/137Cs fingerprint for centralEurope, which likely represents the integral signature in a Europeansetting. These samples were collected in the 1960s, so its 135Cs/137Cs ratio is only governed by weapons fallout . In this scenario, the higher 135Cs/137Cs ratios observed in Kronach , compared to that in otherregions, and the relatively low 137Cs contamination inwild boars together suggest that, here, Chornobyl-137Cswas not the dominant source in this region. By contrast, some regionshave high 137Cs contamination and a relatively low mean 135Cs/137Cs ratio, such as Cham , which implies thatChornobyl-137Cs mostly accounts for the local 137Cs contamination. To better display the spatial distribution of 135Cs/137Cs ratios in the study area, we plottedthe measured values on the 137Cs deposition map derivedfrom BfS data .The 135Cs/137Cs ratios observed in wild boars are negatively relatedto the amount of Chornobyl-137Cs ingested from their habitat,we expected that there would be a negative relationship between the 137Cs activity concentrations and 135Cs/137Cs ratios in samples collected from Bavaria. To validate this idea,we applied the regression analysis for two arrays, and as expected,we found a negative correlation (P < 0.01). However,the 135Cs/137Cs ratios estimated by the fittingcurve do not match the measured value in most cases, and the R2 is only about 0.25. Metabolic variabilitiesmay explain why certain specimens of wild boars may accumulate ormaintain 137Cs levels more efficiently than others, whereasthe 135Cs/137Cs ratio will be unaffected, leadingto such a mismatch between the 137Cs activity concentrationand the ratio. Nevertheless, statistical analysis showed no significantdifference in either the 137Cs activity concentration orthe 135Cs/137Cs ratio among our wild boars\u2019characteristics .Considering that the 137Cs is rapidly adsorbed onto (clay) mineralsand graduallymigrates vertically,55 until it reaches further potentialaccumulators such as underground fungi.27 The global fallout from atmospheric nuclear explosions peaked in1964, more than 20 years prior to Chornobyl\u2019s fallout. Dueto the time span between both events, the actual 137Csinventory in greater soil depths differs from that in the topsoilacross the regions. Moreover, the availability of 137Csin subterranean species  may further amplify the differencesin the spatial pattern of 137Cs as its downward migrationrate and accumulation process varies with the local environmentalconditions, such as the increased likelihood for precipitation inthe alpine regions of Southern Bavaria. Thus, another interpretationfor the poor correlation between 137Cs activity concentrationsand 135Cs/137Cs ratios is that the regionaldifference in 137Cs availability complicates the correlationof two variables using a single model. In other words, different contributionpercentages of two independent 137Cs sources may resultin identical 137Cs contamination levels, thus weakeningthe explanation of the observed phenomenon using a single regressionmodel. This hypothesis has been tested in Figure S7 (part 10 of the Supporting Information) where significantdifferences in the relationship between 137Cs levels and 135Cs/137Cs ratios (sample size \u2265 2) wereobserved in the studied regions.It is well-known from Chornobyl and Fukushima thattopsoil 137Cs sources  have mixed inthe Bavarian soil, the release maxima of which were about 20\u201330years apart. To visualize this mixing process more intuitively, wepropose a conceptual mechanism diagram , downward migration in the pedosphere depends on thebiogeochemical system\u2019s complexity , resulting in significant regional differencesin 137Cs migration, mixture, and accumulation. The situationfor wild boars is further complicated by their mobility, which allowsthem to cover areas with higher and lower contamination, possiblywith a variable mixing degree. Instead of focusing on food sources, it hence appears more practical to focus on the actual,integral contamination in the wild boar itself as it represents thefinal outcome of an equation with virtually countless factors .We propose that two  diagram 5. Up unt137Cs and Chornobyl-137Cs in wildboars using the characteristic 135Cs/137Cs ratios(Table S7). With the signature of fallout and Chornobyl , the cesium from fallout (Ps) can be estimated by putting the measuredratio (Rs) into the equation Ps = (Rs \u2013 Rc)/(Rf \u2013 Rc). Moreover, we plotted the 137Cs activityconcentrations and radiocesium contributions in wild boars for allsamples on the basis of the 137Cs deposition map derivedfrom BfS . Compared with the Chornobyl-137Cs contributions in top soils estimated by plutonium isotopes(ca. 60\u201390%),32 although there isa good linear relationship between the two data sets , the predicted Chornobyl contributionpercentages estimated by cesium isotopes are found slightly lower.Particularly in northern Bavaria (region A), the contributions fromChornobyl-137Cs are significantly lower than in the restof Bavaria , but the 137Cs contamination level in wild boars still exceeds the regulatorylimit in 62.5%. Although it is still debated whether or not the persistent 137Cs contamination in Bavarian boars spanning decades hasits roots in fungal species, we can now present isotopic evidencethat the atmospheric weapons fallout that has been residing in ourenvironment for more than 60 years is still affecting radioactivecontamination levels in wild boars. More unexpectedly, in Cham (regionC), Kelheim (region E), and Garmisch-Partenkirchen (region K), wefound that about 40\u201350% of 137Cs contamination insome wild boar samples originated from the weapons fallout. Therefore,our findings provided visual evidence for the interpretation thatpersistent 137Cs contamination in Bavarian wild boars isalso related to the six decades old global weapons fallout in ourecosystem.The mixing model showed that the median 137Cs contribution to the radioactive contamination in Bavarian wildboars, we calculated the weapons-137Cs activity concentrationby using the estimated contribution percentage and the total 137Cs concentration (Table S10).As shown in 137Cs remains the overall more significantcontributor to wild boar contamination, about 25% of wild boar samplesexhibit such significant contributions from weapons-137Cs that the fraction of weapons-137Cs alone is high enoughto exceed the European regulatory limit (600 Bq\u00b7kg\u20131). Spatially, these samples originated from regions A (n = 1), C (n = 3), E (n = 1), I(n = 2), and K (n = 5), respectively, with the relativecontribution of weapons-137Cs between 12% (region C) and29% (region K). On the other hand, a similar pattern is observed viaan alternative pathway in certain regions where the total contaminationlevel is relatively low (<3000 Bq\u00b7kg\u20131)but the relative contribution of weapons-137Cs is high. In anycase, no assumptions about the contribution of old weapons-137Cs should be made just by a given 137Cs deposition. Forexample, both of the above patterns were observed in region K, wherethe 137Cs deposition exceeds 30,000 Bq\u00b7m\u20132. In contrast, the contribution of weapons-137Cs to thetotal activity concentration was found to be below 20% in region Bwith a relatively low 137Cs deposition inventory (\u223c9000Bq\u00b7m\u20132). We suggest that this phenomenon maybe caused by a certain randomness in the food selection and uptakeof 137Cs by wild boars since regional 137Csavailability and environmental factors can generate multiple combinationsof the two 137Cs legacies. Despite great challenges inrevealing a detailed picture of the persistently high 137Cs contamination in Bavarian wild boars, our findings demonstratethat the six decades old weapons-137Cs alone is still capableof yielding significant contamination levels that exceed the regulatorylimit in wild boars today. Therefore, for the scientific communityof radioecology, the disproportionate weapons-137Cs contributionmay provide new insights into the use of effective half-lives to describe 137Cs behavior in the terrestrial environment as the valueis also governed by the various 137Cs legacy sources andtheir mixing process in the region.In order to further evaluate the weapons-ectively7b. Furth135Cs/137Cs as adirect isotopic fingerprint, we were able to show that the mixed 137Cs legacy from Chornobyl and nuclear weapons fallout isresponsible for the persistence of high contamination levels. Withthe effective half-lives of 137Cs in wild boars being longerthan the physical half-life of 137Cs, this phenomenon sometimesmust have appeared like a violation of the law of radioactive decay.By implementation of a mixing model, our findings demonstrate thatweapons-137Cs contributed between 12 and 68% in those samplesthat exceeded the regulatory limit. The unusually high levels in wildboars not only legitimate rigid regulatory control for human foodsafety, they are partly (21% of samples) also above the conservativescreening benchmark levels  for boars themselves.21Our work reveals deeperinsights into the notorious radiocesiumcontamination in Bavarian wild boars beyond the total radionuclidequantification only. Using 137Cs has resided in the environmentfor at least 60 years  and its contribution as a pollutant of central Europe has generallybeen regarded as negligible compared to that of Chornobyl, our workprovides the forensic evidence showing that this underestimated 137Cs legacy can accumulate in certain environmental mediaalong with more recent reactor-137Cs releases. Both contributorsform an intense 137Cs source that exceeds the contributionfrom any singular, yet dominant source in the area (like Chornobylin the case of Bavaria). This mixed source is the main supplier towild boars in the winter season and in turn the main reason for thepersistent 137Cs contamination in Bavarian wild boars.After several single-source studies, this is the first time that 135Cs/137Cs has been used to demonstrate the accumulationof radiocesium legacies from different nuclear sectors in ecosystemspecies and that the effects of such \u201csuperimposed\u201dradioactive contaminations have been caught while they are transmittedthrough the food chain of biological communities, eventually to humanconsumers of game meat. The recognition of this deleterious environmentalimpact thus provides new insights for the radioecological researchcommunity as policy makers may need to consider a multitude of 137Cs contributors to the total inventory in an ecosystem andtake them all into account for holistic risk assessment.Althoughthe weapons-137Cs release from nuclear accidents or nuclearexplosions will add to the historical 137Cs legacy overtime and further aggravate the current contamination situation. Accordingto the International Atomic Energy Agency, 56 nuclear power reactorsare currently under construction across the world,59 thus underscoring the role of nuclear power in the futureglobal energy portfolio. With the intensifying war between Ukraineand Russia, much concern has been expressed about the terrible consequencesof a nuclear war or a combat-triggered nuclear accident. Once released,radiocesium will remain in the environment for generations and impactfood safety immediately and, as shown in our study, for decades. Anyadditional releases will cause further accumulation and mixing witholder sources, making it necessary to understand the underlying mechanismsof the biogeochemical cycling of radiocesium. For example, the impactof soil properties on mixing of different radiocesium sources hasnot yet been understood sufficiently. Consequently, more efforts arestill needed to better understand the sources, inventories, environmentalfates, and ecological risks of radiocesium.Anyfuture 135Cs/137Cs for the distinction of present or future 137Cs sources. Possible applications include other environmental 137Cs repositories such as mushrooms,61 honey,44 or sediments.62 Lastly, this study illustrates that strategic decisionsto conduct atmospheric nuclear tests 60\u201380 years ago stillimpact remote natural environments, wildlife, and a human food sourcetoday. A similar, long-lasting consequence can be expected from Chornobyl-137Cs deposited in central Europe that will have a longer impactthan the relatively short ecological half-lives of 137Cssuggest.Having proven apowerful tool in complex radioecological questions,this study highlights the outstanding potential of"}
{"text": "Crohn\u2019s disease is an inflammatory bowel disease with up to 50 per cent of patients requiring surgery within 10 years of diagnosis. Patient-reported outcome measures (PROMs) are vital to monitor and assess patient health-related quality of life (HRQoL). This systematic review aims to evaluate PROMs within studies for perioperative Crohn's disease patients.Articles from MEDLINE, Embase, Emcare and CINAHL databases were searched to find studies relating to the assessment of HRQoL in perioperative Crohn's disease patients using PROMs and patient-reported experience measures (PREMs) from 1st January 2015 to 22nd October 2023. Bias was assessed using the ROBINS-I tool was used for non-randomized interventional studies and the Cochrane RoB2 tool was used for randomized trials.1714 journal articles were filtered down to eight studies. Six studies focused on ileocaecal resection, one on perianal fistulas and one on the effects of cholecystectomy on patients with Crohn's disease. Within these articles, ten different PROM tools were identified . Overall improvements in patient HRQoL pre- to postoperative for ileocaecal Crohn's disease were found in both paediatric and adult patients. Outcomes were comparable in patients in remission, with or without stoma, but were worse in patients with a stoma and active disease.There are significant variations in how PROMs are used to evaluate perioperative Crohn's disease outcomes and a need for consensus on how tools are used. Routine assessments using an internationally accepted online platform can be used to monitor patients and support areas of treatment pathways that require further support to ensure high standards of care. They also enable future statistical comparisons in quantitative reviews and meta-analyses. Crohn\u2019s disease (CD) is an inflammatory bowel disease that often requires surgical intervention, making patient-reported outcome measures (PROMs) an important tool for monitoring and assessing patient health-related quality of life (HRQoL). This systematic review evaluates the use of PROMs within surgical CD patients and is able to identify eight studies which collectively utilize eight measures of HRQoL and two measures of function. This review highlights the need for a consensus on how these tools are used and to monitor patients, support treatment pathways and enable future quantitative reviews and meta-analyses. CD can manifest with a variety of presentations at multiple sites and surgical management is complex. CD has a high incidence of perianal disease with a 20-year cumulative incidence of up to 42 per cent2. Perianal fistulas are the most common presentation of perianal disease and often require surgical intervention, with a significant proportion of perianal CD patients eventually requiring a permanent stoma4. Despite the medical therapies available for the management of symptoms, surgical intervention remains a mainstay for the treatment pathway of CD, with approximately 50 per cent of patients requiring surgery within 10 years of diagnosis, with historical reports of surgical recurrence being as high as 80 per cent in previously operated patients5. Surgery cannot cure CD, but is indicated for complications of the disease and to improve patients\u2019 quality of life. Despite the high risk of surgery associated with the disease, the regular assessment of patient-reported outcome measures (PROMs) to assess patient health-related quality of life (HRQoL) is lacking7. A multicentre study assessing national perioperative assessments for surgically managed CD patients in Italy found that PROMs and functional outcomes were being assessed in only 1 per cent of patients following surgery8.Crohn\u2019s disease (CD) is a chronic inflammatory bowel disease (IBD) affecting the entirety of the gastrointestinal tract, but most commonly within the distal ileum of the small intestine9. This study aims to investigate and systematically evaluate the use of PROMs within studies across perioperatively managed CD patients.PROMs are crucial to monitor the impact of surgical interventions in CD. These PROMS are becoming increasingly established, not only during perioperative management but also during remission and medical management. The Food and Drug Administration has emphasized the need for the use of patient-reported outcomes as primary outcomes within clinical trialsA comprehensive systematic literature search was performed through the MEDLINE, Embase, Emcare and CINAHL  databases using the Healthcare Databases Advanced Search (HDAS) platform in order to identify relevant articles investigating the use of PROMs, patient-reported experience measures (PREMs) or other HRQoL tools in CD patients following surgical intervention.The search included all English journal articles from 1st January 2015 to the date of the search (23rd October 2023). The main search terms used were: \u2018Crohn\u2019s Disease\u2019, \u2018Granulomatous Enteritis\u2019, \u2018Crohn\u2019s Colitis\u2019, \u2018Regional Ileitis\u2019, \u2018Terminal Ileitis\u2019, \u2018Ileocolitis\u2019, alongside \u2018Surg*\u2019, \u2018Surg* Manag*\u2019, \u2018Operat*\u2019, \u2018Colectomy\u2019, \u2018Bowel Resection\u2019, and \u2018Patient-Reported Outcome\u2019, Patient-Reported Experience\u2019, \u2018Patient Experience\u2019, \u2018PRO\u2019, \u2018PROM\u2019, \u2018PREM\u2019.Articles containing PROMs data from surgically managed patients with Crohn\u2019s disease were included, meaning that data encompassing all forms of IBD  that did not distinguish CD patients were excluded. Similarly, results that included both surgical and non-surgical PROMs data that did not separate surgical data only were also excluded.Additional searches were also done into the bibliographies of included studies to identify further articles.Articles were independently screened by two authors (W.J.K. and M.I.), and at full-text screening, disagreements were discussed, and a collective decision was made whether to include or exclude.Articles were subdivided into separate manifestations of Crohn\u2019s disease  and the outcome measures used within these studies were analysed to compare how they are being used, as well as their associated benefits and limitations.Quantitative PROMs outcome data were extracted; however, as PROMs tools within CD surgery are still in their infancy, meaningful statistical analysis was not possible. This is due to differences between what these outcome measures assess; accumulation of data sets and comparisons were difficult to achieve.11, the results of which are summarized in Table S1a & S1b.The ROBINS-I tool was used for non-randomized interventional studies and the Cochrane RoB2 tool was used for randomized trials12 (Table S2) and the review has been registered on PROSPERO (registration identifier: CRD42022349869). A separate review protocol was not prepared.This review was completed following the PRISMA guidelines13\u201319 were found to contain relevant information and a single further article20 was found through screening bibliographies of articles in the database, leaving eight articles13\u201320 focusing solely on CD patients following surgery for evaluation for this review . Summaries of the studies, the key findings and information about the PROMs included are represented in the tables below .A total of 1714 articles were identified and were subjected to automated deduplication (using HDAS and Zotero\u2019s deduplication processes) followed by manual deduplication, which removed a total of 510 articles. A final 1204 articles remained for screening, and following title and abstract screening, 1140 articles were excluded, leaving 64 articles for full-text screening; of these, 57 articles were excluded as they lacked PROMs within colorectal surgery, PROMs data were not exclusive to CD , PROMs data were not presented within the paper, or patients were not treated surgically. Seven articleset al.13 and Dipasquale et al.14 were two studies that assessed the outcomes of paediatric patients following ileocaecal resection. Diederen et al.13 assessed the outcomes of 80 patients who had undergone primary ileocaecal resection during childhood (defined by age < 18 years); however, quality of life was only assessed in patients who had reached adulthood at the time of the study ) as there was no single validated, standardized tool for assessing HRQoL in both adult and paediatric patients. The study used the Short Form Health Survey 36 (SF-36) to assess HRQoL, the results of which were compared to mean scores of the general national population. They utilized the patient-reported colorectal function outcome (COREFO) questionnaire to assess colorectal function, which was compared to a separate cohort of patients with normal colorectal function following cholecystectomy; they also assessed the patients\u2019 satisfaction with the surgical procedure13.Diederen et al.14 measured pre- and postoperative HRQoL using a modified IMPACT III questionnaire, an IBD-specific questionnaire for paediatric patients. Scores were obtained 12 and 6 months before surgery and were compared to the 12-month postoperative results of the same patients. Results between 6 months before surgery and 12 months after surgery were compared and statistically analysed14.Dipasquale et al.14 were able to find that median IMPACT III scores from 12 and 6 months preoperatively showed significant improvement across all dimensions of the questionnaire14. When comparing HRQoL outcomes against general populations, Diederen et al.13 found an overall conclusion that paediatric primary ileocaecal resection patients had reported a significantly worse physical-related quality of life. However, mental-related health scores were comparable13.Overall, Dipasquale et al.13 also performed subgroup analysis, dividing the cohort into active disease and remission, and compared scores against the general population. Physical health scores were significantly worse in both active disease and remission against the population, while mental health scores were only significantly worse in patients with active disease; scores were comparable in remissive patients compared to the general population13.Diederen 13.Within patients with active disease, COREFO scores were worse in all domains  compared to a cohort of normal colorectal function. Patients with clinical remission were found to be only significantly worse in social impact domainet al.14 found that patient symptoms such as blood in the stool, abdominal pain and fatigue had significantly improved from 6 months before, 12 months after surgery. Patients also reported having significant improvements in appetite and weight and a better ability to perform activities of daily living14.Dipasquale 14.School absences were reported in almost all patients before surgery, caused by abdominal pain, fatigue and diarrhoea. However, at 1 year following surgery, school absence reduced significantly. Social functioning scores, consisting of a patient\u2019s ability to play, go out, play sport, and travel, significantly improved after surgery14. Dipasquale et al.14 found that emotional functioning results demonstrated a significant reduction of feelings of anger, injustice and embarrassment due to Crohn\u2019s at 12 months and receiving surgery did not affect the patients\u2019 concerns for future health problems (P = 0.202). Diederen et al.13 found that the number of patients who rated their satisfaction following surgery as \u2018very satisfied\u2019 was the greatest at 42/80. A further 23 were \u2018satisfied\u2019, nine were \u2018neutral\u2019, four were \u2018dissatisfied\u2019 and two were \u2018very dissatisfied\u2019. Lower satisfaction was found to be correlated to a higher level of disease activity13. Dipasquale et al.14 also reported that almost all patients were completely satisfied with the surgery outcomes.Both studies found high levels of satisfaction following surgery15\u201317 assessed HRQoL in CD patients receiving different treatments. Gerdin et al.15 and Ponsioen et al.16 conducted RCTs comparing medical treatment versus surgical resection. Gerdin et al.15 investigated HRQoL using the SF-36 and the visual analogue scale (VAS), and Ponsioen et al.16 utilized the inflammatory bowel disease questionnaire (IBDQ) as well as the SF-36.Three studieset al.17 compared HRQoL between CD patients with or without a stoma using a shortened version of the IBDQ (SIBDQ) and the Patient-Reported Outcomes Measurement Information System (PROMIS) as well as patient-reported functional outcomes using the Manitoba IBD Index (MIBDI). They recruited patients from a large online cohort of adult patients with IBD and subcategorized them, using MIBDI results, by disease status (remission or active disease) to avoid any confounding caused by this factor17.Abdalla et al.16 found that the surgical treatment group had significantly worse mean IBDQ scores at 2 weeks; however, these scores subsequently improved and became comparable from 6 weeks. Mean IBDQ scores of the surgical treatment group were higher than the medical treatment group at 6, 9 and 12 months; however, these differences were not significant.Ponsioen 16.Similar trends were observed in the mean combined SF-36 scores. The surgical treatment group had significantly lower scores than the medical treatment group at 2 weeks, but these became comparable at 6 weeks. At 6 and 9 months, the surgical treatment group demonstrated significantly better mean combined SF-36 scores, although this significance was lost at 12 months16.When dividing the SF-36 into its physical and mental component scores, physical component scores in the surgical treatment group were significantly worse at 2 weeks but significantly better at 6, 9 and 12 months compared to the medical treatment group. Mental component scores in the surgical treatment group were worse than the medical treatment group at 2 weeks, 6 weeks and 3 months. At 6, 9 and 12 months, the surgical treatment group demonstrated higher mean mental component scores; however, none of these differences were statistically significantet al.15 found that at 1-year follow up, the surgically treated cohort demonstrated significantly better social function SF-36 scores. This difference, however, was no longer observed at 3 and 5 years. While better general health scores were also found in the surgical treatment group, this difference was not significant. Vitality scores were worse in the surgically treated group, but again, this was not statistically significant. Additionally, VAS scores showed no statistical differences15.Gerdin et al.17 found that the mean SIBDQ scores between patients with or without a stoma for both active disease and remission were not significantly different. For those in clinical remission, in all six domains of the PROMIS tool , differences were found to be insignificant. However, in those with active disease, PROMIS scores in the domains fatigue, pain interference, and social satisfaction were significantly worse in those with a stoma than those without.Abdalla 17, as well as assessing and comparing the HRQoL of CD patients with or without a stoma, Abdalla et al.17 also compared outcomes of sexual interest and satisfaction in those with or without a stoma using PROMIS. Results were stratified by gender and, overall, there were no statistical differences found between those with or without a stoma in all domains for all genders17.In this studyet al.20 investigated the effects of bowel resection on the HRQoL of CD patients following their RCT31 comparing the outcomes of patients receiving a standard care arm versus an active care arm . In order to assess patients\u2019 HRQoL, the researchers used the SF-36 as well as the disease-specific IBDQ. Measures of HRQoL were recorded before surgery, as well as at 6, 12 and 18 months after surgery20.Wright 20.The SF-36 results were divided into a physical component score and a mental component score. Results demonstrated a significant improvement of both the mean physical and mental scores from before to after surgery 20.Mean IBDQ scores also demonstrated similar trends, showing a significant pre- to postoperative improvement in HRQoL throughout the follow-up periodet al.18 assessed the PROMs results of CD patients with perianal disease. They investigated the HRQoL outcomes of patients with perianal fistulas following video-assisted anal fistula treatment (VAAFT) using the Measure Your Medical Outcome Profile 2 (MYMOP2) quality-of-life questionnaire as a primary endpoint at 6 weeks following surgery. These results were compared to the patients\u2019 results 6 weeks before surgery, and they also assessed patients\u2019 attitudes and feelings of regret using the Decisional Regret Scale18.The study by Adegbola 18.Median MYMOP2 scores relating to symptoms of pain and discharge demonstrated significant improvements from 6 weeks before to 6 weeks after surgery18.The results also demonstrated overall positive sentiments towards the procedure, with 81 per cent of patients agreeing or strongly agreeing that they had made the correct decision, as well as 71 per cent of patients agreeing or strongly agreeing that they would undergo the procedure again. Furthermore, 95 per cent of patients disagreed or strongly disagreed that the choice they made did them harm32. Koutroumpakis et al.19 sought to investigate the effects of cholecystectomy on the HRQoL of CD patients using the SIBDQ between patients with (151 patients) or without (683 patients) cholecystectomy.CD patients have been found to be associated with a decreased ability to absorb bile acids due to CD-related tissue dysfunction or bowel resection, leading to a higher incidence of gallstones, and this is linked to increased rates of cholecystectomyet al.19 were able to demonstrate that those who underwent cholecystectomy had a significantly worse quality of life compared to those with CD who did not require cholecystectomy19. The cholecystectomy group was associated with significantly lower mean SIBDQ scores upon univariate analysis and after controlling for potential confounders, such as age, gender, smoking status and BMI. Multivariable analysis demonstrated that patients who had a cholecystectomy were associated with significantly worse SIBDQ scores19.Koutroumpakis 19.Subgroup analysis was performed on patients with ileal CD to assess the impact of cholecystectomy on the development of dysplasia because they would have reduced absorption of bile, leading to increased secretion of bile and thus increased spilling into the colon. Within this subgroup, patients who had undergone cholecystectomy were found to have significantly worse SIBDQ scores with uni- and multivariable analysisThis review demonstrated significant heterogeneity in the PROMs tools utilized to assess patient outcomes following CD surgery. Of the ten tools identified, eight are used to assess HRQoL, with the remaining two being used to assess patient-reported functional outcomes. Clearly, there are a wide variety of tools available to assess HRQoL within perioperative CD patients, and this study was able to identify areas within the studies included in this review where improvements could be made.et al.13 was that patient HRQoL scores were compared to the mean values of the general population of adults aged 26\u201335. A better alternative could have been to compare pre- and postoperative HRQoL if that information had been available, highlighting the need for PROMs-focused prospective studies in CD, which would allow for a clearer representation of the effects of the surgical intervention. The median follow-up time for HRQoL assessment within this cohort was 102.9 months (i.q.r. 46.5\u2013190.0). Due to the extended follow-up period, it may be difficult to draw meaningful conclusions about the direct effects of surgical intervention during childhood on a patient\u2019s HRQoL. While ileocaecal resection during childhood can have lifelong effects, data are lacking regarding subsequent interventions and management steps implemented up until the point of follow-up, which could act as confounding factors. The effects of childhood ileocaecal resection at the time of follow-up on this cohort may be less representative of the effects of the intervention alone.The main limitation found within the study by Diederen 13, patients could have had a significant pre- to postoperative improvement; however, by comparing to a baseline of a general population, these trends would be masked. More frequent/routine recording of PROMs would allow for more representative observations of how the disease progression and various interventions of CD could affect HRQoL over its course.Within this studyet al.14 as, despite being a retrospective analysis, the data were present due to routine records of patient scores within the centre. Through regular close monitoring of PROMs, clinical teams would be able to spot patients that were not coping well and provide further medical, emotional and social support, using the data to potentially signpost patients for further care.This limitation was not present within the study by Dipasquale et al.20 noted the improvement found at 6 months following surgery was maintained at 12 and 18 months. This study was able to demonstrate the sustained improvement in HRQoL following surgical intervention. The conclusion that bowel resection is able to produce a long-term improvement of HRQoL within this trial is significant due to the lack of PROMs data at longer follow-up periods.Wright 20 (which demonstrated an improvement from pre- to postoperative outcomes) to the study by Gerdin et al.15, they were also able to find significantly better outcomes within surgically treated patients when compared to those who were treated with medical therapy at 1- year of follow-up. This benefit, however, was seemingly lost at 3 and 5 years of follow-up.Comparing this study20 highlight the importance of long-term monitoring of patients\u2019 HRQoL through the use of PROMs in CD patients following surgery. CD is a lifelong disease, and the effects of surgery are lifelong too. Routine assessment using PROMs would allow for the analysis of HRQoL outcomes at even longer follow-up periods, allowing researchers to continuously break the ceiling of the definition of the best standard of care, while allowing clinicians and patients to make informed decisions based on long-term empirical data.The two studieset al.16, frequent PROMs assessments were performed, from 2 weeks after baseline up to 12 months of follow-up. Trends of how HRQoL outcomes change over time and differ from medical treatment groups were observed. The study by Gerdin et al.15, which also compares two randomized arms of surgical and medical intervention, was designed so that follow-up would be performed at 1, 3 and 5 years. Although Gerdin et al.15 show significantly better social functioning SF-36 scores for the surgical group, as well as trends to higher general health scores at 1 year, this initial follow-up interval is relatively long. While assessing long-term outcomes is important for such a lifelong disease, it is also important to assess patient outcomes in the short term. The results from Ponsioen et al.16 are able to demonstrate how outcomes may change within that first year after intervention, and that in fact mean IBDQ and SF-36 scores in the surgical treatment group are initially significantly worse, and become comparable over time, becoming significantly better than the medical treatment group at some points. Together, these studies16 are able to demonstrate how regular PROMs data, both short- and long-term, are important in assessing HRQoL in CD patients.Regular PROMs assessments, both short- and long-term, are essential for understanding a patient\u2019s HRQoL. In the study by Ponsioen et al.20 demonstrated consistently lower HRQoL results in women versus men, which is in line with previous literature finding similar results in women with CD34: PCS scores of the SF-36 were found to be significantly lower preoperatively (P = 0.029), at 6 months (P = 0.017) and at 12 months (P < 0.001) following surgery in women compared to men; for the MCS of the SF-36, scores were also significantly lower in women at 6 (P < 0.015) and 12 months (P = 0.006) following surgery; IBDQ scores were also significantly lower in women at 6 (P = 0.007) and 12 months (P = 0.006) after surgery. Women reported a greater impact on body image following surgery for IBD than men, which may negatively impact HRQoL35.Wright et al.17 were unable to find differences stratified by sex in assessments of sexual interest and satisfaction. Despite these results, in other studies stomas have been shown to cause adverse effects on a patient\u2019s sexual function and satisfaction, including self-image, embarrassment, dyspareunia, erectile dysfunction, ejaculation and orgasm. It is important to monitor these adverse effects in order to help provide effective, patient-centred care37. Abdalla et al.17 justify this difference in results as being caused by the indication for surgery, as most patients in these other stoma-related studies receive surgery due to cancer and malignancy as opposed to CD. In patients with malignancy, more radical, extensive resection may be required, leading to worse physiological outcomes as a result of nerve damage17.Abdalla et al.18 is the use of the Decisional Regret Scale. Decisional regret is the measure of the patient\u2019s emotion as a result of feelings that better outcomes could have been achieved from opting for a different intervention or having not received the intervention at all and can be an influential factor within decision-making38. Negative emotions of decisional regret have been previously associated with worse HRQoL, such as having lower levels of satisfaction as well as being linked to depression and thus are an outcome that should be closely monitored in order to help provide further support for those with these risks of poorer HRQoL40.Possibly the most unique outcome of the study by Adegbola 30. In addition to providing further support, it may also allow for the identification of care pathways lacking in patient involvement within the decision-making process, opening that pathway up for improvement, raising the standard of care in order to minimize patient decisional regret, thus improving overall patient HRQoL.Low levels of patient satisfaction and decisional regret are measures that can be targeted with a push for patient-centred care as well as a shared decision-making process between the clinician and patient, allowing for patients to obtain an increased knowledge surrounding the options available, decreasing levels of uncertainty, providing more realistic expectations of the available outcomes, as well as providing feelings of supportet al.19 assessed the outcomes of surgery due to conditions potentially secondary to CD. The authors state how the exploration of this pathological pathway is not well established within research and aimed to explore these patients in further detail19. The study demonstrated the importance of a universal tool within the greater field of colorectal surgery. The study cohort displayed a broad heterogeneity of participants and if a universal tool was to be utilized across colorectal surgery, the HRQoL of patients with co-morbidities requiring multiple surgeries would be able to be assessed throughout their lifetime. A universal tool would enable the comparison of data before and after the development of a secondary condition without having to use a completely separate new tool and having to translate the information in order for a comparison of outcomes.Koutroumpakis 42. Furthermore, the results from patients would be directly uploaded to databases without the need for data input from staff, reducing time and costs, streamlining the entire data collection process42. This would also negate the issue experienced by Dipasquale et al.14 where they were required to modify an existing validated tool in order for its administration via the telephone. The IMPACT III questionnaire, a validated assessment of HRQoL in paediatric IBD patients, is a self-administered tool23. However, to complete the questionnaire via telephone consultation, 20 of the 35 items in the tools were removed. The modified version of the tool has not been validated and may not produce a full, comprehensive picture of the patient\u2019s HRQoL status, hindering the validity of the results of the study. If the PROM had been made available online, the quality of the tool would not have needed to be compromised.With increasing online resources within healthcare due to improvements in technology, catalysed by the coronavirus disease 2019 (COVID-19) pandemic, the advantages of digitally collected PROMs data are becoming more apparent. Patient recruitment and drop-out rates within trials should improve when using digital platforms as less time and effort would be required to recruit patients. They would also be able to access the platform from wherever is convenient, as opposed to being restricted to completing them only when visiting clinics and appointmentsAn online tool with ease of access could lead to a risk of reporting bias, as a result of patients utilizing the tool more frequently when they experience an exacerbation of symptoms. To help reduce this bias, adequate guidance regarding when patients should fill out the tool could prove to be useful. For example, consistent and regular utilization of the tool could be emphasized to patients, and usage patterns could be analysed to identify disproportionate frequency of submissions.41. This digital platform could be expanded from disease-specific to disease-group-specific, not only being used for surgical CD patients but for all IBD patients and even across colorectal surgery, presenting the relevant tools and questionnaires to the specific patient from a single platform .There is no consensus on the best PROM for measuring the HRQoL in patients with CD. The two types of PROMs, generic and disease-specific, targeting different aspects of HRQoL can be complementary if used together. This would produce a holistic view of the patient providing an assessment on how the patient is coping with the specific disease, but also raising red flags for general psychosocial risk. These tools can be collated into a single digital platform and used to gather data from patients with ease, with some suggesting the use of adaptive testing to tailor the relevant questions around the patient using computer algorithmset al.44 is an example of a study utilizing HRQoL as a primary outcome through the use of PROMs to determine quality-adjusted life years within patients undergoing haemorrhoid surgery . Watson et al.44 were able to use the results of the PROMs tools to determine that surgical excision should be considered over stapled haemorrhoidopexy as surgical excision produced significantly better HRQoL outcomes over 24 months post-procedure. Within colorectal surgery, with the impact that CD can have on a patient\u2019s HRQoL, trials should be encouraged to utilize PROMs and patient experience as a primary outcome.The eTHoS trial by Watson 15, making the quality of the data poor. This may also be as a result of this review\u2019s methodology. Searches were limited to only include articles published after 2015. While this might produce data that are within a more consistent timeframe, the absence of older studies could lead to the loss of data as a result.The quality of the systematic review is limited by the types of studies available for analysis. The majority of the articles were of a lower level of scientific evidence, with one of the only three higher-level RCTs that were found being prematurely terminated17. The variation in the PROMs used was also limiting in the fact that comparisons of data between studies could not be easily made. This may be due to a lack of consensus on a single universal tool for providing high-quality, valid data in patients with CD.The tools for measuring HRQoL were also of a limiting nature. Not all of the tools were of the highest quality, with some questionnaires not establishing a minimum clinically important difference for CD, such as PROMISzrad098_Supplementary_DataClick here for additional data file."}
{"text": "Grain boundaries, the two-dimensional defects between differently oriented crystals, tend to preferentially attract solutes for segregation. Solute segregation has a significant effect on the mechanical and transport properties of materials. At the atomic level, however, the interplay of structure and composition of grain boundaries remains elusive, especially with respect to light interstitial solutes like B and C. Here, we use Fe alloyed with B and C to exploit the strong interdependence of interface structure and chemistry via charge-density imaging and atom probe tomography methods. Direct imaging and quantifying of light interstitial solutes at grain boundaries provide insight into decoration tendencies governed by atomic motifs. We find that even a change in the inclination of the grain boundary plane with identical misorientation impacts grain boundary composition and atomic arrangement. Thus, it is the smallest structural hierarchical level, the atomic motifs, that controls the most important chemical properties of the grain boundaries. This insight not only closes a missing link between the structure and chemical composition of such defects but also enables the targeted design and passivation of the chemical state of grain boundaries to free them from their role as entry gates for corrosion, hydrogen embrittlement, or mechanical failure. Interplay between structure and composition of grain boundaries remains elusive, particularly at the atomic level. Here, the authors discover the atomic motifs, which is the smallest structural unit, control the most important chemical properties of grain boundaries. These features qualify GBs as the most important microstructural defects for many high-performance materials.Grain boundaries (GBs) are among the most important features of the microstructure, occupying an area of 500-1000 football fields per cubic meter material with 1 \u03bcm grain size. On the one hand, they render positive effects such as the simultaneous increase in strength and ductility7 and atomic motifs10, yet, it is still elusive which of these really matter for structure-property relations. By atomic motifs we mean here certain geometric polyhedra built by atoms that form repeating structural units to constitute the GBs12, e.g., the kite10, domino and pearl8 structures that were described before to decipher the GB\u2019s elementary \u201cgenetic\u201d structure. This concept of the atomic motif was inspired by the early works of Gaskell14 and Bernal15: they described liquids and amorphous materials as an arrangement of polyhedral structural units and found that only a surprisingly small number of them is needed to construct such complex materials.Two key factors are missing in our knowledge about GBs. The first one is the systematic and meaningful representation of GBs with pertinent and property-oriented parameters: their characterization requires five geometric degrees of freedom and further parameters to describe them down to their atomistic-scale facetsThe second reason is the difficulty in characterizing both the GB structure and its chemical decoration state down to the atomic scale. For a systematic experimental study, we define five levels of hierarchy with respect to the crystallographic, compositional, and electronic features of GBs. The levels are (a) the macroscale interface alignment and grain misorientation (held constant here); (b) the systematic mesoscopic change in the inclination of the GB plane for the same orientation difference; (c) the facets, atomic motifs, and internal nanoscopic defects within the boundary plane; (d) the GB chemistry; and (e) the electronic structure of the atomic motifs. Identifying key properties of GBs across all these scales at systematic variation of these parameters has not yet been realized.16. On a more refined scale, we find that the GB planes do not generally follow this geometrical criterion, but can further decompose into a sequence of piecewise planar facets that are sets of lower total energy reconstruction motifs17. At the atomic level, local GB structures, including the faceting17, as well as many other features such as secondary defects18, ordering21 and phase transformation22, can play crucial roles in the spatial distribution of solute atoms within GB planes. This complex interplay between GB structure and chemistry leads to a deviation from the Langmuir-McLean type of (sub-)monolayer adsorption behavior23, which takes a thermodynamic view at chemical decoration, yet, is structurally agnostic to these fine atomic details. This complexity shows that\u2014in order to gain a fundamental understanding of the coupling behavior between structure and chemical composition\u2014direct experimental observation of all these structure features conducted across all these scales, together with a mapping of the GBs chemical composition is required. This must be done under conditions, where each of these parameters is varied systematically, step-by-step, while the other parameters are kept constant.The hierarchy of the GB structure across these different features is complex: an adequate representation of a GB requires at least to define the misorientation between adjacent grains and the inclination of the GB plane. At a mesoscopic view energy-favored GB planes are normally the most densely packed ones which comprise a high density of coincidence sites, derived from a virtual lattice that extends over both adjacent crystals16) bicrystal, stabilized by approximately 4\u2009at.% Al and alloyed with C and B atoms24. We have selected this material as Fe-C alloys, also referred to as steels, represent about 1.9 billion tons of material produced each year25, by far the most common metal class, with an uncounted number of safety critical and functional applications, ranging from huge infrastructure to tiny magnets. B has been selected as a second alloy element owing to its peculiar, and often highly beneficial effect on GB cohesion and the resulting material properties. At the smallest scale, we are able to reconstruct the charge-density maps from the differential phase contrast \u2013 four dimensional scanning transmission electron microscopy (DPC-4DSTEM) data28 to directly spatially resolve light (low atomic number) interstitial atoms decorating the atomic motifs of GBs. With this multi-scale and multi-physics GB analysis approach we make the surprising observation that it is actually not the macroscopic or mesoscopic geometrical aspects that explain the specific chemical decoration state of an interface as is usually claimed. Instead, features at the smallest length scales, i.e. the atomistic motifs, determine the chemistry of a GB. Analogous to building blocks or Lego bricks, a limited number of atomic motifs with their sequential alignment form complex GB structures with a wide range of microscopic degrees of freedom and varying solubility for accommodating solute atoms.For this study, we have developed a custom-designed workflow along an instrument ensemble which allows to map the structure, chemistry and electronic state of GBs at length scales ranging from macroscopic to atomic. As a model material we have chosen a Bridgeman-produced body-centered cubic (bcc) \u2013 Fe \u03a35  value24. The macro- and mesoscale study of GB structure was carried out by optical, scanning electron microcopy (SEM), and diffraction imaging. During the growth process, the GB plane changed its orientation with respect to the neighboring grains, see the orange dashed line superimposed on the optical image  image Fig.\u00a0 show fac28. As shown in Fig.\u00a017), representing the B or C-containing atomic columns. The charge-density map can also provide an opportunity to study the electronic structure of the GB28. Here we focused on applying the charge-density map to the direct imaging of light atoms at the local atomic motifs of Fe GBs in the electron microscope with sub-\u00c5ngstr\u00f6m-resolution.Using the recently developed DPC-4DSTEM imaging technique, we directly observed the light B and C atomic columns at the local atomic motifs of GBsWe have systematically quantified the GB structures for a series of \u03a35-GBs with different mesoscale inclinations using HAADF-STEM images. The analyses include two symmetric GBs, #41 \u03a35 (310) // (329. For the \u03a35 (11 1 0) // (930 suggests that long-range coherency strains resulting from the misorientation (1.1\u00b0 deviation from the true \u03a35 GB) and inclination can be canceled out by Burgers vectors existing at different junctions of the facetted GB structures. For example, it has been reported by Medlin et al. that an array of (1/5)[310] and (1/5)[120] dislocations can fully accommodate the misorientation and inclination from the true \u03a35 GB17. The dislocations that exist at the junction of the facetted structures play a key role in reducing the coherency strain between the two adjacent regions and stabilizing the GB structure. In the last case of the \u03a35  electrostatic potential, and the charge-density maps, can be found in Supplementary Fig.\u00a024.We have next studied the above mentioned three types of prevalent atomic motifs with regards to the occurrence of the light elements B and C, using the DPC-4DSTEM method33, the \u03a35 (310) //  // (3\u22122. Our APT results show there is less than a monolayer adsorption of B or C atoms at this \u03a35 (310) //  interstitial sites, the segregation energy for interstitial sites approaches zero or even reaches positive values. In these cases, further segregation is energetically unfavorable24.Interestingly, the decoration features with B and C are not strongly correlated but some regions appears to be mutually repulsive, i.e., regions enriched in B can have a low content of C see Fig.\u00a0 and vice33. Wang et al.32 found that more open GB structures, e.g., with local atomic motifs such as (310) //  segregation behavior has been reported not only for symmetrical GBs, such as {013} and {012}, but also for asymmetrical GBs, e.g., 42. The authors attribute the singular segregation behavior of these GBs to the high values of the interplanar spacing41.Additional in-plane quantitative GB chemistry results are summarized Fig.\u00a0. The ave34. Wang et al. indicates that the atomic rearrangement from the extended kite structure to the separated kite structure results in a reduction of GB energy by 0.44 32. In this work, we observed both types of local atomic motifs from the previous DPC-4DSTEM analysis  from the original part of the bicrystal see Fig.\u00a0. The dis37. The wedge extracted by the FIB was mounted on a Si coupon and sharpened at 30\u2009kV into needle-like geometries required for field evaporation, with a subsequent 5\u2009kV cleaning step to remove surface damage implanted with Ga+.We used transmission electron microscopy (TEM) and APT to analyze the GB structure and composition of four selected ROIs, namely #01, #41, #71, and #91. The in-plane lift-out method (electron beam in TEM perpendicular to the common axis [001] of the grains) was used to prepare the TEM lamellae. First, the Cu grid was mounted on the correlative holder and placed horizontally in the FIB chamber for the lift-out process. Then, the chamber was vented for rotating the correlative holder 90\u00b0 to thin the sample. The TEM lamellae were initially thinned to less than 60\u2009nm at an accelerating voltage of 30\u2009kV and then cleanly polished to a thickness of less than 30\u2009nm at an accelerating voltage of 5\u2009kV. The APT tips were fabricated using the conventional FIB lift-out method44  5000 XS operated with a specimen set point of 40\u2009K and a laser pulse energy of 30 pJ at a pulse repetition rate of 200\u2009kHz for a 0.5% atoms per pulse detection rate. The collected data sets were reconstructed using the AP Suite 6.1 software platform , Fe95.38Al4.45B0.07C0.11, Fe95.37Al4.38B0.11C0.14, Fe95.31Al4.42B0.14C0.14, respectively. Here, the peak decomposition algorithm must be applied to quantify the bulk composition because there is significant peak overlapping between Al+ and Fe2+ at 27\u2009Da . The peak decomposition algorithm is only suitable for statistical compositional analyses. It does not provide spatial resolution, e.g., distinguishing compositional differences between two 1\u2009nm3 cubes 1 nm apart. If we want to quantify the one-dimensional (1D) compositional profile across the GB, we need to assign the 27\u2009Da to either Al+ or Fe2+ ions. In the 1D composition profile of the Supplementary Fig.\u00a02+ ion, resulting in a significantly lower Al content than the value obtained from the wet chemical analysis or the peak decomposition analysis. A more detailed investigation of the Al depletion caused by the co-segregation of B and C can be found in our previous publication24. In the present work, we have mainly focused on the segregation behavior of B and C atoms. It is also worth noting that the local B and C contents obtained from APT composition quantification are significantly higher than the results from the global wet chemical analysis, which is due to GB segregation and a high fraction of GB contained in the reconstructed tip volume.The overall compositions for the reconstructed volume of the tips extracted from ROIs #01, #41, #71, and #91 are Fe36 to quantify the in-plane chemical distribution of B and C atoms at the GB, i.e., the composition map and the interfacial excess map  represent a pair of B and C compositions of the nodes in the GB meshes. We obtain these composition values from the in-plane chemical distribution described in the previous paragraph. The third variable The correlation between the local GB compositions of B and C is evaluated using a weighted Pearson product-moment correlation coefficient. A pair of variables  filter to remove background noise. Additional high-resolution HAADF-STEM images of ROIs #01, #41, #71 and #91 are shown in Supplementary Fig.\u00a0All high-resolution HAADF-STEM data were acquired using a Cs probe-corrected FEI Titan Themis 60-300 (Thermo Fisher Scientific) equipped with a high-brightness field emission gun and a gun monochromator operating at 300\u2009kV. Images were recorded with a HAADF detector (Fishione Instruments Model 3000) at a probe current of 68 pA using a semi-convergence angle of 23.6 mrad. The semi-collection angle for high-resolution HAADF-STEM images was set to 103-220 mrad. Image series of at least 20 images were acquired with a dwell time of 2 \u03bcs at a pixel size of 6\u2009pm. To minimize the effects of instrumental instabilities in the images, we used non-rigid registration and averaging of image series to achieve sub-picometer precision measurement of atomic column positions in high-resolution HAADF-STEM images2. The scanning step size was optimized by comparing the reconstructed 4DSTEM data sets with step sizes of 13-36\u2009pm. The selection took into account the possibility of minimizing distortions due to instrument instability and maximizing spatial resolution to resolve light atoms. We calibrated the CBED pattern in reciprocal space using the standard Au nanoparticle. Here, each pixel in the CBED pattern is 2.0 mrad.The atomic 4DSTEM data were also acquired in the Titan microscope at 300\u2009kV. We collected the entire convergent beam electron diffraction (CBED) pattern as a two-dimensional (2D) image for each probe position during scanning. These images were taken using an electron microscope pixel array detector (EMPAD) with a readout speed of 0.86\u2009ms per frame and a linear electron response of 1,000,000:1. Each CBED image has a size of 128 \u00d7 128 47. For Fe, the maximum transferable kinetic energy at 300\u2009kV is 15.25\u2009eV, which is slightly lower than the displacement energy of 16.00\u2009eV47. Theoretically, the radiation damage should not be significant when imaging Fe materials. When acquiring atomic 4DSTEM data sets for imaging light atoms at GBs, a lower dose is preferred.Irradiation of materials with accelerated electrons can initiate ballistic knock-on processes that lead to displacement of atoms from the crystal lattice and produce point defects, e.g., a Frenkel pair consisting of an interstitial and a vacancy55We quantified the dose with the Gatan camera for energy-filtered TEM (EFTEM) by varying the beam via defocusing a monochromator. The measured dose has been shown as a function of the defocus of the monochromator  dark-field image, the electric field map, the (projected) electrostatic potential map, and charge-density map27 49. The script is forked from the py4DSTEM package50. We used py4DSTEM to reconstruct the dark-field image and to calculate center of mass (c.m.) of the transmitted beam for each probe position. Our pyDPC4D script mainly focused on the quantitative reconstruction of the electric field map, the (projected) electrostatic potential map, and the charge-density map. The details of the reconstruction are as follows.The originally collected atomic 4DSTEM data contains the 2D grid of the probe position in real space and the 2D diffraction pattern for each probe position in reciprocal spaceThe dark-field images are reconstructed from 4DSTEM data sets by integrating the intensity of the annular region of 99-122 mrad in the CEBD pattern of each probe position. Supplementary Fig.\u00a054. This method can resolve the structure of weakly interacting phase objects. For example, when an electron probe passes through an electric field, the electron is deflected due to its negative charge. By quantifying the shifts of the transmitted electron probe in the diffraction plane  to the CEBD pattern to calculate the c.m. The purpose of applying a mask is twofold. First, it can eliminate intensity from the high-angle scattering that is less sensitive to the momentum transfer than that from the low-angle scattering. Second, it can also reduce the noise from c.m. calculation. Supplementary Fig.\u00a0 mrad to 50. Supplementary Fig.\u00a0We calculated the (projected) electrostatic potential  // (010), (310) // (357. We took the (310) //  package58. Here we have examined some experimental CEBD patterns and compared them with the simulated CEBD patterns. Supplementary Fig.\u00a0CBED was acquired to determine the thickness of the TEM sample, because the thickness of the TEM sample has been shown to have a strong effect on the CEBD patternWe performed three series of simulations to understand the origin of the contrast appearing in the charge-density map. The benchmark simulation  // (3In the last series, we investigated the influence of atom occupancy on the contrast of the charge-density maps (see Supplementary Fig.\u00a0Supplementary informationPeer Review File"}
{"text": "In multiple logistic regression, a dose\u2013response association from Stage I to Stage III periodontitis for cIMT\u2009\u2265\u20090.8\u00a0mm was also found . Leucocyte counts\u2009\u2265\u20097.6\u2009\u00d7\u2009103/\u00b5L (the highest quintile) was associated with cIMT\u2009\u2265\u20090.8\u00a0mm [OR 1.86 (1.11\u20133.12)], while no association existed for other metabolic risk factors. In conclusion, severe periodontitis and leukocyte counts are independent risk factors of increased cIMT, emphasizing the critical role of inflammation in subclinical atherosclerosis.This study aimed to investigate the association of periodontitis with subclinical atherosclerosis in young adults. In total, 486 non-diabetic military personnel were included in Taiwan. Carotid intima-media thickness (cIMT) was assessed utilizing sonography for subclinical atherosclerosis. Periodontitis severity was defined based on the 2017 US/European consensus. Mean cIMT was compared by analysis of covariance (ANCOVA), and multiple logistic regression model was used to determine the association of periodontitis severity and the highest quintile of cIMT (\u2265\u20090.8\u00a0mm) with adjustments for age, sex, metabolic risk factors and leukocyte counts. The mean cIMT increased in those with greater stages : 0.65\u00a0mm, Stage I (N\u2009=\u200941): 0.72\u00a0mm, Stage II (N\u2009=\u200957): 0.74\u00a0mm and Stage III: 0.76\u00a0mm, respectively,  Periodontitis is associated with disproportionate host inflammatory immune responses that are induced by an imbalance in the microbial ecological environment in oral cavity; this instigates microbial dysbiosis, along with failed resolution of the chronic destructive inflammation2. The European Federation of Periodontology (EFP) and the American Academy of Periodontology (AAP) joint workshop in 2012 suggests a possible link between atherosclerotic disease and periodontitis3. Two mechanisms are proposed to explain such association. First, the subgingival microbiota and their products may directly access to the circulation and provide a persistent gram-negative bacterial challenge to the host4. Low level bacteremia may initiate host responses that alter coagulability, endothelial and vessel wall integrity, and platelet function, thereby resulting in subsequent atherogenic changes and thromboembolic event in patients with periodontitis7. Second, periodontitis can indirectly alter systemic homeostasis through the release of endotoxins as well as inflammatory cytokines, and lead to endothelial dysfunction8. In addition, in epidemiology, both atherosclerosis and periodontitis may be modified by similar risk factors, e.g., age, elements of tobacco and metabolic disorders10. However, the findings for the association between periodontitis and atherosclerosis markers, i.e., carotid intima-media thickness (cIMT) were inconsistent among middle- and old-aged individuals in previous reports12. The conflicting results might be due in part to many risk factors prevalently presented in the process of atherosclerosis and periodontitis development in older individuals, and the association might be over-adjusted if these risk factors were all included as confounders. It is critical to carry out a study in a population with low vascular risk factors exposure, e.g., military subjects who are healthier and have better physical activity than the general population, and are unlikely to have atherosclerosis, to verify the association. Therefore, this study aimed to investigate the association between periodontitis severity and cIMT, a marker of subclinical atherosclerosis, in a population of military young adults in Taiwan.Atherosclerosis, the main process in atherosclerotic cardiovascular diseases, is a focal thickening of the arterial intima residing between the endothelial lining and smooth muscle layers of arterial blood vessels in response to an immune response16. Participants who underwent both an oral examination and a carotid ultrasonography were included. Participants whose age older than 40\u00a0years and total leukocyte counts greater than 11.0\u2009\u00d7\u2009103/\u00b5L were excluded to avoid a presence of unrecognized infectious diseases in the body. The study protocol was approved by the Ethics Committee of the Mennonite Christian Hospital (No. 16-05-008) in the Hualien City of Taiwan and the study was conducted in accordance with the Helsinki Declaration of 1975, as revised in 2013. Participants were informed the nature of the study, and all gave written informed consent to provide the ability to opt out without consequence.This study was a cross-sectional study including participants without taking any antihypertensive medications from the cardiorespiratory fitness and health in eastern armed forces (CHIEF) atherosclerosis study in Hualien City, Taiwan in 2018\u20132020, which has been described in detail previously17. Blood samples were collected in the morning after an overnight fast for total cholesterol, low density lipoprotein (LDL-C), high density lipoprotein (HDL-C), triglycerides, fasting glucose (FPG), serum uric acid and leucocyte counts. Dyslipidemia was defined as total cholesterol\u2009\u2265\u2009200\u00a0mg/dL, LDL-C\u2009>\u2009100\u00a0mg/dL, or triglycerides\u2009\u2265\u2009150\u00a0mg/dL in both men and women. HDL-C\u2009<\u200940\u00a0mg/dL in men and HDL-C\u2009<\u200950\u00a0mg/dL in women were also defined as dyslipidemia17. Hyperuricemia was defined as serum uric acid\u2009\u2265\u20097.0\u00a0mg/dL in men and\u2009\u2265\u20096.0\u00a0mg/dL in women18. Systemic inflammation was defined as elevated leucocyte counts\u2009\u2265\u20097.6 103/\u00b5L19. Measurement of systolic blood pressure (SBP)/diastolic blood pressure (DBP) at rest over right upper arm was performed once, using an automatic device . Hypertension was diagnosed as SBP\u2009\u2265\u2009130\u00a0mmHg and/or DBP\u2009\u2265\u200985 mmHg17. Before the physical examination, participants were asked about their alcohol consumption and tobacco smoking status (active versus former/never)21, and daily tooth brushing frequency.Waist circumference, body height and body weight were assessed in a standing position. The body mass index (BMI) was defined as body weight in kilograms divided by square of body height in meters. Abdominal obesity was defined as waist circumference\u2009\u2265\u200990\u00a0cm for men and\u2009\u2265\u200980\u00a0cm for women22. Since the study was aimed at physically fit young adults, the extent of periodontitis was merely restricted to the localized (<\u200930% of teeth involved)22. Stage I periodontitis was defined if either one criterion was fulfilled: (1) interdental clinical attachment loss (CAL) of 1\u20132\u00a0mm at side of greatest loss; (2) radiographic bone loss\u2009<\u200915%; (3) no tooth loss due to periodontitis; (4) maximum probing pocket depth (PD)\u2009\u2264\u20094\u00a0mm, or mostly horizontal bone loss. Stage II periodontitis was defined when either one criterion was fulfilled: (1) interdental CAL of 3\u20134\u00a0mm at side of greatest loss; (2) radiographic bone loss of 15\u201333%; (3) no tooth loss due to periodontitis; (4) maximum PD\u2009\u2264\u20095\u00a0mm, or mostly horizontal bone loss. Stage III periodontitis was defined if either one criterion was met: (1) interdental CAL\u2009\u2265\u20095\u00a0mm at side of greatest loss; (2) radiographic bone loss extending to mid-third of root and beyond; (3) with tooth loss because of periodontitis; (4) in addition to Stage II periodontitis severity further with PD\u2009\u2265\u20096\u00a0mm, or vertical bone loss\u2009\u2265\u20093\u00a0mm, or class II/III furcation involvement, or moderate ridge defect. No cases of Stage IV periodontitis were observed in this study. Full mouth oral examination and radiograph of each participant were performed by the same dentist. All subjects returned to the outpatient department for a re-evaluation and a treatment for the oral pathologies within one month. The inter-observer agreement (kappa coefficient) for verifying the severity of periodontitis was estimated 90.6%26.The 2017 AAP/EFP joint workshop on the classification of periodontal diseases were used for the definition of periodontitis stagesp robe of 4\u20138\u00a0MHz on the iE33 machine . Intima\u2013media interface diameter of each participant was manually traced as a continuous line for a calculation13. To verify the cIMT, the measurement procedure was performed repeatedly by the technician, and the coefficient of variation was up to 96.8%14. In whole of the carotid sonographic examinations, no carotid plagues were found. The increased cIMT was defined as those over the highest quintile level, corresponding to the diameter\u2009\u2265\u20090.8\u00a0mm, which was modestly greater than the upper normal cIMT level (0.75\u00a0mm) in the general population in prior studies27.All ultrasonographic images were acquired at end diastole (defined as the R wave of an electrocardiogram) by the same certificated technician and verified by a cardiologist. The cIMT diameter was quantitatively measured between the leading edges of the media\u2013adventitia interface and the lumen\u2013intima interface over the far wall of the left carotid bulb, using an ultrasound scanner equipped with a linear p\u2009<\u20090.05 was considered to be statistically significance.Periodontitis severity was classified as health, Stage I, Stage II and Stage III. Group differences among the four groups were evaluated using the analysis of variance (ANOVA) for continuous variables and chi-square test for categorical variables. Analysis of covariance (ANCOVA) with adjustments for age, sex, BMI, SBP, DBP, tooth brushing frequency, alcohol intake and tobacco smoking was used to examine if a difference in the mean of cIMT existed among the four groups. We utilized univariate and stepwise multiple linear regression models to assess the association of periodontitis severity with cIMT. In model 1, age, sex, SBP, DBP, waist circumference, lipid profiles, FPG, serum uric acid, tooth brushing frequency, alcohol intake and smoking status and leukocyte counts were adjusted. In model 2, BMI was further adjusted. Univariate and multiple logistic regression models were also utilized to estimate the odds ratios (ORs) and 95% confidence intervals (CIs) of periodontitis severity for increased cIMT\u2009\u2265\u20090.8\u00a0mm. In Model 1, age, sex, teeth brush frequency, alcohol intake, tobacco smoking, metabolic syndrome risk factors, e.g., dyslipidemia and hypertension, and elevated leukocyte counts within normal limits were adjusted. In model 2, BMI was additionally adjusted. In addition, participants were divided into four groups, based on the presence(\u2009+) or absence(\u2212) of elevated leukocyte counts and severer periodontitis (Stage II or Stage III) to investigate the moderation effect of elevated leukocyte counts in the association between severer periodontitis and increased cIMT\u2009\u2265\u20090.8\u00a0mm in the univariate and multiple logistic regression models. Since the sample of the male participants in this study were much more than the female participants, sensitivity analyses were performed for men only with regard to their clinical characteristics and the association of periodontitis severity with increased cIMT\u2009\u2265\u20090.8\u00a0mm. The statistical analysis was carried out using SPSS software , and a value of 3/\u00b5L (N\u2009=\u200910) were excluded, leaving a sample of 486 subjects for analysis . The clinical characteristics of the men are shown in supplemental Table Of those who underwent a carotid ultrasonography for cIMT measurement N\u2009=\u20091,822), participants who received an oral examination were included (N\u2009=\u2009501). Those who were older than 40\u00a0years of age (N\u2009=\u20095) and those with total leucocyte counts\u2009>\u200911.0\u2009\u00d7\u200910,822, parp-values\u2009<\u20090.01, respectively). Of the metabolic variables, only total cholesterol and LDL-C were associated with cIMT levels  and \u2212\u00a00.001 , respectively, both p-values\u2009<\u20090.05), while there were no associations for waist circumference, SBP and DBP. The main results were not changed in Model 2.The results of the univariate and multiple linear regression analyses for the association of periodontitis severity with cIMT were revealed in Table p-value for trend\u2009=\u20090.001]. Of the other risk factors, systemic inflammation reflected by total leucocyte counts\u2009\u2265\u20097.6 103/\u00b5L was the only risk factor associated with cIMT\u2009\u2265\u20090.8\u00a0mm [OR 1.86 ]. Notably, there were no associations for the metabolic syndrome risk factors, e.g., abdominal obesity and hypertension. The main results were not changed in Model 2. With regard to the sensitivity analysis for men only (supplemental Table The results of the univariate and multiple logistic regression analyses models of periodontitis severity, systemic inflammation and metabolic syndrome risk factors for increased cIMT are revealed in Table The moderation effects of systemic inflammation on the association of severer periodontitis for increased cIMT are shown in Table The principal findings of this study were that among young adults who have a low vascular risk burden, periodontitis severity was positively associated with cIMT levels. In addition, there was a dose\u2013response association for clinically increased cIMT with greater periodontitis stages. Systemic inflammation rather than metabolic risk factors and blood pressure was found to be associated with clinically increased cIMT, and systemic inflammation might be a moderator between periodontitis and subclinical atherosclerosis during young ages.28, indicating that age was a moderator for the association between periodontitis and atherosclerotic cardiovascular diseases. In addition, the severity of periodontitis may increase risk of atherosclerosis in some animal studies30. With regard to cIMT, Cairo et al. also revealed that severe periodontitis was associated with cIMT\u2009\u2265\u20090.82\u00a0mm in young healthy adults, which was in line with the present study finding31. On the contrary, L\u00f3pez-Jornet et al. revealed that periodontitis was associated with carotid atheroma plaques while not cIMT in middle- or old-aged individuals11. Range et al. also found periodontal pathogens and neutrophil activation within atherosclerotic carotid plaques, supporting a link between severe periodontitis and carotid atheroma plaques formation in older individuals32. This study was the first report using physically fit young adults to maximally reduce the effect of age and clarify the association between periodontitis and cIMT.Epidemiological evidence suggested that periodontitis may be associated with a greater risk of incident cardiovascular diseases in adults, and the association was found stronger in younger adults than in older ones3. In previous studies, various mechanisms linking periodontal disease to cardiovascular disease, e.g., increased cytokines due to inflammation, bloodstream infection, dental plaque accumulation and alveolar bone loss have been proposed in middle- and old- aged individuals37. In this study, the mechanisms for the association between periodontitis and subclinical atherosclerosis among young adults were mainly reasoned by systemic inflammation assessed by elevated total leukocyte counts. In patients with periodontitis, cytotoxic neutrophil proteases and histones are responsible to ulcer formations and discontinuity on the sulcular epithelium33. Daily oral hygiene practices, e.g., tooth brushing and flossing might access the pathogens and its lipopolysaccharide from periodontal pocket to the peripheral blood via the sulcular epithelium, which foster bacteremia and endoxemia34. In addition, chronic infection status, e.g., low-grade endoxemia and inflammatory cascade, in which the circulating cytokines bind to the signaling receptors and ligands to generate an inflammatory circle35.Periodontitis was considered as a promoter of many systemic diseases, but the signaling pathways for the interconnection remain elusive38. In addition, a large body of evidence from epidemiologic studies also supported an association between metabolic disorders and atherosclerosis9. Periodontitis contributes to the progress of atherosclerosis, through the subgingival biofilm, either directly modifying lipid structure by bacteria or indirectly stimulation of inflammatory pathways to affect lipid synthesis and atheroma development34. Ylo\u00a8stalo et al. reported an association between periodontal infection and cIMT in middle-aged adults with a low HDL-C level39. Metabolic disorders, however, the present study did not show any association with cIMT, possibly because of merely young fit adults included. Age might play a crucial role in this relevance. Atherosclerosis is a process involving inflammation and lipids interaction that is required decades of time to develop clinically significant diseases. In contrast, this study showed periodontitis and inflammatory markers were independent risk factors of clinically greater cIMT, indicating inflammation status is critical for the development of atherosclerosis in young adults.Metabolic disorders were common non-communicable diseases and previous studies have shown a bidirectional adverse association with periodontitis40 which is highly related to age of military personnel. In this regard, the effects of oral health behaviors on the association between periodontitis and cIMT in military require further investigation.Although oral hygiene was emphasized and obliged in military in Taiwan that all our study participants were found at least once daily tooth brush, some oral unhealth behaviors, e.g., smoking and alcohol intake were prevalent and might increase the risk of periodontitis. In addition, the oral hygiene status in military was found to be associated with rankSome limitations should be considered while interpreting the study findings. First, evidence of the causality of periodontitis for atherosclerosis could not be obtained for the cross-sectional design. Besides, although leucocyte count was a reliable biomarker of inflammation, other inflammatory mediators such as C-reactive protein and interleukin-6 were not available in this study. Moreover, the findings in the military cohort in the present study might not be applicable to the general population of young adults. Finally, more than 90% of the study subjects were men, and thus whether the results were reliable for women may require further study. However, several advantages were present in this study. First, military subjects were characterized by highly homogeneity with unified life style and no regional differences related to access to the dental care, which could reduce unmeasured confounders. Second, there were no participants with diabetes, which has been recognized as an important risk factor for both periodontitis and atherosclerosis.This study suggests that periodontitis and increased leukocyte counts within normal limits are independent risk factors of clinically increased cIMT, whereas no associations were present between other metabolic risk factors and clinically increased cIMT in young adults, highlighting the critical role of inflammation status in subclinical atherosclerosis. In clinical practice, an oral examination for the presence of severer periodontitis incorporating a blood test for the presence of increased leukocyte counts within normal limits could be treated as the signs of increased cIMT in young adults which an early prevention of cardiovascular diseases could be taken by physicians. Future study should be aimed to lower the inflammatory status, i.e., periodontitis therapy, in young adults to prevent the following clinical atherosclerotic cardiovascular diseases development.Supplementary Information."}
{"text": "Photoautotrophs\u2019 environmental responses have been extensively studied at the organism and ecosystem level. However, less is known about their photosynthesis at the single-cell level. This information is needed to understand photosynthetic acclimation processes, as light changes as it penetrates cells, layers of cells, or organs. Furthermore, cells within the same tissue may behave differently, being at different developmental/physiological stages. Here, we describe an approach for single-cell and subcellular photophysiology based on the customization of confocal microscopy to assess chlorophyll fluorescence quenching by the saturation pulse method. We exploit this setup to (1) reassess the specialization of photosynthetic activities in developing tissues of non-vascular plants; (2) identify a specific subpopulation of phytoplankton cells in marine photosymbiosis, which consolidate energetic connections with their hosts; and (3) examine the link between light penetration and photoprotection responses inside the different tissues that constitute a plant leaf anatomy.  \u2022Real-time assessment of chlorophyll fluorescence at confocal microscopy resolution\u2022Study of photosynthesis at single-cell resolution within a living tissue/organism\u2022Relationship between photosynthetic features and cell type or morphology\u2022Mathematical modeling of photosynthesis in a cell volume 3D space Visualizing photosynthetic responses in 3D is essential for understanding most acclimation processes, as light changes within photosynthetic tissues as it penetrates the absorbing/diffusing layers of the cells. To achieve this goal, we developed an imaging workflow merging confocal microscopy and saturating pulse chlorophyll fluorescence detection. This method applies to samples characterized by increasing complexity, and its simplicity will contribute to its widespread use in plant and microalgae photoacclimation studies. Storti et\u00a0al. develop a method to study photosynthesis at single-cell resolution using confocal microscopy. They use this approach to examine photosynthesis specialization in different tissues and organisms and to understand the relationship between light penetration and photoprotection. The efficiency and regulation of this process is usually assessed in\u00a0vivo by measuring chlorophyll (Chl) fluorescence,,,,,,,2 assimilation capacity,Photosynthesis is a major bioenergetic process in the biosphere. It feeds most of the food chains on Earth and is responsible for substantial sequestration of CO\u22122 s\u22121) to saturate PSII and thus achieve maximum Chl fluorescence emission, Fm.,To develop a 3D saturating pulse confocal /Fm, decreased when the laser intensity increased. The Y decrease reflects the actinic effect of blue laser itself, which increases the F\u2032 parameter. However, the lack of fluorescence quenching during exposure to multiple (four) laser pulses before the saturating pulse  of the moss ng pulse B demonstulse \u22122, A and 2B,ulse \u22122, F. On theulse \u22122, B.Figure\u00a02 assimilation and photoprotective responses: at the beginning of illumination, when CO2 assimilation is largely inactive, part of the absorbed light is dissipated. Conversely, most of the absorbed photons are drained to CO2 assimilation in steady state  and thus NPQ disappears.The 3D-Pulse fluorimeter was fast enough to measure the kinetics of NPQ onset (when the actinic light was switched on) and its relaxation in the dark . We coulP.\u00a0patens protonema exposed for 6\u00a0min to 500\u00a0\u03bcmol photons m\u22122 s\u22121. Time series that acquired with 1\u00a0min delay are reproduced at 1 frame per second (fps). The sum of raw fluorescence values for the different stacks is represented in an artificial color scale bar on the top.Four time-course Z-projections (15\u201320 slices) of P.\u00a0patens lhcsr1-2 KO protonema exposed for 6\u00a0min to 500\u00a0\u03bcmol photons m\u22122 s\u22121. Time series that acquired with 1\u00a0min delay are reproduced at 1 frame per second (fps). The sum of raw fluorescence values for the different stacks is represented in an artificial color scale bar on the top.Four time-course Z-projections (15\u201320 slices) of P.\u00a0patens: the caulonema and the chloronema. The former has longitudinally elongated cells involved in propagation and nutrient acquisition, the latter has chloroplast-rich cells, usually considered as the photosynthetic part of the moss protonema  were separated based on their NPQ capacity, while the two cell types  could be differentiated because of their plastid cell density. A more refined analysis  revealed subtle heterogeneity in NPQ responses in both caulonema and chloronema, which we could interpret based on 3D imaging. We identified heterogeneous NPQ responses at the cell level  and chlorophyll fluorescence (red) images acquired with an upright Leica DM6 B  optical microscope. Image size\u00a0= 342.58\u00a0\u00d7\u00a0256.89\u00a0\u03bcm. Time series acquired with a delay of 30\u00a0s between different images and reproduced at 2 frames per second.,,,,Phaeocystis cordata, ,We further investigated the ability of the 3D-Pulse fluorimeter to\u00a0link NPQ responses to different physiological states focusing\u00a0on photosymbiosis, a common lifestyle in oceanic plankton between symbiotic microalgae and unicellular eukaryotic hosts.Phaodactylum tricornutumChlamydomonas reinhardtiiRelating plastid volume heterogeneity to single-cell NPQ responses revealed the existence of two symbiont populations: small algae (open symbols) exhibited lower NPQ C and phoPhaeocystis plastids separately because these organelles are around 10 times smaller than the ones found, e.g., in plants and P.\u00a0patens.,We investigated their NPQ features at the subcellular level. However, it was difficult to track single Plantago lanceolata), we recorded similar NPQ responses on the adaxial and abaxial sides , which harbor an asymmetric mesophyll organization  disentangling heterogeneous cellular responses within a tissue , (2) traHowever, there is a main difficulty associated with this approach. The choice of the laser light intensity is essential to ensure correct measurements of the photosynthetic parameters. In our case, the maximum photosynthetic capacity (the \u201cY\u201d parameter in dtolleter@gmail.com).Further information and requests for resources and reagents should be direct to and will be fullfilled by the lead contact, Dimitri Tolleter (This study did not generate new unique reagents.Physcomitrium patens Gransden wild-type (WT) strain and lhcsr1-lhcsr2 KO (lhcsr1-2)3)2, 1\u00a0mM MgSO4, 50\u00a0\u03bcM FeSO4, 200\u00a0\u03bcM KH2PO4 pH 7, traces elements)2 s\u22121 continuous illumination. 10-days-old moss protonema was employed for confocal microscopy measurement.Non treated seeds of Flaveria robusta, Flaveria bidentis and Plantago lanceolata has been sown on soil  and grown 3\u20134\u00a0weeks in controlled growth chambers in long day conditions (16\u00a0h light/8\u00a0h dark) at a PPF of 100\u00a0\u03bcmol photons m\u22122 s\u22121. Air temperature was 22\u00b0C during the day and 21.0 \u00b0C at night. Relative humidity was constant at 70% during the day and night. Young fully developed leaves were chosen for the experiments.Phaeocystis cordata) were gently collected by towing a plankton net of 150\u00a0\u03bcm in mesh size with a large cod-end (1 L) for 1\u20132\u00a0min in surface waters . After collection, individual cells were isolated under a binocular with a micropipette.2 s\u22121 controlled illumination. Samples were imaged within 24\u00a0h from sampling time. Cultures of the haptophyte P.\u00a0cordata  of P.\u00a0patens protonema was endorsed on a 20\u00a0\u00d7\u00a020\u00a0mm coverslip and soaked in 100\u00a0\u03bcL of water in order to spread the filaments. The coverslip was fixed to the microscopy slide by using a double-side tape of 0.15\u00a0mm thickness and finally sealed using VALAP  to prevent water evaporation.P.\u00a0cordata and Acantharians were settled on a microscopy glass bottom dish  directly on the microscopy plate to avoid media perturbation.F.\u00a0robusta, F.\u00a0bidentis and P.\u00a0lanceolata. 5\u00a0\u00d7\u00a03\u00a0mm sections  were excised using a scalpel. Sections were enclosed between two 20\u00a0\u00d7\u00a020\u00a0mm coverslips allowing to observe both sides of the leaves. A double layer of tape was used to create an enclosure to lodge the leaf section and prevent its crushing. Water was provided to the sample to prevent dehydration during NPQ measurements.All samples were dark adapted for at least 20\u00a0min before introduction in the setup.\u22122 s\u22121) is determined by a 3-position switch located on the front face of the control box. Electronic diagrams of the control box are shown \u22122 s\u22121, duration 1.1 s) to measure of Fm and Fm\u2019. Alternatively, saturating pulses can be switched on manually through a button located on the control box. Refer to The Zeiss LSM 900 microscope was equipped with continuous light and pulses of strong actinic light, provided by a LED module located in front of the biological sample. The module contains 4 red LEDs , equipped with a lens to reduce their divergence. The 4 LEDs were oriented at 42\u00b0, to focus their light onto the middle of the sample holding slits. The LEDs deliver actinic light, the intensity of which (100 and 200 and 500\u00a0\u03bcmols photons m\u22122. s\u22121 in white light) to minimize any potential irreversible impact on photosynthesis. Similarly, the determination of z-stacks boundaries was performed at an extremely low intensity level (30 times lower than the one utilized during the experiment) to ensure the integrity of the experiment and prevent undesired effects. The initial z position was set as the first slide where the fluorescence of chloroplasts, derived from chlorophyll fluorescence, could be clearly distinguished from the background. The initial z position was set as the first slide where the fluorescence of chloroplasts, derived from chlorophyll fluorescence, could be clearly distinguished from the background.,Images were acquired with a 20x/0.8 M27 objective (Zeiss) in confocal mode setting with Airyscan 2 detector. This setup has been chosen for fast acquisition without loss of sensitivity, thanks to the use of a collimation optic. Excitation was provided by a blue laser (488\u00a0nm) and Chl fluorescence was collected between 650 and 700\u00a0nm. Searching for the object under the microscope was conducted under low light intensity conditions (5\u00a0\u03bcmol photons. mTo estimate maximum photosynthetic capacity (Y), a series of 10 consecutive images was acquired . A saturating pulse was provided by the external LED source after the fourth acquisition A.\u22122) at which PSII fluorescence reached Fm to avoid excess excitation. The delay for two consecutive acquisitions was set to 1\u00a0min to prevent photoinhibion due to laser exposure. 3 points were acquired for dark adapted samples, 6 during exposure to actinic red light (LED module) and 6 points again in the dark to follow NPQ relaxation  were selected to include entire cells and maintain plastids in the acquisition field. The blue laser intensity was set at the minimum value  were scanned for every cells to assess reproducibility.To calculate the fluorescence of each object in a confocal image, images were segmented to obtain the location of a given ROI). Data were used to calculate the sum of the voxel values of a given ROI, and therefore the mean fluorescence value of a given plastid or cell. In the case of We performed PCA considering six observed variables: NPQav, NPQmax, Decay, Induction, Fmax and Area Fraction. The variables used here were calculated in automatized way from NPQ data. NPQav is the mean NPQ when a cell is exposed to light while NPQmax is the maximum of NPQ reached during the light exposition. Decay and Induction are the relaxation and induction rate of NPQ evaluated from the slope of NPQ changes during the first 2\u00a0min of the light to dark and the dark to light transitions, respectively. Area Fraction is the area percentage occupied by the chloroplast inside a cell. Fmax is the \u201cMean gray value\u201d of fluorescence of a given cell chloroplasts for dark adapted samples (Fm).P.\u00a0patens chloronema and caulonema in the WT or the lhcsr1-2 KO strains. The type of cells (mutant/WT or chloronema/caulonema) did not play a role in the determination of the component and that they are used after to characterise the possible biological role of the components. All data are normalized by subtraction of the mean and division by the standard deviation so that the singular values decomposition is done on the correlation matrix of the data (Variables were measured in 175 cells from the data .http://www.R-project.org). The table of the original observed variables used to construct the six components  giving the largest possible variance of the distribution was selected as the direction for the first principal component. Then, we selected the direction orthogonal to the previous one(s) giving the largest possible variance of the distribution as the direction for the second principal component. By repeating this procedure automatically, we identify vectors representing the scatter of the distribution from major ones to minor ones . Based omponents  provides"}