{"text": "Accurate assessment of suicidality is of major importance in both clinical and research settings. The Scale for Suicidal Ideation (SSI) is a well-established clinician-rating scale but its suitability to adolescents has not been studied. The aim of this study was to evaluate the reliability and validity, and to test an appropriate cutoff threshold for the SSI in a depressed adolescent outpatient population and controls.218 adolescent psychiatric outpatient clinic patients suffering from depressive disorders and 200 age- and sex-matched school-attending controls were evaluated by the SSI for presence and severity of suicidal ideation. Internal consistency, discriminative-, concurrent-, and construct validity as well as the screening properties of the SSI were evaluated.Cronbach's \u03b1 for the whole SSI was 0.95. The SSI total score differentiated patients and controls, and increased statistically significantly in classes with increasing severity of suicidality derived from the suicidality items of the K-SADS-PL diagnostic interview. Varimax-rotated principal component analysis of the SSI items yielded three theoretically coherent factors suggesting construct validity. Area under the receiver operating characteristic (ROC) curve was 0.84 for the whole sample and 0.80 for the patient sample. The optimal cutoff threshold for the SSI total score was 3/4 yielding sensitivity of 75% and specificity of 88.9% in this population.SSI appears to be a reliable and a valid measure of suicidal ideation for depressed adolescents. Accurate assessment of suicidality is of major importance in both clinical and research settings. Adolescent suicide occurs usually in the context of an active, often treatable, but unrecognized or untreated mental illness -3. The iSuicide attempts are complex acts for which no single set of clinical features can be expected to be a good predictor . SuicidaThe Scale for Suicidal Ideation (SSI)  was desiThe psychometric properties of the SSI have been evaluated in adult population and in inpatient children. Both in a sample of adult psychiatric inpatients and in a sample of inpatient children the internal consistency of the scale was good ,13. SSI The predictive validity of the SSI has been studied in a sample of hospitalised patients, where the SSI scores of those who committed suicide were not significantly higher than the scores of inpatients that did not . In a saSome instruments have evolved from the SSI, for example the Modified scale for suicidal ideation (MSSI)  that wasThe SSI has been used widely in adult psychiatric populations e.g. ,21], but, but21]]The study population consisted of two samples; a psychiatric outpatient sample of 218, and an age- and sex-matched control sample of 200 school-attending adolescents. The outpatients suffered from depressive mood disorder, were of ages 13 through 19, and took part in the Adolescent Depression Study (ADS). They were recruited between 1.2.1998 and 31.12.2001 from a consecutive sample of patients attending the outpatient clinics of the Department of Adolescent Psychiatry of Peijas Medical Health Care District covering approximately 210,000 inhabitants and comprising the cities of Vantaa and Kerava in the Helsinki metropolitan area, southern Finland.Of the eligible  660 outpatients, 624 (94.5%) were screened during their first consultation visit by the Beck Depression Inventory (BDI)  and the The control sample was drawn from the enrollment lists in four schools in the corresponding geographical area. It was a random sample of age- and sex-matched students equating the distribution of the educational level of the outpatients.1) The Scale for Suicide Ideation (SSI) is a clinician-rating scale and is presented in a semi-structured interview format . It cons2) The Schedule for Affective Disorders and Schizophrenia for School-Aged Children-Present and Lifetime (K-SADS-PL)  is a widThe K-SADS-PL is considered internationally reliable and valid diagnostic instrument for adolescent population . It has 3) Clinical suicidality assessment (CSA): A three-point mutually exclusive grouping of suicidality  is a simplified version of the 5-item \"Spectrum of Suicidal Behavior Scale\" . It has After a description of the study, a written informed consent was obtained from the subjects. For subjects less than 18 years consent was also asked from the parents or other legal guardians. For the community sample the K-SADS-PL and the SSI were performed at the same day by an expert clinician. For the outpatient sample the K-SADS-PL was performed within variable time from the SSI rating. The CSA was performed for the patient sample by clinicians during the beginning of the treatment.Central tendencies of some data were reported using medians and quartiles because of non-normal distribution. Mann-Whitney U test was used to assess the significance of differences between the two samples.Internal consistency of the SSI was evaluated by calculation of Cronbach's \u03b1 for the whole scale.Concurrent validity of the instrument was examined by comparing it with the K-SADS-PL with the CSA classifications. SSI total scores were first assessed in 5 classes of increasing suicidality derived from the K-SADS-PL responses in the following way: 1-no suicidal ideation or acts, 2-mild suicidal ideation (score 2 on item-1), 3-severe suicidal ideation (score 3 on item-1), 4-mild suicidal acts (score 2 on any of items 2\u20134 regardless of ideation), 5-severe suicidal acts (score of 3 on any of items 2\u20134 regardless of ideation).Then the SSI total scores were measured in 3 classes of increasing suicidal ideation severity, regardless of possible suicidal acts, derived from the K-SADS-PL responses on item 1: 1-no ideation, 2-mild ideation, and 3-severe ideation. Severe ideation (score 3) in this item was considered as \"clinically significant suicidal ideation\".Finally the SSI total score was assessed in the three classes of the CSA: 1-no suicidality, 2-suicidal ideation, 3-suicidal or self-harming acts.The statistical significance of the between-class differences was evaluated by Kruskal-Wallis test. For the analyses of concurrent validity only SSI-measurements in a range of 30 days from the K-SADS-PL and the CSA were included.Construct validity was measured by performing a principal component analysis (PCA) with varimax rotation in the outpatient sample. The internal consistencies (Cronbach's \u03b1) of the extracted components as well as the originally reported factors  were calROC-analysis was performed to evaluate the screening properties of the SSI, and the cutoff threshold for the instrument was defined by optimal trade-off between sensitivity and specificity (Youden's index ). The K-SPSS 11.0  was used for the statistical analysis.Eighteen percent (n = 40) of the outpatient sample were boys and 82% (n = 178) girls, in the community sample the percentages were 18.6% (n = 37) and 81.4% (n = 162), respectively. The subjects' mean age was 16.4 (SD 1.6) in the outpatient sample and 16.5 (SD 1.6) in the community sample. The median SSI total score for the patient sample was 0 (Q1\u20133 = 0\u20136) and for the community sample 0 (Q1\u20133 = 0-0) . The median SSI total score for subjects aged 13\u201315 was 0 (Q1\u20133 = 0\u20131) and those aged 16\u201319 0 (Q1\u20133 = 0\u20131) . The median time distance between SSI and K-SADS-PL was 21.5 days (Q1\u20133 = 9\u201336) for the patient sample and 0 days (Q1\u20133 = 0-0) for the control sample . The median time distance between SSI and the CSA was 6 days (range 0\u201335).Forty-seven (21.6%) outpatients and one  control subject had current clinically significant suicidal ideation (p = 0.000) according to the K-SADS-PL.Cronbach's \u03b1 was 0.95 for the whole sample, 0.81 for the community sample and 0.95 for the outpatient sample.146 (67%) of the outpatients and 199 (99.5%) of the controls were included in the analyses for concurrent validity, as their measurements were within the required range of 30 days.2 = 111.6, df 4, p = 0.000).The median SSI sum scores in the five suicidality classes derived from the K-SADS-PL were class-1 = 0 (Q1\u20133 = 0-0); class-2 = 5.5 (Q1\u20133 = 0\u20138); class-3 = 13 (Q1\u20133 = 0\u201318.5); class-4 = 4 (Q1\u20133 = 0\u201317.3); class-5 = 8 (Q1\u20133 = 0\u201313). The differences were significant .The median SSI sum scores in the three classes of suicidal ideation derived from the K-SADS-PL were class-1 = 0 (Q1\u20133 = 0-0); class-2 = 4 (Q1\u20133 = 0\u20138); class-3 = 13 (Q1\u20133 = 4\u201318). The differences were significant .The median SSI sum scores in the three clinical suicidality evaluation classes (only the outpatient sample) were class-1 = 0 (Q1\u20133 = 0\u20131); class-2 = 10 (Q1\u20133 = 5\u201318); and class.3 = 15 (Q1\u20133 = 13.3\u201316.6). The differences were significant  and the sample of patients was large compared to earlier similar studies in adult populations, and probably representative of adolescent psychiatric outpatients with depressive disorders. The main finding was that the SSI appeared to be a reliable and valid instrument for evaluation of suicidal ideation in a depressed adolescent population. Its internal consistency and different aspects of validity were good and similar to what has been reported among adults.The construct validity of the SSI was checked by Principal Component Analysis, which yielded 3 theoretically meaningful and coherent factors, only slightly different from the original ones, with good internal consistencies. This suggests good construct validity. The first factor  was nearly identical to Beck's original one . The secThe SSI converged theoretically meaningfully with both the three-class K-SADS-PL suicidal ideation-item and the clinical suicidality assessment (CSA); growing SSI scores were found within categories with increasing severity of suicidality. As to the convergence with the 5-class K-SADS-PL suicidality instrument, the results were more complex. The Kruskal-Wallis test yielded significant differences between the SSI scores in the different categories as expected, but the SSI-scores in the K-SADS-PL classes 4 and 5, with the supposedly most severe suicidality were not higher than in class 3. Classes 4 and 5 inquire about suicidal acts, and may represent a partly separate domain from suicidal ideation, which may be related to the presence of comorbid personality traits or conduct disorders. The SSI was designed to tap suicidal ideation and it may not satisfactorily tap features related with suicidal acts. In accordance with the theory of multidimensional nature of suicidality , severe The authors are not aware of previous empirical estimations of clinically relevant cutoff for the SSI in adolescents. In this study ROC analysis of the whole sample yielded a reasonable result, but the validity coefficients for the different cutoffs of the SSI were somewhat difficult to interpret. In the community sample, there was only one subject with K-SADS-PL-diagnosed clinically significant suicidal ideation, which may have biased the analyses made with the whole sample. The results for both the whole sample and the patient sample suggest that a cutoff threshold score of four or more might be optimal for adolescents. Depending on the purpose the SSI is used, however, the emphasis between sensitivity and specificity may change, and a different threshold may be useful. For example, if the purpose is to detect the maximum number of potential suicides the cutoff threshold should be lowered to minimize the number of false negatives.Several methodological limitations should be noted, some suggesting caution in interpreting the findings. Inter-rater and test-retest reliabilities, which would have given a complete picture of the reliability of the SSI, could not be evaluated in our setting; they would have required repeated SSI measurements for each subject. However, the alpha-coefficients are a marker of internal consistency, which is one indicator of reliability.Although large and representative, the sample was a pure outpatient sample with age- and sex-matched controls, and females were over-represented. The absence of inpatients may have caused us to see the spectrum of suicidal ideation narrower than in real clinical situations. The sample was limited to an urban area in southern Finland, the generalizability of our findings to rural areas, or to other countries, is not known.The use of K-SADS-PL as a standard for clinically significant suicidal ideation and behavior may be criticized, as the authors are not aware of a data on its validity. It is used, however, as one of the best available standards in adolescent mood disorder diagnostics, and taps suicidality with 4 relevant items.The same rater rated the K-SADS-PL and the SSI, which is a weaker test of concurrent validity than correlating measures rated by separate raters.The SSI can safely be used to evaluate suicidal ideation in adolescents where it seems to perform as well as in adults, where it is considered to be well established. When screening clinically significant suicidality in adolescents, a total score threshold of 3/4 may be useful.Suicidal acts may occur among adolescents with only \"mild\" suicidal ideation. Thus, prevention of suicidal acts cannot rely solely on the SSI, which does not seem to tap them accurately. Furthermore, questionnaires should be only an adjunct to the clinical evaluation of suicidality.SSI appears to be a reliable and a valid measure of suicidal ideation at depressed adolescents, with a cutoff threshold value of four or more of total SSI score being an appropriate for detecting significant suicidal ideation.The author(s) declare that they have no competing interests.MMH analyzed the data and wrote the paper. MP interviewed patients, participated in planning the study and analyses, and writing the paper. LK, TR, HH and VT participated in planning the study, interviewed patients, and commented on the manuscript. OK participated in planning the study and the analyses, and commented on the manuscript. MM supervised the study, interviewed patients and participated in planning of the study and analyses, and writing the paper. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "The nature of voltage sensing by voltage-activated ion channels is a key problem in membrane protein structural biology. The way in which the voltage-sensor (VS) domain interacts with its membrane environment remains unclear. In particular, the known structures of Kv channels do not readily explain how a positively charged S4 helix is able to stably span a lipid bilayer. Extended (2 \u00d7 50 ns) molecular dynamics simulations of the high-resolution structure of the isolated VS domain from the archaebacterial potassium channel KvAP, embedded in zwitterionic and in anionic lipid bilayers, have been used to explore VS/lipid interactions at atomic resolution. The simulations reveal penetration of water into the center of the VS and bilayer. Furthermore, there is significant local deformation of the lipid bilayer by interactions between lipid phosphate groups and arginine side chains of S4. As a consequence of this, the electrostatic field is \u201cfocused\u201d across the center of the bilayer. Voltage-gated potassium (Kv) channels play a key role in electrically excitable cells . Recent In support of the VS domain as an independent unit, homologous domains have been found in two non-Kv proteins: a voltage-sensitive phosphatase (Ci-VSP)  and a voThe VS is composed of four transmembrane (TM) helices, S1\u2013S4. The isolated VS domain of KvAP revealed that the S3 helix was distorted into two distinct helical segments, namely S3a and S3b, where the C-terminal S3b segment and the N-terminal portion of the S4 helix  simulations provide a computational approach to exploring structure/function relationships of ion channels and related membrane proteins  and the 1ORS). This was evaluated by measuring the root-mean-square deviation (rmsd) of the C\u03b1 atoms from their starting coordinates. Each simulation shows an initial jump followed by a slower rise to a plateau of \u223c1.8 \u00c5 for all C\u03b1 atoms, and of \u223c1.5 \u00c5 for core fold C\u03b1 atoms  show that the S3b-S4a region of the paddle exists in different orientations with respect to other components of the VS. It is also interesting to note that the motions of the two helical segments (S3a and S3b) which comprise the S3 helix do not appear to be significantly correlated in either the VS/PC or VS/PCPG simulations  of each C\u03b1 atom from its time-averaged coordinate. The overall profiles were similar, with the rmsf values being significantly higher for the interhelical regions relative to the \u03b1-helical core regions see . There iions see .Overall, one may conclude that the VS domain protein is conformationally stable in a bilayer environment simulation on a 50 ns timescale. Thus, it behaves like a stable canonical membrane protein, even though it is an isolated domain containing a positively charged S4 helix. Perhaps the stability of the isolated domain is not surprising, given that the two-state model of membrane protein folding  implies The nature of the interactions between the VS  and the lipid head groups is of particular interest. Simulation studies of an isolated S4 helix  and of tAs a first step, we have combined visualization of simulations with analysis of the location  of the P atoms of the phospholipid head group A. Examin+ channel KirBac3.1, which when simulated for 20 ns in a PC bilayer does not lead to localized lipid bilayer compression  distance out from the center of the protein see . It is eAlthough the charged S4 helix is significantly (\u223c50%) exposed to the lipid bilayer environment during the course of each simulation, the VS domains remain conformationally stable. It is of some interest, therefore, how these gating charges are accommodated over the course of each simulation B. It wasFurther analysis also reveals that the lipid head groups in the mixed PC/PG have the propensity to form a greater number of H bonds with the positively charged residues located along S4 than do the lipid head groups of the PC simulation . This fiEach of the charged residues located along the S4 helix is involved in forming H bonds with water molecules over the course of the simulations, indicating that individual water molecules extensively penetrate the VS. However, in contrast to the gating charge arginines, the centrally located Arg133 forms a limited number of H bonds with waters. It can also be observed that the lipid head groups can form H bonds with all of the gating charge residues located toward the N terminus of S4  and the two charged residues located toward the C terminus of S4 (Asp146 and Lys147). Such H-bonding interactions may help stabilize the VS and the highly charged S4 helix within a bilayer environment.Inspection of the average partial density plots for each simulation reveals a reduction in water density toward the center of the S4 helix and the marked absence of water density at a central constriction point . InteresThe partial density plots also reveal an asymmetric distribution of the lipid head groups, with the phosphorus atoms sitting lower in the lipid leaflet accommodating the gating charges. This location bias suggests that the gating charges form more favorable interactions with lipid head groups than do the charged residues located toward the C terminus of S4.Analysis of the radius profile along the VS crevice reveals that there is a central constriction which (when averaged over the course of each simulation) is significantly narrower than the radius of a water molecule see B. The coElectrostatic potential calculations  was assessed by calculating the mean-square fluctuation (msf) of the lipid phosphorus atoms over the last 10 ns of each simulation . In geneVisual inspection of the equilibrated portion of each trajectory revealed that some of the lipid head group H-bonding interactions to the VS were facilitated by interchanging water molecules. It was also clear that some of the more mobile lipids could maintain continual H-bonding interactions with the VS throughout the simulation period. This is best understood by considering the lipid head group that binds to R123 and over time migrates down to R126 B.Our analysis has examined the interactions of the isolated VS domain of KvAP in lipid bilayer environments. These simulations, conducted over a timescale that allows reasonable sampling of lipid/protein interactions, reveal how it is that the isolated VS domain of KvAP can form\u00a0a stably folded domain in either a PC or a mixed PC/PG lipid bilayer environment. This provides further support for the contention that the VS domain can subsist independently of the pore-forming domain of Kv channels.The VS domain and, moreover, the charged S4 helix, appear to be accommodated in both a PC and a PC/PG bilayer through substantial H-bonding interactions of charged residues with water molecules and lipid head groups. These favorable H-bonding interactions lead to two phenomena occurring, namely the extensive penetration of water molecules into the VS and the significant local perturbation of the lipid species within close proximity of the VS. This latter process is the consequence of favorable H bonding between lipid head groups and charged residues situated in the crevices of the VS. Such interactions effectively draw the coordinated lipid species into the VS and effectively reduce the bilayer width (\u223c7 \u00c5 over 50 ns) within the immediate vicinity of the VS domain.Lateral lipid mobility analysis revealed another interesting phenomena occurring in the lipid bilayer: discrete clusters of slow lipids within the immediate vicinity of the VS and in the bulk lipid bilayer environment. Favorable nonbonding interactions between the VS and the lipids (head groups/tails) may account for the decreased lateral mobility of the lipid species that comprise these slow islands.Thus, these simulations reveal that the lipid bilayer does not simply function as an unstructured fluid into which the protein is embedded; indeed, they reveal a picture of a structured yet dynamical lipid bilayer that can reorganize to accommodate the (charged) protein. A similar situation was seen in simulations of the isolated S4 helix in a bilayer . FurtherThese simulations also reveal that the S3b-S4a region is significantly more mobile in PC than in PC/PG. This suggests that the S3b-S4a region exhibits a degree of flexibility that can be attenuated by its environment. The sensitivity of the S3b-S4a region to its environment may account for the different orientations of the S4 helix observed in the Kv channel structures elucidated thus far .Another important finding from these simulations is that there is a central constriction in the apparent VS cavity which is too narrow to facilitate the passage of water molecules through the VS. The constriction is centered on a salt bridge formed between Asp62 and Arg133 and the hydrophobic band of residues that sit beneath this bond . Electrostatic potential calculations reveal that the lipid bilayer potential is focused across this highly circumscribed hydrophobic region. Given that the isolated VS of KvAP is broadly consistent with a range of biophysical and physiological data for an open state of the channel, it is possible that this salt bridge and the hydrophobic occlusion it maintains may be where the voltage is focused in the open conformation under physiological conditions.1ORS). However, it should also be noted that the conformation of this domain is different in the two structures of the intact KvAP channel (PDB ID codes 1ORQ and 2A0L). This may reflect a degree of distortion (or adoption of a \u201cminor\u201d conformation) of the KvAP channel conformation in the absence of a lipid bilayer environment. The isolated VS domain structure is rather closer in conformation to that of the VS domain in the Kv1.2 structure  structure of the isolated VS domain from KvAP   was taken from the 1.9 \u00c5 isolated voltage-sensor crystal structure (PDB ID code 1ORS) . Side-ch WHAT IF  combined WHAT IF . Thus, thttp://moose.bio.ucalgary.ca) for the VS/PC simulations. To set up the 3:1 PC/PG bilayer, lipids of the PC bilayer were \u201cmutated\u201d into PG species. To mutate a PC into PG, the choline group needs to be replaced with a glycerol group. A glycerol group already exists in PC which connects the phosphate group to the fatty chains. For each choline group, the rmsd of all possible choline/glycerol pairs in the bilayer was calculated after least-square-fitted superimposition. The choline group of each lipid was replaced by the glycerol group of the pair with the lowest rmsd. This ensured that the final bilayer was as close to an equilibrated state as possible.An equilibrated PC bilayer comprised of 128 lipid molecules (64 lipid molecules per leaflet) was obtained, courtesy of D.P. Tieleman  protein atoms were harmonically restrained with an isotropic force constant of 1000 kJ molhttp://www.gromacs.org). The GROMOS96 force field was used for both simulations  method, with a 10 \u00c5 cutoff for the real space calculation . A cutofbarostat  at 1 barlgorithm  was usedlgorithm ."}
{"text": "The first target of antimicrobial peptides (AMPs) is the bacterial membrane. In the case of Gram-negative bacteria this is the outer membrane (OM), the lipid composition of which is extremely asymmetric: Whereas the inner leaflet is composed of a phospholipid mixture, the outer leaflet is made up solely from lipopolysaccharides (LPSs). LPS, therefore, represents the first target of AMPs. The binding and intercalation of polycationic AMPs is driven by the number and position of negatively charged groups of the LPS. Also, proteins other than cationic AMPs can interact with LPS, e.g. leading eventually to a neutralization of the endotoxic effects of LPS. We compared different biophysical techniques to gain insight into the properties of the electrical surface potentials of lipid monolayers and aggregates composed of LPSs and various phospholipids and their interaction with peptides and proteins.The net negative charge calculated from the chemical structure of the phospholipid and LPS molecules is linearly correlated with the adsorption of calcium to two-dimensional lipid monolayers composed of the respective lipids. However, the \u03b6-potentials determined by the electrophoretic mobility of LPS aggregates can only be interpreted by assuming a dependence of the plane of shear on the number of saccharides and charged groups. Various peptides and proteins were able to displace calcium adsorbed to monolayers.To characterize the electrical properties of negatively charged phospholipids and LPSs and their electrostatic interaction with various polycationic peptides/proteins, the adsorption of calcium to and displacement from lipid monolayers is a suitable parameter. Using the calcium displacement method, the binding of peptides to monolayers can be determined even if they do not intercalate. The interpretation of \u03b6-potential data is difficulty for LPS aggregates, because of the complex three-dimensional structure of the LPS molecules. However, the influence of peptides/proteins on the \u03b6-potential can be used to characterize the underlying interaction mechanisms. Cell membranes composed of lipids and proteins are an essential part of all living organisms. The interaction between peptides or proteins and lipid membranes is driven by entropic effects and in many cases also by electrostatic forces. The architecture of membranes differs for various cell types and with that also the specificity of the interaction between lipids and peptides/proteins.The cytoplasmic membrane of mammalian cells has an asymmetric lipid distribution , in partThe important influence of electrostatic interactions is even more pronounced for the interaction between bacteria and antimicrobial peptides (AMPs) of the innate host defense system. Membranes of Gram-positive as well as of Gram-negative bacteria express a high amount of negatively charged lipids on the outer leaflet of the membrane which is in direct contact with the extracellular environment.Gram-positive bacteria have a cytoplasmic membrane containing negatively charged diphosphatidylglycerol   and lipoTo investigate the interactions between negatively charged lipids and polycationic peptides/proteins on a molecular level, the knowledge of the number of charges per lipid molecule or the surface charge density of the lipid aggregates is of importance. A number of techniques to determine these parameters is available. Some of the methods can be applied for whole cells or bacteria (for review see ), for liFour different methods to determine values which depend on the number of charges per molecule and the size of the molecules are compared in this paper for phospholipids and, in particular, for LPS:(i) Calculation of the net charge per molecule which is based on the chemical structure as determined in mass spectrometric experiments.(ii) Determination of innermembrane potentials of monolayers ,19 or pl(iii) Determination of the electrophoretic mobility of cells and lipid aggregates. From the electrophoretic mobility, the \u03b6-potential can be calculated which is correlated with the surface charge density .45Ca2+ as a marker for negatively charged lipids.(iv) Utilization of marker molecules, which bind to specific lipids, e.g. annexin V as a marker for PS in apoptotic cells, or to charged residues, e.g. calcium doped with small amounts of the \u03b2-active isotope 45Ca2+. The measurement of the adsorption of calcium to monolayers and also its displacement . Due toTo investigate the influence of lipid structures, in particular the presence of negatively charged groups, on the surface potential, we determined the electrophoretic mobility and calculated the respective \u03b6-potentials of various aggregates made from LPSs or phospholipids. The respective values are given in Tab. In the case of phospholipids, the absolute values of the \u03b6-potential increase linearly with increasing negative net surface charge as it could be proposed form the \u03b6-potential theory. The \u03b6-potential and the surface charge density of PG and DPG is almost the same, because the net charge as well as the surface area occupied by a DPG molecule is twice of that of a PG molecule. For the various LPSs used, we did not find any correlation between the calculated net charge and the \u03b6-potential. This might be explained by incorrect assumptions for the calculation of the \u03b6-potentials from the electrophoretic mobility. The determination of the \u03b6-potential is based on the Smoluchowski approximation  assumingPhospholipids are described to form multilamellar vesicles. Aggregates formed by LPS are also described to be multilamellar in the presence of di- or polyvalent ions at a temperature of 25\u00b0C ,30. It cd1 between the aggregate surfaces and the planes of shear are in the range between 0.20 nm (LPS R7) and 0.42 nm (LPS R60)  = \u03a8I exp (- \u03ba x) + \u03a8O exp (- \u03ba (x - 1.1 nm)) for x \u2265 1.1 nm(Eq.1)\u03a8x is the distance from the inner charged plane and \u03ba is the reciprocal Debye- length )/\u03ba.(Eq. 2) S. minnesota LPS used in this study are given in Tab. M1 [The respective values for the  Tab. M1 ,32 and P Tab. M1  showed tIt should, however, be pointed out that our approach to describe the surface potential by the superposition of two distinct planes is only a simplified model. For example, the charges of the two phosphate groups of the lipid A and the two Kdo were assumed to be in one plane, however, the diglucosamine backbone of the lipid A moiety of the LPS is tilted with respect to the aggregate surface . Thus, tSeveral advanced theories, taking a rough surface of the aggregate into account, have been published (for review see ). Howeve45Ca2+) was titrated in amounts of up to 25 \u03bcM into the subphase underneath the monolayers composed of the identical number of the respective lipid molecules. The \u03b2-intensity was measured and plotted against the calcium concentration. To further analyze the data, the plots were fitted by the equation:To investigate the adsorption of calcium to lipid monolayers made of various phospholipids and LPSs, calcium (doped with radioactive (Eq. 3) I(c) is the \u03b2-intensity I as a function of the calcium concentration c, Imax the maximum \u03b2-intensity at complete saturation of the lipid monolayer with calcium and c0 is the calcium concentration at which 1-1/e (~63%) of the monolayer is saturated with calcium. In Fig. where Imax is plotted versus the net charge q of all lipids used for monolayer preparation. The respective values are given in Tab. Imax increases with increasing negative values of q and that Imax and q are linear correlated with R = -0.98. The dependence of Imax on q is given by Imax = (-3.1 \u00b1 21.0) cps + (-89.3 \u00b1 6.5) cps/e0 q.In Fig. q and Imax that calcium ions intercalate into the oligosaccharide portion of the LPS, also binding directly to the charged groups of the lipid A part of the molecule. This is supported by calcium displacement experiments using fragments of rabbit and human cathelicidin peptide [These results indicate that the amount of calcium adsorbed to a lipid monolayer depends solely on the number of negative charges and is not influenced by the 3D structure of the monolayer-forming lipid. Furthermore, it can be assumed from the linear correlation between  peptide , in whic-1, and the \u03b2-intensity was monitored.To check the influence of the lateral pressure on calcium adsorption, we used a Langmuir-Pockels film balance equipped with a movable barrier. LPS F515 monolayers were prepared and compressed to a final lateral pressure of 40 mN m-1, the lateral pressure increases almost linearly with decreasing area, above 20 mN m-1 the isotherm shows a typical non-linear dependence between area and lateral pressure. In contrast to the latter, the \u03b2-intensity increases linearly with decreasing film area  were calculated. The most potent substances were the proteins lactoferrin and the bactericidal/permeability-increasing protein (rBPI21) and a fragment of the 18 kDa rabbit cationic antimicrobial protein (rCAP18106\u2013137) which were active already at submicromolar concentrations. The IC50 values of the recombinant human serum albumin (rHSA) and hemoglobin were by two orders of magnitude higher. Interestingly, rCAP18, PMB, BPI, and lactoferrin are well-known LPS-neutralizing peptides [To compare the various peptides/proteins in their ability to displace calcium from an LPS monolayer, the ICpeptides , in casepeptides . Thus, t2+ or Ca2+. Thus, the binding of LPS to proteins being involved in the LPS-induced activation of mononuclear cells is inhibited.Divalent cations lead to a cross linking between the LPS individual molecules  and lead-1 [In many cases, the intercalation of peptides/proteins decreases with increasing lateral pressure. Therefore, to guarantee a maximal interaction between the monolayers and the peptides/proteins, experiments were done at a relatively low lateral pressure as compared to that in a natural cell membrane which is discussed to be in the range from 20 to 30 mN m-1 ,42.-1, no significant change of the film area was observed  underneath an LPSF515 monolayer at a constant lateral pressure of 27 mN mved Fig. , indicatved Fig. , demonst45Ca2+ which is linearly proportional to the calculated net negative charge of the respective phospholipids or LPSs. Thus, calcium ions seem to bind to all negatively charged groups of LPS, even to those which are located close to the LPS backbone. Larger probe molecules might not be able to reach these groups. The peptide/protein-induced displacement of calcium ions is a usable parameter for the determination of the adsorption of molecules to lipid monolayers. The film balance experiments provide information on i) the adsorption of peptides at the monolayer surface caused by electrostatic interactions determined by calcium displacement and ii) the intercalation into the monolayer caused by electrostatic and hydrophobic interactions. In contrast to this, in calorimetric and surface plasmon resonance experiments it is difficult or in many cases not possible to distinguish between binding and intercalation.The characterization of the electrical potential of lipid membranes and of electrostatically driven interactions between lipids and peptides/proteins are important aims for an understanding of the molecular interaction mechanisms. The adsorption of calcium ions to lipid monolayers can be determined by measuring the \u03b2-intensity of The determination of the \u03b6-potential provides valuable information for the characterization of the electrostatic interaction between peptides/proteins and phospholipid or LPS aggregates. However, due to the complexity of the LPS molecules, the theories, which are based on the assumption of flat surfaces, fail to describe the potential of LPS aggregates. The calculation of the respective planes of shear demonstrates that the \u03b6-potentials depend on the number of saccharides and charged groups. As we showed earlier , the innIt has been shown in many publications that the intercalation of peptides/proteins into lipid monolayers and bilayers can be different. However, according to Schoch et al. ,44 the eIn summary, measurements of calcium adsorption and displacement provide additional useful information for the characterization of the electrostatic interaction between negatively charged monolayers and peptides/proteins.Salmonella enterica serovar Minnesota (S. minnesota) strains R595 (LPS R595), R4 (LPS R4), R7 (LPS R7), Rz (LPS Rz), R5 (LPS R5), R345 (LPS R345), and R60 (LPS R60) as well as deep rough mutant LPS from Escherichia coli strain F515 (LPS F515) and Proteus mirabilis strain R45 (LPS R45) were used [Rough mutant LPS from ere used . LPS wasPhosphatidylcholine (PC) from egg yolk lecithin, phosphatidylglycerol (PG) from egg yolk lecithin , and synthetic diphosphatidylglycerol (DPG) were purchased from Avanti Polar Lipids  and used without further purification.1\u2013193 (rBPI21) was a kind gift of XOMA . The rabbit CAP18106\u2013137 was a kind gift provided by J.W. Larrick .Polymyxin B (PMB) and its nonapeptide (PMBN), lactoferrin from human milk, lactalbumin from bovine milk, lysozyme from chicken egg white, and human hemoglobin were purchased from Sigma Aldrich , and recombinant human serum albumine (rHSA) from Welfide Corporation . Recombinant BPIFixed charges within the headgroups of lipid molecules cause an electric potential at the lipid bilayer surface with respect to the surrounding bathing solution, the surface potential ,52. The r \u03b50)(Eq. 4) \u03b6 = \u03bc \u03b7/(\u03b5-3 kg m-1s-1), \u03b50 the dielectric constant of vacuum (8.854\u00b710-12 A2s4kg-1m-3) and \u03b5r the dielectric permittivity of water (78.54).where \u03b6 is the \u03b6-Potential, \u03bc the electrophoretic mobility, \u03b7 the viscosity  at 25\u00b0C and with a driving electric field of 19.2 V cm2, pH7). Briefly, the lipid dispersions were sonicated for 20 min at 60\u00b0C, cooled down to 4\u00b0C for 30 min and temperature-cycled twice between 60\u00b0C and 4\u00b0C (30 min each). The dispersions were equilibrated overnight at 4\u00b0C. Prior to \u03b6-potential measurements, lipid dispersions were diluted to a final concentration of 0.01 mM. Presented values  at a constant and (ii) at a variable film area. In both types of experiments the phospholipids were dissolved in chloroform and the LPSs in a 10:1 (v:v) mixture of chloroform and methanol at a concentration of 1 mM. All lipids were deposited in the given amounts on the subphase and the solvents were allowed to evaporate for 5 min.45Ca2+  were added to the subphase, resulting in a final calcium concentration of 25 \u03bcM. Calcium ions bind to the negatively charged headgroups of the lipids, and the low-energy \u03b2-radiation originating from the bound 45Ca2+ is not absorbed by the hydration shell anymore and, therefore, an increase in \u03b2-intensity was observed using a \u03b2-counter   Itot is the \u03b2-intensity originating from the monolayer and the subphase and Isub is the \u03b2-intensity of the pure subphase. These and the following experiments were performed at a subphase temperature of 20\u00b0C instead of 37\u00b0C to avoid condensation at the \u03b2-counter.where 2+ ions from LPS F515 monolayers, a subphase containing 12.5 \u03bcM Ca2+ doped with radioactive 45Ca2+ (resulting in a relative \u03b2-activity of 250 Bq/ml), buffered with 5 mM HEPES at pH7 was used. Also in the displacement experiments, the number of LPS molecules was kept constant. The agents were added to the subphase at a constant total film area and relatively low lateral pressure of the monolayer (~10 mN m-1). This way, the final pressure after saturation of the intercalation of agents was still in the range of lateral pressures in biological membranes [Irel(c) in dependence on the peptide/protein concentration c was calculated fromTo investigate the capacity of various peptides/proteins to displace divalent Caembranes ,42. The (Eq. 6) Itot(c) is the absolute \u03b2-intensity, Isub the \u03b2-intensity originating from the pure subphase, and Imono the \u03b2-intensity originating from the monolayer. From the displacement curves the concentrations at which 50% of the calcium were displaced  by the peptides/proteins were determined and summarized in Tab. where All presented values are mean values with standard derivations resulting from 3 to 4 independent experiments.2. The solvent was allowed to evaporate at zero pressure for 5 min. Then the monolayers were isothermally compressed at a speed of 1.5 mm2 s-1 to a lateral pressure of 40 mN m-1.A Langmuir-Pockels film balance equipped with a Wilhelmy system  was used to determine the lipid pressure/area isotherms of LPS F515 monolayers. The lateral pressure, area, and the \u03b2-intensity were determined. For the experiments, 36 \u03bcl of the LPS F515 were spread on the buffer surfaces of 290 cmAMP \u2013 antimicrobial peptidesAra4N \u2013 4-amino-4-deoxyarabinoseBPI \u2013 bactericidal/permeability increasing proteinDPG \u2013 diphosphatidylglycerolENP \u2013 endotoxin-neutralizing proteinKdo \u2013 3-deoxy-alpha-D-manno-oct-2-ulosonic acidLPS \u2013 lipopolysaccharideLTA \u2013 lipoteichoic acidOM \u2013 outer membranePC \u2013 phosphatidylcholinePE \u2013 phosphatidylethanolaminePEG \u2013 poly(ethylene glycol)PG \u2013 phosphatidylglycerolPMB \u2013 polymyxin BPMBN \u2013 nonapeptide of PMBPS \u2013 phosphatidylserinerBPI21 \u2013 recombinant 21 kDa fragment of BPIrCAP18 \u2013 18 kDa rabbit cationic antimicrobial proteinrHSA \u2013 recombinant human serum albuminSOH designed and carried out the adsorption binding assay and drafted the manuscript. MUH carried out the \u03b6-potential experiments and helped to draft the manuscript. AW participated in the film balance experiments. US participated in the design of the study and helped to draft the manuscript. TG participated in the design and coordination of the study, performed some of the monolayer experiments and helped to draft the manuscript. All authors read and approved the final manuscript."}
{"text": "Genes of interest mainly expressed in either chondrocytes or osteoblasts were analyzed with real-time RT-PCR and enzyme immunoassays. Signalling pathways regulating osteocalcin were analyzed in the presence of gal-3. Intra-articular injection of gal-3 induced knee swelling and lesions in both cartilage and subchondral bone. On human OA chondrocytes, gal-3 at 1 \u03bcg/ml stimulated ADAMTS-5 expression in chondrocytes and, at higher concentrations (5 and 10 \u03bcg/ml), matrix metalloproteinase-3 expression. Experiments performed with osteoblasts showed a weak but bipolar effect on alkaline phosphatase expression: stimulation at 1 \u03bcg/ml or inhibition at 10 \u03bcg/ml. In the absence of vitamin D3, type I collagen alpha 1 chain expression was inhibited by 10 \u03bcg/ml of gal-3. The vitamin D3induced osteocalcin was strongly inhibited in a dose-dependent manner in the presence of gal-3, at both the mRNA and protein levels. This inhibition was mainly mediated by phosphatidylinositol-3-kinase. These findings indicate that high levels of extracellular gal-3, which could be encountered locally during the inflammatory process, have deleterious effects in both cartilage and subchondral bone tissues.In this study we examine the extracellular role of galectin-3  in joint tissues. Following intra-articular injection of gal-3 or vehicle in knee joints of mice, histological evaluation of articular cartilage and subchondral bone was performed. Further studies were then performed using human osteoarthritic (OA) chondrocytes and subchondral bone osteoblasts, in which the effect of gal-3 (0 to 10 \u03bcg/ml) was analyzed. Osteoblasts were incubated in the presence of vitamin D Osteoarthritis (OA) accounts for 40% to 60% of degenerative illnesses of the musculoskeletal system. On the whole, approximately 15% of the population suffers from OA. Of these, approximately 65% are 60 years of age and over. The high incidence of this illness is rather disturbing since its frequency increases gradually with the aging of the population.It is well known that age is a primary risk factor for the development of OA, but the mechanisms by which aging contributes to an increased susceptibility to OA are poorly understood . The endMechanisms by which synovitis exacerbates structural damage in OA are complex. Synovitis induces alterations in chondrocyte function and in subchondral bone turnover and enhances angiogenesis ,14. CytoThe exact role of gal-3 in articular tissues is not yet known. It is a soluble animal lectin of 30 kDa that preferentially recognizes lactosamine and N-acetyllactosamine structures ,19. Intrin vivo effect in mice having received an intra-articular injection of gal-3, and further investigated its effect on cells from two OA articular tissues: cartilage and subchondral bone.In the present study, we further investigate the role of extracellular gal-3 in joint tissues. To this end, we first examined its ad libitum. Recombinant human gal-3  was prepared in our laboratory and sterilized on a 0.2 \u03bcm filter. As the amino acid sequence of rh-gal-3 shows 85% identical homology and 91% positive homology with murine gal-3, we injected rh-gal-3 into the knees of wild-type mice. Mice were distributed into 4 groups receiving 100 ng, 1 \u03bcg or 10 \u03bcg of gal-3 or vehicle (PBS) alone according to previous established protocols 2 D3  in combination or not with gal-3. To evaluate signalling pathways involved in vitamin D3-stimulated osteocalcin production that are inhibited by gal-3, cells were pre-incubated for 2 h with specific inhibitors and then incubated for 22 h in the presence of the inhibitors and vitamin D3 in combination or not with gal-3. The inhibitors used were KT5720 , KT5823 , Genistein , Taxifolin , wortmannin (inhibitor of phosphatidylinositol 3-kinase (PI 3-kinase); final concentration 250 nM), PD98059 (inhibitor of mitogen-activated protein kinase kinase-1 (MEK-1) activation; final concentration 10 \u03bcM), and SB202190 . All inhibitors were purchased from Calbiochem .The overlying cartilage was removed from the tibial plateaus, and the trabecular bone tissue was dissected from the subchondral bone plate. Primary subchondral osteoblasts were released as previously described . BrieflyRNA extraction and real time RT-PCR were performed as previously described . PrimersThe assay measured only intact human osteocalcin and was performed on human osteoblast-conditioned media using a specific enzyme immunoassay (EIA) kit with a sensitivity of 0.5 ng/ml .Cells were lysed in 0.5% sodium dodecylsulfate and proteins quantified with the bicinchoninic acid assay .t-tests for animal experiments and cell culture, respectively. Results of p < 0.05 were considered significant.Data are expressed as mean \u00b1 SEM or median (range). Statistical analyses were the Mann-Whitney U and the two-tailed Student's p \u2264 0.0002 versus D0) , a significant difference was still seen when D2 was compared to D0 (p < 0.004). Values gradually returned to the basal conditions. Gal-3 exacerbated and extended the swelling; thus, at D2, gal-3 injections of 0.1, 1, and 10 \u03bcg significantly induced higher swelling than the vehicle alone . This effect was sustained the third day post-injection . Finally, at D4, values tended to return to those of the control group, although gal-3-induced joint swelling was still statistically significant (p < 0.006) with the highest gal-3 concentration used.As Ohshima and colleagues  showed t) Figure . Althougp < 0.04 versus control), 10.5 (8.5 to 12.5) (p < 0.02 versus control) and 13 (p < 0.04 versus control) in the gal-3-injected group with 0.1, 1, and 10 \u03bcg gal-3, respectively  and 8 (p < 0.04 versus control) in the gal-3-injected group with 0.1, 1, and 10 \u03bcg gal-3, respectively , 4.0 (3.0 to 5.0) (p < 0.04 versus control) and 5 (p < 0.04 versus control) in the gal-3-injected group with 0.1, 1, and 10 \u03bcg gal-3, respectively ) in the control group was 5.0 (3.5 to 6.0) whereas it reached 9.5 (7.0 to 12.5) , but not at 10 \u03bcg/ml . Alkaline phosphatase, which is upregulated by vitamin D3, tended to be increased with gal-3 at 1 \u03bcg/ml (p < 0.07). A significant difference in alkaline phosphatase expression was found between osteoblasts treated with vitamin D3 in the presence of 1 \u03bcg/ml gal-3 and vitamin D3 in the presence of 10 \u03bcg/ml gal-3 (p < 0.03).The effects of gal-3 on human osteoblasts were evaluated in the presence or absence of vitamin Dl Figure . In cont3, osteocalcin expression was maintained at a minimal level, and gal-3 had no effect on osteocalcin expression  and 6.5 (p < 0.0001) times the basal level, respectively. These results were confirmed at the protein level by analyzing osteocalcin concentration in conditioned media using an EIA. Osteocalcin production was inhibited by around 40% and 85% at gal-3 concentrations of 1 and 10 \u03bcg/ml, respectively  for osteoblasts treated with vitamin D3 alone, 67.6 \u00b1 7.9 for those treated with 1 \u03bcg/ml rh-gal-3 in the presence of vitamin D3 and 2.4 \u00b1 0.9 for cells treated with 10 \u03bcg/ml rh-gal-3 in the presence of vitamin D3. In addition, we made a truncated isoform of gal-3 (Gly108 to Ile249) corresponding to the carbohydrate recognition domain (CRD). This truncated isoform is known to be incapable of multimerizing and it is unable to reproduce the effects of whole gal-3. Results obtained with an EIA were 130.2 \u00b1 16.5  for osteoblasts treated with vitamin D3 alone, 158.5 \u00b1 22.6 for those treated with 1 \u03bcg/ml CRD in the presence of vitamin D3 and 163.4 \u00b1 26.1 for those treated with 5 \u03bcg/ml CRD in the presence of vitamin D3. As expected, CRD was not able to downregulate the osteocalcin production.As previously described, in the absence of vitamin Dn Figure . In conty Figure , insert.3-stimulated osteocalcin production with 5 \u03bcg/ml gal-3, which resulted in an inhibitory effect closer to 50%  and SB202190 (40%), indicating that tyrosine kinases and p38 mitogen-activated protein kinase may be slightly involved , indicating that gal-3 did not induce these pathways. The combination of gal-3 with either KT5720 or KT5823 also significantly inhibited osteocalcin production compared to their respective controls , indicating that neither protein kinase A nor protein kinase G are involved in gal-3-inhibited osteocalcin production. This result was confirmed by the fact that gal-3 alone and gal-3 in the presence of KT5823 did not produce results with a significant difference. In contrast, PD98059 prevented further inhibition of osteocalcin production by gal-3. This result indicates that Erk1/Erk2 kinases are also involved to some extent in gal-3 signalling transduction. Taxifollin, an antioxidant flavonoid, also seemed to prevent gal-3 inhibition of osteocalcin production, but this inhibitor had the weakest effect. The most spectacular result was obtained with an inhibitor of PI 3-kinase, wortmannin, which totally prevented the inhibition of osteocalcin by gal-3.As 10 \u03bcg/ml gal-3 almost entirely inhibited osteocalcin production, we further examined the signalling cascades of gal-3 inhibition of vitamin D% Figure . Vitamind Figure . However3, 10 \u03bcg/ml of gal-3 inhibited 50% of type I collagen \u03b11 chain expression (p < 0.02) but this inhibitory effect was partly reversed by vitamin D3  was unaffected (data not shown). In addition, the level of tissue inhibitor of MMP-1 (TIMP-1), a natural protein inhibitor produced by chondrocytes, also remained stable (data not shown). We show that ADAMTS-5 was more sensitive than MMP-3 to gal-3, since its expression was stimulated with very low concentrations of gal-3, unlike MMP-3, which required higher concentrations for stimulation. The regulation of ADAMTS-5 is crucial since it was recently demonstrated by two independent groups (using knock-out mouse models) that ADAMTS-5 is the major aggrecanase responsible for proteoglycan degradation in cartilage destruction [It is interesting to note that two major enzymes responsible for proteoglycan degradation were stimulated by gal-3. This finding corroborates the truction ,42. On t3-stimulated osteocalcin level [3-stimulated osteocalcin levels, the PI 3-kinase appears to be a key enzyme. This could be related to the implication of integrins, since it has recently been shown that several biological functions of osteoblasts are regulated via the integrin/PI 3-kinase pathway [Gal-3 not only modulated chondrocyte-expressed genes but also those of osteoblasts. More particularly, production of osteocalcin, which is an osteoblastic marker , was strin level . One hyp pathway ,46.3 prevented the inhibition of type I collagen expression. This latter finding raised the potential role of gal-3 in preventing osteoid matrix formation during the inflammatory process, particularly in individuals with low or depleted levels of vitamin D3 since it has been shown that vitamin D3 analogues have immunomodulatory effects [Unlike osteocalcin, type I collagen \u03b11 chain expression was downregulated only with a high gal-3 concentration. However, vitamin D effects .The presence of extracellular gal-3 in the vicinity of chondrocytes and osteoblasts causes deleterious effects by both downregulating the anabolic processes and upregulating the catabolic processes. In fact, this factor may participate in cartilage destruction and subchondral bone erosion, particularly during the highly inflammatory phases of OA.ADAMTS-5 = a disintegrin and metalloproteinase with thrombospondin type 1 motif; CRD = carbohydrate recognition domain; D = day; DMEM = Dulbecco's modified Eagle's medium; EIA = enzyme immunoassay; FBS = fetal bovine serum; Gal-3 = galectin-3; MMP = matrix metalloproteinase; OA = osteoarthritis; PBS = phosphate buffered saline; PI 3-kinase = phosphatidylinositol 3-kinase; rh-gal-3 = recombinant human gal-3.The authors declare that they have no competing interests.in vitro study, analyzed the data and drafted the manuscript. CB participated to the animal study design, analyzed the data and drafted the manuscript. MG participated in the in vitro study. FP, JPP, ND, JMP, PR contributed to the study design. FP, JPP, JMP, PR contributed to the revision of the final manuscript.AJM contributed to the"}
{"text": "According to the innate immunity concept , animalsWhat might bacteria derive from producing this type of lipid A, and what do animals gain from recognizing it? A survey of diverse lipid A structures found that the best-recognized configuration is produced by most of the aerobic or facultatively anaerobic Gram-negative bacteria that can live in the gastrointestinal and upper respiratory tracts. We hypothesize that the CD14\u2013MD-2\u2013TLR4 mechanism evolved to recognize not just pathogens, but also many of the commensals  and colonizers that can inhabit the body's most vulnerable surfaces. Producing this lipid A structure seems to favor bacterial persistence on host mucosae, whereas recognizing it allows the host to kill invading bacteria within subepithelial tissues and prevent dissemination. A conserved host lipase can then limit the inflammatory response by removing a key feature of the lipid A signal, the secondary acyl chains.Gram-negative bacteria that inhabit water, soil, plants, or insects display impressive diversity in their lipid A structures see . AlthougBordetella and Haemophilus species to persist in the respiratory tract [Neisseria gonorrhoeae to survive within epithelial cells [Pseudomonas aeruginosa lives in water, produces a predominantly pentaacylated LPS, and does not colonize the mucosae of normal humans. When P. aeruginosa colonize the airways of children with cystic fibrosis, however, the bacteria often adapt by producing hexaacylated (and even heptaacylated) lipid A [Shigella and Salmonella, pathogenic Escherichia coli [Aeromonas species, Plesiomonas shigelloides, and Vibrio cholerae O1. In Salmonella and some others, a PhoP/PhoQ-regulated transcriptional program promotes lipid A palmitoylation (heptaacylation) along with other changes that increase resistance to CAMPs [Campylobacter jejuni) or more of them: heptaacyl (Moraxella) or octaacyl (V. cholerae O139). Those that produce less hydrophobic lipid A seem to be special cases: the pentaacyl LPS of Chlamydia species is found in spore-like elementary bodies, and Helicobacter pylori, with tetraacyl LPS, is adapted to live in the stomach.Mucosal secretions contain numerous cationic antimicrobial peptides (CAMPs) . As notery tract \u20137 and Neal cells . Pseudom lipid A . Mucosalhia coli , Aeromonto CAMPs ,11\u201313. OLegionella , Burkholderia pseudomallei (soil and water), Yersinia pestis , Coxiella burnetti , Leptospira , and Francisella tularensis . These pathogens usually enter vertebrate tissues via insect bites or cuts, within inhaled droplets, or across the conjunctivae. Brucellae (livestock), which inhabit macrophages yet are typically acquired via ingestion, also produce a nonmucosal LPS [Many other disease-associated Gram-negative bacteria have nonmucosal habitats. Their lipid A moieties differ from the typical mucosal structure by having shorter or longer acyl chains, unsaturated acyl chains, only four or five chains, or only one phosphate see : Legioneosal LPS .P. aeruginosa LPS. Further discrimination is performed by MD-2 [Whereas bacterial peptide resistance and outer membrane impermeability seem to vary directly with the number of acyl chains, the inflammation-inducing CD14\u2013MD-2\u2013TLR4 sensory mechanism best recognizes lipid A that has the hexaacyl mucosal lipid A structure \u201320 Figu. In supp by MD-2 . The sam by MD-2 .E. coli mutant that was unable to attach the secondary myristate at position 3\u2032 and could not stimulate human endothelial cells. Having a hexaacyl LPS also enhances other responses to intact bacteria, including the induction of tumor necrosis factor by Salmonella in vivo [S. flexneri [E. coli [Evidence that lipid A structure influences the recognition of intact bacteria by host cells came from mutating enzymes that attach secondary acyl chains to the backbone. Somerville et al.  found an in vivo , the iniflexneri , and the[E. coli . These a[E. coli .Shigella invasion through the colonic epithelium prompts intense local inflammation, for example; the fact that Shigella possess hexaacyl LPS may help the host confine infection to the intestine (bacteremia rarely occurs) [Haemophilus and Bordetella species to the respiratory tract, most strains of N. gonorrhoeae to the urethral mucosa, and E. coli to the bladder [Salmonellae [Although the TLR4-based mechanism for sensing LPS has been highly conserved , how it  occurs) ,34. TLR4 occurs) . Similar bladder . In contmonellae  avoid reY. pestis [B. pseudomallei [F. tularensis [L. pneumophila [C. burnetti [H. pylori [Brucellae [Leptospira [Most mucosal Gram-negative bacteria that enter the bloodstream are rapidly killed. In many instances, LPS sensing is required for effective elimination ,36. Few . pestis  and B. pdomallei  produce domallei \u201342. As sdomallei ,40,42, tlarensis ,44, L. pumophila , C. burnburnetti , H. pylo. pylori , Brucellrucellae ,49, and ptospira  species.Neisseriae. Both N. meningitidis and N. gonorrhoeae produce a mucosal lipid A and colonize mucosal surfaces. How they invade the bloodstream is not known [The most obvious exceptions are the pathogenic ot known , but theDictyostelium discoideum produces several lipid A\u2013deacylating enzymes, only one has been found in mammals. Acyloxyacyl hydrolase (AOAH) removes only the secondary chains from lipid A; it cleaves saturated, short secondary chains, as are found in the mucosal lipid A structure, more rapidly than it removes long unsaturated ones [Whereas ted ones ,53. A phted ones , and theted ones  and the ted ones In vertebrates, AOAH is produced by neutrophils, dendritic cells, renal cortical epithelial cells, and monocyte-macrophages. AOAH treatment greatly reduces LPS sensing via TLR4 , and LPSThe host response to LPS also has noninflammatory, immunostimulatory elements. Lipid A analogs that lack the optimal configuration for inducing inflammation may be excellent adjuvants, enhancing acquired immune responses in ways that mimic those induced by LPS itself ,58. The Porphyromonas gingivalis, the pentaacylated monophosphoryl LPS of Bacteroides fragilis seems to be sensed principally by TLR2 [LPS recognition by CD14\u2013MD-2\u2013TLR4 has received intensive study because it initiates the inflammatory response to so many disease-associated Gram-negative bacteria. Less is known about how animals sense their far more abundant flora of strictly anaerobic Gram-negative bacteria, although doing so may be important for establishing beneficial mutualism between bacteria and host ,60. Like by TLR2 \u201363 and c by TLR2 ,65.An immune system that only recognizes pathogens would leave animals vulnerable to the commensal and colonizing microbes that enter subepithelial tissues at sites of microtrauma throughout life . An innaIf the synthesis proposed here is correct, it would not be surprising to learn that other elements of innate immunity also sense commensal microbes. Animals may also have conserved enzymatic mechanisms for extinguishing microbial signals that are sensed via other receptors ,68.Table S1(208 KB DOC)Click here for additional data file.Table S2(25 KB DOC)Click here for additional data file.http://www.ebi.ac.uk/swissprot) primary accession numbers discussed in this paper are AOAH (P28039), CD14 (P08571), MD-2 (Q9Y6Y9), and TLR4 (000206).The SwissProt ("}
{"text": "Cyanobacterial lipopolysaccharide/s (LPS) are frequently cited in the cyanobacteria literature as toxins responsible for a variety of heath effects in humans, from skin rashes to gastrointestinal, respiratory and allergic reactions. The attribution of toxic properties to cyanobacterial LPS dates from the 1970s, when it was thought that lipid A, the toxic moiety of LPS, was structurally and functionally conserved across all Gram-negative bacteria. However, more recent research has shown that this is not the case, and lipid A structures are now known to be very different, expressing properties ranging from LPS agonists, through weak endotoxicity to LPS antagonists. Although cyanobacterial LPS is widely cited as a putative toxin, most of the small number of formal research reports describe cyanobacterial LPS as weakly toxic compared to LPS from the Enterobacteriaceae.We systematically reviewed the literature on cyanobacterial LPS, and also examined the much lager body of literature relating to heterotrophic bacterial LPS and the atypical lipid A structures of some photosynthetic bacteria. While the literature on the biological activity of heterotrophic bacterial LPS is overwhelmingly large and therefore difficult to review for the purposes of exclusion, we were unable to find a convincing body of evidence to suggest that heterotrophic bacterial LPS, in the absence of other virulence factors, is responsible for acute gastrointestinal, dermatological or allergic reactions via natural exposure routes in humans.There is a danger that initial speculation about cyanobacterial LPS may evolve into orthodoxy without basis in research findings. No cyanobacterial lipid A structures have been described and published to date, so a recommendation is made that cyanobacteriologists should not continue to attribute such a diverse range of clinical symptoms to cyanobacterial LPS without research confirmation. Cyanobacterial LPS is attributed with a range of pathological effects in humans, from gastro-intestinal illness, cutaneous signs and symptoms, allergy, respiratory disease, headache and fever. This review will present the studies of cyanobacterial LPS, and will attempt to place the knowledge of these products within the broader understanding of LPS from Gram-negative heterotrophic bacteria. The paper will present an overview of the mechanisms of toxicity of Gram-negative bacterial LPS, discussing the history of its discovery and the present perception of its pathogenicity.Table Several authors note that the health implications of cyanobacterial LPS are poorly understood and the topic requires more research -15. OnlyThe relationship between cyanobacterial LPS and illness is discussed in language ranging from cautious: \"...may be responsible...\" , \"possibThe references in the literature to the association between cyanobacterial LPS and this rather diverse range of symptoms are not based on any research evidence specific to cyanobacterial LPS. As will be discussed later in this review, the few toxicological investigations that have been carried out to date are mostly limited to the end-points of lethality and the local Shwartzman reaction, in which sequential subcutaneous and intravenous injections of LPS produce a dermonecrotic lesion in rabbit skin. Rather, symptomatology attributed to contact with cyanobacterial LPS appears to be something of a default diagnosis for illnesses that are not otherwise explained by the current knowledge of cyanobacterial exotoxins, most of which are somewhat specific to their target organ system.The most likely explanation for the ready attribution of these illnesses to cyanobacterial LPS lies in the realisation that LPS from Gram-negative heterotrophic bacteria are implicated in significant morbidity \u2013 and mortality \u2013 so cyanobacteria, which are widely but somewhat inaccurately accepted as Gram-negative bacteria may equally be responsible for illness because they contain LPS. Codd makes such a proposition, suggesting that: \"The LPS of other bacteria are associated with gastroenteritis and inflammation problems and it is thought that cyanobacterial LPS may contribute to waterborne health incidents although this possibility has not been adequately investigated\" .There is a risk that speculative attribution of symptoms in humans to environmental exposure to cyanobacterial LPS will continue without an appropriate and specific research foundation. This review will attempt to examine more closely the mechanisms by which LPS from Gram-negative heterotrophic bacteria is associated with morbidity, and compare and contrast cyanobacterial LPS and heterotrophic bacterial LPS.Anabaena variabilis they investigated was Gram-positive, \"like other blue-green algae...\". Drews [Most references to cyanobacteria describe these organisms as Gram-negative prokaryotes ,22-26. W\". Drews  also cla\". Drews  reviewed\". Drews ,32, and \". Drews  and Gole\". Drews  suggest \". Drews , electroAphanizomenon flos-aquae as an \"alkaloid endotoxin\". Gentile & Maloney [While most references to endotoxin in the cyanobacteria literature , a core oligosaccharide featuring an outer and inner region, and an acylated glycolipid (termed lipid A) \u2013 is seen in such ecologically diverse bacteria as hizobium . The O-shizobium , while lhizobium   in two ester-linked fatty acids [R. sphaeroides and R. capsulatus is of pharmacological interest because of their LPS-antagonist properties; these lipid A structures and some synthetic derivatives have been shown to be potent LPS antagonists in vitro and to protect against LPS-induced morbidity and mortality in animal models [Rhodopseudomonas viridis and Rhodopseudomonas palustris are also reported to lack endotoxic activity [Rubrivivax gelatinosus, is reportedly associated with high lethality in mice \u2013 at similar doses that cause lethality in Salmonella \u2013 and high pyrogenicity in rabbits [R. gelatinosus is apparently due to the presence of six fatty acid groups in the lipid A structure [Chlamydia trachomatis and Legionella pneumophila and the non-pathogenic hyperthermophile Aquifex pyrophilus reportedly possess little or no LPS agonist or antagonist properties [Although the basic structure of lipid A is seen in phylogenetically diverse Gram-negative bacteria, variations in the nature and location of acyl groups or alterations in the hydrophilic backbone can result in partial or total loss of biological activity ,63,82,83tivation ,52,63,84l models ,63,78,85activity ,84, but  rabbits ,84. The tructure . Lipid ABacteroides spp., which are common gut and periodontal commensals, have low endotoxic activity compared to that of Salmonella, with a greater than 500-fold higher mouse LD50 and 100 to 1,000-fold reduced ability to stimulate production of IL-1 in monocyte cultures [Bacteroides fragilis LPS inhibits E. coli LPS-induced endothelial adhesiveness for polymorphonuclear leucocytes, although B. fragilis LPS is reported to be directly toxic to endothelial cell cultures at high concentrations [B. fragilis stimulated IL-1\u03b2, IL-6 and IL-1ra at levels comparable to Gram-positive bacteria, where 100 to 1,000-fold more organisms are required to produce similar concentrations of cytokines than with common pathogenic Gram-negative bacteria. Wilson et al [B. fragilis may be such a weak cytokine inducer because, being a dominant organism in normal gut flora, it has evolved mechanisms to downregulate the synthesis of inflammatory cytokines in order to optimise their niche in the host gut. B. fragilis has five fatty acyl groups in the lipid A moiety, and other structural differences to Salmonella and E. coli LPS, such as a monophosphorylated disaccharide backbone and longer fatty acyl chains [cultures ,88. Bacttrations . In a sttrations  showed ton et al  suggest l chains .Neisseria, Haemophilus and Bordetella have developed unique surface glycolipids lacking O-antigens, which some workers call lipooligosaccharides [Some pathogenic bacteria have LPS which reflects the highly specific niches they inhabit: enteric Gram-negative bacteria have long, hydrophilic and neutral O-specific polysaccharide chains which protects the organism from solubilisation by bile acids and intestinal enzymes, whereas organisms that colonise the mucous membranes of the respiratory and genital tracts have outer membrane surfaces that are hydrophobic and can be solubilised by bile ,93. Gramcharides ,92,93.E. coli, Salmonella typhimurium, Haemophilus influenzae and Neisseria meningitidis were shown to have reduced activities in a series of tests relating to endotoxic potential, in some cases by greater than two orders of magnitude, and deacylated Neisseria LPS demonstrated some antagonistic activity towards Neisseria and Salmonella LPS [The presence of one or more secondary acyl chains appears to be essential for lipid A to stimulate some endotoxic reactions ,88. One ella LPS ,95,96.E. coli lipid A, is unable to induce cytokines in human cells [R. capsulatus) conforms to lamellar structures, whereas endotoxic lipid A adopts exclusively cubic or hexagonal structures.The lipid A analog, compound 406, which lacks the two secondary fatty acids of an cells ,51,75. RNetea et al  suggest R. gelatinosus, which has high endotoxic activity [Chromobacterium violaceum forms a cylindrical geometry and is reportedly three orders of magnitude less active than E. coli lipid A [C. violaceum lipid A had markedly lower cytokine-inducing capacity than an E. coli-based synthetic lipid A. These findings are in contrast to some other reports, which describe C. violaceum lipid A as having a high agonist activity [C. violaceum and R. gelatinosus are very similar  [C. violaceum lipid A is an LPS antagonist, whereas R. gelatinosus lipid A expresses high agonist activity. Seydel et al[Campylobacter jejuni, which has low endotoxic potential, shows a very slight tendency to adopt a conical/concave shape, whereas the lipid A of E. coli clearly adopts a conical/concave form [More recent work by Seydel and collaborators has led to the realisation that the biological activity of specific lipid A structures can be determined by an understanding of their supramolecular structure, which is a function of the monomeric conformation, which in turn is largely determined by the primary molecular structure ,99,100. activity ,84, was activity . Lipid A lipid A . Ulmer e lipid A  also fouactivity ,75. Of idel et al suggest ave form .As a result of these studies, the ability of a lipid A monomer to adopt a conical shape  has been described as a prerequisite for endotoxicity . Seydel The discussion above has contrasted the endotoxic potential of lipid A structures from the most widely studied forms, those of the Enterobacteriaceae, with some unusual lipid A complexes from photosynthetic bacteria and synthetic lipid A analogs. The reason that cyanobacterial LPS has not been discussed here is simply that the required research has not been done as yet. No cyanobacterial lipid A structures have been published, therefore no inferences can be deduced as to their likely endotoxic potential, or lack of it. But with the knowledge that endotoxic potential can vary in the most fundamental way across Gram-negative bacteria, from agonistic to weakly active to inactive to antagonistic, it should be incumbent on the cyanobacteria research community to cease attributing biological activity and clinical symptoms to cyanobacterial LPS without specific research evidence. Cyanobacteria may not be typical Gram-negative organisms because of their unusual cell wall architecture, and cyanobacteria will have experienced very different selection pressures to gut-dwelling Gram-negative bacteria, which may be reflected in different lipid A structures.in vitro studies of isolated cell lines or animal and human studies where LPS is exposed to the circulation by parenteral injection.Much research into LPS and lipid A has understandably concentrated on the severe, life-threatening host responses to circulating LPS that constitute Gram-negative septicaemia and septic shock. Many experimental models have utilised either The matter of the degree to which cyanobacterial LPS/lipid A can stimulate mammalian cytokine networks under experimental conditions, which remains largely unanswered, is only one aspect in the understanding of cyanobacterial LPS and the gastro-intestinal, respiratory and cutaneous illnesses which have been attributed to contact with it. The other side of the story that needs to be considered is the mechanism by which cyanobacterial LPS might (and might not) stimulate endotoxic responses by the various natural exposure routes: ingestion, inhalation and contact. The following discussion will briefly review the association between acute gastrointestinal illness and Gram-negative bacterial LPS. Cutaneous responses to LPS will be briefly discussed.Infectious diseases caused by bacteria are characterised by several discrete steps: bacterial adhesion to the host, colonisation within or on the host, and evasion of host defences ,49. The \u2022 Rank -109 put Microcystis aeruginosa is the causative organism of the mostly tropical, water-exposure-related invasive disease rhinosporidiosis. However, this theory has been disputed; convincing and probably conclusive evidence appears to place the eukaryotic protist Rhinospiridium seeberi as the causative organism .Most public health workers would presumably place cyanobacteria-related illnesses in the context of environmental exposures, as distinct from familiar diseases due to communicable infectious bacteria, which in many cases feature transmissible illnesses, secondary to the original reservoir of infection. Cyanobacteria-related illness is viewed as intoxication, rather than infection, usually on the basis of a sudden onset of symptoms occurring soon after exposure (i.e. without an incubation period), and lack of secondary cases . GieseckNausea and vomiting are normal physiological responses to the ingestion of toxic substances; they are essential defences because they are the end result of the actions of sensorimotor systems that operate to identify and rapidly expel hazardous substances from the upper G-I tract -117. TheE. coli LPS is a potent emetic stimulant. In a series of experiments using piglets, Girod et al [Circulating od et al  showed tod et al .The area postrema is reported to be the primary sensory area involved in nausea as well as vomiting, although nausea is accompanied by autonomic excitation, whereas vomiting is a somatic process independent of the autonomic nervous system ,121. PreTo investigate vomiting associated with exposure to cyanobacteria, the appropriate research efforts should determine whether cyanobacterial LPS is capable of stimulating gut chemoreceptors, or if cyanobacterial LPS can gain access to the circulation and stimulate nausea and vomiting centrally. Another point of interest should be directed towards the cyanobacterial exotoxins, as to their capacity to stimulate either gut mucosal chemoreceptors, vascular emetic chemoreceptors, or whether they induce vomiting through the activity of endogenous mediators. Bacterial exotoxins such as staphylococcal enterotoxins (SEs) are known to stimulate emesis via gut chemoreceptors ,117,124.One inference that can be drawn from the references that posit cyanobacterial LPS as the cause of G-I illnesses  to LD80 concentrations of 10\u201323 mg/kg [Literature searches using PubMed and Web of Science with the search terms  AND (LPS OR endotoxin) revealed 17 publications that describe the extraction \u00b1 purification of cyanobacterial LPS. The Westphal hot phenol/water method was used in 15 of these studies (described in ). J\u00fcrgen23 mg/kg .Agmenellum quadruplicatum LPS, Schizothrix calcicola LPS and Anabaena flos-aquae LPS, but not by Oscillatoria tenuis LPS [A. quadruplicatum LPS led the study authors to describe Agmenellum LPS as \"a less effective endotoxin than Salmonella LPS\" [A. flos-aquae LPS was reportedly \"weakly positive\" [A. nidulans LPS for pyrogenicity in rabbits, reporting a tenfold lower response than that seen from E. coli LPS. Schmidt et al [Synechococcus strains for pyrogenicity, with maximum increases in rabbit body temperature of 1.5\u00b0C after injection of up to 1 mg/kg. The authors reportthat these doses are some three orders of magnitude higher than those required of Salmonella LPS to achieve the same effect. LPS extracted and purified by author IS [E. coli LPS. Cyanobacterial LPS doses of 7 mg/kg also initiated transient hypothermia and sickness behaviour, although at markedly lower intensity and duration than was seen with E. coli LPS at 4 mg/kg [In addition to lethality, various other toxicity endpoints were examined in some of the studies listed in Table nuis LPS -169. Thenuis LPS ,171. Howlla LPS\" . The Shwositive\"  tested Adt et al  also tesuthor IS  and alsouthor IS  were inv 4 mg/kg .S-transferases (GSTs) in Zebra fish embryos. They reported that cyanobacterial LPS reduced microsomal and soluble GSTs in vivo to a greater extent than LPS from E. coli or Salmonella typhimurium. The authors suggested that such reduction in GST availability may deleteriously affect the ability of organisms to detoxify microcystins, presumably through decreased utilisation of glutathione (GSH) for conjugation reactions. This would seem to be a reasonable assumption, although other interpretations of this finding are possible. While the GSH system is an essential intracellular redox buffer, preventing oxidative injury, it is also an important participant in many cellular functions, including DNA and protein synthesis, metabolism, cell growth and amino acid transport [Most workers concluded that the cyanobacterial LPS they examined were weakly toxic when compared to the activity of positive control heterotrophic bacterial LPS. The exception was the work of Best et al , who invransport ,176. Manransport . GSH is ransport -184. It ransport ,185-187.ransport ,189. Gluransport ,190. Dr\u00f6\"It is clear that GSH is one of the limiting factors that determine the magnitude of immunological functions in vitro and in vivo...we must be prepared to reevaluate one of the central dogmas concerning the role of GSH. GSH was viewed mostly as an important anti-oxidant that protects cells against oxidative stress\" .in vitro and in vivo. Animals treated for three days showed two-fold-plus increases in the same enzymes [So the findings of Best et al , where c enzymes ,193. We  enzymes , perhapsIn addition to the studies cited above, nine reports describe the isolation and purification of cyanobacterial LPS for various biomedical, biochemical or structural studies, but no toxicological endpoints were investigated ,194-200.Limulus amoebocyte (LAL) assay. This is a highly sensitive test, though there are trade-offs in terms of specificity, with other bacterial products such as peptidoglycan and glucan capable of registering positive responses [in vivo responses [E. coli LPS, and several were below the assay's detection limits. This suggests that the lipid A structures of these LPS have some significant and fundamental structural differences to endotoxic lipid A, as the LAL assay does not react to some unusual or modified lipid A structures [In addition to work done on isolated and purified LPS, some reports discuss the activity of cyanobacterial LPS by use of the esponses ,202,203.esponses . Seydel esponses  suggest esponses  had someructures .S. platensis has a long history of use as a foodstuff, dietary supplement and livestock feed additive, with its probable use dating back to the ninth century in Africa, and the 14th century in Mexico [Spirulina is classified taxonomically under the genus Arthrospira, order Oscillatoriales; A. maxima and A. fusiformis are grown commercially in mass culture, but usually designated as \"S. platensis\" [Spirulina was briefly reviewed along with that of other edible microalgae by Kay [Spirulina feeding were seen in multigenerational studies and mutagenicity tests. However, this appears to be a misinterpretation on the part of Kay [Spirulina is not harmful, and enhances various immune functions [n Mexico . Spiruliatensis\" . The useatensis\" , who cone by Kay , who cite by Kay  in statit of Kay , as Cifet of Kay  describet of Kay  were unounctions -214.Spirulina, presumably on a regular basis. Liver function tests showed a significant deterioration over the following three weeks, after which he was hospitalised. Although a physical examination was unremarkable, a liver biopsy revealed some degenerative changes. Serological studies for a range of viruses were negative. His medications and Spirulina were withdrawn, after which his hepatic function rapidly returned to normal. Hepatotoxicity in this case was attributed to consumption of Spirulina, on the basis of temporal relationships between liver function abnormality and recovery with consumption and withdrawal of Spirulina, although possible interaction effects with the medications would have been worth considering. This may have been the case with simvastatin, the cholesterol-lowering agent this individual was taking. Simvastatin causes increased proinflammatory cytokine production, and it can potentiate inflammatory responses induced by bacterial products [Spirulina pills in Canada in the early 1980s, though there was an indication that one individual's tablets had some bacterial contamination [A single case report is the exception to the rest of the literature. Iwasa et al  describeproducts . A briefmination .A. fusiformis in Kenyan soda lakes is capable of producing the cyanobacterial exotoxins microcystin-YR and anatoxin-a [A. fusiformis is the principal food source for these animals [Anabaena and Microcystis are also found in these lakes, and periodically dominate the phytoplankton profile [Recent work has demonstrated that atoxin-a ,219. The animals ,221. Com profile , so presArthrospira spp. illuminates the importance of considering the route of exposure in toxicology studies, and the dangers in this case of presumptive inference of disease from the findings of parenterally administered LPS. Tornabene et al [Spirulina platensis LPS in the range of 400 mg/kg (i.p. mouse), although those findings are not supported by the work of Stewart, where Spirulina LPS i.p. injections of 350 mg/kg failed to induce either thermoregulatory change or sickness behaviour signs [Spirulina were highly toxic to mice when administered by intraperitoneal injection.The long-standing and widespread consumption of ne et al  reportedur signs . Howeverur signs  reportedAphanizomenon flos-aquae was over a decade ago reportedly \"consumed by thousands of people without incident\" [Microcystis spp., and some A. flos-aquae end-product batches contaminated with microcystins have since been found [Aphanizomenon, Spirulina and unidentified cyanobacteria) but did not present the results according to the component genera, so it is not clear whether Spirulina products  contained microcystins [Nostoc commune, a terrestrial cyanobacterium, has a long history of use in China and Scandinavia as food and medicine [Other cyanobacteria are consumed as foods, medicines and dietary supplements. Wild-harvested ncident\" , althougen found -227. A Cocystins . Nostoc medicine . The widPseudomonas spp., colonised water spray systems in the facility, and increased endotoxin in bio-aerosols was linked to the illnesses.In our opinion, the sole natural exposure route that might explain aquatic cyanobacterial LPS-related illness is via inhalation of aerosolised cells or fragments. Extrapolating from the understanding of Gram-negative bacterial LPS on the respiratory system  in the bronchial tree. Microcystin-LR appears to be able to efficiently gain access to the circulation by both intranasal and intratracheal routes -248, butCyanobacterial exotoxins may have the capacity to generate respiratory illness in non-atopic individuals, with endotoxins from cyanobacteria or commensal bacteria possibly augmenting the symptoms. The potential for cyanobacterial and/or contaminant endotoxin alone to produce symptoms by inhalation exposure remains open, given the observation that LPS can produce measurable airway function changes in animal models and in some healthy individuals ,252-254.Rubrivivax gelatinosus, as discussed above. A similar example is given by another group of non-pathogenic bacteria, Rhizobium spp., the LPS from some of which are comparable to that of enterobacterial LPS in lethal toxicity and cytokine-inducing activity [Lipid A, the endotoxic moiety of LPS, was in previous decades thought to remain constant across different Gram-negative bacteria . This isactivity ,256. DetIn vivo studies of oral exposure to cyanotoxins would be well served by use of a vomiting-capable model, i.e. non-rodent experiments.From the discussion in this review, we will put the hypothesis that oral consumption of non-toxic cyanobacteria, i.e. absolutely or essentially free of any of the known cyanobacterial exotoxins, will not result in either vomiting or diarrhoea. This hypothesis would be falsified by experiments that show isolated cyanobacterial LPS or non-toxic crude extracts can cause gastrointestinal signs and/or pathology in a suitable model. Our impression is that reports of G-I symptoms in humans exposed to cyanobacterial products are indications of innate defences being signalled by exotoxins that have breached the intestinal barrier. Once this occurs, and gut permeability is sufficiently disrupted, LPS may well synergise the pathology of cyanotoxins, especially the hepatotoxins. From what little is known to date about the toxic potential of cyanobacterial LPS, i.e. that they are weakly toxic compared to those of the Enterobacteriaceae, gut-derived LPS would seem to be the more likely candidate for augmenting the pathology of cyanotoxins. There does not appear to be good evidence that cyanobacterial LPS are likely to initiate cutaneous reactions in healthy people exposed in recreational or occupational settings. Cutaneous reactions to cyanobacteria are discussed in detail elsewhere -259.Exposure to bio-aerosols containing cyanobacterial endotoxins may be worthy of investigation, but we are not convinced that cyanobacteria-related acute respiratory illness in non-atopic, non-allergic individuals is not equally or more likely to be explained by inhalation of cyanobacterial exotoxins. If some of the exotoxins turn out to possess ligands that stimulate innate immune responses (discussed further in ), then tIn conclusion, LPS of the Enterobacteriaceae are potent immunomodulatory and immunotoxic bacterial products that stimulate a wide variety of responses in mammals, not least of these being a desire to wax lyrical on the topic. Thus:\"Endotoxins possess an intrinsic fascination that is nothing less than fabulous. They seem to have been endowed by Nature with virtues and vices in the exact and glamorous proportions needed to render them irresistible to any investigator who comes to know them\" .And:\"The dual role of LPS as effector and target makes it a fascinating molecule which...still hides many miracles. It intrigues at the same time clinical, biological, chemical, and biophysical researchers...\".Facetiousness aside, these workers are pointing out that there is much to learn about the LPS of the most widely studied Gram-negative bacteria, these being the Enterobacteriaceae. The understanding of cyanobacterial LPS is utterly miniscule by comparison, and we urge caution before continuing to attribute such a disparate range of symptoms in humans to contact with these materials without the required research evidence. Weckesser, Drews and Mayer wrote in 1979 that:\"...the picture obtained with the Enterobacteriaceae cannot be assigned to other Gram-negative bacteria without detailed investigations. Considering the broad spectrum in morphological and physiological diversity of the many taxonomic groups of both photosynthetic bacteria and cyanobacteria, there is a wide open field for studies on the composition of their cell wall.\" .Ressom et al  stated t\"Given the enormous heterogeneity in LPS from Gram-negative bacteria there is every reason to suspect that the same will apply to cyanobacterial LPS and, due to their taxonomic distance apart, cyanobacterial LPS are likely to be different from those found in Gram-negative bacteria.\"We agree with these statements.CYP cytochrome P450DNA deoxyribonucleic acidG-I gastrointestinalGSH glutathioneS-transferaseGST glutathione IgE immunoglobulin EIL interleukini.p. intra-peritonealLimulus amoebocyte lysate assayLAL assay LBP lipopolysaccharide-binding proteinLD lethal doseLPS lipopolysaccharide/sSEs staphylococcal enterotoxinsTh cell T-helper cellTLR Toll-like receptorTNF-\u03b1 tumour necrosis factor-alphaThe author(s) declare that they have no competing interests.IS conducted the review; PJS and GRS supervised the work and contributed to redrafting the paper. All authors read and endorsed the final manuscript."}
{"text": "Arabidopsis thaliana accessions implicated FLOWERING LOCUS C (FLC) as a circadian-clock regulator. The MADS-box transcription factor FLC is best known as a regulator of flowering time. Its activity is regulated by many regulatory genes in the \"autonomous\" and vernalization-dependent flowering pathways. We tested whether these same pathways affect the circadian system.The circadian system drives pervasive biological rhythms in plants. Circadian clocks integrate endogenous timing information with environmental signals, in order to match rhythmic outputs to the local day/night cycle. Multiple signaling pathways affect the circadian system, in ways that are likely to be adaptively significant. Our previous studies of natural genetic variation in FLC, were found to regulate circadian period in Arabidopsis. The mechanisms involved are similar, but not identical, to the control of flowering time. By mutant analyses, we demonstrate a graded effect of FLC expression upon circadian period. Related MADS-box genes had less effect on clock function. We also reveal an unexpected vernalization-dependent alteration of periodicity.Genes in the autonomous flowering pathway, including FLC's role in the clock, as it reveals that the network affecting circadian timing is partially overlapping with the floral-regulatory network. We also show a link between vernalization and circadian period. This finding may be of ecological relevance for developmental programing in other plant species.This study has aided in the understanding of  Most eukaryotes and some prokaryotes have evolved a circadian clock to adapt to the 24 h day/night cycle. These clocks drive biological rhythms in many aspects of metabolism, physiology, and behavior, all with a period close to 24 h . CircadiCircadian clocks, including those of Arabidopsis, are reset by light and temperature signals in a characteristic fashion that entrains the clock to the local time in its environment . HoweverA circadian clock maintains accurate timing because it is buffered against many environmental changes, yet several environmental-signaling pathways must affect the circadian oscillator for entrainment to occur. Limiting the input connections to the circadian clock from the rest of the plant-signaling network provides a potential mechanism to balance the opposing requirements of homeostasis and entrainment. In the gene network that regulates flowering time, for example, the circadian clock is an integral part of the photoperiodic sensor, receiving input from light signaling ,4. Curreerecta (Ler) and Columbia (Col) \u00d7 Ler [FLOWERING LOCUS C (FLC). The Ler allele of FLC is weakly functional due to a transposon insertion within an intron of FLC [er as one parent, therefore FLC function segregates in these recombinant populations [er allele of the QTL shortened the circadian period by 0.8 h, as did independent flc mutant alleles, leading us to conclude that the known allelic variation in FLC could account for the QTL [Substantial natural variation has been detected in clock-affecting genes, based upon assays of rhythmic leaf movement under constant light -11. Thisl) \u00d7 Ler . In eachn of FLC ,13. The ulations . The Ler the QTL .FLC encodes a MADS-box transcription factor that had no known function in the circadian clock, but was well-characterized as a repressor of flowering. FLC expression is enhanced by FRIGIDA (FRI) and its paralogues, which are active in many late-flowering accessions [FLC transcription is suppressed by genes of the autonomous floral-promotion pathways and by prolonged cold temperatures . As FLC RNA abundance correlates with repression of flowering time and quantitatively mediates the vernalization response of flowering time [FLC expression levels similarly regulated the circadian clock. To assay the plant's endogenous circadian period, rhythmic movement of the primary leaves of Arabidopsis seedlings were measured by video imaging under constant white light. Relatively large numbers of plants were tested in replicate experiments in order to increase the sensitivity of the assays, allowing us to detect small changes in circadian period . FLC RNA abundance was manipulated by two methods. Firstly, we tested a line expressing FLC from the CaMV 35S promoter (35S:FLC). This transgenic construction strongly delays flowering time. The 35S:FLC line had a circadian period lengthened by over 1 hour in multiple experiments  , all uniformly in a Col background. These comprised the functional allelesFRI-Sf2 and FLC-Col (FRI and FLC) and recessive alleles fri-Col and flc-3 (fri and flc) [FLC had a lengthened circadian period compared to flc lines  [FLC lengthened circadian period in both FRI and fri backgrounds. Our findings are also consistent with the function of FLC in flowering time. fri;FLC plants flower slightly later than fri;flc mutants under non-inductive photoperiods, indicating FLC can function independently of FRI in the floral pathway [FLC transcript is therefore sufficient to increase the circadian period of the plant. The greater effect of 35S:FLC compared to endogenous FLC suggests that increasing FLC RNA levels increase circadian period in a graded manner, similar to FLC's dose-dependent delay of flowering [FLC expression in 35S:FLC plants contributed to this result, though such effects on the location of FLC expression have not previously been implicated in flowering-time control.ing time . We sougand flc) . Lines h. (1999) , who sholowering ,18. It mFRI caused an additional increase in period in the presence of functional FLC . This indicates that FRI can increase circadian period weakly and less consistently than FLC. In contrast, functional FRI strongly enhances FLC RNA levels and severely delays flowering [FRI does not enhance FLC expression in the cells that regulate leaf movement as much as 35S:FLC.We suggest that functional C Figure . Althouglowering ,18, highFLC expression levels, including the genes of the autonomous pathway, would affect circadian period. In order to compare the network of circadian regulators to the pathways that regulates flowering time, we analyzed the circadian period of plants carrying mutations in several genes of the autonomous flowering-time pathway .FCA is one of the genes that defines the autonomous flowering-time pathway. FCA encodes a nuclear-localized protein with RNA recognition motifs. It is involved in 3' RNA processing of FCA transcripts through physical interaction with the FY protein [FCA promotes flowering by repression of FLC RNA levels [fca lesion have high levels of FLC RNA and flower late. Assays on fca mutants revealed an increase in circadian period of nearly 1 hour compared to the Col-0 wild-type , in line with the hypothesis that elevated FLC levels increase circadian period    . To test whether this was due to an increase in FLC activity in the mutant, we assayed the fve; flc double mutant. We found a statistically insignificant decrease in circadian period (0.24 h) in the double mutant compared to the fve single mutant , so the period of the fve; flc double mutant retained a significantly lengthened period  compared to the wild type, and this modest effect was not statistically significant   Figure , Table 2e dosage , FPA int pathway , and has pathway . These dSOC1  is a MADS-box gene that activates flowering, in response to signals from the autonomous and photoperiodic flowering-time pathways [SOC1 is described as a target of FLC-mediated transcriptional repression in the flowering-time pathway [soc1 mutant has a small increase in circadian period relative to wild type , indicating that SOC1 normally shortens circadian period . The resulting period of soc1; flc was identical to that of Col  , is the member of this family with the highest level of identity with FLC [FLM to have a similar function in the repression of flowering as FLC. However, unlike FLC, FLM expression is not increased by FRI, and FLM does not contribute to the vernalization requirement [flm mutant revealed that it had no circadian defect (P = 0.69)  in repressing flowering time [svp mutant showed a significant lengthening in period of 0.7 h compared to wild type  . We found in duplicate experiments that vernalization consistently decreased circadian period (P < 0.001) but that none of the single-gene or gene interaction effects was significant .e Spring . flc mutresponse , which mresponse . Based ot Figure  and 4. TFLC itself, modulate the period of a circadian clock in Arabidopsis. The effects on period are modest, but our data measurements are accurate, as detected in plots of relative amplitude error (RAE) versus period length for individual cotyledon traces of a genotype in an experiment  [fve-4, fve-4;flc-3 [ld-1, ld-1;flc-3, fpa-7 [flm [ld-3 [fca-9 [svp-41 [ld-1 from the Nottingham Arabidopsis Stock Centre. 35S:FLC ; soc1-2,0;flc-3) ;fve-4, f-4;flc-3 ;ld-1, ld3, fpa-7 . Mutantsa-7 [flm , ld-3 [2lm [ld-3 . We are 3 [fca-9  from Car [svp-41  from Petet al. 1995 [-2sec-1 continuous cool white fluorescent light for 7 days, at 21\u201322\u00b0C, followed by entrainment to three 12 h-light, 12 h-dark cycles. Growth of the first pair of primary leaves was recorded under 30\u201340 \u03bcmolm-2sec-1 continuous cool white fluorescent light, at 21\u201322\u00b0C for 7 days. Seedlings were arranged randomly with respect to genotype within each experiment, to avoid positional bias in the imaging arrays. For vernalization, stratified seed were germinated for 4 days, as described above (at which point cotyledons were expanding), then incubated at 2\u00b0C for 8 weeks under low-intensity white light (0.5\u20131.0 \u03bcmol m-2sec-1). After the vernalization treatment, seedlings were transferred to continuous light for 4 days, then entrained and imaged as above. In order to confirm the effectiveness of vernalization, imaged seedlings were transferred from agar to soil immediately after the leaf-movement assay. Flowering time of these lines was measured as the number of rosette leaves when the floral bolt was 1 cm high. These studies confirmed the expected effects of FLC and FRI upon vernalization-responsiveness (data not shown).Seedlings were grown and followed by assays of rhythmic leaf movements by video imaging, as described by Dowson-Day and Millar, 1999; Millar al. 1995 ,49. Brieal. 1995  that incFRI-FLC interactions and vernalization effects on period were assessed using the Wald test with variances derived from REML. The significance of the differences between the mean period of pairs of genotypes was assessed using the standard error of each difference, derived from REML. Figures Leaf movement data were analyzed by Fast Fourier Transform non-linear least squares program FFT-NLLS , essentiNS, AJM, and SJD conceived the experiments and wrote the paper, with critical experimental and intellectual revisions from SDM and RMA. SDM and RMA generated reagents. NS carried out the experiments. JRL conducted statistical analysis.Robustness of rhythmicity of all lines examined MS EXCEL file containing 3 worksheets. These include RAE plots for all genotypes examined (sorted with respect to Figure Click here for file"}
{"text": "The first Japanese case of fibrolamellar carcinoma (FLC) of the liver is described. The 17-year-oldJapanese male affected died of the disease 25 months after palliative operation. The diagnosis of FLC hadnot been confirmed before autopsy. Pre-operative diagnosis of FLC is important to surgeons. Acccordingto the literature, FLC is rare in Asia. The endemic discrepancy may suggest that the carcinogenic factorsare different from those of general hepatocellular carcinoma."}
{"text": "Escherichia coli and Salmonella lipopolysaccharide are modified by membrane enzymes including ArnT, EptA and LpxT. ArnT and EptA catalyse the periplasmic addition of the positively charged substituents 4-amino-4-deoxy-L-arabinose and phosphoethanolamine respectively. These modifications are controlled by the PmrA transcriptional regulator and confer resistance to cationic antimicrobial peptides, including polymyxin. LpxT, however, catalyses the phosphorylation of lipid A at the 1-position forming 1-diphosphate lipid A increasing the negative charge of the bacterial surface. Here, we report that PmrA is involved in the regulation of LpxT. Interestingly, this regulation does not occur at the level of transcription, but rather following the assembly of LpxT into the inner membrane. PmrA-dependent inhibition of LpxT is required for phosphoethanolamine decoration of lipid A, which is shown here to be critical for E. coli to resist the bactericidal activity of polymyxin. Furthermore, although Salmonella lipid A is more prevalently modified with l-4-aminoarabinose, we demonstrate that loss of Salmonella lpxT greatly increases EptA modification. The current work is an example of the complexities associated with the structural remodelling of Gram-negative lipopolysaccharides promoting bacterial survival.During its transport to the bacterial surface, the phosphate groups of the lipid A anchor of  Lipopolysaccharide (LPS) is a complex bacterial surface structure that is composed of lipid A, a core oligosaccharide, and the O-antigen polysaccharide. LPS is characterized by its endotoxicity, which is provided by the lipid A domain, a hydrophobic molecule that anchors LPS to the outer membrane . Given tSalmonella and Escherichia coli consists of a \u03b2-1\u2032-6-linked glucosamine disaccharide backbone bearing six fatty acyl chains, that is phosphorylated at the 1 and 4\u2032 positions. This molecule is further glycosylated at the 6\u2032-position with two 3-deoxy-d-manno-octusolonic acid (Kdo) moieties that link the lipid A domain to the remaining polysaccharide of LPS  and phosphoethanolamine (pEtN) respectively   species is mediated by the undecaprenyl phosphotransferase, LpxT (3+) (3+) . Under these conditions PmrA activation is mediated by a second two-component system, PhoP\u2013PhoQ. According to the proposed mechanism, activation of PhoP in Salmonella induces the synthesis of PmrD, which regulates PmrA activity post-transcriptionally by preventing dephosphorylation of PmrA  . Other s of PmrA . It was  as previously described (2+ (0.01\u20130.1 mM) produced lipid A species modified with L-Ara4N and pEtN, but lacking 1-PP (2+ (1\u201310 mM) concentrations  medium supplemented with increasing concentrations of FeSO4. Fe2+ is quickly oxidized to Fe3+ serving as a specific signal for activation of the PmrA\u2013PmrB system  harbouring a PmrA constitutive (PmrAc) phenotype , CH040 (\u0394arnT) and the double mutant CH034 (\u0394arnT\u0394eptA) in the W3110 background. 32P-lipid A profiles were evaluated in cells grown in LB medium supplemented with 200 \u00b5M FeSO4 (eptA), strong induction of single L-Ara4N modification was observed (arnT), both single and double pEtN-lipid A substitutions were evident (eptA) grown in Fe3+ produced a peak at m/z 1928.8 atomic mass units (amu) indicative of L-Ara4N modification (arnT) produced major peaks at m/z 1920.8 and 2043.5 amu corresponding to the predicted pEtN modified species (3+ induction (data not shown). Similar lipid A profiles were obtained in N-minimal medium containing 10 mM Mg2+, at pH 5.8 (eptA or arnT mutants. Only in the double mutant CH034 (\u0394arnT\u0394eptA) could any 1-PP lipid A be detected , CH040 (\u0394eptA) and the double mutant CH034 (\u0394arnT\u0394eptA) were similar to that of wild-type (data not shown).We examined whether inactivation of ArnT or EptA, or both, would restore LpxT-dependent phosphorylation of lipid A. For this purpose, we created the isogenic strains CH030  background (pmrAc background even in strain WDarnTeptA (lane 5). Moreover, single and double pEtN-lipid A species were highly induced compared with L-Ara4N-lipid A substitutions  gene is downstream of the yeiR gene separated by only 38 bp. To elucidate whether both genes are transcribed into the same mRNA, yeiR and lpxT transcripts were evaluated by reverse transcription-PCR  was reported to be under PmrA-regulation  harbouring these plasmids were grown in LB medium supplemented with or without 200 \u00b5M FeSO4 (lpxTp (lpxT promoter) was not upregulated in the presence of Fe3+. Furthermore, W3110 and CH020 (\u0394pmrA) did not exhibit differences in lpxTp activation. Contrary, eptAp (eptA promoter) was induced sevenfold in the presence of Fe3+, and this induction was lost in strain CH020 (\u0394pmrA). These data confirmed that eptAp was activated in a PmrA-dependent manner. Background activity from plasmid pRS415 was limited to 50\u201380 units or lower in the negative controls, which is consistent with the reported plasmid background  strains when grown in LB medium (data not shown). These results confirm that PmrA does not regulate lpxT transcription.To perform \u03b2-galactosidase assays, the 250 bp upstream region of \u00b5M FeSO4 . Our res8 or 7.5 . Again, lpxT at the transcriptional level, growth conditions promoting PmrA activation result in inhibition of LpxT-dependent phosphorylation of lipid A in whole cells. To determine if LpxT is successfully assembled into the membrane, we monitored the expression of a chromosomal lpxT\u2013gfp fusion protein under the control of its native promoter in strain CH01. The fusion protein was also expressed in strain CH021 . LpxT\u2013GFP was fully functional in whole cells as indicated by the production of 1-PP lipid A  and CH020 (\u0394pmrA) strains were prepared from cultures grown in LB medium with or without 200 \u00b5M FeSO4. Phosphorylation of lipid A by LpxT was evaluated using [4\u2032-32P]Kdo2-lipid A  catalysed phosphate addition to [4\u2032-32P]Kdo2-lipid A even under Fe3+ inducing conditions (3+) PmrA is necessary for the loss of LpxT activity in the bacterial membrane. A more hydrophobic reaction product resulting from the PagP catalysed transfer of palmitate  was grown under Fe3+ inducing conditions there was an unexpected increase in pEtN modification of lipid A with a concomitant loss of L-Ara4N modification compared with wild-type  expressing pWSK29 plasmid-born lpxT were evaluated  . On the other hand, pEtN addition is lost upon introduction of plasmid born LpxT even under Fe3+ inducing conditions. Together, these results suggest that even though LpxT activity is inhibited during PmrA activation it is possible to overcome this inhibition by overexpression of the protein.As we reported previously  , lane 3.6RP-(X12\u201354)-PSGH-(X31\u201354)-SRX5HX3D (190) within the predicted active site of LpxT (WT) and the H190A (LpxTH190A) mutant were expressed in plasmid pWSK29. EptA was expressed in plasmid pACYC184 (pACeptA) avoiding plasmid incompatibility. Expression of LpxTH190Ain trans was unable to complement the loss of 1-PP in strain MST01 (\u0394lpxT) (WT (lane 4). Coexpression of LpxTWT and EptA produced both 1-PP and pEtN-lipid A species, with LpxTWT clearly the predominate activity (lane 6). In contrast, coexpression of LpxTH190A and EptA led to extensive double pEtN modification (lane 7) identical to that seen when EptA was expressed alone (lane 8). The latter result was confirmed by mass spectrometry (data not shown) yielding similar results to those shown in EptA and LpxT are both inner membrane proteins with their active sites located in the periplasmic compartment  , lane 5 E. coli plays a role in polymyxin resistance in a cpmrA background using strain WD101. The minimal inhibitory concentrations (MICs) were determined on LB agar using ETest polymyxin B strips (pmrAc) was 40-fold more resistant to polymyxin compared with its isogenic parent, W3110. Loss of arnT, which still allows for the synthesis of single and double pEtN modifications  unable to modify its lipid A with either L-Ara4N or pEtN was slightly more resistant  than wild-type E. coli   . This sl\u00b5g ml\u22121) . Finallyfication  and compfication . MICs wefication .E. coli, we performed a comparative analysis of the lipid A profiles of Salmonella typhimurium LT2 (wild-typeST) and its isogenic mutant CH05 (\u0394STlpxT)  . In SalmST, both 1-PP and L-Ara4N modified lipid A were easily detected, whereas pEtN modification was less evident (STlpxT (strain CH05) there was a drastic increase in lipid A modifications even in the absence of iron induction with pEtN modification predominating (3+ induction promoted L-Ara4N modification and inhibited LpxT modification in wild-type LT2 (lane 7), whereas in strain CH05 (\u0394STlpxT) pEtN modification was again increased (lane 10). The identification of Salmonella lipid A species was based upon previous reports (STarnT), CH07 (\u0394STeptA), and CH057 . The doubly modified lipid A species prevalent in the \u0394STlpxT background during Fe3+ induction were lost upon introduction of \u0394STeptA (lane 11). On the other hand, deletion of eptA in the wild-type background had little effect on the lipid A profile (lane 8). Here again, these data support a role for LpxT in the reduction of EptA activity. Furthermore, loss of functional Salmonella LpxT results in a shift from lipid A species primarily modified with L-Ara4N to modification with pEtN.In wild-type evident , lane 1.minating , lane 4. reports ; 2001; aE. coli and Salmonella, the PmrA\u2013PmrB and PhoP\u2013PhoQ two-component systems are primarily responsible for regulating the expression of the molecular machinery required for the structural modification of LPS. PmrA controls synthesis of both ArnT and EptA, two inner membrane enzymes that modify the phosphate groups with amine-containing substituents by the addition of L-Ara4N  and increasing the overall negative charge of the bacterial surface  were the same in both wild-type (W3110) and PmrAc (WD101) strains. These data are supported further by microarray analysis in pmrAc and pmrA null mutants where levels of lpxT transcripts did not change in cells grown in 400 \u00b5M Fe3+-containing LB medium  L-Ara4N addition drastically decreases and pEtN modification predominates, indicating the ability of LpxT to inhibit EptA modification in Salmonella as well. Previously, it was shown that EptA  did not play any significant role in providing resistance to CAMPs in S. typhimurium . Other membrane phosphatases are dedicated to the hydrolysis of Und-PP ;, and somotility . A proteE. coli K-12 strains were grown at 37\u00b0C on LB broth or agar (DIFCO), or N-minimal medium containing 0.1% casamino acids and 38 mM glycerol , kanamycin (30 \u00b5g ml\u22121), chloramphenicol (30 \u00b5g ml\u22121) and polymyxin B were used where appropriate.All relevant strains are listed in RPfuTurbo DNA polymerase (Stratagene) or Takara Ex Taq DNA polymerase (Takara). PCR products were isolated from agarose gels using QIAquick PCR gel extraction kit. Primers were purchased from Invitrogen. All restriction endonucleases and T4 DNA ligase were purchased from New England Biolab. Total RNA was extracted with Trizol Max bacterial RNA isolation kit (Invitrogen) from cells grown in LB up to an OD600 of 1.0. RNA was treated with RQ1 RNAse-free DNAse (Promega) to eliminate DNA contamination. RNA quality was evaluated by gel electrophoresis (Genomic DNA was extracted with Easy DNA Kit (Invitrogen). Plasmid DNA was purified with QIAGEN Spin Prep Kit (Stratagene). DNA fragments were amplified using phoresis . cDNA syvir phage transduction was used to move selectable deleted genes from the donor DY330 strain to the recipient W3110  according to the manufacturer's instructions with plasmid pWSlpxT as the template. Primers LpxTA190-S and LpxTA190-A were used to mutate amino acid H190 to A190 resulting in plasmid pWSlpxTH190A.Site-directed mutagenesis of 4. Membrane pellets from cells lysed by French Press were homogenized and washed twice as previously described (Cells expressing the YeiU-GFP fusion protein were grown in LB with or without 200 \u00b5M FeSOescribed  and was 600 of 0.05 in 5 ml of fresh medium and labelled with 2.5 \u00b5Ci ml\u2212132Pi (Amersham) in LB broth or N-minimal media as indicated. Cells were harvested at an OD600 of 1.0 by centrifugation and the isolation of 32P-labelled lipid A carried out by mild acid hydrolysis as previously described (32P-lipid A species (\u223c10 000 cpm\u00b7per lane) were analysed by TLC in a solvent system of chloroform, pyridine, 88% formic acid and water  and visualized by phosphorimaging analysis (Bio-Rad PMI).Cultures were diluted to an OD600 1.0 served as the enzyme source. Membrane pellets were homogenized and washed twice as previously described (2-[4\u2032-32P]lipid A was prepared as previously described and served as the lipid acceptor (2-[4\u2032-32P]lipid A (\u223c5000 cpm nmol\u22121). Endogenous undecaprenyl-pyrophosphate within the membrane fraction served as the phosphate donor. The reaction mixture was incubated at 30\u00b0C for 1 h. Reaction products were analysed by TLC in a solvent system of chloroform, pyridine, 88% formic acid, water  and visualized by phosphorimaging analysis (Bio-Rad PMI).Double-washed membrane fractions from cultures harvested at OD600 of 0.05. FeSO4 was added to starting dilutions for inducing conditions when necessary. Cells were harvested at mid-exponential phase (OD600 of 0.5\u20130.6) and \u03b2-galactosidase activity of bacterial lysates was determined as described by Bacteria were grown overnight in LB medium, washed in the same medium to be cultured, and diluted to an OD600 of 0.05 and applied to LB agar. Quantitative MIC values were determined using ETest gradient Polymyxin strips (AB Biodisk) after 24 h.Cells were grown overnight followed by a 1:100 dilution in LB. Cells were cultured up to exponential phase, diluted to an OD600 of \u223c1.0. Lipid A was released from cells and purified as previously described (Typically, 200 ml cultures of each strain were grown at 37\u00b0C until cultures reached an ODescribed  by the U"}
{"text": "Aspergillus and the ciliate Tetrahymena. In the former, a single Nek plays an essential role in cell cycle regulation; in the latter, which has more than 30 Neks in its genome, multiple Neks regulate ciliary length. Mammalian genomes encode an intermediate number of Neks, several of which are reported to play roles in cell cycle regulation and/or localize to centrosomes. Previously, we reported that organisms with cilia typically have more Neks than organisms without cilia, but were unable to establish the evolutionary history of the gene family.NIMA-related kinases (Neks) have been studied in diverse eukaryotes, including the fungus We have performed a large-scale analysis of the Nek family using Bayesian techniques, including tests of alternate topologies. We find that the Nek family had already expanded in the last common ancestor of eukaryotes, a ciliated cell which likely expressed at least five Neks. We suggest that Neks played an important role in the common ancestor in regulating cilia, centrioles, and centrosomes with respect to mitotic entry, and that this role continues today in organisms with cilia. Organisms that lack cilia generally show a reduction in the number of Nek clades represented, sometimes associated with lineage specific expansion of a single clade, as has occurred in the plants.This is the first rigorous phylogenetic analysis of a kinase family across a broad array of phyla. Our findings provide a coherent framework for the study of Neks and their roles in coordinating cilia and cell cycle progression. Never In Mitosis A from the fungus AspergillusAspergillus genome, plays multiple roles in cell cycle progression and localizes to the fungal equivalent of the centrosome, the spindle pole body The NIMA-related family of serine/threonine kinases (Neks) are widespread among eukaryotes. They are defined by similarity in their N-terminal catalytic domains to the founding member, Centrosomes are typically located near the nucleus in the centre of the cell, where they serve as organizers of the microtubular cytoskeleton during both interphase and mitosis Chlamydomonas and Tetrahymena regulate ciliary length and/or disassembly In mammalian cells, the elder centriole of the centrosomal pair often directly nucleates a cilium. Cilia have functions in both motility and sensory signaling Aspergillus as an ancestor to mammals. The assumption by these authors is that the last common ancestor of Fungi and Metazoa had one Nek, similar to NIMA, and this gene underwent an expansion in Metazoa and especially in mammals. This conflicts with previously published phylogenies Chlamydomonas and Tetrahymena. However, these earlier Nek phylogenies had few taxa and poor support at many nodes. We set out to establish a more complete Nek family tree, by sampling distantly-related phyla, by using Bayesian inference methods, and by testing specific hypotheses in a Bayesian framework. To our knowledge, no similar analyses have been published for a eukaryotic kinase family. Our results suggest that the last common ancestor of the eukaryotes, which must have been a ciliated cell able to divide The breadth of organisms in which Neks are found and the lack of sequence conservation outside the kinase domains has meant no large-scale phylogenetic analysis has been possible via traditional methods. Many authors refer to NIMA as \u201cancestral\u201d to the mammalian Neks, yet no eukaryotic phylogeny would ever place Species from a broad range of eukaryotic lineages, with publicly-available sequenced genomes, were selected for analysis . We genebona fide Neks, as they are outgroup to a clade containing multiple eukaryotic kinase families (not shown).In the course of our BLAST searching, we found some prokaryotic kinases which were reciprocal best hits with Neks. However, these sequences do not represent 6 generations, sampled every 100 generations, and run until the average standard deviation of split frequencies between the two runs remained below the 0.01 convergence threshold for at least 1\u00d7105 generations.\u00a0Ninety percent of each run was burned in before the parameters were analyzed. Human Cdk2 was used to root all trees in either Treeview We used the Metropolis-coupled Markov chain Monte Carlo program MrBayes v. 3.1.2 Chlamydomonas dataset we first analyzed the unconstrained dataset and obtained a harmonic mean of the log likelihood values of the MCMC samples (a priori imposed constraint (i.e. the hypothesis). To test hypotheses on the unikonts plus  samples .\u00a0We then samples , and recThalassiosira or the green alga Ostreococcus.We use the terminology of Cavalier-Smith Leishmania and Trypanosoma, as well in the genome of Giardia  all sequences recognized as having a Nek-like kinase domain had that domain at the N-terminus of the predicted protein; when C-terminal domains were predicted by SMART, these were always protein-protein interaction domains. These results are consistent with the view that Neks have rapidly-evolving C-terminal regulatory/interaction domains, allowing differential localization, regulation, or function in various lineages.Large numbers of Neks were found in the genomes of the kinetoplastids  Giardia . InclusiChlamydomonas Neks was the largest dataset we could analyze in a reasonable time (\u223c1 week on a desktop computer), while inclusion of the bikont Neks to produce the tree in A dataset consisting of the unikont Neks plus the a posteriori-defined clades, each of which contains representatives from most species tested and most of which have well-supported nodes  branch near the well-supported Nek2 clade .Addition of Nek sequences from other bikonts, as well as the (unikont) chytrid fungus rahymena \u20137. Thek2 clade . The Nekchytrium . Satisfyeria Nek . Similareria Nek , and nowChlamydomonas Cnk10p, Tetrahymena Nrk29 and Cryptosporidium cgd7 3760 are members of a well-supported Nek1/3/5 clade (posterior probability of 0.94). This suggests that some of the clades arising from the polytomy could be orthologous to members of the unikont Nek1/3/5 clade. Above, we provided additional evidence that Cnk10p is a Nek1/3/5 family member  of unikonts and bikonts most likely had at least five Neks and variations in the numbers of Neks in different lineages was due to expansion or loss of multiple Neks; this is a novel finding and changes our view of this kinase family and the relationships of its members. Second, this work confirms and extends our previous suggestion that Neks are more abundant in the genomes of organisms which must co-ordinate ciliary assembly and disassembly with respect to the cell cycle.Currently, there is a paucity of functional data relevant to the cell biology of the Nek family. Consequently, there is insufficient data available to discern clear roles for particular Nek subfamilies from comparison of the Nek repertoires. However, the availability of the relationships between the various Neks will make future research on any particular Nek more relevant to the field at large. While most Neks that have been studied are associated with cilia/centrosomes/cell cycle, we do not propose that all Neks subserve this triumvirate. Indeed, expansion of the subfamilies was inevitably associated with both loss of function and acquisition of new roles de novo when differentiating into gametes Giardia genome has >70 Neks; Giardia flagella undergo a complex maturation process which takes four cell cycles Although we cannot discern cellular roles for individual Nek subfamilies, it is clear that Neks are not required for the formation of centrioles or cilia. Diatoms, for example, make both of these organelles Given our phylogenetic results, ciliary and centrosomal Nek functions are likely to be ancestral and thus may be retained in phylogenetically distant organisms. The wide distribution of the Neks from both unikonts and bikonts suggests strongly that the Neks had already expanded in the eukaryotic LCA. We suggest deviations of the topologies of the Nek subfamilies from our analysis from the species tree may represent different evolutionary constraints in the various lineages.y correlated with the presence of ciliated cells which divide. The cell biology of the eukaryotic LCA can be partially inferred by applying the principal of parsimony to diverse extant eukaryotes: it is thus likely that the LCA was ciliated with a 9+2 axoneme and centrioles with triplet microtubules, and that the LCA could undergo both mitosis and meiosis Our conclusion that the LCA, which must have been a non-terminally differentiated ciliated cell, had at least five Neks, should be interpreted in two ways: first, we are discerning the nature of the eukaryotic LCA, which is distinct from the first eukaryote; second, the presence of several Neks in the LCA conforms well with our idea that this kinase family is ancestrallAlthough the relationship between cilia and the cell cycle is a long-standing problem in cell biology Table S1(0.03 MB DOC)Click here for additional data file.Figure S1Phylogram of the largest and most diverse dataset containing Leishmania and Trypanosoma sequences that was able to converge. This tree is rooted on HsCdk2. Please note that the majority of Leishmania and Trypanosoma Neks are members of a well-supported clade that includes HsNek8 (posterior probability\u200a=\u200a0.90).(1.05 MB TIF)Click here for additional data file.Figure S2Phylogram of Nek kinase domains from species listed in (1.16 MB TIF)Click here for additional data file."}
{"text": "Deep Sclerectomy is a non penetrating surgical procedure for the treatment of open angle glaucoma. In this article we will describe the surgical technique, the indications for surgery and will review the scientific literature on surgical outcome following this procedure. We will also discuss the important role played by antimetabolites, implants and the use of gonipuncture to achieve the desired IOP reduction. Over the past decades, non penetrating surgical procedures have been developed to improve the safety of glaucoma surgery. Deep sclerectomy (DS) has emerged as one of the more established non penetrating procedures and a growing body of evidence on its safety and efficacy has become available. Following DS, the aqueous outflow is enhanced by removing the inner wall of Schlemm's canal and juxta-canalicular trabecular meshwork, the structures responsible for most of the outflow resistance in open angle glaucoma. In this procedure a trabeculo-Descemet's membrane (TDM) is left intact to control aqueous outflow through the filtration site. This controlled pressure reduction is responsible for a better safety profile of DS with lower rate of complications related to over drainage and hypotony. The superior safety profile has been confirmed by several clinical studies and is now wildly accepted.The earliest reports on non penetrating filtering procedures were published in 1964 by KrasnovNon penetrating procedures were further refined in 1980s and 1990s. ZimmermannTo improve long term efficacy, DS has been further developed with the use of anti metabolites to reduce postoperative scarring and use of space-maintainer implants to keep the scleral lake open.Traditional glaucoma teaching places surgery as a procedure of last resort after medical and laser therapies. This is largely due to the relatively high complication rates and unpredictability of trabeculectomy.DS targets the site of highest outflow resistance in open angle glaucoma, namely the inner wall of Schlemm's canal and juxtacanalicular trabecular meshwork.12Neovascular glaucoma is an absolute contraindication to DS, as a fibro vascular membrane is formed over the irido-corneal angle making filtration through a TDM impossible. Cases of ICE syndrome are contraindicated for the same reason. A narrow angle is a relative contraindication to DS as proximity of the iris can lead to anterior synechia formation or iris incarceration following surgery. DS is also relatively contraindicated in eyes with damaged trabeculum  as surgical success relies on intact angle structures.1\u03bcm thick scleral bed. This flap should be 4 \u00d7 4 mm leaving a step for closure of the superficial flap. Defining the correct tissue plane is critical, as dissecting in this plane Schlemm's canal gets deroofed as the dissection is advanced anteriorly [The aim of DS is to create a TDM which functions as site of controlled aqueous outflow as well as to form an intrascleral space to act as a reservoir.teriorly . The TDMteriorly . The supteriorly  and 4.DS appears to be a safe surgical procedure to reduce IOP. The complication rate appears to be lower; flat anterior chamber, choroidal detachment, hypotonic maculopathy, and postoperative infections are rare.et al.DS achieves good IOP control in the early postoperative period. However, without the use of adjunctive therapies an increasing proportion fails over the long term. Khairy et al.et al. report 10-year postoperative outcomes after DCSI in 105 eyes and find 47.7% complete success (IOP less than 21 mmHg without glaucoma medications) and 88.9% qualified success (IOP less than 21 mmHg with or without glaucoma medications) with laser gonio puncture in 59.8% of patients. Five-fluotouracil (5-FU) injections were required in 24.5% of cases to treat bleb fibrosis or encapsulation.The use of implants to maintain the intrascleral space improved the long-term results.et al. study compares DS and DS augmented by MMC (0.2 mg/ml/2.5 min) with 36 months follow-up. The use of MMC has been associated with a larger IOP reduction and improved success rate, with 72.5% of DS achieving qualified success versus 95% of DS-MMC. Anandet al. study DS with low dose MMC (0.25 mg/ml/2 min) in a Nigerian population, and fail to show a significant benefit of using an antimetabolite, and had low success rate in both DS and DS MMC groups in this west African population.Several studies show that use of antimetabolites improves success rates. They act by reducing scaring at the filtration site. Kozoboliset al.21et al.et al. find no significant difference in outcomes between DS and trabeculectomy.Several randomized prospective studies compare DS with trabeculectomy, and most find only small differences in their efficacy to control IOP. El Sayyad DS has evolved over the past decades, and now long term data on its safety and efficacy is becoming available. There is consensus that complications related to over-filtration and infections are significantly lower than in trabeculectomy. The studies summarized above showed that the use of implants, antimetabolites and gonio puncture could ensure good long term IOP control.The results of El Sayyad from Saudi Arabia are encouraging for the population of that region, however Anand's results from Nigeria were disappointing for a predominantly Afro-Caribbean population due to aggressive scaring. These results are worth bearing in mind when selecting patients for the procedure from different racial backgrounds.As for any technically challenging procedure the learning curve for DS is long, can take up to 20 cases. However the most common intra-operative complication is TDM perforation, which essentially converts DS to a trabeculectomy, a procedure most surgeons would be familiar with. However we recommend DS for surgeons with a sufficiently high glaucoma surgical caseload that allows for developing and maintaining their technical skills.The role of DS in the management of open angle glaucoma is still being defined. As it appears to have a superior safety profile than penetrating procedures it could be considered at an earlier stage of the disease, especially in case of medical/laser therapy intolerance or unavailability."}
{"text": "Torpedo nicotinic acetylcholine receptor (AChR) protein reconstituted into liposomes made up of dioleoylphosphatidic acid (DOPA) and dioleoylphosphatidylcholine (DOPC) doped with two extrinsic fluorescent probes (NBD-cholesterol/pyrene-PC). F\u00f6rster resonance energy transfer (FRET) was observed between the protein and pyrene-PC and between pyrene-PC and NBD-cholesterol, leading to overlapping emission bands. Partial least squares analysis was applied to fluorescence spectra of pyrene-PC in liposomes with different DOPC/DOPA ratios, generating a model that was tested by an internal validation  and was further used to predict the apparent lipid molar ratio in AChR-containing samples. The values predicted for DOPA, the lipid with the highest Tm, indicate that the protein exerts a rigidifying effect on its lipid microenvironment. A similar conclusion was reached from excimer formation of pyrene-PC, a collisional-dependent phenomenon. The excimer/monomer ratio (E/M) at different DOPC/DOPA molar ratios revealed the restricted diffusion of the probe in AChR-containing samples in comparison to pure lipid samples devoid of protein. FRET from the AChR (donor) to pyrene-PC (acceptor) as a function of temperature was found to increase with increasing temperature, suggesting a shorter distance between AChR and pyrene PC. Taken together, the results obtained by MA on complex spectra indicate that the AChR rigidifies its surrounding lipid and prefers DOPA rather than DOPC in its immediate microenvironment. Analysis of fluorescent spectra from complex biological systems containing various fluorescent probes with overlapping emission bands is a challenging task. Valuable information can be extracted from the full spectra, however, by using multivariate analysis (MA) of measurements at different wavelengths. We applied MA to spectral data of purified PACS Codes: 32.50.+d, 33.50.Dq Torpedo postsynaptic membrane. The lipid bilayer beyond the lipid annulus has also been reported to be affected, albeit to a lesser extent, by the presence of the AChR protein . The id state , similarid state . Incorpoid state , suggestFluorimetric methods are extensively used to study the lipid organization in bilayers in combination with appropriate (intrinsic or extrinsic) fluorescent probes. Even after careful design and correct experimental performance, however, with suitable fluorescence spectra being recorded, the experimentalist is often frustrated by the paucity of information that can be extracted by direct examination of spectral data. Analysis of fluorescent spectra from complex biological systems containing various components and fluorescent probes with overlapping emission bands and/or interfering signals is therefore not an easy task . ValuablIn the present work we make use of Partial Least Squares (PLS-1)  as a mulTorpedo californica were obtained from Aquatic Research Consultants  and stored at -70\u00b0C until further use. DOPA, DOPC and Chol were obtained from Avanti Polar Lipids, Inc . NBD-Chol and cholic acid were purchased from Sigma Chemical . PyPC was obtained from Molecular Probes Inc. . Mid-range protein molecular weight markers were purchased from Promega . All other reagents were analytical quality. Lipid stock solutions were prepared in chloroform/methanol (2:1 v/v) at a concentration of 0.5 mg/ml and 0.05 mg/ml for PyPC. All solutions were stored at -20\u00b0C before use.Frozen electric organs from Torpedo californica were prepared as described previously  values in the control samples as temperature increases. These findings validate the procedure for calculating FRET and confirm that energy transfer increases with increasing temperature.In order to check that the increase in FRET = 1- enabled us to extract otherwise masked spectral fluorescence data on protein-lipid interactions under conditions known to affect the functionality of the former [reviewed in ].m (DOPA).The PLS-1 model predicted higher DOPA molar fractions (here termed \"apparent\") than their actual values in lipid bilayers containing the AChR. These predictions emerge from the MA applied over a selected portion of the analyzed spectra corresponding principally to the PyPC excimer band, which reports on membrane fluidity. The obtained information proved extremely difficult to extract from the raw overlapping spectra Figs.  by utilim of each lipid; -8\u00b0 for DOPA) it is also unlikely that lateral phase segregation occurred at any of the assayed lipid molar ratios. Conversely, the drop in the E/M upon incorporation of the AChR indicates that the protein decreases the diffusion rate/fluidity of its surrounding lipid matrix, in agreement with the results of the apparent DOPA molar fraction experiments. E/M was also found to decrease in studies of AChR reconstituted in a single-phase DPPC bilayer and in coexisting liquid-solid bilayers composed of POPA/POPC[The series of experiments using E/M in bilayers lacking the AChR revealed no appreciable changes in the diffusion rate/fluidity with changing DOPA/DOPC molar ratios Fig. . This isPOPA/POPC.m's above and below the working temperature, this enhanced affinity could lead to segregation of PA-enriched domains from the bulk lipid. In a liquid system such as the one used in this work, where no liquid-solid phase segregation is likely to occur, the minor increase in FRET with increasing temperature can most economically be interpreted in terms of a migration and re-distribution of the probe. The mixing of lipids upon heating, and the resulting diffusion of DOPC to regions near the AChR were mirrored by the diffusion of PyPC, which partitions favorably in DOPC-enriched domains. Thus, increasing temperature causes a dispersion of DOPA and a concurrent enrichment of DOPC and PyPC molecules in the immediate vicinity of the AChR. AChR incorporation into PA-containing membranes leads to an increase in both the lateral packing densities and the Tm's of POPC/DOPA or POPC/POPA mixtures, an effect which is absent in pure POPC bilayers [m's of the lipid system. PA is required for proper receptor function [m is higher than that of non-functional bilayers composed of PC only [AChR-PyPC FRET experiments in DOPA/DOPC bilayers revealed the preference of the AChR protein for DOPA over DOPC, in agreement with previous results showing favored interactions between PA and the AChR relative to PC, PG and PS ,7,30,29.bilayers . In the bilayers . The profunction ,33, and The ability of the AChR to selectively modulate the physical properties of the bilayer could stem essentially from a hydrophobic mismatch between the AChR and the fatty acyl chains and/or polar head groups. Such mismatch could also play an important role in the modulation of AChR function. The present results, obtained by application of MA to complex spectra obtained under various fluorescence spectroscopy modalities  and exploiting the intrinsic fluorescence of the AChR protein or extrinsic fluorescent derivatives of phosphatidylcholine or cholesterol, support the more general notion that the AChR organizes its immediate environment with increased lateral packing density and rigidity. The functional counterpart of this finding is that ordered lipid membranes stabilize the receptor in a resting, activatable state, whereas fluid or disordered membranes favor a desensitized conformation of the receptor protein.m: transition temperature.MA: multivariate analysis; AChR: acetylcholine receptor; Chol: cholesterol; DOPA: dioleoylphosphatidic acid; DOPC: dioleoylphosphatidylcholine; DPPC: dipalmitoylphosphatidylcholine; DTNB: 5,5'-dithiobis (2-nitrobenzoic acid); FRET: F\u00f6rster resonance energy transfer; NBD-Chol: amino)-23,24-bisnor-5-cholen-3-ol; PA: phosphatidic acid; POPC: 1-palmitoyl-2-oleoylphosphatidylcholine; PC: phosphatidylcholine; POPA: 1-palmitoyl-2-oleoylphosphatidic acid; PyPC: 1-hexadecanoyl-2-(1-pyrenedecanoyl)-sn-glycero-3-phosphocholine; RMSEP: root mean square error of prediction; TReference spectra of AChR, PyPC and NBD-Chol. Fig. Click here for fileREMSEP and explained y-variance. Fig. Click here for fileFRET controls. Fluorescence emission of AChR-only and PyPC-only samples as a function of temperature. Fig. Click here for file"}
{"text": "Trypanosoma brucei (T.b.).There is an urgent need to substitute the highly toxic compounds still in use for treatment of the encephalitic stage of human African trypanosomiasis (HAT). We here assessed the treatment with the doublet cordycepin and the deaminase inhibitor deoxycoformycin for this stage of infection with T.b. brucei infections in mice were determined. Oral, intraperitoneal or subcutaneous administrations of the compounds were successful for treatment. The doublet was effective for treatment of late stage experimental infections with human pathogenic T.b. rhodesiense and T.b. gambiense isolates. Late stage infection treatment diminished the levels of inflammatory cytokines in brains of infected mice. Incubation with cordycepin resulted in programmed cell death followed by secondary necrosis of the parasites. T.b. brucei strains developed resistance to cordycepin after culture with increasing concentrations of the compound. However, cordycepin-resistant parasites showed diminished virulence and were not cross-resistant to other drugs used for treatment of HAT, i.e. pentamidine, suramin and melarsoprol. Although resistant parasites were mutated in the gene coding for P2 nucleoside adenosine transporter, P2 knockout trypanosomes showed no altered resistance to cordycepin, indicating that absence of the P2 transporter is not sufficient to render the trypanosomes resistant to the drug.Cordycepin was selected as the most efficient drug from a direct parasite viability screening of a compound library of nucleoside analogues. The minimal number of doses and concentrations of the drugs effective for treatment of Altogether, our data strongly support testing of treatment with a combination of cordycepin and deoxycoformycin as an alternative for treatment of second-stage and/or melarsoprol-resistant HAT. Trypanosoma brucei. We exploited the inability of trypanosomes to engage in de novo purine synthesis as a therapeutic target. Cordycepin was selected from a trypanocidal screen of a 2200-compound library. When administered together with the adenosine deaminase inhibitor deoxycoformycin, cordycepin cured mice inoculated with the human pathogenic subspecies T. brucei rhodesiense or T. brucei gambiense even after parasites had penetrated into the brain. Successful treatment was achieved by intraperitoneal, oral or subcutaneous administration of the compounds. Treatment with the doublet also diminished infection-induced cerebral inflammation. Cordycepin induced programmed cell death of the parasites. Although parasites grown in vitro with low doses of cordycepin gradually developed resistance, the resistant parasites lost virulence and showed no cross-resistance to trypanocidal drugs in clinical use. Our data strongly support testing cordycepin and deoxycoformycin as an alternative for treatment of second-stage and/or melarsoprol-resistant HAT.There is an urgent need to substitute the highly toxic arsenic compounds still in use for treatment of the encephalitic stage of African trypanosomiasis, a disease caused by infection with  Following a hemo-lymphatic stage with waves of parasitemia, the nervous system is involved manifested as a leukencephalitis, invariably lethal if left untreated. Drugs, which are effective at an early stage of the disease, but poorly penetrate the blood-brain barrier, are ineffective for the second stage. For treatment of the second encephalitic stage of HAT, arsenic compounds such as melarsoprol, which are associated with severe and even lethal side-effects, are still widely used. Moreover, there has been an alarming increase in melarsoprol-refractory sleeping sickness cases T.b. gambiense. However, this drug is given by intravenous injections, is expensive, and is not effective against T.b. rhodesiense that causes the East African form of HAT. Since the development of new drugs for HAT is not likely to occur in the immediate future, the strategy of testing drugs approved or in clinical use for other diseases should be pursued in order to identify less toxic or alternative drugs to cure second stage HAT Human African trypanosomiasis (HAT), also known as sleeping sickness, is a neglected tropical infectious disease that has re-emerged in sub-Saharan Africa in the late 1900de novo. Instead they depend on the salvage pathway of nucleosides from the body fluids of the host de novo purine synthesis has been exploited as a therapeutic target. The trypanocidal potential of cordycepin (3\u2032-deoxyadenosine), a metabolite from the fungi Cordyceps spp., was noted in experiments performed in the 1970's in vivoIn contrast to most mammalian cells, trypanosomes cannot synthesize purines T. brucei where its intracellular cleavage to adenine is followed by phosphoribosylation to AMP, or by a high affinity adenosine kinase Trypanosoma sp.Cordycepin is probably taken up by trypanosomes through transporters. Nucleoside transport systems, P1 and P2, are able to concentrate cordycepin inside the cells and has turned out to play an important role in the uptake of trypanocides T.b. brucei infections in mice T.b. brucei. Cordycepin and deoxycoformycin treatment did also cure second stage infection with human pathogenic T.b. gambiense and T.b. rhodesiense, and oral administration of the duplet when combined with a proton pump inhibitor was effective. Cultivation of T.b. brucei with low doses of cordycepin allowed resistance to cordycepin to develop, but resistant parasites lost virulence, and no cross-resistance between cordycepin and melasoprol. suramin and pentamidine was noted. Importantly treated mice showed diminished levels of pro-inflammatory cytokines in the brain.We have previously shown that intraperitoneal (i.p.) injection of cordycepin, together with coformycin or deoxycoformycin, can cure Altogether, our findings encourage the possible use of cordycepin and deoxycoformycin as an alternative for treatment of second stage HAT or melasoprol-resistant HAT.Cordycepin, suramin, pentamidine, omeprazole and EHNA (erythro-9-(2-hydroxy-3-nonyl)adenine) were all purchased from Sigma . Deoxycoformycin (pentostatin) was a kind gift of R. McCaffrey . Melarsoprol  was a gift from P. Simarro . Unless otherwise indicated, all reagents were diluted in PBS, fractioned and stored at \u221220\u00b0C until further use.The library of nucleoside analogs used consisted of compounds design to be inhibitors of various viral and microbial enzymes and is property of Medivir AB.\u2212/\u2212ad libitum under specific pathogen-free conditions. All experiments were conducted following protocols that received institutional approval and authorization by the Stockholm Region's animal protection committee.BALB/c, C57Bl/6 and RAG1T.b. brucei (AnTat1.1E), T.b. rhodesiense (STIB 851) and T.b. gambiense (MBA) were kindly provided by P. B\u00fcscher . Tbat1 null parasites constructed by sequential homologous recombination of T.b. brucei Lister 427 T.b. brucei, T.b. gambiense and T.b. rhodesiense freshly isolated from infected C57BL/6 mice (3 days post infection with 1\u00d7107 parasites/mouse) were separated by DEAE-cellulose chromatography under sterile conditions T. brucei parasites were incubated in D-MEM containing 10% heat-inactivated calf serum, 28 mM HEPES, 0.14% glucose, 1.5% NaHCO3, 2 mM L-glutamate, 0.14 mg/ml gentamycin, 0.3 mM dithiothreitol, 1.4 mM sodium pyruvate, 0.7 mM L-cysteine, 28 \u00b5M adenosine, 14 \u00b5M guanosine at 37\u00b0C.Bloodstream forms of 4 parasites were cultured in 96 flat-bottomed well culture plates with serial drug dilutions for 72 h at 37\u00b0C. Cultures (100 \u00b5l) were incubated for 2 h with 10 \u00b5l of WST-1 reagent . Viability was measured by the conversion of WST-1 reagent to formazan, recorded by multiwell scanning spectrophotometer at an excitation wavelength of 450 nm. A direct correlation between WST-1 reagent oxidation and parasite numbers was confirmed (data not shown).To measure drug sensitivity, 2.5\u00d710Mice were deeply anesthetized with isoflurane, sacrificed and brains were dissected and snap frozen. To examine presence of trypanosomes within and outside the blood vessels in the brain, cryostat sections were cut and immunolabelled with anti-AnTat1.1 VSG  and goat polyclonal anti-glucose transporter 1  as described previously Renilla luciferase expressing parasites were generated as recently described . The use of such luciferase tagged T. brucei for real time studies of parasite dynamics was validated in vitro and ex vivo . BABLB/c mice were infected i.p. with 2\u00d7103 luciferase tagged T.b. brucei AnTat1.1. At different days after infection, mice were anesthetized with 2.3% isoflurane, injected intraperitoneally with 100 \u00b5L of coelenterazine (2 \u00b5g/\u00b5l dissolved in methanol) (Synchem) diluted with 90 \u00b5L PBS pH 7, and light emission in photons/second/cm2/steradian (p/sec/cm2/sr) was recorded in an IVIS Imaging System 100 (Xenogen LifeSciences) and Living Image 2.20.1 software (Xenogen) for 180 seconds. Measurements started 3\u20135 minutes after substrate injection to allow the spread of the coelenterazine.Stable recombinant Briefly, following a 30 min permeabilization of trypanosomes in 10 mM phosphate buffer containing 6 \u00b5M digitonin, nuclei were stained with a 10 \u00b5g/ml propidium iodide solution in 10 mM phosphate buffer and kept on ice until measurement by flow cytometry.DNA fragmentation was assessed by using the terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling method (Roche) as described Exposed phosphatidylserine was detected on the outer membrane of cells using Annexin-V-Fluor (Roche) following instructions by the manufacturer. Fluorescence was measured using FACS analysis as described before In order to analyze disruption of the plasma membrane after cordycepin treatment, nuclei were stained with propidium iodide (5 \u00b5g/ml) in the absence of a cell permeant and analyzed by flow cytometry.t). The relative amount of target gene transcripts was calculated using the 2\u2212\u0394\u0394Ct method as described Gene transcripts of several pro-inflammatory cytokines were quantified in brains from cordycepin-treated and PBS-treated, uninfected and infected mice by real time PCR. Total RNA was extracted from half of the fresh frozen brains, reverse-transcribed, and the transcripts levels quantified on an ABI Prism 7000 sequence detection system (Applied Biosystems) as described previously senso latu T. brucei primers Total DNA was extracted from brains from treated and untreated mice using a Dneasy tissue kit . The amount of parasite DNA was quantified by real time PCR as described above using T. brucei genome project (www.ebi.ac.uk) and Blast2seq (www.ncbi.nlm.nih.gov). Single nucleotide polymorphisms between clones were taken into account.Total DNA from parental and resistant strains was extracted using the DNeasy tissue kit (Qiagen). Candidate genes suspected to be involved in the resistance to cordycepin were PCR amplified from total DNA using forward and reverse specific primers designed over the following annotated genes by the  project : AdenosiT.b. brucei was first studied. For this purpose we screened a library of 2200 drug-like nucleosides compounds for toxicity against T.b. brucei AnTat1.1. The screening revealed 14 hits showing toxicity for T.b. brucei at less than 1 \u00b5M concentration. Ten of these compounds were found to also be toxic for mammalian cells at these concentrations. One of the remaining compounds was identified as cordycepin. A second one was tubercidin, a nucleoside previously shown to inhibit the respiratory chain in T.b. brucei, but that induced adaptation of parasites to a glucose-independent metabolism We have previously suggested that cordycepin could be used for treatment of second stage African trypanosomiasis. Whether other nucleoside analogues could have a more selective toxic effect on T.b. brucei infections. Three out of 22 tested compounds showed at least 3 log higher toxicity for T.b. brucei as compared to mammalian HL-cells (T.b. brucei (data not shown).Subsequently, the trypanocidal activity of cordycepin was compared with that of adenosine deaminase resistant nucleoside analogues. Such nucleosides could potentially act as stand-alone drugs in treatment of in vivo. Cordycepin 116, but not cordycepin 110, showed anti-trypanosomal effect during the early stage of infection  were analyzed. Parasite DNA in whole blood or brain tissues was measured by real time PCR.Experiments were then performed to confirm, using more extended protocols, the curative effect of cordycepin and deoxycoformycin on the second stage murine infection with 3T.b. brucei. displayed parasites at 85 days of infection (65 days after treatment). No parasites were detected in the blood of cordycepin- and deoxycoformycin-treated mice. On the contrary, although no parasites were detected directly after treatment with 20 mg/kg suramin, the presence of parasites was recorded at least once in the blood of all suramin-treated mice before sacrifice (65 days after treatment), although only in a fraction of mice at a given time.In a first experiment we showed that none of the C57Bl/6 mice (n\u200a=\u200a9) treated i.p. with 2 mg/kg body weigth (kg)/day (d) cordycepin and 0.2 mg/kg/d deoxycoformycin for 7 consecutive days, starting at day 20 after infection with 2\u00d710\u2212/\u2212 mice inoculated with blood or brain homogenates from suramin-treated mice showed parasites early after infection, no parasites were detected in mice inoculated with either blood or brain homogenates from cordycepin- and deoxycoformycin-treated mice. Parasite DNA could not be amplified and parasite antigens were not detected in the brain tissues of cordycepin- and deoxycoformycin-treated mice. Infected and non-treated mice showed signs of morbidity before day 32 after infection. No mortality was recorded in the cordycepin-treated group and 1 out of 8 suramin-treated mice died 79 days after infection.Whereas all RAG1In a second experiment the minimal effective concentration of cordycepin was determined. For this purpose, we compared the treatment of mice given different doses of cordycepin and a constant dose of deoxycoformycin. Mice were inoculated with 2, 1.2 and 0.6 mg/kg/d cordycepin plus 0.2 mg/kg/d deoxycoformycin for 7 days starting at day 20 after infection. Whereas the trypanocidal effect was evident in all groups of mice (n\u200a=\u200a9), a dose-dependent effect was observed, with doses lower than 2 mg/kg/d not sufficient to completely clear parasitemia . One outNext, groups of mice (n\u200a=\u200a7) were dosed with 2 mg/kg/d cordycepin and 0.2 mg/kg/d deoxycoformycin during 3, 5 or 7 days starting 20 days after infection. Again, a dose-dependent trypanocidal effect was observed also in this experiment. Five or three doses were not enough to completely clear infection, whereas in the group treated with 7 doses only one animal remained infected . Since, 3T.b. brucei. Treatment with either 0.1 or 0.2 mg/kg/d deoxycoformycin resulted in complete cure of second stage infection, while no curative effect was observed when 0.02 mg/kg/d deoxycoformycin was used for treatment  were treated for 10 days with 2 mg/kg/d cordycepin and different concentrations of deoxycofomycin starting 20 days after infection with 2\u00d710reatment . We alsoStarting treatment with cordycepin and deoxycoformycin at 20 days after infection resulted in loss of weight of infected mice. Surprisingly, toxicity was largely independent of the dose of cordycepin and deoxycoformycin used, since mice treated either for 15, 10, 7, 5 or 3 days with 2 mg/kg/d cordycepin and 0.2 mg/kg/d deoxycoformycin or treated with 7 doses of 2, 1.2 or 0.6 mg/kg/d cordycepin and 0.2 mg/kg/d deoxycoformycin all showed similar weight loss . Whereas mice inoculated i.p. with 2\u00d7105T.b. gambiense (MBA stabilates) showed parasitemia up to at least 70 days after infection, mice inoculated 2\u00d7103 or 2\u00d7104T.b. gambiense showed no parasites in the blood. In contrast to T.b. rhodesiense, morbidity was only observed in T.b. gambiense-infected mice at the time of sacrifice (80 days after infection) with small numbers of parasites observed in brain parenchyma, with elevated parasite densities observed only in the septum (data not shown). Treatment of T.b. gambiense infected mice with 2 mg/kg/d cordycepin and 0.2 mg/kg/d deoxycoformycin for 10 days, starting at 30 days after infection, when parasites where first detected in the brain parenchyma, completely eliminated parasitemia for at least 50 days after treatment  of cordycepin for 72 h at 37\u00b0C. Parasites surviving the highest concentrations of cordycepin, were then further cultured for 3 days with similar or higher concentrations of cordycepin. This procedure was repeated for four months, after which a 40\u201360 fold increased resistance to cordycepin, compared to the parental strain was achieved  and pleomorphic (AnTat1.1) parasites displayed mutations in the TbAT1 gene, we tested whether this transporter affected the susceptibility of parasites to cordycepin by using TbAT1 knockout parasites. We found that resistance of cordycepin by knockout parasites was only slightly affected by the mutation, suggesting that the absence of the P2 transporter is not sufficient to explain the observed increased resistance of parasites to cordycepin .T. brucei. In brief, cordycepin was selected from a direct parasite viability screening of a compound library of nucleoside analogues. The minimal effective concentrations of cordycepin and deoxycoformycin for late stage treatment in vivo were determined. Of importance, the dose of deoxycoformycin used is similar or lower to that employed in leukemia patients, and cordycepin and deoxyformycin have been tested in clinical trials in humans  and in preclinical studies in dogs at higher concentrations to the ones here presented in vivo will improve efficacy of treatment by reducing the doses, and that enteric coating might reduce the problem of acid lability of deoxycoformycin. The nucleoside analogue treatment was also effective for treatment of late stage infections with both T.b. rhodesiense and T.b. gambiense, different to some drugs in clinical use such as DFMO (eflornithine), which is only effective against T.b. gambiense. Cordycepin and deoxycoformycin treatment diminished the inflammatory cytokine accumulation in the brains of infected mice. In agreement, the number of CD45+ inflammatory cells in the brain parenchyma of T. brucei-infected mice was also reduced after treatment cordycepin and deoxycoformycin T. brucei to be similar to those described in pluricellular organisms. Programmed cell death was followed by secondary necrosis. Interestingly, programmed cell death processes have previously been shown to be activated during the life cycle of trypanosomatids, regulating parasite number in certain host tissues, in the maintenance of clonality, as a mechanism of immunomodulation and of parasite differentiation We here report a preclinical evaluation of the chemotherapeutic efficiency of cordycepin and deoxycoformycin for late stage infection with T.b. brucei developed resistance to cordycepin upon prolonged culture with low doses of the compound, such resistant parasites showed diminished virulence and reduced growth in vivo. Moreover, resistant parasites showed no cross resistance to melarsoprol, suramin and pentamidine in clinical use for early or late stage treatment of HAT, suggesting that cordycepin targets are different to those of the other drugs. This is of importance since a strategy to delay or prevent the development of resistance is to combine drugs that act on different targets and therefore are unlikely to show cross-resistance. Additionally, synergistic effects may arise from a combination of two drugs that act differently. In such a situation, the concentrations of the combination partners can be reduced compared with those used in a mono-therapy, which leads to better safety.The development of this new drug combination with reduced toxicity, high activity and oral availability gives rise to renewed hope of new and safer treatments of HAT. However, the utility and longevity of these new treatments will, to a large degree, be determined by the development of parasite resistance to the drug. We found that although Since resistance to cordycepin was slowly increased during the four months-long culture of the parasites with the drug (data not shown), it is likely that a number of mutations had accumulated during the process. After cloning and sequencing 11 candidate genes from cordycepin-induced resistant and parental strains, we found that parasites showed altered functional mutations only in the P2 transporter encoded by the TbAT1 gene. Although mutations found in the other examined genes were present, they did not show any predicted deleterious or altered effect for the respective protein function. Cordycepin uptake has been reported to be mediated by both the P1 and P2 transporters T. brucei showed two- and three-fold increases resistance to melarsoprol and melarsen Since cordycepin-resistant parasites show a genetic defect in TbAT1, it was surprising that no cross resistance to pentamidine, suramin and melarsoprol was not observed: the P2 transporter has been shown to be responsible for uptake of different trypanocides such as melaminyl arsenicals, pentamidine, diminazenes, cordycepin and tubercidin Most drugs for treatment of HAT were developed in the first half of the twentieth century, and some of them would not pass current high safety standards. A safe drug that is effective in the treatment of the encephalitic stage of HAT would significantly change the control and management of sleeping sickness. The data here presented strongly suggest that the combination of cordycepin and deoxycoformycin can be used in clinical tests for treatment of African trypanosomiasis. Besides the results from the preclinical experiments described in our manuscript, cordycepin fulfills a number of requirements for to be considered a candidate drug: It is available for other purposes and cheap, it can be given orally, clinical trials of the doublet have been performed and toxicity in man at the same concentrations used in animals seems not to pose a problem.Alternative Language Abstract S1Spanish translation of the abstract by MER.(0.04 MB DOC)Click here for additional data file.Figure S1T.b. brucei incubated with 1 \u00b5M cordycepin was measured by incubating T. brucei with TMRE.The depolarization of mitochondrial membrane in (0.59 MB PPT)Click here for additional data file.Table S1Sequencing primers list(0.06 MB DOC)Click here for additional data file.Text S1Supplementary methods.(0.03 MB DOC)Click here for additional data file."}
{"text": "The phenotype of an organism is an outcome of both its genotype, encoding the primary sequence of proteins, and the developmental orchestration of gene expression. The substrate of gene expression in eukaryotes is the chromatin, whose fundamental units are nucleosomes composed of DNA wrapped around each two of the core histone types H2A, H2B, H3 and H4. Key regulatory steps involved in the determination of chromatin conformations are posttranslational modifications (PTM) at histone tails as well as the assembly of histone variants into nucleosomal arrays. Although the mechanistic background is fragmentary understood, it appears that the chromatin signature of metazoan cell types is inheritable over generations. Even less understood is the conservation of epigenetic mechanisms among eukaryotes and their origins.In the light of recent progress in understanding the tree of eukaryotic life we discovered the origin of histone H3 by phylogenetic analyses of variants from all supergroups, which allowed the reconstruction of ancestral states. We found that H3 variants evolved frequently but independently within related species of almost all eukaryotic supergroups. Interestingly, we found all core histone types encoded in the genome of a basal dinoflagellate and H3 variants in two other species, although is was reported that dinoflagellate chromatin is not organized into nucleosomes.Trichoplax. H3.1 and H3.1t are probably restricted to mammals.Most probably one or more animal/nuclearid H3.3-like variants gave rise to H3 variants of all opisthokonts . H3.2 and H3.1 as well as H3.1t are derivatives of H3.3, whereas H3.2 evolved already in early branching animals, such as We deduced a model for protoH3 of the last eukaryotic common ancestor (LECA) confirming a remarkable degree of sequence conservation in comparison to canonical human H3.1. We found evidence that multiple PTMs are conserved even in putatively early branching eukaryotic taxa (Euglenozoa/Excavata).At least a basal repertoire of chromatin modifying mechanisms appears to share old common ancestry and may thus be inherent to all eukaryotes. We speculate that epigenetic principles responsive to environmental triggers may have had influenced phenotypic variation and concomitantly may potentially have had impact on eukaryotic diversification. The regulation of eukaryotic gene expression occurs in the context of DNA fibres compacted by interactions with proteins - the chromatin, where on the first level of compaction the DNA is wrapped around a protein octamer composed of the four core histone proteins types H2A, H2B, H3 and H4 forming the nucleosome. This fibre becomes further compacted by the interaction with linker histone H1 and other proteins, forming a 30 nm fibre . In eukaChromatin modifying mechanisms play a superordinate role in the orchestration of developmental processes, thus influencing phenotypic differentiation. Recent studies have also shown that some chromatin modifying mechanisms are responsive to environmental agents -14, whicHowever, the diversity of epigenetic mechanisms, their common themes as well as differences, and finally their potential impact to the evolution of eukaryotes remains largely unexplored. From all core histone types, variants of histone H3 with their dynamic posttranslational modifications have been most extensively studied in selected model organisms to date. In order to discover the evolutionary history of basal chromatin modifying mechanisms, we decided to undertake combined phylogenetic and molecular biological analyses focusing on variants of the core histone H3 and its PTM signature.Entamoeba, were usually used to represent putatively early branching eukaryotic supergroups [To date phylogenetic analyses of histone H3 variants were limited due to poor data availability of sequences from species representing putatively early branching eukaryotes. If not neglected totally parasitic organisms, such as ergroups -19. On tMonosiga brevicollis  and Arabidopsis thaliana  vary in only 2 out of 135 residues . Similarly, histone H3 from Nuclearia simplex  deviates in only 4 out of 135 residues from histone H3 in the green alga Ostreococcus lucimarinus  (~97% identity) . We focused on the identification of H3 sequences from non-parasitic organisms representing putatively early branching Euglenozoa and Excavata. Importantly, we were able to assemble multiple new histone H3 sequences from various species of putatively early branching eukaryotes . We also obtained sequences of histone H3 variants from a ciliated protist, Stylonychia lemnae   using vaInterestingly, we found extremely conserved histone H3 sequences and remarkable examples of divergent H3 variants in all eukaryotic supergroups  as well as CenH3 variants , which showed tendency to be positioned at the bottom of trees, including all characterized and putative CenH3 derivatives. Although the bootstrap support for such unrooted trees was weak for numerous clades, the monophyly of many groups was well represented , whereas the monophyly of Amoebozoa, Chromista  and Archaeplastidae could only weakly or not be resolved, probably due to the generally very high degree of H3 sequence similarity in those groups , suggesting a cell cycle dependent regulation by phosphorylation of specific H3 variants. Since phosphorylation of serine, or presumably also threonine, can prevent or even disrupt binding of effector proteins  at adjacent methylated lysine residues, it can be assumed that such sites could also function as switches regulating the chromatin signature ,27. The Xenopus, Branchiostoma, Drosophila) or slightly different protein sequence . Notably, in our phylogenetic analyses the only H3 from Nuclearia simpex we could identify occurs near the root of the animal H3.3 clade. This H3.3-like variant deviates from human H3.3 only in one substitution . In Opisthokonta S87 occurs predominantly in fungal H3 variants , whereas A87 is found in animals, choanoflagellates and most sequences of Amoebozoa. For example in two putative stem Amoebozoa species A87 is found in a H3 variant of Mastigamoeba balamuthi , whereas S87 is found in a 118 aa H3 sequence fragment of Hyperamoeba dachnya . Remarkably, S87 dominates in H3 variants of Bikonta. We conclude that one or more H3 variants very similar to animal/nuclearid H3.3 gave rise to all H3 variants found in extant opisthokonts.Our data suggest, that a variant similar to the replication-independent mammalian histone H3.3 - but not the  H3.1 - was likely ancestral to H3 variants of fungi and their sister group nuclearids as well as choanozoa and animals. In many metazoan species H3.3 occurs with identical * . However, the occurrence of numerous H3 variants is not restricted to animals. Our analyses strongly suggest that they have evolved frequently and independently in many eukaryotic taxa. For example, we characterized the macronuclear genomic sequences of at least 7 core histone H3 variants and one putative CenH3 variant (mdp64) in the spirotrichous ciliate species Stylonychia lemnae, which have been partially identified before by Bernhard [Stylonychia H3 variants are within sequence motifs known to be involved in 'writing' or 'reading' the histone PTM signature, thus determining chromatin higher order structure  and the somatic (macronuclear) genomes resulting in a selection of macronucleus-destined sequences . In spiiewed in , which ciewed in . We assuCandida albicans), Amoebozoa (3 in Entamoeba sp. and Dictyostelium discoideum), Plants , Apicomplexa/Chromista , Heterokonta/Chromista , also in excavates  and more divergent H3 variants in euglenozoa (2 in Trypanosoma sp.). Since we could identify only one H3 sequence from a Rhizaria species, we can make no statement for this group, whether H3 variants exist or not.Examples of increased H3 variant numbers within related species could be found in almost all eukaryotic supergroups by our analyses  as well as in the dinoflagellates Pyrocystis lunula and Karlodinium micrum , whereas K9/K27 motifs are absent in Karlodinium micrum and Pyrocystis lunula. Furthermore the K36 motif lacks in Pyrocystis lunula. Since the Pyrocystis H3 variant seems to be among numerous genes whose expression profiles are affected by oxidative stress [Using nuclease digestion experiments and electron microscopic approaches it has been observed, that the most portion of chromatin in dinoflagellates is not organized into nucleosomal repeats -36. In ae stress , evidencPerkinsus marinus we found also sequences encoding core histones H4 (GeneBank XM_002777579), H2A (GeneBank XM_002772145) and H2B (GeneBank XM_002787339) but no sequences homologous to other dinoflagellate histone-like proteins [Remarkably, in proteins , suggestKarlodinium micrum or Pyrocystis lunula, whereas we found one H2A-family sequence fragment in another dinoflagellate, Alexandrium tamarense (GeneBank AY849372). Our observation suggests that these histone variants are the only core histone types involved in chromatin organization in these species, raising the question what could be the consequences on chromatin structure. Without experimental evidence we can only speculate that in dinoflagellates like Karlodinium micrum or Pyrocystis lunula, which apparently do not possess a complete set of core histone types, H3 variants could be involved into chromatin organization of a fraction of the genome, similar to spermatozoa in many species, which replace most histones by protamines but retain nucleosomal chromatin organization at some genomic loci (reviewed in [On closer look we could not identify further core histone types in the genomes of iewed in ). It canPerkinsus marinus and also the evidence for single core histone types in other species strongly support the view that the alternative chromatin organization in most representatives of that phylum is a derived, not an ancestral feature in dinoflagellate chromatin evolution.However, the presence of all four core histone types in a basal dinoflagellate like Due to the presence of conserved H3 variants with high similarity to animal/nuclearid H3.3-like variants in selected species of all eukaryotic supergroups, it may be concluded that ancestral states are unlikely to be represented by the more divergent H3 variants in various supergroups. Following these assumptions we deduced ancestral states for selected clades well supported in our phylogenetic analyses and subsequently a putative protoH3 sequence, which exhibits 87% sequence identity compared with human  H3.1 Figure , confirmTrypanosoma and Leishmania is almost identical to canonical H3  alter between the aromatic amino acids tyrosine (Y) or phenylalanine (F). The observed presence or absence of putative phosphorylation sites at various positions as a character state of many histone H3 variants is nicely confirmed by the reconstruction of ancestral H3 s of all supergroups as well as LECA's protoH3 Figure . It seemEuglena gracilis (Euglenozoa/non-parasitic) and Trichomonas vaginalis (Excavata/parasitic) as representative species, since Euglena histone H3 differs in only one amino acid (A28) from human H3.1 (S28) in the N-terminal 40 residues (~98% identity). Although the N-terminal sequence identity in comparison with human H3.1 does not exceed ~78% in two H3 variants of Trichomonas vaginalis the overall similarity of these variants is higher than in other parasitic Excavata/Euglenozoa model systems, such as Giardia, Leishmania or Trypanosoma. Moreover motifs adjacent to K4, K9, K14, K27 and K36 exhibit a high degree of conservation. Importantly, we performed competition assays as controls as described in [Stylonychia lemnae, since antibodies used have been extensively tested in this single cell organism before [Euglena gracilis as well as Trichomonas vaginalis. Histone H3 acetylation at K9 or K14, which in Stylonychia occurs in the transcriptionally highly active macronuclei (M), was detected in nuclei (n) of Euglena and in most undistinguished stages observed in Trichomonas. Using antibodies targeted to H3K36ac, which in Stylonychia is restricted to developing macronuclear anlagen (a), we could not detect this PTM in Euglena, whereas signals were prominent in nuclei of most stages of Trichomonas. H3K4me3 is mostly associated with transcriptional activity as highlighted by strong macronuclear signals in Stylonychia macronuclei (M). This PTM was detected in nuclei (n) of Euglena and many undistinguished stages of Trichomonas. H3 methylated at K9 or K27 in the context of ARKS/T sequence motifs frequently propagates binding of heterochromatin binding protein 1 (HP1)-like chromobox proteins, often resulting in heterochromatin formation. In Stylonychia H3K27me3 occurs in the heterochromatic micronuclei (m), which are silent in gene expression. Using an antibody which cross-reacts with H3K9me3 and H3K27me3 we observed nuclear signals corresponding to ARKme3S/T in both Euglena and Trichomonas. The assumption that ARKme3S/T within H3 tails could be involved in heterochromatin formation even in early branching eukaryotes is strengthened by the presence of numerous HP1-like chromodomain proteins encoded in the genomes of several representative species, with at least 8 chromodomain proteins being encoded in the genome of Trichomonas vaginalis  were scanned for H3 sequences using Stylonychia lemnae macronuclear genome encoded H3 variants using degenerate oligonucleotides in combination with telomere suppression PCR (TSP), a technique to amplify the 5'- or 3'-ends of Stylonychia nanochromosomes including their telomeric sequences [Stylonychia was initiated by mixing equal numbers of cells from different mating types. Samples for cDNA synthesis were taken periodically at time points as indicated. Total RNA was isolated as described earlier [We fully characterized equences . Sexual  earlier . SubsequAligments were performed using ClustalW included in MEGA 4.1  and werePhylogenetic tree calculations were conducted using MEGA 4.1  softwareThe evolutionary history of 159 H3 and CenH3 variants Figure  was infeThe evolutionary relationship of 128 non-redundant histone H3 variants Figure  was infeAncestral states represented by selected internal nodes from clades well supported by NJ tree topology were reconstructed  or alternatively in methanol:acetic acid (3:1) (Euglena), washed twice with phosphate buffered saline (PBS), and immobilized onto poly-L-lysine coated coverslips. Subsequently immunostaining with PTM-specific antibodies and in some experiments peptide competition assays were performed as described earlier [http://rsb.info.nih.gov/ij/, 1997-2004.) and Adobe Photoshop CS3 software.Cells were fixed in 2% paraformaldehyde  and aligned protein sequences of 128 H3 variants. Amino acid positions refer to human H3.1. Identical sites are shaded in black, similar residues are shaded in light grey. The positions of four helix motifs within the histone fold domain and the putative chaperone recognition domain are marked at the top of the alignment.Click here for filePhylogenetic tree of eukaryotic life (simplified after [). The position of selected species is highlighted.ed after ). The poClick here for fileFASTA formatted histone H3 variant sequence alignment.Click here for fileOverview about the most frequent residue alterations in various ancestral state sequences of histone H3 . Variable sites are highlighted (*); symbols beneath list the most frequent amino acid variations. Outgroup taxons used for ancestral state reconstruction a displayed within brackets for each clade.Click here for fileThe alignment contains some exemplary N-terminal chromodomain sequences of putative Hp1-like proteins from putatively early branching eukaryotes, which possess a set of conserved residues (*) formally required for ARKme3S/T binding. Residues identical in 85% of all sequences are shaded black; residues similar in 85% of all sequences are shaded grey. Notably, in three Trichomonas vaginalis sequences a C-terminal chromoshadowdomain could be recognized (C+CS).Click here for file"}
{"text": "However, treated spheroids showed an increased uptake of doxorubicin and, consequently, an increased toxicity following electrical field exposure. The electrical field raised intracellular reactive oxygen species (ROS) as revealed using 2\u2032,7\u2032-dichlorofluorescein diacetate (H2DCFDA) as an indicator. ROS induced membrane lipid peroxidation since the lipid peroxidation end products malondialdehyde (MDA) and 4-hydroxy-2-(E)-nonenal (4-HNE) were detected after electrical field treatment. Moreover, lipid peroxidation decreased the lipid diffusion coefficient D from 4.2 \u00d7 10\u221210 cm2 s\u22121 to 2.7 \u00d7 10\u221210 cm2 s\u22121 in the control and treated sample, respectively, as revealed by fluorescence recovery after photobleaching (FRAP) experiments. The field effects could be mimicked by incubating spheroids with 100 nM hydrogen peroxide and were inhibited by the radical scavengers dehydroascorbate (DHA) and \u03b1-tocopherol (vitamin E), indicating that the increased uptake of doxorubicin after electrical field treatment is owing to lipid peroxidation and decreased membrane lipid mobility. Treatment of tumours with low intensity electrical fields may be useful to improve the cytotoxic capacity of anthracyclines. \u00a9 1999 Cancer Research CampaignElectrochemotherapy (ECT) is a new approach to the treatment of tumours. In the present study, multicellular prostate tumour spheroids were treated with non-lethal direct current (DC) electrical fields, and uptake and toxicity of doxorubicin were investigated. An electrical field with a field strength of 500 Vm"}
{"text": "Further gel filtration of the latter on Superdex 75 yielded a single peak containing both activities. In a cytotoxicity assay, most of the TNF found in the crude supernatants was recovered in the D-gal\u2212 fraction. Furthermore, the incubation of the D-gal\u2212 fraction with anti-TNF-\u03b1 plus anti-IL-8 antisera partially prevents its inhibitory effect on neutrophil migration, but had no effect on the D-gal+ activity. Overall, these results suggest that the D-gal\u2212 inhibitory effect is partially mediated by TNF-\u03b1 and IL-8, and that MNCF accounts for the inhibition of neutrophil migration in vivo by the D-gal+ fraction.In a previous study, we demonstrated the presence of a neutrophil recruitment inhibitory factor (NRIF) in the supernatants of LPS-stimulated macrophages. Recently, the purification of a 54 kDa protein, identified as the macrophage-derived neutrophil chemotactic factor (MNCF) was reported. Since NRIF and MNCF are obtained under the same conditions, and, since the intravenous administration of TNF-\u03b1 and IL-8 inhibits neutrophil migration, we have investigated whether MNCF could be responsible for this inhibitory activity. After affinity chromatography of the macrophage supernatants on a D-galactose column, the inhibitory activity was recovered in both the unbound (D-gal"}
{"text": "Owners would pay \u2248400\u2013700 CFA francs (US $0.78\u2013$1.36)/animal. To vaccinate  Canine rabies globally causes an estimated 55,000 human deaths each year; 23,750 (\u224843%) of which occur in Africa . We then estimated the maximum amount that could be charged to owners (cost recovery) and still achieve a minimum of 70% of dogs vaccinated.One way to fund dog rabies vaccination programs is to charge owners a fee for each dog vaccinated. However, the higher the fee, the lower the compliance is likely to be. To estimate the association between the amount charged to dog owners and the probability of vaccination , we collected data from 3 observational studies  and 1 survey of dog owners (2006) . Both campaigns followed similar protocols. Each campaign covered the same 3 city quarters, which had high-density dog populations (www.oanda.com/convert/classic) For each campaign, the percentage of dogs vaccinated was estimated by using a capture\u2013recapture method . For the 2002 free-to-owners campaign, 71%\u201387%  of all dogs (owned and unowned) were vaccinated in 2 of the zones (1 zone per quarter) included in the campaign . For this study, we used the latter estimates because we were interested in measuring owner compliance to charges for dog vaccination.We obtained direct observations of the association between compliance  and amount charged to owners from 2 pilot dog vaccination campaigns held in N\u2019Djam\u00e9na in 2002 and 2006 . We did not perform additional statistical analyses.We graphed the 3 observational data points (assuming a straight-line interpolation between points) and the reverse cumulative probability of the owner-stated amounts that they would be willing to pay for their animal to be vaccinated against rabies . An initInterviewed households provided 356 questionnaires from which we estimated owner-stated willingness-to-pay for pet vaccination and calculated the resultant reverse cumulative probability of having their animal vaccinated. When asked how much they would be willing to pay, 5 (1%) owners stated that they were against vaccination. We interpreted that response to indicate that such owners would, essentially, have to be paid to have their animals vaccinated.<1,500 CFA francs/animal vaccinated, owners were more likely to state that they would pay to have their pet vaccinated than they were to actually do it. The stated values and observed values were closest at 2,000 CFA francs  (When the proposed cost of vaccination was cinated) . This fiFew studies have compared what members of the general public state they are willing to pay for a public health intervention with their actual observed behavior . Full-cost recovery concepts will not ensure that enough dogs are vaccinated in Chad  to interrupt rabies transmission in dogs in urban areas. Clearly, to have Owner Valuation of Rabies Vaccination ofDogs, Chad"}
{"text": "At present, there is no evidence on whether using condition-specific Oral Health-Related Quality of Life (OHRQoL) measures provides more reliable information than generic measures for needs assessment. Therefore, the objective was to assess the discriminative ability of one generic and one condition-specific OHRQoL measure, namely, respectively, the short form of the Oral Health Impact Profile (OHIP-14) and the Condition-Specific form of the Oral Impacts on Daily Performances (CS-OIDP) attributed to malocclusion, between adolescents with and without normative need for orthodontic treatment.200 16\u201317-year-old adolescents were randomly selected from 957 schoolchildren attending a Sixth Form College in London, United Kingdom. The impact of their oral conditions on quality of life during the last 6 months was assessed using two OHRQoL measures; OHIP-14 and OIDP. Adolescents were also examined for normative orthodontic treatment need using the Index of Orthodontic Treatment Need (IOTN) and the Dental Aesthetic Index (DAI). Discriminative ability was assessed comparing the overall scores and prevalence of oral impacts, calculated using each OHRQoL measure, between adolescents with and without normative need. Using the prevalence of oral impacts allowed adjusting for covariates.There were significant differences in overall scores for CS-OIDP attributed to malocclusion between adolescents with and without normative need for orthodontic treatment when IOTN or DAI were used to define need (p = 0.029 or 0.011 respectively), and in overall scores for OHIP-14 when DAI, but not IOTN was used to define need (p = 0.029 and 0.080 respectively). For the prevalence of impacts, only the prevalence of CS-OIDP attributed to malocclusion differed significantly between adolescents with and without normative need, even after adjusting for covariates (p = 0.017 and 0.049 using IOTN and DAI to define need).CS-OIDP attributed to malocclusion was better able than OHIP-14 to discriminate between adolescents with and without normative needs for orthodontic treatment. Oral Health-Related Quality of Life (OHRQoL) can be assessed using either generic or specific measures ,2. GenerIt has been claimed that condition-specific OHRQoL measures may increase acceptability to subjects by including only relevant dimensions ,3,6. In Although using condition-specific OHRQoL measures for needs assessment seems theoretically sound, some recent studies have also assessed oral health needs using generic OHRQoL measures ,16. EmpiTwo hundred 16\u201317-year-old adolescents were randomly selected from a list containing the names of all the 957 schoolchildren attending the Havering Sixth Form College in London, United Kingdom during 2006. All the students selected agreed to take part in the study. Sample size was calculated to estimate a prevalence of 25% for the condition-specific oral impacts on daily performances attributed to malocclusion, with a maximum tolerable error of 5% [The Local Ethics Committee and the Research and Development Directorate of the University College London Hospitals National Health Service Trust approved this study. Participants signed a consent letter agreeing for their participation in the study.First, information about demographic characteristics , orthodontic treatment status and the impact of oral conditions on quality of life during the last 6 months was self-reported by the participants. Information about oral impacts was collected using OHIP-14 and OIDP. Adolescents self-completed OHIP-14 in their classrooms and were later interviewed individually with OIDP in a private room. The OHIP-14, which has been previously validated on British populations ,22, asseAdolescents were then examined for normative orthodontic treatment need using both components of the Index of Orthodontic Treatment Need (IOTN) as well as the Dental Aesthetic Index (DAI). Both indexes have gained international acceptance because they are valid, reliable and easy to use -28. For Discriminative ability was examined in terms of construct validity whereby the distributions of scores for both OHRQoL measures are compared between groups with different levels of oral health . Since oAs the aforementioned method did not allow adjusting for covariates , the prevalence of oral impacts was also compared between adolescents with and without normative need for orthodontic treatment. For that, the prevalence of oral impacts was calculated as the percentage of adolescents reporting one or more items 'fairly often' or 'very often' for OHIP-14  and as tThis study included 134 (67.0%) females and 66 (33.0%) males, 116 (58.0%) were aged 16 years and 84 (42.0%) aged 17 years; 170 were Caucasian (85%) and 30 (15.0%) were of other ethnic origins. One third (32.5%) had completed orthodontic treatment, 12.5% were currently undergoing orthodontic treatment and the remaining 55.0% were untreated. Based on the two measures of orthodontic need, 42 (21.0%) had a normative need for orthodontic treatment according to IOTN whereas 25 (12.5%) had a normative need using DAI.There were significant differences in the overall scores for CS-OIDP attributed to malocclusion between adolescents with and without normative need for orthodontic treatment when IOTN or DAI were used to define need (p = 0.029 or 0.011 respectively), and in the overall scores for OHIP-14 when DAI, but not IOTN was used to define need (p = 0.029 and 0.080 respectively). Using DAI, the mean difference in overall scores for OHIP-14 and CS-OIDP attributed to malocclusion between adolescents with and without normative need was 1.64 points  and 2.13%  respectively. The corresponding size effects for such mean differences in overall scores were 0.28  and 0.53  respectively , but not for OHIP-14 (p = 0.799 and 0.211 respectively). This finding was independent of the index used to define normative need for orthodontic treatment . The comparison of prevalences between groups with different oral health statuses has been reported for other OHRQoL measures -43. UnquOverall, different findings were found when comparing the discriminative ability of OHIP-14 and CS-OIDP attributed to malocclusion between groups with and without normative need for orthodontic treatment. These findings differed according to the indicator used to assess the impacts of oral conditions on participants' quality of life  or the index used to define normative need for orthodontic treatment (IOTN or DAI). However, based on the present findings it appears that CS-OIDP attributed to malocclusion was better able than OHIP-14 to differentiate between the two groups of adolescents based on needs. Therefore, the present findings confirmed our earlier assumption that the condition-specific OHRQoL measures were better able to discriminate between sub-groups with different levels of oral health than their generic counterparts. This also provides empirical support for using condition-specific OHRQoL measures for oral health needs assessment.Our findings agree with the few previous studies comparing generic and condition-specific OHRQoL measures -44. TheyAmong a population of 16\u201317-year-old British adolescents, the CS-OIDP attributed to malocclusion was better able than the more generic OHIP-14 to discriminate between different levels of normative need for orthodontic treatment. Findings differed according to the indicator used to assess the impacts of oral conditions on participants' quality of life  or the index used to define normative need for orthodontic treatment (IOTN or DAI).The authors declare that they have no competing interests.EB conceived of the study, performed statistical analysis and drafted the first version of the manuscript. CMdO organized and conducted the study, and has critically revised the manuscript. AS supervised the entire study and critically revised the manuscript. All authors read and approved the final version of the manuscript."}
{"text": "We have recently noted that ingestion of dietary lipid (in the form of heavy whipping cream) leads to greater oxidative stress than dietary carbohydrate (in the form of dextrose), when consumed in isocaloric amounts.In the present investigation we attempted to replicate our work and also to determine the oxidative stress response to dextrose and lipid meals of two different kilocalorie  amounts.2O2). Area under the curve (AUC) was calculated for each variable, and a 4 \u00d7 5 ANOVA was utilized to further analyze data.Nine young (22 \u00b1 2 years), healthy men consumed in a random order, cross-over design one of four meals/drinks: dextrose at 75 g , dextrose at 150 g , lipid at 33 g , lipid at 66 g . Blood samples were collected Pre meal, and at 30 min, 60 min, 120 min, and 180 min post meal. Samples were assayed for glucose, triglycerides (TAG), malondialdehyde (MDA), and hydrogen peroxide . A meal \u00d7 time effect (p = 0.0002), a meal effect , and a time effect was noted for H2O2 . The time effect for H2O2 was primarily influenced by the 66 g lipid meal.A meal \u00d7 time effect (p = 0.0002) and a time effect was noted for glucose . The dextrose meals primarily contributed to this time effect. No other effects were noted for glucose (p > 0.05). A meal effect was noted for TAG . No other effects were noted for TAG (p > 0.05). An AUC effect was noted for MDA . A meal \u00d7 time effect (p = 0.02) and a meal effect was noted for MDA . No time effect was noted for MDA (p = 0.72). An AUC effect was noted for H2O2.These data indicate that 1) minimal oxidative stress is observed following ingestion of dextrose loads of either 75 g or 150 g, or a lipid load of 33 g and 2) lipid ingestion at 66 g leads to greater oxidative stress than lipid at 33 g or dextrose at either 75 g or 150 g. Hence, in a sample of young and healthy men, only 66 g of lipid (taken in the form of heavy whipping cream) leads to a significant increase in blood oxidative stress, as measured by MDA and H The process of normal cellular metabolism leads to the production of reactive oxygen species (ROS), the majority of which are inactivated by endogenous and exogenous antioxidants . The balIn general, a low-grade production of ROS  is associated with enhanced health; whereas, excessive ROS production and a chronic oxidative shift in the redox environment has been implicated in a wide variety of pathological conditions . This laIn relation to the ingestion of food, oxidative stress has been reported to occur during the minutes to hours following intake. This \"postprandial oxidative stress\" is likely a result of both a dramatic increase in ROS production, coupled with a decrease in antioxidant defense (commonly measured in blood samples of human participants) . FollowiThe postprandial production of ROS appears highly correlated to both the glucose  and the In terms of comparisons between carbohydrate and lipid meals, we have recently noted that ingestion of dietary lipid (in the form of heavy whipping cream) leads to significantly greater oxidative stress than dietary carbohydrate (in the form of dextrose), when these are consumed in isocaloric amounts . Our sub-1), non-diabetic (fasting glucose < 126 mg\u00b7dL-1), not regularly using antioxidant supplements or drugs, and did not have diagnosed cardiovascular or metabolic disorders. It should be noted that only nine subjects successfully completed all meal testing. Subject descriptive characteristics are presented in Table Ten young, healthy men were recruited from the University of Memphis and surrounding community and completed all aspects of this study. Sample size was chosen based on our prior work and the work of others focused on postprandial oxidative stress using similar outcome variables. All subjects were non-smokers, of normal weight, normolipidemic  prior to be being admitted as a subject.During the initial visit to the laboratory, subjects completed the informed consent form, health form, and physical activity questionnaire. The height, weight, and body composition (via 7 site skinfold assessment) of each subject was measured using a stadiometer, digital scale, and Lange skin fold calipers, respectively. Heart rate  and blood pressure (via auscultation) were recorded following a 10 minute period of quiet rest. An explanation of dietary data recording was provided, along with data collection forms.All subjects who met study criteria reported to the laboratory in the morning following a 10-hour overnight fast. Subjects rested for 10 minutes and then a pre-meal blood sample was collected. On four different days, in random order cross-over design, and separated by 3-7 days, subjects consumed one of four meals: dextrose at 75 grams , dextrose at 150 grams , lipid at 33 grams , lipid at 66 grams . The dextrose was in powder form  and the lipid consisted of heavy whipping cream . The 300 kcal drinks contained a total of 350 mL of fluid and the 600 kcal drinks contained a total of 700 mL of fluid. The amount of dextrose powder and whipping cream was weighed  and measured prior to the mixing of each drink. The volume of water added to each drink  was measured in a graduated cylinder. All portions were mixed in a blender. Subjects were given 10 minutes to consume the assigned drink.ad libitum during the first test day and matched for all subsequent test days. These procedures are similar to those we have used in several recent investigations [The postprandial observation period lasted three hours, during which time four additional blood samples were collected . We have noted in our previous work that in healthy men, the peak oxidative stress response occurs between 2-4 hours following ingestion of a lipid meal ,18,36. Tigations -18,36-39\u00ae by a trained phlebotomist. Following collection, blood samples were processed accordingly, and the plasma/serum was immediately stored at -70\u00b0C until analyzed. All blood samples were assayed for the following variables: glucose, triglycerides (TAG), malondialdehyde (MDA), and hydrogen peroxide (H2O2). We have recently studied these same variables in response to isocaloric dextrose and lipid meals . Therefore, we wanted to have similarity in our measures for the current study.Venous blood samples (~15 mL) were taken from subjects' forearm via needle and Vacutainer2O2 was analyzed in plasma using the Amplex Red reagent method as described by the manufacturer . In the reaction mixture, hydrogen peroxide, in the presence of horseradish peroxidase, reacts with Amplex Red reagent to generate the red-fluorescence oxidation product, resorufin. All assays were performed in duplicate on first thaw. These are commonly performed within our laboratory and the coefficient of variation for all measures is \u22647%.Assays for serum glucose and TAG were performed following standard enzymatic procedures as described by the reagent manufacturer . Standard curves for all assays were developed for determination of unknown samples. MDA was analyzed in plasma using a commercially available colorimetric assay , using previously described methods . H2O2 waSubjects were instructed to maintain their normal diet, and to record their food and beverage intake during the 24 hour period prior to each test day. Subjects were asked to consume similar food choices and quantities during the 24 hours prior to each test day. Nutritional records were analyzed for total kcals, protein, carbohydrate, fat, vitamin C, vitamin E, and vitamin A . Subjects were asked to maintain their normal physical activity habits during the study period but to avoid strenuous exercise during the 24 hours immediately preceding the test days, since such activity may have impacted the chosen biomarkers, as reported previously ,42.For each biomarker, the area under the curve (AUC) was calculated using the trapezoidal method as described in detail by Pruessner et al. . In addiAs indicated earlier, although 10 subjects were enrolled in the study, only nine subjects successfully completed all meal testing. One subject decided not to complete the testing protocol due to loss of interest. Therefore, data are only presented for nine subjects. No statistically significant differences were noted for kilocalories (p = 0.34), protein grams (p = 0.87), carbohydrate grams (p = 0.50), fat grams (p = 0.53), vitamin C (p = 0.76), vitamin E (p = 0.85), or vitamin A (p = 0.73). Data are presented in Table For blood glucose, no AUC effect was noted (p = 0.44). No meal effect was noted p = 0.13), although both a meal \u00d7 time effect (p = 0.0002) and a time effect was noted (p < 0.0001), with 30 min greater than Pre, 1 hr, 2 hr, and 3 hr (p < 0.05). As expected, the glucose meals contributed most to this time effect. Data are presented in Figure 3, althouFor blood TAG, no AUC effect was noted p = 0.26). No meal \u00d7 time effect (p = 0.27) or time effect was noted (p = 0.63). However, a meal effect was noted (p = 0.01), with the 66 g lipid meal greater than the 75 g and 150 g dextrose meals (p < 0.05). Data are presented in Figure 6. No meaFor blood MDA, an AUC effect was noted (p = 0.04), with the 66 g lipid meal greater than the 75 g and 150 g dextrose meals (p < 0.05). A meal \u00d7 time effect (p = 0.02) and a meal effect was noted (p = 0.004), with the 66 g lipid meal greater than the 75 g and 150 g dextrose meals (p < 0.05). However, no time effect was noted (p = 0.72). Data are presented in Figure 2O2, an AUC effect was noted (p = 0.0001), with the 66 g lipid meal greater than the 33 g lipid meal and the 75 g and 150 g dextrose meals (p < 0.05). A meal \u00d7 time effect (p = 0.0002), a meal effect (p < 0.0001), and a time effect was noted (p < 0.0001). Regarding the meal effect, the 66 g lipid meal was greater than the 33 g lipid meal and the 75 g and 150 g dextrose meals (p < 0.05). With regards to the time effect, 2 hr was greater than Pre, 30 min, and 1 hr; 3 hr was greater than Pre (p < 0.05). Data are presented in Figure For blood HWhen considering all four meals combined and using values generated using the AUC analysis, significant positive correlations were noted between many biochemical variables (p < 0.05). A correlation matrix is provided in Table 2O2). This is true despite the transient increase in blood glucose following ingestion of both the 75 g and 150 g dextrose meals  may have responded differently to the meals. Further work should consider the above prior to attempting to generalize results to populations other than young and healthy men, as doing so may be problematic.In addition to the above, other limitations of this work should be noted. First, it is important to mention that as with most studies in this area of investigation, we only measured olecules , as oppoSecond with regards to our main findings, lipid ingestion at 66 g leads to greater oxidative stress than lipid at 33 g or dextrose at either 75 g or 150 g. These data 1) confirm the results from our prior work in which we noted that ingestion of dietary lipid (heavy whipping cream) leads to greater oxidative stress than ingestion of dietary carbohydrate (dextrose), when consumed in isocaloric amounts  and 2) c2O2 production, and subsequent formation of MDA, a greater postprandial increase following the lipid meal would be expected based on the commonly accepted mechanisms underlying the regulation of postprandial superoxide production [2 donation to electron transferring flavoprotein-coenzyme Q oxidoreductase [2 than do carbohydrate) would promote greater H2O2 production compared to the dextrose meals. These findings are in agreement with our work [In relation to Hoduction . Consideeductase ), it folour work  and the our work ,32,48, nour work .Our results for the dextrose meals parallel some previous findings of minimal increase in oxidative stress when assessed using young, healthy subjects ,29,35,442O2 . Second, it should be understood that the magnitude and time course of response for TAG, MDA, and H2O2 does not exactly parallel one another, as can be observed in Figures 2O2. Following this rise in H2O2, lipids undergo oxidation which then leads to the delayed appearance of MDA which can be detected in the circulation. In the present study, MDA was still increasing at the end of the collection period, highlighting the delayed response for this marker of lipid peroxidation, which often occurs between 4-6 hours post feeding. Our failure to extend the collection time beyond three hours may be considered an additional limitation of this work.Related to the lipid meals, in particular the 66 g lipid meal, the TAG response to feeding was greater than that of the dextrose meals Figure . Based oO2 Table , it follThe present study is the fourth in which we have shown strong, positive correlations between the TAG response to feeding and the oxidative stress response to feeding -18. BecaIn relation to meal size, we did not observe any further increase in either blood glucose or oxidative stress with the 150 g vs. the 75 g dextrose meal. Therefore, we feel confident that simple sugar in the form of dextrose is rapidly and efficiently processed by young, healthy men. However, based on the present design, we cannot rule out that a ceiling effect occurs with lipid in relation to either blood TAG or oxidative stress. There is clearly a greater response with the higher lipid load, and further study is needed with ingestion of even higher amounts of lipid in order to adequately address the question of whether or not a ceiling effect occurs for oxidative stress in response to lipid feedings.From an applied point of view, we are uncertain that such work will provide practical data. That is, while subjects generally did not have a problem consuming either dextrose meal or the 33 g lipid meal, the 66 g lipid meal was challenging for some subjects--in particular for those who do not routinely ingest high fat meals--and would generally not be consumed in isolation without the inclusion of other macronutrients. However, while this amount of dietary lipid (66 g) can easily be consumed in a mixed meal (whole food or milkshake), it is likely that a similar oxidative stress response may be observed in a non-laboratory based setting where individuals consume high fat, high calorie meals. In a recent study we have compared a pure lipid meal (heavy whipping cream) to an isocaloric mixed meal of lipid, carbohydrate, and protein, noting a much greater oxidative stress response for the pure lipid meal . HoweverThe present findings indicate that minimal oxidative stress is observed following ingestion of dextrose at either 75 g or 150 g, or lipid at 33 g. Moreover, lipid ingestion at 66 g leads to greater oxidative stress than lipid at 33 g or dextrose at either 75 g or 150 g. Based on these data we conclude that in a sample of young and healthy men, only 66 g of lipid (consumed in the form of heavy whipping cream) leads to a significant increase in blood oxidative stress. Future research should consider the inclusion of older and metabolically compromised individuals, in an effort to determine their response to such feedings. These studies should consider the incorporation of a more realistic \"mixed meal\" in terms of macronutrient composition. This should provide for practical applications that may have clinical relevance pertaining to oxidative stress specific ill-health and disease.Financial support for this work was provided by the University of Memphis. The authors declare no competing interests.RJB was responsible for the study design, biochemical work, statistical analyses, and manuscript preparation; REC, MMK, KEM, and TMF were responsible for data collection, blood collection and processing, and assistance with manuscript preparation. All authors read and approved of the final manuscript."}
{"text": "This study examines changes in socio-demographic, environmental and intrapersonal factors associated with dog acquisition in non-dog owners at baseline to 12-months follow-up and the effect of dog acquisition on minutes per week of recreational walking.RESIDE study participants completed self-administered questionnaires (baseline and 12-months follow-up) measuring physical activity, dog ownership, dog walking behavior as well as environmental, intrapersonal and socio-demographic factors. Analysis was restricted to 'Continuing non-owners'  and 'New dog owners' .p < 0.05). After adjusting for baseline variables the effect of dog acquisition on the increase in minutes of recreational walking within the neighborhood was 31 minutes . However, this reduced to 22 minutes  after further adjustment for change in baseline to follow-up variables. Increase in intention to walk was the main factor contributing to attenuation of the effect of dog acquisition on recreational walking.Overall, 12% of baseline non-owners had acquired a dog at follow-up. Dog acquisition was associated with working and having children at home. Those who changed from single to couple marital status were also more likely to acquire a dog. The increase in minutes of walking for recreation within the neighborhood from baseline to follow-up was 48 minutes/week for new dog owners compared with 12 minutes/week for continuing non-owners (leads to an increase in walking. The most likely mechanism through which dog acquisition facilitates increased physical activity is through behavioral intention via the dog's positive effect on owner's cognitive beliefs about walking, and through the provision of motivation and social support for walking. The results suggest that behavioral intention mediates the relationship between dog acquisition and walking and that dogs may have a significant role in the maintenance of owner walking behavior.This study used a large representative sample of non-owners to examine the relationship between dog acquisition and recreational walking and provides evidence to suggest that dog acquisition  Over half of all adults in the United States and Australia do not meet the recommended level of physical activity necessary for health benefit ,2. GrowiCross-sectional studies suggest that dog owners are more physically active than non-owners ,7 and arEvidence of the potential for dog ownership to facilitate higher levels of physical activity has been limited to date because it is mainly cross-sectional. One small study of adults who acquired a pet (dog or cat) from an animal shelter (n = 71) examined whether pet acquisition changed owner's health status, including their physical activity. Compared with cat owners and the control group, dog owners increased and maintained their walking from one hour/week at baseline to five hours/week at 10 months follow-up ,15. WhilOnly two prospective studies have examined the association between dog ownership and physical activity over time and both of these studies were conducted in an elderly population ,16. ThorThe sample included all baseline non-dog owners taking part in the RESIDential Environments (RESIDE) project, a 5-year longitudinal study evaluating the impact of a state-government sub-division code in Perth, Western Australia . DescribAt both time points participants were asked about the type of pet(s) owned. The responses included dog, cat, bird and other pet. Only baseline non-dog owners who at 12 months follow-up either remained non-owners or had acquired a dog were included in the study (n = 773). Participants' who did not own a dog at baseline but who had acquired a dog at follow-up were classified as 'New dog owners' while participants who were non-dog owners at baseline and follow-up were classified as 'Continuing non-owners'.Self-reported physical activity over a usual week was collected using the Neighborhood Physical Activity Questionnaire (NPAQ), which differentiates between walking within and outside of the neighborhood and has acceptable reliability . NPAQ meBaseline socio-demographic variables included: gender, age, country of origin, marital status, presence of children <18 years at home, mean age of children <18 years at home, education level attained, work status, number of hours worked/week, occupational status, household income and type of residence. New categorical socio-demographic variables were created to reflect changes in these variables between baseline and follow-up.A modified version of the Neighborhood Environment Walkability Scale (NEWS)  was usedMost change variables were coded as no change, increase or decrease from baseline to follow-up. Four socio-demographic change variables were coded differently: marital status ; work status ; children under 18 years at home ; and type of residence . For example, no change in marital status included participants who were the same marital status [either single  or couple (married or defacto)] at both time points.p \u2264 0.05 were entered (forced entry) into a linear regression model to investigate the association between dog acquisition and change in minutes of recreational walking in the neighborhood. Three models were constructed. The first model was unadjusted; the second model adjusted for baseline recreational walking in the neighborhood and significant baseline socio-demographic variables from Table p \u2264 0.05.Chi square and independent sample t-tests were used to examine the association between dog acquisition and, baseline socio-demographic and change from baseline to follow-up variables. Those variables found to be significant at p < 0.05). No significant differences between new dog owners and continuing non-owners baseline physical or social environments were observed (results not shown).Twelve percent (n = 92) of baseline non-dog owners (n = 773) acquired a dog by follow-up. A number of baseline socio-demographic characteristics were significantly associated with dog acquisition Table . At basep < 0.05). Furthermore, more new dog owners than continuing non-owners reported an increase in their intention, self-efficacy and use of behavioral skills for walking in the next month (p < 0.05). There were no other significant changes in physical and social environments or individual factors by dog acquisition at follow-up.Changes in marital status Table , intentip < 0.05)  Table . Mean wep < 0.05). Moreover, new dog owners increased their total walking by 38 minutes/week between baseline and follow-up. In the same period, continuing non-owners decreased their walking by 5 minutes/week (p < 0.05). While new dog owners reported an increase in their overall physical activity of 32 minutes/week, this was not significantly different to that of continuing non-owners (3 minutes/week).At follow-up, new dog owners walked with their dog in their neighborhood an average of 130 minutes/week Table . Increasp < 0.01) greater in those who acquired a dog compared with continuing non-owners. After adjusting for baseline walking for recreation within the neighborhood and significant baseline socio-demographic variables (model 2), the effect of dog acquisition on the increase in minutes of recreational walking within the neighborhood attenuated to 30.8 minutes but remained statistically significant . Baseline walking for recreation in the neighborhood accounted for almost all of the attenuation. Nevertheless, when the model was further adjusted for significant change in baseline to follow-up variables (model 3), the effect of dog acquisition on the increase in minutes of recreational walking within the neighborhood was reduced to 21.9 minutes and was no longer statistically significant . Further modeling revealed that when the variable for change in intention to walk was dropped from model 3, the effect of dog acquisition on the increase in the minutes of recreational walking within the neighborhood increased to 27.3 minutes and was once again statistically significant  thus indicating that adjustment for change in intention to walk was the principal reason for the reduced effect of dog acquisition. The other three change variables  collectively were responsible for the remaining difference of 3.5 minutes.Linear regression models were used to examine the unadjusted and adjusted effects of dog acquisition on change in minutes of recreational walking within the neighborhood. In the unadjusted model (model 1), the increase in minutes/week of recreational walking within the neighborhood was 35.9 minutes , the increase in minutes of recreational walking reduced from 36 to 22 minutes/week and was no longer statistically significant. Thus, increase in intention to walk was associated with both dog acquisition and increased recreational walking and explains a large part of the effect of dog acquisition on increased recreational walking. While it appears that change in intention to walk is a significant mediator of this relationship, the temporal order of dog acquisition and increased intention to walk is unconfirmed. For instance, does interest, capacity or intention to walk in the next month increase and as a result a dog is acquired to assist in shifting intention to action, or is a dog acquired and through a sense of obligation to care for the dog, intention to walk increases ?Acquiring a dog is coupled with a responsibility to care for the health and well-being of that dog . Basic cIn this study, the increase in overall walking was greater than the increase in recreational walking in the neighborhood (43 vs. 36 minutes). Although the increase in minutes of recreational walking associated with dog acquisition represented a significant increase, walking for recreation makes up only one component of all walking. Thus, it is possible that new dog owners also increased their time spent walking for recreation outside their neighborhood  as well as transport-related walking . Moreover, at baseline new dog owners did significantly less weekly minutes of overall walking than continuing non-owners. This suggests that new dog owners had greater potential than continuing non-owners to increase their weekly minutes of overall walking and may in part explain why the increase in minutes of overall walking was more than the increase in minutes of recreational walking in the neighborhood.Furthermore, the increase in minutes of recreational walking and overall walking associated with dog acquisition was not reflected in the increase in total physical activity (36 vs. 30 and 43 vs. 30 minutes respectively), suggesting that recreational walking was substituted in place of other types of physical activity. It could be that confounding factors influence the relationship between dog acquisition and change in minutes of total physical activity as was shown for recreational walking. However, it is more likely that new dog owners increased their minutes of recreational walking at the expense of other types of physical activity. In this study, baseline levels of total physical activity were well above the recommended level of 150 minutes/week and there was no significant difference in baseline minutes of total physical activity for new dog owners and continuing non-owners. These results suggest that there was little potential for minutes of total physical activity to increase post dog acquisition and it is likely that new dog owners substituted other types of physical activity for more dog walking.The Marchetti principle  applied While dog acquisition appears to positively influence the initiation of walking behavior, dog ownership may be more important for the maintenance of such behavior over time. For example, a study in the elderly found that after three years, dog walkers maintained their mobility advantage over owners who did not walk their dog and non-owners . A dog mIn addition, dog ownership may help with the maintenance of physical activity behavior during periods of transition. For example, in this study, dog acquisition was associated with people moving from a single to couple relationship. Previous research has shown that changing from a single lifestyle to cohabitation is associated with changes in health-related behaviors such as decreased physical activity, poorer dietary habits and weight gain -52. PeopThis study's large sample size with sufficient power to examine the association between dog acquisition and increased recreational walking is a strength. However, generalizability of the findings may be compromised because RESIDE study participants are moving into new housing developments and may not be representative of all new dog owners and continuing non-owners. Moreover, this study relied on self-reported physical activity and it is possible that new dog owners may have over-estimated the minutes spent walking with their dog. Future studies would be strengthened by objectively measuring dog walking behavior. Finally, this study was not able to ascertain the causal pathway between dog acquisition and increase in intention to walk. Reasons for acquiring a dog, type of dog acquired and age of dog at follow-up are relevant factors to consider when investigating whether dog acquisition increases walking and should be considered in future prospective studies. Furthermore, it may be useful to examine the effect of long term intention  on the relationship between dog acquisition and walking.Our study provides longitudinal evidence to suggest that dog acquisition leads to an increase in walking. Dog acquisition increased recreational walking by 31 minutes/week and this relationship persisted after adjusting for baseline recreational walking and baseline factors associated with dog acquisition. Moreover, increased intention to walk mediated the relationship between dog acquisition and increased recreational walking. It is likely that the mechanisms through which dog acquisition facilitates increased physical activity is through behavioral intention via the dog's positive effect on owner's cognitive beliefs about walking and from motivation and social support for walking. Furthermore, while it appears dog owners may substitute dog walking for other types of physical activity; it is likely that the long-term commitment of dog ownership plays a significant role in assisting owners to maintain their walking behavior. Considering that 40% of households in the United States and Australia own a dog, examination of the effect of dog ownership on physical activity adoption and adherence warrants further investigation.The first author (Hayley Cutt) is supported by an Australian Research Council, Australian Postgraduate Award \u2013 Industry which has Petcare Information and Advisory Service as the Industry Partner. The Petcare Information and Advisory Service placed no restrictions on the design, analysis, interpretation or publication of study findings. All other authors declare that they have no competing interests.HC conceived and designed the study and, analyzed and interpreted all data. HC drafted the manuscript revising it critically at each stage. MK advised on the design and analysis of the study, the interpretation of results and provided input at each stage of the manuscript draft. BG-C advised on interpretation and implications of results also providing input at each stage of the manuscript draft. All authors read and approved the final manuscript."}
{"text": "The early flowering of siz1 was suppressed by expressing nahG, indicating that SIZ1 represses the transition to flowering mainly through suppressing SA-dependent floral promotion signaling under short days. Previous results have shown that exogenous SA treatment does not suppress late flowering of autonomous pathway mutants. However, the siz1 mutation accelerated flowering time of an autonomous pathway mutant, luminidependens, by reducing the expression of FLOWERING LOCUS C (FLC), a floral repressor. This result suggests that SIZ1 promotes FLC expression, possibly through an SA-independent pathway. Evidence indicates that SIZ1 is required for the full activation of FLC expression in the late-flowering FRIGIDA background. Interestingly, increased FLC expression and late flowering of an autonomous pathway mutant, flowering locus d (fld), was not suppressed by siz1, suggesting that SIZ1 promotes FLC expression by repressing FLD. Consistent with this, SIZ1 facilitates sumoylation of FLD that can be suppressed by mutations in three predicted sumoylation motifs in FLD (i.e. FLDK3R). Furthermore, expression of FLDK3R in fld protoplasts strongly reduced FLC transcription compared with expression of FLD, and this affect was linked to reduced acetylation of histone 4 in FLC chromatin. Taken together, the results suggest that SIZ1 is a floral repressor that not only represses the SA-dependent pathway, but also promotes FLC expression by repressing FLD activity through sumoylation, which is required for full FLC expression in a FRIGIDA background.Loss-of-function  AtSIZ1, facilitates SUMO modification of transcription factors, PHR1 and ICE1, which regulate phosphate-starvation signaling and low-temperature response, respectively  to protein substrates . SUMO E3ectively . A SUMO Flowering is the result of a plant developmental process that controls the transition from vegetative maturity to the reproductive stage . Floral GIGANTEA (GI), CONSTANS (CO) and FLOWERING LOCUS T (FT), cause significantly delayed flowering under long days (CO transcript is regulated by circadian clock oscillators [e.g. CIRCADIAN CLOCK-ASSOCIATED PROTEIN 1 (CCA1)] (GI) (FLOWERING LOCUS T (FT) expression. FT in turn activates expression of SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) and floral identity genes such as APETALA1 (AP1) (Photoperiodic-pathway genes promote transition to flowering in response to a long-day photoperiod ( (CCA1)]  and clocFLOWERING LOCUS C (FLC)  in winter-annual ecotypes causes increased expression of FLC and delayed flowering, which is reversed by lesions in FLC or by vernalization treatment (FLOWERING LOCUS D (FLD), a plant ortholog of the human protein KIAA0601/LYSINE-SPECIFIC HISTONE DEMETHYLASE1 (LSD1), represses FLC expression by facilitating deacetylation of histone H4 in FLC chromatin, but how this process is regulated remains to be elucidated  . FLC encreatment . Among tSOC1 and LEAFY expression, and is considered to be involved in the main floral-inducing cascade under short days (SD)  are implicated in the regulation of floral transition  loss-of-function mutant plants  in siz1-2 plants suppressed the dwarf and early flowering phenotypes of plants from multiple, independent transformed lines (ProSIZ1:GUS:GFP (SGG) in siz1-2 failed to complement these siz1-2 phenotypes in the same experiments  were determined (CCA1 and CCR2::LUCIFERASE (CCR2::LUC) was not altered by siz1 mutations, suggesting that SIZ1 does not regulate the circadian clock .Mutations in circadian oscillator genes cause a short-period phenotype, which results in early flowering under SD . To determine whether siz1 mutations affect the GA-dependent floral promotion pathway, exogenous GA was applied to wild-type, siz1-2 and siz1-3 plants, and flowering times were determined under LD and SD . Exogenous GA treatment accelerated the flowering time of both wild-type and siz1 plants to an equivalent extent , indicating that the GA floral promotion pathway is not impaired in siz1 plants.To determine if there is an interaction between  pathway . Consistsiz1 plants accumulate higher levels of SA, which causes increased plant innate immunity /MADS AFFECTING FLOWERING1 (MAF1), MAF2, MAF3, MAF4 and MAF5, and SHORT VEGETATIVE PHASE (SVP) were analyzed  .To test whether reduced  (flc-3) . Under Le plants . The flo2 plants . Consist2 plants , the flounder SD . Double-under SD . These rSOC1 transcript levels were greater in siz1 compared with wild-type plants under both LD and SD , SIZ1 appears to be required for full FLC expression in late-flowering autonomous pathway mutants and a FRI background. Double mutants were made between siz1-2 and dysfunctional alleles of late-flowering autonomous pathway mutants, such as luminidependens (ld-1) and fld-6 , indicating that SIZ1 does not regulate expression of FLD.Although reduction of nd fld-6 . Also, a FRI-Col , ld-1 ane plants . The sizl plants ,c. Consiectively ,d. Note under SD . Moreovemutation . These rhttp://www.abgent.com/tool/sumoplot) analyses. Thus, FLD could be a potential SUMO target protein  in FLD were identified by SUMOplot  reduced FLC expression to a greater extent than expression of HA:FLD (sumoylated) relative to vector control (Effects of FLD and FLDK3R (constitutively unsumoylated) on activity . HA:FLD,time PCR . Transie control ,c.FLD mutations, which disturb protein function, cause FLC transcript accumulation and late flowering that is linked to hyperacetylation of histone 4 (H4) in chromatin associated with the first intron of FLC . Under SD, SIZ1 function on flowering time also showed little dependence on FLC (i.e. the flowering time of flc-3 siz1-2 was similar to that of siz1-2 plants), indicating that under SD, SA promotes transition to flowering mainly through FLC-independent pathway(s). These results further indicate that SA accelerates flowering through pathways that are independent of the vernalization and the autonomous pathways, as these two pathways promote transition to flowering through repression of FLC expression. SA could facilitate transition to flowering by shortening the circadian period , suggesting that SA does not regulate the circadian clock. Moreover, GA-dependent floral promotion is operative in siz1 plants that contain a high level of SA . Thus, it is likely that SA accelerates flowering through pathways that are independent of photoperiodic- and vernalization-dependent pathways, and the autonomous and GA-dependent pathways. Despite the major role of SA in the early flowering of siz1 under SD, the flowering time of nahGsiz1-2 was slightly earlier than that of nahG plants under SD  by which SUMO modification of FLD affects HDAC activity remains unelucidated. The FLD homolog, KIAA0601/LSD1, has lysine-specific demethylase activity that is associated with numerous co-repressor complexes, such as CoREST, BHC80 and HDAC in humans . LSD1 ansiz1-2 (SALK_065397) and siz1-3 (SALK_034008) lines were obtained from ABRC at Ohio State University  were described previously (fld-6 (SAIL_642 C05) was isolated from T-DNA mutant SAIL lines, which were kindly provided by Dr R.M. Amasino . Homozygous double mutants were obtained by crossing various flowering-time mutants with siz1-2. The presence of siz1-2 and fld-6 mutations were analyzed by diagnostic PCR analysis according to the SALK T-DNA verification protocol , and the presence of the FRI-SF2, ld-1, flc-3, gi-2, co-1, ft-1 and soc1-2 mutations was analyzed according to a previous report  in growth chambers, which were equipped with seven ALTO PLUS T8 fluorescent lamps  and one PLANT & AQUARIUM 40W lamp . For exogenous GA treatment, 100 \u03bcM GA3 was sprayed twice onto 7- or 14-day-old seedlings grown under either LD or SD. The flowering time is estimated based on the number of rosette leaves formed by the primary shoot apical meristem prior to flowering under LD and SD, as described above. At least 15\u201320 plants were used to determine the flowering time of each genotype.To break seed dormancy, seeds were stratified on soil for 4 days at 4\u00b0C before transfer to normal growth conditions. Plants were grown at 23\u00b0C in a greenhouse under LD (16-h light/8-h dark), whereas for SD (8-h light/16-h dark), plants were grown at 22\u00b0C under fluorescent lights  according to the manufacturer\u2019s protocol. A 200-ng sample of RNA was used as the template for first-strand cDNA synthesis with the ThermoScript RT-PCR System  and an oligo (dT21) primer. Specific gene expression levels were analyzed by semiquantitative RT-PCR or real-time PCR  with protein-A-sepharose CL-4B . Immunoprecipitated proteins were released in 2\u00d7 SDS sample buffer, separated by SDS- PAGE, and detected by western blotting using anti-HA monoclonal antibodies   (siz1-2 and fld-6 plants and anti-acetylated H4 antibody were used for ChIP analyses. To check the activity of the sumoylation-deficient mutant, FLDK3R, HA:FLD or HA:FLDK3R were transiently expressed in SD-grown 20-day-old fld-6 protoplasts. After 40 h of incubation, ChIP analysis was performed to determine the acetylation status of H4 in FLC chromatin as described above. The fold enrichment in H4 acetylation was calculated as follows: FLC was first normalized to ACTIN in each sample, and these values were normalized against their respective wild type or vector controls.The chromatin immunoprecipitation experiments were performed as described previously (Rhythm analysis was performed as described by"}
{"text": "It is shown that at least three intracellular pathways are implicated in the Ia induction, p21ras is the first protein activated by the two agents while further signalling requires Ca2+ mobilization and PKC activations. When the in vitro results are transferred to live animals using the same inducing agents and pathway inhibitors, it is found that theophylline (Ca2+/CaM inhibitor) and anti-p21ras are the most potent suppressors of the IFN-\u03b3- and 5-azaC-induced side effects during pregnancy. The data presented here point to novel directions not only as to the intracellular signalling, but also to the use of pathway inhibitors in vivo to treat aberrant antigen expression associated with fetal loss.The placenta, one of the most important fetal tissues during gestation, ensures nutrition, development and protection of the fetus. Although placenta lacks expression of class II MHC antigens, they can be induced either by interferon-gamma (IFN-\u03b3) on the spongiotrophoblast zone, or by 5-azacytidine (5-azaC) on the labyrinthine trophoblast zone, two agents actively participating in a plethora of immunological and inflammatory reactions. This induction is correlated with fetal abortion and fetal developmental abnormalities. In this work the"}
{"text": "To ensure carers of people with dementia receive support, community services increasingly use measures of caregiver (carer) burden to assess for unmet need. This study used Bradshaw's taxonomy of need to explore the link between measures of carer burden (normative need), service use (expressed need), and carer's stated need (felt need).This mixed method exploratory study compared measures of carer burden with community services received and unmet needs, for 20 community-dwelling carer/care-recipient pairs.A simple one-item measure of carers' felt need for more services was significantly related to carer stress as measured on the GHQ-30. Qualitative data showed that there are many potential stressors for carers, other than those related to the care-giving role. We found a statistically significant rank correlation (p = 0.01) between carer's use of in-home respite and the care-recipient's cognitive and functional status which is likely to have been related to increased requirement for carer vigilance, effort and the isolation of spouse carers. Otherwise, there were no statistically significant relationships between carer burden or stress and level of service provision.felt need may be a better indicator of service need, and a red flag for recognising growing stress in carers of people with dementia. Assessment of service needs should recognise the fallibility of carer burden measures, given that carer stress may not only come from caring for someone with dementia, but can be significantly compounded by other life situations.When carers are stressed or depressed, they can recognise that they would like more help from services, even if measures of carer burden and care recipient status do not clearly indicate unmet service needs. A question designed to elicit carer'  Assessment and monitoring of caregiver (carer) burden are increasingly seen as essential factors in ensuring that carers receive community support , but theThe focus of this study is carers of persons with dementia, who provide critical support for care recipients by improving their quality of life and delaying entry to care homes . With esIn comparison with the general carer population, carers of people with dementia exhibit higher levels of unmet need and lower levels of service use ,15,16. TBrodaty et al.  developeService organisations typically use a range of assessment tools at admission to assess carers' service needs, which generally act as a 'gateway' to services. In this approach, a care professional \"begins with the identification of specific difficulties, accounts for the presence and efficacy of current help, recognises perceived need and finally specifie[s] the type of intervention required to meet those needs\" : 323]. W23. W3]. normative need, felt need, expressed need, and comparative need. The carer burden assessment approach described by Meaney et al.  and she just won't have a bar of it\" [(2) Int 2].Carers felt 'caught' and 'trapped' when care recipients were reluctant to leave the home, as most care recipients could not be left alone. As a consequence, our sample of carers needed in-home respite as dementia severity increased, in order to address the basic requirements of their lives and households. One interviewee caring for a person with a DRS-2 score of 35 (i.e severe dementia) reported that:\"With [IHR] I can leave the house to go out and do the things that I am interested in\" [(13) Int 2].Another carer felt that in-home respite was necessary because:\"You just go out, pay your bills, (then) you've got to get back again because you can't leave them on their own, they're not safe to be on their own\" [(8) Int 3].In instances of in-home respite, carers also felt reassured that their 'time-out' had not been obtained at the cost of distressing the care recipient by exposure to new environments and unfamiliar circumstances.The interviews also suggested reasons why practical help was the least used service in this sample. Most of the carers were female spouses, and for many  of this group, caring fell within their normative expectations of the spousal role. The increased 'work' within the home  was accepted as an extension of the regular duties that this role implied. For carers such as this one, offers of practical help were deemed unnecessary and inappropriate:\"All I ever wanted was someone to be here in the house so he was safe, to feed him. I never expected or wanted anyone to come in and do my housework or any of those types of thing.\" [(13) Int 1].This quote illustrates the difference between the carer's felt need and a normative assessment of need, demonstrating that the carer is quite clear about the type of service she would like to receive and would accept.normative measures of need may fail to identify carers experiencing significant stress.The interviews supported documented evidence that care-giving is stressful, but also showed that carers' stress may originate from events that are unrelated to the cognitive or functional status of care recipients. The carer sample proffered examples of other events that had generated stress in their lives, such as a carer diagnosed with a life-threatening illness or with a medical history of mental illness, the death of a pet, and grief for the loss of the partnership that the care recipient had once provided. These diverse life situations and expectations highlight problems inherent in basing carers service needs on measures of carer burden or care recipient disease status, and explain why The interviews also indicated that the process of finding out about existing services and about their own eligibility for those services could be onerous for carers. Some carers felt that assessments were time consuming and achieved no satisfying result, either because particular services were not what the carer wanted or because the care recipient was not deemed eligible. The following quote is from a carer whose care-recipient had only moderate cognitive impairment, but whose GHQ-30 score was 13:\"Well there's been five actual assessments and three interviews... over the last four months...then there was the day care lady came and assessed her and that was fruitless\" [(3) int 3].normative need assessments (five home visits), without necessarily benefiting stressed carers. Overall, the interview data highlighted the complexity of interactions between the care-giving situation and service use, and the limitations of relying on professional assessments.This quote also demonstrates how many resources can be applied to felt needs expressed by carers of people with dementia are an important indicator of service need. The extensive list of possible causes of burden in carers' lives extends beyond the fact of caring for someone with dementia. Within the context of particularly challenging life circumstances, even modest care recipient demands may 'tip the scales' for carers and cause excessive stress. This means that relying on assessments of the status of care recipients with dementia, and on carer burden, may inadvertently exclude those for whom the basis of their need for services falls outside existing measures. While large data sets indicate that key factors such as cognition and ADL functions increase the probability of carers needing services [felt need should be given greater priority over normative need in assessing service needs for carers of people with dementia.A key implication arising from our data is that services , unknownnormative measures of need and the expressed need of service use in the case of dementia carers. Insufficiently acknowledged interactions between carer life circumstances and identity issues, and the disease status of care recipients may mean that measures of normative need capture only a limited range of causes of carer stress and service needs. Measuring stress clinically with a more direct tool such as the GHQ-30 objectively measures carer stress, since professionals are not trying to 'work backwards' by assessing possible causes of stress, in the manner of many burden measures. Given the complexity of carers' life situations, and the benefits that carers provide to the health care system in supporting people with dementia, it may be that offers of services should be based primarily on carers felt needs. This suggestion is supported by previous studies finding that unmet service needs have complex causes [Our interview data shed light on the limited relationship between x causes , and thax causes .The correlation between DSR-2 and BADLS and in-home respite suggests that the cognitive and functional aspects of care recipient deterioration are linked to in-home respite need. The reported social isolation of spouse carers  is an exfelt) service needs should be considered a 'red flag' by service providers.Assisted by the provision of only modest service hours, carers who participated in this study were able to support care recipients to remain at home until they reached moderate to severe stages of dementia. Carers such as these make an important contribution to the health care system and save health and social services significant costs thereby benefiting the public purse. In line with previous research ,10 howevWhat of those who refuse services? These findings suggest carers could be refusing services because particular services are not suitable, or because the carer does not identify his or her stress as directly linked to the care recipient. In these cases, services may need to offer more flexible options, a conclusion also reached by other researchers . These cThe small convenience sample used in this study is a limitation that raises the risk of Type II errors and prevents generalisability. The participants comprising our sample were already linked into and using some services, as could be expected by the dementia severity of their care recipients, and did not include isolated carers, or carers of persons with early stage dementia. Our sample also consisted mostly of female spouses, and this clearly influenced their belief systems about the appropriateness of using services. However the mixed method design we utilised provides a different strength through triangulation of quantitative with qualitative data, in which interlinked contextual information informed the interpretation of measurement results.normative need is not as useful as felt need when considering the health service needs of carers of people with dementia. A focus on measuring the care recipient's disease status and carer's burden overlooks the influences that broad life circumstances have on carer's service needs. Attempts to index the carer's service needs via objective cataloguing of functional and cognitive impairments may therefore be inadequate Our data suggest that felt need is a suitable indicator of carer unmet needs, because it is significantly related to carers' mental health status. Felt need may therefore be an appropriate 'red flag' of carer burnout, even in the absence of obvious \"flags\" raised by behavioural, functional and cognitive decline. In view of the current client-centred focus of health services, and the acknowledged burgeoning of numbers of people with dementia, our study contributes to the growing knowledge of how services can better support carers. Health services and professionals may need to reorient their approach away from traditional normative need assessments toward more participatory felt need. The small sample of carers and care recipients used in this mixed-methods study means that a larger investigation is required to assess the relevance of our findings to the general population of carers of people with dementia. However the similarity of our findings to larger data sets suggests that such a wider investigation needs to focus on felt carer need and service access, rather than on assessment.Overall, this exploratory study suggests that None declared. This study was funded by the JO and JR Wicking Trust (ANZ Charitable Services). The funders played no role in the study, data analysis or writing of the article. All researchers had complete independence from the funders in undertaking the study.CS and SA analysed the data and wrote the paper. TC, AR, JV and PT designed and supervised the study. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6963/10/122/prepub"}
{"text": "ANOVA analyses detected significant differences in dN/dS ratios among races (P < 0.02). gp120 sequences from the black individuals showed higher mean dN/dS ratios for all estimators (1.24\u20131.45) than in other races (0.66\u20131.35), and several pairwise comparisons involving blacks remained significant (P < 0.05) after correction for multiple tests. In addition, black-placebo individuals showed significantly (P < 0.02) higher mean dN/dS ratios (1.3\u20131.66) than placebo individuals from the other races (0.65\u20131.56). These results suggest intrinsic differences among races in immune response and highlight the need for including multiple ethnicities in the design of future HIV-1 vaccine studies and trials.Differences in HIV-1 gp120 sequence variation were examined in North American volunteers who became infected during a phase III vaccine trial using the rgp120 vaccine. Molecular adaptation of the virus in vaccine and placebo recipients from different ethnic subgroups was compared by estimating the  P = 0.012). After adjustment for multiple tests, this difference was not significant (P = 0.13) [More than 33 million people are currently infected with HIV-1, resulting in 2\u20133 million deaths every year. Natural immunity to the virus is virtually nonexistent; hence, the creation of a vaccine to combat this global pandemic is an international public-health priority . OveralldN/dS) [HIV-1 evolution is driven, to a significant extent, by the immune response. If viruses isolated from non-white patients are in fact under a stronger selection pressure either because of genetic differences in the magnitude, specificity, or potency of the natural immune response, or because of differences in factors affecting virus replication, we should expect higher ratios of nonsynonymous (amino acid changing) to synonymous nucleotide substitutions (dN/dS) -8 than i). Full-length HIV-1 subtype B gp120 sequences were amplified as described in Gilbert et al. [dN/dS ratios were estimated using Nei and Gojobori's method [dN/dS ratios independently for each fragment.To test whether levels of selection were significantly different between vaccinated and placebo individuals in different races, we analyzed 3 clones per individual from 345 infected North Americans from the VAX004 study  and pairwise t-tests. Because treating all non-whites as a single unit is unrealistic considering their own genetic differences [Mean ferences , we testferences .dN/dS obtained with SNAP, PAML and HYPHY were all significantly correlated among the different estimators used . Importantly, the mean dN/dS ratios varied across races (Table P < 0.02) for SNAP and PAML estimates. Blacks (vaccinees and placebo combined) showed higher dN/dS ratios for all the estimators than individuals from other ethnicities (Table P < 0.05) between black and white, Hispanic and \"others\" viral samples were observed for all the estimators before corrections, but only the comparisons involving SNAP and PAML estimates remained significant after the Benjamini and Hochberg's adjustment  in SNAP dN/dS ratios were detected among placebo individuals. Moreover, black-placebo patients showed significantly  higher mean dN/dS ratios  than the other races . These results might indicate that natural differences in the immune response may have increased viral rgp120 adaptation in blacks.Does the greater virus adaptive variation presumed in black participants reflect genetic differences in the intrinsic (no-preconditioned) immune response to HIV-1, or is it a consequence of the conditioned immune response induced by vaccination with rgp120? Comparison of vaccine and placebo recipients showed different results based on the In North America, blacks correspond to 42% of all newly diagnosed HIV/AIDS cases, while white (non-Hispanic) and Hispanic individuals represent approximately 40% and 17%, respectively . If moreThe authors declare that they have no competing interests.MPL, DP, and KC developed the genetic and statistical strategies implemented in this work. MPL, DP, and MA performed the genetic and statistical analyses. DVJ, FS, and PWB carried out the molecular genetic studies and immunoassays. All authors participated in the design of the study and helped to draft the manuscript. All authors read and approved the final manuscript."}
{"text": "The burden of psychiatric morbidity is ever increasing, cutting across regional, socio-economic and cultural barriers.The global burden of disease due to neuropsychiatric disorders was measured to be 6.8% world wide in 1990. This is projected to increase to 15% by the year 2020. Psychiatric disorders account for 5 of the 10 leading causes of disability across the world.[Population - 1081.2 millionPopulation per sq km - 328.9Population under 15-32.1%Population over 60-7.1%Urban population -28.7%Men per 100 women - 105Mental-health disorders account for nearly a sixth of all related disorders. Yet we have just 0.4 psychiatrists and 0.02 psychologists per 100,000 people and 0.25 mental health beds per 10,000 population.Depression, child abuse, domestic violence, adjustment disorders are on the rise; so is the rate of suicide. The suicide rate in India in the early eighties used to be 6 per 1,00,000 per year. More than a decade later, the rate is 11 per 1,00,000 per year. The highest rate of suicide is prevalent among the younger age groups - between 18 and 29 years.[Despite such high rates of mortality and morbidity associated with psychiatric disorders, the psychiatrist to population ratio in India is very low.Besides, not all patients with psychiatric disorders or symptoms consult the psychiatrist. The findings of the ICMR-collaborated effort in Bangalore. Hyderabad and Vellore showed that an overwhelming majority of patients with neurosis, depression, alcohol-related problems, sexual problems and psychosomatic disorders seek advice from general physicians and not from the psychiatrists .Studies have also revealed that nearly two-thirds of all persons who commit suicide contact their family physicians in the month preceding the event. Physicians being aware about psychiatric symptomatalogy therefore, can prevent many untimely deaths.Patients from all disciplines of Medicine or Surgery may develop psychiatric complications at any point of time.Delirum, one of the commonest psychiatric diagnoses, is present in nearly 10% of emergency department patients and 40% of all terminally ill patients. Nearly 53% of all patients of chronic renal failure have been shown to have definite psychiatric disturbances. Deafness lasting more than six years is associated with a higher incidence of paranoid schizophrenia.Depression is an independent risk factor for coronary heart diseases and an indicator of poor prognosis in post myocardial infraction patients.Psychooncology is one of the expanding facets of oncology research in India and abroad.Apart from postpartum psychosis, which is a psychiatric emergency, maternal anxiety and depression are definitely known to influence developmental quotient (DQ) of infants, their weight gain and over all morbidity.Therefore there is an urgent need to sensitize and teach psychiatry in detail to all undergraduate medical students so that they do not falter with or miss psychiatric symptoms in their patients and establish an appropriate liaison with the specialist at the right time.Unless this is done, important advances made in the different fields of Medicine are likely to go in vain.In this era of increasing complications of treatment regimens and public awareness, doctor-patient relationships are often at stake. Driven by fear of litigations, doctors too often practice \u201cdefensive medicine\u201d, an approach that adds unnecessarily to the public exchequer. Some basic knowledge of into the patients psychology and own reactions may help reduce unnecessary litigations.The need to train medical students and nonpsychiatrists has been emphasized by various policy making bodies, starting from the Mudaliar Committee (1962) to the National Health Policy (NHP) 1983.Thorough training of undergraduate students in Psychiatry andTraining nonpsychiatrists in the basic principles of psychiatric diagnosis and treatment.This object can be fulfilled by:The training of a specialists from other streams can pose problems of time, attitude and other constraints. However, a general practitioners (GPs) training carried out by the ICMR revealed the following difficulties.GPs tend to zealously protect their unique professional freedom and dread to function as an extension of specialistsGPs expect their patients to be referred back when they refer them for specialist consultation.Besides, training of nonpsychiatrists across the country would pose operational difficulties, like bringing all non psychiatrists in government, private, rural, urban sectors under one umbrella. A single short-term training session would hardly be comparable to a rigorous subject training in the M.B.B.S course.All these factors emphasize the need to train medical students, first and foremost, in the basic principles of Psychiatry. This should include an adequate period of compulsory clinical exposure.Present status of psychiatry training in the M.B.B.S. course.Twelve hours lecture classTwo weeks clinicsTheory paper: 1-2 short notes These evidences urge the need to include psychiatry as an examination subject in under graduate curriculum.In fact, psychiatry is being taught with due importance globally. Even in our neighbouring countries, psychiatry is an examination subject in the undergraduate curriculum.If we scrutinize the course and curriculum of Nursing training, we find that they also have given immense importance of psychiatry."}
{"text": "Prader-Willi (PWS) and Down Syndrome (DS) are two genetic disorders characterised by some common clinical and functional features. A quantitative description and comparison of their patterns would contribute to a deeper understanding of the determinants of motor disability in these two syndromes. The aim of this study was to measure gait pattern in PWS and DS in order to provide data for developing evidence-based deficit-specific or common rehabilitation strategies.19 PWS patients (17.7-40 yr) and 21 DS patients (18-39 yr) were evaluated with an optoelectronic system and force platforms for measuring kinematic and kinetic parameters during walking. The results were compared with those obtained in a group of normal-weight controls .The results show that PWS and DS are characterised by different gait strategies. Spatio-temporal parameters indicated a cautious, abnormal gait in both groups, but DS walked with a less stable strategy than PWS. As for kinematics, DS showed a significantly reduced hip and knee flexion, especially at initial contact and ankle range of motion than PWS. DS were characterised by lower ranges of motion (p < 0.05) in all joints than CG and PWS. As for ankle kinetics, both PWS and DS showed a significantly lower push-off during terminal stance than CG, with DS yielding the lowest values. Stiffness at hip and ankle level was increased in DS. PWS showed hip stiffness values close to normal. At ankle level, stiffness was significantly decreased in both groups.Our data show that DS walk with a less physiological gait pattern than PWS. Based on our results, PWS and DS patients need targeted rehabilitation and exercise prescription. Common to both groups is the aim to improve hypotonia, muscle strength and motor control during gait. In DS, improving pelvis and hip range of motion should represent a major specific goal to optimize gait pattern. Prader-Willi (PWS) and Down Syndrome (DS) are two different chromosomal disorders characterised by some common clinical features, such as obesity, muscular hypotonia, ligament laxity and mental retardation.PWS is a complex multisystemic disorder equally affecting males and females. The genetic basis is the absent expression of the paternally active genes in the PWS critical region on chromosome 15 ,3.DS is caused by trisomy of chromosome 21 (Hsa21) and is associated with a number of signs and symptoms including learning disabilities, heart defects, craniofacial dysmorphia and childhood leukaemia . PhysicaAmong the latter, gait disorders are common in both syndromes. They tend to progressively worsen as the clinical picture advances, severely limiting the patients' quality of life.In previous studies, gait analysis has mainly focused on DS with special reference to their specific associated orthopaedic conditions and biomechanical limitations.Caselli et al.  reportedTo our knowledge, only one quantitative study has investigated the biomechanical strategy during gait in PWS . These aDespite a different aetiology, the two genetic conditions do share several clinical and functional features. Whether the biomechanical determinants of such motor limitations are the same is still unknown and needs further investigations at various levels. Rehabilitation specialists are challenged by motor disability in PWS and DS patients, but they fail to provide evidence-based treatment modalities. A deeper understanding of the causes of their gait abnormalities, and ultimately of their motor disability, may well generate novel spin-offs for rehabilitation planning and treatment. 3-D gait analysis (GA) is nowadays the most accurate tool to investigate the gait pattern. From a clinical perspective, measuring the joint angular displacement, reactions, moments and powers provides insight into the 'how' (kinematics) and the 'why' (kinetics) of the movement observed. No studies up to now have addressed this issue of defining quantitative differences in gait strategy between DS and PWS. We could hypothesise that due to their common clinical and functional features rehabilitation strategies aimed at reducing motor disability in these two genetic conditions may share some common bases. In this wake of evidence, appropriate and effective rehabilitation and exercise prescription could be tailored to the unveiled specific or common deficits.The aim of our study was therefore to identify, quantify and compare the spatiotemporal, kinematic and kinetic parameters of gait in PWS and DS adult patient using 3D-Gait analysis (GA) and compare their results with those obtained in a group of normal-weight control subjects.Nineteen PWS and twenty-one DS patients matched for age, height, weight and body mass index (kg/m2: BMI), were enrolled in this study Table .The PWS patients had been periodically hospitalised at the Ospedale San Giuseppe, Istituto Auxologico Italiano, Piancavallo (VB), Italy. At admission, they underwent a clinical assessment and attended a 4-week comprehensive rehabilitation program. All patients showed the typical PWS clinical phenotype . CytogenThe DS patients were all referred to the IRCCS \"San Raffaele Pisana\", Tosinvest Sanit\u00e0, Roma, Italy. The distribution of chromosomal anomalies is pure trysomy 21 in all of the DS patients.All PWS and DS patients were able to understand and complete the test and walk independently without aids.Twenty age-matched individuals were included as controls (Control Group: CG). Exclusion criteria for the control group included prior history of cardiovascular, neurological or musculoskeletal disorders. They showed normal flexibility and muscle strength and no obvious gait abnormalities.The study was approved by the Ethics Committees of the two Institutes for PSW and DS patients. Written informed consent was obtained by the parents or, when applicable, by the patients.The complete evaluation consisted of: clinical examination, video recording and 3 D Gait Analysis (GA).The PWS patients were evaluated at the Movement Analysis Lab of the San Giuseppe Hospital, Istituto Auxologico Italiano, Piancavallo (VB), Italy, using an optoelectronic system with 6 cameras  with a sampling rate of 100 Hz, and two force platforms .DS patients were assessed at the Movement Analysis Lab of the IRCCS \"San Raffaele Pisana\", Tosinvest Sanit\u00e0, Roma, Italy, using a 12-camera optoelectronic system  with a sampling rate of 100 Hz, two force platforms  and 2 TV camera Video system  synchronized with the system and the platforms for videorecording.To evaluate the kinematics of each body segment, passive markers were positioned on the participants' body, as described by Davis After placement of the markers, subjects were asked to walk barefoot at their own natural pace (self-selected speed) along a walkway containing the force platforms at the mid-point. Kinematic and kinetic data were collected for each patient from five trials in order to guarantee reproducibility of the results.A potential bias of this study is the variability of data originating from the two different laboratory settings. Variability can indeed be present if different systems for kinematic acquisition are used and differences in marker positioning are evident. Therefore, two control subjects were tested in both laboratories in order to assess the consistency of the data measured with the two systems, the markers' placement and the data collection procedures.All graphs obtained from GA were normalized as % of gait cycle and kinetic data were normalized for individual body weight.For each participant (both patients and controls), three out of five trials, consistent in terms of gait pattern  using the STATISTICA computer package . This procedure was performed by the same operator to ensure data reproducibility. The following parameters were evaluated:Spatio-temporal parameters:- % stance (as % of the gait cycle);- mean velocity, normalised to the individual's height (1/s);- anterior step length, normalised to individual's height;- cadence: number of steps in a time unit (steps/min).Kinematics:- the mean value (Mean PT index) of pelvis on sagittal plane during the gait cycle;- the values of angle of ankle (AIC index), knee (KIC index) and hip joint (HIC index) at the Initial Contact (IC);- the values of maximal ankle dorsiflexion during stance phase (AMSt index) and the maximal flexion of the knee (KMSw index) during swing phase;- the values of minimal ankle dorsiflexion in stance phase (AmSt index), knee (KmSt index), and hip flexion (HmSt index) during the gait cycle;- the range of motion of the pelvis on the coronal (PO-ROM index) and transversal (PR-ROM index) plane; the range of motion of hip on coronal (HAA-ROM index) and sagittal (HFE-ROM) plane; the range of motion of knee (KFE-ROM index) on sagittal plane; the range of motion of ankle on sagittal plane during stance phase (ADP-ROM index).Kinetics:2). This parameter represents the push-off capacity during walking and is related to the forward propulsive power during gait.- the maximum ankle power during terminal stance  and the same index normalized to the velocity of progression  were expressed by plotting the values of the flexion-extension moment versus the flexion-extension angle over the gait cycle interval between 10% and 30%. The 10% to 30% interval (corresponding to the second rocker) of the gait cycle was selected and the linear regression was fitted. The angular coefficient of the linear regression corresponded to the joint stiffness index, as described in previous studies ,17. KneeThese parameters were chosen in line with the studies on gait strategy in PWS  and DS ,12.All the previously defined parameters were computed for each participant and then the mean values and standard deviations of all indexes were calculated for each group.Data of the two individuals acquired in the two different laboratories were compared with the Wilcoxon's test, in order to detect significant differences due to marker placement and data collection procedures in the two laboratories. Data of the PWS and DS were compared using Mann-Whitney U tests, in order to detect significant differences between PWS and DS. The patients' and the controls' data were compared with Mann-Whitney U tests. Null hypotheses were rejected when probabilities were below 0.05.We verified that marker placement and data collection procedures in the two laboratories were compared and the differences of all the computed kinematic and kinetic data of the two healthy subjects were not statistically different (p > 0.05). On this basis data from other 18 control subjects who served as the CG were acquired at the Movement Analysis Lab of the San Giuseppe Hospital, Istituto Auxologico Italiano.In Table Age was not significantly different among groups. BMI, weight and height were similar in PWS and DS but significantly different from CG. In order to take in account the variability in height and weight between pathological groups and CG, stride length was normalised to the subject's height and kinetic data were normalised to the subject's weight.In Tables PWS patients were characterised by longer stance duration than DS and normal cadence when compared to DS patients. In terms of anterior step length and velocity of progression, both PWS and DS showed reduced values as compared to CG, with PSW performing better than DS.As for the pelvic joint, PWS and DS showed a forward tilted pelvis in the sagittal plane (Mean PT index) with no significant differences between groups. Their pelvic range of motion in the transversal plane (PR-ROM index) was close to normal. In the frontal plane (PO-ROM index), PWS group was characterised by a higher pelvic range of motion during walking as compared to DS and CG.The hip joint exhibited excessive flexion during the whole gait cycle (HIC and HmSt indices) in both PWS and DS patients, but PWS walked with a more flexed hip at the initial contact (HIC index). The hip range of motion (HFE-ROM index) was close to normal in PWS and reduced in DS. So despite an increased hip flexion in PWS, its range of motion was more functional as compared to DS.As for hip ab-adduction, the PWS patients were characterised by an increased hip movement in the frontal plane as compared to DS (HAA-ROM index).The knee flex-extension plot revealed that, whilst the PWS group showed an excessively flexed knee as compared to DS at the initial contact (KIC index), both PWS and DS obtained values close to normal in midstance (KmSt index). In the swing phase, the maximum value of knee flexion (KMSw index) was reduced in both PWS and DS, with generally higher mean values in PWS leading to a wider joint range of motion (KFE-ROM index) than that observed in DS.The analysis of the ankle kinematics showed a plantar flexed position with reduced range of motion (ADP-ROM index) during the whole stance phase  in DS, while PWS were limited at the initial contact (AIC index) and during midstance (AMSt index), even if their dorsiflexion capacity, and therefore their range of motion (ADP-ROM index), in stance phase was higher than that observed in DS. During the swing phase, PWS were characterised by higher values of ankle dorsiflexion when compared to DS and CG. All these differences are significant from a statistical point of view (p < 0.05).2; DS: 2.02 \u00b1 0.86 m/s2; CG: 2.42 \u00b1 3.06 m/s2; PWS vs. DS: p = 0.2261)As for kinetic parameters (ankle power), both PWS and DS showed lower maximum ankle power during terminal stance  than CG (3.07 \u00b1 0.86 W/Kg), with DS significantly more limited than PWS. The APMax index normalised to the velocity of progression (APMax norm index) did not reveal significant differences among groups . This strategy allows PWS a fair hip range of motion during gait (HFE-ROM index), whereas DS showed a limited excursion. The reason for that may be linked to the anatomical configuration of their pelvic girdle: the so-called \"mongol pelvis\" is characterised by a deeper acetabulum and a decrease in the cephalo-caudal diameter and acetabular angle ,19.In the frontal plane, hip excursion (HAA-ROM index) was higher in PWS than DS and CG. This strategy, directly linked to the pelvis movement in the frontal plane (PO-ROM index), appears to produce together with obesity and hypotonia the typical external rotation of the hip during stance . This maAs for ankle kinematics, DS were characterised by an increased plantar flexion and reduced dorsal flexion throughout the gait cycle with a globally limited ankle range of motion. On the contrary, PWS showed an ankle strategy close to normal, apart from a slight plantar flexion at the initial contact and an increased dorsal flexion during swing. The PWS group was generally characterised by a wider, closer to normal range of motion in all of the lower limb joints in the sagittal plane.In terms of ankle kinetics, PWS and even more DS showed lower peak ankle power than CG (APMax index), meaning a lower propulsion capacity during terminal stance. This result was consistent with previous studies . Two posInterestingly, we found differences in joint stiffness in PWS and DS. At hip level, PWS showed values close to normal, while in DS increased stiffness values were measured. At ankle level, joint stiffness was significantly decreased in both groups.It is known that hypotonia and ligament laxity are common in PWS  and DS . Our resThe increased hip stiffness in DS we found is consistent with the literature and may represent, together with the anatomical configuration of the pelvic girdle , a compeA potential weakness of this study may be the variability of data, since PWS and DS patients were evaluated in two different laboratories. However, we had previously compared markers' placement, procedures and data from normal-weight subjects in the two laboratories and no inconsistencies between laboratories occurred. Another bias of the study is that participants were not compared in terms of orthopaedic characteristics. PWS patients tend to develop a range of orthopaedic problems including scoliosis, hip dysplasia, flat feet, and pain syndromes of the lower limbs which may have an impact on gait. Also, the degree of muscular hypotonia and weakness, ligament laxity and cognitive impairment had not been measured nor compared between groups, thus hindering interpretation of the findings. As overweight is a distinctive feature in both PWS and DS, their gait pattern should have been more rigorously compared with obese instead of normal-weight individuals. However, the main object of our investigation was to compare gait strategy in PWS and DS patients to identify possibly common rehabilitation strategy.From a clinical point of view, quantitative characterisation of gait patterns in PWS and DS is important to develop, differentiate and enhance the rehabilitative options. The quantification of their peculiar gait deficits strongly support the issue that PWS and DS patients need targeted rehabilitation and exercise prescription. Common to PWS and DS is the aim to improve hypotonia, muscle strength and motor control during gait. Both patient groups should be encouraged to walk for its positive impact on muscle mass and strength and energy balance. In DS, improving pelvis and hip range of motion should represent a specific major goal to optimize gait pattern and prevent the onset of compensatory strategies. Evidence-based rehabilitation programs would contribute to improve daily functioning, quality of life and weight management issues in those patients.All authors haven't any conflicts of interest and any financial interest.All authors attest and affirm that the material within has not been and will not be submitted for publication elsewhereVC made substantial contributions to analysis and interpretation of data and was involved in drafting the manuscript. MG made contribution to conception, design and interpretation of data, revising the manuscript critically and gave the final approval of the manuscript. GG made contribution to interpretation of data, revising the manuscript critically. LV made substantial contributions to data acquisition, elaboration and interpretation. GA made contribution to interpretation of data, revising the manuscript critically. CR made contribution to interpretation of data and to revision of the final version of the manuscript. PC made contribution to conception, design and interpretation of data, revising the manuscript critically and gave the final approval of the manuscript. All authors read and approved the final manuscript."}
{"text": "Helicobacter pylori, the major cause of human gastric diseases, affects histone modification. We therefore investigated the effects of H. pylori infection on histone modifications in a global and promoter-specific manner in gastric epithelial cells. Infection of gastric epithelial cells by wild-type H. pylori induced time- and dose-dependent dephosphorylation of histone H3 at serine 10 (H3 Ser10) and decreased acetylation of H3 lysine 23, but had no effects on seven other specific modifications. Different cag pathogenicity island (PAI)-containing-clinical isolates showed similar abilities to induce H3 Ser10 dephosphorylation. Mutation of cagA, vacA, nonphosphorylateable CagA mutant EPISAcagA, or disruption of the flagella showed no effects, while deletion of the entire cagPAI restored the H3 Ser10 phosphorylation to control levels. Analysis of 27 cagPAI mutants indicated that the genes that caused H3 Ser10 dephosphorylation were similar to those that were previously found to induce interleukin-8, irrespective of CagA translocation. This effect was independent of ERK or p38 pathways and type I interferon signaling. Additionally, c-Jun and hsp70 gene expression was associated with this histone modification. These results demonstrate that H. pylori alters histone modification and host response via a cagA-, vacA-independent, but cagPAI-dependent mechanisms, which contribute to its persistent infection and pathogenesis.Histone modifications are critical in regulating gene expression, cell cycle, cell proliferation, and development. Relatively few studies have investigated whether  Helicobacter pylori, a Gram-negative bacterium, is a major cause of chronic gastritis, peptic ulcers, and gastric malignancies, including gastric non-cardia adenocarcinoma and mucosal-associated lymphoid tissue (MALT) lymphoma H. pylori infection induces both acute and chronic gastritis, which is present as superficial mucosal inflammation in the gastric mucosa. In vitro experiments demonstrate that H. pylori activates multiple intracellular pathways including mitogen-activated protein kinases (MAPK), NF-\u03baB and activator protein-1 as well as the Wnt/\u03b2-catenin pathway, which affect various cellular functions. These include increased inflammatory cytokine production, increased apoptosis, and epithelial cell turnover cag pathogenicity island (PAI), and vacuolating cytotoxin (VacA) are responsible for these effects H. pylori VacA has also been shown to inhibit T-cell proliferation and the cell cycle, and therefore suppress the immune response H. pylori induces the transcription of thousands of host genes, while at the same time represses another set of genes Chronic infection of the human stomach by Listeria monocytogenes secretes listeriolysin O (LLO), which induces a dramatic dephosphorylation of histone H3 at serine 10 (H3 Ser10) and deacetylation of histone H4, and this correlates with changes in host gene expression during the early infection Clostridium perfringens toxin perfringolysin (PFO) and Streptococcus pneumoniae toxin pneumolysin (PLY) also induce the same dephosphorylation of histone H3 Ser10; this decreased phosphorylation of H3 Ser10 is associated with the previously reported decreased inflammatory cell responses during bacteria infection Shigella flexneri toxin OspF blocks phosphorylation of MAPK ERK2 in the nucleus; this subsequently prevents histone H3 Ser10 phosphorylaton, which is a prerequisite of NF-\u03baB activation and downstream gene transcription, and leads to a compromised inflammation in mouse tissue Immune subversion by histone modification is an important mechanism used by multiple bacteria and viruses during infection H. pylori infection is chronic and persistently enhanced inflammation with increased inflammatory cell infiltration in the local gastric mucosa and increased inflammatory cytokine production. A small percentage of infected individuals manifest the clinical presentation of gastritis, peptic ulcer, or gastric malignancy H. pylori infection effects histone modifications has not been as thoroughly evaluated. In the present study, we investigated if H. pylori infection modulates host gastric epithelial cell histone modification. In addition, we correlated H. pylori-induced histone modification with the changes in gastric epithelial cell functions and detected bacterial genes that are responsible for these effects, and explore their impact on pathogenesis.One prominent feature of H. pylori cagPAI-dependent dephosphorylation of histone H3 Ser10 and deacetylation of H3 lysine (K) 23. The effects of H3 Ser10 dephosphorylation are independent of major H. pylori virulence factors including CagA, VacA, and flagella. In addition, this cagPAI-dependent effect is common to multiple H. pylori strains, and the histone H3 Ser10 dephosphorylation is independent of ERK and p38 pathways, and type I interferon (IFN) signaling. Additionally, H3 Ser10 dephosphorylation is associated with changes in host gene expression. These results indicate a novel mechanism of H. pylori pathogenesis through histone modifications that has potential implications on H. pylori-induced chronic and persistent infections.We demonstrate a H. pylori in gastric epithelial cells, we first monitored the histone H3 Ser10 phosphorylation status in whole cell extracts by Western blot  did not alter the dephosphorylation of H3 Ser10 in AGS cells, compared to the wild-type 60190 strain  are the cause of H. pylori-induced H3 Ser10 dephosphorylation.The major virulence factors of rylation . In addi0 strain . These rH. pylori genes products within the cagPAI are the cause of H3 Ser10 dephosphorylation in AGS cells, G27-MA (and its derivatives) did not induce H3 Ser10 dephosphorylation in MKN45 cells (data not shown), likely due to the fact that G27-MA is a MDCK cell adherent strain H. pylori Sydney strain 1 which has a handicapped cagPAI cagPAI, induced H3 Ser10 dephosphorylation (data not shown). The results suggest both pathogen and host factors may affect histone dephosphorylation.Although we showed that H. pylori can cause H3 Ser10 dephosphorylation, we next investigated if H. pylori 26695 also induced other histone modifications. We monitored several common histone protein modifications, including the acetylation of H3K9, H3K14, H3K18, H3K23, H3K9K14, H3S10P/K9Ac, H3S10P/K14Ac, dimethylation of H3K9, hyperacetylation of H4, and acetylation of H4K8 in gastric epithelial cells. The results indicated that H. pylori 26695 cagPAI induced dephosphorylation of H3S10P/K14Ac, in a similar manner to the H3 Ser10 dephosphorylation caused by H. pylori in both AGS (cagPAI-dependent (data not shown). We also detected decreased H3K23 acetylation during H. pylori infection in a cagPAI-dependent manner in AGS cells, while other modifications tested in this study revealed no difference as compared with uninfected control cells , a histone deacetylase inhibitor which non-specifically increases the chromatin acetylation status, resulted in increased multiple histone H3 acetylations (data not shown). Interestingly, this effect is associated with some commonly reported gene transcription pattern alterations in nd c-fos . We notecagA is not responsible for the H3 Ser10 dephosphorylation in gastric epithelial cells as shown above, we investigated which gene or gene product within the cagPAI was responsible for this effect. To determine this, we used a series of H. pylori cag mutant strains cag genes that are necessary for IL-8 induction  Since H. pylori or L. monocytogenes infection cxcl2, prkdc, dusp4, cox2, c-Jun, hsp70, cyclin D1, and il-8, using chromatin immunoprecipitation (ChIP). We infected AGS cells with wild-type H. pylori G27-MA, which showed dephosphorylation of H3 Ser 10, and performed RT-PCR and ChIP assays. Interestingly, we noted that c-Jun and hsp70 gene expression was correlated with the H3 Ser10 phosphorylation in the promoter region of these genes . c-Jun and hsp70 mRNA expression levels in H. pylori-stimulated AGS cells represented up- or down- regulated genes, respectively. The results are in line with previously reported gene array H. pylori selectively regulates gene expression in host cells associated with chromatin modification, which subsequently regulates cellular functions.To determine if the changes in histone modification are associated with alterations in host gene expression, we tested a group of genes that has previously reported to be changed during se genes . On the H. pylori infection status  hours post-infection  has been shown to induce H3 Ser10 phosphorylation at the IL-6 promoter and this is also associated with increased IL-6 mRNA and protein expression H. pylori has been shown to regulate p21(WAF1) expression associated with histone H4 acetylation in gastric epithelial cells c-fos, expression L. monocytogenes has been shown to regulate il-8 gene expression through histone modification, including increased H4K8 acetylation and phosphorylation of histone H3 Ser10 in endothelial cells il-8 and c-fos genes, including the up-regulation of c-fos and down-regulation of il-8 in MKN45 cells upon H. pylori infection. These results suggest that altered chromatin structure can function to \u201cmask\u201d or \u201cunmask\u201d gene transcription start sites and therefore affects their transcription. The opposite effects between il-8 and c-fos gene transcription provide additional information on the bacterial-induced gene regulation, and may suggest different roles of histone deacetylation/acetylation and transcription factors play on each of their gene promoter in gastric epithelial cells.The effects of specific histone modifications in host cells appears to be cell type and promoter specific: in the mouse macrophage, H. pylori has been shown to affect the cell cycle H. pylori infection are not clear. Interestingly, during the submission of this work, a paper by Fehri et al. H. pylori-induced cagPAI dependent H3 Ser10 dephosphorylation. H3 Ser10 dephosphorylation and cyclin B1 correlated with transient pre-mitotic arrest. Further they showed vaccinia-related kinase 1 (VRK1) activity but not Aurora B activity are responsible for this transient cell cycle delay. In addition, they pointed out that this effect was IkB kinase alpha (IKK\u03b1) dependent H. pylori-induced cell cycle arrest is independent of cagPAI H. pylori-induce a cagPAI dependent H3 Ser 10 dephosphorylation, and the current work further suggest this modification is also associated with gene transcription control. Since H3 Ser10 phosphorylation has been linked with both cell cycle and transcription control H. pylori pathogenesis remain to be established in the future.H3 Ser 10 is cell cycle mitotic marker in proliferating cells, and H. pylori-induced H3 Ser10 phosphorylation levels. SP600125, the JNK inhibitor, which has been reported to reduce global H3 Ser10 phosphorylation H. pylori-induced a fast inhibition on H3 Ser10 phosphorylation within one hour, a time we reason most likely linked to transcriptional control through chromatin remodeling. Therefore, the current results provide a signaling link between bacterial infection and H3 Ser10 dephosphorylation.MAPK pathways including ERK and p38 have been reported to mediate the increased H3 Ser 10 phosphorylation, but not decreased H3 Ser10 phosphorylation il-8, cox2, cxcl2, prkdc, dusp4, and cyclin D1 were not associated with, or were independent of, histone modification in the current infection model. However, altered c-jun and hsp70 gene expression was associated with the H3 Ser10 dephosphorylation. Increased c-Jun protein phosphorylation and mRNA and reduced hsp70 mRNA has been observed during H. pylori infection H. pylori infection is not clear, but several studies have suggested it has cytoprotective effects, by reducing stress-induced denaturation and aggregation of intracellular proteins, and protecting the mitochondria, and interfering with the stress-induced apoptotic program H. pylori infection by inhibiting the expression of iNOS from gastric epithelial cells The global gene expression profile regulated by phosphorylated histone H3 Ser10 has yet to be identified. In this work, we noted, several commonly expressed genes, including H. pylori-induced pathophysiology in human stomach related to histone modifications. The delicate interplay between the host and pathogen may potentially lead to the different outcomes of H. pylori infection. Identification of the mechanisms by which H. pylori affects chromatin structure at gene promoters will allow us a better understanding of the gene transcription control, and subsequent alteration of cellular functions.In conclusion, these observations provide novel evidence in microbial pathogenesis as well as 2 incubator.Tissue culture reagents were purchased from GIBCO . The human gastric epithelial cell line, AGS, and the mouse fibroblast cell line, L929, were purchased from American Type Culture Collection . The human gastric epithelial cell line MKN45 was purchased from JCRB Cell Bank . Cells were grown in Ham's F-12 (AGS) or RPMI 1640 (MKN45 and L929) medium supplemented with 10% fetal bovine serum (FBS) without antibiotics at 37\u00b0C in a humidified 10% COH. pylori stimulation.MAPK inhibitors, including MEK1/2 inhibitor U0126, which inhibits extracellular signal-regulated kinases 1 and 2 (ERK1/2) activation, p38 inhibitor SB203580, and c-Jun/SAPK N-terminal kinases (JNK) inhibitor SP600125, were purchased from Calbiochem . Cells were treated with the above inhibitors 30 minutes before H. pylori infection. Controls without inhibitors were treated with medium alone and an equal concentration of DMSO.Rabbit polyclonal anti-histone antibodies including histone H3 phosphorylated at serine 10 (p-H3 Ser10); histone H3 acetylated at lysine 9 (H3K9Ac); histone H3 acetylated at lysine 18 (H3K18Ac); histone H3 acetylated at lysine 23 (H3K23Ac); histone H3 phosphorylated at serine 10 and acetylated at lysine 9 (H3S10P/K9Ac); histone H3 phosphorylated serine 10 and acetylated lysine 14 (H3S10P/K14Ac); histone H3 dimethylated at lysine 9 (dimeH3K9); total H3; and histone H4 acetylated at lysine 8 (H4K8Ac) were purchased from Cell Signaling Technology . Histone H3 acetylated at lysine 14 (H3K14Ac); histone H3 acetylated at lysine 9 and lysine 14 (H3(K9K14)Ac); and hyperacetylated H4  were purchased from Upstate Biotechnology . Specific histone deacetylase inhibitor trichostatin A (TSA) was purchased from Sigma . Stock solutions were prepared in DMSO solution at 100 mM. In some experiments, cells were treated with the above inhibitors 30 minutes before H. pylori strains were used in the current study including 26695 and its isogenic cagPAI mutant (entire cag island deletion) strain 8-1  H. pylori strain 60190 and its vacA mutant strain (60190 VacA/KO), which contains a kanamycin cassette insertion  cag+ strains   cagA, vacA, cagPAI, cagA-vacA, and the nonphosphorylateable CagA mutant EPISAcagA and EPISAvacA-cagAcagPAI genes , and strain P12, its \u0394cagA and \u0394cagPAI mutants 2 at 37\u00b0C, and then harvested with a sterile cotton swab and resuspended in phosphate buffered-saline (PBS) solution. The bacteria were pelleted at 1,400\u00d7g for 10 minutes and resuspended in 5 ml of culture medium and added to the cell culture media at different bacteria to cell ratios , as indicated. Infections lasted from 0.5 to 6 hours in 10% CO2 at 37\u00b0C. Under these conditions, H. pylori remained alive and motile . We also noted that wild-type 26695, P12, and G27-MA strains induced hummingbird phenotype.A total of 52 different 5) or MKN45 cells (1\u00d7106) per well in 6-well culture plates were infected with bacteria at designated doses for designated times, washed three times with PBS, and lysed with cell lysis buffer directly on the dish (62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 50 mM dithiothreitol, 0.1% bromophenol blue). Prior to loading, samples were boiled at 100\u00b0C for 3 minutes, cooled down on ice, and then separated on 15% SDS polyacrylamide gels. Proteins were subsequently transferred from gels onto nitrocellulose membranes (Bio-Rad). Membranes were blocked for 1 hour at room temperature in Tris-buffered saline plus 0.025% Tween-20 (TBS-T) with 5% nonfat dry milk (pH 7.4). Various histone antibodies were diluted at 1\u22361000 in TBS-T with 5% nonfat dry milk solution. Membranes were then incubated with antibodies at 4\u00b0C overnight and washed three times with TBS-T (pH 7.4). The secondary antibodies, horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibodies, were used at a 1\u22361000 dilution in TBS-T with 5% nonfat dry milk and incubated at room temperature for 3 hours (pH 7.4). Bands were detected with an enhanced chemiluminescence detection kit . In some experiments, proteins were separated on 8% polyacrylamide gel, blotted on a polyvinylidene difluoride membrane, and examined for p-H3 Ser10 with protein A coupled to alkaline phosphatase. The original membrane was stripped with stripping buffer (50 mM Tris-HCl (pH 6.7), 2% SDS, and 200 mM \u03b2-mercaptoethanol) at 60\u00b0C for 30 minutes, followed by three washes with TBS-T and blocked for 1 hour with TBS-T in 5% nonfat dry milk solution (pH 7.4) and re-probed with total histone H3 antibodies to assess protein loading.AGS cells (5\u00d710Rt\u2013Et), where Rt is the mean threshold cycle for the reference gene HPRT and Et is the mean threshold cycle for the experimental gene. Data were expressed as arbitrary units and fold changes were adjusted to the non-stimulated control cells. Primer sequences are provided in Total RNA from AGS and MKN45 cells was purified using the RNeasy Mini Kit (Qiagen), as described previously Cells were seeded and treated essentially the same way as described for Western blot. The procedures to detect IL-8 production from AGS cell was described previously 6) per well in 150 mm dish were infected with bacteria at MOI of 150:1 for 6 hours, washed three times with PBS, and cross-linked with 1% formaldehyde (Sigma) for 10 minutes. Cells were harvested in cell lysis buffer, and sonicated with 6\u00d710 second pulses to generate 0.4\u20131.2 kb size. The sonicated chromatin was then split equally into four parts, one part without any process served as input control, the other 3 parts were immunoprecipitated with: rabbit polyclonal histone H3 Ser10 antibody  H. pylori treated control. Total H3 and non-immune isogenic IgG was used as monitoring control. PCR primer for both ChIP and RT-PCR are listed in Chromatin immunoprecipitation (ChIP) assays were performed as previously described \u201ct\u201d tests, and differences were considered significant if P values were <0.05.All quantitative data were expressed as mean \u00b1 SEM. Data were compared by using paired or unpaired Student Figure S1cagPAI mutants on H3 Ser 10 dephosphorylation during H. pylori infection in AGS cells. AGS cells (5\u00d7105) were treated in the presence or absence of wild-type H. pylori 26695 and its various mutants strains at MOI of 150:1. The cell lysate was then subjected to immunoblot analysis with rabbit anti-phospho-histone H3 Ser10 antibodies, anti-total H3 antibodies were used to re-probe the membrane and monitor protein loading. A representative blot from each strain is presented.Effects of (0.18 MB TIF)Click here for additional data file.Figure S2cagPAI mutants on H3 Ser 10 dephosphorylation during H. pylori infection in AGS cells. Data are mean\u00b1SEM from 3\u20136 densitometry scans, adjusted with total histone H3, and expressed as fold changes over the appropriate control. **P<0.05, *P<0.01 when compared with controls.Comparison of the effects of (0.25 MB TIF)Click here for additional data file.Figure S3H. pylori-induced H3 Ser10 dephosphorylation is independent of IFN \u03b1/\u03b2 signaling or bacterial DNA transfer into host cells. Mouse fibroblast cell line L929 (2\u00d7105) and human gastric epithelial cell line AGS (5\u00d7105) were treated with H. pylori G27-MA (G27) or its isogenic mutant strains in antibiotic-free medium for 10 hours at an MOI of 100:1, control cells were treated with medium alone. Supernatant from L929 cells were collected and used to measure IFN \u03b1/\u03b2 production (panels A and B). RNA was extracted from AGS cells with the same treatment and cDNA was made for quantitative RT-PCR assay as described in (0.21 MB TIF)Click here for additional data file."}
{"text": "Oligosaccharides containing a terminal Gal-\u03b11,3-Gal moiety are collectively known as \u03b1-Gal epitopes. \u03b1-Gal epitopes are integral components of several medical treatments under development, including flu and HIV vaccines as well as cancer treatments. The difficulty associated with synthesizing the \u03b1-Gal epitope hinders the development and application of these treatments due to the limited availability and high cost of the \u03b1-Gal epitope. This work illustrates the development of a whole-cell biocatalyst for synthesizing the \u03b1-Gal epitope, Gal-\u03b11,3-Lac.Agrobacterium sp. ATCC 31749 was engineered to produce Gal-\u03b11,3-Lac by the introduction of a UDP-galactose 4'-epimerase:\u03b11,3-galactosyltransferase fusion enzyme. The engineered Agrobacterium synthesized 0.4 g/L of the \u03b1-Gal epitope. Additional metabolic engineering efforts addressed the factors limiting \u03b1-Gal epitope production, namely the availability of the two substrates, lactose and UDP-glucose. Through expression of a lactose permease, the intracellular lactose concentration increased by 60 to 110%, subsequently leading to an improvement in Gal-\u03b11,3-Lac production. Knockout of the curdlan synthase gene increased UDP-glucose availability by eliminating the consumption of UDP-glucose for synthesis of the curdlan polysaccharide. With these additional engineering efforts, the final engineered strain synthesized approximately 1 g/L of Gal-\u03b11,3-Lac.Agrobacterium biocatalyst developed in this work synthesizes gram-scale quantities of \u03b1-Gal epitope and does not require expensive cofactors or permeabilization, making it a useful biocatalyst for industrial production of the \u03b1-Gal epitope. Furthermore, the engineered Agrobacterium, with increased lactose uptake and improved UDP-glucose availability, is a promising host for the production of other medically-relevant oligosaccharides.The  In nature, three main \u03b1-Gal epitopes are produced: two trisaccharides  and a pentasaccharide . These epitopes are components of glycolipids and glycoproteins displayed on the cell surface of non-primate mammals and New World monkeys via expression of an \u03b11,3-galactosyltransferase . The \u03b11,3-GalT was inactivated in ancestral Old World primates approximately 20-28 million years ago, resulting in the absence of \u03b1-Gal epitopes in humans, apes, and Old World monkeys today . In addiThe increasing interest in \u03b1-Gal epitopes for various medical applications necessitates an efficient and economical means of synthesizing the oligosaccharide. Traditional chemical synthesis requires numerous reaction steps, leading to low overall yields, a high cost, and a process that is not applicable for large-scale production. Enzymatic production of \u03b1-Gal epitopes can be achieved in just one step through the use of an \u03b11,3-GalT; however, enzymatic synthesis requires provision of an expensive sugar nucleotide, UDP-galactose. To reduce cost, enzymatic synthesis schemes often employ a UDP-galactose 4'-epimerase to provide the UDP-galactose from a less expensive sugar nucleotide, UDP-glucose ,9. As UDE. coli was constructed by overexpressing five enzymes: three enzymes of the Gal operon  for UDP-galactose synthesis, a pyruvate kinase for energy production, and an \u03b11,3-GalT. In this strategy, glucose and catalytic amounts of other cofactors  were supplied to the engineered E. coli to initiate Gal-\u03b11,3-Lac synthesis [Pichia pastoris expressed a sucrose synthase which directly converts sucrose and UDP to UDP-glucose with fructose as co-product. With two additional enzymes , the modified P. pastoris required only sucrose, lactose, a catalytic amount of UDP, and a few essential nutrients to produce Gal-\u03b11,3-Lac. The three recombinant enzymes in P. pastoris constituted an artificial pathway, whose operation was independent of cellular metabolism [E. coli and P. pastoris were capable of synthesizing gram-scale amounts of Gal-\u03b11,3-Lac.Alternatively, whole cell biocatalysts can synthesize \u03b1-Gal epitopes in just one step without enzyme purification. Different hosts and engineering strategies were explored by Wang and coworkers for whole-cell Gal-\u03b11,3-Lac synthesis. An engineered ynthesis . Alternatabolism . Both thE. coli and P. pastoris biocatalysts, permeabilization was found to be necessary [E. coli biocatalyst was engineered to synthesize the acceptor sugar in vivo. Expressing a chitin oligosaccharide synthase (NodC) and several glycosyltransferases, the recombinant E. coli produced a heptasaccharide \u03b1-Gal epitope without permeabilization of the cell membrane [in vivo substrate synthesis may hinder \u03b1-Gal epitope production.One key challenge with whole-cell catalysts is uptake of the acceptor sugar, lactose, along with the primary sugar (i.e. sucrose or glucose). In both the engineered ecessary ,13. Whilmembrane . While tAgrobacterium sp. strain ATCC 31749 is a good host for oligosaccharide production through the synthesis of \u03b21,4-Gal disaccharides [in vivo substrate synthesis, an alternative strategy is employed to address insufficient uptake of the substrate sugar, lactose. A lactose permease (LacY) from E. coli is introduced in the Agrobacterium host to facilitate lactose transport across the cell membrane. In addition, sugar nucleotide availability is improved by eliminating curdlan production, a competing pathway for utilization of UDP-glucose  from E. coli and a truncated bovine \u03b11,3-galactosyltransferase   Figure . InsertiAgrobacterium, ATCC 31749/pBQET, was utilized for small-scale \u03b1-Gal epitope synthesis. The synthesis process includes two phases. In the first phase, the engineered Agrobacterium is grown and induced. After recombinant protein production, the cells are transferred to a nitrogen-limited minimal media for synthesis of Gal-\u03b11,3-Lac. Nitrogen-limited conditions are employed for \u03b1-Gal epitope synthesis as curdlan production, and hence UDP-glucose production, is activated by this environmental signal. In the \u03b1-Gal epitope synthesis reaction, the engineered strain synthesized 0.39 g/L of the desired product, Gal-\u03b11,3-Lac  [A major challenge of whole-cell synthesis is the efficient transport of reactants across the cell membrane. This task is particularly difficult for oligosaccharide synthesis reactions such as \u03b1-Gal epitope synthesis. The synthesis reaction requires uptake of two sugars: the acceptor sugar (lactose) and a carbon source for production of the sugar nucleotide and cellular energy (sucrose) Figure . Simulta 8.5 mM) . These rlacY) from an E. coli K12 strain was expressed along with the fusion enzyme in the engineered Agrobacterium  availability, the amount of the sugar nucleotide, UDP-glucose, may also restrict \u03b1-Gal epitope synthesis by the GalE:\u03b11,3-GalT fusion enzyme. Under the nitrogen-limited conditions of the synthesis reaction, production of the \u03b1-Gal epitope competes with curdlan synthesis for the available UDP-glucose Figure , indicatrdS [Curdlan, a \u03b21,3-glucan polysaccharide, is not known to perform any essential or beneficial function for ATCC 31749. Therefore, by eliminating curdlan production, the amount of UDP-glucose available for \u03b1-Gal epitope synthesis will be increased without any detrimental impact on the cell. The gene responsible for the transfer of glucose from UDP-glucose to the growing curdlan polymer chain was previously determined to be curdlan synthase, crdS . CrdS haAgrobacterium sp. strain ATCC 31749; however, successful gene knockout has been reported for a related organism, Agrobacterium tumefaciens. Gene knockout in A. tumefaciens employed the standard method of insertional mutagenesis via homologous recombination of a disruption cassette [A. tumefaciens contains several tetracycline resistance genes, gentamicin was selected for the antibiotic resistance cassette in the crdS knockout plasmid. Sequences homologous to the 5' and 3' ends of crdS (500 bp) were added to each side of the gentamicin resistance cassette to allow for homologous recombination. The resulting fragment was inserted into the pBluescript II (KS-) phagemid to give the crdS knockout plasmid, pBScrdShG . The cell growth profile for ATCC 31749\u0394crdS in LB media showed no deviation from the wild-type strain, indicating that the crdS knockout did not affect cell growth. Since curdlan is not produced during cell growth, but rather, under nitrogen-limited conditions, the cell viability of ATCC 31749\u0394crdS was studied in minimal, nitrogen-free media. The cell viability of the crdS mutant under curdlan-producing conditions showed no significant difference from the wild-type strain (data not shown). Therefore, curdlan production does not appear to contribute to cell survival under nitrogen-limited conditions and should not have a detrimental effect on \u03b1-Gal epitope synthesis.This is the first reported attempt at gene knockout in cassette . To deteG Figure . After tcrdS was transformed with pBQET and pBQETY. ATCC 31749\u0394crdS/pBQETY produced 0.96 g/L of Gal-\u03b11,3-Lac , the engineered Agrobacterium is capable of producing gram-scale quantities of the \u03b1-Gal epitope for medical research and applications.To determine the effect of the curdlan synthase knockout on \u03b1-Gal epitope synthesis, ATCC 31749\u0394Agrobacterium sp. ATCC 31749. This microorganism can produce up to 93 g/L of curdlan polysaccharide [E. coli. Insufficient uptake of substrate and acceptor sugars is yet another obstacle in whole-cell oligosaccharide synthesis. To enhance sugar uptake, other strategies have used permeabilization techniques to weaken the cell membrane or have expressed additional enzymes to synthesize the acceptor sugar in vivo [Agrobacterium host to selectively increase uptake of the acceptor, lactose. This strategy increased lactose uptake without the undesirable consequences of cell permeabilization techniques, leading to a 67% improvement in Gal-\u03b11,3-Lac synthesis. The LacY-expressing Agrobacterium may also be used to synthesize other lactose-containing oligosaccharides such as Globo-H, the major component of a vaccine for metastatic breast cancer [Agrobacterium host was exploited for \u03b1-Gal epitope synthesis, negating a need for expensive cofactors. Without the requirements of cell permeabilization or cofactors, the engineered Agrobacterium developed in this work is a suitable biocatalyst for large-scale production of the \u03b1-Gal epitope, and with only slight modification, it may be utilized for the production of other medically-relevant oligosaccharides.The whole-cell biocatalysts developed in this study provide a basis for an efficient and cost-effective means for large-scale production of the Gal-\u03b11,3-Lac epitope. Enzymatic and whole-cell methods developed for \u03b1-Gal epitope synthesis face many obstacles including (1) low synthesis levels, (2) inefficient substrate transport across the cell membrane, and (3) expensive cofactors. This work addresses all three of these issues. Host selection is a critical factor in determining product synthesis levels. To provide an adequate host for synthesis of the oligosaccharide, Gal-\u03b11,3-Lac, a polysaccharide-producing microorganism was selected, ccharide , demonst in vivo -14. In tt cancer . Lastly,lacY expression and crdS knockout are effective in addressing the two respective limitations, these efforts resulted in only moderate improvements in \u03b1-Gal epitope synthesis. The highest product concentration was about 1 g/L with shaker flask cultivation, far below the theoretical potential of 270 g/L (estimated from reported levels of curdlan synthesis in Agrobacterium sp.). One reason for the lower than expected improvement is that LacY expression negatively impacted expression of the fusion enzyme. As shown in Table lacY to pBQET leads to nearly a 5-fold reduction in GalE:\u03b11,3-GalT fusion enzyme activity. In the future, chromosomal integration of lacY may be considered to improve lactose uptake while maintaining the high fusion enzyme activity of the pBQET strain. The use of shaker flask cultivation may also contribute to the low level of Gal-\u03b11,3-Lac synthesis. Other reported methods of whole-cell \u03b1-Gal epitope synthesis utilize fermenters for either high cell density growth or both growth and the epitope synthesis reaction [Agrobacterium as high curdlan synthesis requires high levels of dissolved oxygen and pH control at pH 5.5 [crdS mutant should produce high levels of UDP-glucose for Gal-\u03b11,3-Lac synthesis. Unfortunately, initial fermentation attempts with the engineered Agrobacterium were unsuccessful due to the low recombinant protein production. Chromosomal integration of the galE:\u03b11,3galT fusion enzyme and expression using a natural host promoter may overcome the limited recombinant protein production to allow large-scale fermentation. The reasons for only modest improvement from crdS knockout are not clear to us at this point due to limited knowledge about the regulation of curdlan synthesis. Recently, we sequenced the genome of ATCC 31749 and a transcriptome analysis is being conducted. These efforts will lead to a better understanding of the regulation mechanism governing curdlan synthesis and its precursor, UDP-glucose. In turn, this knowledge will allow metabolic engineers to formulate better strategies for improving synthesis of \u03b1-Gal epitopes and other oligosaccharides using ATCC 31749 as host.While the results clearly show that the metabolic engineering strategies of reaction -14. Largt pH 5.5 ,27. Unde2HPO4\u00b73H2O, and MnCl2\u00b74H2O); Acros organics (aniline blue); V-labs, Inc. ; and Fisher .The chemicals used in this study were obtained from Sigma-Aldrich  and truncated bovine \u03b11,3-galactosyltransferase  was constructed and inserted into the Agrobacterium expression vector, pBQ, to form pBQET for \u03b1-Gal epitope synthesis. The truncated bovine \u03b11,3-galT was amplified from pET15b-\u03b1GalT [\u03b11,3-galT (5'-TCGGATCCATGGAAAGCAAGCTTAAGCTATC-3') contains a BamHI site  and a start codon (underlined). The 3' primer for \u03b11,3-galT (5'-TCGAGCTCTCAGACATTATTTCTAACCACATT-3') contains a SacI site  and a stop codon (underlined). The amplified \u03b11,3-galT was inserted into the pGEM-T easy vector to form pT-\u03b11,3-galT. The \u03b11,3-galT fragment, obtained by double digestion with BamHI and SacI, was inserted into the respective restriction sites of the pT-GalE plasmid containing galE with a linker sequence [galE:\u03b11,3-galT fusion gene for \u03b1-Gal epitope synthesis. The fusion gene fragment, obtained from BglII and SacI digestions, was fused to the BamHI and SacI sites of pBQ. The resulting plasmid, pBQET, is shown in Figure A fusion enzyme containing the 5b-\u03b1GalT . The 5' lacY) was cloned from the genomic DNA of E. coli K12 strain JM109. The 5' primer for lacY (5'-ACGAGCTCAAAGAGGAGAAAT TAACTATGTACTATTTAAAAAACACAAAC-3') contains a SacI site , a ribosome binding site (underlined), and a start codon (in bold and underlined). The 3' primer (5'-GTCTCGAGTTAAGCGACTTCATTCACCTG-3') contains an XhoI site  and stop codon (underlined). The amplified lacY fragment was inserted into the pGEM-T easy vector, yielding pT-LacY. The lacY fragment, obtained by SacI and XhoI digestions, was ligated to the SacI and SalI sites of pBQET to form pBQETY  contains a SacI site  and the start codon for crdS (underlined). The 3' primer for crdS amplification (5'-CCGGTACCTCACCCGAATGCCCGTGC-3') contains a KpnI site  and crdS stop codon (underlined). The amplified crdS gene was inserted into the pGEM-T easy vector to produce pT-crdS. Using pT-crdS as template, the pGEM-T easy vector along with 500 bp of homology at the 5' end of crdS and 500 bp of homology at the 3' end of crdS were amplified using phosphorylated primers. The 5' primer (5'-pGGCCGAATTCTCGCAATAGGTTCTTACCTC-3') contains an EcoRI site  while the 3' primer (5'-pGGCAAGCTTTTCGTGACCCTGTCTTCGGC-3') contains a HindIII site. The amplified pGEM-T easy vector with homologous regions of crdS was self-ligated to form pT-crdSh. pT-crdSh was digested using SacI and KpnI, and the resulting fragment containing crdS homology (crdSh) was inserted into the corresponding restriction sites of pBluescriptII (KS-), generating the plasmid pBScrdSh. The gentamicin resistance gene (GmR), along with its promoter and transcription terminator, was amplified from pYanni2 [GmR amplification (5'-CCGAATTCGTCTAGTGAGTAGTG GGTAC-3') contains an EcoRI site , and the 3' primer (5'-CGAAGCTT GCTTGCAAACAAAAAAACCACC-3') contains a HindIII site. The amplified fragment containing GmR was inserted into the pGEM-T easy vector, forming pT-GmR. pT-GmR was digested using EcoRI and HindIII, and the fragment containing GmR was inserted into the corresponding restriction sites in pBScrdSh to form pBScrdShG  and 8 mM of UDP-glucose  in the enzyme activity buffer described previously. The assay was conducted at 30\u00b0C for 40 min followed by 10 min at 97\u00b0C to stop the reaction. The deactivated enzyme mixture was diluted 50\u00d7, and the Gal-\u03b11,3-Lac product was analyzed using the protocol detailed below .For the enzyme activity assay, the induced cells were collected by centrifugation at 5,000 \u00d7 g and 4\u00b0C for 2 min. The cell pellet was resuspended in a buffer containing 25 mM Tris-HCl (pH 7.5), 10 mM MnClcrdS inoculums were prepared at 30\u00b0C and 250 rpm in a culture tube with 4 mL of LB media containing 10 \u03bcg/mL of gentamicin for the crdS mutant. The inoculums were diluted 1000\u00d7 and grown in 150 mL of freshly prepared LB media, supplemented with antibiotics for ATCC 31749\u0394crdS. After 12 hours of growth in LB, the cells were collected by centrifugation at 3000 \u00d7 g for 10 min at 4\u00b0C. The cell pellets were washed with 10% glycerol and then resuspended in nitrogen-free media. The nitrogen-free media consisted of 70 g/L sucrose, 1 g/L K2HPO4\u00b73H2O, 5 g/L MgSO4\u00b77H2O, 5 g/L sodium citrate, 1 g/L MnCl2\u00b74H2O, and 50 mM Tris-HCl (pH 7.5). The cells were cultivated in nitrogen-free media at 30\u00b0C and 250 rpm in a biological shaker for 72 hours. Samples were taken at intervals of 12 hours and diluted using sterile LB media. The diluted cultures were spread on LB/agar plates, and colony forming units (cfu's) were counted as a measure of cell viability.ATCC 31749 and ATCC 31749\u03942HPO4\u00b73H2O, 5 g/L MgSO4\u00b77H2O, 5 g/L sodium citrate, 1 g/L MnCl2\u00b74H2O, and 50 mM Tris-HCl (pH 7.5). The final cell concentration was 10% wet wt/v, and the reaction vessel was a 50 mL Erlenmeyer flask. The reaction vessel was placed in a biological shaker at 30\u00b0C and 250 rpm. Samples were centrifuged for 3 min at 13,200 rpm. The supernatant was heated in boiling water for 10 min and then centrifuged again at 13,200 rpm for 3 min. The supernatant was appropriately diluted and analyzed as described in Carbohydrate analysis.The induced cells were prepared as described above . The cells were then collected by centrifugation for 10 min at 3,000 \u00d7 g and 4\u00b0C. The cell pellets were washed once with sterile 10% glycerol, and then resuspended in the reaction media. The reaction media contained 50 g/L sucrose, 25 g/L lactose, 1 g/L K600 of 0.2 - 0.3 was reached, the cultures were induced with IPTG . Immediately after the addition of IPTG, the temperature was shifted to 25\u00b0C. After an induction period of 4 hours, the culture was centrifuged at 3,000 \u00d7 g and 4\u00b0C for 10 min. The cell pellet was washed with 0.4 M NaCl and collected by centrifugation. A buffer containing 100 mM Tris-HCl and 100 mM NaCl (pH 8.0) with protease inhibitor cocktail (Sigma-Aldrich) was used to resuspend the cell pellet to a final concentration of 0.2 g/mL (wet weight). The cell suspension was sonicated 8 times for 10 second intervals with 1 min rest on ice. Cellular debris was removed by centrifugation at 3,000 \u00d7 g and 4\u00b0C for 20 min. The GalE:\u03b11,3-GalT fusion enzyme was purified from the supernatant using a HIS select HF nickel affinity gel (Sigma-Aldrich). A 12% Tris-HCl gel (Bio-Rad) was used for SDS-PAGE to analyze the His-tag purified and soluble protein fractions.SDS-PAGE was used to confirm the successful expression of the GalE:\u03b11,3-GalT fusion enzyme. JM109/pBQET was inoculated in 4 mL of LB media containing 100 \u03bcg/mL of kanamycin and 100 \u03bcg/mL of ampicillin. After overnight growth at 37\u00b0C with 250 rpm, 3 mL of the inoculum was transferred to 150 mL of LB media with antibiotics and grown at 37\u00b0C with 250 rpm. When an ODDiluted samples were analyzed using a Dionex BioLC system with a CarboPac PA20 analytical column. The Dionex ED50 electrochemical detector measured carbohydrate concentrations through pulsed amperometry . Sucrose, lactose, and Gal-\u03b11,3-Lac concentrations were determined using calibration curves prepared from standards. The mobile phase consisted of degassed 200 mM sodium hydroxide (A) and 18 M\u03a9-cm water (B), pressurized with inert gas (He) at a flow rate of 0.5 mL/min. The following linear gradient was used for sucrose and lactose detection: t = 0 min, 5:95 (A:B); t = 5 min, 5:95; t = 10 min, 20:80; t = 25 min, 20:80; t = 25 min, 100:0; t = 40 min, 100:0; t = 40 min, 5:95; t = 55 min, 5:95. The linear gradient for Gal-\u03b11,3-Lac detection entails the following steps: t = 0 min, 30:70 (A:B); t = 35 min, 30:70; t = 35 min, 100:0; t = 50 min, 100:0; t = 50 min, 30:70; t = 60 min, 30:70.ATCC 31749/pBQET and ATCC 31749/pBQETY were prepared as described above . Samples (1 mL) were taken from both reaction vessels at 34 and 45 hours after the start of the synthesis reaction and centrifuged for 5 min at 5,000 \u00d7 g and 4\u00b0C. The supernatant was removed and used for analysis of extracellular lactose and Gal-\u03b11,3-Lac. The cell pellet was washed with 50 mM of Tris-HCl buffer (pH 7.5) and centrifuged a total of three times to remove any residual extracellular lactose. After washing, the cell pellet was resuspended in 600 \u03bcL of 50 mM Tris-HCl buffer (pH 7.5). The cells were disrupted using sonication . Cell debris was removed by centrifugation, and the supernatant containing the intracellular lactose was heated for 10 min in boiling water to denature any proteins. After centrifugation, the sample was diluted 50\u00d7 and analyzed as described in Carbohydrate analysis to determine the amount of lactose in mmol. The intracellular volume was determined by taking another 1 mL sample and collecting the cell pellet by centrifugation. The cell pellet was washed with DI water and centrifuged three times to remove any residual media. The wet weight of the cell pellet was measured, and then, the cell pellet was dried in an oven at 80\u00b0C until a constant dry weight was obtained. The difference in weight between the wet and dry cell pellets was used to calculate the intracellular volume. The intracellular lactose concentration was then calculated using the amount of lactose determined through carbohydrate analysis and the intracellular volume.crdS was detected using an aniline blue staining method [The elimination of curdlan production in ATCC 31749\u0394g method . Candida\u03b11,3-GalT: \u03b11,3-galactosyltransferase; ADP: adenosine diphosphate; ATP: adenosine triphosphate; Crd: curdlan; F6P: fructose-6-phosphate; Fru: fructose; G1P: glucose-1- phosphate; G6P: glucose-6-phosphate; Gal: galactose; GalE: UDP-galactose 4'-epimerase; GalK: galactokinase; GalT: galactose-1-phosphate uridylyltransferase; GalU: glucose-1-phosphate uridylyltransferase; Glc: glucose; IPTG: isopropyl \u03b2-D-1-thiogalactopyranoside; Lac: lactose; PEP: phosphoenolpyruvate; UDP: uridine diphosphate; UDPG: uridine diphosphoglucose; UTP: uridine triphosphateThe authors declare that they have no competing interests.RRC conceived of the study and participated in the analysis of data and writing of the manuscript. AMR carried out the study and data analysis and participated in the writing of the manuscript. All authors read and approved the final manuscript."}
{"text": "Neuraxial opioids provide excellent analgesia intraoperatively and postoperatively while allowing early ambulation of the patient by sparing sympathetic and motor nerves. A prospective, randomised double blind study was conducted involving 90 patients of ASA 1 physical status coming for elective cesarean section to evaluate the analgesic effect of neuraxial buprenorphine. They were allocated into three groups. Spinal local anaesthetic was used as the main stay of anaesthesia for surgery and spinal and epidural analgesia with opioids continued as the main stay for postoperative analgesia. All the groups were given 0.5% Bupivacaine intrathecally for the surgery. Besides this, group I was given 150 mcg Buprenorphine intrathecally and group II and III were given 150 mcg and 300 mcg Buprenorphine respectively, epidurally. In the present study, we observed that 150 mcg of Buprenorphine given intrathecally provided much longer duration of analgesia compared to 150 mcg of Buprenorphine given epidurally. Increasing the epidural dose of Buprenorphine from 150 mcg to 300 mcg proved to produce prolonged analgesia comparable to intrathecal Buprenorphine without compromising patient safety and neonatal outcome. The minor side effects were more with intrathecal Buprenorphine than epidural Buprenorphine. We concluded that 300 mcg of Buprenorphine epidurally is equianalgesic to 150 mcg Buprenorphine intrathecally. Opioids are widely used for providing postoperative analgesia and advantages of neuraxial narcotics over systemic narcotics are well established. Opioids,3There are numerous studies comparing opioid agents in varying concentrations given through either epidural route or intrathecal route separately. But there are few studies comparing the effects of the same opioid given intrathecally and epidurally and few studies on analgesic effects of neuraxial buprenorphine.The present study is undertaken to compare the effects of intrathecal and epidural buprenorphine and to find a safe equianalgesic dose of intrathecal and epidural Buprenorphine. Quality and duration of analgesia was assessed for 24 hours postoperatively. Occurrence of adverse effects like hemodynamic effects, respiratory depression, Post Dural Puncture Headache, Nausea and vomiting, drowsiness and pruritus when given through each of the routes were also assessed. Neonatal outcome was evaluated using Apgar score and neonA randomised controlled double blind prospective study was done to compare the effects of intrathecal and epidural Buprenorphine. The study was conducted after approval by the hospital Ethics Committee and an informed written consent was obtained from all the patients. A total number of 90 ASA I patients belonging to age group 20-40 years posted for elective lower segment cesarean section were divided into three groups of 30 each. Group allocation was achieved by a computer generated randomisation list. Patients with any variations from normal were excluded.The patients were kept fasting for 6 hours prior to surgery and premedicated with oral Ranitidine 150 mg at night and oral Metoclopramide 10 mg and Ranitidine 150 mg two hours prior to the surgery. NIBP, ECG, SPO2, RR were monitored up to 24 hrs postoperatively. An 18g IV canula was secured and all patients were preloaded with 750 ml of Ringer Lactate before the neuraxial block. Spinal local anaesthetic was used as the main stay of anaesthesia for surgery and spinal and epidural analgesia with buprenorphine continued as the main stay for postoperative analgesia.A single space Combined Spinal Epidural technique was chosen and the same volume of drug was injected intrathecally and epidurally in all study groups. To make the intrathecal volume of drug equal in all groups, group II and III were given 0.5% Bupivacaine 2.5 ml intrathecally while group I was given 0.5% Bupivacaine 2 ml and 0.5 ml of buprenorphine Grouping of cases was in the following manner:-The procedure was carried out in lateral decubitus position using combined spinal epidural needle. Epidural space was identified in L2-L3 region using loss of resistance technique. The anaesthetist conducting the study was blinded to the study drug which was prepared by another anaesthetist as per instructions. Epidural test dose of 3 ml of xylocaine with adrenaline was given and observed for any motor block or significant rise in heart rate. After injecting 7 ml of the epidural test drug, spinal needle was advanced into the subrachanoid space and 2.5 ml of intrathecal test drug was given. A left uterine displacement of 15\u00b0 was maintained during surgery. Supplemental oxygen was given through a poly mask.Three groups were compared.Sensory block was tested by pinprick till level reached T4. The total duration of analgesia was calculated from onset of sensory block to end of analgesia i.e.; pain score of 5 or more on the Verbal Numerical Rating Scale .8]8]Verbal numerical rating scaleCriteria for hypotension was taken as a systolic BP less than 100 mm Hg and bradycardia as heart rate less than 60. Hypotension was treated with IV ephedrine and rapid infusion of fluid. Criteria for respiratory depression were a fall in oxygen saturation to <90%, a respiratory rate less than 12/min. At the end of the surgery, the overall quality of anaesthesia was judged by the surgeon and patient on a Numerical Rating Scale (NRS) from 1 (unsatisfactory) to 10 (excellent). Neonatal outcome was assessed by APGAR score at I min and 5 min and by umbilical arterial blood gas analysis. APGAR score of <7 and an umbilical arterial blood pH <7.2 was considered abnormal.Postoperatively patients were monitored in post anaesthesia care unit and complications like hypotension, respiratory depression, drowsiness, post dural puncture headache, nausea, vomiting and pruritus were assessed for 24 hours. Occurrence of urinary retention could not be assessed as the patients for LSCS are routinely catheterised for 24 hours postoperatively in our institution.P < 0.05 was considered as significant.Parametric data were analysed using Z test. P>0.05). The minimum blood pressure recorded was systolic BP of 84 mm Hg and fall in BP was transient and responded to one dose of 6mg ephedrine IV. There was no significant variation in respiratory rate and saturation in all three groups and were within acceptable limits [In all the three groups, there was no significant change in heart rate and blood pressure from the base line value, neither in intraoperative nor in the postoperative period  [The 1 minute and 5 minute Apgar score and the umbilical cord pH of babies in all the three groups were acceptable and there was no significant differences between the groups (P>.05) .In all groups the surgeon enjoyed adequate muscle relaxation for performing the surgery and patient was comfortable throughout the procedure. There was no statistically significant difference between the groups in the NRS scores .In group I , 100% of patients had analgesia till 2.5 hours and 50% had analgesia till 6 hours. At 20 hours and 24 hours 16% and 1% of patients, respectively, had analgesia.In group II  100% of patients had analgesia till 2 hours and 50% till 3 hours. Thereafter the analgesia was poor.In group III  till 3.5 hours 100% of patients had analgesia and it took 16 hours for the percentage to drop to 50%. At 20 hours and 24 hours, 20% and 4% of patients, respectively, had analgesia.Any method of postoperative analgesia must meet three basic criteria; it must be simple, safe, clinically appropriate and evidence based. The majo1012Buprenorphine is a mixed agonist \u2013 antagonist type of opioid with a long duration of action. The high lipid solubility; high affinity for opioid receptors and prolonged duration of action makes Buprenorphine a suitable choice for intrathecal and peripheral nerve site administration.4Addition of Buprenorphine 150 mcg intrathecally or epidurally and 300 mcg epidurally provided good postoperative analgesia without prolonged motor block.15 In all16One of the main concerns with Buprenorphine is respiratory depression.\u201320 In ouThe incidence of Nausea and Vomiting was 20% in GP I which was slightly higher than the other groups. Pruritus is one of the commonest side effects of neuraxial opiods. It is more likely to occur in obstetric patients due to the interaction of estrogen with opioid receptors. Previous studies show the incidence of pruritus after epidural administration of 50 mcg fentanyl was 47% and with 300 mcg Buprenorphine, 10%. In our oet al.,[et al.,[Incidence of PDPH, backache and drowsiness were not reported. This was comparable to the results obtained by Fuller JG et al., and Esca,[et al., The high,[et al.,Neonatal outcome was good in all the groups as assessed by 1min and 5 min Apgar and umbilical arterial blood pH. In all pOne of the drawbacks of the study was that the latency of onset of action of Buprenorphine could not be studied because it was masked by the action of subarachnoid local anaesthetic. Also the concentration and quantity of intrathecal local anaesthetic in Group I was dilute (2.0 ml of Bupivacaine and 0.5 ml of Buprenorphine). Urinary retention could not be assessed because in our institution all patients for caesarean section are catheterised for 24 hours postoperatively.Buprenorphine 150 mcg intrathecally, 150 mcg epidurally and 300 mcg epidurally provided good quality postoperative analgesia.150 mcg Buprenorphine epidurally was not equianalgesic to 150 mcg Buprenorphine given intrathecally. The duration of analgesia was much shorter with epidural 150 mcg Buprenorphine.Increasing the epidural dose of Buprenorphine from 150 to 300 mcg, prolonged postoperative analgesia up to 24hours without compromising patient safety and neonatal outcome.The minor side effects of Buprenorphine are more when administered intrathecally, compared to Buprenorphine administered epidurally."}
{"text": "Pathological angiogenesis represents a critical issue in the progression of many diseases. Down syndrome is postulated to be a systemic anti-angiogenesis disease model, possibly due to increased expression of anti-angiogenic regulators on chromosome 21. The aim of our study was to elucidate some features of circulating endothelial progenitor cells in the context of this syndrome.in vitro cultured and analyzed by confocal and transmission electron microscopy. ELISA was performed to measure SDF-1\u03b1 plasma levels in Down syndrome and euploid individuals. Moreover, qRT-PCR was used to quantify expression levels of CXCL12 gene and of its receptor in progenitor cells. The functional impairment of Down progenitors was evaluated through their susceptibility to hydroperoxide-induced oxidative stress with BODIPY assay and the major vulnerability to the infection with human pathogens. The differential expression of crucial genes in Down progenitor cells was evaluated by microarray analysis.Circulating endothelial progenitors of Down syndrome affected individuals were isolated, We detected a marked decrease of progenitors' number in young Down individuals compared to euploid, cell size increase and some major detrimental morphological changes. Moreover, Down syndrome patients also exhibited decreased SDF-1\u03b1 plasma levels and their progenitors had a reduced expression of SDF-1\u03b1 encoding gene and of its membrane receptor. We further demonstrated that their progenitor cells are more susceptible to hydroperoxide-induced oxidative stress and infection with Bartonella henselae. Further, we observed that most of the differentially expressed genes belong to angiogenesis, immune response and inflammation pathways, and that infected progenitors with trisomy 21 have a more pronounced perturbation of immune response genes than infected euploid cells.Our data provide evidences for a reduced number and altered morphology of endothelial progenitor cells in Down syndrome, also showing the higher susceptibility to oxidative stress and to pathogen infection compared to euploid cells, thereby confirming the angiogenesis and immune response deficit observed in Down syndrome individuals. Down syndrome (DS) is a complex disorder caused by trisomy of the entire or a critical portion of chromosome 21 (HSA21); it represents the most frequent genetic cause of mental retardation, with a frequency of about 1/1000 new-borns, and is associated with a huge number of congenital heart defects ,4. DespiDS phenotype results from a dosage imbalance of HSA21 genes, although expression analyses have reported conflicting results ,10. The Growing interest is emerging on circulating endothelial progenitor cells (EPCs) and their pivotal role in the maintenance of endothelium integrity, repair after injury and postnatal neovascularization -17. ManyBartonella henselae, a gram-negative intracellular bacteria responsible of vasoproliferative disorders in immunocompromised individuals [Bacterial toxins may trigger pathogenic events through the over-production of cytokines and chemokines, leading to the alteration of endothelial function and capillary leakage . Particuividuals ,28, adheB. henselae model, we investigated the susceptibility of DS progenitors to this pathogen infection, also performing a detailed analysis of deregulated genes after Bartonella infection, with particular attention to angiogenesis and immune response pathways.The present study was designed to pursue the molecular mechanisms contributing to immune, vascular and haematopoietic defective DS phenotypes, by investigating the number and functions of DS EPCs compared to euploid cells, also focusing on bioinformatics analysis of differentially expressed genes. Moreover, by using the previously described DS and euploid donors were recruited at the Institute of General Pathology, Section of Clinical Pathology, Faculty of Medicine, University of Milan, and at the Second University of Naples, and an approval statement was obtained by the ethics' review boards of both Institutions. Informed consent was obtained from all persons involved in all clinical investigation of this study according to the principles expressed in the Declaration of Helsinki.All subjects recruited for EPC isolation were free of infection, and no individual was taking any medication known to affect immune system/response. DS and euploid individuals were 65% males and 35% females as gender and 28 \u00b1 9 as mean age. The experiments, where not specified, were performed on at least six DS and age-matched euploid individuals.Plasma samples were obtained from 50 DS individuals and 30 age matched euploids subdivided into three age subgroups  as described elsewhere .EPCs were isolated from non-institutionalized individuals with DS and age-matched euploid donors.EPCs were isolated as previously described . BrieflyB. henselae strain ATCC 49882 (LGC Promochem) was grown on Columbia agar supplemented with 5% defibrinated sheep blood (Oxoid) in a humidified atmosphere at 37\u00b0C and 5% CO2. For production of bacterial stock suspensions, bacteria were harvested after 7 days of culture until they reached the mid-exponential phase of growth (109 bacteria/ml), resuspended in Tryptone Soya Broth USP (Oxoid) containing 10% glycerol, and stored at -80\u00b0C. The number of viable bacteria in the frozen stocks was determined as previously described [The escribed .For infection, Bartonella stock solutions were thawed, washed and suspended in antibiotic-free cell culture medium, and sedimented onto cultured EPCs at different multiplicity of infection (MOI) of 50, 100, 250, 500 and 1000 . The MOIUlex europaeus and counted both by fluorescence microscopy and flow cytometry as previously described [http://rsb.info.nih.gov/ij/).EPCs were dual stained with Dil-Ac-LDL and lectin from escribed ,30. ImagCommercially available SDF-1\u03b1 ELISA kit  was used to determine plasma SDF-1\u03b1 levels. Tests were carried out at RT on freshly thawed plasma samples of 50 DS individuals and 30 age matched euploids subdivided into three age subgroups  . ConcentB. henselae, were harvested, centrifuged and washed in PBS. After centrifugation at a speed of 400 g for 7 min, cells were fixed in 4% glutaraldehyde as described [After a short incubation with Trypsin/EDTA, DS and euploid EPCs, both infected and uninfected with escribed . Postfixescribed . SemithiOxidation-sensitive fluorescent probe, C11-BODIPY581/591 , was loaded  into the cells 30 min. before oxidative treatment. The samples were aliquoted in triplicate wells of a 24-well microplate, and fluorescence was determined with confocal laser microscopy at different times  from oxidant treatment. Between times, plates were maintained at 37\u00b0C in 5% CO2. To determine red fluorescence each microplate was excited at 543 nm (emission at 590 nm); for green fluorescence, microplates were excited at 488 nm (emission at 526 nm). Blank wells were also evaluated as well as C11-BO alone.http://www.ebi.ac.uk/arrayexpress; provisional accession number E-MTAB-312). Results were validated by qRT-PCR and semi-qRT-PCR, performed as described [Total RNA 10 \u03bcg) was isolated as previously described  [Additio0 \u03bcg was escribed , using pAnalysis of over-represented genes was performed using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) ,34 and tP value < 0.05 was considered statistically significant [Additional file EPCs number, cell size differences, SDF-1\u03b1 plasma levels, fluorescence intensity of C11-BO and qRT-PCRs data were reported as mean values, and results analysed by paired Student t test. P < 0.0001 vs euploid EPCs; see Figure We established that the number of EPCs isolated from peripheral blood of young and adult (mean age 28 \u00b1 9) DS was significantly lower than age-matched euploid individuals (P = 0.02) . Thus, we first measured by ELISA its plasma levels in peripheral blood of 30 euploid and 50 DS individuals, collected in three age subgroups . Then, c) Figure .SDF-1\u03b1 encoding gene, CXCL12, and of its membrane receptor CXCR4. A significant decrease in the expression of CXCL12  and CXCR4  was observed in DS endothelial progenitors compared to euploid cells . This shift was not observed in euploid hydroperoxide-treated EPCs vs untreated, as already described [To determine oxidant activities in living cells, membrane lipid peroxidation (LP) of isolated EPCs was measured by using C11-BO, a fatty acid analogue. We cultured both DS and euploid EPCs in the presence of a fixed concentration of hydroperoxide (200 nM) , and perescribed .B. henselae, known to induce - albeit at low MOI (50) - long-term endothelial cell survival and proliferation [B. henselae [To evaluate the protective effects of feration ,38, the henselae ,38.S100B, due to HSA21 trisomy, is likely to induce ROS generation, leading to increased oxidative stress in DS [SOD1 gene has been suggested to be responsible of oxidative damage to neurons [S100B and SOD1 genes in DS and euploid isolated EPCs, showing their significant over-expression in DS derived cells , were detected in this microarray analysis. Furthermore, 52  showed an evidence of differential expression in DS EPCs compared to euploid cells. In particular, 37 genes were up- and 15 down-regulated  [Additional file IFNAR1 and IFNAR2), and oxidative stress, such as SOD1, S100B and APP - recently implicated in DS neurotoxicity from elevated expression of free radicals [Database searches based on GO classification, revealed that differentially expressed genes were mostly associated to immune response (GO:0006955) and transcription regulation GO:0045449) Figure . Particuradicals  - were h5449 FiguAlthough we observed relatively small up-regulation of chromosome 21 genes, significant changes in gene expression were not limited to HSA21 genes. Indeed, we observed a global and pronounced deregulation overall the chromosomes, possibly explained by dosage imbalance of HSA21 genes encoding transcriptional factors or gene expression modulators  approach [A less frequently explored gene characteristic for microarray analysis is the chromosomal location of the genes, especially when studying diseases caused by genome alterations. First we demonstrated, by using chi-squared association tests, that differentially expressed genes are not uniformly distributed along the chromosomes. We observed that in DS EPCs the chromosomes 21 - as expected - and 19 were enriched for differentially expressed genes compared to the other chromosomes , 2913 genes (2489 of them with single probe and 424 with multiple probes) were differentially expressed, on a total of 11327 distinct genes considered. By using DAVID and PANTHER Classification System, differentially expressed genes were categorized according to their known or hypothetical biological function, and the enrichment for specific gene pathways was evaluated. The analysis revealed that most of the deregulated genes were involved in \"angiogenesis\", \"inflammation mediated by cytokines and chemokines\", \"integrins\" and \"interleukines\" signaling pathways Figure . A partiCXCL10 and other interferon-stimulated genes - were up-regulated in DS-derived progenitors, whereas, on the opposite, pro-angiogenic genes  were dramatically down-regulated  and the down-regulation of CXCR7 receptor . The reduced number of progenitors could be associated with alterations in the cell cycle; however, we did not find any significant difference between the groups [Additional file CXCL12 and CXCR4 gene transcription in their EPCs, suggest a link with the reduced number of circulating progenitors and the angiogenesis suppression observed in DS.Growing evidences indicate that chemokines and cytokines, such as SDF-1\u03b1 and its receptor CXCR4, play a crucial role in the mobilization and homing of EPCs from bone marrow ,46, alsoCXCR7, IL8 and RCAN1 genes, crucial factors involved in endothelial cells' migration, homing and angiogenesis [CASP8, which has been demonstrated to have a novel apoptosis-unrelated role in proangiogenic cells [These results are strengthened by microarray analysis, indicating that DS progenitors have a pronounced perturbation, at least at transcriptional level, in the angiogenesis and cell cycle pathways. Indeed, by using this approach we demonstrated the transcriptional deregulation of ogenesis -49. Moreic cells , althougic cells .S100B and SOD1, is likely to represent a leading cause of ROS generation and increased oxidation in DS neurons [We recently demonstrated the relevance of oxidative stress on the number and function of progenitor cells . Besides neurons ,40. Oxid neurons .S100B and SOD1 genes. These findings strengthen the hypothesis of their involvement in the susceptibility to oxidation observed in DS endothelial progenitors.Here, we have assessed, by both experimental evidences and microarray analysis, that DS progenitors are more susceptible to hydroperoxide-induced LP and significantly over-express B. henselae, responsible of vasoproliferative diseases such as bacillary angiomatosis and peliosis in immunocompromised patients [B. henselae infection at low MOI on mature endothelial cells' survival [In our study we have infected DS progenitors with a human pathogen, patients ,28, prevpatients . Particusurvival ,38.In contrast, a reduced cell number in both DS and euploid groups was observed after Bartonella infection at higher MOIs; however, detrimental changes were visible only in DS EPCs, displaying a higher number of invasomes and infected cells compared to euploid cells.The molecular basis of such Bartonella-induced detrimental effect on endothelial progenitors of DS was investigated at a transcriptional level by microarray. Significant up-regulation of the Jak/STAT pathway was observed only within infected DS progenitors, whereas, on the opposite, infected euploid cells displayed a significant down-regulation. These findings strengthen the hypothesis that transcriptional analysis of EPCs is clearly of major interest in the context of this syndrome. Indeed, the activation of ISGs, involved in the immune response against infections and in tumor surveillance , also inPathologic immune and inflammatory responses are regulated by the cross-talk between interferons and TNF\u03b1 , as wellPhysiological angiogenesis plays a central role in the embryogenesis and placental development; on the other hand, pathological angiogenesis represents a critical issue in the progression of many diseases, such as solid tumor growth and retinopathy.Individuals with Down syndrome, due to decreased incidence of angiogenesis-dependent diseases, have been postulated to be a systemic anti-angiogenesis model. Indeed, they exhibit a significantly increased anti-angiogenic surveillance, possibly due to increased expression of anti-angiogenic regulators on chromosome 21 .However, it has been shown a complex regulation of gene expression not only related to gene copy number, with several genes escaping the rule of \"increased transcription proportional to the gene copy number\" ,59. ThisOur study shows that circulating endothelial progenitors are reduced in patients with DS, possibly correlating to the low SDF-1\u03b1 plasma levels, to a reduced expression of its membrane receptor in these cells, and to their higher oxidative stress and pathogen infection susceptibility compared to euploid cells. A significant perturbation in the angiogenesis and inflammation gene pathways was also observed by microarray analysis, highlighting that gene expression analysis is a crucial issue for the study of common diseases. Endothelial dysfunction, angiogenesis' suppression and infection recurrence are hallmarks of DS, and the impairment in the number and function of circulating progenitors may account for some of their pathological features. Further studies are needed to understand possible therapeutic implications of circulating EPCs in Down syndrome.The authors declare that they have no competing interests.CV, LS, ACa, BA, PS, ACi and CN designed research. CV, LS, ACa, RCo, VM, LM, CF, MR and MP carried out experimental research. VM and BA performed Transmission electron microscopy. CV and MR performed microarray analysis and quantitative RT-PCR. CV and CAn assisted with statistical analysis. BF, MMC, BS and RCa participated in the participant recruitment. CV, LS, ACa, RCo, CAn, VM, LM, BF, AG, CF, MR, MP, BA, MMC, BS, RCa, PS, ACi and CN analyzed data. CV, LS, ACa, CAn, BA, PS, ACi and CN wrote the paper. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1755-8794/3/40/prepubSupplementary MethodsClick here for fileTable S1: Primer pairs used for quantitative and semi-quantitative RT-PCRClick here for fileFigure S1: Impaired EPC number and function. A) Representative photomicrographs of merged double-positive Dil-Ac-LDL/Lectin cells isolated from euploid (left panel) and DS (right panel) subjects (100X magnification). B) Fluorescence micrographs of EPCs labeled for 30 min with C11-BO in euploid and DS subjects. C) EPC number expressed as percentage in the different phases of cell cycle obtained by FACS. D) Curves indicate the percentage of EPC number infected with B. henselae in euploid and DS individuals. Results are representative of five different experiments in duplicate.Click here for fileTable S2: Chromosome 21 genes differentially expressed in DS vs euploidsClick here for fileFigure S2: Distribution of differentially expressed genes along the human chromosomes (DS vs euploids). A) Bar graph showing the empirical frequency distribution of differentially expressed genes along the autosomes of DS progenitors vs euploids. Asterisks indicate the significantly deregulated chromosomes. B) Representation of the robustness of our findings shown in A. The left column shows the different user-defined fold-change. For each \u00e1 value used in the analysis are shown the relative p-values. C) Bar graph showing the percent of differentially expressed genes along the DS autosomes.Click here for fileFigure S3: Positional gene mapping of differentially expressed genes (DS vs euploids). Graphic representation of positional gene enrichment (PGE) approach used to map differentially expressed genes in DS vs euploids EPCs to the exact location on the chromosome.Click here for fileB. henseale-induced gene expression in DS EPCsFigure S4: . A) Bar graph showing the top-scored deregulated gene pathways after infection in DS progenitors. Ratio indicates the percent of differentially expressed genes within the related pathway. B) Semiquantitative RT-PCR of Jak/STAT genes deregulated after B. henseale infection.Click here for fileB. henselae infectionTable S3: Differentially expressed genes after Click here for file"}
{"text": "Caenorhabditis elegans, the fly Drosophila melanogaster, and the zebrafish Danio rerio indicate that these \u201clower\u201d metazoans possess unique attributes that should help in identifying, investigating, and even validating new pharmaceutical targets for these diseases. We summarize findings in these organisms that shed light on highly conserved pathways of energy homeostasis.A pandemic of metabolic diseases , unleashed by multiple social and economic factors beyond the control of most individuals, threatens to diminish human life span for the first time in the modern era. Given the redundancy and inherent complexity of processes regulating the uptake, transport, catabolism, and synthesis of nutrients, magic bullets to target these diseases will be hard to find. Recent studies using the worm  Major shifts in human populations to urban centers, engagement in sedentary employment and leisure activities, and over-abundance of calorie-dense, processed foods have created a milieu in which ancient metabolic pathways that evolved under pressures to extract enough energy from the environment to maintain optimal reproductive and immune function and to tolerate short bouts of fasting, while avoiding excessive weight gain that would hinder escape from would-be predators, are running amuck . The conThe energy-producing, storing, and transferring reactions of life are a common thermodynamic inheritance of all organisms. The large catalog of in-born errors in human metabolism includes a series of mutations ranging in phenotype from mildly hypomorphic  to completely null  in the key enzymes of cellular energetics that are shared by metazoans . AlthougC. elegans, Drosophila, and zebrafish are proving that genetically tractable lower organisms can alter our understanding of the relationship of metabolic processes underlying obesity and its related illnesses (atherosclerotic vascular disease and type 2 diabetes mellitus). Through study of these organisms, insights relating energy homeostasis to life span, reproduction, and immune function have been made [Since it is unlikely that the social and economic pressures that have generated a global pandemic of obesity will be reversed, creative tools are required to understand the signaling pathways that govern energy homeostasis and to develop new drug targets that exploit this new knowledge. In this review, we highlight metabolic research in three metazoan organisms, and argue that these studies are not mere exercises in comparative energetics . Rather,een made \u20137. BelowDrosophila and C. elegans. Orthologous proteins for nearly all of the intermediates in this cascade are found in vertebrates. Multiple mutations in components of the IIS pathway result in alterations in life span [The evolutionarily central insulin/insulin-like growth factor signaling pathway (IIS) has been characterized in great detail in ife span , have diife span \u20137. A conife span \u201311.C. elegans adults, triacylglycerol (TAG) is stored in gut granules  by searching for defects in the accumulation of fluorescent dyes that label acidified, mature lysosomes specifically [glo mutants have altered neutral lipid stores, altered fertility, or changes in life span as a consequence of a defect in gut granule genesis are open questions. Likewise, the involvement of these proteins in higher metazoan neutral lipid homeostasis should be investigated.Four novel genes were identified in a genetic screen for mutations causing gut granule loss  of C. elegans gut granules. [The transcription factors C/EBP and steroid regulatory element binding protein 1 (SREBP-1) are necessary and sufficient for mammalian adipogenesis in vitro. RNAi-mediated depletion of C/EBP and SREBP-1 led to lipid depletion  for the lpd phenotype [lpd-3 gene is expressed in worm intestine and mammalian adipose tissue. A short-hairpin RNA strategy to knock down LPD-3 in 3T3-L1 preadipocytes caused decreased lipid accumulation, indicating the conserved function of this protein [A secondary screen using a library of 80 RNAi vectors known to cause larval arrest  uncovered eight more proteins whose knockdown caused the henotype . LPD-3 i protein .C. elegans, but should also prioritize human and rodent investigations. For example, PGP-2 (glo-5), an ABC family transporter identified in this screen, was subsequently found to be required for gut granule acidification [glo phenotype.In a comprehensive RNAi survey, depletion of 305 proteins led to decreased intestinal lipid stores, while depletion of 112 proteins led to increased intestinal lipid stores . Most prfication \u201315. LikeTubby mouse has a mutation in a gene of unknown function. Mouse Tub is expressed in the central nervous system, and there is evidence that it is a transcription factor [tub-1 mutant showed a modest decrease in gut granule lipid accumulation. Five alleles of a 3-ketoacyl-coA thiolase gene, kat-1 were identified in a screen for mutations that could suppress the tub-1 mutant phenotype [tub-1 mutant phenotype was rescued through either restoring normal KAT-1 expression in muscle and intestine, or in intestine alone. Restoring KAT-1 expression in muscle alone did not affect the increased lipid mass in the intestine. Mutations causing alterations in ciliated neurogenesis recapitulated the genetic interaction of tub-1 and kat-1, suggesting that a neurohormonal mechanism regulates intestinal lipid stores [tub-1 regulation of fat stores is not regulated by the insulin receptor ortholog daf-2, nor does it require the downstream forkhead family transcription factor daf-16. Both daf-2 and daf-16 regulate life span in addition to lipid metabolism [tub-1 can selectively modulate lipid metabolism without impacting longevity [The spontaneously obese n factor ,19, an an factor , or a ren factor . A worm henotype . KAT-1 md stores . Finallytabolism ,24, indiongevity .TUB-1 interacts with a Rab GTPase activating protein RBG-3 in ciliated neurons where TUB-1 undergoes both dendritic and ciliary transport, suggesting that TUB-1\u2032s function in the worm is to modulate chemosensory or neurohormonal functions . Given tnhr-49, which encodes a nuclear (hormone) receptor required for induction of beta oxidation, is also upregulated. Conversely, deletion of nhr-49 results in elevated fat content and shortened life span. NHR-49 regulation of life span is dependent on SCD, but NHR-49 regulation of beta oxidation was independent of SCD [Drosophila, zebrafish, mouse, and human orthologs of NHR-49 are summarized in In response to a 1-h fast of adult worms, the abundance of 18 of 97 mRNAs encoding genes involved in glucose and lipid metabolism examined by reverse transcriptase polymerase chain reaction is modulated . Inducedt of SCD . This obt of SCD . The funDrosophila fat body is a structure that stores maternally supplied lipids, and \u201cfeeds\u201d the developing animal during its larval stages. As these lipid stores are consumed, most of the fat body cells die [The ells die , althougells die . Adult mells die . Geneticells die .Drosophila fat mass were made over four decades ago with the female sterility(2)adipose mutant , a spontaneous mutant found to have increased fat body size and female infertility [Adp mutants are also protected from starvation-induced death owing to this increased and \u201cavailable\u201d energy storage pool [adp gene encodes a WD40/tetratricopeptide-repeat-domain protein [WDTC1 is a candidate gene for obesity worth pursuing.Many of the associations among various aspects of physiology and ertility ,36. Adp age pool . The adp protein  whose fu protein . The Adp protein . In lighDrosophila fat body development and lipid accumulation [Adipocytes are mesodermal cells generated by well characterized transcriptional networks ,41. The mulation . Treatmemulation . Specifimulation . ConversDrosophila has cell types reminiscent of vertebrate metabolic organs that regulate fat body lipid stores , a neuropeptide that functions like glucagon and \u03b2-adrenergic agonists do in vertebrates in counteracting insulin action. AKH is particularly important for mobilizing energy stores for active flight muscles ,49, whenDrosophila fat body cells have shown that the proteins coating these storage structures are similar to those in mouse adipose tissue in form and function [Drosophila PAT  family lipid droplet coat protein lipid storage droplet-2 (Lsd-2) is expressed in the ovary and the fat body [lsd-2 results in defects in oogenesis [Study of lipid droplets in function . The Drofat body ,54. Mutaogenesis . These dogenesis . Dynamicogenesis  and multogenesis .AKHR), or ablation of AKH-producing CC cells leads to increased fat body TAG stores, and to an inability to release FAs from depot in response to starvation. This defect in fat body lipolysis in animals lacking AKH signaling is manifested by their earlier death when food is withdrawn [In response to AKH, fat body TAG lipase is activated, and multiple lipid droplet proteins, Lsd-2 chief among them, show increased phosphorylation. Furthermore, lipid droplet protein phosphorylation in response to AKH requires cyclic AMP and protein kinase A, reminiscent of \u03b2-adrenergic stimulation of mammalian lipolysis . Conversithdrawn .Drosophila TAG mobilization is underscored by observations involving the brummer (bmm) mutant fly and human neutral lipid storage disease: both are caused by mutations in the gene encoding adipocyte TAG lipase  [Atgl/\u2212\u2212 mice have massive intracellular liposis in many tissues, including the heart [bmm mutant flies, increased TAG stores, frank obesity, and an increased sensitivity to starvation  are seen. This final phenotype contrasts with that seen when adp mutant flies are fasted, indicating that expanded lipid mass does not necessarily mean increased availability of calories during fasting [bmm mutant phenotype can be antagonized by introducing an lsd-2 loss of function mutation; bmm/lsd2 double mutants have normalized TAG stores [AKHR/bmm double mutants have higher fat body TAG stores than either AKHR or bmm individual mutants, and are more sensitive to starvation than either mutant [The similarity between mammalian and  PNPLA2) ,59. Humahe heart . In bmm  fasting . The bmmG stores . Mobilizr mutant .Drosophila oenocyte functions in the capacity of ketogenic hepatocyte during a fasting response [lsd-2 decreases oenocyte lipid staining during starvation. Conversely, overexpression of Brummer lipase in fat body cells promotes oenocyte lipid accumulation during fasting. Taken together, these findings suggest that oenocyte lipid stores are derived from fat body cells, much like vertebrate hepatocytes' lipids are derived from TAGs that are mobilized from adipocytes during fasting. Finally, targeted ablation of oenocytes leads to runtiness and failure to mobilize fat body lipid stores during fasting, a process that requires the lipid \u03c9-hydroxylase Cyp4g1 [During fasting, mobilized adipose TAG stores are sent to the liver as free FAs for partial oxidation to ketone bodies, molecules that can be used by nearly all cell types as energy sources . The Droresponse . Wherease Cyp4g1 .Drosophila and C. elegans do not , and the hepatic and intestinal protein apolipoprotein B (Apob). The packaging of lipids into beta lipoprotein particles is the task of the evolutionary progenitor of this family of proteins, microsomal triglyceride transfer protein (Mtp), which is also present in the zebrafish yolk cell layer, intestine, and liver [Mtp/\u2212\u2212 mice, with failure to transport yolk lipids and die in utero by starvation [The machinery of lipid synthesis and transport used by humans is present and active in zebrafish . Beta lind liver . Knockdoarvation .Mtp/\u2212\u2212 mice, including death by failure to transport neutral lipids across the yolk cell layer, an intermediate phenotype of decreased, but not absent, vascular lipid staining was not seen in Mtp MO-injected zebrafish larvae. This \u201cintermediate\u201d phenotype is present in +/Mtp\u2212 mice and many humans with point mutations in the orthologous MTTP gene [While knockdown of zebrafish Mtp recapitulates many of the phenotypes of severe, lethal abetalipoproteinemia seen in TTP gene . This diC. elegans, which has comprehensive RNAi libraries for transient knockdown of most genes, a large pool of validated MOs is not available for systematic knockdown of zebrafish genes. One study illustrates this limitation. Following a proteomic survey to identify cotranslationally translocated (membrane and secretory) proteins in zebrafish embryos, a tractable set (150) of the corresponding genes was selected for targeted knockdown with antisense MOs [Unlike ense MOs . KnockdoAnalogous redundancy and compensation for loss of one of three \u03949 FA desaturases occurs in worms , where igonzo mutant also demonstrates the high degree of conservation of metabolic regulatory function across animal phyla: the affected gene encodes the site 1 protease responsible for processing the ER membrane-tethered transcription factor SREBP, the master regulator of de novo cholesterol and FA synthesis [gonzo mutants are incapable of responding to low cellular cholesterol by activating SREBP, and are thus genetically \u201cstarved\u201d of lipids. This defect is manifested by an inability to mobilize the yolk lipid stores, a phenotype that is readily apparent with conventional staining methods.The ynthesis . gonzo mfat-free mutant fails to concentrate a fluorescent FA analog in its gall bladder [fat-free mutants appeared morphologically normal , they have multiple defects in intracellular transport. Since a large-scale genetic screen in medaka has found three more mutants with defective hepatobiliary processing of the same fluorescent substrate used to identify fat-free, further insights into these processes are expected from genetic studies with fish [In addition to confirming the conservation of known genes in regulating lipid metabolism, zebrafish has been useful in identifying novel proteins involved in energy homeostasis. The  bladder ; the aff bladder . While fith fish .foie gras, whose encoded protein exhibits no obvious domains and represents a completely novel pathway to inappropriate accumulation of lipids in the liver.One obesity-related disease receiving increasing attention is non-alcoholic fatty liver disease (NAFLD). The initial step in the pathogenesis of NAFLD is the accumulation of excess neutral lipid in the liver, a condition commonly seen in overweight and insulin-resistant persons . Two mutTo address the looming public health crisis of obesity and its related illnesses, increasing attention is being turned to the three work-horse organisms of modern genetics outlined in this review. Future work with these organisms must exploit their individual strengths and avoid their limitations . In thisC. elegans, integration of acute and long-term signals among the nervous system, skeletal muscles, and intestine should emerge from studies of gut granule biogenesis, ciliated neurogenesis, and feeding behavior. These studies will parallel and inform discoveries into the mechanisms by which life span and fertility are regulated.In The accelerated pace of advances in studying the molecular genetics of energy homeostasis in fruit flies should allow investigators to ask increasingly sophisticated questions about physiology. In particular, understanding the signals emanating from the fat body to the IPCs, CC cells, and oenocytes should be informative. Further genetic dissection of the regulation of Brummer lipase, particularly through interaction with PAT proteins, should tell us more about how lipid droplets are regulated. Finally, through exploration of the form and function of the proto-pancreatic and hepatic organs, we can expect new insights into the integration of energy homeostasis and other facets of life including reproduction, life span, and immune function.Future screens of energy metabolism in zebrafish must harness the optical transparency and power of transgenesis to label individual cells with fluorescent protein to monitor real-time changes in energy state . ExaminaBroader questions of central nervous system regulation of energy homeostasis could also be addressed in zebrafish. Vertebrate hypothalamic  and pituUltimately, technical advances and more detailed characterization of the known pathways regulating lower metazoan energy metabolism should aid in identifying and characterizing novel candidate genes for human diseases such as obesity, diabetes mellitus, lipodystrophy, and non-alcoholic fatty liver disease. Conversely, the function of completely novel genes implicated in obesity  and diabhttp://www.ncbi.nlm.nih.gov/sites/gquery) accession numbers for the genes, gene products, and conditions discussed in this paper are: ACAT1/acat1, OMIM: *607809; adp, FBgn0000057; AKH, FBgn0004552; Apob, OMIM: +107730; Apoc2, AL916586/OMIM: *608083; ATGL/PNPLA2, OMIM: *609059; B0412.3, WBGene00015173; B0414.8, WBGene00015176; C/EBP, OMIM: *116897; c11orf2/formerly ANG2, *601922; CG10932, FBgn0029969; CG15087, FBgn0034380; CG4841, FBgn0032622; CG8449, FBgn0038129; CG9342, FBgn0032904; chico, FBgn0024248; C05d11.7,WBGene00015484; cyp-37B1, WBGene00009226; Cyp4g1, FBgn0010019; CYP4V2, OMIM: *608614; daf-16, WBGene00000912; daf-2, WBGene00000898; desat1, FBgn0086687; F23F1.6, WBGene00017747; fat-free, NP_001036200; foie gras, ENSDARG00000004726; foxo, FBgn0038197; FOXO/Foxo OMIM: *136533; GLO-1, NP_001024837; glo-1,WBGene00011083; GLO-4, WBGene00017195; gonzo, NP_954683; gryzun, FBgn0035416; Hh, FBgn0004644; HLH106, FBgn0015234; HNF4A/Hnf4a, OMIM: *600281; InR, FBgn0013984; INSR/Insr, OMIM: *147670; kat-1, WBGene00002183; king tubby, FBgn0015721; lightoid, FBgn0002567; LOC570606, XP_699199; lpd-2, WBGene00003059; LPD-3, WBGene00003060; Lsd-2, FBgn0030608; Mdr50, FBgn0010241; Mtp, OMIM: #200100; nhr-49, WBGene00003639; PGP-2/glo-5, WBGene00003996; Rab32, OMIM: *606281; RBG-3, WBGene00007167; sbp-1/lpd-1, WBGene00004735; scd/fat-6, WBGene00001398; SCD/Scd1\u20134, OMIM: *604031; slbo, FBgn0005638; SLC7A3/Slc7a3, OMIM: *300443; slif, FBgn0037203; SREBP1/SREBF1, OMIM: *184756; Tub, OMIM: *601197; tub-1, WBGene00006655; and zgc:92195, NP_001002338.The National Center for Biotechnology Information (NCBI) Entrez database ("}
{"text": "The US Servicemen's Testicular Tumor Environmental and Endocrine Determinants (STEED) case\u2013control study of testicular germ-cell tumours (TGCTs) enrolled participants and their mothers in 2002\u20132005. Hours of sports or vigorous childhood physical activity per week were ascertained for three time periods; 1st\u20135th grades, 6th\u20138th grades and 9th\u201312th grades. Son- and mother-reports were analysed separately and included 539 control son\u2013mother pairs and 499 case son\u2013mother pairs. Odds ratios and 95% confidence intervals were produced. The analysis of the sons' responses found no relationship between childhood physical activity and TGCT, while the mothers' analysis found an inverse association, which was solely due to nonseminoma. Future studies should seek to validate responses further using recorded information sources such as school records. Exposurmportant . Howevermportant .Increased levels of childhood physical activity have been reported to be protective against certain malignancies . The US Details of the US STEED Study have been published elsewhere  with the hope of stimulating memory.post hoc analysis, another question was used, which asked the son and mother to name the sports in which the son competed during 1st\u201312th grades. For this set of responses, the son's report was set as the \u2018gold standard\u2019 against which the mother's report was assessed. The mother's score was awarded two points for corroborating a sport named by the son, deducted half a point for failing to corroborate and deducted one point for providing a sport not specified by the son. Using the median of this score, the mothers' responses were divided into low- and high-agreement groups, both of which subsequently underwent re-analysis in an attempt to assess reporting accuracy.For a Odds ratios (ORs) and 95% confidence intervals were calculated to estimate the association of childhood physical activity with risk of TGCT using conditional logistic regression. To maximise the sample size in the analyses, unconditional logistic regression was also performed. As this involved breaking the match, risk estimates derived were first minimally adjusted, taking into account only the three matching factors. Further adjustment (in the fully adjusted model) was then made for the known TGCT risk factors: history of cryptorchidism and family history of testicular cancer. The results from all the analyses did not differ and therefore, only the fully adjusted estimates derived from the unconditional model are presented. When applicable, tests for linear trend in risk according to the medians of each quartile of a given ordered categorical variable were conducted to evaluate possible dose\u2013response relationships. In addition, stratified analyses by tumour histology were performed to assess whether risks of seminoma and nonseminoma differed.P-values for testing the equivalence of the logarithm of the ORs between the mother's and son's reports of childhood physical activity  and a family history of testicular cancer (P=0.026). Participants were mainly White and TGCT incidence peaked at ages 20\u201324 years. Stratified by histology, the incidence peak for seminoma was slightly later than nonseminoma. Cryptorchidism was positively associated only with nonseminoma (P<0.001), while family history of testicular cancer was positively associated only with seminoma (P=0.001).Characteristics of study participants are shown in n=767) and controls (n=928) were included in the analysis of sons' data, regardless of whether their mother had returned a completed questionnaire, the estimates remained statistically nonsignificant. Also, although height has previously been reported to be positively associated with TGCT risk in this study (P>0.05) and was, therefore, not included in the fully adjusted model.The risk estimates derived from logistic regression analyses of sons' reports are shown in P-values for linear trend. Childhood physical activity in the highest grades (9th\u201312th grades) was only associated with decreased risk at the highest level of exertion .The risk estimates calculated from mothers' responses  were marP-values for linear trend also lower. None of the ORs for seminoma were significant.The observed protective effect of increased childhood physical activity was solely and consistently associated with nonseminoma, all the risk estimates being lower relative to the TGCT analysis, and the \u03c732=14.02, P=0.003) and 6th\u20138th , but not for grades 9th\u201312th . When stratified by histologic group the \u03c72 estimates became statistically nonsignificant for the differences within seminoma analyses , while the nonseminoma comparisons were statistically significant for the first two time periods .The differences between sons' and mothers' responses were more pronounced at the younger ages: the ORs were statistically significant for grades 1st\u20135th  or not? The mothers' results would be easier to dismiss if the effect was not so consistent across time periods and, more importantly, within one histologic subgroup. The latter observation gives credence to the results; if the protective effect on TGCT was caused by bias or chance, one may expect the effect to be equal when stratified by histology. Given parental nurturing responsibilities, it is conceivable that differential misclassification could have been stronger in mothers compared with sons, but it is both unlikely and nonsensical that the bias would be associated with nonseminoma Two previous case\u2013control studies have found physical activity to be protective against TGCT . This stFor testicular congenital abnormalities, mother's responses were used to verify or supplement self-report data . The main limitation is the lack of validation of the responses of sons and mothers.Our analysis of mothers' data suggests that increased childhood physical activity may decrease the risk of nonseminoma, although the sons' data do not support this. Studies with validated responses against other sources of information, such as school records, are needed to confirm or refute our findings."}
{"text": "Dgcr8. These cells are heavily depleted for microRNAs, allowing us to reintroduce specific microRNA duplexes and identify refined target sets. We used deep sequencing of small RNAs, mRNA expression profiling and bioinformatics analysis of microRNA seed matches in 3\u2032 UTRs to identify target transcripts. Consequently, we have identified a network of microRNAs that converge on the regulation of several important cellular pathways. Additionally, our experiments have revealed a novel candidate for Dgcr8-independent microRNA genesis and highlighted the challenges currently facing miRNA annotation.Small RNAs such as microRNAs play important roles in embryonic stem cell maintenance and differentiation. A broad range of microRNAs is expressed in embryonic stem cells while only a fraction of their targets have been identified. We have performed large-scale identification of embryonic stem cell microRNA targets using a murine embryonic stem cell line deficient in the expression of  MicroRNAs (miRNAs) are important mediators of post-transcriptional gene regulation. They are RNA molecules \u223c22 nt in length, responsible for guiding the RNA induced silencing complex (RISC) to mRNA molecules, predominantly through complementarity between the 5\u2032 end of the miRNA (containing the seed region) and sequences within the 3\u2032 UTR of the target molecules. This can lead to degradation of the targeted mRNA and inhibition of its translation. There are examples of these mechanisms acting independently, but it has recently become clear that in the majority of cases a miRNAs will reduce both protein and mRNA levels of a target Transcribed within much larger RNA sequences (pri-miRNA), miRNAs are released by series of RNase III processing reactions. In the nucleus the precursor miRNA (pre-miRNA) hairpin is released by the RNase III enzyme DROSHA, operating in conjunction with the double stranded RNA binding protein, DiGeorge syndrome critical region gene 8 (DGCR8) in vitro or in vivo conditions that may influence target selection, such as the co-expression of targets and miRNAs.The number of annotated miRNAs has expanded enormously over the course of the last decade. Currently there are 741 mouse-miRNA hairpins annotated in miRBase (release 18) in vitro model for development and a system that possesses considerable therapeutic potential. Recently, several systems have been developed that provide an insight into the roles that miRNAs play in ES cells by knocking out components of the miRNA processing pathway Dicer1 knockout cells maintain ES cell marker expression Dgcr8 knockout cells are able to revert to an undifferentiated state once the differentiation conditions are reversed Embryonic stem (ES) cells, which are derived from the inner cell mass of the blastocyst, are capable of self-renewal and are pluripotent, capable of differentiating into all somatic lineages. As such they provide an Dgcr8 and canonically processed miRNAs. This allows us to reintroduce miRNAs into a system with limited miRNA functional redundancy so targets should no longer be saturated by endogenous miRNA expression. Through a simple system by which miRNAs are reintroduced individually to these cells and subsequent mRNA expression changes are measured by microarray, we were able to partially rescue the wild-type ES cell mRNA expression profile and identify lists of mRNA transcripts that are likely targets of a number of miRNAs within wild type ES cells. In this way we are able to propose functions for individual miRNAs, uncover a broad network of the targets of miRNAs in ES cells and identify both basal transcription factors and the mediator complex as global/shared routes by which ES cell miRNAs appear to converge to regulate a wider cohort of secondary targets within these cells.We describe a mouse ES cell line depleted in the expression of Dgcr8 were disrupted. Targeted trapping of the second allele of Dgcr8 was performed in two independent gene trap cell lines from the BayGenomics resource   . This cont cells . This reDgcr8 depletion. In contrast, independent comparisons of the two homozygous mutant cell lines to their corresponding heterozygous control line identifies 2220 and 3101 transcripts with significantly altered expression, with approximately 73% of the smaller set of transcripts also found within the larger set. Thus, homozygous depletion of Dgcr8 results in a large number of significant expression changes at the mRNA level and those changes are highly consistent between replicates.To better understand the molecular consequences of miRNA depletion, mRNA expression was assayed for each of the cell lines. A comparison between WT and the individual heterozygous cell lines identified only 10 and 62 differentially expressed transcripts (in the two replicates respectively). This demonstrates that there is no broad effect on mRNA expression of heterozygous Dgcr8-depleted cells. Sylamer analysis of the list of transcripts ordered according to mRNA expression change (log fold change) upon Dgcr8 depletion  have been removed from miRBase  cells  cells . In all S) cells . In the S) cells .In order to judge the effectiveness of these experiments in generating significant miRNA target lists, calculations were performed to estimate the signal to noise ratio of each and an estimate was made of the number of targets in the target list above that which may have been expected by chance . The siggt1/tm1Dgcr8 cells should represent the reversal of the effect of the depletion of Dgcr8, at a molecular level. To confirm this, the expression profile of the Dgcr8-depleted cell lines when compared to the heterozygous controls was interrogated with each miRNA target list in turn, using Gene Set Enrichment Analysis (GSEA) Dgcr8 depletion. Hence, the regulation of transcripts within these gene lists is likely to be highly relevant in an ES cell context.The transfection of individual miRNAs into the Dgcr8 depletion. It is possible that the networks regulated by these miRNAs differ in complexity or they regulate a different number of in vivo targets. These enrichments may be more easily identifiable for miRNAs with large numbers of targets, a more significant effect on the down-regulation of those targets or which cause a broad depletion of an entire network, therefore having a more pronounced cumulative effect. On the other hand the seed enrichment for those miRNAs with fewer targets, whose role is to maintain homeostatic regulation of those targets under specific circumstances, or whose target networks may be corrected by feedback loops following perturbation may be harder to detect in this way. In the case of miR-298, it is not highly expressed in mouse ES cells so we were not expecting to identify a large number of in vivo targets that would be up-regulated upon miRNA depletion.There are several factors that may account for the differences in both the length of the target lists generated for each miRNA and the observed enrichments. The target lists of miR-302a and miR-106a are both the longest and most enriched amongst the genes up-regulated upon broad miRNA depletion in the ES cell system ). By contrast miR-292-5p and miR-298 have weaker seed sequence enrichments amongst significantly down-regulated genes following transfection and their proposed targets are not enriched among the genes up-regulated by It might be expected that ES cell expressed miRNAs regulate similar processes and may have considerable overlap between their target sets, leading to a robust layer of post-transcriptional regulation. It is expected that miRNAs with shared seed sequences will also share a considerable number of their targets due to the extent to which the recognition of miRNA target sites depends on the degree of complementarity between the target transcript and the miRNA seed region gt1/tm1Dgcr8 cells ) with both miR-291a-3p and miR-302a (7mer(2)), which may also suggest that they maintain functionally redundant roles through interaction with the same target sites. However, the transcripts bearing only the 7mer(3) seed sequence of miR-106a do not appear to be significantly affected by the transfection of miR-106a mimics into the m1 cells , so it im1 cells . In addim1 cells . Thus incell cycle network. Indeed, the targets of both miR-106a and miR-302a are significantly enriched within this category. Although the targets of miR-291a-3p are not enriched in this pathway, this is not surprising given the relatively small size of the miR-291a-3p target list. Our results therefore support a fundamental role for miRNAs in regulating the ES cell cycle.In order to better understand the function that each of these miRNAs play in mouse ES cells, enrichment analysis of annotation to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways Ccnd1, Cdkn1a and E2f1, all of which have been shown to targeted by the miR-17 family of miRNAs which includes miR-106a Cdkn1a, a key regulator of the G1/S phase transition, also appears in our miR-302a and miR-291a-3p target lists. These miRNAs share a seed sequence and as such this is consistent with the results of Wang et al.cell cycle pathway, Cdkn1c, a confirmed miR-25 target Our miR-106a target list includes cell cycle pathway. Considering the targets for those miRNAs either highly expressed in WT ES cells or for whom there is a clear seed sequence enrichment amongst those genes up-regulated following Dgcr8 depletion  and E2f2  both appear to be potentially targeted by three miRNAs, while Skp2 (miR-21 and miR-302a) and Cyclin D1 (miR-106a and miR-302a) may be targeted by two each. Further to this, miR-302a appears to target multiple members of the anaphase promoting complex. This implies a degree of cross-regulation and redundancy not only between miRNAs with shared seed sequences (miR-291a-3p and miR-302a) but also both amongst miRNAs with no shared seed identity and through the regulation of multiple components of a functional complex.It is intriguing to note that multiple miRNAs appear to converge on a number of genes in the epletion , Cdkn1a While miR-302a and miR-106a appear to make the greatest contribution to regulation of the cell cycle, the targets of miR-21 are also significantly enriched in this pathway despite possessing a completely different seed sequence. The connection of miR-21 to cell cycle regulation is perhaps expected as this miRNA is known to have altered expression in a number of cancers. It is clear from these interactions and the additional associations demonstrated in this study, that a complex network of miRNAs regulate the progression of the ES cell cycle.basal transcription factors KEGG Pathway . To validate the clones, nested RT-PCR reactions were performed with primers in the gene trap cassette sequence and exon sequences upstream of the insertion site . PCR products were subsequently purified and sequence confirmed. Each of the cell lines was subcloned and reconfirmed by RT-PCR.Two independently derived cell lines were acquired from BayGenomics (XG058 and XH157), each with a gene trap in a single allele of NotI digested BAC clone bMQ-62C21 AscI restriction site . The cloning strategy for the Dgcr8 insertion-type targeting construct is shown in AscI fragment contains exons 4\u20138 of Dgcr8 and was cloned into pR3R4_AsiSI, replacing the chloramphenicol resistance gene and ccdB cassette. The fragment was then transferred to the pL3/L4_(+)_GT1T2hygroP2EGFP gene trap plasmid through an in vitro L/R clonase reaction (Gateway L/R clonase II (Invitrogen)). Prior to electroporation, the plasmid was linearised in the homology region at a unique HindIII site in intron 6 of Dgcr8 (ENSMUST00000115633). Hygromycin resistant clones were picked and expanded. Nested RT-PCR between Dgcr8 specific primers that bind to exons upstream of both the gene trap insertion sites and homologous region and primers that are common to both gene trap cassettes were used to detect the trapped and targeted alleles . Clones that express both the BayGenomics gene trap and the targeted gene trap alleles were considered to be homozygous mutant lines. Products representative of each of the expected amplicon sizes were confirmed by sequencing.2 in gelatinised tissue culture treated plates and flasks and electroporated as described +/+Dgcr8 (E14) gt1/+Dgcr8 and gt2/+Dgcr8 cells were maintained in media supplemented with 150 \u00b5g (active)/ml G418 (Geneticin - Gibco). Following the electroporation of the gene-targeting construct, cells were selected at 120 \u00b5g/ml Hygromycin B  and maintained at 100 \u00b5g/ml Hygromycin B. To assay for \u03b2-galactosidase activity, cells were washed with PBS, fixed in 0.2% gluteraldehyde and stained with 1 mg/ml Xgal as described Cell lines were maintained feeder-free in ES cell medium (GMEM+10% serum+LIF) at 37\u00b0C, 7% COCells were maintained for 4 days in non-selective media prior to lysis. RNA was purified by Trizol and RNeasy according to the manufacturers protocol. RNA was quantitated on an Agilent Technologies 2100 Bioanalyser using a Eukaryotic Total RNA Nano Chip. Polyadenylated RNA was purified with the PolyATract mRNA Isolation System III (Promega) and quantitated as above to ensure removal of rRNA. Sample concentrations were equalized, and separated by denaturing agarose gel electrophoresis in the presence of SybrGreen (Invitrogen) and a 0.5\u201310 kb RNA ladder (Invitrogen). Separated RNA was transferred overnight by capillary blot to Hybond XL membrane  and UV cross-linked (UVP).+/+Dgcr8 Trizol-purified-RNA derived cDNA followed by subcloning and reamplification. Probes were amplified with the KOD Hot-Start PCR kit (Novagen) using primers GCTGGGCTGTTGTCTCCATA and CATCTTGGGTTTCTTCCGAGT (3\u2032) or CGACGACCCATTCAACTTCT and TCGAGCACTGCATACTCCAC (5\u2032) and purified by Qiagen Qiaquick Gel Extraction. The probe fragments were A-tailed , AmpliTaq (Perkin Elmer), \u223c250 ng DNA), and cloned using pGEM-T-Easy (Promega) with the Roche Rapid Ligation Kit and MACH1 cells (Invitrogen). Transformant colonies were confirmed by colony PCR with flanking plasmid primers GTAAAACGACGGCCAGT and GGAAACAGCTATGACCATG. Plasmids were prepared using a Qiaprep Spin Miniprep Kit (Qiagen) and inserts were confirmed by sequencing. The probes were finally amplified by KOD Hot-Start PCR and the probe specific primers and purified by Qiaquick Gel Extraction (Qiagen).RNA probes were prepared by amplification from Amplified probes were radiolabeled using the Random Labeling kit (Invitrogen). Hybridisations were performed overnight in PerfectHybTMPlus buffer (Sigma) at 55\u00b0C. The membrane was washed to 0.1\u00d7 SSC with 0.1% SDS at 55\u00b0C and imaged by phosphoimager  for 2.5 hours.Cells were maintained for 4 days in non-selective media prior to protein purification and lysed while subconfluent. The cells were lysed in protein lysis buffer ) by repeated passage through a 21 G hypodermic needle. Samples were quantified with Bradford Reagent. 50 \u00b5g of each reduced sample was size separated on a 4\u201312% Bis-Tris Gel (Invitrogen). The proteins were transferred to a Hybond-ECL filter. Oct4 and \u03b1-tubulin were detected using primary antibodies  and peroxidase conjugated secondary antibodies (Sigma-Aldrich A4174 and A6782) were used to visualise each protein sequentially with Western Lightning reagents.gt1/tm1Dgcr8 cells were cultured for 4 days in non-selective media and plated to gelatinised 6 well plates at 96\u00d7104 cells per well. Cells in each well were transfected after 3 hours. 240 pmoles of miRNA mimic were added to 240 \u00b5l OptiMEM I (Gibco). 7.2 \u00b5l of Lipofectamine 2000 (Invitrogen) was added to further 240 \u00b5l of OptiMEM and incubated for 5 minutes at room temperature. Both solutions were mixed gently and then combined. This mixture was incubated for a further 25 minutes at room temperature. The media on the cells was replaced with 2.4 ml of fresh, non-selective media. The miRNA-lipid complexes in the OptiMEM mixture were then transferred to this media and the wells were mixed gently. 5 hours later, the media was aspirated from the cells and replaced with a further 7.2 ml of non-selective media. 10 hours after the initiation of transfection the cells were lysed for RNA with 1 ml of Trizol (Invitrogen). Duplicate miRNA transfections were performed and expression profiles were compared to those of control mimic transfections prepared in parallel.gt1/tm1Dgcr8 cells. Both of these miRNAs are highly expressed in the wild type mouse ES cells, are down-regulated in the gt1/tm1Dgcr8 and gt2/tm1Dgcr8 cell lines and their seeds are enriched in the 3\u2032 UTRs of transcripts up-regulated upon Dgcr8 depletion. The Sylamer algorithm was used to analyse gene lists ordered according to differential expression between the miRNA transfected cells and those transfected with a control duplex. This identified 10 hours as the time point at which the seed sequences for each miRNA were most significantly enriched amongst the down-regulated genes.To determine the optimal time post-transfection at which to lyse cells to identify the gene set most enriched for primary miRNA effects, transfected cells were lysed in a time-series post-transfection and their mRNA expression was profiled at each time point. Initially, miR-291a-3p and miR-25 were transfected into the miRIDIAN Negative Control #2 (Dharmacon CN-002000-01-05)miRIDIAN mmu-miR-291-3p mimic (Dharmacon C-310470-01-0005)miRIDIAN mmu-miR-25 mimic (Dharmacon C-310564-01-0005)miRIDIAN mmu-miR-302 mimic (Dharmacon C-310483-05-0005)miRIDIAN mmu-miR-292-5p mimic (Dharmacon C-310471-03-0005)miRIDIAN mmu-miR-106a mimic (Dharmacon C-310488-07-0005)miRIDIAN mmu-miR-21 mimic (Dharmacon C-310515-05-0005)miRIDIAN mmu-miR-298 mimic (Dharmacon C-310479-07-0005)Trizol purified RNA was cleaned up with an RNeasy MiniElute Cleanup Kit (Qiagen). 500 ng of RNA was amplified and labeled with the Illumina Total Prep RNA Amplification Kit (Ambion). Microarrays were processed by the Sanger Institute Microarray Facility. Briefly, 1500 ng of biotinylated cRNA was hybridised to Illumina expression BeadChips . Bead chips were processed following the manufacturer's instructions and analysed using BeadStudio software v.3.1.8 or GenomeStudio version 1.1.1 (Illumina). All array data has been submitted to ArrayExpress (E-MTAB-418 and E-MTAB-968).http://www.bioconductor.org/) with additional packages . Samples derived from each array version were combined into 2 independent sets, variance-stabilising transformation (VST) transformed and quantile normalised lumi package of Bioconductor. Probes from both the v1.1 and v2 formats were mapped to Ensembl gene annotation v56 . Additional annotation for these transcripts, including Gene ID, Entrez ID, Gene symbol and Description were also derived from Ensembl. When no Ensembl transcript could be found for a probe, a RefSeq transcript was assigned if available from Illumina chip annotation along with additional annotation (MouseWG-6_V1_1_R4 and MouseWG-6_V2_0_R2). Probes with no transcript annotation were removed form the set used for transcriptional analysis. Where multiple probes mapped to the same target transcript, the probe with the highest inter-quartile range across arrays was retained. The remaining probes were considered for differential expression between samples. Samples ascribed to different array versions and arrays relating to miRNA transfection and broad cell line profiling experiments were analysed independently at this stage.Analysis of the expression array data was conducted in R/Bioconductor  cutoff of 0.1 were used where required.Differential gene-expression analysis was carried out on these data by performing an empirical bayes t-test with Benjamini Hochberg multiple-testing correction via the Transcripts were considered as possible miRNA targets if they were significantly down-regulated at least 1.2\u00d7  in the presence of a transfected miRNA mimic relative to the expression in cells transfected with a control duplex. Since the v2 arrays appear to be more sensitive, a p-value cutoff of 0.05 was used for these miRNA transfection experiments, compared to 0.10 for the v1.1 arrays. Annotation information was assigned to the significant probes according to Ensembl v56.For the purposes of this study 7mer(1A), 7mer(2) and 7mer(3) and 8mer(1A) seed sequences were defined as follows:7mer(1A): A 6 nucleotide sequence complementary to positions 2 to 7 of the miRNA followed by an adenosine.7mer(2): A 7 nucleotide sequence complementary to positions 2 to 8 of the miRNA8mer(1A): A combination of the two seed sequences above.7mer(3): A 7 nucleotide sequence complementary to positions 3 to 9 of the miRNASylamer was used to count the number of corresponding miRNA seed sequences within the unmasked 3\u2032 UTRs of annotated target transcripts. Transcripts without one or more corresponding 7mer(2) or 7mer(1A) seed sequence were removed from the target lists.Dgcr8 depletion. In the comparisons between each miRNA transfection and the corresponding control, the targets of the miRNA should be relatively down-regulated by the miRNA transfection. Heterozygote and homozygous mutant samples derived from either the gt1/+Dgcr8 and gt2/+Dgcr8 lineages were considered as replicates for the comparison of expression between Dgcr8-depleted cells and heterozygotes and heterozygote and WT cells.Sylamer was used to verify miRNA-directed changes of gene expression. The expectation is that targets of many miRNAs will be up-regulated upon Briefly, Sylamer tests for miRNA effects by searching sorted lists of genes for enrichment or depletion of all possible words complementary to the seed regions of miRNAs. The method uses the hypergeometric statistic, comparing the counts of each word in all the 3\u2032 UTR sequences, before a cutoff in a sorted gene list, to the counts in the remaining genes after that cutoff. Gene lists were produced by sorting the transcripts with annotated 3\u2032 UTR sequence , according to the observed differential expression between different samples. Sylamer parameters used were -k 7 (words of length 7), -grow 500 , -m 4 (use Markov correction for nucleotide biases using observed frequencies of words of length 4) and -words word_file (only test words present in \u2018word_file\u2019). The words considered were all the 7 nt words complementary to positions 1\u20138 of annotated mouse miRNAs for which at least 10 reads were sequenced in any of our Illumina GA experiments, always using an adenine as the base matching the first position of the miRNA As a measure of the specificity of this target identification method a signal to background ratio was determined for each miRNA target list. The proportion of transcripts that were down-regulated significantly upon the introduction of the miRNA, which possess a miRNA seed in their 3\u2032 UTR (7mer(2) or 7mer(1A)) was divided by the proportion of transcripts whose expression was altered less than 1.1 fold in the same experiment (control set) and which possess the same seeds in their UTRs. Similarly the sensitivity of each target list was calculated as the number of significantly down-regulated transcripts that possess a seed sequence for the specific miRNA beyond the number of transcripts that would be expected given the proportion of transcripts with seeds in the control set.org.Mm.eg.db) were removed from the corresponding analyses. After filtering, the genes belonging to each miRNA target list were compared to the rest of the genes from the corresponding array using the GOstats package to test for enriched KEGG pathways. A p-value significance cutoff of 0.01 was used.Probes used in the initial expression analyses were mapped to Entrez IDs (based on Ensembl v56 annotation or Illumina annotation files (see above)) and used as a Gene Universe. For this analysis probes without Entrez Gene ID annotation were removed in addition to duplicate IDs. Furthermore, Entrez IDs without any associated KEGG annotation . The gene subsets tested for enrichment consisted of the miRNA target lists derived from the transfection of the miRNA mimics (see above). Where target lists were derived from experiments performed on an array version that differed from that used in the comparison of expression in heterozygous cell lines to the Dgcr8-depleted cells, only transcripts whose expression was interrogated by both array versions were retained for this analysis. The number of permutations used in the GSEA analysis was 40000, which allows for the estimation of a minimum p-value detection of 2.5E-5.Gene Set Enrichment Analysis (GSEA) was performed using the \u201cGSEAPreranked\u201d method The molecular interaction network was retrieved from Pathway Commons (Feb 2011) et al. Supplementary org.Mm.eg.db library in R/Bioconductor. In the case of multiple Entrez IDs the first was selected. All NAs and duplicate IDs were removed from the gene sets.For each miRNA, targets without an annotated Entrez ID were removed from the lists along with duplicate Entrez IDs. The miR-294 and let-7a target sets were derived from Melton The initial interaction network consisted of 4808 nodes with 55894 edges, corresponding to an average node degree of 23.3. In this network, there were many nodes of very high degree, namely two nodes of degree >\u200a=\u200a400, 4 nodes of degree >\u200a=\u200a300, 28 nodes of degree >\u200a=\u200a200, and 218 nodes of degree >\u200a=\u200a100. Such \u2018hub\u2019 nodes obscure cluster structure, as they tend to pull together many nodes into coarse clusters.This network was reduced using a k-nearest neighbour approach, with k chosen as 100. With this approach, an edge E with weight w between two nodes a and b is kept only if w is in the top k edge weights for 1) the edges emanating from a and 2) the edges emanating from b. The input network could not be submitted to k-NN (k-nearest neighbour) reduction straight away, as it is a simple network with all edge weights equal to 1. The chosen approach was to add to each edge weight a number proportional to the number of triangles in which the edge participates. This preprocessing step, promoting edges in accordance with the number of secondary connections, allowed the application of k-NN reduction. Following this reduction with k\u200a=\u200a100, the resulting network has 46788 edges, corresponding to an average node degree of 19.5. In the resulting network the highest node degree is now 100.The reduced network  was submitted to MCL clustering. Two clusterings were considered, at different levels of granularity, with the first a superclustering of the second. The first, coarse clustering was obtained by using inflation 1.3, the second was obtained by subclustering the k100 network restricted to the first clustering, with inflation set to 2.0. The clusters were annotated by running a GO-enrichment script written in R, using the customary hypergeometric test. All GO categories  were considered. The second clustering was deemed more informative, as large clusters split into smaller units with more specific annotation. For example, the largest supercluster with 433 nodes and annotations \u2018ribonucleoprotein complex (8.7e-71), \u2018RNA splicing\u2019 (1.1e-47) and \u2018RNA processing\u2019 (2.5e-47) split into a cluster with 92 nodes , a cluster with 85 nodes , a cluster with 85 nodes , a cluster with 82 elements , a cluster with 79 elements  and several smaller clusters. When considering the fifty largest clusters in the second clustering, the median of the best P-value associated with each of the clusters (referring to a GO-term enriched for such a cluster) is 6.811652e-10. For each cluster, the two best scoring GO-terms were used to annotate the cluster in the heatmap . For praThe heatmap shows for each list of target genes (corresponding to a list of nodes in the network) and for each cluster the support for that list in that cluster. This number (the support) is the sum of the support of each individual node (from the list) for that cluster, normalised by cluster size. The support of a node is the sum of edge weights (in the k100 network) for its edges that connect it to (other nodes in) the cluster, divided by the total sum of weights of all its outgoing edges.It is thus possible for a cluster to give support to a node that is not part of the cluster, simply by virtue of the node having neighbours in that clusters. Additionally, the heatmap shows numbers in the cells. Such a number indicates, for the cluster and target list specific to that cell, the number of genes shared between the cluster and the list.Cells were maintained for 4 days in non-selective media prior to lysis. RNA was purified with Trizol (Invitrogen). Large RNA was removed from the small RNA fraction using the RNeasy Mini Kit (Qiagen), and small RNAs were collected by isopropanol precipitation and quantitated on an Agilent Technologies 2100. Sequencing libraries were prepared by an adapted version of Illumina \u201cPreparing Samples for Analysis of Small RNA\u201d protocol version 1 (2007). Initially, the 3\u2032 adaptor was added to heat denatured small RNA fraction and ligated with RNA ligase in the presence of 20% DMSO and RNase Out (Invitrogen). The RNA between 35\u201365 bp was size separated on a Novex 15% TBE-urea gel, eluted and ethanol precipitated in the presence of GlycoBlue (Ambion). Heat denatured RNA was ligated to the 5\u2032 Adapter as before. RNA of 60\u2013100 bp in size was purified by 10% TBE-urea gel electrophoresis and recovered as above. The RNA was reverse transcribed and the cDNA was amplified by PCR using the smRNA primer 2 and RT primer (Illumina) with Phusion Taq (NEB). Heat denatured cDNA was purified by 10% SequaGel PAGE gel electrophoresis and recovered in 0.3 M NaCl followed by ethanol precipitation and quantified by Agilent Technologies 2100 Bioanalyzer. The Illumina libraries were Solexa sequenced by the Sanger Institute Core Sequencing Facility . Sequencing data has been submitted to ArrayExpress and ENA (E-MTAB-975).FASTQ files from each sequencing lane were processed by R/Bioconductor using the ShortRead and Biostrings packages. After verifying that the sequencing quality was acceptable for all libraries, the 3\u2032 adapter sequence was trimmed from all the reads with the trimLRPatterns function. The distribution of read lengths confirmed the expected enrichment of miRNAs (a peak of \u223c22 nucleotides) for the wild type and heterozygous samples, while this was essentially absent in the Dgcr8-depleted samples. Reads were then trimmed if they contained runs of ambiguous nucleotides (three Ns in a window of five bases) of if they contained any number of Ns within 2 bases from the end of the read. A low-complexity filter was implemented to remove all reads that consisted mostly of runs of identical nucleotides, di-nucleotides or tri-nucleotides. The remaining sequences of lengths between 16\u201330 were kept for further analysis, collapsing them into unique sequences and keeping track of the observed depth of sequencing.The A dataset of all mouse non-coding RNA sequences was obtained by extracting all the hairpin sequences from miRBase v14 and all RNA genes and predictions from Ensembl v56. The distinct sequence reads were mapped against this dataset using SSAHA2 The normalisation strategy consisted of using the total depth of reads mapping to ncRNAs (excluding the miRNA and mixed categories) and scaling all the libraries to have an equivalent depth to the WT sample .Figure S1Schematic illustration of the gene targeting strategy used in this study.A) Map of vectors introduced in this study. The pR3R4AsiSI plasmid is a Gateway shuttle vector for cloning genomic DNA fragments. Positive and negative selection cassettes, CmR and ccdB, respectively are flanked by AscI restriction sites and attR3 and attR4 Gateway sites. The pL3L4_(+)_GT1T2hygP2EGFP plasmid contains a gene trapping cassette and attL3 and attL4 Gateway cloning sites to allow transfer of cloned genomic DNA fragments. The gene trap cassette is composed of the En2 splice acceptor, hygromycin resistance gene (HygroR), Enhanced Green Florescent protein gene (EGFP) and the SV40 polyadenylation site (SV40 polyA). The T2 and P2 sites cause ribosome skipping and are included for optimal expression of the resistance marker and fluorescent reporter B) Cloning of the homology region into the pL3L4_(+)_GT1T2hygP2EGFP vector. See C) Schematic of the Dgcr8-targeted trapped and gene trapped alleles. The pGT1T2hygP2EGFP_Dgcr8 plasmid is an insertion-type gene-targeting vector containing exons 4 to 8 of Dgcr8. The vector is linearised within the homology region at a unique HindIII site prior to electroporation. The resulting targeted events cause a duplication of the homology region, placing the hygromycin-EGFP cassette downstream of exon 8. The BayGenomics gene trap cassette contains a \u03b2-geo reporter cassette, conferring G418 resistance and \u03b2-galactosidase activity, inserted downstream of exon 9. Insertion of the targeted cassette into the Bay Genomics gene trap allele will silence the \u03b2-geo reporter (reporter .(TIFF)Click here for additional data file.Figure S2Xgal staining of cell lines to determine \u03b2-geo  activity associated with the initial gene trap. Xgal-staining confirmed that in the selected heterozygous cell lines , the insertion of the second gene trap had disrupted the expression of the fusion transcript containing the original downstream construct and silenced the \u03b2-galactosidase activity of the fusion protein produced. This staining demonstrated that both gene traps are inserted within the same allele of the target gene. In contrast the homozygous mutant cell lines retained positive x-gal staining confirming that the gene traps must be within separate alleles of the gene. The inserted pane shows the nuclear localisation of the \u03b2-galactosidase activity of the \u03b2-geo fusion protein.(TIFF)Click here for additional data file.Figure S3RNA blot of Dgcr8 derived transcripts assessing the expression of wild type and fusion transcripts. RNA derived from the two heterozygous cell lines were separated  alongside the 2 homozygous mutants (gt1/tm1Dgcr8 and gt2/tm1Dgcr8) and the wild type cell line (Dgcr8+/+). Additionally, RNA samples from the parental gene trap cell lines were also blotted (gt1/+Dgcr8 and gt2/+Dgcr8). The blot was hybridised sequentially with radiolabelled probes that either anneal to the 5\u2032 (top) or 3\u2032 (bottom) ends of the Dgcr8 transcripts. The expected transcript sizes are shown to the right of the blot. Size estimates for the gene-trapped transcripts are based on ENSMUST00000115633 and include the gene trap cassettes up to the polyadenylation sites. The nature of the smaller wild type transcript is unclear although the second small wild type transcript has previously been observed in mouse (TIFF)Click here for additional data file.Figure S4Read counts for each class of ncRNA in each cell line.A) Raw small RNA mapped read counts. B) Equivalent read counts after scaling to the non-miRNA non-coding RNA population in the WT sample.(TIFF)Click here for additional data file.Figure S5Total read counts for each RNA species compared between cell lines pre-normalisation.(TIFF)Click here for additional data file.Figure S6Western blot comparing the expression of Oct4 in Dgcr8-depleted, heterozygous and wild type cell lines. The same blot was treated with antibodies for both Oct4 and \u03b1-tubulin (loading control).(TIFF)Click here for additional data file.Figure S7Global expression profiles to determine miRNA-dependent transcriptional effects.A: Sylamer plots comparing the expression profiles of Dgcr8gt1/tm1 cells transfected with a miRNA mimic  and a cel-miR-239b control miRNA. For a full description see B: GSEA enrichment plots Dgcr8 in homozygous mutant cell lines. For a full description see (TIFF)Click here for additional data file.Figure S8Overlap in target transcripts between each of the miRNAs. The percentage overlap represents the proportion of the transcripts within the smallest target set which overlap the larger set in each pairwise comparison between miRNA target sets. Bonferroni corrected hypergeometric P-values were calculated for each overlap. The universe consisted of those transcripts interrogated in the differential expression analyses. The number of potential targets identified for each miRNA is recorded beneath the miRNA name. In cases where targets were derived from alternative microarray versions, only transcripts interrogated by both platforms were considered in the comparison.(TIFF)Click here for additional data file.Figure S9Assessing the potential for functional redundancy between miR-106a and miR-302a through a shifted 7mer(3) seed. A cumulative graph is presented of the relative effect of each miRNA seed sequence (7mer (1A), 7mer (2) and 7mer (3)) on transcripts which contain at least one seed from the relevant category and for which the seed is not part of a longer seed matching site (achieved through the exclusion of transcripts containing adjacent 7mers)  when compared to a 1/10 sampling of all transcripts represented on the array (Black), following the transfection of miR-302a or miR-106a miRNA mimics. P-values displayed were calculated using a Wilcoxon or T-test to determine if the relative distribution of the seed bearing transcripts, according to log fold change (logFC), differ significantly from the bulk of the other transcripts following miRNA transfection. The x-axis represents the relative logFC following miRNA transfection when compared to the cel-miR-239b. The y-axis is the cumulative percentage of each target set or transcripts represented on the array.(TIFF)Click here for additional data file.Figure S10Investigation of the seed sequences found in miR-106a and miR-302a targets.A) A Venn diagram of transcripts within the target lists of both miR-106a and miR-302a. Shown are the numbers of transcripts found exclusively within the miR-302a target list and the miR-106a target list in addition to those shared by both. B) The class of seed sequence found in the 3\u2032 UTRs of target transcripts. The nature of the miR-106a and miR-302a seed sequences found within the 3\u2032 UTRs of the transcripts found exclusively in the miR-106a target list, the miR-302a target list or those transcripts within both target lists. The extended 8mer refers to the target sequence AGCACTTT, which is complementary to the accepted seed sequences of both miR-302a and miR-106a. The miR-302a and miR-106a target sites exclusively refer to those target sites that do not overlap these extended sites and are therefore not expected to be targeted by both miRNAs.(TIFF)Click here for additional data file.Figure S11miRNAs found to target transcripts of proteins found within cluster 12 of the interaction network. Hexagons represent proteins and grey lines represent known interactions. Stars mark those genes in the sub-network targeted by miRNAs either in this study or in the work of Melton et al.(TIFF)Click here for additional data file.Figure S12Relative disruption of miRNA targets within mediator associated cluster. Log fold change of transcripts associated with the miRNA targets from within cluster 12  upon the addition of each miRNA relative to the control miRNA (Left) and the log fold change upon the depletion of all miRNAs (Right). Stars represent those transcripts selected as potential targets of the transfected miRNA.(TIFF)Click here for additional data file.Table S1Transcripts identified as probable miRNA targets. Transcripts identified as the probable targets of each miRNA over-expressed within this study. Each table includes the number of relevant seed sequences within the transcript's 3\u2032 UTR, the log fold change and associated p-value of each transcript following transfection of the miRNA when compared to a cel-miR-239b control miRNA Click here for additional data file.Table S2Estimates of the signal to noise ratio of each of the target lists produced as part of this study.(XLSX)Click here for additional data file.Table S3KEGG Pathway analysis results. Significant KEGG pathway terms over-represented amongst the targets of the miRNAs with a significance cutoff of 0.01 in each case.(XLSX)Click here for additional data file.Table S4Sequences mapping to RNA class sets. A summary of the number of sequences mapping to each RNA class set. Columns in bold italics represent those RNA classes used to normalise the samples.(XLSX)Click here for additional data file."}
{"text": "We also observed that the expression of VEGF increased significantly during the development of hepatic fibrosis and CCl4 was found to induce hepatocytes to secrete VEGF, which led to the activation and proliferation of HSCs. Bevacizumab was also found to block the effects of the hepatocytes on the activation and proliferation of HSCs. Our results suggest that bevacizumab might alleviate liver fibrosis by blocking the effect of VEGF on HSCs. Bevacizumab might be suitable as a potential agent for hepatic fibrosis therapy.Angiogenesis is a fundamental part of the response to tissue injury, which is involved in the development of hepatic fibrosis. Vascular endothelial growth factor plays an important role in angiogenesis. The expression of VEGF is increased during hepatic fibrogenesis and correlates with the micro-vessel density. In this study, we investigated the effects of bevacizumab, an anti-angiogenetic drug, on the formation of hepatic fibrosis. We found that bevacizumab could attenuate the development of hepatic fibrosis and contribute to the protection of liver function. Bevacizumab was also found to downregulate the expression \u03b1-SMA and TGF-\u03b21, which have been reported to be profibrogenic genes  Hepatic fibrosis is characterized by excess production and deposition of extracellular matrix (ECM), which leads to loss of liver function and structure disruption of liver tissue4) intoxicationHepatic stellate cells (HSCs) play an important role in the development of hepatic fibrosis. HSCs are considered as a key target in anti-fibrotic therapy because of their role in ECM accumulationBevacizumab, a full-length humanized monoclonal antibody, is a therapeutic candidate suitable for use as a direct inhibitor of angiogenesis. Its antiangiogenic efficacy is attributable to its ability to bind and neutralize all isoforms of VEGF-A in vivo. We then, examined the role of bevacizumab in the proliferation and activation of HSCs in vitro. Our results demonstrated that bevacizumab administration could alleviate liver fibrosis by inhibiting activation and proliferation of HSCs.In this study, we investigated the effects of bevacizumab on liver fibrosis. Carbon tetrachloride was used to establish a hepatic fibrosis animal model suitable for observation of the effect of bevacizumab 4-induced hepatic fibrosis. As shown in 4 in rats. Semiquantitative analysis of the ECM area revealed that bevacizumab significantly reduced the area of ECM (Sirius red staining) after injection in the CCl4-treated fibrotic livers (We assessed the effects of bevacizumab in a rat model of CClic livers. In CCl4 P<0.05) .As shown in 4. Bevacizumab injection was found to remarkably down-regulate the expression of the genes related to liver fibrosis relative to the control groups  were used to detect the expression of \u03b1-smooth muscle actin (\u03b1-SMA) and transforming growth factor-\u03b21 (TGF-\u03b21) in the liver tissues. These have been reported to be important for the development of hepatic fibrosis. The results demonstrated that expression of \u03b1-SMA and TGF-\u03b21 was very low in normal liver tissue. However, a significant increase in gene expression was observed with the development of hepatic fibrosis induced by CCll groups .We also examined the expression of VEGF in liver tissue and serum. As shown in 4. As shown in The expression of VEGF was higher in fibrotic hepatic tissue than in healthy tissue. Real-time PCR and ELISA were used to examine VEGF expression in hepatocytes after exposure to CCl4. We then detected the gene expression of fibrotic markers in HSCs treated with the conditioned medium. As shown in We have demonstrated that the expression of VEGF increased significantly during the formation of hepatic fibrosis and that bevacizumab could effectively attenuate hepatic fibrosis. HSCs have been shown to play a central role in the development of hepatic fibrosis. HSCs are considered a key target in anti-fibrotic therapy because of their role in ECM accumulation. The conditioned medium was collected from hepatocytes which were treated with CCl4. We found that the up-regulation of \u03b1-SMA and TGF-\u03b21 in conditioned medium-treated HSCs was cancelled by bevacizumab . A rat normal liver cell line-BRL and an activated HSCs cell line-HSC-T6 were obtained from the cell bank of the Chinese Academy of Sciences .Male Sprague-Dawley rats (190\u00b115 g) were housed under standard animal laboratory conditions in the specific-pathogen-free-grade animal room at the Experimental Animal Center of the Second Military Medical University. The rats had free access to standard rat chow and water. This study was approved by the Local Ethical Committee of the Second Military Medical University.4 at a dose of 2.4 ml/kg twice per week for 8 weeks2 exposure and liver tissues were harvested.The hepatic fibrosis model of SD rats was induced by subcutaneous injection of 40% CClAll paraffin-embedded liver tissues were HE stained for histopathological examination. Sirius red staining and Masson's trichrome staining were used to assess collagen levels. The red-stained areas in the Sirius Red stained sections were assessed with an image analyzer  for semiquantitative analysis. The percentage of the Sirius Red was used to demonstrate the differences in each groups. Immunohistochemical examinations were used to detect the expression of \u03b1-SMA , and TGF-\u03b21 .Total hepatic hydoxyproline levels were determined in the hydrolysates of liver samples as described previously Serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and total bilirubin(TB)were assessed by the kits from Sigma-Aldrich.2 in a humidified incubator.Primary HSCs were freshly isolated as described previously 4(5 mmol/L) for 12 hours. Then the culture medium was replaced with fresh DMEM. After another 24 hours of culture, the conditioned medium was obtained by collection and 0.22 \u00b5m filtration of the supernatant medium from BRL cells.BRL cells were stimulated with CClELISA assays were performed using a commercial VEGF ELISA kit . Samples were diluted 10-fold in deionized water before the assay. Assays were performed in duplicate, and readings were compared using standard curves obtained with standard protein provided with the kit. Samples were collected in triplicate, and means and standard deviations were compared using the t-test.3 cells/well) were seeded in 96-well plates for overnight, we changed the medium with conditioned medium and continued to culture these cells for 24 hours. When the treatment was completed, 10 \u00b5l solution of Cell Counting Kit-8 was added in each well. The plate was continuously incubated for 2 hours. Finally, the absorbance of sample taken from each well was measured by microplate reader  at 450 nm.The measurement of viable cell mass was assessed by Cell Counting Kit-8 . Cells (5\u00d7103 cells/well for overnight. Then we changed the culture medium with conditioned medium and continued to culture these cells for 24 hours. Twenty microlitres of MTT (5 mg/ml) were added to each well and the plate was continuously incubated for 4 hours. The formazan crystals were dissolved in 200 \u00b5l of DMSO. Finally, the absorbance of sample taken from each well was measured by microplate reader  at 490 nm.In order to measure the effects of conditioned medium on the viability of HSC-T6 cells, the cells were seeded in 96-well plates at a density of 5\u00d710Total RNA was extracted from the cells using Trizol reagent . The cDNA was synthesized using MMLV reverse transcriptase  and 2 \u00b5g total RNA and oligo dT18-primers. Real-time PCR was performed in triplicate using a SYBR PrimeScript RT-PCR Kit . Total RNA was normalized by endogenous \u03b2-actin mRNA. The level of mRNA expression is presented as fold change relative to an untreated control. The primer sequences used in realtime-PCR are shown in P<0.05 was considered to be statistically significant.Data sets were analyzed by analysis of variance (ANOVA) with a posteriori contrast by least significant difference for comparisons among multiple groups and by Student t-test for comparison between two groups using the Microsoft Excel Analysis Tool Pak . The data, collected from at least three separate experiments, was showed as mean \u00b1SEM."}
{"text": "The mechanism may be associated with the reduced expression of cancer stem cell markers HIF-2\u03b1, Oct-4 and ABCG2. 5-Fu and celecoxib have a synergistic antitumor effect. The mechanism associated with the amelioration of resistance to chemotherapy in gastric cancer and the enhancement of the effect of chemotherapy may be via the reduction of the expression of HIF-2\u03b1, ABCG2, Oct-4 and other cancer stem cell markers in the tumor tissues.5-Fluorouracil (5-Fu) is one of the most commonly used drugs to treat gastric cancer; however, drug-resistance in cancer cells reduces the efficacy of 5-Fu. Celecoxib may be able to reduce resistance to 5-Fu chemotherapy. The aim of the present study was to investigate the inhibitory effects of a combination of 5-Fu and celecoxib on implanted gastric cancer xenografts in nude mice and to elucidate the underlying mechanism. A tumor-bearing nude mice model was established. The mice were divided into blank control, 5-Fu, celecoxib and combination groups. The weight change and the tumor inhibition rate in each group were calculated. Immunocytochemistry, reverse transcription-polymerase chain reaction and western blotting methods were used to observe hypoxia-inducible factor-2\u03b1 (HIF-2\u03b1), ATP-binding cassette transporter G2 (ABCG2) and octamer-binding transcription factor 4 (Oct-4) expression in the SGC7901 cells. Inhibition of the growth of the implanted gastric cancer was observed in the 5-Fu, celecoxib and combination groups. In the celecoxib and combination treatment groups, the mean tumor mass was significantly less than that in the control group (P<0.05), and the mean tumor mass in the combination treatment group was significantly less than that in the 5-Fu group (P<0.05). The tumor inhibition rates in the 5-Fu, celecoxib and combination groups were 26.36, 59.70 and 88.37%, respectively. The combination group exhibited the highest inhibition rate; the inhibition rates of the combination and celecoxib groups were significantly higher compared with the 5-Fu group (P<0.05). The expression levels of HIF-2, ABCG2 and Oct-4 mRNA and protein were high in the blank control group, and were further increased in the 5-Fu group. However, in the celecoxib and combination groups, the expression levels were lower compared with those in the control group. Significant differences were identified among the 5-Fu, celecoxib and combination groups (P<0.01). Celecoxib has antitumor effects  On the basis of these previous experiments, the current study used human gastric cancer cells transplanted in nude mice to investigate the inhibitory effects of celecoxib on SGC7901 cell growth in vivo. Whether the combination of 5-Fu and celecoxib is able to reduce the expression of stem cell markers HIF-2\u03b1, ABCG2 and Oct-4 in human gastric carcinoma tumors transplanted into nude mice and improve the resistance to 5-Fu chemotherapy was also examined.Chemotherapy is one of the primary treatments for gastric cancer . AlthougThe human gastric cancer cell line SGC7901 was given as a gift from Professor Yuguang Feng of the Affiliated Hospital of Weifang Medical College . 5-Fu was acquired from Jiangsu Zhenguo Pharmaceutical Co., Ltd. . Celecoxib was purchased from Pfizer . Rabbit anti-HIF-2\u03b1, Oct-4 and ABCG2 polyclonal antibodies were from Abcam . Immunohistochemistry kits (SP-9000) were purchased from Zhongshan Golden Bridge Biotechnology Co., Ltd. . TRIzol reagent was from Invitrogen Life Technologies, and the reverse transcription (RT) and polymerase chain reaction (PCR) kits were purchased from Fermentas (Thermo Fisher Scientific). The protein extraction kit was from Biyuntian Co. . The western blot enhanced chemiluminescence kit was from Thermo Fisher Scientific. The 28 male nude mice  were purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd. . The mice weighed 18\u201322 g and were raised in a specific pathogen-free environment.7/ml. Under sterile conditions, 0.2 ml cell suspension was inoculated subcutaneously into the nude mice, which were continuously fed for two weeks to establish the nude mouse model. The inoculated mice were randomly divided into four groups, with seven mice in each group; the body weight difference between groups was not significant. In the blank control group, an intraperitoneal injection of saline (10 ml/kg) was performed every other day. In experimental group 1 (the 5-Fu group), an intraperitoneal injection of 5-Fu (60 mg/kg) was administered every other day. In experimental group 2 (the celecoxib group), an intraperitoneal injection of celecoxib (30 mg/kg) was given every other day. In experimental group 3 (the combination group), celecoxib (30 mg/kg) and 5-Fu (60 mg/kg) were administered by injection every other day. All treatments were continued for 2 weeks. The diet, activity, urine and tumor growth of the nude mice were observed every day. At the end of the experiment, the mice were weighed and the tumor size was measured. Mice were sacrificed by cervical dislocation, the tumor was stripped with scissors and the tumor weight was documented. The procedures carried out in the present study were approved by the Medical Ethics Committee of the Affiliated Hospital of Weifang Medical University .A total of 28 male mice (BALB/c nu/nu) aged 5\u20136 weeks and weighing 18\u201322 g were used in the experiment. SGC7901 human gastric cancer cells in the logarithmic growth phase were used to create a cell suspension with a concentration of 1\u00d7102)/2, where L is the long diameter and S is the short diameter of the tumor.On the day after the final administration, the animals were sacrificed by cervical dislocation, the tumor tissue was excised and the tumor mass was weighed using electronic scales. The inhibition rate in each group was calculated according to the following formula: Inhibition rate (%) = /average tumor weight in control group \u00d7 100. The short and long diameters of the tumor were measured and the tumor volume was calculated using the following formula: Tumor volume (V) = (L \u00d7 SMice xenograft specimens from each group were cut (5 \u03bcm) and fixed with 10% formalin. The sections were paraffin-embedded, stained with hematoxylin and eosin and observed under a light microscope. The immunohistochemical staining of tumor tissue from each group was conducted using an SP-9000 kit according to the instructions of the manufacturer. HIF-2\u03b1, ABCG2 and Oct-4 antibody staining was carried out (dilution 1:50) following which the tissues were placed in a 4\u00b0C refrigerator overnight. 3,3\u2032-Diaminobenzidine color rendering, dehydration, transparency were performed and the tissues were mounted with neutral gum. Phosphate-buffered saline replaced the primary antibody to act as the negative control. Staining for HIF-2\u03b1, Oct-4 and ABCG2 was considered to be positive when brown particles were observed within the cytoplasm.The TRIzol method was used for extraction of total RNA from the tumor tissue. The RNA was dissolved in 30 \u03bcl diethylpyrocarbonate-treated water. First-strand cDNA was reversely synthesized, using an RT reaction system (20 \u03bcl) as follows: 9 \u03bcl deionized water with no RNA enzyme, 2 \u03bcl template RNA, 181 \u03bcl Oligo (dT), 4 \u03bcl 5\u00d7 reaction buffer, 1 \u03bcl RNase inhibitor (20 U/\u03bcl), 2 \u03bcl dNTP mix (10 mmol/l) and 1 \u03bcl M-MuLV RT. The reaction conditions were as follows: 70\u00b0C for 5 min and then placed on ice; 37\u00b0C for 5 min; 37\u00b0C for 60 min; 70\u00b0C for 10 min and then placed on ice for subsequent testing or preservation at \u2212150\u00b0C.2 (25 mmol/l), 5 \u03bcl 10\u00d7 PCR buffer and 34 \u03bcl ddH2O were maintained at 94\u00b0C for 5 min; 94\u00b0C for 30 sec; 50\u00b0C for 30 sec and 72\u00b0C for 60 sec for 40 cycles. Extension was carried out at 72\u00b0C for 10 min and 4\u00b0C for +\u221e. Then, 1.5% agarose gel electrophoresis was used for identification of the product. A digital gel imaging system was used to capture images and the optical density of the amplification products was analyzed. Through analysis of the HIF-2\u03b1, ABCG2 and Oct-4 mRNA and GAPDH optical density values, the expression levels of HIF-2\u03b1, ABCG2 and Oct-4 mRNA were evaluated.The primers used were HIF-2\u03b1, forward: 5\u2032-CTTGGA GGGTTTCATTGCTGTGGT-3\u2032 and reverse: 5\u2032-GTGAAG TCAAAGATGCTGTGTCCT-3\u2032, with a product length of 123 bp; ABCG2, forward: 5\u2032-CCCTTATGATGG TGGCTTATTC-3\u2032 and reverse: 5\u2032-GTGAGATTGACC AACAGA CCAT-3\u2032, with a product length of 132 bp; Oct-4, forward: 5\u2032-CCCGAAAGAGAAAGCGAACC-3\u2032 and reverse: 5\u2032-CAGAACCACACTCGGACCAC-3\u2032, with a product length of 151 bp; and GAPDH, forward: 5\u2032-GCACCACCA ACTGCTTAGCAC-3\u2032 and reverse: 5\u2032-GCAGCGCCA GTAGAGGCAGG-3\u2032, with a product length of 143 bp. In the 50-\u03bcl PCR reaction system, 1 \u03bcl template cDNA, 1 \u03bcl each of upstream and downstream primers, 1 \u03bcl Taq DNA polymerase, 5 \u03bcl dNTPs (2 mmol/l), 2 \u03bcl MgClThe total protein of the tumor tissue was extracted. The bicinchoninic acid assay method was used to determine the protein concentration. SDS-PAGE gel electrophoresis was then conducted. The proteins were placed on a cellulose membrane and sealed with 5% skimmed milk powder at 37\u00b0C for 2 h. HIF-2\u03b1, ABCG2 and Oct-4 and \u03b2-actin antibodies were added , and the membrane was incubated overnight at 4\u00b0C. After washing the membrane with Tris-buffered saline and Tween 20, the secondary antibody horseradish peroxidase-labeled anti-IgG (Invitrogen Life Technologies) was added and the membrane was incubated for a further 2 h at 37\u00b0C. After washing the membrane, the electroluminescence (ECL) reagent was added. X-ray film exposure, developing and fixing were performed. LabWorks analysis software, version 4.5  was used to measure the absorbance value of the western blotted strip; the ratio of the absorbance value of the protein of interest to that of \u03b2-actin was considered to indicate the relative content of HIF-2, ABCG2 and Oct-4.Data were analyzed using the SPSS statistical package, version 17.0 . Quantitative data are expressed as the mean \u00b1 standard deviation. Quantitative data were compared between groups using a Student\u2019s t-test and analysis of variance (ANOVA). P<0.05 was considered to indicate a statistically significant difference.The formation of nodules was observed in the 28 nude mice 14 days after gastric cancer cell inoculation; all grew into a tumor. The average volumes of the tumor mass in the four groups were not significantly different prior to the administration of the various treatments (P>0.05). However, 15 days after the treatment was initiated , the average volume of the tumor mass in the 5-Fu group was less than that in the control group, but the difference was not significant (P>0.05). The average volumes of the tumor mass in the celecoxib group and the combined group were significantly lower than that in the control group (P<0.05), and the average volume of the tumor mass in the combined treatment group was significantly less than the volume in the 5-Fu group (P<005). Similar results were obtained for the tumor weight. The mean tumor weight in the 5-Fu group was not statistically significant different from that in the control group (P>0.05). The mean tumor weights in the celecoxib and combined treatment groups were significantly lower than that in the control group (P<0.05), and the mean tumor weight in the combined treatment group was significantly less than the mean weight in the 5-Fu group (P<0.05). The tumor inhibition rates in the 5-Fu, celecoxib and combination groups were 26.36, 59.70 and 88.37%, respectively. A statistically significant difference was identified between the combination group and the 5-Fu and celecoxib groups .The positive expression of HIF-2\u03b1, ABCG2 and Oct-4 proteins was identified as brown granular staining. The proteins were mainly dispersed throughout the cytoplasm and along the nuclear membrane border in a linearly distributed manner, and a strong positive reaction was observed in the nucleus.For the four groups of nude mice after 14 days, the expression levels of HIF, ABCG2 and Oct-4 proteins were highest in the tumor tissue of the 5-Fu group, followed by the blank control group, and the expression levels of the three proteins in the combined and celecoxib groups were significantly reduced \u20134.The RT-PCR technique was used in the four groups of nude mice to detect the mRNA expression of HIF-2\u03b1, ABCG2 and Oct-4 in the tumor tissue after 14 days of treatment. In the control group, which received saline every other day, HIF-2\u03b1, ABCG2 and Oct-4 mRNA expression was observed at high levels. In the 5-Fu group, the levels of HIF-2\u03b1, ABCG2 and Oct-4 mRNA expression were increased by the injection of 5-Fu every other day. In the celecoxib and combined treatment groups, the HIF-2\u03b1, ABCG2 and Oct-4 mRNA expression levels were lower than those in the 5-Fu group. The celecoxib and combination treatment groups showed a significant difference from the control group when a pairwise comparison was performed P<0.01;  and 6.The western blotting technique was used to detect the protein expression of HIF-2\u03b1, ABCG2 and Oct-4 in the tumor tissue after 14 days of treatment. The results showed that the HIF-2, ABCG2 and Oct-4 protein expression levels in the tumor tissue were high in the control group, and were further increased in the 5-Fu group. The HIF-2\u03b1, ABCG2 and Oct-4 protein expression in the tumor tissue was significantly decreased in the celecoxib and combination treatment groups compared with the control and 5-Fu groups. For all four groups, a pairwise comparison was performed  and 8. TGastric cancer is an disease that is seriously harmful to human health, as it has a high morbidity and mortality. Surgery remains the only mean possible to cure gastric cancer, but in approximately two-thirds of cases, the patient\u2019s condition has reached advanced gastric cancer at the time of diagnosis ,8. It haet al , indicating that a 5-Fu insensitive subpopulation of cancer stem cells is the source of resistance to chemotherapy. The preliminary results of the present study demonstrated that under hypoxic conditions, when 5-Fu was used to treat human gastric cancer cell lines, the expression of cancer stem cell markers HIF-2\u03b1 and ABCG2 increased (Previous studies have suggested that a very small amount of tumor tissue has unlimited self-renewal capacity and multi-cell proliferative potential, due to the presence of cancer stem cells. These are considered to be the root cause of metastasis, recurrence, drug resistance and chemotherapy resistance ,14. Howeet al  reportedl (et al  demonstrncreased . In the et al (in vivo, specifically, in gastric cancer transplants in nude mice. The inhibition rate in the combination treatment group was significantly enhanced compared with that in the 5-Fu group. Celecoxib and 5-Fu exhibited a synergistic effect in the treatment of gastric cancer. However, the specific antitumor mechanism of NSAIDs remains unclear. Previous cell and animal experiments have shown that NSAIDs inhibit COX-2 activity to reduce the synthesis of prostaglandin E2, thereby inducing tumor cell apoptosis (et al found in a premalignant and malignant oral mucosal cell culture model, that the potential anticancer and apoptosis-inducing effects of celecoxib occurred via a mechanism that was independent of COX pathways (Celecoxib is a selective COX-2 inhibitor that has anti-inflammatory and analgesic effects. Clinically, it is used for the treatment of acute and chronic osteoarthritis and rheumatoid arthritis. Compared with conventional NSAIDs, it has significantly reduced gastrointestinal side-effects. Clinical and experimental studies have shown that celecoxib also plays a role in tumor suppression. Steinbach et al  performeet al ,25. In tpoptosis . Howeverpathways . Numeroupathways \u201333. The In conclusion, HIF-2\u03b1, ABCG2 and Oct-4 mRNA and protein expression levels were significantly increased in the tumor tissues of the 5-Fu group; this may be a due to the tumor cells having resistance to 5-Fu. However, when 5-Fu and celecoxib were used together, compared with 5-Fu used alone, the HIF-2\u03b1, ABCG2 and Oct-4 mRNA and protein expression levels were significantly lower, and the difference was statistically significant. This showed that the combined use of 5-Fu and celecoxib is able to attenuate the resistance to chemotherapy in gastric cancer and enhance the effect of chemotherapy by reducing the expression of HIF-2\u03b1, ABCG2 and Oct-4 and cancer stem cells in tumor tissue xenografts in nude mice."}
{"text": "Mycobacterium tuberculosis (Mtb) strains using genotyped Mtb isolates from tuberculosis patients is a routine public health practice in the United States. The present study proposes a standardized cluster investigation method to identify epidemiologic-linked patients in Mtb genotype clusters. The study also attempts to determine the proportion of epidemiologic-linked patients the proposed method would identify beyond the outcome of the conventional contact investigation.Tracking the dissemination of specific Mtb culture positive patients from Georgia, Maryland, Massachusetts and Houston, Texas. Mtb isolates were genotyped by CDC\u2019s National TB Genotyping Service (NTGS) from January 2006 to October 2010. Mtb cluster investigations (CLIs) were conducted for patients whose isolates matched exactly by spoligotyping and 12-locus MIRU-VNTR. CLIs were carried out in four sequential steps: (1) Public Health Worker (PHW) Interview, (2) Contact Investigation (CI) Evaluation, (3) Public Health Records Review, and (4) CLI TB Patient Interviews. Comparison between patients whose links were identified through the study\u2019s CLI interviews (Step 4) and patients whose links were identified earlier in CLI (Steps 1\u20133) was conducted using logistic regression.The study population included Forty-four clusters were randomly selected from the four study sites . Epidemiologic links were identified for 189/401 (47\u00a0%) study patients in a total of 201 linked patient-pairs. The numbers of linked patients identified in each CLI steps were: Step 1 - 105/401 (26.2\u00a0%), Step 2 - 15/388 (3.9\u00a0%), Step 3 - 41/281 (14.6\u00a0%), and Step 4 - 28/119 (30\u00a0%). Among the 189 linked patients, 28 (14.8\u00a0%) were not identified in previous CI. No epidemiologic links were identified in 13/44 (30\u00a0%) clusters.Mtb genotype clusters, which can be integrated into the TB control and prevention programs in public health settings. The CLI interview identified additional epidemiologic links that were not identified in previous CI. One-third of the clusters showed no epidemiologic links despite being extensively investigated, suggesting that some improvement in the interviewing methods is still needed.We validated a standardized and practical method to systematically identify epidemiologic links among patients in The online version of this article (doi:10.1186/s12879-016-1937-9) contains supplementary material, which is available to authorized users. Mycobacterium tuberculosis (Mtb) strains in populations is an important tool used to understand TB transmission dynamics . No difference in the number of clusters having 100\u00a0% foreign-born patients was seen between the two groups (data not shown).There was substantial variability by cluster in terms of the proportion of patients with identified epidemiologic links . All epidemiologic links with a household transmission setting and/or involving relatives were identified earlier than Step 4, while workplace and church transmission settings were associated with identification through CLI TB patient interviews in Step 4 . Epidemiologic links involving a black TB patient had higher odds of being identified by early investigation steps (p\u2009=\u20090.036). Epidemiologic links including Asians or patients with extrapulmonary TB were associated with identification through CLI TB patient interviews in univariate analysis ; these associations became non-significant in multivariate results. Definite (strength) epidemiologic links had decreased odds for identification through interviews (p\u2009<\u20090.007)  found in the CLI interview were not identified through the previous CI . When applied in a local health department context, existing knowledge of clusters or patient relationships is available through communication with a case manager, disease intervention specialist, or contact investigator . Existing contact investigation records were then reviewed for documented links (Step 2). The next investigation step, entailing review and evaluation of public health records, added a more time-intensive and analytic component to investigations Step 3). Finally, the most resource intensive step was patient re-interviews (Step 4). The analysis of the CLI step where epidemiologic links were determined , the inability to locate and obtain consent from patients for re-interviews and exclusion of clinically defined and non-genotyped culture-positive patients with epidemiologic links to patients in study clusters. In addition, the infectious period of each patient was not considered. Although beyond the scope of this study, including non-genotyped patients may show a more complete picture of cluster transmission dynamics. Furthermore, NTGS transitioned from using spoligotype and 12-locus MIRU-VNTR (MIRU12) to spoligotype and 24-locus MIRU-VNTR (MIRU24) in 2009 to increase the discriminatory power of MIRU-VNTR , 14, 15.Mtb genotype clusters. In addition, CI record review (Step 2) found 15 (3.9\u00a0%) linked patients exemplifying a need for better tools and trainings for contact investigations, which is an essential component of TB control programs.Public health departments need to develop strategies and focus resources to prioritize and investigate clusters that may be of public health concern. An initial step in these investigations should be to evaluate clusters using readily available data. Many data elements needed to investigate clusters in specific jurisdictions are now available to TB control personnel routinely and electronically through the Tuberculosis Genotyping Information Management System . AdditioMtb transmission by implementing the expanded and efficient CIs and CLIs would be critical for the success of TB control and prevention programs in the US.Despite the continuing decline in US TB rates leading to a decrease of funding for public health activities for TB control, the elimination goals established in 1989  remain uMtb genotype clusters.We validated a practical method to systematically identify tuberculosis epidemiologic links that can be integrated into routine TB control and prevention programs in public health settings. Re-interviewing patients in a cluster can identify additional epidemiologic links that were not found in the previous CLI steps. Improvement of the interview methods and effective contact investigation trainings may be needed as no epidemiologic links were identified in one-third of the"}
{"text": "We show that this approach, despite being more laborious, is a very efficient pipeline for the creation of large libraries of mutants.Site-directed scanning mutagenesis is a powerful protein engineering technique which allows studies of protein functionality at single amino acid resolution and design of stabilized proteins for structural and biophysical work. However, creating libraries of hundreds of mutants remains a challenging, expensive and time-consuming process. The efficiency of the mutagenesis step is the key for fast and economical generation of such libraries. PCR artefacts such as misannealing and tandem primer repeats are often observed in mutagenesis cloning and reduce the efficiency of mutagenesis. Here we present a high-throughput mutagenesis pipeline based on established methods that significantly reduces PCR artefacts. We combined a two-fragment PCR approach, in which mutagenesis primers are used in two separate PCR reactions, with an  The technique permits mapping of protein\u2013protein interaction interfaces, ligand binding sites and residues important for enzymatic activity or general functionality. Furthermore, it allows protein engineering by combination of mutations with desired characteristics. While mutagenesis was initially limited to very few residues, improvement of mutagenesis techniques now enables scanning of an entire protein sequence of several hundred amino acids. This was demonstrated for both soluble and membrane proteins, including several G protein-coupled receptors (GPCRs) with the aim of stabilising the inherently unstable proteins, reviewed in ref. i1 and arrestin-1 residues involved in GPCR signalling5. As an alternative to using scanning mutagenesis based on predefined sets of mutations, random mutagenesis is also a very powerful approach applied to protein engineering and establishing structure-activity relationships10.Scanning mutagenesis, the replacement of selected single amino acid residues by alanine or any other amino acid11) of the widely used QuikChange\u2122 method , both partially overlapping PCR primers contain the mutation which is then inserted in the newly synthesized DNA. The PCR-linearized plasmid is then transformed and repaired (circularized) by homologous recombination in the bacterial cells. Although being very simple, this approach sometimes results in artefacts in the final PCR products13. Several versions of this method are available for producing site-directed mutants, with varying degrees of complexity and efficiency. All of them could be used for library generation. However, when making a large number  of site-directed mutants, and aiming for 100% coverage of the gene of interest, the differences in efficiency become very important for the overall speed, success rate and cost of library generation.Generally, alanine-scanning mutagenesis is based on PCR amplification of the recombinant DNA followed by an enzymatic digest of the methylated template DNA using endonuclease DpnI. In the improved version  and bovine arrestin-1  proteins13. After the initial success of the two-fragment approach in generating several \u201cdifficult-to-make\u201d arrestin-1 mutants, we decided to use this strategy for high-throughput scanning mutagenesis of two human GPCRs \u2013 cannabinoid CB2 receptor  and vasopressin V2 receptor .The mutagenesis primers are combined with another pair of primers, annealing approximately on the opposite side of the plasmid Fig.\u00a0. The twoHere, each vector fragment was amplified by PCR using one mutagenic primer and the appropriate ColE1 primer annealing to the complementary DNA strand within the vector\u2019s bacterial origin of replication  or valines (CB2). The alanine and glycine substitutions remove the side chain of the amino acid and are used for probing its role in protein function. Valines are one of the prevalent types of amino acids in membrane proteins and promote stability of transmembrane helices. These substitutions are generally well tolerated and used for thermostabilisation of GPCRs \ufeff agar plates to save space without losing efficiency of mutagenesis. Alternatively, bacteria could be plated on 24-well plates using an expanding pipette21. It should be noted that 68 CB2 transformants gave no visible colonies on the selection plates. We hypothesized that the corresponding PCRs were not successful, so we repeated them using another DNA polymerase and the corresponding PCR conditions .After PCR, the two matching fragments carrying one mutation were combined without checking PCR products on an agarose gel Fig.\u00a0. The metin vivo recombination in the E. coli Mach1 strain22, according to our earlier one-fragment approach13. When few mutants remain to be cloned, we tend to try different approaches in parallel and/or send more clones at once. Therefore, the standard single-fragment approach was used alongside the two-fragment method.Colonies were sent for sequencing on 96-well LB agar plates with the appropriate selection antibiotic. Initially, we sent out only one colony per mutant to reduce sequencing costs. If the first sequencing reaction was not successful, we sequenced DNA from one to three additional colonies. Difficult CB2 mutants 14, 4%) were obtained by repeating PCR, analysing products on agarose gels and cutting the right bands out in case of significant side-products. Alternatively, the rest of the missing V2R mutants  were obtained by repeating the PCR with two mutagenic primers in the same reaction mixture . We use this term when discussing occurrence of primer tandem repeats, which were the main cause of failure in the one-fragment approach used in arrestin-1 high-throughput mutagenesis we use as a comparison. However, it should be noted that sequencing failures could also be caused by unsuccessful cloning, e.g. when a part of plasmid to which sequencing primer should anneal is missing. Because we cannot distinguish a true sequencing failure from a cloning failure in our data, we decided to use an overall success rate of the method as well. It takes into account all encountered practical difficulties and it is defined as a percentage of the expected sequences obtained in all sequencing attempts (including failed sequencing and non-informative sequencing data). In our opinion, this information is valuable in the context of high-throughput site-directed mutagenesis with direct repercussions on expected costs.Taken together, we successfully generated complete alanine scanning libraries of the two GPCRs. For V2R, 467 out of 565 sequencing reactions confirmed the designed single amino acid mutations, which correspond to an overall success rate of 83%. For CB2, we obtained the right sequences for 390 out of 537 colonies sent for sequencing (73%). The lower efficiency in this case was mostly due to failed sequencing or lower quality of sequencing data not allowing their reliable interpretation as well as primer misannealing resulting in large deletions  \u2013 two plant membrane proteins with an extensive cytoplasmic domain. Out of 50 successfully sequenced DNA samples, 45 had the correct sequence. Although the remaining 5 had the correct truncation, they also contained an additional point mutation, presumably introduced as a DNA polymerase error in PCR. While the Gibson method is an established cloning method, these results suggest that it is very well suited for general high-throughput applications.We also used the same two-fragment cloning approach to prepare twenty N- and/or C-terminally truncated constructs of 13. In our case, the pCDNA4/TO vector encoding for fusions of the CB2 and V2R constructs used in this work have the same length of 7 kbp and an average GC content of 55 and 54%, respectively . The constructs encoding for the ETR1 were in the range of 6.2\u20137.5\u2009kbp. Based on the two parameters that can dramatically affect the PCR efficiency, the length and GC content, these samples are relatively similar. The plasmid size is very critical for co-transformation cloning, where overlapping fragments are simply used to co-transform E. coli, without in-vitro treatment with In-Fusion or assembly mix15. However, the assembly mix is efficient at combining DNA fragments up to several hundred kilobases, a size that is never reached with plasmids14. If insert-plasmid mixtures are combined in vitro using assembly mix, as in our method, the limiting factor is the PCR. Because we use two fragments and 6\u2009kb can be robustly amplified today, the method works for plasmids up to at least 12\u2009kb. The larger plasmid size also has a slight negative effect on transformation efficiency, but this is not a problem with competent cells of reasonably high transformation efficiency. In comparison to the method previously used in our lab with both mutagenic primers in one PCR and recombination in Mach1 cells13, we found that a number of instances with tandem repeats of the primer sequence before or after the mutation site was drastically reduced , longer elongation times (at least 30\u2009s/kbp) and less PCR cycles in combination with annealing temperatures not lower than 60\u2009\u00b0C . Furthermore, the Hot Fusion methodThe two-fragment approach presented here can be further extended to a three-fragment approach where the whole plasmid backbone is prepared by restriction digestion, mutagenesis is then done with mutagenesis primers and primers flanking the gene of interest, followed by PCR clean-up and Gibson assembly. This could be a very efficient way of making mutants, especially in the GC rich regions that are challenging for the PCR. An additional benefit is that the backbone, since it is only produced once, can be verified for the absence of mutations and deletions, something that is not practical with the two-fragment approach. It needs to be noted that, from our experience, it is more difficult to assemble three fragments successfully, especially when the molar ratio of the assembling fragments has not been chosen carefully. In our two-fragment high-throughput approach, we do not measure or adjust fragment concentration before the assembly reactions.Although there are many general cloning methods developed and kits commercially available, it is of crucial importance to have a highly-efficient, simple, fast and cost-effective method when it comes to generating libraries comprised of hundreds of mutants with 100% coverage. Even though the presented high-throughput mutagenesis and cloning pipeline is slightly more laborious than other established mutagenesis protocols, we found this to be a convenient and efficient alternative.13. The AAscan, PCRdesign and MutantChecker are an open source software written in an open source multi-platform Pascal-Lazarus environment25 and are freely available from the authors\u2019 web site (https://www.psi.ch/lbr/aascan).In this work, we used software specially developed for primer design and sequence analysis in high-throughput scanning mutagenesisTm) of 60\u201370\u2009\u00b0C with a maximum \u0394Tm of 5\u2009\u00b0C for a pair of primers. Our designed primers, excluding the mismatching bases, had annealing temperatures in a range 60\u201368\u2009\u00b0C. The minimal overlap of the two mutagenic primers was 21 nucleotides for CB2 and 15 for V2R. A minimum of 13\u201315 bases is needed for both Gibson assembly and bacterial recombination to work27. A too long overlap may restrict primer design options of the program, which may lead to a decrease in mutagenesis success rates. In several cases of CB2 mutagenesis, the value of 21 nucleotides had to be decreased in order to design primers within the given restraints. Longer overlap of the primers used for CB2 mutagenesis may be an explanation for the lower success rate compared to V2R mutagenesis. Codons were chosen according to their frequency in the expression host and according to the GC content of the gene. Very high and very low GC contents should be avoided. For mammalian expression vectors, we chose the codons GCC/GCT for alanine, GGC/GGA for glycine and GTG/GTC for valine. For genes with high GC contents it could be advisable to choose GCT/GCA for alanine, GGA/GGT for glycine and GTT/GTA for valine, provided that the host organism is able to translate these codons efficiently. Due to consecutive cytosine bases in the CB2 gene sequence, several primers designed in AAscan had to be manually modified by introducing other degenerate codons in order to avoid G-repeats in the reverse (antisense) primers. G-repeats are prone to formation of G-quadruplex secondary structure  and might thus interfere not only with the oligonucleotide production and quantification, but might also reduce PCR efficiency. Primers used for the C- and/or N-terminal truncations of ethylene receptor 1 from Arabidopsis thaliana  and tomato  in pET16b vectors were designed in program PCRdesign13 with the following parameters: a primer length 16\u201350 nt, an overlap 21\u2009bp (base pairs), a minimum GC clamp of 2, optimized GC content and a minimum Tm of 60\u2009\u00b0C.For human CB2 and V2R genes in pcDNA4/TO vector (both plasmid sizes 7.0\u2009kb) we designed the mutagenic primers in a high-throughput way by using the program AAscan and the following parameters: a primer length 18\u201360 nt (nucleotides), a minimum GC clamp of 2, a melting temperature , pH 7.5. Other primers were ordered from Microsynth or Sigma-Aldrich in lyophilized form.28. It is also possible that the PCR reaction was not efficient enough to be detected by ethidium bromide staining.PCR conditions were first tested for a random set of 30 CB2 mutants using Phusion High-Fidelity PCR Master Mix with HF \ufeffBuffer, Phusion High-Fidelity PCR Master Mix with GC Buffer  and KOD Hot Start Master Mix (Merck Millipore). Based on analysis of the PCR products on agarose gels , and either 1\u00d7 Phusion buffer HF (NEB) or 3% (v/v) DMSO (NEB) with 1\u00d7 Phusion buffer GC (NEB). Also, PCR thermocycling described above was modified in case of the ETR1 plasmids to have: (1) 11 step-down cycles with annealing starting from 65\u2009\u00b0C down to 60\u2009\u00b0C (i.e. decreasing by 0.5\u2009\u00b0C in each subsequent cycle); (2) elongation time of at least 30\u2009s per kbp of the target product (up to 200\u2009s for the longest PCR products); and (3) final elongation time of 5\u2009min.For the two-fragment approach, each mutagenesis primer was combined with the matching ColE1 primer, giving two PCR products per mutation. For the one-fragment approach, the two mutagenesis primers were combined in one PCR reaction, which required a longer elongation time compared to the two-fragment approach. PCRs were carried out in 20\u2009\u03bcL final volume with 1\u2009ng template DNA, 300\u2009nM of each primer and, in case of CB2 only, 3% (v/v) DMSO (dimethyl sulfoxide). Good results were obtained with the following thermocycling setup using Phusion High-Fidelity DNA Polymerase with GC buffer: initial denaturation at 98\u2009\u00b0C for 1\u2009min, followed by 20\u2009step-down thermal cycles, each comprising denaturation at 98\u2009\u00b0C for 20\u2009s, annealing from 65\u2009\u00b0C down to 55.5\u2009\u00b0C for 30\u2009s (0.5\u2009\u00b0C decrement per cycle), and elongation at 72\u2009\u00b0C for at least 25\u2009s per kbp of the expected PCR product , then 10 thermal cycles with the constant annealing temperature , and final elongation at 72\u2009\u00b0C for 3\u2009min completed with a hold at 10\u2009\u00b0C. When using KOD Hot Start Master Mix, the following thermocycling setup was used: Initial denaturation at 95\u2009\u00b0C for 2\u2009min, followed by 20\u2009step-down thermal cycles, each comprising denaturation at 95\u2009\u00b0C for 20\u2009s, annealing from 65\u2009\u00b0C down to 55.5\u2009\u00b0C for 10\u2009s (0.5\u2009\u00b0C decrement per cycle), and elongation at 70\u2009\u00b0C for at the appropriate time (up to 135\u2009s), then 5 thermal cycles with the constant annealing temperature , completed with a hold at 10\u2009\u00b0C. For truncations of the AtETR1 and LeETR1 plasmids by the two-fragment approach, a slightly different PCR protocol was used: 20\u2009\u03bcL PCR mixture prepared with nuclease-free water  contained 1\u2009ng DNA template, 500\u2009nM each primer, 200\u2009\u03bcM each dNTP , 0.4\u2009U \u03bcL\u22121 from NEB or 10 units \u03bcL\u22121 from Thermo Scientific) to a final PCR mixture. The mixtures with DpnI were incubated at 37\u2009\u00b0C for 18\u2009h (GPCR mutagenesis) or 2\u2009h (ETR1 truncated products), however the digestion time can be shortened if necessary, provided the template amount in PCR and DpnI amount are optimised beforehand. The reaction was cleaned-up using a 96-well ZR-96 DNA Clean-up Kit (Zymo Research), MinElute Reaction Cleanup Kit (Qiagen) or Illustra GFX PCR DNA and Gel Band Purification Kit  according to the manufacturer\u2019s instructions. We used a low elution volume of 10\u2009\u03bcL to obtain higher DNA concentrations and, in case of two-fragment cloning, a more efficient Gibson assembly.After PCR, the two fragments carrying one mutation in a GPCR gene were combined already before digestion and purification. To reduce background, methylated template DNA was digested by adding 0.5\u2009\u03bcL DpnI enzyme (20 units \u03bcLin vitro using Gibson assembly14. Twelve mL 1.33\u00d7 Gibson assembly mix was prepared in-house using 6.4\u2009\u03bcL 10\u2009U \u03bcL\u22121 T5 exonuclease (NEB), 200\u2009\u03bcL 2\u2009U \u03bcL\u22121 Phusion High-Fidelity DNA polymerase (NEB) and 1.6\u2009mL 40\u2009U \u03bcL\u22121 Taq DNA ligase (NEB) in isothermal reaction (IT) buffer (5% (w/v) PEG-8000 (poly(ethylene glycol) 8000), 100\u2009mM Tris-HCl pH 7.5, 10\u2009mM MgCl2, 10\u2009mM DTT (dithiothreitol), 1\u2009mM \u03b2-NAD (\u03b2-nicotinamide adenine dinucleotide), 200\u2009\u03bcM of each dNTP). IT buffer was prepared as a 5\u00d7 stock in nuclease-free water. In case of the CB2 and V2R mutants, 1\u2009\u03bcL cleaned-up DNA mixture was added to 3\u2009\u03bcL 1.33\u00d7 Gibson assembly mix and incubated at 50\u2009\u00b0C for 10\u2009min followed by 1\u2009h at 37\u2009\u00b0C. In case of CB2, with 21\u2009bp overlap within a pair of mutagenic primers, we observed more colonies on selective LB agar plates when Gibson reaction was performed for 1\u2009h at 50\u2009\u00b0C. For ETR1 truncations, 2.5\u2009\u03bcL 1.33\u00d7 Gibson assembly mix was combined with 1\u2009\u03bcL of the longer PCR product and 1.5\u2009\u03bcL of the shorter one, without determining DNA concentration of each cleaned-up PCR product, and the assembly was conducted at 50\u2009\u00b0C for 1\u2009h.Cleaned PCR products with two fragments were assembled Escherichia coli XL-1 Blue cells were prepared by the Inoue method30 and had a transformation efficiency of at least 107 colonies per 1\u2009\u00b5g plasmid pBR322. The assembled fragments were transformed into the competent cells using 20\u2009\u03bcL of cell suspension and 2\u2009\u03bcL assembly mix for GPCR mutagenesis or 50\u2009\u03bcL cell suspension and 5\u2009\u03bcL assembly mix for ETR1 mutagenesis. Cells for transformations were thawed on ice, aliquoted, incubated with DNA for 10\u201320\u2009min, heat shocked for 1\u2009min at 42\u2009\u00b0C, incubated on ice for 2\u2009min and plated on LB agar plates with 150\u2009\u03bcg\u2009mL\u22121 ampicillin. A quarter of LB agar plate was used for each V2R mutant, while the transformed cells of other constructs were spread over a whole plate. Plated cells were incubated at 37\u2009\u00b0C for 16\u201324\u2009h.Chemically competent PCR reactions, heat shock for transformation and Gibson assemblies were done in 96-well PCR plates (Eppendorf) using Mastercycler pro S or Mastercycler gradient thermocyclers (Eppendorf).\u22121 ampicillin and sent for plasmid preparation and sequencing by the GATC Biotech Company. Sequencing results were analyzed with the program MutantChecker13. In case the mutant was not obtained in the first round, another clone was sent for sequencing. If there were no more clones, PCR with modified conditions and/or Gibson assembly was repeated. ETR1 plasmids were prepared using NucleoSpin Plasmid Kit (Macherey-Nagel) and sequenced by the Biological-Medical Research Centre (BMFZ) at the Heinrich Heine University D\u00fcsseldorf.In the high-throughput CB2 and V2R mutagenesis, one cell colony per mutation was transferred into a well of a 96-well LB agar plate with 150\u2009\u03bcg\u2009mLA small number of mutants have proven difficult to make, 14 (4%) in case of CB2 and 3 (0.8%) in case of V2R. In the CB2 mutagenesis, a large deletion in the plasmid was a most common problem. This is a clear indication of a primer misannealing in PCR, probably related to a higher GC content (61%) in the CB2 gene, while no correlation with high GC content in the primer itself was observed (Supplementary Data). To obtain missing mutants, PCR was repeated using different DNA polymerase (Hot Start Master Mix). In the third round of mutagenesis, PCR was repeated using both Phusion High-Fidelity DNA Polymerase with GC buffer and KOD Hot Start Master Mix with the conditions as described above, but longer elongation times were used (135\u2009s). PCR fragments were analysed on agarose gels . Linear PCR products were digested with DpnI and directly transformed into the chemically competent E. coli Mach1 strain for in vivo recombination, in which case SOC medium was added after transformation followed by 2\u2009h recovery at 37\u2009\u00b0C to allow bacterial DNA repair before plating on LB agar plates with the selective antibiotic.An alternative approach was used for obtaining the three remaining V2R mutants. In this case, a PCR was repeated, but with the two mutagenic primers in the PCR mixture (\u201csingle-fragment\u201d approach) and a longer extension time which is sufficient for full plasmid amplification (Sun, Ostermaier The results of data analysis are included in the supplementary information.Supplementary Dataset 1"}
{"text": "A 40-year-old female patient with a 5-year history of systemic lupuserythematosus was referred to our policlinic with complaints of erythema,atrophy, and telangiectasia on the upper eyelids for 8 months. No associatedmucocutaneous lesion was present. Biopsy taken by our ophthalmology departmentrevealed discoid lupus erythematosus. Topical tacrolimus was augmented to thesystemic therapeutic regimen of the patient, which consisted of continuousantimalarial treatment and intermittent corticosteroid drugs. We observed noremission in spite of the 6-month supervised therapy. Periorbital discoid lupuserythematosus is very unusual and should be considered in the differentialdiagnosis of erythematous lesions of the periorbital area.. Delayed diagnosis usually reflects intreatment delays.3Discoid lupus erythematosus (DLE) is the most common chronic form of lupuserythematosus (LE). DLE is more common than the systemic form of the lupuserythematosus. Clinical features include lesions with squamous and erythematousscaly plaques that may result in atrophic scars, alopecia, or permanent pigmentarychanges. The most commonly involved areas are those exposed to sun, such as theface, the \"V\" region of the neck, and the extensor sides of the arms; periorbitallocalization is rare.We report a case of DLE on the eyelid in a patient who had been followed fortreatment-resistant systemic LE.A 40-year-old woman had been followed with the diagnosis of systemic lupuserythematosus (SLE) for 5 years in our rheumatology clinic. She presentedphotosensitivity, synovitis, arthritis, hemolytic anemia, leucopenia, positiveantinuclear antibodies, and positive anti-dsDNA antibodies. According to TheAmerican College of Rheumatology (ACR) and the SLICC (Systemic Lupus CollaboratingClinics) criteria, the patient was diagnosed with SLE. She presented to ourdermatology clinic with the complaints and signs of erythema, telangiectasia, andmild atrophy of her upper eyelids and left lower eyelid. The complaints about theeyelids had started about 8 months before the patient sought treatment and worsenedwith sun exposure. Ophthalmologists suspected discoid lupus erythematosus.Ophthalmic examination revealed squamous, erythematous, mildly edematous, andatrophic areas. Scaly patches and telangiectasias were seen on both eyelids (5-6 mmx 1-2 mm on the right upper side and 2 mm x 1 mm on the left upper and lowereyelids) . The lesRoutine tests showed normal results. Laboratory investigation yielded positiveresults for anti-nuclear antibodies and anti-dsDNA tests. We took an excisionalbiopsy from the right upper eyelid based on a suspected DLE diagnosis. Histologicalexamination revealed epidermal atrophy, vacuolar degeneration, and lymphocyticinfiltrations in deep and superficial perivascular and periadnexial areas,confirming the DLE diagnosis . Thepat7 The disease typically manifests with bilateraleyelid involvement and mucocutaneous lesions.2 Cases involving the conjunctiva and the cornea have alsobeen reported. DLE patients presenting with unilateral eyelid involvement are veryunusual and its diagnosis is a challenge for physicians since it lacks the typicalmorphologic signs of CCLE.5 DLE patients may complain of mild pruritus or sometimes pain,but most cases are asymptomatic. Serological and hematological signs are seen inpatients with typical involvement.Discoid lupus erythematosus (DLE) is the most common form of chronic cutaneous lupuserythematosus (CCLE) and is mostly seen in women 20-40 years of age. Eyelidinvolvement is seen in 5%-6% of DLE patients. 8 Some patients presenting with thesesymptoms received treatment for chronic blepharitis or eczema for many years, asillustrated by Aubaret et al. and Duke-Elder etal., who reported cases of DLE presented as chronicblepharitis.10 In our case, the diagnosis wasmade 6 months after the beginning of the treatment.Delay in diagnosis can lead to eye or eyelid complications \u2013 such as periorbitaledema, epiphora, trichiasis, conjunctivitis, stromal keratitis, madarosis,ectropion, and entropion. Such complications, in addition to the development of apermanent scar, can disturb the psychological status of the patient.10Several diseases may be initially considered in the differential diagnosis of DLE:basal cell carcinoma, squamous cell carcinoma, Bowen's disease, actinic keratosis,contact dermatitis, atopic dermatitis, seborrheic dermatitis, psoriasis, andsarcoidosis.4 In our case, we observed no healing with the use ofsystemic antimalarial, topical corticosteroid, or topical tacrolimusmedications.Treatment of DLE lesions on the eyelid usually involves oral hydroxychloroquine,topical corticosteroid, and avoidance of sun exposure. Some researchers also suggestthe use of topical tacrolimus or intralesionary steroid. Although DLE on the eyelids typically has a benign course, diagnosis is frequentlydifficult, resulting in patients receiving treatments for different diagnoses. As aconsequence, treatment results may be negative."}
{"text": "Kidneys have an important role in regulating water volume, blood pressure, secretion of hormones and acid-base and electrolyte balance. Kidney dysfunction derived from acute injury can, under certain conditions, progress to chronic kidney disease. In the late stages of kidney disease, treatment is limited to replacement therapy: Dialysis and transplantation. After renal transplant, grafts suffer from activation of immune cells and generation of oxidant molecules. Anesthetic preconditioning has emerged as a promising strategy to ameliorate ischemia reperfusion injury. This review compiles some significant aspects of renal physiology and discusses current understanding of the effects of anesthetic preconditioning upon renal function and ischemia reperfusion injury, focusing on opioids and its properties ameliorating renal injury. According to the available evidence, opioid preconditioning appears to reduce inflammation and reactive oxygen species generation after ischemia reperfusion. Therefore, opioid preconditioning represents a promising strategy to reduce renal ischemia reperfusion injury and, its application on current clinical practice could be beneficial in events such as acute renal injury and kidney transplantation. The kidneys are involved in several important bodily functions, including blood filtering, resulting in excretion of toxins and metabolic end products, regulating water volume, blood pressure control, secretion of hormones, and acid-base and electrolyte balance . Blood pGlomerular filtration is one of the major purposes of the kidney. The glomerulus filtrates through three specific layers: The fenestrated endothelium, the glomerular basement membrane, and epithelial podocytes with foot processes . MoleculEvaluation of the renal function is vital to determine renal conditions in several pathologies. The glomerular filtration rate (GFR) is used to assess the renal function and indicates the amount of fluid filtered by the kidneys, which is dependent on the hydrostatic and osmotic pressure. GFR is equal to the product of the net filtration pressure, hydraulic permeability, and filtration area. Several equations have been established to obtain the GFR such as Cockroft-Gault and MDRD  equations . KDOQI  5]. Uri. Uri5]. Many different conditions can affect the kidney and its function in a short or long term. The most significant pathologies are acute kidney injury (AKI) and CKD. AKI is defined as a reduction in the kidney function with a decreased GFR . It resu+/K+ ATPase enzyme and depletion of ATP produce uncoupling of the respiratory chain, free radical production, loss of epithelial cell adhesion, and cell death [One of the major causes of AKI is ischemia due to partial or total obstruction of the vessels inflow. . Lack ofll death ,13,14. Ill death . Vasodilll death ,16. Vasoll death ,18,19. TOne of the most critical mechanisms of AKI is IRI . KidneysAKI is an entity that if left untreated, can cause irreversible kidney damage, which can progress into CKD or even end-stage renal disease (ESRD). The postoperative development of AKI occurs in 40% of the cases and is related to increased morbidity and high mortality ,23,24. TSeveral biomarkers besides creatinine, GFR, and urinary output are currently under study as novel diagnostic approaches for AKI. Examples of these are NGAL  and KIM-1 (Kidney Injury Molecule), which are involved in acute responses to injury .2 [CKD is a consequence of several chronic diseases such as diabetes or hypertension . Risk fa2 ,30. This2 . The CKD2 ).Different pathological conditions affecting the glomerulus, vasculature, or tubulointerstitium can result in kidney structural deterioration. Renal fibrosis is the most common pathological factor in advanced kidney diseases and has shown to be the most reliable predictor of CKD progression to ESRD . The conSignaling pathways involved in renal fibrosis are complex and not completely elucidated. Several mechanisms underlying fibrogenesis have debuted, all of them with important characteristics that result in a multifaceted process. Representative molecules that participate in fibrosis are hypoxia-inducible factor 1, transforming growth factor-beta, nuclear factor-kappa b (NF-\u03bab), angiotensin II, reactive oxygen species (ROS), interleukin 6 (IL-6), interleukin 8 and kidney injury molecule 1 .Patients that develop CKD exhibit numerous factors that contribute to the decline of the kidney function and the following clinical symptoms as hypertension, proteinuria, and mineral misbalance. Progression to ESRD is almost inevitable and chronic inflammation appears to be the main trigger. Macrophages and the interstitial fibroblast support the production of cytokines and collagen that modify and accumulate in the extracellular matrix. Finally, pharmacological approaches are minimal and based on controlling symptoms, leaving replacement therapies such as dialysis and transplantation as the best options to patients suffering from ESRD.+/K+ ATPase pump [Kidney transplant is considered one of the most suitable treatments for ESRD patients. However, during the transplant surgery, there is a cessation of renal blood flow with a posterior reestablishment, and therefore, the IRI phenomenon always takes place. Other conditions, such as trauma or vascular and heart surgery also cause IRI. Hypoxia and nutrient deprivation due to ischemia results in an excessive generation of ROS, which cause cell death and inflammatory responses . Biochemase pump . The orgase pump .The IRI mechanism involves the activation of the immune system by neutrophils, macrophages, and dendritic cells in kidneys. Endothelial and tubular epithelial cells also play an essential role in the inflammation induced by IRI ,39. IschKidney injury is worsened by the aggregation of neutrophils to endothelium in tubular capillaries and kidney interstitium. Neutrophil-endothelium adhesion causes neutrophils to activate, release their granules and secrete proteases, which generate ROS. That same activation produces interferon-gamma (INF-\u03b3), interleukin 4 (IL-4), IL-6, interleukin 10 (IL-10), and TNF-\u03b1 secretion . NeutropPreconditioning refers to the molecular changes that occur at the tissue level, which enable that same tissue to adapt and overcome later adverse events. Preconditioning includes the physiological and molecular adaptations in a changing environment. As a minor event, ischemic preconditioning is an example of how the body uses adverse conditions to improve tissue response for following incidents. Ischemic preconditioning is an adaptive mechanism that takes place in multiple organs like the brain, heart, kidney, liver, and muscle.Brief intervals of ischemia and early reperfusion have been considered as a beneficial therapeutic approach to contain the damage caused by further and more prolonged episodes of ischemia . ProtectPreclinical studies have shown evidence about renal protection conferred by a preceding ischemic event. Classical articles demonstrated that the ischemic preconditioning could reduce IRI improving the renal function, metabolic homeostasis, and preserving cell integrity and tissue morphology. However, they do not leave clarity about the mechanism involved ,51,52. RThe potential clinical use oriented to prevent AKI has already been tested in clinical trials. This strategy is able to reduce the incidence of AKI in patients undergoing a cardiovascular surgical procedure . HoweverThe molecular responses caused by ischemia and reperfusion can be reached pharmacologically with different anesthetic substances ,61. ThisIn summary, tissue exposure to an ischemic condition can enable cells to adapt rather than suffer damage. Therefore, cells under those conditions are able to manage further challenging situations more effectively.A comprehensive understanding of the nature of opioids and its influence on kidney pathophysiology may improve morbidity and mortality in patients undergoing surgical procedures as transplantation, and consequently, has the potential to modify clinical practice. Furthermore, opioids are commonly used to manage pain in CKD and post-transplant patients .Back to the 1800s, the first known opioid (morphine) was isolated from opium . Four naAnalgesia mediated by opioids is induced by binding to \u03bc receptors in GABAergic neurons. These neurons inhibit descendent neurons in the brainstem and produce analgesia. The same effect is also obtained by inhibiting the release of pain mediators such as substance P, nitric oxide, and glutamate . Along wOpioid receptors can also be found in the kidneys, with the \u03b4 receptor broadly expressed and, on a smaller scale, the \u03ba type . AlthougMorphine is known as the opioid prototype to which other opioids are compared. Both \u03bc and \u03b4 receptors bind morphine to have its effect. These receptors are widely distributed in the human brain, mainly in the amygdala, hypothalamus, thalamus, and several cortical areas. Morphine has two major metabolites, morphine-3-glucuronide (M3G) and morphine-6-glucuronide . M6G has been known to have a higher analgesic effect compared to M3G . MorphinUndoubtedly, the analgesic effects of morphine are supported by abundant scientific and clinical evidence. However, the properties on non-nervous tissues such as the kidneys are poorly understood and controversial. Some reports show that morphine has antioxidant properties and is a potent modulator of immune responses ,78. OtheFentanyl was developed in 1960 by Paul Janssen as a synthetic opioid drug for pain treatment and anesthesia. The range of effects consists of analgesia, anxiolysis, euphoria, and drowsiness . It workAlthough much has been studied about the beneficial properties of fentanyl in vivo and in vitro in the heart and cardiomyocytes ,85,86, lThere is considerable research interest in potential methods of renal protection against IRI. Proof from experimental studies shows that anesthetic preconditioning with volatile agents can be achieved and protect the heart, brain, and kidney from IRI . SeveralExperimental renal ischemia and reperfusion in rabbits showed that morphine significantly inhibited superoxide generation by neutrophils, suggesting a potential for reducing the oxidative stress after hypoxia . HabibeyMorphine, fentanyl, and other opioid medications are strong analgesics used frequently in analgesia and pain management, despite reported concerns about drug safety. Long-term administration is commonly associated with the development of side effects including tolerance, dependence, and addiction. Therefore, it is necessary to discriminate between the long-term effects and the effects of single uses in a surgical procedure and preconditioning. Pain management is an essential part of the comprehensive care of patients with CKD at any stage . One of Complex surgical anesthesia schemes in humans make it difficult to dissect the effect of these drugs on the renal function; however, perioperative use showed positive results. This is how the study by Terashi et. al. showed that anesthetic management using remifentanil exerted a renal protective outcome in perioperative adult patients with CKD for at least two weeks after orthopedic surgery . ConversActions of opioid drugs in the kidney have not been well characterized. Nonetheless, most of the information about mechanisms involved in organic protection conferred by opioids come from studies in organs as heart and brain. We will summarize below some of the molecules involved considering the overlapping molecular mechanisms between the kidneys and other organs it is important to mention.i proteins and also can activate the \u00b5 receptors, but this has very low expression in cardiomyocytes [Experimental and clinical studies showed that opioids can positively influence the cardiac function and could reduce the size of an infarction resulting from prolonged ischemia . Opioidsmyocytes . The \u03b4 rmyocytes ,106. Themyocytes  and invomyocytes . Morphinmyocytes . This remyocytes ,109.Fentanyl, morphine, and remifentanil are frequently used for neurosurgical procedures. Effects on the brain and nervous system undergoing an ischemic event have been documented in experimental models . PrecondEffective and safe anesthesia for successful transplantation depends on an understanding of the influence and interactions with other anesthetics . Here, wPropofol is an intravenous drug widely used in anesthesia as an inducer. It is characterized by its rapid onset of action and the speedy recovery of the patient from its effects. It has been shown to have a protective effect at the cardiac and renal level in reperfusion ischemia models , this efDexmedetomidine is an alpha-adrenergic receptor agonist drug and extensively used as a sedative. Dexmedetomidine protects against myocardial infarction , ischemiIsoflurane is a common volatile anesthetic in the clinic and protects against ischemic brain injury  by supprFinally, barbiturates can also reduce the severity of IRI in cardiac models . The molPotential new uses of old well-known drugs as opioids is an emerging field for kidney research. Anesthetic preconditioning is a promising strategy to reduce renal IRI, and its application on current clinical practice could be beneficial in events such as acute renal failure and kidney transplantation. Current evidence suggests that opioids provide organ protection by decreasing reactive oxygen species and inflammation. However, more experimental evidence is still needed to understand the physiological and molecular mechanisms involved in the protection of the kidney and to translate our current knowledge into clinical settings."}
{"text": "Two artisanal varieties of cheese made in Spain, one made of ewes\u2019 raw milk and the other of goats\u2019 raw milk were selected to evaluate the effect of a high hydrostatic pressure (HHP) treatment at 400 MPa during 10 min at 2 \u00b0C on the formation of biogenic amines (BA). These conditions were applied at the beginning of the ripening  and in the case of ewes\u2019 milk cheeses also after 15th days (HHP15). BA formation was greatly influenced by HHP treatments in both types of cheese. HHP1 treatments significantly reduced the amounts of BA after ripening, being tyramine and putrescine the most affected BA in goats\u2019 milk cheeses and tyramine and cadaverine in ewes\u2019 milk cheeses. The BA reduction in the HHP1 samples could be explained by the significant decrease in microbiological counts, especially in the LAB, enteroccocci and enterobacteria groups at the beginning of ripening. The proteolysis in these samples was also affected reducing the amount of free amino acids. Although proteolysis in ewes\u2019 milk cheeses HHP15 was similar than in control samples a reduction of BA was observed probably because the decrease caused on microbial counts. Biogenic amines (BA) are basic nitrogenous compounds formed in different foodstuffs due to the microbial decarboxylation of amino acids. The kind and the amount of BA formed depends on the decarboxylase capability of the bacterial strains present, the availability of substrate amino acids and the physicochemical properties of the matrix . Some arDuring cheese manufacture several factors may contribute to the accumulation of toxic amounts of BA. Good manufacturing practices to minimize the occurrence of BA-producing microorganisms in raw materials, pasteurization of milk or addition of BA-non-producing starter cultures have been suggested as BA risk mitigation options. Although it has been described that milk pasteurization reduces the level of decarboxylase-positive bacteria, later contamination of milk and curd during cheese manufacturing by decarboxylating bacteria and their subsequent growth and metabolic activity during cheese ripening usually results in BA build up ,11,12,13High hydrostatic pressure (HHP) is non-thermal processing method used to extend shelf-life of foods. This induces morphological changes and inhibition of enzymes and genetic mechanisms of microorganism . HHP offThe main objective of this survey was to evaluate HHP processing to reduce BA formation in two varieties of artisanal Spanish cheese made of raw milk from ewe and goat. Treatments were applied at different stages of ripening and the consequences of these treatments on the BA formation and proteolytic activity were evaluated during the ripening.Two types of artisanal ripened cheeses elaborated in Spain were studied in this work, both made with starter culture, enzymatic curd and pressed paste. The first one was produced from goats\u2019 raw milk in the region of Catalonia, northeast of Spain, and the second was made from ewes\u2019 raw milk in Castilla y Le\u00f3n, central Spain. Three independent batches of each type of cheese were produced following the usual manufacturing procedures used by the manufacturers.HHP treatments were performed at 400 MPa for 10 min at a temperature of 2 \u00b0C using an Alstom HHP equipment  with a 2 L pressure chamber. A mixture of alcohol and water (1:9) was used into the chamber. The pressurization rate and depressurization time were 268 MPa/min and 55 s, respectively. Before processing, goats\u2019 milk cheese samples were separated in two batches: samples not HHP treated (Control samples) and samples HHP treated before the 5th day of ripening (HHP1). In the case of ewes\u2019 milk cheese samples a third batch for samples that were treated after 15 days of ripening (HHP15) was included. In all cases a portion of about 8.0 cm diameter was obtained and shaped to adequate it to the diameter of the cylinder of the HHP equipment and then vacuum packaged. After the HHP treatments, samples were deprived of the plastic bag and kept into a ripening chamber at 14 \u00b0C and 88% of relative humidity to continue with the ripening process for 60 days. Analyses of cheeses were performed at the 5th, 15th, 30th, 45th and 60th day of ripening.Lactococcus spp. were made on M-17 agar (Oxoid) supplemented with a bacteriological grade lactose solution  and incubated at 30 \u00b0C for 48 h; Lactobacilli were determined on Man Rogose Sharpe agar  and incubated at 30 \u00b0C for 48 h; Enterococci were enumerated using KF Streptococcus Agar (Oxoid) supplemented with 2,3,5-trifeniltetrazolium chloride solution 1% (Oxoid) and incubated at 37 \u00b0C for 48 h; enumeration of Enterobactericeae was performed on Violet Red Bile Glucose Agar  and counts of Escherichia coli was made on the chromogenic selective media Coli ID  and incubated at 30 \u00b0C for 24 h; Staphylococcus aureus counts were determined on Bair Parker Agar supplemented with rabbit plasma fibrinogen  and incubated at 37 \u00b0C for 24\u201348 h.Ten grams of each sample were homogenized in 90 mL of sterile Buffered Peptone Water  with a paddle blender . Counts of WSN) fraction was obtained and determined by the Dumas combustion method [WSN fraction was expressed as a percentage of Total Nitrogen (TN), described as the Ripening Index (RI), according to the formula:Water Soluble Extracts (WSE) of cheese were prepared according to the method described by Kuchroo and Fox . From thn method . The nitl-Leucine per g of cheese.The measurement of the amino group content was determined on WSE by the Trinitrobenzensulphonic Acid method (TNBS) according to the procedure described by Hern\u00e1ndez-Herrero et al. . ResultsThe RP-HPLC method described by Eerola et al.  and modip < 0.05. Comparisons of mean values of proteolysis indexes were performed using the Student-Newman-Keuls test with the significance level set at p < 0.05. All tests were performed with the SPSS for windows (v.15.01) program .Analysis of variance (ANOVA) was performed on all data from each batch and treatment of goats\u2019 and ewes\u2019 milk cheeses at different ripening stages. Comparisons of mean values of physicochemical, microbiological and BA were followed by Duncan test with significance level set on 10 CFU/g, probably because strains of Lactococcus lactis were added as the starter culture, while lactobacilli counts were significantly lower at the beginning of the ripening, although their counts rose as the ripening progressed, achieving similar counts to lactococci. Enterococci counts remained steady at a level about 6 log10 CFU/g at the beginning of the process, showing a slight decrease around the 15th and the 30th day in the goats\u2019 and ewes\u2019 cheeses, respectively. S. aureus, enterobacteria and E. coli counts decreased during the ripening until becoming undetectable in most of the samples. These results are in agreement with those reported by other authors in other varieties of cured cheeses [In control samples (non HHP-treated) of both types of cheese, Lactoccocci was the main microbial group at the beginning of the ripening, showing counts above 8 log cheeses ,28,29,3010 CFU/g and 1.5 log10 CFU/g in the goats\u2019 and ewes\u2019 milk cheeses, respectively. In the case of lactobacilli mean reductions were 3.41 log10 CFU/g and 1.03 log10 CFU/g. However, these counts recovered along the ripening process and no statistical differences were observed at the end of the work with respect to control samples. Ewes\u2019 milk cheeses HHP15 showed a reduction of about 1.91 log10 CFU/g and 1.33 log10 CFU/g for lactoccocci and lactobacilli counts, respectively. In that case the subsequent recovery of these counts was not so clear and they did not achieve the same counts than control samples. Novella-Rodr\u00edguez et al. [10 CFU/g in goats\u2019 milk cheeses as a consequence of HHP, although a subsequent increase was found during ripening. Rynne et al. [10 CFU/g in starter and non-starter LAB in cheddar cheese treated at 400 MPa on the first day of ripening. In ovine milk ripened cheeses treated on day 1 and 15 at 300 MPa and 400 MPa proved to cause similar reductions although recovery of LAB counts was observed only in samples treated 1st day. HHP treatments also affected significantly (p < 0.05) the counts of enteroccocci in both type of cheeses in either HHP1 and HHP15 samples, being unable to recover the initial counts in any case. Arqu\u00e9s et al. [10 CFU/g in enteroccocci counts when a treatment of 400 MPa for 10 min at 10 \u00b0C was applied on the 2nd day of ripening to \u201cLa Serena\u201d cheeses, remaining constant during the rest of the ripening. Although high counts of enteroccoci have been associated with the unhygienic processing of cheese, their presence is also considered important for the development of the typical aroma and flavour of traditional Mediterranean cheeses. Their counts may range from 104 to 106 CFU/g in curds and 105 to 107 CFU/g in ripened cheeses [S. aureus HHP1 treatments also caused significant reductions in both kind of cheeses and HHP15 in ewes\u2019 milk cheeses, becoming undetectable in most cases at the last day of the work. Nevertheless, the initial counts were already quite low. Similar results were reported in \u201cLa Serena\u201d cheeses treated at 400 MPa on the 2nd day of ripening [S. aureus has been described as one of the most HHP resistant non-sporulated bacteria. L\u00f3pez-Pedemonte et al. [10 CFU/g.HHP treatments reduced significantly the Lactic Acid Bacteria (LAB) counts. In HHP1 treated samples, lactoccocci counts decreased 2.2 logz et al.  also obse et al.  reporteds et al.  reportedripening  and in Cripening . S. auree et al.  describe10 CFU/g of enterobacteria in ewes\u2019 milk cheeses after a 400 MPa treatment applied the 1st and the 15th day of ripening. Initial counts of E. coli were significantly lower than enterobacteria. O\u2019Reilly et al. [E. coli to HHP in cheeses with reductions above 6 log10 CFU/g after HHP treatments at 400 MPa.HHP treatments showed to be very effective reducing Gram-negative bacteria except for HHP1 in goats\u2019 milk cheese samples, where a slight growth was noted on the 15th day probably due to a possible recovery of the sub lethal injured cells after the HHP treatment. However, cheese ripening conditions, with low pH, increasing salt concentration and presence of LAB, made difficult this recovery to consolidate and no positive counts were detected later at the 30th and 45th days of ripening. Juan et al.  also desy et al. , Capellay et al.  and De Ly et al.  have preThe proteolytic activity parameters measured in the goats\u2019 and ewes\u2019 cheeses are presented in Significant differences between control and HHP1 samples in TNBS were observed from the 45th to the 60th days of ripening in goats\u2019 milk cheeses, while the differences in FAA content were mainly noted from day 30 to 60. In both parameters control samples showed the highest values. The ratio of RI displayed a different trend where an increment of around two times was observed during the first 15 days period in control and HHP-treated samples but after this point the proteolysis rate became slower. In the ewes' milk cheeses, an increment on the three-proteolysis index evaluated was observed during the ripening period . In the WSN is produced mainly by the rennet and to a lesser extent by plasmin or cellular proteinases, whereas starter peptidases are primarily responsible for the formation of small peptides and free amino acids [RI values indicated that proteolysis was more intense during the first 15 days of ripening in the goats\u2019 and ewes\u2019 cheeses in control and HHP treated samples. This proteolytic activity was probably caused by milk and rennet proteinases, being not so clear the role of microbial proteinases. On fact, no acids . Messensno acids  observedno acids  in a stuno acids  found inWSN/TN values than control samples, at the end of the ripening but higher than those obtained in samples with HHP-treatment on the 1st day. In contrast, some works reported after application of HHP treatments not differences on proteolysis indexes during ripening in Gouda [On ewes\u2019 milk cheeses HHP15 samples showed slightly higher values on the three-proteolysis index evaluated than control samples during the ripening period, although no significant differences were observed at the end of the ripening, reflecting that this treatment did not significantly affect the proteolysis process. However, the HHP application during the initial stages of the ripening in ovine and caprine milk cheeses led to a decrease of the proteolysis rate. Similar results were obtained by Juan et al.  who in pin Gouda  and chedin Gouda  or an inin Gouda ,42. Starin Gouda , being oin Gouda . HHP-indin Gouda  and possin Gouda  indicatein Gouda  pointed in Gouda  and Calzin Gouda  noticed in Gouda ,42 suggeEnterococcus spp. and LAB isolated from cheese samples [TY and PU were the main BA formed in untreated goats\u2019 milk cheeses, showing concentrations of about 492 and 476 mg/kg, respectively, at the end of the ripening. Whereas in ewes\u2019 milk control samples the predominant BA were TY and CA with 277 and 106 mg/kg, respectively. Several authors reported, in variable ranges, TY (88.6\u2013445 mg/kg), HIS (not detected\u2013697 mg/kg), PU 74.15\u2013446.5 mg/kg) and CA (44\u2013269.77 mg/kg) as the most abundant BA in goats\u2019 and ewes\u2019 milk ripened cheeses .5 mg/kg ,55,56. T samples ,59,60,61Enterococcus spp. also have shown this capability \u201cin vitro\u201d [Lactococcus lactis, are also able to form PU via the agmatine deiminase [PU amounts in control goats\u2019 milk cheeses were almost the same than TY but HHP1-treatments caused a decrease on the first 15 days, remaining almost stable throughout the rest of the ripening. PU levels were about 83% lower in the HHP1 samples than in control samples at the 60th day. The pressure application in ewes\u2019 milk cheeses also affected the PU amounts formed, showing that HHP1 treatments limited the production of this diamine around 93% compared with control cheeses at the end of the ripening. HHP15 showed to be less efficient reducing the formation of PU. With respect to CA, untreated and HHP-treated goats\u2019 milk cheeses displayed amounts below 100 mg/kg without appreciate significant differences between them. In control ewes\u2019 milk cheeses this diamine increased mainly during the first 15 days, while in HHPI and HHP15 cheeses remained without significant changes throughout the ripening. The amounts of TR and PHE increased during the ripening in control goats\u2019 milk cheese samples without significant differences in relation to HHP1-treated samples, while low amounts were detected in ewes\u2019 cheeses remaining practically constant during ripening and without showing significant differences between treatments. Formation of PU and CA is usually associated with Gram negative bacteria, although some strains of n vitro\u201d . Some LAeiminase . The appeiminase .Enterobacteriaceae strains able to decarboxylate histidine in diverse foodstuffs [In goats\u2019 raw milk control cheeses the concentration of HIS was very low at the beginning of ripening but increased later reaching its maximum after 45 days (18 mg/kg). No significant changes were observed until the 60th day. In HHP1-treated samples HIS showed a similar behaviour but in this case, differences were found after the 45th day displaying levels 68% lower than control samples at the 60th day of ripening. HHP1 ewes\u2019 milk cheese samples showed a reduction of 92% of HIS when compared with control samples. This treatment was more efficient than the HHP15. Diverse authors reported low HIS amounts in cheese (below 100 mg/kg), relating the production of this BA with some LAB ,56,63,64odstuffs ,67,68,69odstuffs ,59,70.In cheeses made from raw goat milk, low levels of polyamines were found at the beginning of ripening, increasing their concentration very slightly during ripening until the 60th day . HoweverThe effectiveness of HHP treatments depends on different factors, such as the type of cheese, the stage of ripening, the HHP processing conditions applied, the kind and number of microorganisms present. In this work, the use of HHP applied at the initial phases of ripening affected significantly the microorganisms responsible of forming BA, and, in consequence, reduced its content, especially of TY and PU in goats\u2019 milk cheeses and TY and CA in ewes\u2019 milk cheeses, assuring the safety of this product for the most BA sensitive consumers. As previously mentioned, HIS and TY are the BA that most frequently have been related with food-borne outbreaks, being suggested threshold values in cheese between 200\u2013400 mg/kg of HIS ,72,73 an"}
{"text": "The incidence of breast cancer and immediate breast reconstruction is on the rise particularly in the US and Western Europe. Over the last decade, implant based breast reconstructions have gained popularity. The prepectoral breast reconstruction has emerged as a novel technique, minimally invasive, preserves the chest wall anatomy while restoring body image. However, implant rippling appears to be an adverse effect associated with this technique. We have described a new grading system for rippling following prepectoral implant breast reconstruction and discussed its management. We then evaluated the new grading system in our practice. We looked at the first 50 consecutive patients who underwent prepectoral implant based breast reconstruction. In our experience, 45 patients (90%) had grade 1, 3 patients (6%) had grade 2, 1 patient (2%) had grade 3 and 1 patient (2%) had grade 4 rippling. The observed rippling was seen more often in patients with low BMI<20 and in those who had poor subcutaneous fat preoperatively (pinch test<2 cm). Prepectoral implant based breast reconstruction adds a whole new dimension to breast reconstruction. However rippling can be an undesired adverse effect associated with this technique and patients need to be informed. The current technique of creating a new breast in the pre-pectoral plane usually involves ex-vivo coverage of the breast implant with a mesh and subsequent attachment to the chest wall, preserving both the pectoralis major and serratus anterior muscles. As the breast remains in its anatomical plane animation deformity is prevented,2 postoperative pain is reported to be lower, and shoulder function is not impaired.3,4Implant-based breast reconstructions account for 40-60% of all breast reconstructions performed in the UK and approximately 75% in the United States.5 We aim to provide a new grading system for rippling with prepectoral implant breast reconstruction in order to guide its management. The prepectoral mesh forms an internal bra with the mesh implant wrap, which in turn is secured to the chest wall. Biological meshes integrate through collagen remodelling, which ultimately integrate with host tissue becoming vascularised.6 The collagen matrix in biological grafts aids in remodelling and new collagen deposition.7 Synthetic meshes create a scaffold and promote fibrous tissue growth to cover for the implant. Integration occurs via a fibroblastic reaction alongside a mild inflammatory response.8Implant rippling, however, remains a large concern.8Over time, and under the weight of the implant, the upper part of the prepectoral reconstruction atrophies. This, coupled with thinning of the collagen in the skin, can result in visible implant rippling. Indeed, subcutaneous cover influences the degree of rippling and is often less prevalent in those with a high body mass index (BMI).We have tabulated the degree of rippling  to aid w9Patients were selected for this new procedure according to the Association of Breast Surgery and the British Association of Plastic, Reconstructive and Aesthetic Surgeons\u2019 guidelines for ADM-assisted implant-based breast reconstruction. Inclusion criteria includes a body mass index (BMI) of <35 kg/m2, no previous radiotherapy, an estimated mastectomy weight of <500 g and a good subcutaneous layer (pinch test>1 cm). The technique of prepectoral implant based breast reconstruction has been described by the author previously.9,10 All patients in this series had fixed volume silicone implant with an average volume of 360 mL (range: 150-540 mL). Basic demographics of our series are noted in We looked at the incidence of rippling in our centre. All consecutive patients had prepectoral implant-based breast reconstruction using a pre-shaped Braxon\u00ae mesh: a porcine derived acellular dermal matrix (ADM) that is 0.6 mm thick.We looked at the first 50 consecutive patients who underwent prepectoral implant based breast reconstruction. In our experience, 45 patients  had grade 1, 3 patients  had grade 2, 1 patient  had grade 3 and 1 patient  had grade 4 rippling. The observed rippling was seen more often in patients with low BMI<20 and in those who low subcutaneous fat preoperatively (pinch test<2 cm). All patients with rippling were offered correction of which only 10% underwent treatment. Two patients with grade 2, One patient with grade 3 underwent lipomodelling, while the patient with grade 4 underwent exchange to a larger implant and lipomodelling.11,12 As such, there was a paradigm shift towards submuscular implant based breast reconstruction. However, over the recent years, prepectoral breast reconstruction has regained its popularity due to the problems associated with submuscular implant based reconstruction, that largely being animation deformity.3Breast cancer appears to be the most frequent cancer among women with an increase in the number of patients having mastectomy with immediate implant based reconstruction each year. Historically, subcutaneous implant based reconstruction was associated with poor cosmetic outcome including rippling and visible implant contours.12 However, the same plane gives rise to rippling, an unwanted side effect that can be observed over time. The current literature reports the incidence of rippling to lie between 0-35%  fat injections.14 Lipomodelling is often used to correct rippling and can be carried out in stages with fat harvested and stored but injected over a period of time. Along with lipomodelling, a number of adjunct procedures can be employed: if saline implants were initially used then converting to gel based implants may provide some improvement.15To avoid rippling in the patients with low BMI, Salibian 15,16 Combination of ADM and lipomodelling  restores the thickness of mastectomy skin flaps resulting in improvement in the aesthetic results.17 Finally, a capsulorrhaphy can be performed with exchange of implants along with fat injections. Based on our experience, we have developed a grading system of the implant rippling and its management depending on the grade (The addition of another ADM to the thinned out flap can provide thickness to the upper pole making the implant less visible reduce rippling.he grade .Patients with grade 2 and grade 3 rippling were corrected with lipomodelling. The fat is grafted from the patient\u2019s abdomen, thigh, or knee areas. Patients with grade 4 rippling benefit from higher volume lipomodelling with or without exchange of implant. Further follow up of the patients after the fat injections is important with re-evaluation and possible repeat of lipomodelling procedure, if necessary, in 3-6 months. This should be discussed with the patient before the first lipomodelling session to manage the patient\u2019s cosmetic expectations. 18 However, formal evaluation of this is required. Prepectoral or muscle sparing implant-based breast reconstruction is a minimally invasive method of breast reconstruction. This new technique brings a new choice in implant-based breast reconstruction with preservation of normal anatomy. However, rippling is an adverse effect associated with this technique and patients should be well informed.Indeed, further longitudinal evaluation is required to validate our results. In our series we mainly used lipomodelling while other adjuncts such as change of implants, tightening of excess skin can be offered to correct rippling. We also postulate that using an expander inflated with air may cause less tissue atrophy as it is lighter and results in less stretching of the skin.The authors declare no conflict of interest."}
{"text": "N-[2--hexyl]]-nicotinamide hydrochloride (3e) as the most promising compound with inhibitory potencies against EeAChE and EqBuChE in the low nanomolar level 67 and 153 nM, respectively. Moreover, 3e compound is non-hepatotoxic, able to inhibit amyloid beta aggregation, and shows a mix-type of cholinesterase\u2019s inhibition. The mixed type of inhibition of the compound was confirmed by molecular modeling. Then, yeast three-hybrid (Y3H) technology was used to confirm the known ligand-receptor interactions. New derivatives do not show antioxidant activity (confirmed by the use of two different tests). A pKa assay method was developed to identify the basic physicochemical properties of 3e compound. A LogP assay confirmed that 3e compound fulfills Lipinsky\u2019s rule of fiveHere we report the two-step synthesis of 8 new cyclopentaquinoline derivatives as modifications of the tetrahydroacridine structure. Next, the biological assessment of each of them was performed. Based on the obtained results we identified 6-chloro- Alzheimer\u2019s disease (AD) is the most common form of dementia and chronic, neurodegenerative disease. AD attacks the brain leading to impaired memory, thinking and behavior, mainly among the elderly. AD has been proven to be a multifactorial disease associated with several aspects including low levels of acetylcholine (ACh), formation of \u03b2-amyloid (A\u03b2), hyperphosphorylated tau aggregates, oxidative stress and so on. Genetic studies have shown that dysfunction of A\u03b2 or tau is sufficient to cause dementia. Ongoing molecular research is expected to lead to a true understanding of the disease\u2019s pathogenesis. The neuropathological alterations described above suggest that the target at these factors could create the possible and effective treatment of AD ,2.N-Methyl-d-aspartate (NMDA) receptor antagonist. Unfortunately, none of the currently available strategies can completely prevent neurodegeneration and cure AD  was tested for bait autoactivation. All negative and positive controls described in the manual of Y2H Matchmaker Gold system were performed.The Y3H method was applied to evaluate if the synthesized hybrid ligand induces in vivo the interactions between AChE and A4, BACE1A, MAO B and MAPT. Plasmids suitable for Y3H screening were prepared by Gene Universal Inc. . The company performed cDNA synthesis, molecular cloning of inserts in a proper frame as the NdeI/BamHI fragments into the pGBKT7 (ACHE) or pGADT7  vectors. Gene Universal Inc. performed also the yeast codon optimization to facilitate the high expression of human recombinant proteins in The small scale mating procedure (5mL) based on Matchmaker Gold Y2H system manual recommendations was applied to exclude the putative protein\u2013protein interactions between bait (AChE) and four preys . Obtained cell suspension was transferred on DDO agar plates to initially screen for putative protein\u2013protein interactions. DDO agar plates were supplemented with Aureobasidin A (200 ng/mL) and X-\u03b1-Gal (40 \u00b5g/mL) (DDO/X/A).Finally, a small scale mating procedure (10 mL) was performed. The mating mixture contained the hybrid ligands at the concentration of 10 \u00b5M to promote the putative ligand-mediated protein interactions. The products of mating were placed on DDO/X/A agar plates containing 10 \u00b5M of hybrid ligand. The blue colony was transferred to the more stringent QDO agar plates containing Aureobasidin A (200 ng/mL), X-\u03b1-Gal (40 \u00b5g/mL) (QDO/X/A) and hybrid ligand (10 \u00b5M) to confirm the presence of interactions. The obtained blue colony was spread on QDOX/A agar plates without the hybrid ligand to confirm that the interaction depends on the hybrid ligand. The strength of hybrid-ligand induced interactions was quantitatively evaluated by yeast \u03b2-galactosidase assay kit .ADMET  prediction was performed to estimate the risk and effectiveness of use our compound as a medicine. Calculated parameters were confronted with the values defined by the Lipinski\u2019s \u201cRule of Five\u201d. Our experimental parameters like logP and pKa (Base) were used as basic parameters to predictions. The ADMET analysis was done with the help of ACD/Percepta Version 14.0.0 .3a\u20133h were evaluated by 1, 1-diphenyl-2-picrylhydrazyl (DPPH) free-radical scavenging assay according to the method of Blois (1958) with slight modifications [50 values of test compounds were determined. Results are expressed as the mean \u00b1 SD of at least three different experiments performed in triplicate.DPPH Assay. The antioxidant activities of compounds ications . Briefly\u2022+ Assay. The ABTS\u2022+ solution was prepared by reaction of 5 mL of a 7 mM aqueous ABTS solution with 88 \u00b5L of a 140 mM potassium persulfate. After storage in the dark for 16 h, the solution was diluted until the absorbance value of 0.70 \u00b1 0.05 at 734 nm was reached. Solutions of each tested compounds were prepared in PBS (pH = 7.4). For each compound and concentration, measurements were made in triplicate with blank solutions using a microplate reader Synergy H1 (Biotek) [ABTS(Biotek) .2 before the initiation of the assay.The SH-SY5Y (human neuroblastoma) (European Collection of Cell Culture) was chosen to determine the potential neuroprotective properties of novel compounds. SH-SY5Y were grown in Ham\u2019s F12:EMEM (1:1) (Sigma Aldrich) containing 15% Foetal Bovine Serum , 2mM Glutamine (Sigma Aldrich), 100 units/mL penicillin and 100 mg/mL streptomycin  and 1% non-essential amino acids . Cells were grown in an incubator at 37 \u00b0C with 5% CO3 cells per well and cultured for 24 h in the incubator . After 24 h of cells incubation, medium was removed and cells were exposed to the 100 \u00b5L of the compound solutions over a range of concentrations ranging from 0.0001 to 10 \u00b5M or nothing but culture medium (control). After 24 h, the medium was removed and 50 \u00b5L of the MTT solution was added. Plates were incubated for additional 2 h in the incubator . Then, the MTT solution was removed and 100 \u00b5L of DMSO was added. Plates were incubated for 10 min at room temperature and 5 \u00b5L of Sorensen Buffer was added. The plate was swayed and the absorbance was measured in the microplate reader  at a wavelength of 570 nm. The cell viability was expressed as a percentage of the control values (blank). The experiments were done in triplicate [Cells were seeded in 96-well plates at the density of 5 \u00d7 10iplicate .3e against oxidative stress were determined in three different experiments. Hydrogen peroxide (H2O2) was used to generate exogenous free radicals in the first experiment. SH-SY5Y were incubated with compounds in the range of concentrations (from 10 \u00b5M to 0.01 \u00b5M) for 24 h before the addition of H2O2 (100 \u00b5M). Then, H2O2 was added and the incubation in the presence of compounds as conducted for the next 24 h. In the second and third experiments, mix of rotenone (30 \u00b5M) with oligomycin A (10 \u00b5M) (R/O) was used to cause mitochondrial reactive oxygen species. A second experiment involved \u201cpre-incubation\u201d. SH-SY5Y were incubated with 3e before the addition of the rotenone and oligomycin A mixture for 24 h. Next, the mixture was added, and cells were incubated with 3e for additional 24 h. The last experiment, \u201cco-incubation\u201d, involved adding the cells at the same time as the mixture of rotenone with oligomycin A and 3e. Incubation took 24 h. Trolox was used as a positive control. Each experiment was done three times in quadruplicates and cell death was tested by the MTT assay. Data were shown as the percentage of the reduction of MTT in regard to non-incubated cells [The neuroprotective properties of ed cells ,23.The 3-dimentional structure of synthesized compounds were drawn in Corina on-line (Molecular Networks and Altamira)  and subs3e is a dual AChE and BuChE inhibitor and a promising compound for further development. This compound is a good EeAChEI and EqBuChEI with IC50values . 3e compound shows a mixed-type of inhibition confirmed by in vitro study and molecular modeling. What is very important is that 3e derivative are non-hepatotoxic, show low antioxidant activity, and have the ability to inhibit A\u03b2 aggregation. The results of ADMET prediction and LogP assay, which confirmed the fulfillment of Lipinsky\u2019s rule of five, shows a good pharmacokinetics and future potential use in medicine. Moreover, we conducted an innovative study\u2014a yeast three-hybrid technology (Y3H) which is an extension of the two-hybrid system (Y2H). In the Y2H, the interaction between two hybrid proteins activates the expression of reporter genes facilitating the yeast cells to grow on particular selective media [To sum up, a novel series of eight cyclopentaquinoline derivatives were designed, synthesized, and evaluated as potential multifunctional compounds for the AD therapy. In vitro studies concerned their ability to inhibit AChE and BuChE. The results demonstrated that compound ve media ,43. In tve media ,45,46,47"}
{"text": "Some polyphenols are known to improve the symptoms of diabetes. In the present study, we investigated the effects of a polyphenol-rich extract of maple syrup (MSx) on a diabetic mouse model.Ay mice were fed a normal or 0.05% MSx-supplemented diet for 42\u2009days. Body weight, food intake, serum biochemical parameters, and fecal total bile acid were measured. Gene expression of liver and epididymal white adipose tissue (WAT) and cecal microbiota were analyzed. Data were analyzed with an unpaired two-tailed Student\u2019s t test or Welch\u2019s t test according to the results of the F test.KK-Serum low-density lipoprotein cholesterol levels were significantly reduced in mice that consumed MSx. Hepatic genes related to fatty acid degradation and cholesterol catabolism were upregulated in mice that consumed MSx. In contrast, the expression of genes related to lipid metabolism in WAT was unaffected by the intake of MSx. There were no significant differences between the two groups in terms of total bile acid level in the feces and the relative abundance of bacteria in the cecum.Our results primarily indicate that MSx can help alleviate one of the symptoms of dyslipidemia. Ay mice, a model for type 2 diabetes accompanied by obesity, and acacia polyphenols improved dyslipidemia and insulin resistance in KK-Ay mice [The increasing prevalence of diabetes is a global problem . Diabete-Ay mice , 4.Acer saccharum, which contains a large number of polyphenols [Maple syrup is a sweetener made from the sap of the sugar maple tree, yphenols . A butanyphenols . Inhibityphenols . In our yphenols . Maple syphenols .Ay mice and fed them an ethanol extract of maple syrup (MSx) containing 15.02% polyphenols as gallic acid equivalents for 42\u2009days. Then, serum biochemical parameters related to nutrient metabolism, gene expression profiles of liver and epididymal white adipose tissue (WAT), and composition of intestinal bacteria were evaluated to determine the effects of MSx on nutrient metabolism, with the results demonstrating that MSx alters lipid metabolism.Based on the above reports, we speculated that maple syrup, particularly its polyphenol-enriched extract, could alleviate chronic hyperglycemia in individuals with diabetes. In the present study, we used KK-MSx prepared from Canadian maple syrup (Canada No. 2/Amber) by SiliCycle Inc.  was purchased by the Federation of Quebec Maple Syrup Producers  . BrieflyAy mice 4\u2009weeks of age were purchased from CLEA Japan . The mice were individually housed in a room maintained at a temperature ranging from 21 to 23\u2009\u00b0C with 50\u201370% relative humidity and a 12:12-h light/dark cycle. Normal and 0.05% MSx-supplemented diets were prepared based on the AIN-93G formula by Oriental Yeast Co.  (Table\u00a0n\u2009=\u20098 each) with approximately equal mean body weights. Mice were fed the normal or MSx diet for 42\u2009days and were allowed free access to the diet and ultrapure water during this period. Body weight and food intake were measured every 2\u2009days. Feces were collected on days 36\u201338 of the testing period and were stored at \u2212\u200980\u2009\u00b0C until use. After 16\u2009h of food deprivation, mice were sacrificed under sodium pentobarbital anesthesia. Blood was collected from the heart chamber and centrifuged at 830\u00d7g for 10\u2009min for serum isolation. The liver was treated with RNAlater . Epididymal WAT and cecum contents were immediately frozen in liquid nitrogen. All samples were stored at \u2212\u200980\u2009\u00b0C until use.Male KK-Eight serum biochemical parameters, including glucose, glycated albumin, total cholesterol, low-density lipoprotein (LDL) cholesterol, high-density lipoprotein cholesterol (HDL), triglycerides, nonesterified fatty acids (NEFA), and total ketone bodies, were measured on a 7180 Clinical Analyzer  by Oriental Yeast Co. Serum insulin and tumor necrosis factor (TNF)-\u03b1 levels were measured with a Mouse Insulin ELISA Kit  and a Mouse TNF-\u03b1 Quantikine ELISA Kit , respectively. Homeostasis model assessment of insulin resistance (HOMA-IR) was calculated using the following formula:HOMA-IR\u2009=\u2009insulin (ng/ml)\u2009\u00d7\u200926 \u03bcIU/ml\u2009\u00d7\u2009glucose (mg/dl).Total cholesterols were isolated as total lipids from the liver according to the Folch method  and its t test or Welch\u2019s t test according to the results of the F test. Differences were considered significant at P\u2009<\u20090.05.Data were analyzed with the unpaired two-tailed Student\u2019s Total RNA was isolated from the liver and WAT with TRIzol Reagent (Thermo Fisher Scientific Inc.) and was purified with an RNeasy Mini Kit and RNase-Free DNase Set . Total RNA concentration was measured on a spectrophotometer. RNA integrity was evaluated with an Agilent RNA 6000 Nano Kit and on an Agilent 2100 Bioanalyzer  and RNA Integrity Number was confirmed greater than 8.0. cRNA was prepared from purified 100\u2009ng total RNA with the GeneChip 3\u2032 IVT PLUS Reagent Kit and hybridized to a GeneChip Mouse Genome 430 2.0 Array (Thermo Fisher Scientific Inc.). The array was stained using a GeneChip Hybridization, Wash and Stain Kit and a GeneChip Fluidics Station 450 (Thermo Fisher Scientific Inc.). The fluorescence signals of the probes were scanned with a GeneChip Scanner 3000 7G (Thermo Fisher Scientific Inc.) and converted to an intensity value with Affymetrix GeneChip Command Console software (Thermo Fisher Scientific Inc.).p value [p value using the Benjamini and Hochberg method [The intensity values of probe sets were normalized by the distribution-free weighted method in the case of liver and by the quantile normalization factor analysis for robust microarray summarization method in the case of WAT , 13. Datp value . FDR wasg method . GO termg method . DEGs ang method . Ensemblg method .http://primer3.ut.ee/) and these sequences are shown in Additional\u00a0file\u00a0ctin, beta (Actb) whose expression showed the smallest differences between the two groups among 5 housekeeping genes. PCR reactions were performed with 3 technical replicates for each gene. DNA contamination was not detected.Total RNA 1\u2009\u03bcg) isolated from the liver as described above was reverse transcribed with a SuperScript IV VILO Master Mix (Thermo Fisher Scientific Inc.). The synthesized cDNA (1\u2009ng) was amplified in a 10-\u03bcL reaction volume with a PowerUp SYBR Green Master Mix (Thermo Fisher Scientific Inc.) on a CFX Connect Real-Time PCR Detection System with CFX Maestro 1.1 software  under the following conditions: 50\u2009\u00b0C for 2\u2009min, 95\u2009\u00b0C for 2\u2009min, and 40\u2009cycles of 95\u2009\u00b0C for 15\u2009s and 60\u2009\u00b0C for 1\u2009min. Primers were designed with Primer3web v.4.1.0  using a modified terminal restriction fragment length polymorphism (T-RFLP) method . BrieflyAy mice were fed a normal diet with or without 0.05% MSx for 42\u2009days. Feces were collected on days 36\u201338. After fasting, mice were sacrificed, and serum samples were obtained. Values for physical and biochemical parameters are shown in Table\u00a0To examine the effect of MSx on diabetes, KK-To examine changes in cholesterol metabolism, we performed a hepatic transcriptome analysis using the DNA microarray technique. There were 272 and 265 DEGs that were up- and downregulated, respectively, in the MSx group compared to the expression levels in the control group (FDR\u2009<\u20090.001). A total of 537 DEGs were annotated with GO terms to categorize their function. DEGs were shown to be related to lipid metabolism  and the immune system  (Table\u00a03-hydroxy-3-methylglutaryl-coenzyme A synthase 2 (Hmgcs2), encoding the rate-limiting enzyme in the ketogenesis pathway, was upregulated. These results suggest that fatty acid degradation is accelerated by the intake of MSx. All DEGs mapped to the cholesterol catabolic pathway were upregulated in the MSx group. Moreover, cytochrome P450, family 7, subfamily a, polypeptide 1 (Cyp7a1), encoding the rate-limiting enzyme, was included among the DEGs mapped to the pathway. This result suggests that cholesterol catabolism was stimulated by the intake of MSx.To examine the effect of MSx on lipid metabolism, we mapped DEGs annotated with GO terms related to lipid metabolism in four KEGG pathways as follows: mmu00071 fatty acid metabolism, mmu00100 steroid biosynthesis, mmu00120 primary bile acid biosynthesis, and mmu00072 synthesis and degradation of ketone bodies. We integrated the KEGG pathways into a single metabolic pathway , Hmgcs2, and cytochrome P450, family 8, subfamily b, polypeptide 1 (Cyp8b1) showed significant differences between the two groups  and serum amyloid A 1/ 2/ 4 (Saa1/ 2/ 4) are synthesized in the liver in response to inflammatory cytokines [Inflammation leads to the aggravation of diabetes symptoms by activating the immune system . To examytokines . These DThe hepatic gene expression profile suggested that lipid catabolism increased with the intake of MSx. A gene expression analysis of WAT was performed to examine the effect of MSx on lipid metabolism in the tissue. There were 241 and 298 DEGs that were up- and downregulated, respectively, in the MSx group compared to the control group (FDR\u2009<\u20090.02). A total of 539 DEGs were annotated with GO terms. DEGs related to lipid metabolism were not distinctly presented (Table\u00a0The gut microbiota is reported to affect host lipid metabolism . Therefop\u2009=\u20090.23). Thus, MSx intake may cause the use of acetyl-CoA for ketogenesis rather than cholesterol synthesis, resulting in a decrease in serum LDL cholesterol levels. The enhanced ketone body production in diabetic patients is caused by the promoted utilization of fatty acids as an energy substrate due to the impairment of glucose utilization. However, there were no significant differences between the two groups with respect to the levels of serum glycated albumin, glucose, or insulin. This result indicates that MSx intake does not aggravate diabetic symptoms. Detailed research is needed to understand the mechanism of the underlying effect.According to the results of this study, dietary intake of MSx alters lipid metabolism Fig. . The serAy mice. The results of qRT-PCR analysis were also affected by an individual difference, especially C1 in the control group. The effects of MSx intake on lipid metabolism of KK-Ay mice will be accurately revealed by increasing sample size.Various parameters  in this study showed the large variance, which may be derived from an individual difference of KK-Ay mice, the catabolism of lipoproteins such as VLDL and LDL is suppressed due to insulin resistance, resulting in the elevation of these lipoprotein cholesterol levels in blood [In the context of diabetes, including in KK-in blood , which iUsing gene expression analysis of the liver and WAT, this study showed the possibility that MSx intake may affect the immune system. However, the results demonstrating the effect of MSx intake at the protein level could not be shown. Thus, further study is required to understand the effect of MSx intake on the immune system.The present study examined the effect of MSx intake in obese diabetic mice. The intake of MSx does not influence chronic hyperglycemia, but it reduces the LDL cholesterol level. Hepatic gene expression analysis suggested that the intake of MSx promotes cholesterol catabolism, although further studies are required to identify the detailed mechanism underlying the reduction in LDL cholesterol levels. Our findings provide evidence that MSx contributes to alleviating one of the symptoms of dyslipidemia.Additional file 1. Primer information.Additional file 2. GO terms and annotated DEGs in the liver. Up and down represent DEGs that were up- and downregulated, respectively, in mice fed MSx compared to the levels in controls. Fold change was calculated from the expression value of each probe normalized by the Affymetrix Micro Array Suite 5.0 method.Additional file 3. DEGs related to the immune system in the liver. Down represents DEGs that were downregulated in mice fed MSx compared to the levels in controls.Additional file 4. GO terms and annotated DEGs in WAT. Up and down represent DEGs that were up- and downregulated, respectively, in mice fed MSx compared to the levels in controls. Fold change was calculated from the expression value of each probe normalized by the Affymetrix Micro Array Suite 5.0 method."}
{"text": "A minority of patients have a late-onset form of disease that presents from late-childhood to adulthood and has a slowly progressive course with prolonged survival.The GM2 gangliosidoses (GM2), Tay-Sachs and Sandhoff diseases, are rare, autosomal recessive genetic disorders caused by mutations in the lysosomal enzyme \u03b2-hexosaminidase A Little research has been published documenting patient experiences with late-onset Tay-Sachs and Sandhoff diseases and how the disease impacts their daily lives and functioning. This study explored the most frequent symptoms and functional impacts experienced by patients with late-onset GM2 gangliosidosis through interviews with patients and caregivers.A qualitative research study design was employed, using three focus groups and 18 one-on-one interviews with patients who were recruited at the National Tay-Sachs and Allied Diseases Annual Family Conference. Transcripts were generated from the discussions, and patient quotes were analyzed using a content analysis approach. Concepts were aggregated into symptom and functional impacts, and the frequency of mention in the focus groups and individual interviews was calculated.n\u2009=\u200919, 95%), \u201cclumsy\u201d gait , fatigue ] and impacts  disclosed by patients and caregivers were similar to those previously reported in the literature. However, less frequently described symptoms such as gastrointestinal issues  and coughing fits  have been expanded upon. This study evaluated the immediate impact of these symptoms on the patients\u2019 lives to highlight the burden of these symptoms and the functional limitations on daily living activities, independence, and emotional well-being. The findings were used to develop a conceptual disease model that could serve as a foundation for patient-centered outcomes in clinical trials and provide insights to the medical community that may benefit patient care.Many of the frequently described symptoms [muscle weakness (This study contributes to the current understanding of symptoms associated with late-onset GM2 gangliosidosis, and further identifies the many consequences and impacts of the disease. These symptoms and impacts could be measured in clinical trials to examine the effects of novel treatments from the patient perspective. HEXA) or \u03b2 subunit (HEXB), respectively, of the two \u03b2-hexosaminidase isoenzymes, hexosaminidase A (\u03b1\u03b2) and hexosaminidase B (\u03b2\u03b2). Tay-Sachs disease is caused by a deficiency of \u03b2-hexosaminidase A activity, whereas Sandhoff disease results from a combined deficiency of \u03b2-hexosaminidase A and B activities. The reduced ability of patients\u2019 cells to catabolize GM2 ganglioside leads to progressive lysosomal accumulation of GM2 and related glycolipids, hence their classification as GM2 gangliosidoses  and just kind of like give up. Some people just say \u2018Huh? Huh?\u2019 \u2026 He\u2019ll order a lager and they give him a water and he\u2019ll get annoyed\u201d .Embarrassment was centered on symptoms, such as muscle weakness, gastrointestinal issues, and coughing, as well as impacts such as falling and going out. One patient was embarrassed by how muscle weakness prevented him/her from being able to stand up to use the bathroom, stating \u201cthat\u2019s really bad for my psyche and ego \u2026 I wear \u201cDepends\u201d and I have my help clean it up at night\u201d (Interview #4). One patient mentioned that the frequent coughing was embarrassing as it caused a lot of unwanted concern from others, particularly when \u201cgoing out to eat and then you eat and you\u2019re either\u2026you start that cough and people think you\u2019re constantly choking\u201d (Interview #13).A number of patients were worried about disease progression and worsening symptoms. After a bad fall that resulted in a broken patella, one patient was worried, stating \u201cI was scared I would never walk again\u201d (Interview #14). Though some patients were worried about falling, another patient specified that his/her fear was not of falling, but of not being able to get up again. Lastly, the fear of the future and how quickly the disease might progress was a tangible concern, and a patient stated that \u201cI\u2019ve noticed over the last probably six months that I\u2019m definitely starting to progress\u2026not quickly, but much quicker than I have in the previous four to five years\u201d (Interview #16). What was even more concerning for this patient was that it would be many years before he/she would be able to collect a disability check, and \u201cI don\u2019t know if I\u2019m going to be able to make it that far\u201d (Interview #16).Patients were acutely aware of the effect that late-onset GM2 gangliosidosis has on other people. They felt that their disease is burdensome to others and that these feelings made it difficult for them to proactively engage with other people. Difficulty communicating was reported in 11 interviews (55%) and affected communication with family, friends, and strangers. Despite patients\u2019 best efforts to communicate, \u201csome people won\u2019t take the time to try and listen\u201d (Interview #6).Due to the actual and perceived social hurdles, patients and caregivers felt that their disease negatively impacted relationships as \u201cfriends, family, everything, his whole life was affected by this\u201d (Interview #6). Engaging in romantic relationships was difficult, particularly for one patient who \u201cused to be engaged and it never worked out because she couldn\u2019t handle my condition\u201d (Interview #4). Another patient mentioned that having the disease was very challenging for his/her self-esteem to handle having \u201csuch a difficult diagnosis, looking for a partner. Most women, they\u2019ll run for the hills when they see that\u201d (Interview #11). One patient felt socially isolated due to limited mobility, stating \u201cI can\u2019t dance at weddings. When people go to weddings and they are getting up to do the Hora or whatever, I am not and I am not too happy about that. My girl got married two years ago and I was sitting down. My husband danced, but I could not dance\u201d (Patient Focus Group #1).Most patients were unable to work in the career of their choice due to the physical limitations of the job, communication obstacles, or financial constraints. Six patients (30%) reported that the disease affected their productivity, as muscle weakness affected jobs that ranged from physical labor \u2013\u201cI just could not handle the climbing up and down in the truck all day long\u201d (Interview #15) to fine motor skills \u2013 \u201cHe had problems with the weakness and typing in the computer\u201d (Interview #14). A caregiver stated that due to the patient\u2019s worsening speech difficulties, \u201cshe ultimately lost her job. \u2026 So rather than having a career in marketing, she\u2019s a cashier at a supermarket. \u2026. Her career is no longer an option for her\u201d (Interview #8). Lastly, patients had few opportunities available as the job needed to meet certain requirements, such as \u201cI have to get a job that I could do in my wheelchair. And I have to get a job that\u2019s close enough to home for me \u2026 That dictates where I can work\u201d (Interview #1).n\u2009=\u200910, 50%). Being unable to work caused financial difficulties and many patients needed to live with their parents for symptom and financial support. As one patient was unable to work a full-time salaried job and was on disability, her caregiver stated that \u201cThe disability only allows her to make a certain amount of money a month, which limits whatever kind of job she can get. \u2026 She could no longer afford to support herself\u201d (Interview #8). Due to their disease symptoms, patients often had to purchase specialty items, such as an electric chair to navigate stairs, and others made changes to their homes such as \u201cput[ting] a foam floor on the top of a packed \u2026 floor, so when she falls, it\u2019s not as bad\u201d (Caregiver Focus Group). When a patient mentioned in a focus group that \u201cI will have to sell my house and move to a one level eventually\u201d (Patient Focus Group #1), others also echoed the need to move to a more accommodating residence. Since some patients required non-medical services, such as a trainer or nursing service, these were not covered by health insurance and required out-of-pocket payment. Patients were acutely aware of the amount of money they earned in order to remain eligible for Medicaid, which was necessary as \u201cprescriptions are over $1,000 a month, so I can\u2019t be without Medicaid\u201d (Interview #1).Patients and caregivers were significantly impacted financially due to disease management or securing their future financial stability. Patients expressed an overwhelming concern about being eligible for or staying on disability (n\u2009=\u20093) and speech and walking (n\u2009=\u20092 each). For treatment, four patients each felt that preventing disease progression and being able to walk would be the most important treatment benefits. A meaningful improvement in symptoms would be reducing muscle weakness (n\u2009=\u20094), improving the ability to communicate, improving clarity of speech, and not needing to use a wheelchair (n\u2009=\u20092 each). Overall perspectives are presented in Tables\u00a0Patients were asked to consider what the most bothersome symptoms of late-onset GM2 gangliosidosis were and which were the most important to treat. Due to time constraints, not all patients were asked these questions. Five patients felt that the most bothersome symptom was muscle weakness, followed by lack of independence . Caregivers noted that many patients experienced frustration in their inability to self-care, help their caregivers around the household, and move independently. One caregiver stated that, \u201cI think the biggest problem [he] had was stopping driving. That was his last vestige of independence. It didn\u2019t matter that he was in a wheelchair\u201d (Caregiver Focus Group). With the progression of disease over time, caregivers expressed that patients felt increasingly isolated as a result of their reduced ability to express themselves or actively engage with others in social situations.The aspects of late-onset GM2 gangliosidosis perceived by caregivers to be most burdensome for patients were the lack of independence, impact on self-esteem, and muscle weakness, confirming patient reports that muscle weakness was among their most bothersome symptoms. Caregivers noted that the lack of independence and impact on self-esteem were often linked. For one caregiver, the patient who he/she cared for \u201cfeels he is a burden. It doesn\u2019t matter what I say or do. I can\u2019t seem to help him overcome that lacking that he has\u201d (Caregiver Focus Group).A conceptual model Fig.  was deveThis study used a semi-structured interview method that consisted of focus groups and one-on-one interviews to elicit patient perspectives (complemented by caregivers\u2019 views) on the symptoms and functional limitations experienced by patients with late-onset GM2 gangliosidosis. A conceptual model was developed to capture the relationship between symptoms, functional limitations, and other impacts of the disease. As no instruments exist that specifically measure the impact of late-onset GM2 gangliosidosis on the patient experience, this conceptual model may be used to develop new disease-specific clinical outcome assessments (COAs) and inform clinical trial and registry designs.7,8 In both late-onset Tay-Sachs and Sandhoff diseases, patients described their balance and frequent falling as being \u201cclumsy\u201d (Patient Focus Group #2). Development of a broad-based ataxic gait that made walking difficult is well-documented, and this study captured various adaptations by patients, including assistive devices, specialty adaptations to the home, and changes to gait to assist with mobility.Patients mentioned experiencing symptoms of muscle weakness and muscle tremors, as well as altered speech , all of which are cited as being more apparent in the first decade of disease manifestation, indicating underlying neurologic problems.Some of the symptoms of late-onset GM2 gangliosidosis disclosed by patients and caregivers in this study are similar to those reported elsewhere, particularly problems with balance and walking, muscle weakness, and cognitive function , 10. HowThe main strength of this study is the patient-centered approach, which focused on generating a representative view from patients and caregivers. Considering the rarity of the disease, a relatively large sample size of 20 patients was attained. The qualitative study design involved both focus group and individual interviews, which minimized any potential limitations that may exist with either method of data collection alone. Data saturation was achieved with the patient interviews, and the caregiver group corroborated the most salient concepts. The consistent input from participants supports the likelihood that the perspectives documented here are representative of patients with late-onset GM2 gangliosidosis. However, it is possible that since the population of this study was drawn from people who attend a disease-specific patient advocacy conference, they may differ from other patients with late-onset GM2 gangliosidosis. Nevertheless, the opportunity to use national patient/family meetings to collect qualitative data from a broad spectrum of patients and caregivers is an important one and represents a patient-centered approach that recognizes patients as the experts of their conditions.The limitations of this study are those that are common to similar studies in a population of patients with a rare disease, especially one that has limited peer-reviewed literature. The retrospective nature of the research, the self-reporting by parents and other family members, and the presence of disease-related features makes it difficult to exclude recall bias and ascertainment bias. As this study was not designed to evaluate subgroups such as gender or age, there may be different experiences of the disease across populations. Additionally, there were only four patients with late-onset Sandhoff disease who participated in the study, and thus the findings may not fully reflect the experiences of all patients with late-onset Sandhoff disease. However, the four patients with late-onset Sandhoff disease who participated in this study largely reported similar experiences to what was reported by patients with late-onset Tay-Sachs disease. Clinically, late-onset Tay-Sachs and Sandhoff diseases are considered as one entity.This research has demonstrated that patients experience many consequences of the symptoms of their disease, some of which have a direct impact , while other, more indirect impacts, extend over a longer term . The symptoms with the most impact present viable opportunities for evaluation as possible primary or secondary endpoints in late-onset GM2 gangliosidosis clinical trials. Patients were most frustrated by their muscle weakness, lack of independence, altered speech, and lack of/limited mobility, and many expressed a desire to improve these symptoms. In more advanced states of the disease, speech becomes more burdensome for patients as communication becomes more difficult. The conceptual model will be validated in a future study and can provide insight to the medical community. In addition, a repeated measures approach could be useful in order to better understand the trajectory of the condition and how patients are impacted by and cope with it over time.There is a clear need for additional support and solutions for patients that would enable more independence and management of their own lives. Research into ways to enable patients to move more independently, especially in moderate to advanced disease stages, as well as being able to communicate more effectively, would strongly improve patients\u2019 quality of life by enabling them to be mobile, better understood, and independent.This study revealed that patients with late-onset GM2 gangliosidosis experience difficulties with walking, balance, and communication that limit many aspects of their lives, from relationships to career choices. The findings and development of this preliminary conceptual model may prove useful to the recognition or development of instruments that will optimally measure relevant clinical outcomes in clinical trials, registries, or other studies. In the long term, these findings are an important contribution to the current understanding of patients\u2019 and caregivers\u2019 experiences with late-onset GM2 gangliosidosis and may lead to the introduction of interventions designed to better support patients.Sanofi Genzyme collaborated with the National Tay-Sachs and Allied Diseases (NTSAD) patient association in the United States (US) to identify potentially eligible patients and to conduct the interviews. Adult patients with late-onset GM2 gangliosidosis and their caregivers were recruited through their attendance at the NTSAD Annual Family Conference in 2015 and/or 2018. No other screening was conducted to determine eligibility for participation.The protocol, informed consent form, and relevant supporting information were submitted for review and approved by Schulman IRB and Advarra IRB. The study was conducted in accordance with the ethical principles outlined in the Declaration of Helsinki and consistent with Good Clinical Practice and applicable regulatory requirements.Informed consent was obtained in writing from interested patients and caregivers prior to participation in the focus groups and individual interviews. To preserve patient confidentiality, all transcripts and audio recordings were de-identified and no personal identifying information was collected.A qualitative research design using semi-structured focus group and individual interviews with patients and caregivers was adopted to elicit multiple perspectives on each topic . In 2015Each focus group comprised between five and seven participants. To ensure homogeneity between focus group participants, the GM2 gangliosidosis patient groups differed by age distribution, time since diagnosis, and living situation: one group with older and more advanced patients (Patient Focus Group #1), and the other one (Patient Focus Group #2) with primarily younger patients diagnosed within the previous 5\u00a0years and living alone or with parents. The sessions were audio recorded with participant permission to capture the discussion verbatim in the transcripts in order to be analyzed a posteriori. The patient focus groups were designed to improve the understanding of the signs, symptoms, and burden of disease by obtaining the views directly from the perspective of patients with late-onset GM2 gangliosidosis. To further confirm the symptoms and impacts that were experienced by patients, a single focus group interview was held with seven caregivers of some of these patients. This focus group was designed to expand upon the concepts spontaneously elicited by patients and obtain information on concepts that were not fully discussed with patients.In 2018, 18 interviews were conducted with patients with late-onset GM2 gangliosidosis, nine of whom had also participated in the 2015 focus group interviews. All of the interviews were conducted one-on-one, with the exception of five patients who were interviewed with their caregivers assisting in communicating the full breadth of their experience. The interviews lasted approximately 75\u2009min and the goal was to confirm the most salient symptoms and impacts for patients with GM2 gangliosidosis.Data were pooled across the 2015 and 2018 interview cohorts to describe the symptoms and functional limitations of GM2 gangliosidosis. While this included data from the nine patients who participated in both the focus group and individual interviews, their 2018 data was retained in the analysis because the one-on-one interviews provided a more in-depth assessment of their experiences. There also was the possibility that patient experiences may have changed in the three-year period between the interviews. The initial analytic step involved repeatedly listening to recordings and reading transcripts while taking notes, and comparing the recordings and transcripts with the minutes made during the focus group sessions. Meaningful information was organized into themes that described and categorized the possible observations. De-identified interview transcripts were reviewed and analyzed in ATLAS.ti 8 software using content analysis techniques to extract meaningful themes and concepts. The frequency with which themes and concepts were mentioned was the primary method for establishing the salience of their relevance to GM2 patients. The transcript from each focus group was treated as a single patient in analysis, as it was not possible to distinguish the identities of individual speakers from the focus group transcripts.Concept saturation was assessed to ensure that the number of interviews was sufficient to confirm that all of the most relevant concepts related to the late-onset GM2 gangliosidosis patient experience were identified."}
{"text": "Drosophila recapitulates many previous findings about gene duplication in this lineage, showing that new functions often emerge rapidly and asymmetrically in younger duplicate gene copies, and that functional divergence is driven by strong natural selection. Hence, CLOUD represents a major advancement in classifying retention mechanisms and predicting evolutionary parameters of duplicate genes, thereby highlighting the utility of incorporating sophisticated statistical learning techniques to address long-standing questions about evolution after gene duplication.Learning about the roles that duplicate genes play in the origins of novel phenotypes requires an understanding of how their functions evolve. A previous method for achieving this goal, CDROM, employs gene expression distances as proxies for functional divergence and then classifies the evolutionary mechanisms retaining duplicate genes from comparisons of these distances in a decision tree framework. However, CDROM does not account for stochastic shifts in gene expression or leverage advances in contemporary statistical learning for performing classification, nor is it capable of predicting the parameters driving duplicate gene evolution. Thus, here we develop CLOUD, a multi-layer neural network built on a model of gene expression evolution that can both classify duplicate gene retention mechanisms and predict their underlying evolutionary parameters. We show that not only is the CLOUD classifier substantially more powerful and accurate than CDROM, but that it also yields accurate parameter predictions, enabling a better understanding of the specific forces driving the evolution and long-term retention of duplicate genes. Further, application of the CLOUD classifier and predictor to empirical data from  Gene duplication is a mutational process that creates copies of existing genes. Experimental studies in several diverse species have revealed that duplication occurs faster than all other types of spontaneous mutation , thus seYet, the evolutionary path leading from gene duplication to functional innovation remains unclear. According to traditional evolutionary models , gene duOn the other hand, genomic studies from the past two decades show that the duplication process itself can often generate a child copy that is distinct from its parent copy . A key eDue to their vastly different evolutionary forces and functional outcomes, differentiating among duplicate gene retention mechanisms is critical to understanding how gene duplication drives phenotypic innovation. Accordingly, many studies have tackled this problem through applications of comparative  and modeDrosophila , making it applicable to a wide range of single- and multi-cellular biological systems.Though OU processes have been used to model expression evolution of single-copy genes , they haosophila  recapituDrosophila. First, we introduce our OU framework for modeling expression evolution after gene duplication, which forms the basis of the CLOUD classifier and predictor. Next, we formally define the multilayer neural network architecture implemented by CLOUD for both classification and prediction tasks. We then employ simulations to evaluate the relative classification powers and accuracies of CDROM and CLOUD across a wide range of parameters, as well as in more targeted regions of the parameter space. We also use these simulations to probe its accuracy in predicting parameters driving gene expression evolution after duplication, specifically its ability to estimate optimal gene expression, selection strength, and phenotypic drift for each of the classified retention mechanisms. Last, we apply CLOUD to empirical data from Drosophila . We assumed two hidden layers when training and testing CLOUD, as this resulted in the best cross-validation performance . Our training set consisted of 50,000 observations, of which 10,000 were simulated under each class. We trained CLOUD on these data, and explored evolutionary parameters drawn on a logarithmic scale across many orders of magnitude. Specifically, we independently drew the five parameters er CDROM  to the sAnalysis of the resulting classifications reveals that CLOUD generally has substantially higher power A and acc\u03b1 and \u03b1) or random phenotypic drift is weak  and phenotypic drift is strong  to make predictions for each of the five parameters (\u03b1), which are more precise than those of phenotypic drift  or phenotypic drift is weak  or phenotypic drift becomes stronger (larger \u03b1 and \u03b1 and \u03b1) with weak phenotypic drift  with strong phenotypic drift . As for the trained CLOUD classifier and predictor, we assumed m\u2009=\u20096 tissues, and explored all possible distinct scenarios in which k tissues shared one mechanism and m \u2212 k tissues shared a different mechanism. For each setting, we evaluated 1,000 independent replicate test data sets, with tissue model parameters drawn from the same wide distributions as in the training data set.We showed that under ideal settings, CLOUD is a superior classifier to CDROM, and is also adept at predicting underlying evolutionary parameters. Thus, we next explored the performance of the trained CLOUD classifier and predictor on test data generated under scenarios that violated model assumptions of the training data. In particular, we considered test data in which the duplicate gene retention mechanism was non-uniform across the simulated tissues. Specifically, we evaluated scenarios in which Comparisons among these diverse scenarios illustrates that the classification performance of CLOUD is dependent on a combination of the difference between flexibilities in model parameters of the two retention mechanisms and the numbers of tissues sharing each retention mechanism  online. \u03b1 for the setting of three \u201cConserved\u201d and \u201cSubfunctionalized\u201d tissues  compared to those classified as conserved or subfunctionalized  estimates were shifted toward higher values for retention mechanisms in which there were acquisitions of new functions  relative to those in which ancestral functions were preserved  L2-norm regularization when \u03b3 \u2009=\u2009 0, L1-norm regularization that incorporates feature selection when \u03b3\u2009=\u20091, and both types of regularization when To prevent overfitting, we include an elastic net-style regularization penalty term  on the wi is from class k, and 0 otherwise. Hence, all output values are zero except for that corresponding to class k, which has a value of one. Based on this output, we employ the loss function used in In the classification problem, for training observation deviance \u2112(y^(i),kth parameter value from simulated replicate i. Based on this output, we employ the loss function used in In the prediction problem, 4 observations from each of the five classes, for a total of N\u2009=\u200950,000 training observations. We assumed that tissues were independent, and that there were a total of m\u2009=\u20096 tissues as in an empirical data from Drosophila  and the second is only present in one species (child). Quantile-normalized gene expression abundances for carcass, female head, ovary, male head, testis, and accessory gland tissues in D.\u00a0melanogaster and D.\u00a0pseudoobscura were obtained from the Dryad data set associated with https://doi.org/10.5061/dryad.742564m. In that study, paired-end RNA-sequencing reads were downloaded from modENCODE (https://www.modencode.com, and aligned to reference transcriptomes of each species with Bowtie 2 (We applied CDROM and CLOUD to empirical data consisting of py genes  and theipy genes . In part species , was dowodENCODE  at httpsBowtie 2 . AbundanBowtie 2  were calBowtie 2 , quantilN\u2009=\u200950,000 observations as described in subsection Training the neural network on data simulated from OU processes above. Gene expression data from single-copy genes in Drosophila (L\u2009=\u20092 hidden layers, and through five-fold cross-validation (Because CLOUD requires estimates of th MACSE , which ath MACSE  for eachth MACSE . The emposophila  were uselidation , estimatMolecular Biology and Evolution online.www.flybase.org, modENCODE at https://www.modencode.com, and Dryad at https://doi.org/10.5061/dryad.742564m.The data underlying this article were derived from sources in the public domain: FlyBase at https://msaa267_Supplementary_DataClick here for additional data file."}
{"text": "Loligo vulgaris among two closely related and less valuable species. The assay, coupled to rapid genomic DNA extraction, is suitable for large-scale screenings and on-site applications due to its easy procedures, with fast (30 min) and visual readout.A colorimetric assay, exploiting the combination of loop-mediated isothermal amplification (LAMP) with DNA barcoding, was developed to address the authentication of some cephalopod species, a relevant group in the context of seafood traceability, due to the intensive processing from the fishing sites to the shelf. The discriminating strategy relies on accurate design of species-specific LAMP primers within the conventional 5\u2019 end of the mitochondrial COI DNA barcode region and allows for the identification of  Loligo vulgaris and its discrimination from two genetically similar and often mislabeled species, Loligo reynaudii and Loligo forbesii [Food adulteration has become a concern of great interest worldwide. This issue is strictly connected to the phenomenon of trade globalization and overexploitation of biodiversity, which are causing profound changes in the whole food supply chain and market systems. Seafood is among the most adulterated food categories . Its lonforbesii . This onLoligo spp. tissues were obtained from a previous study assessing the mislabeling rate of cephalopod seafood items in the Italian market using a DNA barcoding approach [Loligo vulgaris, L. forbesii, L. reynaudii, and closely related species , were downloaded from GenBank and aligned using MUSCLE online [approach . COI seqE online  to perfoTo perform LAMP experiments, we homogenized squid tissues (\u22645 mg) with a sterilized plastic pestle, and DNA was extracted using the InstaGene Matrix , following the manufacturer\u2019s instructions. With this protocol, DNA was rapidly extracted (approximately 15 min) and required no further purification steps prior to perform LAMP experiments.4, 1.4 mM of each deoxyribonuclotide triphosphate (dNTP) , 0.32 U/\u00b5L Bst 2.0 WarmStart DNA polymerase , and 0.06 mM Xylenol Orange . The colorimetric reaction was performed at 63 \u00b0C and the result was visualized after 30 min.Colorimetric LAMP reactions were performed in a Bio-Rad T100 Thermal Cycler. Specifically, 4 \u00b5L of genomic DNA (\u224825 ng/\u00b5L) was used as a template and mixed to 21 \u00b5L of reaction mix, containing 0.2 \u00b5M of forward outer primer (F3) and backward outer primer (B3), 1.6 \u00b5M of forward inner primer (FIP) and backward inner primer (BIP), 1.2 \u00b5M of forward loop primer (LF) and backward loop primer (LB) , 0.6 M betaine , 1x LAMP reaction buffer , 6 mM MgSO4, 1.4 mM of each dNTP , 0.32 U/\u00b5L Bst 2.0 WarmStart DNA polymerase , and 0.2x SYBR Green . The reaction was performed at 63 \u00b0C for 60 min.Fluorimetric LAMP reactions were performed in an Applied Biosystems StepOne Real-Time PCR System. Specifically, 4 \u00b5L of genomic DNA (\u224825 ng/\u00b5L) were used as a template and mixed to 21 \u00b5L of reaction mix, containing 0.2 \u00b5M of F3/B3, 1.6 \u00b5M of FIP/BIP, 1.2 \u00b5M of LF/LB , 0.6 M betaine , 1x LAMP reaction buffer , 6 mM MgSOColorimetric LAMP products were electrophoresed on a 1% agarose gel to assess the amplification reactions. In detail, 500 mg of ultra-pure agarose  was dissolved in 50 mL of 1x tris-borate-EDTA buffer (TBE)  using a microwave oven. A total of 5 \u00b5L of SYBR Safe DNA gel stain  was added to the solution, which then was poured into the plate with a spacer for gel polymerization. Each product of reaction was analyzed by mixing 5 \u00b5L of LAMP products to 1 \u00b5L of gel loading dye. A 0.1\u201310 Kb DNA ladder  was used as a molecular weight marker. The electrophoresis was performed at 80 V, and the result of the run was visualized in a Bio-Rad Gel Doc XR system.Loligo vulgaris products is representative of an important issue in the field of seafood since the global demand for cephalopods has shown a positive trend in the last decades, with the main importers and consumers being Italy, Spain, and Japan . Given this growing market importance, the correct identification and labelling of traded cephalopods is of primary importance for food safety issues due to the possible occurrence of direct or indirect toxicity phenomena in different species [The species substitution of labelled  species ,35.The schematic procedure of the entire method is displayed in Loligo tissue was used as starting material prior to homogenization with a sterilized plastic pestle. Then, without any purification steps, a few microliters of the extracted target were directly added to the reaction tube, containing all reagents for the amplification reaction. The six primers were designed to be highly specific to the authentic species (unlike the polymorphic variants), and annealed to the selected regions in the presence of the target, triggering the amplification process. The colorimetric result is directly visualized by the naked-eye, due to a color change from purple to pink/orange when amplicons are produced. Remarkably, the overall colorimetric method, including the DNA extraction, the amplification reaction, and the colorimetric readout of the result, requires no instrumentation, apart from a simple heating block.A rapid DNA extraction from the squid tissue was performed using the InstaGene Matrix  following the manufacturer\u2019s instructions. Less than 5 mg of L. vulgaris, and allow its discrimination from the two closely related species. In detail, all the available DNA barcodes of each Loligo species and close relatives (The key point of the entire strategy relies on the accurate design of species-specific LAMP primers, which target the mitochondrial COI gene of elatives  were alielatives  were desL. vulgaris, L. reynaudii, and L. forbesii specimens, using 100 ng/\u00b5L of each crude DNA extract. The isothermal amplification process was performed in a simple heating block, and the colorimetric result was rapidly and easily visible within 30 min (The one-step colorimetric LAMP was applied to various genomic DNA samples, rapidly extracted from the tissues of n 30 min A.L. vulgaris, as shown by the typical profile of LAMP products, unlike the closely related species that were not amplified (As is shown, the colorimetric assay was able to correctly identify the target species, which exhibited a clear purple-to-orange color change, whilst the other species maintained the same initial color as the control sample. The reaction was further controlled by agarose gel electrophoresis, confirming that the amplification occurred specifically for mplified B. In addmplified  by usingThus, the positive control reaction was tested on each sample under the same conditions. The visual inspection of the results showed that all samples turned pink/orange , demonstBesides on-site assessments, this reaction may also represent an interesting laboratory-based methodology due to its simplicity and rapidity. Actually, when coupled to a real-time fluorescence reader, using a classical fluorescent intercalating reporter instead of a colorimetric dye, the assay exhibited high discrimination efficiency and ultra-rapidity, being capable of providing clear authentication results in only 15 min .L. vulgaris, L. reynaudii, and L. forbesii specimens by fluorimetric LAMP, observing fast amplification after 15 min of reaction only in the case of the target species L. vulgaris. Hence, the optimized design of the LAMP primers, combined with the DNA barcoding approach, enabled us to address the authentication of L. vulgaris. Notably, both the colorimetric and the fluorimetric LAMP were also proven effective when associated with a rapid DNA extraction procedure.Specifically, we analyzed three genomic DNA extracts from In this work, we reported the development of a fast, on-site assay for the authentication of squid species, addressing the specific discrimination of one species from two genetically similar and less valuable ones. By coupling the LAMP technique with DNA barcoding and rapid DNA extraction procedures for a one-step readout, we showed the possibility of achieving fast, naked-eye readout of the species discrimination. Such features make these methodologies suitable for large-scale screenings and on-site industrial quality controls in several fields."}
{"text": "Pain assessment and management are important in postoperative circumstances as overdosing of opioids can induce respiratory depression and critical consequences. We aimed this study to check the reliability of commonly used pain scales in a postoperative setting among Korean adults. We also intended to determine cut-off points of pain scores between mild and moderate pain and between moderate and severe pain by which can help to decide to use pain medication.A total of 180 adult patients undergoing elective non-cardiac surgery were included. Postoperative pain intensity was rated with a visual analog scale (VAS), numeric rating scale (NRS), faces pain scale revised (FPS-R), and verbal rating scale (VRS). The VRS rated pain according to four grades: none, mild, moderate, and severe. Pain assessments were performed twice: when the patients were alert enough to communicate after arrival at the postoperative care unit (PACU) and 30\u2009min after arrival at the PACU. The levels of agreement among the scores were evaluated using intraclass correlation coefficients (ICCs). The cut-off points were determined by receiver operating characteristic curves.The ICCs among the VAS, NRS, and FPS-R were consistently high (0.839\u20130.945). The pain categories were as follow: mild \u2266 5.3 / moderate 5.4\u2009~\u20097.1 /severe \u2267 7.2 in VAS, mild \u2266 5 / moderate 6\u2009~\u20097 / severe \u2267 8 in NRS, mild \u2266 4 / moderate 6 / severe 8 and 10 in FPS-R. The cut-off points for analgesics request were VAS \u2267 5.5, NRS \u2267 6, FPS-R \u2267 6, and VRS \u2267 2 (moderate or severe pain).During the immediate postoperative period, VAS, NRS, and FPS-R were well correlated. The boundary between mild and moderate pain was around five on 10-point scales, and it corresponded to the cut-off point of analgesic request. Healthcare providers should consider VRS and other patient-specific signs to avoid undertreatment of pain or overdosing of pain medication. Up to 80% of patients experience acute postoperative pain, and the severity is greater than moderate in 75% of these patients . PostopePain assessment is necessary for the proper management of pain. There are several tools to assess the strength of pain validated intrapatient and inter-rater reliability. Visual analog scale (VAS), numeric rating scale (NRS), faces pain scale-revised (FPS-R), and face, legs, activity, cry, and consolability scale (FLACC) are scales that are commonly used in hospitals. The choice of tool is based on whether the patient can report his or her pain and varies according to developmental status, cognitive status, level of consciousness, education level, and cultural and language differences .A specific value usually expresses these scales, and it cannot describe the tolerability of the pain to the individual patient. For example, when a patient responds to his or her pain as VAS 5.0 or NRS 5, we do not know if the patient perceives the pain as mild, moderate, or severe. There have been several studies that worked on categorizing the pain score or determining cut-off points focused on chronic pain such as cancer pain or musculoskeletal pain \u201311. HoweThis prospective study was approved by the institutional review board of Ewha Womans University Medical Center, Seoul, Korea (EUMC 2016\u201301\u2013019-001). We enrolled a total of 180 patients, each of whom provided written informed consent between April and October in 2018. Adult patients who were older than 19\u2009years and were undergoing elective non-cardiac surgery were included. We excluded patients who had difficulty communicating, vision or hearing problems, those unable to move their arms after surgery, patients with previous histories of chronic pain and intake of pain medication, and those with cognitive disorders.We collected four pain scores: VAS, NRS, FPS-R, and a verbal rating scale (VRS). For VAS, we offered a 10\u2009cm line with a movable pointer so the patient could move the pointer to indicate his or her perceived pain severity on the line from no pain (0\u2009cm) to the worst pain (10\u2009cm). For NRS, the patients were asked to choose a fixed number, which represented their pain from 0 (no pain) to 10 (the worst pain). For FPS-R, we offered a sheet of paper on which there were six figures of faces of gradually changing facial expressions from a comforting face with no pain to a crying face indicating the worst pain. The patients were asked to choose one of the face figures that represented their pain best, and we recorded a corresponding score to the face: six even numbers from 0 for the comforting face to 10 for the crying face. For the VRS, we asked the patients to express their pain in the words of intensity: none, mild, moderate, severe . The data were collected in the following order: VAS, NRS, FPS-R, and VRS.Before arriving at an operating room, we educated the patients about how we would assess the four kinds of pain scores. An assigned anesthesiologist performed anesthesia, and the pain score assessments were performed by one investigator (M Lee) in the PACU. The pain score assessments were performed twice. The first pain assessment was when the patients opened their eyes spontaneously or responded well to physicians\u2019 verbal commands to say their name after arriving at the PACU. The second pain assessment was performed 30\u2009min after arriving at the PACU. During the stay at the PACU, analgesics were given on the patient\u2019s request rather than the certain pain score, and every analgesia was given under the anesthesiologist\u2019s confirmation to prevent respiratory depression or re-sedation. The choice of analgesic was the discretion of the assigned anesthesiologist, and the options were fentanyl 0.5\u2009\u03bcg/kg or ketorolac tromethamine 30\u2009mg.We hypothesized all the agreement levels between the three pain scores  from the intraclass correlation coefficients (ICC) would be higher than 0.7. At the value of \u03b1\u2009=\u20090.05 and the power\u2009=\u20090.8, the sample size was calculated as 169 using the ICC Sample Size package for R. Considering potential attrition, we determined the target sample size to be 180.Agreement levels between the VAS and NRS, VAS and FPS-R, and NRS and FPS-R were analyzed by ICC applying a two-way random effects model using a consistency definition. Clinical significance of the ICC was as follows: less than 0.40 indicated poor agreement, between 0.40 and 0.59 was fair, between 0.60 and 0.74 was good, and more than 0.75 was considered excellent .To determine the cut-off points of the scores, receiver operating characteristic (ROC) curve analyses were used. The ROC curve is a widely used method when figuring out a diagnostic test\u2019s accuracy and a cut-off point of the test for a disease. This analysis draws a plot of sensitivity (true positive rate) by 1-specificity  at every test value by dichotomizing patients into having the disease or not. Then we can determine the test value where the sensitivity and specificity are highest as the cut-off point, which means that that value can classify whether the patient has disease best , 14.d) to the top-left corner from points on the ROC curve were calculated, and the point with the lowest distance was chosen for the cut-off point [Three ROC curves for each of the VAS, NRS, and FPS-R by VRS were drawn: for the borders of between none (VRS\u2009=\u20090) and mild pain (VRS\u2009=\u20091), between mild pain (VRS\u2009=\u20091) and moderate pain (VRS\u2009=\u20092), and between moderate pain (VRS\u2009=\u20092) and severe pain (VRS\u2009=\u20093). The distance to the corner determined the cut-off points. The distances .The result was considered significant when the A total of one hundred and eighty patients completed the two sets of pain scores. One hundred and eighty-five patients were assessed for eligibility, and five patients declined to participate. There was no dropout of patients or missing data during the collecting of data. Demographic data and surgery-related data are shown in Table\u00a0The distribution of the pain scores is presented in Table\u00a0The levels of agreement among the VAS, NRS, and FPS-R are shown in Table\u00a0p-values were less than 0.001.The ROC curves to determine the cut-off points were drawn, and the cut-off points between none and mild pain, mild and moderate pain, and moderate and severe pain were determined Fig.\u00a0. and thep-values were less than 0.001  minimums from anywhere from a few days to a maximum of a few years after the surgery , 23. SecROC analysis is an effective and one of the most commonly used methods to analyze the effectiveness of a diagnostic test and to find the optimal cut-off point , 14. We Racial and ethnic differences in pain or treatment have been consistently reported \u201332. SeveWe observed a wide range of pain scores within one pain intensity. For example, mild pain ratings ranged from 0 to 8 on the NRS and 0 to 7.8 on the VAS. It shows that pain assessments could be superficial and incomplete when they are performed using only pain scores. Healthcare providers are prone to write pain scores less than 3 or 4 as mild pain. However, some patients may perceive their pain to be moderately intense, and these patients may need a pain-reducing drug. Vice versa, even when pain scores are as high as 7 or 8, some patients might think their pain is mild and tolerable. Therefore, doctors or nurses should approach pain in multiple ways to determine whether their patients\u2019 pain is tolerable or needs intervention. Considering we found that the cut-off point between mild and moderate pain was around 5.5, we have to be cautious when we give opioids to the patients with NRS ratings of 4 or 5. The immediate postoperative period is unique due to the residual effects of anesthesia drugs. Providers should be attentive following drug administration. Therefore, from the fact that the AUC of the ROC curve for the analgesic request was the biggest in VRS (0.723), pain assessment using VRS would be useful before an administration of analgesics.This study has several limitations. First, we did not study the patients\u2019 preferences. Second, we included a heterogeneous group of patients undergoing various surgeries. Prediction of postoperative pain intensity is affected by various factors such as age, surgery type, preexisting pain, and anxiety \u201335. HoweDuring the immediate postoperative period, any pain scale among the VAS, NRS, or FPS-R can be used. We recommend combining these scales with the VRS and other patient-specific signs to avoid under- or overdosing of pain medication, particularly for opioids. We suggest a simple, applicable category of pain in the immediate postoperative situation: an NRS score of 5 or lower is mild pain, an NRS score of 6 to 7 is moderate pain, and an NRS score of 8 to 10 indicates severe pain."}
{"text": "A healthy diet should nourish the brain with essential nutrients, including bioactive compounds, for normal brain functioning and to protect it from the negative effects of inflammation and oxidative stress. In this review, a concise summation of the protective effects of selected fruits, namely, berries, grapes, and citrus fruits, against neurological disorder is presented. The focus is on the neuroprotective potential of these fruits against neurodegenerative and mental disorders. The fruits selection was based on the vast reported pharmacological studies on their neuroprotection efficacies. Hence, the respective knowledge and limitations are discussed based on the biological and pharmacological evidence compiled from the previously reported laboratory, epidemiology, and intervention trials. Cognition is a cluster of brain functions which involves memory, speech, language, reasoning, judgement, planning, learning, compassion, and other thinking abilities. A decline in cognitive abilities is a common aspect of the normal aging process. However, in some instances, severe cognitive impairment occurs as a result of neurological disorders, including various forms of dementia . The gloThe second most prevalent neurodegenerative disorder is Parkinson's disease (PD). Meta-analysis of worldwide data revealed a rising incidence of PD, with more cases observed in North America, Europe, and Australia, compared with Asian countries . HoweverIn addition to neurodegenerative diseases, mental illness also contributed significantly to the 37.6% global growth in the healthcare burden of brain disorders from 1990 to 2010 , adults Although depression is less common among the community-dwelling elderly in Malaysia (7.6%), a critical rate of depression cases has been reported among adults in elder care centres (67%), which is about twice as high as the figure reported for the United Kingdom , 13. In \u03b2, interferon beta-1\u03b1, and glatiramer acetate are widely used to reduce the exacerbation of multiple sclerosis (MS) chromen-2-one (auraptene) is a coumarin derivative, which has been reported to possess various pharmacological properties including neuroprotective effects  on the mIn addition to the impact on the quality of life for the sufferers, families, and caregivers, mental health disorders, as a health category, are one of the heaviest burdens on the world's economy. In 2010, the total European cost of mental healthcare was estimated as \u20ac798 billion , and a tCitrus spp., grapes, nuts, and berries, in neuronal and brain disorders (However, current studies are insufficient to provide more definitive information which relates to optimal servings of these foods or to recommended doses of active phytoconstituents for neuroprotective actions in humans or to interactions with other foods which may act synergistically or antagonistically with prophylactic metabolites. Animal and in vitro studies have shed light on the possible metabolism-based therapies for the mental illnesses, as well as aging, ischemia, trauma, and mitochondrial cytopathies. However, the clinical investigation on the consumption of the selected fruits, which are efficacious as neuroprotective agents, is important. Evidence from larger clinical cohorts and longer trial periods under well-defined controlled conditions is necessary for a more precise estimation of the neuroprotective effects of functional foods, including isorders . In addiDue to the complexity between the nutritional effects of the foods and human health, the present study recommends that the consumption of fruits and nuts based on the guidelines of US Food and Drug Administration  on a dai"}
{"text": "Clostridium butyricum (C. butyricum) immunity and intestinal epithelial barrier function at the intestinal mucosal level, by using Salmonella enteritidis (S. enteritidis) to infect specific-pathogen-free (SPF) chickens and intestinal epithelial cells (IEC). We found that C. butyricum could decrease cytokine levels  via the TLR4-, MyD88-, and NF-\u03baB-dependent pathways in intestinal tissues and intestinal epithelial cells. Additionally, C. butyricum could attenuate bacteria-induced intestinal damage and increase the expression level of muc-2 and ZO-1 in the intestine and intestinal epithelial cells. Furthermore, C. butyricum altered the intestinal microbial composition, increased the diversity of the bacterial communities in the cecum of Salmonella-infected chickens. In conclusion, C. butyricum effectively attenuated inflammation and epithelial barrier damage, altered the intestinal microbial composition, increased the diversity of the bacterial communities in the intestine of Salmonella-infected chickens. The result suggests that C. butyricum might be an effective and safe therapy for the treatment of Salmonella infection.This study was aimed to investigate the effects of  Salmonella is a common bacterial entero-pathogen and one of the leading causes of serious illness in humans and animals, such as enteritis and diarrhea  and toxins. Impaired epithelial barrier function may predispose to various intestinal disorders, such as inflammation  chicken model with an emphasis on the response at the intestinal mucosal level.In this study, we aimed to explore the mechanism by which All procedures were approved by the Animal Care and Use Committee of Shandong Agricultural University (SDAUA-2016-016), and all husbandry practices and euthanasia were performed with full consideration of animal welfare.Clostridium butyricum (AQQF01000149) was obtained from Dalian Sanyi Animal Medicine Company (China). The strain was cultured anaerobically with Reinforced Clostridial Medium (RCM) broth at 37\u00b0C for 48 h. According to the plate count method as described by 6 colony forming units (CFU)/mL.S. enteritidis was obtained from the Avian Disease Centre of Shandong Agricultural University, and it was selected for the challenge study due to the invasive characteristic previously described , followed by dilution with PBS to a final cell count of 106 colony forming units (CFU)/mL according to the LD50.A virulent atrichia strain of escribed . The S. Salmonella by taking cloacal swabs. Thereafter, a total of 60 health chickens were randomly assigned to three groups (n = 20/group): (S. enteritidis (106 CFU/mL) on day 8 ; and (C. butyricum (106 CFU/mL) once every day from day 1 through day 14 and challenged with 0.2 mL S. enteritidis (106 CFU/mL) on day 8 [C. butyricum + S. enteritidis treatment (EXP)]. At the age of 14 days (6 dpi), all birds were euthanized via cervical dislocation. The tissues of duodenum, jejunum, ileum, and cecum were collected and stored in liquid nitrogen for mRNA and histological analysis. The cecal contents were collected and stored at \u221280\u00b0C for microbial composition analysis.Specific-pathogen-free chickens were obtained from Jinan SPAFAS Poultry Company . SPF chickens refer to animals that do not have specific microorganisms or parasites, but may carry non-specific microorganisms and parasites, also known as third-class animals . Chicken/group):  orally a/group):  orally aC)]; and  orally aOne inch of the cecum of chickens was removed, fixed in 4% paraformaldehyde and prepared for histological studies as described by n = 6/group) were sequenced on an Illumina MiSeq platform provided by Personalbio . Paired-end reads from the original DNA fragments were merged using FLASH. Clustering was performed using the UPARSE pipeline, and sequences were assigned to operational taxonomic units at 97% similarity  according to the manufacturer\u2019s instructions. The V4 hypervariable region of the 16S rRNA gene was amplified by PCR using 515F and 806R primers. Eighteen samples , followed by cDNA synthesis via the Transcriptor First-Strand cDNA Synthesis Kit  using 2 \u03bcg RNA template. Real-time PCR was performed using SYBR Green I Master mix (Roche). Two microliters of cDNA, 5 \u03bcl SYBR Green buffer 2 \u00d7 (Roche) and 2.5 pmol of each primer were combined for a total reaction volume of 10 \u03bcl. The thermocycler protocol consisted of a 5 min pre-incubation at 95\u00b0C for 20 s, 60\u00b0C for 30 s and 72\u00b0C for 20 s, and melt curves were added. The \u03b2-actin reference gene was chosen for the relative expression of targeted genes. mRNA relative expression was calculated using the 2\u2013\u25b3\u25b3Ct method. The primers used in this study are listed in Total RNA was extracted from duodenal, jejunal, ileal, and cecal tissues using Trizol reagent  according to the manufacturer\u2019s instructions. Briefly, 50\u2013100 mg tissue samples were ground to powder with liquid nitrogen and transferred to a tube with 1 ml of Trizol; after centrifuged at 4\u00b0C, 0.2 ml chloroform was added to the supernatant; after centrifuged at 4\u00b0C, the supernatant containing the intact RNA was transferred to a new tube, RNA was then precipitated with equal volume of isopropyl alcohol, and washed with 80% ethanol. The RNA was solubilized in RNase free water. RNA quantity and quality were evaluated using a NanoDropg for 3 min. To separate mucus and IECs, a centrifugation step of 10 min was performed at 400 \u00d7 g. Mucus covering the cell pellet was discarded. The remaining cell pellet was subsequently washed several times until the suspension was clear, and finally, 1 \u00d7 107 cells were cultured in six-well plates and incubated at 37\u00b0C with 5% CO2. After incubation for 48 h, IECs were treated under three different conditions as follows: (NC) DMEM alone; (PC) S. enteritidis (106 CFU) infection only; and (EXP) pre-incubation with C. butyricum (106 CFU) for 2 h prior to exposure to S. enteritidis. At 2 and 6 h after S. enteritidis challenge, a portion of the cells were then collected and treated with lysis buffer to extract total RNA for real-time PCR.Specific-pathogen-free eggs were purchased from Jinan SPAFAS Poultry Company (China). Chicken intestinal epithelial cells (IECs) were prepared from 19-day-old SPF chicken embryos as described previously  with somP < 0.05 was considered significant.Statistical evaluations were performed using a one-way ANOVA followed by a Duncan multiple range test or a Fisher least significant difference test using SPSS 16.0 . Data were visualized using GraphPad Prism 5 software . S. enteritidis in the PC group showed surface damage and disruption to villi. Cecal tissue of chickens pre-treated with C. butyricum in the EXP group showed less severe surface damage to villi than did cecal tissue of chickens in the PC group. These observations demonstrate that pretreatment of C. butyricum resulted in a reduction of bacteria-induced intestinal damage  (P < 0.05), but there was no significant difference between the NC and EXP groups (P > 0.05); in the jejunum, the gene expression level of IL-1\u03b2 was significantly elevated in the PC group compared to the EXP group (P < 0.05), but there was no significant difference between the NC and EXP groups and the same change between NC and PC groups (P > 0.05); in the ileum, no significant difference of IL-1\u03b2 was found among NC, PC, and EXP groups (P > 0.05); in the cecum, the gene expression level of IL-1\u03b2 was significantly elevated in the PC group compared to the NC group (P < 0.05), but no significant difference was found between the NC and EXP groups and the same change between PC and EXP groups (P > 0.05) (P < 0.05), but no significant difference was found between the NC and EXP groups (P > 0.05); of note, no significant difference of IL-8 in duodenum, ileum, and cecum was found among NC, PC and EXP groups (P > 0.05) , but there was no significant difference between the NC and EXP groups (P > 0.05) (P < 0.05), but there was no significant difference between the PC and EXP groups (P > 0.05). Regarding the expression levels of IL-1\u03b2 and TNF-\u03b1, no significant difference was found among the NC, PC, and EXP groups (P > 0.05) (P < 0.05), but there was no significant difference between the NC and EXP groups (P > 0.05) (P < 0.05), but there was no significant difference between the NC and EXP groups, and the same change between PC and EXP groups (P > 0.05)  were also evaluated. The results showed that at 6 days post-infection, no significant differences were found in IFN-\u03b3 and TNF-\u03b1 among NC, PC, and EXP groups in intestinal tissue  ( > 0.05) . The gen > 0.05) . The gen > 0.05) . Further > 0.05) . The exp > 0.05) . After 6 > 0.05) . The gen > 0.05) .P < 0.05), but there was no significant difference between the NC and EXP groups, and the same change between PC and NC groups (P > 0.05). Of note, C. butyricum effectively attenuated the S. enteritidis-induced changes to muc2 expression in the jejunum. There were no significant differences in muc2 expression in the duodenum, ileum, or cecum among any of the groups (P > 0.05)   . Further > 0.05) .C. butyricum on epithelial barrier function in the chicken intestines by detecting the expression level of Zonula occludens-1 (ZO-1) and Occludin via real-time PCR. The results showed that at 6 days post-infection, the expression level of ZO-1 in duodenum and jejunum was significantly decreased in the PC group compared with the EXP group (P < 0.05), but there was no significant difference between the NC and EXP groups, and the same change between PC and NC groups (P > 0.05). There were no significant differences in ZO-1 expression in either the ileum or cecum among any of the groups (P > 0.05) (P > 0.05) (C. butyricum on tight junction (TJ) expression in IECs in vitro. The data show that after 2 h post-infection, the expression levels of ZO-1 and Occludin were not significantly different among NC, PC and EXP groups (P > 0.05) (P < 0.05), and there was no significant difference between the NC and EXP groups (P > 0.05) (P > 0.05)  . Similar > 0.05) . We also > 0.05) ; but aft > 0.05) . The exp > 0.05) .P < 0.05), but there was no significant difference between the NC and EXP groups and the same change between PC and NC groups regarding the gene expressions of MyD88 (P > 0.05), which indicates a direct effect of C. butyricum. There were no significant differences in TLR4 and MyD88 expression in the duodenum, ileum, or cecum among any of the groups (P > 0.05). The expression level of NF-\u03baB in duodenum was significantly elevated in the PC group compared with the EXP and NC groups (P < 0.05), but there was no significant difference between the NC and EXP groups (P > 0.05)  , but there was no significant difference between the NC and EXP groups and the same change between PC and NC groups (P > 0.05)  . We furt > 0.05) ; but aft > 0.05) .C. butyricum on the microbiota in chicken cecum using Illumina sequencing of the 16S rRNA V4 region. Firmicutes, Tenericutes, and proteobacteria were the three most abundant bacterial phyla in all samples, and C. butyricum increased the proportion of Tenericutes in the EXP chickens compared to the NC and PC groups  production in intestines and the expression level of the pro-inflammatory cytokine  in intestinal epithelial cells of chickens after Salmonella infection. The protective action of C. butyricum was similar to that of other probiotics  of intestinal, inhibit pathogenic bacteria, and thus adjust the bacterial community structure. Our study aligns with another study that showed a diet supplemented with Enterococcus faecalis could shift microbial diversity in the porcine gut and inhibit pathogens (Dietary supplementation of chickens . In thisathogens .Clostridium butyricum effectively attenuated inflammation and epithelial barrier damage, altered the intestinal microbial composition by increasing the diversity of the bacterial community, and promoted immune function in the intestines of Salmonella-infected chicken. C. butyricum might be an effective and safe therapy for Salmonella infection.Salmonella and Clostridium butyricum counts during the course of the experiments to further verify that the organism of the bacteria colonized the gut.In future work, we will supplement the detection of The datasets generated for this study are available on request to the corresponding author.The animal study was reviewed and approved by The Animal Care and Use Committee of Shandong Agricultural University.HL, SS, and XZ conceived and designed the study. XZ, JY, ZJ, JW, and LW performed the experiments and analyzed the data. HL, SS, and XZ wrote and revised the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Co-infections have a key role in virus transmission in wild reservoir hosts. We investigated the simultaneous presence of astroviruses, coronaviruses, and paramyxoviruses in bats from Madagascar, Mayotte, Mozambique, and Reunion Island. A total of 871 samples from 28 bat species representing 8 families were tested by polymerase chain reactions (PCRs) targeting the RNA-dependent RNA-polymerase genes. Overall, 2.4% of bats tested positive for the presence of at least two viruses, only on Madagascar and in Mozambique. Significant variation in the proportion of co-infections was detected among bat species, and some combinations of co-infection were more common than others. Our findings support that co-infections of the three targeted viruses occur in bats in the western Indian Ocean region, although further studies are needed to assess their epidemiological consequences.The online version contains supplementary material available at 10.1186/s12985-021-01673-2. Co-infection (sometimes written as coinfection) can be defined as the simultaneous infection by at least two genetically different infectious agents in the same host \u20135. It caIn previous studies, we have investigated the presence of either AstVs, CoVs or PMVs in bats in the western Indian Ocean (WIO) region \u201323. HereBiological material was collected on Madagascar, in Mozambique, on Mayotte, and on Reunion Island as part of previous investigations on infectious agents circulation in bats . The liphangorn package in R, version 2.6.3 [PCR products of expected size were submitted for direct Sanger sequencing . Nucleotide sequences were aligned to generate consensus sequences, and were edited manually using ChromasLite 2.6.5 . The 33 partial AstV sequences and 13 partial PMV sequences generated in this study were deposited in GenBank respectively under the accession numbers MZ614404 to MZ614436 and MZ614437 to MZ614449. Genetic diversity was explored with pairwise distance values obtained from on 2.6.3 . Sequencon 2.6.3 , 29. Theon 2.6.3 , with a 2\u2009=\u20090.3, df\u2009=\u20091, P\u2009>\u20090.5). Significant differences in AstV detection were observed between roost types , between species  and between males (20.9%\u2009\u00b1\u20093.8%) and females (11.6%\u2009\u00b1\u20093.0%) . AstV prevalence was significantly higher in bats species roosting in caves (27.5%\u2009\u00b1\u20093.9%) than in buildings (2.5%\u2009\u00b1\u20092.0%). On Madagascar, a high detection rate was found in species of the genus Miniopterus as compared to the other taxa , and especially in Miniopterus manavi (88.9%\u2009\u00b1\u200914.5%), Miniopterus gleni (86.7%\u2009\u00b1\u200917.2%), and Miniopterus sororculus (71.4%\u2009\u00b1\u200933.5%). The highest AstV detection rate in Mozambique was observed in Triaenops afer (68.6%\u2009\u00b1\u200912.7%).One hundred and forty-two samples tested positive for AstV  . Significant differences were detected between males (5.4%\u2009\u00b1\u20092.1%) and females (1.9%\u2009\u00b1\u20091.3%) , and between roost sites . Bats living in caves were more frequently positive (5.7%\u2009\u00b1\u20092.0%) than those living in buildings (1.7%\u2009\u00b1\u20091.6%). The proportion of positive bats was also significantly different between species on Madagascar , particularly in Triaenops menamena (42.4%\u2009\u00b1\u200916.9%). In Mozambique, differences between species were not statistically significant .A total of 32 samples tested positive for PMV (3.7%\u2009\u00b1\u20091.3%)  and no difference between males and females  . However, a significant variation was detected among bat species . In Mozambique, the highest prevalence was detected in the cave roosting Rhinolophus lobatus (66.7%\u2009\u00b1\u200930.8%). No difference was observed among the species that tested positive on Madagascar .The detection of CoV was conducted as part of a previous study . BrieflyThe overall proportion of positive bats detected for either AstVs or PMVs was consistent with previous studies performed in the WIO region, and in other tropical regions \u201334. Inte2\u2009=\u20097.0, df\u2009=\u20091, P\u2009<\u20090.01) , and no significant variation was observed between males and females . Globally, co-infections involving AstV-CoV (1.4%\u2009\u00b1\u20090.8%) and AstV-PMV (1.1%\u2009\u00b1\u20090.7%) were more frequently detected than CoV-PMV (0.1%\u2009\u00b1\u20090.3%) and AstV-CoV-PMV (0.3%\u2009\u00b1\u20090.4%)   suggesting a potential positive association between these two viruses. Co-infections involving AstVs, CoVs or PMVs were reported in other tropical bat species. For example, a study of Hipposideros cervinus on Borneo reported 4.1% of AstV-CoV coinfected bats with a positive association between these two viruses [Twenty-one of the 871 samples tested positive for more than one virus (2.4%\u2009\u00b1\u20091.0%). These co-infections were detected only in Mozambique (5.0%\u2009\u00b1\u20092.7%) and on Madagascar (1.7%\u2009\u00b1\u20091.1%), with significant variation among these locations (\u03c701) Fig.\u00a0. In bothTriaenops menamena (15.2%\u2009\u00b1\u200924.7%), Miniopterus gleni (13.3%\u2009\u00b1\u200914.8%), and Paratriaenops furculus (3.2%\u2009\u00b1\u20090.2%), without significant difference between species  , Nycteris thebaica (7.1%\u2009\u00b1\u200913.5%), Hipposideros caffer (5.1%\u2009\u00b1\u20095.6%), and Miniopterus mossambicus (4.8%\u2009\u00b1\u20099.1%) , also without significant difference between species  and on Madagascar (Triaenops and Paratriaenops). In Mozambique, the proportion of co-infections was significantly higher in Triaenops afer than in all other tested species . Also, as compared to other species that tested positive for co-infection, different combinations of co-infections (i.e. different associations between viruses) were detected in species of the genus Triaenops. Indeed, Triaenops menamena on Madagascar presented two types of co-infections: AstV-PMV and CoV-PMV, whereas Triaenops afer in Mozambique harbored three types: AstV-CoV, AstV-PMV, and AstV-CoV-PMV; while other species, including Paratriaenops furculus, only presented one co-infection type , or with sequences obtained in bats from the same family . However, some sequences were included in more diversified groups including different bat families (e.g. two sequences obtained from Paratriaenops furculus on Madagascar that clustered with sequences detected in Miniopterus griveaudi and Chaerephon leucogaster on Madagascar).Genetic diversity was less important for PMV sequences, with pairwise differences up to 29%. All our sequences were genetically related to PMVs previously described on Madagascar , 19 or iWe report co-infections in bats on Madagascar and in Mozambique, ranging from 3.2% to 15.7% of the positive samples, and depending on the tested bat species. Although our cross-sectional sampling precludes detailed interpretation of the biological drivers of such variation, our results nevertheless highlight that interactions between infectious agents in bats may exist with potential consequences on their epidemiology. AstVs, CoVs, and PMVs are emerging viruses that represent a major challenge for human and animal health. Further knowledge on virus interaction in wildlife, based on long-term longitudinal sampling is needed to fully assess the epidemiological consequences of co-infections [Additional file 1. List and origin of samples, day roost sites, and result of the molecular screening.Additional file 2. Number of tested and positive samples, per location, bat family, species, samples types, and collection year.Additional file 3. Number of tested and positive samples for co-infections, per country, bat family, bat species, sample type, and collection year.Additional file 4. Astrovirus nucleotide sequence similarity obtained with BLASTn.Additional file 5. Paramyxovirus nucleotide sequence similarity obtained with BLASTn"}
{"text": "Therefore, we aimed to assess the knowledge of COVID-19, sleep problem and identify sociodemographic factors associated with sleep problems among healthcare workers in a Nigerian neuropsychiatric hospital.a cross-sectional study was conducted among 200 healthcare workers in a neuropsychiatric hospital using self-administered questionnaires to assess knowledge of COVID-19, sleep problem, social support, and sociodemographic factors that affect sleep. Chi-square test and Spearman's correlation were applied to assess the association between sociodemographic factors and sleep problems.about 23.9% of the healthcare workers reported having a sleep problem. However, there was no association of sleep problems with any sociodemographic factors except age (r=0.26) and social support (r=-0.18).the study offered insight into the occurrence of sleep problems among healthcare workers and suggested a guide for planning interventions targeted at improving the psychological well-being of healthcare workers in the face of current global pandemics. Sleep is a naturally re-occurring physiological phenomenon that is essential for rest, repair, learning, and development . When itSleep problems may thus be worse among health workers in low and middle-income countries like Nigeria, who are overlaboured by work schedule . PreviouStudy design and location: the study design was a cross-sectional descriptive one. It was conducted at the federal neuropsychiatric hospital (FNPH) in Benin-City, Edo State, South-south Nigeria. The hospital is a 270-bed facility which provides in-patient and out-patient care, as well as emergency services to mentally ill persons primarily across the region  of Nigeria. The location operates at two sites: the old site is centrally located in the city; and the new (permanent) site, located on the outskirt of the city. The sample size was calculated using single population proportion formula 21. Data was collected over one-month period between May 2020 to June 2020 using self-administered questionnaires to assess knowledge of COVID-19, sleep problem, social support, and sociodemographic factors that affect sleep.Eligibility criteria: healthcare workers who were bonafide staff of the hospital, aged 18 years and above, have worked in the hospital for a minimum of one year prior to the outbreak of COVID-19 in Nigeria, reported no history of mental illness and willing to participate were included in the study. Healthcare workers who did not meet any of the above criteria were excluded from the study.Study population: the study population consisted of the staff with close contact with patients working in the health facility, consultant psychiatrists, resident doctors in psychiatry, medical officers, psychiatric nurses, pharmacists/technicians, laboratory scientists/technicians, clinical psychologists, social workers, occupational therapists, health attendants, and others.Sampling technique: the staff of the hospital who were present in the course of questionnaire distribution were randomly sampled. All the consenting personnel listed above that were available during the study period were recruited.Socio-demographic data collection sheet: specifically designed to inquire about the sociodemographic characteristics of the staff, such as gender, age, marital status, education level, profession, and religion.Knowledge about COVID-19: seven questions were self-designed to capture the knowledge about nature, cause, risk, treatment, fatality, prevention, and prognosis of the coronavirus disease.Sleep problems: this was enquired as a single question: \u201cdo you have difficulty falling asleep, staying asleep or waking up early\u201d and a Likert option of responses were provided, such as never, sometimes, half the time, frequently and always; to enable scoring. Higher scores are indicative of greater sleep problems.The Oslo 3-item Social Support Scale (OSS-3): the OSS-3 provides a brief measure of social support [ support . It cove support . Its str support . The higEthical consideration: approval for the study was obtained from the Research and Ethics Committee of Federal Neuropsychiatric Hospital, Benin City, Nigeria, and written informed consent from the participants to qualify for recruitment. The ethical approval obtained was PH/A. 864/vol. XV/129. the study questionnaires were administered within one month to the study population after obtaining consent.Statistical analysis: data collected were analyzed using the statistical package for social sciences (SPSS) version 22. Descriptive statistics were used, such as frequencies and median. A normality test was performed, which revealed that the sleep problem score was not normally distributed, hence a non-parametric test was adopted in bivariate analysis. Chi-square test was used to test the association between sleep problem and categorical variables  while Spearman\u00b4s correlation was applied between sleep problem and continuous variables . All the variables except profession were dichotomized for easier comparison with previous studies and to enable enough participants for analysis e.g. the educational status was categorized into at most secondary level of education and at least tertiary education. The profession was categorized into doctors, nurses, and others . The level of significance was set at a p-value of less than 0.05.Concerning their knowledge about COVID-19, This hospital-based cross-sectional study examined the knowledge of COVID-19 and sleep problems among a selected sample of healthcare workers in a neuropsychiatric hospital in the South-south region of Nigeria. This survey outcome can help with making health recommendations and formulating right precautionary measures, which will invariably boost the psychological and physical health of the healthcare workers during and after the pandemic . The heaet al. [et al. [Our study also indicated that 23.9% of the respondents had a sleep problem. This rate is consistent with several studies that have reported the prevalence of sleep problems among healthcare workers, in the range of 10-30% ,15. Howeet al. , where tet al. . It was  [et al. , where t [et al. . The finet al. [et al. [et al. [Another important finding in this study was that increasing age was also significantly associated with sleep problems. This is in tandem with the findings of Patterson et al. , where tet al. . However [et al.  where th [et al. , in an IMost of the health workers in this study were well aware of the etiology of COVID-19 disease, treatment and recovery of individuals with COVID-19. The study also showed that approximately 24% of the healthcare workers reported having sleep problem during the pandemic. It is therefore recommended that during pandemics, preventive interventions are put in place for the overall mental and psychological being of healthcare workers.Healthcare workers do experience poor sleep quality with relevant consequences on their health;Poor sleep quality among healthcare workers is prevalent and this has increased during the COVID-19 pandemic;Several variables such as educational level or work in an isolation unit appear to play a crucial role in moderating sleep disturbance.Sleep disturbance was prevalent among the healthcare workers and sociodemographic variables increasing age and lower level of social support were associated with sleep problem among the study population."}
{"text": "All participants have shown a significant decrease pre\u2013post-lockdown in both health and performance perception, especially in women, individual athletes, medalists, and student-athletes. Strong limitations of training, attention, and motivation as well as a moderate negative emotional state during lockdown were reported, in women, individual athletes, medalists, and student-athletes. Even with an improved emotional state and energy level in the post-lockdown period, moderate-to-high stress scores were reported by women and medalists. Our findings highlight the importance of paying attention to the physical and psychological health of elite athletes on three profiles: team athletes , student-athletes , and women athletes .Spain is one of the many countries highly affected by the COVID-19 crisis, establishing very restrictive measures with a complete lockdown for more than 3 months. This situation forced the complete closure of sport practice and national or international competitions, leading to a negative impact on physical and psychological health of high-performance athletes. Therefore, the objectives of this study were (a) to determine the effects of the COVID-19 health crisis on Spanish high-performance athletes in terms of sports practice, life quality, and emotional state and (b) to identify the profile with the greatest difficulties during and after the lockdown. A sample of 130 high-performance athletes aged between 18 and 34 years (67 women and 63 men) participated in this study . Measures included socio-demographic data through a 5-dimension  In early 2020, a new viral outbreak began to spread internationally. On January 30, 2020, according to the International Health Regulations  aged between 18 and 34 years. The 85.4% of the sample were considered top or elite athletes according to the Spanish government. The 29.2% had been in the elite for 0\u20133 years, 46.9% for 3\u201310 years, and 23.8% for more than 10 years of their sporting life. The 83.1% of the participants had achieved a gold, silver, or bronze medal in their sport discipline at least once during their time competing internationally in the elite. In total, 54.6% of the athletes belonged to individual sports, while 45.4% belonged to team sports. Finally, 86.9% of the sample were considered student-athletes. All of them gave their consent for their responses to be treated anonymously, and the University\u2019s Research Ethics Committee approved the study, which was conducted in accordance with the Declaration of Helsinki.ad hoc survey was created in order to collect relevant data according to the objectives of this study. This survey was composed by items related to (a) gender, (b) best sporting result obtained , (c) sporting discipline practiced , (d) student-athlete, and (e) high-performance sporting expertise.An International Physical Activity Questionnaire  health perception, (2) performance perception (ranging both between 0 = bad and 4 = excellent), (3) degree of limitation in training , (4-6) Limitations of training, attention and motivation due to negative emotional causes , and finally, (7-8) Positive-negative emotional state and (9) energy levels . Cronbach\u2019s alpha coefficient reported values of reliability between 0.78 and 0.96. This instrument provided a profile of the health status of participants and is one of the most widely used generic scales in both descriptive and evaluative studies.An adapted questionnaire based on the original ionnaire  translate  and then adding the 12 items together. The direct score obtained indicates that a higher score corresponds to a higher level of perceived stress. Cronbach\u2019s alpha coefficient reported the values of reliability between 0.78 and 0.82. The PSS was completed concerning the post-lockdown period.A shortened version of the Spanish version of the ale PSS;  designedProfile of Mood States (POMS) in its original reduced version . In total, 130 elite athletes  completed the whole online survey agreeing to participate in the present study. Through human resources contact, coaches from multiple sports disciplines were encouraged to discuss with their athletes the importance of conducting this type of study and to raise awareness of the difficulties that elite athletes have experienced both physically and psychologically, during this unusual and uncertain period. During 5 weeks, the project team was in contact with the supervisor for the athlete recruitment in order to receive information about the process. Responses to the online questionnaire by the athletes were provided in a single session and without any interruption until all the tests were completed. The completion of the online survey was performed in a controlled manner and in the presence of the respective coaches. The athletes answered the IPAQ questionnaire according to pre- and post-lockdown periods, except for resting days and hours with three time-point questions: (a) PRE (before the lockdown); (b) DURING (during the lockdown period); and (c) POST (after the lockdown). For the questionnaire related to health status and limitations, only two points (pre vs. post or during vs. post) were taken into consideration. The remaining questionnaires (perceived stress and mood states) were only related to the post-lockdown period. Athletes who agreed to participate were informed of the confidential and voluntary nature of the study as well as the absence of any reward for participation. When answering the questionnaire, all of them had accumulated 99 days of lockdown. Finally, in appreciation of their collaboration, a final report was sent with the main findings of the study.After obtaining the approval of the Ethics Committee of the University, the online tool was designed through the t-test was applied. Additionally, paired Wilcoxon signed-rank test was used to assess changes within pre vs. during or during vs. post and pre vs. post COVID-19 lockdown when available. Chi-square test was used for categorical variables. Wilcoxon\u2019s effect size (ES) was calculated for non-normal variables; otherwise, Cohen\u2019s D was used. Differences at p < 0.05 level were considered statistically significant. All statistical analyses and plots were performed using the packages nortest , yielding non-normal results for all variables except Stress score. Median and interquartile ranges were used for non-normal continuous variables, and mean (\u00b1 standard deviation) was used for Stress score variable. The N and percentages were used for descriptive variables as well. Comparisons for each variable type were assessed based on the following categorical variables: gender, best result achieved, modality, student-athlete, and high-performance expertise. Wilcoxon\u2019s rank-sum test was used for continuous variables if non-normally distributed; otherwise, a  nortest  and rsta nortest . Correla package .The descriptive data from all the variables are shown in p < 0.001). Attending to the categorical variables, men increased from 2 to 6 days of rest during the lockdown, and then returned at 2\u20133 days in the post-lockdown period. Team sports use more resting days in each pre\u2013during\u2013post stage compared to individual sports (p < 0.01). Student-athletes increased resting days during lockdown to a lower extent compared to non-athletes, regained their pre-lockdown habits later on (p < 0.01). From a general perspective, sportsmen and women belonging to team sports and with lower competitive level retained 1 day more for resting in the post-lockdown period compared to pre-lockdown.A paired Wilcoxon signed-rank test revealed significant differences in days of resting in pre vs. during and during vs. post for all of the groups analyzed (p = 0.008), in individual sports (p = 0.003), and in athletes with medium-broad expertise in elite (p = 0.032), significantly decreasing their daily and weekly training hours between pre- and post-lockdown.Concerning hours of training and moderate physical activity, changes were observed in medalist athletes (podium) (p < 0.001). The aforementioned samples considerably increased the hours of rest per day during lockdown, where the intervals of 3\u20135 h and +5 h per day were greatly increased. In the post-lockdown period, the resting hours were generally somewhat higher than those shown in the pre-lockdown period.Significant differences for hours of resting pre vs. during, during vs. post and pre vs. post, were reported for the whole sample and by subcategories, especially for both genders, medalist athletes, both individual and team sports, student-athletes, and athletes with 3\u201310 years of experience in the elite . Both genders, male , and female , showed a significant decrease in the performance perception pre\u2013post-lockdown  and performance perception  pre\u2013post-lockdown .The degree of limitation in training was compared during and post-lockdown for all the categorical variables. A paired Wilcoxon signed-rank test indicated that these differences were significant (\u03c72(2) = 36.847, p < 0.001], attention  as well as motivation  due to negative emotional causes, and the lockdown status. A higher number of participants reported limitations during lockdown period but not after.A chi-squared test found that there was a statistically significant association between the limitations of training [p < 0.001, moderate ES, being more pronounced in men); both modalities ; best result ; student-athletes , and short and medium high performance (HP) sporting expertise .Concerning the negative emotional state, p < 0.01, small ES); student-athletes ; and athletes with (medium) 3\u201310 years of experience in the elite   .p < 0.05 and p < 0.001, small ES, for female and male, respectively); individual and team athletes ; medalists ; student-athletes ; and short sporting experience   .t-test revealed significant differences between genders for stress scores  and in medalists, with higher scores compared to non-medalists . When combining both variables, women still show significantly higher levels, but only within those competitors with the best result (podium) . In addition, women showed higher scores compared to men in team sports (p = 0.008), student-athletes (p = 0.004), and medium sporting expertise (3\u201310 years) (p = 0.002) (A = 0.002) .p = 0.01, large ES). In general terms, as sporting expertise increases, the differences between medalists and non-medalists equalize and become non-significant after 3\u201310 years of experience in the elite  and fatigue (p = 0.003) with higher scores for women, and vigor with higher scores for men (p = 0.008). Those with better results have a slightly more negative profile, showing higher levels of tension (p = 0.02) and hostility (p = 0.04) than non-medalists. They generally score a little higher on the negative dimensions of the profile and lower on vigor compared to non-medalists. No significant differences were found for any factor regarding other categorical variables . It also meant the delay and/or cancelation of sporting events all over the world, with the postponement of the Olympic Games for the first time in its history, being an example of the magnitude of this crisis worldwide. A large number of retrospective studies were carried out during the lockdown period, trying to understand the problems athletes were facing and how they could affect their physical and mental health. To complement these studies and the problems that have become evident, it is necessary to know what consequences have been produced on the lives months of athletes after exceptional circumstances. For this purpose, the present results extend previous knowledge on the consequences of the COVID-19 pandemic by providing new evidence on the physical status, quality of life, and mental health of Spanish top-level athletes who, after a long lockdown period, had to return to their sporting lives in a new context.Attending to physical health, the major increase in the resting time that Spanish athletes dedicated during the lockdown period seems to be a relevant aspect to be taken into account. According to previous studies with elite athletes , a signiIt should also be noted the rest days of team sports athletes, which were longer compared to individual sports athletes during the lockdown period, coinciding with the study by Also, noteworthy are the results in student-athletes, characterized by pursuing academic studies at the same time as their sporting careers and are framed within the so-called dual career , where aIn any case, they duplicated the practice of physical activity compared to non-athlete university students. Apparently, despite the loss of physical activity, the student-athletes followed the recommendations to exercise at home during the lockdown, but similar to the results of the present research, the sedentary activities could be related to increasing the time dedicated to studies, with the aim of synchronizing the learning processes in their future profession.On the contrary, these statements would disagree with the results reported by \u201cactivity must be resumed slowly and by listening to the athlete, as there is still uncertainty as to whether we will return to the old habits of the old \u2018normality,\u2019 or whether the pandemic will give rise to a new stage with new lifestyles that will define the future\u201d (p. 54).Related to progressively returning to sport, it is observed that there are differences between the hours that athletes dedicated to training before the lockdown and in the post-lockdown. The athletes with the highest competitive level, in individual sports and with medium and broad experience in the elite, significantly reduced their daily and weekly training hours after the lockdown by returning to training. For this reason, the main responsible for the athletes\u2019 return to training and competitions should have specific knowledge of the different profiles and how the COVID-19 health emergency situation may have influenced their lives. Along the same lines, The health perception of athletes in the post-lockdown period after the difficulties experienced during the lockdown period, is a factor that has been taken into account through two summary components: physical and psychological . AccordiAlthough the health and performance perception in athletes after the lockdown period has not yet been extensively studied, a study carried out during lockdown with more than 13,000 youth athletes , states Considering the competitive level of athletes, those with higher level  reported a significant decrease in the health and performance perception compared to pre-lockdown. It could be interpreted that these athletes were those who had Olympic qualification as one of their next objectives. Therefore, after 4 years of preparation, the postponement was an added stressor. In this line, studies affirm that this situation could cause a loss of concentration, motivation, and the desire to continue preparing for the Olympics with the same energy as before, affecting, among other variables, their health and performance perception . It shouThe health of athletes was possibly also influenced by emotional problems experienced during the lockdown period, the reduced time dedicated to training, and the training performance with less attention and motivation compared to pre-lockdown. Social distancing seems to be one of the main reasons for the appearance of such problems . StudiesThis perceived loss of social connection and support  could inFocusing on the post-lockdown period, differences between the limitations experienced in training during lockdown (high degree) and the post-lockdown (low degree) were observed for both genders, also reported by medalists, individual sports, student-athletes, and those with more experience in the elite. It seems clear then the importance of maintaining adequate levels of physical activity in professional athletes, as in addition to positive physiological effects, sports practice enhances psychological well-being. Moreover, strategies should be incorporated to reduce stress and anxiety about returning to competition, respecting each individual\u2019s own time, avoiding injuries and frustrations to quickly reach the competitive level they showed prior to lockdown . RegardiThese negative emotional values decreased significantly in the post-lockdown period, especially in men, medalists, student-athletes, both modalities , and athletes with 0\u20133 years of experience. This correlates with a decrease in training limitations, and an inverse correlation in the positive emotional state and energy level, both increasing significantly in the post-lockdown period. This is possibly linked to being able to get back to socializing, training again with the opportunity to compete in a short-term period, resuming studies and leading a regular life after months of lockdown.Furthermore, it is important to highlight those fluctuations in stress and modifications in exercise routines, especially when drastic, could result in sports injuries or illnesses . AccordiThe so-called Coronavirus experience  is underAs discussed above, and now related to the emotional state, student-athletes should be particularly considered since their behavior is different compared to other athletes not combining academic and sporting life. Significant differences were reported in the negative emotional state, with student-athletes showing a worse baseline level during lockdown, suggesting a worse post-lockdown emotional state, but actually the results showed a significant drop afterward, correlating with the increase in positivity and energy. These results could mean that the student athletes took advantage of the lockdown period, to spend more time than usual on their studies instead of training, whereas, after return to training, they experienced a better emotional state, as they can continue their normal academic activity as well as training and competition, feeling more competent and controlling the situation. In fact, non-student-athletes showed an inverse behavior, being affected by the situation to a greater extent, maintaining their emotional state unchanged in the post-lockdown period.As highlighted by other studies , COVID-1Student-athletes have reported higher values of negative emotional state during the lockdown, similarly to The results on stress and mood of athletes in the post-lockdown period showed significant differences between genders and best sporting results. Women showed higher levels of depression and fatigue, as well as higher levels of stress, especially those sportswomen with better results. On the other hand, men had higher values for vigor. Once again, the present study shows that women experienced more negative consequences of lockdown, possibly affecting their mental health and, therefore, their personal life and sporting performance in the period of post-lockdown. According to Carrying out a cross-sectional study to find out the situation of athletes at different times of the health crisis could find limitations in the results obtained, because the responses were obtained in the post-confinement period. A longitudinal study could have been presented for the most appropriate in this case, but the uncertainty in the duration of the periods lived, as well as the difficulties that the athletes were facing, were the reason for carrying out the study once the confinement had passed and efforts were being made to regain normalcy, even with a large number of limitations.In addition, other limitations to consider would be the inclusion of the questionnaires used in the present study in a single survey, which could mean that it was too long for the athletes to answer, as well as the inability to take the data in person due to mobility limitations that characterized the post-confinement stage in Spain.This study shows how the health crisis caused by COVID-19 altered the sporting practice, life quality, and emotional state of Spanish elite athletes during the lockdown and in the subsequent post-lockdown period. Concerning the sporting practice, even with the advice of coaches during the lockdown, there were modifications due to the restrictions and the closure of sports facilities. After returning to the new situation, sporting activity did not return to normal levels immediately, since training was carried out in a progressive and scheduled manner by professionals, well aware that training had to be adapted to the circumstances. The health and performance perception were other altered factors in the athletes, especially in student-athletes and women groups. In addition, athletes with a higher competitive level suffering greater uncertainty due to the postponement of competition had an important decrease in both perceptions that should be considered. Furthermore, the health of athletes was also influenced by emotional problems, leading them to perform their training sessions with less attention and motivation compared to before the health crisis. However, the post-confinement period led to a decrease in the negative emotional state of the athletes, while at the same time increasing their positive emotional state and energy level in order to face their tasks. On the other hand, the stress level remained moderately high, due to the workload to be recovered, especially concerning the competitive and academic field for student-athletes.We highlight the identification of profiles of different athletes to be considered, due to the consequences and difficulties caused by the health crisis on their lives. First, Spanish women athletes could be a group to be specifically approached that might indicate the prevalence of implicit gender inequalities in sport, becoming even more evident in a global crisis situation. Our findings could be related to less support received from organizations, as well as to other gender-related difficulties  that should be further studied. Considering the physical and emotional health of female athletes, it appears to have been impaired, potentially affecting their lives and sports performance. During the last two Olympic Games, Spanish women have won more medals . Therefore, it would be necessary to increase the research, in order to know the real impact of the pandemic on the elite sport of women in Spain, as well as the current and future consequences of the pandemic. Second, Spanish athletes who practiced team sports had more limitations when training both during and in post-lockdown periods, mainly due to the social distance, something that should clearly be considered. Third, student-athletes, who found the lockdown an opportunity to focus more time on their academic careers, leading to an increase in more sedentary activities, with possible implications for their sports performance on the one hand, but advances for their lives outside of sport as well.The original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by the San Antonio Catholic University (UCAM), Murcia, Spain. The patients/participants provided their written informed consent to participate in this study.EC, CLdS, and MT participated in the design of the researchproject. EC, LMMA, CLdS, and MT participated in the surveydesign and adjustments. ASP, AL, and JAGR participated in thesubject recruiting and data collection process. LMMA and GSparticipated in the data analysis and results. EC, LMMA, GS, andADA participated in the preparation of the original manuscript. EC, LMMA, GS, YR, CLdS, and MT participated in the revised version of the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "The aim of this study was to analyze athlete-specific psychological strain among Olympic athletes following the postponement of the Tokyo 2020 Olympic games due to the COVID-19 pandemic.A survey that comprised three sub-sections , Patient Health Questionnaire\u2014Depression Module (PHQ-8) and Participant characteristic) concerning mental health, performance issues and concerns about the postponement of the Tokyo Olympics, was distributed online and sent to 102 Olympic athletes.A total of 85 participants from 11 Olympic sports\u00a0were enrolled. Results indicated that most athletes showed psychological strain related to concerns regarding the postponement of the Tokyo Olympics. Depression severity was positively associated with maladaptive avoidance coping patterns, negative effects in training, worries and fear. Depression severity was also negatively associated with motivation and adaptive factors such as chances and opportunities that can be drawn from the pandemic.The present sample of Olympic athletes reported suffering from psychological uncertainty associated with the postponement of the Olympic games. Sports federations should therefore, provide ongoing wellbeing support to athletes and offer them, for example, sports psychological support in order to be able to better deal with pandemic-related uncertainties and changes. The International Society of Sport Psychology suggested that the postponement of the 2020 Tokyo Olympic games represents a significant career disruption that could involve a loss of identity, motivation and meaning  with emoThe emotional response of Olympic and Paralympic athletes to the decision to postpone the Olympic games in Tokyo is likely to be varied . After yWhile the severe acute respiratory syndrome coronavirus 2 (hereafter referred as COVID-19) continues to spread worldwide, the impact on mental health symptoms and disorders in both the general population and within elite sports is gaining increased attention \u20138. XiongThis study aimed to explore and describe mental health symptoms and athlete-specific psychological strain among Olympic athletes during this pandemic phase, and to understand whether sports psychology, medical and/or coaching support were available for athletes during this phase. We hypothesized that the postponement of the Olympic Games would have a negative impact on athlete wellbeing, as evidenced by elevated levels of psychological strain and depressive symptoms.The present study was part of a research project examining dispositional and emotional features associated with athletes\u2019 mental health symptoms due to the COVID-19 pandemic. An online questionnaire was distributed by international sports federations with the request to send it to athletes who had already qualified or were still in the qualification process for the Olympic Games in Tokyo 2020. The survey was send to 102 athletes from which 86 (84%) completed the survey. One participant did not agree to the privacy policy statement and was excluded.The online survey was open from July until September 2020.Athletes who had already qualified or were still in the qualification process for the Olympic Games in Tokyo 2020Age 18\u00a0years and olderComplete surveyAgreement to the privacy policy statementInclusion criteria:Athletes who had not qualified or were not involved in the qualification process for the Olympic Games in Tokyo 2020Age under 18\u00a0yearsIncomplete surveyNo agreement to the privacy policy statementExclusion criteria:Participants provided informed consent\u00a0before participating voluntarily in the\u00a0study. The study was approved by the Ethics Committee of the University of Witten/Herdecke (No. 171/2020). The study team used the Declaration of Helsinki ethical principles for medical research involving human subjects as standards.The Survey comprised three sub-sections, including participant demographics, questions related to the COVID-19 pandemic and 41 questions about athletes\u2019 feelings towards their sporting activity.The APSQ is a 10-item mental health questionnaire with 3 subscales assessing self-regulation, performance and external coping in athletes. The 4-item performance subscale and 3 additional single items from APSQ  were used to provide a brief, targeted self-report of athletic distress and maladaptive avoidance coping patterns  . Items wn\u2009=\u200911) of the athletes scored the commonly used threshold of\u2009\u2265\u200910 for the PHQ-8. Scores above this cutpoint suggest that the probability for a major depression is increased , upon reasonable request.t-tests to explore mean differences between athletes. For these t-tests the five response categories \"None of the time\", \"A little of the time\", \"Some of the time\", \"Most of the time\" and \"All of the time\" of single items were combined into dummy variables with the category \"rarely\" for the first two response categories and with the category \"yes\" for the last three response categories. Whenever group size (in the t-test) was smaller than 30 nonparametric tests were calculated additionally. Results did not show any differences regarding significance. Effect sizes according to Hedge's g were determined for all differences. All statistical analyses were performed using IBM SPSS 27 , with p-values\u2009<\u20090.05 used as significance threshold. All plots were created using the R package .To investigate associations between depression and athletes\u2019 problems, worries and fears, Pearson correlation analyses were conducted. We conducted M\u2009=\u200926.92, SD\u2009=\u20094.60) participated. Athletes of 11 Olympic sports and 24 countries took part in the study. Most participants were Olympic athletes in judo , field hockey , wrestling  and surfing . For most,  the Olympics 2020 in Tokyo would have represented their first Olympic games. A total of 40% (n\u2009=\u200934) athletes had participated in a previous Olympics, with 13% (n\u2009=\u200911) athletes participating twice or three times. Athletes detailed demographics are shown in the Flow chart diagram in Fig.\u00a0A total of 85 participants (52 women), aged 18 to 44\u00a0years (n\u2009=\u200979) reported agreeing with the decision to postpone the Tokyo Olympic Games . While a majority of athletes  reported experiencing difficulties when the Olympic games were postponed , most  also reported seeing an opportunity to better prepare for the re-scheduled Olympics in 2021  and to work on their weakness . Means and standard deviations from single items concerning feelings about the postponement, training and coping can be found in TableAlmost all participants . The commonly used cut point of\u2009\u2265\u200910 , showing that athletes in team sports report higher PHQ-8 scores than athletes from individual sports.Across the sample, the mean PHQ-8 score was 5.51 . No sex differences were found. PHQ-8 scores correlated strongly with the APSQ performance subscale, r(85)\u2009=\u20090.53, p\u2009=\u20090.001. Figure\u00a0The mean score reported on the performance subscale of the APSQ was 11.14  and individual sport , we found significant differences in on the performance subscale of the APSQ, t(83)\u2009=\u20093.28, p\u2009=\u20090.002, g\u2009=\u20090.88, 95% CI , showing that athletes in team sports report higher psychological strain than athletes from individual sports.When comparing team sport  reported significantly higher depression scores  compared to athletes having no difficulties , t(83)\u2009=\u2009\u2212\u20093.04, p\u2009=\u20090.003, g\u2009=\u2009\u2212\u20090.68, 95% CI . Similar results were obtained in relation to athletes finding training more stressful  compared to not , t(83)\u2009=\u2009\u2212\u20092.52, p\u2009=\u20090.01, g\u2009=\u2009\u2212\u20090.55, 95% CI , athletes feeling less motivated  compared to those not feeling less motivated , t(83)\u2009=\u2009\u2212\u20092.53, p\u2009=\u20090.01, g\u2009=\u2009\u2212\u20090.55, 95% CI , and athletes feeling irritable, angry or aggressive  compared to those feeling rarely irritable, angry or aggressive , t(83)\u2009=\u2009\u2212\u20095.57, p\u2009<\u20090.001, g\u2009=\u2009\u2212\u20091.24, 95% CI . Athletes seeing this time as an opportunity to work on their weaknesses reported significantly lower depression scores  compared to athletes not seeing this chance , t(83)\u2009=\u20093.12, p\u2009=\u20090.002, g\u2009=\u20090.79, 95% CI .Athletes who indicated difficulties with the postponement of the Olympics in Tokyo  shifted to the right, which suggests higher scores on the PHQ-8.Figure\u00a0Regarding density distributions of the single items addressing the chances athletes can draw from the COVID-19 pandemic and the Tokyo 2020 Olympics postponement Fig.\u00a0, the denThe aim of this paper was to explore and describe mental health symptoms and emotional responses of Olympic athletes in light of the COVID-19 pandemic. It was hypothesized that the postponement of the 2020 Tokyo Olympics would have a negative impact on athletes and their well-being. This exploratory assumption was confirmed in several ways, although we acknowledge that the results need to be interpreted in the context of several limitations, including the relatively small sample size, the low statistical power, and the use of modified outcome measures.Our results demonstrate a significant association between self-reported depression severity and athlete reactions to the postponement of the Tokyo Olympics, including perceived difficulties with training, motivation and self-regulation. These findings are consistent with other COVID-19 research regarding loss of motivation, coping problems and negative emotional response in elite athletes . Our desOur results suggest that athletes reported experiencing a range of problems associated with the postponement of the Tokyo 2020 Olympics. Athletes with higher depression scores reported experienced more impairing problems with the cancellation of the Games, including stress in training, and other motivational and self-regulatory aspects. Moreover, these athletes viewed the cancellation of the Olympic Games less as a chance to improve their performance compared to those screening below the PHQ-8 cut-off.physical health and advise amongst medical services [Very few Olympic athletes reported receiving professional support for their mental health and well-being at the time of responding. This is particularly surprising, since Olympic athletes are the highest performing athletes, who should be able to access and receive the best interdisciplinary support possible . It is uservices , despiteservices , yet theservices . While mservices , 11. Higservices .The impact of the pandemic on elite athletes exposes the weak spots of systems and organizations in relation to mental health support. The whole multidisciplinary entourage  in elite sports should be aware and prepared for mental health issues of their athletes, and national sports federations and stakeholders should create sports environments that promote mental well-being for the athletes and entourage members .In addition to the limitations we already highlighted, this study has several other limitations. Unfortunately, we did not include para-athletes or athletes from developing nations making this sample less representative. Further limitations relate to the cross-sectional study design and the reliance on self-report. Nonetheless, we see value in research on real aspects of behavior as seen in the Olympic sports represented in this study, and in highly selective samples of Olympic athletes (24 different countries and 11 different sports) like ours. It can provide clues to how athletes react to and cope with live changing events and setbacks, not only in the lab but also in real life.The study demonstrated that the present sample of Olympic athletes suffered from the uncertainty associated with the postponement of the Olympic games. Only a small amount of athletes were receiving professional help regarding mental health issues in this difficult times. Sports federations should support the athletes and offer them, for example, sports psychological support in order to be able to better deal with the uncertainties and changes."}
{"text": "Microangiopathic hemolytic anaemia, thrombocytopenia, renal failure, neurologic abnormalities, and fever form the pentad of thrombotic thrombocytopenic purpura (TTP). Early diagnosis is crucial because TTP responds well to plasmapheresis therapy but is associated with substantial mortality if left untreated. A substantial percentage of patients with TTP used to die from systemic microvascular thrombosis in the brain and the heart. However, since plasma exchange therapy became a mainstay in the treatment of TTP, mortality has reduced considerably. Diagnosing TTP can be difficult due to the vast range of symptoms and the absence of clearly defined diagnostic criteria. Hemolytic uremic syndrome and disseminated intravascular coagulation are a close differential of TTP. Here we report two patients with TTP who achieved remission when treated with steroids, plasmapheresis and were free of disease relapse till about two months during follow-up in the outpatient department. Thrombotic thrombocytopenic purpura (TTP) is one of the entities in thrombotic microangiopathy (TMA).\u00a0Eli Moschcowitz first defined TTP in 1924, and it is characterised by a pentad of symptoms, including microangiopathic haemolytic anaemia, thrombocytopenia, renal failure, neurologic abnormalities, and fever. TTP affects around 4-6 million people per year . Proof\u00a0oPatient 1oF, haemodynamically stable, and general examination revealed no abnormality, Glasgow coma scale (GCS) was E4M5V3. He was evaluated accordingly, his reports done were: blood urea- 63.9 mg/dL, serum creatinine- 1.97 mg/dL, sodium- 141 mEq/L, potassium- 3.22 mEq/L, chloride- 103.2 mEq/L, hemoglobin- 14.6 g/dL, platelet count- 42000/cumm, tropical fever workup came negative, serology was negative, blood and urine cultures were sterile, Chest X-ray (CXR) was normal, procalcitonin (PCT) was 50 ng/ml, prothrombin time (PT) and activated partial thromboplastin time (aPTT) were normal, direct and indirect Coombs test was negative, urine routine; protein +++, glucose ++, pus cell 3-/HPF, red blood cell (RBC) 25-30/HPF, ultrasound abdomen- right kidney (RK)- 11.7 x 5.8cm, left kidney (LK)- 10.7 x 6.1 cm, raised bilateral echogenicity, cortico-medullary differentiation (CMD) maintained. Liver function test (LFT)- bilirubin (direct/Indirect) 1.17/0.9 mg/dL,\u00a0aspartate transaminase (AST or SGOT)\u00a0and alanine transaminase (ALT or SGPT) were normal, HbA1c was 9.2%. MRI Brain showed no significant brain parenchymal abnormality.\u00a0After sending cultures, the patient was empirically started on intravenous antibiotics: injection piperacillin tazobactam + teicoplanin, injection artesunate with other supportive treatment. On day 1\u00a0evening, he became violent with the inability to control by restraint, was sedated and intubated, in view of the prolonged need of sedation and risk of respiratory depression, put on a mechanical ventilator. Lactate dehydrogenase (LDH) was 90 U/L on day 1. Repeat LDH on day 2 was 589 U/L which increased to 987 U/L on day 3. On day 3, renal function test (RFT) showed blood urea 191 mg/dl, creatinine 5.15 mg/dl and since morning his urine output had decreased, so the patient was\u00a0haemodialysed. Direct and indirect Coombs tests were negative and peripheral smear for schistocytes was reported as negative. In view of fever persisting over 102 - 106oF despite broad-spectrum antibiotics and antimalarial drugs, the elevation of LDH within three days, fall in hemoglobin, deranged RFTs, altered sensorium, and thrombocytopenia with normal coagulation parameters; a diagnosis of thrombotic thrombocytopenic purpura was made. His mean corpuscular volume (MCV) was 78.7 fl and the\u00a0PLASMIC score was 6 points (high risk)\u00a0denoting 72% risk of severe ADAMTS13 deficiency (defined as ADAMTS13 activity level <15%). Injection methylprednisolone 1 gm was started post hemodialysis on day 3. On day 4, LDH was 1443 U/L and the first session of plasmapheresis with an exchange of 2.5 litres followed by haemodialysis (HD) was done. The patient dramatically became afebrile after the first session of plasmapheresis, while prior to plasmapheresis he had a fever of 102 - 104oF. A second dose of injection methylprednisolone was given post HD. Improvement in LDH level and platelet count was seen on day 5 and the second session of plasmapheresis with an exchange of 2.5 litres of plasma and the third dose of injection methylprednisolone 1 gm was given. Improvement in LDH and platelet count was seen on day 6 and day 7 and the third and fourth session of plasmapheresis with an exchange of 2.5 litres was done and oral prednisolone 1 mg/kg was started on day 6. By day 8 his sensorium had improved, and he was oriented, he was extubated, and his blood reports were urea- 137 mg/dL, creatinine- 2.08 mg/dL, sodium- 139 mEq/L, potassium- 3.41 mEq/L, chloride- 98 mEq/L, hemoglobin- 11.3 g/dL, platelet count- 208000 per cumm, LDH- 705 U/L. In view of urine output of 2550 mL, plasmapheresis was withheld even though LDH was >500 U/L as his plasmapheresis filter was not reusable and it was decided to wait and see the trend of the platelet count and LDH to decide about the further need for plasmapheresis. His blood pressure started increasing, he needed Injection nitroglycerin infusion and later started on oral antihypertensive drugs. From day 9, serial RFT and platelet count showed improvement and no further plasmapheresis or hemodialysis was needed till discharge. He was shifted to ward on day 11 and after his blood sugar level was also controlled .\u00a0After it was ascertained that his RFT, platelet count, and LDH were stable he was discharged on day 14 on antihypertensive drugs, mixture insulin and oral hypoglycaemic, and prednisolone 1 mg/kg with a plan to continue the same dose for a total of one month and then taper and omit. His daily lab reports and events are shown in Table A 38-year-old man presented to our hospital with chief complaints of fever for six days and altered sensorium for two days. He was treated elsewhere for the past four days and then shifted to our hospital. On examination he was febrile - 104Patient 2A 27-year-old man presented to our ICU with fever, alteration in sensorium, and decreased urine output. On examination and investigation, he was found to have fever, disorientation, thrombocytopenia, renal dysfunction, and microangiopathic haemolytic anaemia. A diagnosis of TTP was made.\u00a0His mean corpuscular volume (MCV)\u00a0was 86 fl and the\u00a0PLASMIC score was 6 points (high risk)\u00a0denoting 72% risk of severe ADAMTS13 deficiency (defined as ADAMTS13 activity level <15%). He was initiated on three pulses of injection methylprednisolone followed by oral prednisolone 1 mg/kg for one month and then taper and omit. Alternate day haemodialysis was done till his urine output improved and daily plasmapheresis was done till his platelet count increased above 150000 per cumm. Tropical fever workup investigation was negative, HIV, hepatitis B surface antigen (HBsAg), and hepatitis C virus (HCV) were also negative, blood and urine cultures were sterile, CXR was normal, PCT was 0.42 ng/mL, PT and aPTT were normal, direct and indirect Coombs test was negative. Urine routine showed protein +++, RBC >50/HPF, pus cells 4-5/HPF, urine protein creatinine ratio (UPCR) 2651 mg/g creatinine.\u00a0Ultrasound abdomen showed RK- 11.7 x 5.8cm, LK- 10.7 x 6.1 cm, raised bilateral echogenicity and CMD maintained. LFT- bilirubin was normal. Serum SGOT (1082 U/L) and SGPT (220 U/L) were raised on admission but later normalized. HbA1c was 6%. His daily lab reports and events are shown in Table In adults, thrombotic thrombocytopenic purpura is idiopathic in around a third of instances, meaning it develops suddenly and without any known underlying cause. Women are more likely to be affected. The median age at the time of diagnosis is around 40 years old , dissemiLaboratory data should be obtained in patients who come with new thrombocytopenia, with or without evidence of renal insufficiency and other aspects of classic TTP, to rule out DIC and evaluate for signs of microangiopathic hemolytic anemia. Increased lactate dehydrogenase and indirect bilirubin, decreased haptoglobin, and increased reticulocyte count, along with a negative direct antiglobulin test, all support the TTP diagnosis. Schistocytes should be looked for in the peripheral smear. The diagnosis of TTP in both cases was made on clinical grounds. According to the newer classification, both the cases fit mostly into primary TMA acquired - TTP due to ADAMTS13  antibodies triggered due to infection, as the elevated procalcitonin levels suggested in both cases.Because plasmapheresis eliminates von Willebrand factor multimers, ADAMTS13 anti-metalloproteinase antibodies .\u00a0Fresh f3 and the LDH levels fall below 400 U/l, as these are the most sensitive markers for assessing therapeutic response [3 for two days after which plasmapheresis was halted, although LDH levels showed an increasing trend immediately after plasmapheresis was stopped and later showed a downward trend. Thus corticosteroid therapy plays a role in maintaining complete disease remission, in both of our cases following the initial rise in LDH seen after halting plasmapheresis, later on, there was a downward trend in LDH. Outpatient follow-up is essential to monitor remission or detect recurrent chronic form with a mortality rate of roughly 15% [The literature does not provide a treatment time, however, therapy should be continued until the platelet count reaches 100,000/mmresponse . In bothPrimary TTP is triggered by conditions such as pregnancy, infections, cancers, HIV, lupus, surgical stress, chemotherapy, or medications such as clopidogrel and ticlopidine. TTP is a serious condition and a keen eye is to be kept for diagnosing it when conditions which trigger it are present. Plasmapheresis is the cornerstone of therapy and has improved patient outcome considerably, and addition of corticosteroid therapy helps in maintaining complete disease remission when plasmapheresis is stopped and also at follow-up."}
{"text": "The generation of these predictive equations represents a step towards updating the ME:DE default conversion factor value of 0.82 adopted from the National Research Council to meet the ME requirements of beef cattle in Korea. The new recommended predictive equation enables the adjustment of the nutrient requirements, thus enhancing animal productivity and maximising the economic return for beef farmers.The available energy in feedstuff represents the largest proportion of the total cost for intensive beef production. Therefore, the energy content of feeds must be known before diet formulation. The determination of digestible energy (DE) and metabolizable energy (ME) values by animal experiments is both time-consuming and costly. Predictive equations to estimate the ME from DE can be useful for feed ingredient evaluations and diet formulations. A range of regression equations were developed in the present study, taking into consideration the gender and body weights of the animals, as well as the feed nutrients, to predict the relationship between the DE and ME. An evaluation of these equations suggested predicting the ME value based on ME = 0.9215 \u00d7 DE \u2212 0.1434 (R2) = 0.946, root mean square error (RMSE) = 0.107, p < 0.001 for intercept and slope). Mixed-model regression analyses to adjust for the effects of the experiment from which the data were obtained similarly showed a strong linear relationship between the DE and ME : ME = 0.9215 \u00d7 DE \u2212 0.1434 . The DE was strongly related to the ME for both genders: ME = 0.8621 \u00d7 DE + 0.0808  and ME = 0.7785 \u00d7 DE + 0.1546  for male and female Hanwoo cattle, respectively. By BW, the simple linear regression similarly showed a strong relationship between the DE and ME for Hanwoo above and below 350 kg BW: ME = 0.9833 \u00d7 DE \u2212 0.2760  and ME = 0.72975 \u00d7 DE + 0.38744 , respectively. A multiple regression using the DE and dietary factors as independent variables did not improve the accuracy of the ME prediction .This study was performed to update and generate prediction equations for converting digestible energy (DE) to metabolizable energy (ME) for Korean Hanwoo beef cattle, taking into consideration the gender  and body weights (BW above and below 350 kg) of the animals. The data consisted of 141 measurements from respiratory chambers with a wide range of diets and energy intake levels. A simple linear regression of the overall unadjusted data suggested a strong relationship between the DE and ME : ME = 0.8722 \u00d7 DE + 0.0016 (coefficient of determination (R Energy is a vital component for biological reactions and an important nutrient to meet the requirements for the maintenance, growth and reproduction of beef cattle. The energy requirements depend mainly on age, gender, body weight (BW), animal genotype, physiological state and environment . To meetn = 87 means) from different cattle breeds. Scarce calorimetric studies have been conducted in Korea to evaluate the efficiency of converting the DE to ME of the Korean native beef cattle (Hanwoo) [Hanwoo is a cattle breed native to the Republic of Korea and is one of the most economically important domestic animals in the country. The Hanwoo beef industry has experienced a considerable change between 2005 and 2017, with the total number of cattle increasing from 1.8 to 2.6 million head and an improvement of Hanwoo cattle performance in terms of the quantity and quality. The average carcass weight of Hanwoo steers increased from 343 to 437 kg and the marbling score improved from 3.6 to 5.6 within the same period, andthis trend affected the basal metabolism of the animals. Hence, Hanwoo beef cattle tended to have higher metabolic rates and require more energy for maintenance and production. Currently, farmers rely more on the use of high energy-based concentrate diets imported mainly from international markets . Vermore(Hanwoo) . Kim et (Hanwoo)  estimateTherefore, we hypothesised that Hanwoo beef cattle have been fed more digestible diets with different ME:DE conversion factors compared to the NRC conversion factor. Therefore, there is an urgent need to update this conversion factor according to the Korean context (diet and genotype). Hence, the aim of this study was to analyse the relationship between the DE and ME of typical diets for Korean Hanwoo beef cattle, taking into consideration the gender  and BW (above and below 350 kg) of the animals.The data used for the present work were from published research papers and reports. Therefore, the requirement for animal care and use committee approval was waived, because no animals were used in this study.n = 36) [n = 54) [n = 20) [n = 31) [Statistical evaluation of the relationship between DE and ME was performed using published data. The data included individual treatments from three different studies published in Korean Journals and national reports from 1983 to 2013. Data were assembled in a dataset of 141 individual animal measurements from 35 respiration calorimetry experiments with a wide range of diets and energy intake levels. In addition, data were generated from experimental studies carried out in the National Institute of Animal Science (NIAS), Republic of Korea (average data are presented in n = 36) ,11,12, f[n = 31) ,14 and hThe mixed model methods as described by Littell et al.  were usep-value of 0.05 to remain in the model. The correlation coefficients between the chemical components  and energy contents  of the dataset treatments were analysed using the PROC CORR procedure.Similar to Galyean et al. , citatio2) and root mean square error (RMSE) were determined for all the models. The R2 is an indicator that defines the best-fit equations, and the RMSE is an indicator of the model accuracy [The coefficient of determination : intercept  and slope ), and the linear regression equation was: The results of the linear regression analyses of the relationship between ME as a dependent variable and DE as an independent variable using the whole data (unadjusted and adjusted for random coefficients) are graphically represented in 2 value (R2 = 0.9999 and RMSE = 0.00403), in which the ME and DE were expressed in Mcal/kg of the DM. The 95% CI for the slope and intercept were  and , respectively. The adjusted linear regression equation was: The scatterplot of the adjusted citations for random coefficients presented in The ME:DE was about 0.87 at 2.80 Mcal/kg of the DE (approximate mean of the whole dataset).2 values of 0.9600 and 0.9718 for male (n = 90) and female (n = 51) beef cattle, respectively. The adjusted citation showed increases in the precision of the prediction equations for both male and female cattle, with R2 of 0.9929 and 0.9999, respectively. The steers showed a higher ME:DE (0.89) compared to female cattle (0.83). By BW, the unadjusted data showed a strong positive correlation between the DE and ME, where the R2 of the generated equations were 0.9907 and 0.9139 for animals with BW < 350 kg and >350 kg, respectively. The adjusted data improved the R2 of the ME prediction equations to 0.9998 and 0.9999, respectively. In addition, the results showed a difference in the ME:DE between animals with BW below and above 350 kg . The unadjusted and adjusted linear regression equations expressing the DE and ME relations for animals by gender and BW are shown in The unadjusted DE and ME relationship between the gender  and BW (<350 kg and >350 kg) are plotted in p < 0.001) with the NDF and ADF dietary contents. In addition, the ME showed strong positive correlations with the DE, EE and CP dietary contents. Specific dietary nutrients that modify the ruminal fermentation may affect the relationship between the DE and ME. The results of the residual analyses (n = 141) of the predicted ME using a simple linear regression with EE, NDF and ADF are presented in p < 0.001) of the EE (r = 0.67), NDF (r = \u20130.87) and ADF (r = \u20130.79) with the ME prediction errors, suggesting that the ME prediction will probably be biased by these dietary factors, and their inclusion could improve the precision of the predictive equations.The Pearson correlation coefficients (r) of the various chemical compositions  to the GE, DE and ME contents of the dataset treatments are presented in p < 0.001) for predicting the ME. However, the EE concentration in the diet as an independent factor was not significant (p > 0.05)  . Therefo2 = 0.9621); the intercept and slope coefficients in the model were significant at p < 0.001 , DE , CP , NDF  and ADF ).The DE and ME were expressed in Mcal/kg of the DM, and the CP, NDF and ADF were expressed as percentages of the DM (R2 = 0.9995) than the NRC equation . In addition, Equation (2) was more accurate and had a lower RSME (0.0059) than the NRC equation (RSME = 0.0079).This study highlighted the importance of updating the NRC equation used for converting the DE to ME in the Hanwoo beef industry. The data analysed represented a broad range in terms of animal age ; BW and diet type (forage and concentrate feeds) of Hanwoo beef cattle. This study showed that the ME:DE is higher than the fixed NRC conversion factor (0.82). This equation seems to not be adequate for Hanwoo beef cattle, which led to overfeeding animals to meet their energy requirements. Our DE and ME values were similar to those reported by Galyean and Tedeschi  for seveWe found a strong relationship between the DE and ME for gender and BW. This relationship was similar to that of Galyean et al. , who revThe Agriculture and Food Research Council (AFRC)  suggestsWe observed differences in energy utilisation according to gender. This difference may reflect differences in the energy costs of the maintenance and production of beef cattle of different physiological status and productivity. Our ME:DE were 0.89 in males and 0.83 in females. The steers were more efficient in converting DE to ME compared to female cattle because of the specific feeding program for steers where the animals received high metabolic diets, in particular, to produce high fat depositions in the intramuscular tissues. Steers were fed diets with a forage-to-concentrate ratio ranging from 40:60 in the growing phase (7\u201313 months of age) to 30:70 in the early fattening phase (14\u201321 months of age) and 10:90 in the late fattening phase (22\u201330 months of age) ,21. Furtp < 0.01) as the forage-to-concentrate ratio decreased, 0.86 to 0.92.Moreover, the BW is another key driver determining the relationship between the DE and ME in the feeding management of Hanwoo cattle. A BW of 350 kg at around 13 months of age is the typical switching point from the growing to the fattening phase for Hanwoo beef cattle in Korea , and thep < 0.001), initial analyses using stepwise regression indicated that only the CP, NDF and ADF concentrations in the diet were significantly independent variables, along with the DE (p < 0.001), for predicting the dietary ME (Equation (9)). This study did not consider the data points of the starch content, as some trials did not report the starch content in the diet. Moreover, the results showed that the inclusion of dietary factors did not improve the accuracy of the prediction of the ME (R2 = 0.9621) compared to the estimation of the ME using a single-variable (DE) regression approach (R2 = 0.9999).Galyean et al.  reported2 > 0.9000). However, Equation (2) gave a higher prediction precision in terms of the R2 (0.9995) compared to the NRC (2000) equation (R2 = 0.9461). Therefore, Equation (2) has higher predictive power than the previously published ME:DE [A comparative slaughter studydetermined the net energy requirements for the growth of Hanwoo steers from 6 to 30 months of age . Eight sed ME:DE , the fixThis study highlighted the importance of updating the relationship between the DE and ME recommended by the NRC using Hanwoo beef cattle data. Our results strongly suggest that the use of a constant value of 0.82 to convert the dietary concentration of DE into ME for beef cattle diets should be replaced with a new model that considers the national specificity of animal performances and the nature of the diet energy contents. Therefore, it is recommended to adopt the newly generated equation (ME = 0.9215 \u00d7 DE \u2212 0.1434) for Hanwoo beef cattle instead of the NRC ME:DE constant conversion factor of 0.82. Our results will be useful for future studies that aim to update the energy requirements for the maintenance and growth of beef cattle in Korea. Future research is warranted to re-evaluate the ME:DE conversion factor of cattle in other regions and continents according to the specificity of the breed and feed quality in order to understand the underlying mechanisms that affect the conversion of DE to ME."}
{"text": "Compared to warfarin, all reduced-dose NOACs showed significantly lower risk of S/SE , 0.63 (0.52\u20130.75) for apixaban; 0.51 (0.42\u20130.61) for dabigatran; and 0.67 (0.57\u20130.79) for rivaroxaban) and MB (0.54 (0.45\u20130.65) for apixaban; 0.58 (0.49\u20130.69) for dabigatran; 0.73 (0.63\u20130.85) for rivaroxaban). In the real-world practice among Asians with NVAF, all reduced-dose NOACs were associated with a significantly lower risk of S/SE and MB compared to those of warfarin.Reduced-dose nonvitamin K antagonist oral anticoagulants (NOACs) are commonly prescribed to Asian patients with nonvalvular atrial fibrillation (NVAF). We aimed to compare the risk of stroke/systemic embolism (S/SE) and major bleeding (MB) between patients treated with reduced-dose NOACs and those treated with warfarin, using the claims database in Korea. Patients with NVAF newly initiated on oral anticoagulants  between 1 July 2015 and 30 November 2016 were included. Among all patients with NVAF treated with OACs, 5249, 6033, 7602, and 8648 patients were treated with reduced-dose apixaban, dabigatran, rivaroxaban, and warfarin, respectively. Patients treated with reduced-dose NOACs were older and had higher CHA Oral anticoagulants (OACs) have taken a crucial role in the treatment strategy of atrial fibrillation (AF) to prevent stroke ,2,3. AltNonvitamin K OACs (NOACs), now recommended as the choice of treatment, are widely used based on evidence from recent large randomized controlled trials (RCTs), which have demonstrated their noninferiority and superior efficacy/tolerability compared with those of warfarin ,13,14,15Therefore, this study aimed to compare the risk of stroke/systemic embolism (S/SE) and major bleeding (MB) in Korean patients treated with reduced-dose NOACs versus warfarin under real clinical practice.The Korean Health Insurance Review and Assessment (HIRA) Service claims data from 1 January 2007 to 30 November 2016 were used in this study. The HIRA database includes data covering the entire population under the universal health insurance system in Korea [2DS2-VASc score of 2 or higher, all included patients are considered indicated for anticoagulation therapy.The study included OAC-na\u00efve patients who had one or more prescriptions for apixaban, dabigatran, or rivaroxaban during the intake period of 1 July 2015\u201330 November 2016. We defined the index date as the first OAC prescription date. The inclusion criteria were patients above 18 years of age on the index date and a minimum of two outpatient visits or one hospitalization with AF diagnosis  before or on the index date. The latter inclusion criterion performed well in a previous validation study with a positive predictive value of 94.1% . As the Patients with the following conditions were excluded: hip or knee replacement surgery within six weeks prior to or on the index date; valvular AF, prosthetic heart valves, venous thromboembolism, thyrotoxicosis, hypertrophic cardiomyopathy, end-stage chronic kidney disease, kidney transplant, dialysis, pericarditis, elective defibrillation, radiofrequency ablation, or left atrial appendage occlusion during the 12-month baseline period; NOAC or warfarin use within 1 year prior to the index date; more than one OAC prescription on the index date; both standard and reduced dose on the index date; both standard and other dose on the index date; or both reduced and other dose on the index date.Standard dose was defined as the general recommended dose for patients with AF as specified in the package insert . Reduced dose was defined as the recommended dose for patients who have renal dysfunction and/or low body weight or are elderly as specified in the package insert . Other dose was defined as a dose lower than the reduced dose on label or higher than the standard dose .The follow-up period was from the index date to the date of switching from index OAC treatment to another OAC, treatment discontinuation, death, or 30 November 2016, whichever came first. Discontinuation was defined as the absence of prescription for any OACs within 30 days after the last day of supply of the last filled prescription. Medication switch was defined as the presence of a prescription filled for nonindex OAC treatment within 30 days after the last day of supply of the last filled prescription.S/SE was the effectiveness outcome and included ischemic stroke, hemorrhagic stroke, and systemic embolism. Diagnosis codes with hospitalization and brain computed tomography (CT) or magnetic resonance imaging (MRI) records were used to identify stroke ,23, wher2DS2-VASc score, HAS-BLED score, and individual risk factors of CHA2DS2-VASc and HAS-BLED scores. The details on CHA2DS2-VASc and HAS-BLED scores, baseline medication use, and CCI are provided in Propensity score matching (PSM) using propensity scores was conducted to balance baseline demographics and clinical characteristics. Propensity score is the probability of receiving treatment, which is based on the observed characteristics . We usedFor analysis, the following three comparisons were performed: (1) reduced-dose apixaban versus warfarin, (2) reduced-dose dabigatran versus warfarin, and (3) reduced-dose rivaroxaban versus warfarin. All statistical analyses were performed using SAS 9.4 .2DS2-VASc and HAS-BLED scores compared to those of patients treated with warfarin , 87% of patients were prescribed on-label NOAC doses; the rates of underdosing and overdosing were 9.4% and 3.4%, respectively [In a US prospective registry for patients with AF receiving NOACs , this study\u2019s results provide additional information on the benefit of NOACs over warfarin in Asian patients requiring anticoagulation for stroke prevention.Although this study could not differentiate between the appropriate and inappropriate use of reduced-dose NOACs, the study findings revealed the clinically significant data on reduced-dose NOACs that may provide benefits in real-world practice compared to warfarin therapy. However, caution is warranted in its interpretation and use of reduced-dose NOACs should be strictly based on prescribing labels. This finding suggests that NOACs, regardless of dosage, may provide better clinical outcomes in patients with AF for whom warfarin is indicated. Poor INR control and low treatment satisfaction of VKA users among Korean patients with AF might be one of the potential underlying reasons for the observed differences in outcomes between warfarin and reduced-dose NOACs in this study . In anotThis study has some inherent limitations associated with the retrospective analysis of claims data. First, the HIRA database does not include data on some patient characteristics such as body weight or laboratory data, including INR and those related to renal and liver function. Therefore, assessing whether patients were managed with appropriate doses of anticoagulants was challenging. In addition, the adequacy of anticoagulation in patients in the warfarin group could not be determined due to lack of information on INR, which may affect the clinical interpretation of the study results, as Asian AF patients tend to be kept at a lower INR range compared to that of non-Asians. Second, the claims database that we utilized in this study cannot discern the specific type of AF . Third, despite the careful adjustment of confounders by PSM, thereby allowing a close balance between the groups, the presence of unmeasured confounding factors cannot be ruled out. Finally, the study follow-up period was relatively short as reimbursement of NOACs as first-line therapy was initiated on 1 July 2015. Therefore, further studies are necessary to explore the long-term effectiveness and safety of NOACs. However, the Cox proportional hazards model revealed significant differences in all comparisons; therefore, the relatively short follow-up period might not have had a significant impact on the main findings of this study.In a large observational study of reduced-dose NOACs, NOACs were associated with lower thromboembolic and bleeding risk compared to those of warfarin. Nevertheless, the use of NOACs should adhere to dose-reduction criteria indicated in the therapeutic label. This study provides further evidence for the use of NOACs in Asian patients with NVAF."}
{"text": "The titer of the anti-SARS-CoV-2 antibodies produced after vaccination shows a relevant decay over time, as demonstrated in several studies. However, less is known on the possible factors affecting the entity of this decay. The aim of this study is to analyze a group of individual factors which are possibly associated with anti-SARS-CoV-2 antibody titer decay six months after the second vaccine dose. We report here the results of a follow-up serological analysis and a questionnaire-based evaluation of a sample of workers from an Italian nursing home, vaccinated with two doses of BNT162b2 vaccine in early 2021. The baseline data were collected one month after the vaccine, while in the present analysis we report the data collected six months later. Our data show a relevant decay of the neutralizing antibody titer, even if for all the workers a largely positive response was detected. Moreover, our results demonstrate a possible association between younger age and the absence of previous COVID-19 infection, and a higher decay rate of the anti-SARS-CoV-2 antibodies titer. The decrease in the protection against SARS-CoV-2 new infections and re-infections after a few months from the second vaccine dose has highlighted the need for a third booster dose. The administration of this further anti-COVID-19 vaccine dose began in European and North American Countries in the second half of the year 2021 ,4. CurreAccording to these premises, the objective of this work is to evaluate a series of individual factors which are possibly associated with a significant decrease of the anti-RBD IgG antibody titer in a sample of healthcare workers (HCW) six months after the second dose of the COVID-19 BNT162b2 vaccine.We performed a new evaluation of a previously described group of workers employed in a nursing home in northern Italy, who received two doses of the anti-SARS-CoV-2 BNT162b2 vaccine in early 2021 . The nat-being an employee of the nursing home at work during the period January\u2013August 2021;-being vaccinated with two doses of the Pfizer/BioNTech BNT162b2 anti-SARS-CoV-2 mRna vaccine between 12 January and 17 February of 2021 ;-having participated to our first baseline investigation, with an available anti-SARS-CoV-2 IgG antibody titer determined via a serological test performed in our lab.The inclusion criteria of this follow-up study were:No other exclusion criteria were applied.We did not only consider healthcare operators for our analysis, but also included other workers employed in the nursing home such as administrative personnel, cleaning service and kitchen staff and maintenance workers. Healthcare workers (HCW) were categorized as follows: nurses, nurses\u2019 assistants, physicians and other HCW . All the personnel voluntarily agreed to participating in our study, and signed a written informed consent. The study was approved by our local institutional review board.As reported in our prior publication , four weDuring the baseline investigation we collected a self-reported questionnaire  Supplem and a set test, and one-way analysis of variance (ANOVA) with the Bonferroni test were applied whenever necessary. Mann\u2013Whitney test was used to compare the percentage of anti-SARS-CoV-2 neutralizing IgG titer decline between two subgroups and Kruskal\u2013Wallis test for the comparison of three or more subgroups. Multivariate linear regression analysis was performed to determine whether the participants\u2019 characteristics  influenced anti-SARS-CoV-2 neutralizing IgG titer decline six months after the vaccination. Data collected were analyzed using STATA Software . Regarding statistical significance, a p value < 0.05 was considered.Logarithmic transformation was used to normalize anti-SARS-CoV-2 neutralizing IgG and the results are expressed as median and ranges. The chi-square test, paired n = 28), 20.6% by other HCWs (n = 13), 14.3% by kitchen and cleaning personnel (n = 9) and 20.6% by technical and administrative personnel (n = 13).A total of 63 out of 74 employees of the nursing home (85.1%) investigated in our first study agreed to participate in the follow-up and gave a further blood sample for the determination of the anti-SARS-CoV-2 IgG titer. Workers were for the 79.4% females, with a median age of 54 years old (range: 25\u201373). Regarding job type, 44.5% of the sample was composed of nurses, nurses\u2019 assistants and physicians (p < 0.001), also considering the subjects grouped according to the different variables investigated  , while after six months the titer was 876 (156\u20136034). For all the subjects, a decrease of the titer was observed and the difference between the first and the second determination was highly significant (iseases) . In Figuiseases) .In Overall, the decline of the antibody titer reached 83%, slightly higher in males compared to females (84.5 vs. 82%), even if the difference is not statistically significant .p = 0.04, p = 0.001).We observed a significant difference evaluating the decay of the titer with respect to age-classes: in the younger group, the highest decrease of the titer was observed , while in the older group the decrease of 78% is lower compared to the other age-classes (p = 0.085) (p = 0.017), as well as for those with no previous COVID-19 infection (p = 0.016) (p = 0.024), while for previous COVID-19 the coefficient was \u22122.57 .No significant differences in the decrease of neutralizing antibodies\u2019 titer were observed according to BMI and smoking habit, and, as expected, according to job type . A lower= 0.085) . A signi= 0.016) . Using mConsidering the number of concomitant diseases reported, no differences in the reduction of the titer were identified when comparing workers with no diseases vs. personnel with 1 or \u22652 pathologies .Our results are a further confirmation of the relevant decline of the anti-SARS-CoV-2 IgG titer six months after the second dose of anti-COVID-19 vaccination ,4,5,6. NThe second objective of this work was to identify possible factors associated with different decay rates of anti-SARS-CoV-2 IgG titer six months after the vaccines. It should be underlined that, considering our data, the most relevant decline was observed in those subjects who had a higher antibody titer at the baseline, confirming recent data . This isWith regards to the role of previous SARS-CoV-2 infection, it is well documented that HCW who had a SARS-CoV-2 infection plus a vaccination reach higher anti-SARS-CoV-2 antibody titer one month after the vaccination when compared to subjects with no infection history, and our results are in agreement with these findings ,24,28. MConsidering recognized risk factors for COVIID-19 as high BMI, smoking status and the number of concomitant diseases , we did Among the main limitations of our study there is the small sample size and the observational nature of the research, analyzing self-reported data collected with a survey. Among all the variables analyzed, the self-reporting may have been particularly critical for the variables related to the medical anamnesis of the subjects, including the data on anti-flu vaccination and those on concomitant diseases. This data would be better captured with more objective methods, based on the direct collection of clinical data by health professionals. Regarding the diseases, we tried to overcome this limitation by performing a blind and rigorous ex-post coding of the answers to the open questions given by the respondents. Moreover, we tested various approaches, categorizing the diseases in different ways, considering the specific types of pathologies, finally keeping the most reliable variable we used in the multivariate analysis . Regarding the anti-flu vaccine, in this case the possibility of further cleaning and testing the self-reported data in different ways was not reliable, as we had only one yes/no question based on the survey administered. For this reason, the finding related to anti-influenza vaccine must be interpreted with extra caution, and has to be confirmed with an additional analysis of larger samples, possibly including more objective data on the performance of the vaccine. Our study may have also technical limitations, referred in particular to the determination of the anti-SARS-CoV-2 antibody titers and to the assay performed, including the possible presence of different immunoglobulins\u2019 isotopes and their relations with the total level of circulating antibodies. Moreover, other limitations of our study are intrinsically related to its nature and to the source population, which is selected from a small nursing home located in northern Italy, where the spread of SARS-CoV-2 was particularly relevant compared to other areas of Italia and the world during the first few months of the pandemic. Furthermore, it should be taken into consideration that this is a professionally exposed population, with a significantly higher exposure to SARS-CoV-2 compared to the general public: this peculiarity, together with the already mentioned issue of the small sample size, makes the extrapolation of our findings to a wider public not possible. Finally, the limitations intrinsically related to the variability over time of the virus, and in particular of SARS-CoV-2, should also be mentioned here: the changes of the virus, considering the quite long duration of our study, may have influenced the antibodies\u2019 titer of our population, with different individual responses based on the virus variant and viral load exposure.Despite these limitations, our study has also important strengths, as almost all the subjects investigated one month after the vaccination agreed to participate again six months later, filling in the same questionnaire administered the first time and being evaluated for the anti-SARS-CoV-2 with the same test applied for the first serological determination. Moreover, all the subjects had been vaccinated with two doses of the same anti-COVID-19 vaccine, indicating that the possible differences in the decline of the antibodies\u2019 titers, identified across sub-groups, cannot be related to different vaccines used or different number of doses administered.Our study in a sample of Italian nursing home workers shows a relevant decay of anti-SARS-CoV-2 neutralizing antibodies six months after the second BNT162b2 vaccine dose. A largely positive antibody response was detected in the totality of the sample. We found that the absence of previous COVID-19 infection and a younger age were significantly associated with a higher decay of the antibody titer."}
{"text": "Objectives: This is a longitudinal prospective study which was designed to assess the trend of anti-SARS-CoV-2 antibodies targeting the Spike (anti-S) and Nucleocapside protein (anti-N) viral antigens over a 9-month period after the administration of an anti-SARS-CoV-2 vaccine in a big COVID-19 hospital located in Northern Italy. Participants: 7411 vaccinated workers were included in a linear mixed-effect model analysis performed to model the anti-S decay over the 9 months following the vaccination, during serological screening performed approximately 2, 4, and 9 months following the first jab administration. Serological tests performed in the 9 months preceding vaccine administration were retrospectively analysed to identify the burden of infections occurring before vaccination. Results: The serological assays were used for monitoring the antibody titres during the observational period. Vaccination significantly reduced the rate of infection and elicited a specific humoral response, which lasted during the whole observational period (9 months). A decay was observed in all considered subgroups. At 35 weeks, workers with no history of pre-vaccine infection showed a significantly lower anti-S titre (\u22122522 U/mL on average (\u22122589.7 to \u22122445.7)); younger workers showed significantly higher anti-S titres (140.2 U/mL on average (82.4 to 201.3)). Only seven immunocompromised workers did not show significant levels of anti-S antibodies; three of them, all females, showed a specific T-cell response. Conclusions: Comparing the 9-month periods before and after the first vaccine dose, a significant reduction in infection rate was observed (1708 cases vs. 156). Pre-vaccine infection, especially if contracted during the first pandemic wave, greatly enhanced the response to vaccination, which was significantly affected also by age both in extent and duration (inversely related). A gender effect on the T-cell immune response was observed in a small group of workers who did not produce antibodies after vaccine administration. Vaccination against SARS-CoV-2 started in Italy, as well as other European countries, on 27 December 2020 (European Vaccine Day), soon after the EMA released a conditional marketing authorization for the BNT162b mRNA vaccine , hence mASST Spedali Civili is a public, major European COVID-19 centre in Lombardy, Northern Italy, an area strongly hit by the pandemic since its early beginning, which accounted for around 500,000 cases and over 25,000 deaths in 2020 . Before The main objective of the present study was to evaluate the 9-month trend of anti-SARS-CoV-2-S (anti-S) antibody titres in vaccinated workers, also considering age, gender, and pre-vaccine SARS-CoV-2 infections, as well as to evaluate the effectiveness of the vaccination campaign over time. The trend of anti-N antibody titres was also monitored, and anti-N serological conversions in vaccinated workers were used to identify new SARS-CoV-2 infections. Finally, we evaluated the anti-SARS-CoV-2 T-cell response induced by vaccination in a very small group of vaccinated workers who did not develop detectable amounts of anti-S antibodies after two vaccine doses.0) and then in March\u2013April 2021 (T1), May\u2013June 2021 (T2), and August\u2013October 2021 (T3) for determination of both anti-S and anti-N antibody titres. All samples collected within 24 h from the vaccine 1st jab were included in the T0 group; T1, T2, and T3 groups include all samples collected more than 14 days, more than 90 days, and more than 180 days from the vaccine 1st jab, respectively , involved 382 workers at T0). Further serological blood samples were taken on average after 2 (T1), 4 (T2), and 8 (T3) months. A total of 7411 individuals performed at least a test during the observational period and were enrolled in the study. A full description of the entire cohort, which includes administrative staff, assistant personnel, nurses, physicians, other HCW and \u201cexternal\u201d workers , is presented in the 0 and in the 9 months before (in spring 2020 and autumn 2020), as they had shown higher sensitivity in detecting previous SARS-CoV-2 infections among our personnel [0) to further minimize the risk of misclassification. New cases of SARS-CoV-2 infection in vaccinated workers were identified by anti-N sero-conversion.We planned a prospective longitudinal cohort study involving the WF (mostly HCW) of the ASST Spedali Civili di Brescia, one of the largest tertiary university hospitals in Italy, with over 1500 beds and an estimated workforce of 9436 individuals, including those who are not directly employed but who are continuously working in the hospital. Every worker receiving the 1st dose of the anti-SARS-CoV-2 vaccine (N = 8648 people) had the chance to join the study and undergo a baseline serological screening ; written informed consent was obtained from all participants. The study was reported according to the Strengthening the Reporting of Observational Study in Epidemiology (STROBE) Statement.None.\u00ae SARS CoV2 S1/S2 IgG assay , whereas, during autumn 2020, electrochemiluminescence immunoassay (ECLIA) Elecsys\u00ae Anti-SARS-CoV-2, which detects immunoglobulins (IgG/A/M) anti-N , was used. The response to the vaccine (from T1 onwards) was assessed using the ECLIA Elecsys\u00ae Anti-SARS-CoV-2 S for anti-S (IgG/A/M) detection .During spring 2020, serum samples were tested using the chemiluminescent immunoassay Liaison\u00ae SARS CoV2 S1/S2 IgG is a CLIA assay for the in vitro quantitative detection of IgG anti-S (anti-S1 and anti-S2) in serum and plasma. Recombinant S1 and S2 antigens bound to magnetic beads and the mouse monoclonal antibody anti-human IgG were used to detect and quantitate IgG in human samples. The results are expressed as U/mL, and specimens are considered negative if <12 U/mL, equivocal between 12 and 15 U/mL, and positive if \u226515 U/mL.Liaison\u00ae Anti-SARS-CoV-2 is an ECLIA immunoassay for the in vitro qualitative detection of antibodies (IgG/A/M) against SARS-CoV-2 in human serum and plasma. The assay uses a recombinant protein representing the nucleocapsid (N) antigen in a double-antigen sandwich assay format. The results are expressed as the cut-off index, the cut-off being 1.Elecsys\u00ae Anti-SARS-CoV-2 is an immunoassay for the in vitro quantitative determination of antibodies (IgG/A/M) to the SARS-CoV-2 Spike (S) protein receptor binding domain (RBD) in human serum and plasma. The assay uses a recombinant protein representing the RBD of the S antigen in a double-antigen sandwich assay format. The results are expressed as U/mL, the cut-off was 0.8 U/mL, and the upper limit of detection was 250 U/mL. Since the antibody titres elicited in immunized individuals were very high, we tested all serum samples at a dilution of 1:20, in accordance with Roche, so the upper limit of detection raised to 5000 U/mL and the dynamic range could be extended.Elecsys\u00ae, Venlo, The Netherlands), an interferon-gamma release assay (IGRA) consisting of two antigen tubes that use a combination of proprietary antigen peptides specific to SARS-CoV-2 to stimulate lymphocytes involved in cell-mediated immunity in heparinized whole blood samples. The QuantiFERON SARS CoV-2 Ag1 tube contains peptides targeting CD4+ epitopes from the receptor binding domain (RBD) of the spike protein with overlap to span the entire RBD, whereas the Ag2 tube contains immunodominant CD8+ epitopes selected from the entire spike protein and CD4+ epitopes from the RBD. Plasma from stimulated samples can be used for the detection of IFN-\u03b3 using an enzyme-linked immunosorbent assay (ELISA)-based platform. Specimens were processed according to the manufacturer\u2019s guidelines. Following ELISA, quantitative results (IFN-\u03b3 concentration in U/mL) were recorded and used for analysis. According to the manufacturer\u2019s instructions, a positive response was defined as a value at least 0.20 U/mL greater than the background U/mL value from the QuantiFERON SARS-CoV-2 Nil tube; the Nil tube value was subtracted to mitigate against background IFN-\u03b3 in the sample that was not a result of SARS-CoV-2-specific T-cell stimulation. Median (min\u2013max) Nil subtracted IFN-\u03b3 responses were plotted, and the median was chosen to illustrate the central measurement of the dataset in which biological variation could skew results. Minimum and maximum values were provided to inform the range of responses in addition to the central (median) value.The T-cell response against SARS-CoV-2 was evaluated via the QuantiFERON SARS-CoV-2 assay  and R (version 4.1.0).Normality of distributions was assessed using the Kolmogorov\u2013Smirnov test. Categorical variables are presented as frequencies or percentages and compared by the chi-squared test or Fisher\u2019s exact test, as more relevant. Continuous variables were summarised by the means \u00b1 standard deviations (SD) when normally distributed or as medians, interquartile range (IQR) when a skewed distribution was observed, and a bootstrapped two-way ANOVA for repeated measures was applied to test differences among groups over time. Multivariate logistic regression was used to identify groups at higher risk of infection. A multivariable linear mixed effect model was performed to estimate the anti-S decay over time adjusted for pre-vaccine SARS-CoV-2 infection, sex, and age to address potential sources of bias and to test group differences through the introduction of interaction terms. Covariates were included based on the hypothesis that they could have an influence on the anti-S trajectories. A restricted cubic spline with 3 knots, in which outer quantiles were set at the 1st and 9th decile, was applied to allow for a non-linear relationship between time and anti-S levels. A total of 500 bootstrap iterations were used to account for the non-normal outcome distribution. The choice of the mixed-effect models also allowed us to deal with missing data at T\u00ae, Pfizer\u00ae, New York, NY, USA/BioNTech\u00ae, Mainz, Germany; >99.1%), and 6862 (79.3%) were included into the T0 group of the SeroCoVax-BS Project  were vaccinated against SARS-CoV-2, most of them with the BNT162b2 mRNA vaccine , 493 (29%) males and 1215 (71%) females. Pooling together the serological tests performed in 2020 and those performed at T0 vs. 23.1 U/mL at T1, 20.1 U/mL at T2 and 14.4 U/mL at T3) together with a significant increase with age. Higher antibody titres were measured in the older age groups at the different sampling times  identified by RPS.A significant decrease of anti-N antibody levels over time was observed , p = 0.037 for 50\u201359 years and over 60 years age groups, respectively, compared to the reference age group 20\u201329).During the entire observational period, sero-reversion of anti-N antibody titres was observed in 85 individuals, about 6% of all workers who tested positive for anti-N serological assays. Such event was not affected by gender and was inversely associated with age groups (OR 0.36 (95%CI 0.19\u20130.69), 1, anti-S assays demonstrated a 99.9% effectiveness of the vaccine in terms of serological conversion . During the whole observational period, two serological reversions were detected at T3 in two over-50 aged males. p < 0.001). In contrast to anti-N antibodies, an inverse relationship of anti-S antibodies with age groups was observed at T1, T2, and T3 (p < 0.001).At T0\u2013T1), we observed an average decrease of \u221242.3 U/mL per week ; at the average time of the second interval , there was a reduction of \u221237.4 U/mL per week  while at the average time of the third interval  the decrease per week is almost null .The bootstrapped simple linear mixed-effect regression model showed an overall non-linear antibody decay over time that stabilizes at around 1477.4 U/mL  after 39 weeks since the first jab A. The deWhen introducing an interaction term between time and pre-vaccine infection , we observed significant differences at any time between both groups  as well When comparing the trends between genders in the whole sample, we only observed a significant difference during the first weeks , always on the sample. In this case, we could observe statistically significant differences at any time, where younger subjects had higher anti-S antibody titres  as well When we stratified by gender and pre-vaccine infection groups, we observed significantly higher anti-S antibody titres in females compared to males among subjects that were not infected during the first and last weeks of observation but not in the central part of the follow-up . Both thWe then analysed our sample stratifying by age and pre-vaccine infection groups. Among not infected subjects, those below 50 years old showed higher anti-S antibody titres compared to older subjects . Both cuWe finally compared the subjects with no pre-vaccine infection, those who got an infection during the first wave and those who got a pre-vaccine infection later in time. The last two groups had similar anti-S antibody titres during the first weeks but those who got the infection during the first wave showed higher anti-S antibody titres  and a leOverall, seven vaccinated workers did not develop a significant amount of anti-S antibodies. All such workers were in treatment with immunosuppressive drugs due to their clinical conditions, which are summarized in 0 confirmed that our hospital, with a prevalence rate of infected workers of 19.8%, was severely hit by the first (March\u2013April 2020) and second (October\u2013November 2020) pandemic waves. Such a high infection rate can possibly explain the in-mass adhesion (>90%) of workers to the vaccination campaign, well before the enaction of the Italian Law n. 76/2021 on 28 May 2021, which made SARS-CoV-2 vaccination mandatory for HCW. Females showed a significantly lower risk of infection, whereas a higher risk was found both for nurses  and \u201cother HCW\u201d , as well as in the youngest age group . Vaccination, which mostly occurred with the BNT162b2 vaccine , succeeded in reducing the rate of infection among our workforce despite the local increase of cases observed during the first trimester of 2021 [To the best of our knowledge, this is the first longitudinal study investigating the trends of anti-N and -S antibody titres in such a large sample for such a long time. Since the beginning of the SARS-CoV-2 pandemic, six in-mass serological screenings were performed on the WF of the ASST Spedali Civili of Brescia Hospital, the last four in the context of the SeroCoVax-BS prospective study. The 2020 serological screenings and those at T of 2021 . A compa of 2021 .1\u2013T2 period plus a further 22% during the T2\u2013T3 interval). In general, the production of anti-SARS-CoV-2 antibodies was strongly influenced by age, showing a complementary pattern: while higher anti-S antibody titres were observed in younger workers, higher anti-N antibody levels were found in the older age groups. The hypothesis that a dysregulated antibody response could be related to the severity of the disease observed in different age groups needs to be further investigated [Despite the persistence of a positive serological response, our data documented a progressive decay of anti-S antibodies of approximately 46% in 9 months . This phenomenon may lead to misdiagnosis of previous infections. While a positive test for anti-N could be considered a reliable marker of previous SARS-CoV-2 infection, a negative test should not rule it out, especially in younger individuals, who are more prone to lose this type of antibodies over time. This finding again agrees with what was observed in the REINASSANCE study [We also observed a reduction in anti-N antibody titres and 85 cases of sero-reversion in individuals who tested positive at TCE study . Only a CE study . RegardlCE study ,21. FurtCE study ,23,24.0). Misclassification due to possible anti-N sero-reversions was addressed considering the results of serological tests performed during 2020, at the end of the first and second pandemic waves, which were cumulated with the baseline. Preferring serological test results to RPS increased the sensibility and specificity [Based on the sero-conversion of anti-N antibodies, we could detect 156 new infections during the 9-month follow-up, mostly occurring in the first two months after the first vaccine jab . Such a figure and the constant pauci-symptomatic clinical course of all such cases allowed us to estimate a protection from SARS-CoV-2 infection above 95% and a 100% protection from hospitalization during the first nine months following the first jab administration. A possible limitation of the study is that no anti-S assay was performed at the baseline (Tcificity  for iden"}
{"text": "In recent years, evolutionary algorithms based on swarm intelligence have drawn much attention from researchers. This kind of artificial intelligent algorithms can be utilized for various applications, including the ones of big data information processing in nowadays modern world with heterogeneous sensor and IoT systems. Differential evolution (DE) algorithm is one of the important algorithms in the field of optimization because of its powerful and simple characteristics. The DE has excellent development performance and can approach global optimal solution quickly. At the same time, it is also easy to get into local optimal, so it could converge prematurely. In the view of these shortcomings, this article focuses on the improvement of the algorithm of DE and proposes an adaptive dimension differential evolution (ADDE) algorithm that can adapt to dimension updating properly and balance the search and the development better. In addition, this article uses the elitism to improve the location update strategy to improve the efficiency and accuracy of the search. In order to verify the performance of the new ADDE, this study carried out experiments with other famous algorithms on the CEC2014 test suite. The comparison results show that the ADDE is more competitive. Optimization exists in various fields of engineering and applications , and theTo solve the problem of numerical optimization, Price and Storn firstly proposed differential evolution algorithm (DE) in 1995. Since the 21st century, more and more advanced DE variants have been proposed to be applied in different fields . It has The rest of this article is arranged as follows: in the second section, we briefly review the development of DE, the ABC algorithm, and their famous variants; The third section introduces the principle and structure of the proposed algorithm in detail. In \u201cExperiment and Result\u201d, experiments are carried out in the CEC2014 test suite , and theIn this section, two important branches of the stochastic optimization algorithm, the famous ABC and the powerful DE, are reviewed as well as their variants.In the ABC algorithm, the global optimal solution is found through three different stages. In the first stage, the leader bee looks for a better honey source in the neighborhood of the honey source (feasible solution); in the second stage, the following bee selects one of the leading bees to follow and collect honey according to the information of the quality of the honey source found by the leader bee, so as to find a better honey source in the neighborhood of the honey source; in the third stage, when the leader bee cannot find a better honey source for many times, he will become a reconnaissance bee, The new honey source location was randomly searched within the search range. The standard functions of the location update process of the original ABC algorithm are shown as follows.\u03bb is a random number and in the range of , when the function value of the new honey source is better, the new honey source is used to replace the original honey source, otherwise the original honey source is retained. The original ABC algorithm updates the position by randomly approaching or away from other bees, which greatly enhances its search ability, but also weakens the exploitability and is not easy to converge to the global optimal solution. In the development of the ABC algorithm, many excellent ABC variants have been proposed . For exaDE is a powerful evolutionary algorithm, the core idea of which is survival of the fittest. The evolution process of DE imitates the operation of mutation, crossover, and selection in genetics. It is a robust global optimization algorithm. The operation mechanism of DE consists of four steps . First, In the past 20 years, scholars have done a lot of research on DE, and many DE variants , 2013b hAs we all know, search and development are equally important for the performance of swarm intelligence algorithms. DE is well known for its powerful development performance, which largely benefits from its multidimensional search strategy. In the search process, it can quickly approach the global optimal solution, but there will be premature convergence. This is caused by the lack of search performance in the late iteration, and the one-dimensional search strategy can make up for this deficiency. ABC algorithm is famous for its powerful searching ability. It uses a one-dimensional search strategy to update the location. Inspired by ABC, a new DE algorithm is proposed in this study, which update by the adaptive selection of single or multi-dimensional search strategy. The arrangement of this chapter is as follows: In the first part, the improved location update equation is given. In the second part, the adaptive selection scheme for the multi-dimensional update or single dimensional update is described. Finally, the pseudo-code of the proposed ADDE algorithm is given in the third section.Generally speaking, elitism is an effective technique to enhance the performance of the algorithm in the optimization process: using elitist individuals  to guide other individuals to complete the evolution, will more quickly approach the global optimal solution. However, when only one elite is used, for example, only the global optimal position of the current iteration is used for guidance, it is easy to fall into the local optimal solution and converge prematurely.In the second stage of the ABC algorithm, it is easier for observation bees to follow the better bees to collect honey. This means that the better the individual is, the easier it is to be selected for one-dimensional location updating. This is undoubtedly beneficial to the whole optimization process. The difference is that the poor individuals in the population usually mean that they are far away from the global optimal solution, and multidimensional updating can speed up the whole optimization process. Based on this, this article proposes an adaptive selection scheme based on ranking. Its selection mechanism is as follows:Among them, As shown above, the higher the current individual ranking, the easier it is to choose a single-dimensional update strategy, while the lower the ranking, the easier it is to choose a multi-dimensional update strategy. In particular, when using a multi-dimensional strategy, there is still a need for crossover, and when using a single-dimensional strategy, there is no need for crossover. In the adaptive dimension selection scheme, according to the ranking of multi-dimensional or single dimensional update strategy selection, is a kind of effective play to their expertise technology, to achieve the balance of search and development.In our experiments, the CEC2014 benchmark set is used to evaluate the performance of the proposed algorithm. In the test benchmark suite, all benchmark functions can be divided into four categories: single-mode function  fitness value will get more position update opportunities. These two improvements are reflected in the location update strategy and adaptive selection scheme of the ADDE algorithm. Therefore, we compare our algorithm with some famous ABC variants and advanced DE variants to verify the effectiveness of our algorithm. ABC variants include: GABC, MABC, IABC, QABC, and DE variants include: DE/rand/1, RBDE, DEGL, SADE, QUATRE, S-QUATRE, QUATRE-DEG. The parameters of all algorithms are in line with the original recommended values, and the detailed parameters are listed in maxFES, is set to 10e4*D, where D is the dimension. We then compared the average value of fitness error \u2206f and std (standard deviation) of 51 runs of each algorithm. In order to evaluate the significance of the two algorithms, a paired nonparametric statistical procedure of Wilcoxon\u2019s signed rank test, was performed on experimental data  benchmarks, and some benchmarks still got worse. In addition, both ADDE and RBDE improved better than DE/RAND/1 and RBDE on high-dimensional problems, both achieving 28 better and a similar result on the 50D basis. Secondly, compared with the improved results of SADE, which is also an adaptive scheme, ADDE has the best effect on the basis of 30D, achieving 26 better results and one similar results. It only becomes worse on F6, F7 and F27. Finally, the improvement of ADDE over advanced QUATRE-DEG deteriorates as the dimension increase, becoming best at 10D, obtaining 26 better benchmarks, and 24 and 23 better benchmarks at 30D and 50D, respectively. It can be analyzed that compared with the more advanced DE variants, the effect on the high-dimensional benchmark is slightly decreased. This is because ADDE algorithm has enhanced certain search ability (from ABC), so the development energy will be relatively weaker, and some high-dimensional problems need to be developed more. Overall, however, we still got the best performance compared to these DE variants.We select the representatives of four benchmark functions in the CEC2014 test suite and analyze their convergence rate, including basic single-mode function FUNC1, FUNC3, basic multi-mode function FUNC6, FUNC9, FUNC15, FUNC16, mixed function FUNC17\u2013FUNC22, combined function FUNC27\u2013FUNC30. We evaluate the algorithm complexity of the novel ADDE on 30D, and the algorithm complexity of the CEC2014 is given in DE is a simple and powerful algorithm, which has attracted more and more attention in recent years. We know that the outstanding development ability of DE is largely due to its multidimensional search strategy, which enables it to quickly approach the global optimal solution. But for a better solution, the one-dimensional search strategy can ensure a greater update success rate. Especially in the late stage of the optimization iteration, the one-dimensional search strategy can slow down the particles falling into the local optimal solution. Based on this, this article proposes an adaptive updating scheme, which uses multi-dimensional and one-dimensional updating strategies to achieve a better balance between search and development. The multi-dimensional updating strategy comes from the improvement of the standard DE algorithm, while the one-dimensional updating strategy comes from the improvement of the standard ABC algorithm. The main idea to improve them is to increase elitism which is used to improve the overall optimization speed. To verify the performance of our ADDE algorithm, we compared it with other famous ABC variants and DE variants on the CEC2014 dataset. The results show that the new algorithm is competitive. In the future, we will further use ADDE to solve practical engineering problems .10.7717/peerj-cs.1007/supp-1Supplemental Information 1Click here for additional data file."}
{"text": "Althaea officinalis L., radix), which we can find in European pharmacies, are widely used among the European population. However, recently, voices have been heard in the public about alleged PTE occurrence. In this article, the levels of Pb and Cd impurities were measured in samples of THMPs with marshmallow root available in Polish pharmacies (n = 10). Our proposed toxicological approach was based on two important issues. The first was PTE levels (Pb: 1.60\u20136.80 \u03bcg/L and Cd: 0.80\u20133.81 \u03bcg/L presented as raw results) in comparison with the permissible limit set by FAO/WHO for medicinal herbs  and also ICH Q3D guidelines . The second was the estimation of exposure of investigated PTE in a single dose and daily dose for each THMP. It should be noted that the content of analyzed heavy metals in a single dose of analyzed products was very low, and hence is not a threat for patients. The obtained daily intake of heavy metals impurities in comparison with PDE values confirms the safety of all analyzed phytopharmaceuticals . It can be summarized that each of the analyzed THMP with marshmallow root available in Poland are safe for the patients. Based on literature review, this article is the first study about heavy metals impurities level in final THMPs with A. officinalis L., radix  available in European pharmacies.The level of potentially toxic elements (PTE) in phytopharmaceuticals can be a potential threat to human health through the food chain. The traditional herbal medicinal products (THMPs) with the marshmallow root ( Althaea officinalis L., radix . This herbal plant has been used since ancient times in different European countries [Althaea officinalis L. [Sirupus althaeae is prepared by maceration of 5 parts of roots with 1 part of ethanol (760 g/L) and 40 parts of purified water for 3 h without stirring. In macerate obtained 64 parts of sucrose and 0.1 part of benzoic acid are solved\u201d. This kind of pharmaceutical product is widely applied for irritation of the pharyngeal and oral mucosa and associated dry cough [A. officinalis L. [Lead and cadmium are potentially toxic elements (PTE), but usually scientific studies about impurities of these heavy metals in pharmaceutical products are treated very marginally. It seems that nowadays lead and cadmium impurities are not a popular problem in scientific literature; however, herbal plants in traditional herbal medicinal products (THMPs) can especially be a potential source of these elements impurities . One of ountries . The THMountries . The marnalis L. . The pronalis L. : \u201cSirupuethanol 70 g/L andry cough . Even thnalis L. , not in It should be mentioned that exposure to Pb and Cd may cause serious health effects\u2014especially ,11,12 neA. officinalis L. is required. For this purpose, the best strategy is based on the ICH Q3D  guideline about acceptable limits of EI [Hence, comprehensive health assessment of Pb and Cd impurities in THMPs with ts of EI . In thists of EI . Althaea officinalis L., radix, available in Polish pharmacies. Our studies included all available THMPs in the market with marshmallow root extracts in Poland (n = 10). The justification for the choice of this study was the lack of appropriate investigations about Pb and Cd impurities in such pharmaceutical products. Additionally, there are common opinions among the Polish population about the alleged PTE impurities in THMPs available in Poland, without any scientific background.Hence, our work aimed at a comprehensive assessment of Pb and Cd impurities (based on the ICH Q3D guideline mentioned earlier) in THMPs with 3)2 in 0.5 mol/L HNO3 and 1000 mg/L Pb CertiPUR\u00ae  and cadmium (Cd standard solution traceable to SRM from NIST\u2013Cd(NO3)2 in 0.5 mol/L HNO3, 1 g/L Cd CertiPUR\u00ae, catalog product: 1.19777.0500) were prepared by dilution of certified standard solutions, 1 mg/L MERC of corresponding metal ions. The purchased certified reference material  was material prepared from lichen. Additionally, the second certified reference material  was purchased from the Institute of Nuclear Chemistry and Technology\u2014Department of Analytical Chemistry .For the experimental work, demineralized water was applied during sample processing. Nitric acid (65%) was of spectroscopic grade . Standard solution for Pb was standard solution traceable to SRM from NIST\u2014Pb. All samples were denoted by letters (A\u2013J). It should be noted that only a few independent manufacturers produce these kinds of pharmaceutical products in Poland. The investigated products were over-the-counter medicines collected from pharmacies in Krak\u00f3w, Niepo\u0142omice, Bochnia, Wieliczka, and Rzesz\u00f3w in 2021 (April\u2013May). All investigated THMPs were syrups and contained A. officinalis L. (root). The preparation in all cases was the same. The detailed information about each product (based on manufacturer information) is described in more detail in THMPs containing Althaea officinalis L., radix was homogenized. From each sample, 0.5 mL was measured , poured into Teflon vessels, and digested (1 h) with 5.0 mL of concentrated nitric acid . After this operation, all samples were cooled to a room temperature (25 \u00b0C). The final volume was 20 mL. Five replications were performed for all samples to increase the precision of the results. The time\u2013temperature program in the graphite furnace atomic absorption spectrometer for Pb and Cd determination is presented in The acid digestion of samples was applied using a microwave oven MDS 2000 . Each THMP with The analytical calibration function includes levels 0.0; 1.0; 2.0; 5.0; 10.0 \u00b5g/L for Pb, and 0.0; 0.5; 1.0; 2.0 \u00b5g/L for Cd. The values of correlation coefficients (R) were 0.998 for Pb and 0.998 for Cd, which indicated that the analyses were both precise and accurate.The obtained values for recoveries were 98.2% and 97.5% for Pb and Cd, respectively.The calculated limits of detection (LODs) were 0.46 \u00b5g/L for Pb and 0.16 \u00b5g/L for Cd. The calculated limits of quantification (LOQs) were 0.96 \u00b5g/L for Pb and 0.35 \u00b5g/L for Cd.The CRM was prepared from lichen  and corn flour, INCT-CF-3. Until the analysis, samples of CRM were dried at 70 \u00b0C for 24 h. After drying, the samples were transferred for microwave digestion . In the first step, 5 mL of nitric acid (concentration 65%) was added to 300 mg of the sample in Teflon reaction vessels and left to predigest for 24 h. In the next step, digestion was carried out, and after cooling the vessels, the extracts were transferred to Sarstedt vessels and completed with demineralized water to a total volume of 15 mL. Samples prepared were analyzed using a Perkin-Elmer 5100 ZL atomic absorption spectrometer with a graphite furnace. The declared value of Pb was 40.9 \u00b1 1.4 mg/kg and the obtained value was 38.05 \u00b1 0.23 mg/kg for BCR-482; IRMM. The declared value of Pb was 0.052 \u00b1 0.009 mg/kg and the obtained value was 0.050 \u00b1 0.009 mg/kg for corn flour, INCT-CF-3. The analysis of the mentioned certified reference materials was helpful for assessing the traceability of the results. The applied methodology was similar to our previous studies using the same apparatus ,19,20,21Obtained results were calculated using the scientific statistical software Excel 2010 (Microsoft Office) and Origin 2021 Pro.The strategy for our toxicological assessment of investigated PTE impurities is shown schematically in The first step was the preparation of raw results impurities for each THMP. The results were compared with the permissible limit set by FAO/WHO for medicinal herbs in different countries. The next step was the assessment of exposure of lead impurities after the application of THMP. For this purpose, the first step was the estimation of Pb levels in a single administration (ng/single dose) based on posology. The last step was to estimate the daily dose of PTE (ng/day) and compare with permitted daily exposure (PDE) based on the ICH Q3D guideline.The results of all analyzed samples of THMP samples (A\u2013H) are presented in The comprehensive toxicological assessment of investigated PTE impurities also requires estimation of exposure after oral application. Hence, based on the posology for each product . Azizov et al. [A. officinalis L., radix collected in Syrdarinsk District of Uzbekistan. As was mentioned in the introduction, lead may be taken up by plant roots [4 \u00b5g/kg [The general characteristics indicate that lead impurities were present at a relatively low level (mean = 3.73 \u03bcg/L) in all analyzed samples (1.62\u20136.74 \u03bcg/L). The lowest level of Pb was in sample F (1.62 \u00b1 0.13 \u03bcg/L), and the highest level was observed in sample G 6.74 \u00b1 0.24 \u03bcg/L). It should be noted that there are limited studies about Pb level in v et al.  and Esmav et al.  describent roots . Additiont roots . In ment \u03bcg/L. ItA. officinalis L., radix . Azizov et al. [A. officinalis L., radix collected in Syrdarinsk District of Uzbekistan. This element is readily taken up by plants, and an important problem can be that the toxicity level is in the range of 0.5\u20131 mg/kg dry plant material, whereas crop plants tolerate at least ten-fold of that concentration in tissue [Similar results were observed for cadmium; the Cd impurities were present at a very low level mean = 1.88 \u03bcg/L) in all investigated samples (0.85\u20133.81\u03bcg/L). The highest Cd level was observed in sample E (3.81 \u00b1 0.13 \u03bcg/L), and the lowest level was in samples D (0.85 \u00b1 0.09 \u03bcg/L) and H (0.85 \u00b1 0.07 \u03bcg/L). As in the case of Pb, there are limited studies about Cd levels in v et al.  and Esmav et al.  describen tissue . The abon tissue ). Additi.88 \u03bcg/L \u22126/day) are variable. Based on the Integrated Exposure Uptake Biokinetic (IEUBK) Model [\u22126/day\u2014sample G). Additionally, the estimated daily exposure levels for Cd are variable (21.25\u2013228.6 mg 10\u22126/day). The main point for toxicological assessment of Cd by oral route is renal toxicity [The obtained results  of dailyK) Model , PDE valK) Model . Hence, toxicity ; hence tAlthaea officinalis L., radix. Additionally, all results were below the permissible limit set by FAO/WHO for medicinal herbs and plants in different countries . The contents of these elements in a single dose were also at a very low level; hence, there is no potential hazard for people. Additionally, the estimated daily intake of Pb and Cd impurities compared to the PDE value confirm all samples safety. Hence, it can be summarized that all samples meet the standards of the ICH Q3D guideline due to the PTE impurities.Our studies are extremely important for regulatory purposes (regulatory toxicology), especially for the pharmaceutical industry. Conducted studies show that lead (1.62\u20136.74 \u03bcg/L) and cadmium (0.80\u20133.81 \u03bcg/L) impurities as raw results were at a very low level in all analyzed THMPs with n = 10) but this could be a limit for global interpretation .The broader toxicological assessment considering other heavy metals (Hg and As) in THMPs available in European pharmacies will be valuable in future studies. It should be noted that we analyzed all available products in Poland ("}
{"text": "The COVID-19 pandemic has likely affected the already high unmet need for family planning in low- and middle-income countries. This qualitative study used Andersen\u2019s Behavioral Model of Health Service Use as a theoretical framework to explore the possible ways in which the COVID-19 pandemic, including the impact of a 3-month government mandated lockdown, might affect family planning outcomes in rural Uganda. A secondary aim was to elicit recommendations to improve family planning service delivery in the context of COVID-19.Between June and October 2020, we conducted four focus group discussions with men and women separately (N\u2009=\u200926) who had an unmet need for family planning, and 15 key-informant interviews with community leaders and family planning stakeholders. Data were analyzed using thematic analysis.We identified a significant disruption to the delivery of family planning services due to COVID-19, with potential negative effects on contraceptive use and risk for unintended pregnancy. COVID-19 had a negative effect on individual enabling factors such as family income, affecting service access, and on community enabling factors, such as transportation barriers and the disruption of community-based family planning delivery through village health teams and mobile clinics. Participants felt COVID-19 lockdown restrictions exacerbated existing contextual predisposing factors related to poverty and gender inequity, such as intimate partner violence and power inequities that diminish women\u2019s ability to refuse sex with their husband and their autonomy to use contraceptives. Recommendations to improve family planning service delivery in the context of COVID-19 centered on emergency preparedness, strengthening community health systems, and creating new ways to safely deliver contractive methods directly to communities during future COVID-19 lockdowns.This study highlights the consequences of COVID-19 lockdown on family planning distribution, as well as the exacerbation of gender inequities that limit women\u2019s autonomy in pregnancy prevention measures. To improve family planning service uptake in the context of COVID-19, there is a need to strengthen emergency preparedness and response, utilize community structures for contraceptive delivery, and address the underlying gender inequities that affect care seeking and service utilization. This study explored the potential impact of the COVID-19 pandemic and a 3-month government mandated lockdown on barriers to accessing family planning services in rural Uganda, and recommendations to improve service delivery in the event of future COVID-19 restrictions. Data were collected from four focus group discussions with men and women separately (N\u2009=\u200926) who had an unmet need for family planning, and 15 interviews with community leaders and family planning stakeholders. The delivery of family planning services was disrupted due to COVID-19, negatively affecting community members\u2019 ability to access services, such as by reducing their income. COVID-19 also disrupted community and health system distribution of services, such as through a transportation ban and the suspension of all community-based family planning delivery through village health teams and mobile clinics. Participants felt that COVID-19 lockdown restrictions worsened intimate partner violence, and with men at home more, limited women\u2019s ability to use contraceptives without their partner\u2019s knowledge and resulted in more sex between partners without women being able to refuse. Taken together, these consequences were thought to increase women\u2019s risk of unintended pregnancy. Recommendations to improve family planning service delivery in the context of COVID-19 centered on measures to improve the health system\u2019s response to emergencies and to safely deliver contraceptive methods directly to communities during future COVID-19 lockdowns. The successful implementation of community-based family planning will depend on efforts to increase men\u2019s acceptance of family planning, while addressing underlying gender inequities that diminish women\u2019s ability to time and space\u00a0pregnancy. Early in the COVID-19 pandemic, it was projected that the pandemic would result in a 10% reduction in contraceptive use and a significant rise in unintended pregnancies in low and middle-income countries (LMICs) .LMICs such as Uganda are particularly vulnerable to COVID-19 disruptions that affect reproductive health; Uganda has an already high fertility rate (5.45 children per woman), low contraceptive use (29.2%), and a high maternal mortality rate  . While tWhile it is expected that such restrictions have affected reproductive healthcare access globally , 9\u201311, rThis qualitative study uses Andersen\u2019s Behavioral Model of Health Service Use (ABM) as a theoretical framework to explore the effect of the COVID-19 pandemic on barriers to family planning service delivery and use in rural Uganda immediately following a 3-month government mandated lockdown \u201325. The Predisposing factors include individual and contextual factors that lead to a predisposition of people to use services. Examples of individual factors associated with greater contraceptive use in Uganda and other LMICs include demographic and social characteristics, such as higher education levels and being in a committed/marital relationship , 29. IndContextual factors that predispose individuals to use health services include the demographic and social composition of communities, collective and organizational values, cultural norms and political perspectives , 27. FerEnabling factors are those that enable or impede use of health services. Individual enabling factors include an individual\u2019s income, access to health insurance to pay for health services, and the price of health care. In Uganda, greater wealth is associated with greater contraceptive use , 36. COVAt the contextual level, community enabling factors include health system barriers, like waiting time for health care, quality of care, and the financial and organizational resources available within the community for health services, such as the rate of health insurance coverage, the relative price of goods and services, the distribution of health facilities and personnel, provider availability, and outreach and education programs , 27. ResPerceived need for health services at the individual level is defined as how people view and experience their own general health, functional state and illness symptoms. In contrast, evaluated need is an objective measurement or professional assessment of one\u2019s health status. The ABM also defines need at the contextual level, including environmental need characteristics or environmental health conditions  and population health indices . Since the current study is a qualitative inquiry with community members, we focus on individual-level perceived need.Taken together, the ABM provides an appropriate framework to explore COVID-19\u2019s effect on family planning barriers through the perspectives of community members and family planning stakeholders who have experienced or witnessed the effects first-hand. As displayed in Fig.\u00a0This qualitative study aimed to understand the determinants of contraceptive use in a rural area of Butambala district in central Uganda as part of the formative phase of a pilot intervention. Given the onset of the COVID-19 pandemic during the study, we expanded the aims of the study to include the exploration of the impact of COVID-19 on barriers and facilitators to contraceptive use and factors influencing risk of unintended pregnancy, which is the focus of the current paper. Data were collected from June and October 2020 in a rural district of Butambala in central Uganda immediately following a 3-month government-mandated lockdown from March to June 2020. Restrictions during lockdown included stay-at-home orders and a curfew, a ban on public transportation, the closure of nonessential businesses and schools, and social distancing measures such as the ban of group gatherings. The study was carried out with support from the Butambala District Health Team, comprised of technical health officials responsible for the strategic planning and allocation of resources to meet the health needs of the community.Participants were recruited from three villages within the same rural district located approximately two hours from the capital city of Kampala. The population of each selected village is approximately 100 households each. All villages are largely Muslim and Christian, with polygamy commonly practiced. A governmental health center III (HCIII) located in the sub-county served the three villages, offering free contraceptives and individual and couples family planning counseling. HCIIIs offer condoms, oral pills, injectable contraceptives, intrauterine devices (IUDs), and implants. However, the contraceptives offered can vary across HCIIIs based on stock availability and the capacity of providers to offer long-acting reversible methods (LARCs). A General Hospital (HCV) in the district provides all the short-term reversible methods, LARCs, and non-reversible methods . In addition, the Village Health Team (VHT), a cadre of community health workers, serve as a liaison between the community and health facilities, and support community family planning efforts. VHTs distribute short-term methods directly in the community  and provide individual and group community education about family planning. In addition, an international nongovernmental organization, Marie Stopes International, works in the district to provide regular community outreach to distribute contraceptives in selected villages within the district, including the provision of LARCs and non-reversible methods.Methods used for data collection included focus group discussions (FGDs) and key informant interviews (KIIs). We conducted four FGDs with men and women (N\u2009=\u200926) recruited directly from one of the three villages with the support of a VHT. Groups were separated by age and gender to ensure participants could speak openly . Inclusion criteria included being from the selected communities, being of reproductive age , considering oneself married, speaks Luganda, not currently pregnant, and having an unmet need for family planning. An unmet need for family planning was defined as wanting to delay pregnancy for at least a year but not currently using an effective method of contraception. These criteria were chosen so that we could assess barriers to contraceptive use generally and specific to COVID-19 among community members at risk for unintended pregnancy and wanting to delay pregnancy, but not using a contraceptive method following the 3-month lockdown. Potentially eligible individuals recommended and introduced to study staff by the VHT completed a brief screening assessment to confirm eligibility with two research assistants. Research assistants obtained written informed consent from eligible and interested participants.Two facilitators experienced in qualitative research and trained in this study\u2019s focus group protocol moderated the groups, with one leading facilitation and the other taking detailed field notes. The interview guide explored barriers and facilitators to contraceptive use generally and included questions specific to the effect of COVID-19 on pregnancy intentions, risk of unintended pregnancy, access to family planning services, and the ability to use contraception. It also elicited participants\u2019 recommendations for ways to improve family planning delivery during future COVID-19 or other outbreaks/lockdowns. The facilitator conducted the focus groups in Luganda, the local language. The group sessions lasted approximately 90\u00a0min each and were audio recorded. Participants received light refreshments during the sessions, and 7,000 Ugandan Shillings (~\u2009$2 USD) for their participation. The audio recordings of FGDs were translated from Luganda to English, translated verbatim, and reviewed by a second party.In addition, we conducted 15 KIIs with community leaders and family planning stakeholders. Key informants were identified in collaboration with the District Health Team, and recommendations from other local health stakeholders, such as VHTs and the HCIII In-Charges. We sought individuals from the community that could provide expert insight into the local health system, community norms, and other barriers or facilitators to contraceptive use. Thus, KII participants included midwives and other health workers involved in the provision of family planning, VHTs, and community leaders, including religious and elected leaders. We selected KII participants from all three villages and the respective HCIIIs. A trained interviewer conducted one-on-one, in-person interviews in English. Like the FGD guide, the interview guide aimed to elicit determinants of contraceptive use, the effects of COVID-19 on contraceptive use, and recommendations to improve service delivery, but questions were tailored for relevance for each KII. Individuals received 15,000 Ugandan Shillings (~\u20094 USD) for their participation. Audio recordings were transcribed and double-checked by a second party. The data that support the findings of this study are available from the corresponding author upon reasonable request.Data were analyzed thematically . Study tTable The 15 KII participants are listed in Table Study participants described significant disruption to the delivery of family planning services and barriers to accessing health services due to COVID-19. These effects were mainly related to the ramifications of COVID-19 lockdown or prevention measures, as opposed to direct effects of COVID-19. The COVID-19 lockdown measures had effects on individual  and community enabling factors . Health workers and community members confirmed COVID-19\u2019s direct effect on health service utilization among the community due to fear of infection. Contextual predisposing factors, including poverty and those related to gender inequity, worsened the effect of COVID-19 lockdown on\u00a0barriers to contraceptive use. Taken together, the data supports COVID-19 prevention measure\u2019s effect on barriers to contraceptive use and other factors that might increase the risk of unintended pregnancy . These findings are detailed below, and depicted in Fig.\u00a0poverty and gender inequity. For example, the broader context of community poverty exacerbated the effect of COVID-19 on the enabling factor of income (discussed in the next section). As one participant in the women\u2019s focus group (age 36) explained, existing problems related to poverty were made worse by COVID-19:Respondent: Where [we] operate from to earn [is] locked up. Even if you want to go to the village, it will not work; COVID disorganized everything. Free land is not there anymore, poultry was attacked by different diseases especially the local ones, which we used to operate as free range. The goats were also attacked by several diseases. There is no place where someone can say they can work from or deal in and get some money. All things are disorganized.Moderator: Have all these things come because of COVID 19 or\u2026?Respondent: No, they have been there but then COVID has just worsened it all.COVID-19 lockdown restrictions exacerbated existing contextual predisposing factors related to gender inequity. Men\u2019s opposition to family planning, reinforced by numerous gender norms linking men\u2019s status to large family size, was one of the most salient barriers to women\u2019s contraceptive use irrespective of COVID-19. As explained by a council representative, \u201cThe opposition [to family planning] \u2013 I see it on men\u2019s side. The men are not seriously in support of it. Actually, [the] majority of men strongly disagree with their spouses on the matter of family planning, both Muslims and Christian\u201d . Power imbalances between men and women, an outcome of inequitable gender norms, result in male control of family planning decision-making. Consequently, all participants agreed that it is common practice for women in the community to use family planning in secret, but health workers explained how COVID-19 stay-at-home orders disrupted women\u2019s ability to do so. The following quotation from a female healthcare worker demonstrates how stay-at-home orders have reduced women\u2019s autonomy to use contraceptives:\u201cA woman will come and tell you that, \u2018Musawo [Doctor], please hurry up because I lied to my husband that I had just gone to the neighbor\u2019s place.\u2019 So when you hear that, you leave whatever you are doing and decide to go and attend to this mother. So, this lockdown has really affected them because the man is always around and he is so inquisitive. When they go to the health facility they are asked why they have delayed, he [man] even times her. He can say you went in the morning, how come you have spent all that time?\u201dIn addition, the COVID-19 lockdown intersected with barriers to family planning underpinned by COVID-19 has mainly brought violence in homes\u201d . Further, IPV was an expected response to finding one\u2019s wife using family planning in secret, thus potentially diminishing women\u2019s use during COVID-19, as one woman explained: \u201cPhysical abuse is not supported in the community, but if it concerns family planning, most men support the abuse\u201d .Also related to gender inequity, while participants generally looked down on IPV, they agreed that it was still prevalent in the community, with some male participants considering it necessary in some situations. The stay-at-home orders were said to have resulted in an increase in IPV in general: \u201cRespondent 1 (age 42): Most men are at home; they lack what to do and they are all over their wives all the time and [the] majority of women are pregnant now.Respondent 2 (age 36): I have nothing different [to say] but we are bored of men being around us all the time.Moderator: Okay, but what has led to these women getting pregnant during the COVID lockdown?Respondent 1: We used to count our days [calendar method] and things would be okay but today they [men] are around us all the time. You would spend your 10 days or more without being disturbed but today they [men] are home all the time.Gender inequity also intersected with the COVID-19 pandemic to increase women\u2019s risk of unintended pregnancy through the increased occurrence of sex due to men being at home more; see excerpt below from the women\u2019s FGD.This and other narratives imply that women may not be interested in having more sex, but due to inequitable gender norms, have less say over its occurrence than men in a relationship.income, an individual enabling factor, in turn affecting service access. As one female focus group participant (age 23) stated, \u201cFor me, this lock down has affected me in my wellbeing and income; all [of] my business has gone down. We are so poor in this lock down.\u201d Participants explained how the pandemic\u2019s effect on income created new financial barriers to accessing health services, particularly in not having money to cover the cost of transportation to the clinic, another enabling factor, or the cost of methods at private clinics, as the following exchange between participants from the younger women\u2019s focus group illustrates:Participant 1 (age 24): Now the method can be due but when you don\u2019t have money for transport to go to the health centre and get the new dose or even for the injectaplan. So, the next thing is to conceive because you are married but the family planning method expired.Participant 2 (age 23): Also, such women may get money for transport and may fail to get money for the injectaplan [at private clinics] or fail to get transport but remember they escape from home to go for it to a health centre. So, you cannot walk; you will be delayed \u2013 bearing in mind that you escaped from home, you need to run and come back soon.COVID-19 had a negative effect on gender; women that use family planning in secret tend to have more difficulty getting to the clinic.This narrative again intersects with the contextual predisposing factor of lower capacity due to fewer health workers available and shorter hours. Moreover, a common misconception in the community was that facilities were closed completely, resulting in poor attendance, as one female health worker explained: \u201cNew [contraceptive] users were even more affected. They thought that family planning services were also locked-down. It's mainly after a period of about two months that we started to see some of the new users.\u201d Moreover, health worker participants described fear of COVID-19 transmission, as well as a lack of protective gear, as a barrier to the delivery and receipt of services. As one female health worker explained, \u201cIt [COVID-19] has really affected me because most of my work has been door-to-door, so it worries me to move to people\u2019s homes because I can infect them or they can infect me.\" Health workers described the risks of being without protective masks, gloves, thermometers, and hand sanitizer throughout the 3-month lockdown. As another male VHT explained, this also negatively affected client attendance: \u201cThe family planning clients fear to meet health workers and vice versa because they don\u2019t have masks.\u201dCommunity enabling factors were prominent barriers to contraceptive use pre-dating COVID-19, including contraceptive method and equipment stock outs, low provider capacity to provider LARCs such as IUDs at HCIIIs, clinic wait time, and the perception of poor treatment from providers. Facilitators, irrespective of COVID-19, included community outreach strategies, such as VHT outreach and collaboration with Marie Stopes International for pop-up clinics. COVID-19 worsened existing and created new barriers to family planning within community enabling factors. For example, during lockdown, family planning services had strict transportation ban that restricted all public transportation , which negatively affected the community\u2019s access to health facilities; those that do not live in walking distance rely on public transportation to get to the clinics. Some transportation exceptions were made for \u201cessential services,\u201d such as for pregnant women reaching the clinic. Although the District provided transportation for healthcare workers to reach the facilities, the transportation ban still challenged the movement of healthcare workers, making it more difficult to get to the facilities for work, and prohibited the distribution of contraceptives and family planning education through community outreach from Marie Stopes International and VHTs. The community relies on quarterly outreach from the non-governmental organization, Marie Stopes International, to provide contraceptives not offered at the local clinic because of limited provider capacity to offer LARCs and frequent stock outs. This outreach was restricted during lockdown.\u201cBetween March and June, we stopped the outreaches because there was a total ban on gatherings. In that quarter, we never held any outreaches and the outreach is our biggest clinic because people know that is when Marie Stopes, that has the experience, is coming. So, in that quarter the uptake was low, people were not coming out and they also had their own challenges with transportation to the facility\u201d .COVID-19 lockdown\u2019s effect on mobility was the most salient community enabling barrier to family planning delivery. Lockdown included a \u201cThe lock down affected our mobilization and counseling because of the rules of social distancing. We could not access community members.\u201d VHTs who normally mobilize the community, providing individual and group outreach, education, and short-term contraceptives, were prohibited from working in the community.\u201cAs health workers, we remained open but working for fewer hours than full days. Of course, we kept receiving complaints from the community about the inaccessibility of the patients who wanted us to help them, but we could not help; we had no means to reach out to help them. The VHTs would bring complaints from the community expecting quick feedback on how we could reach out to communities but we had no means to do it. Besides, we had to adhere to the guidelines from the government\u201d .In addition, as explained by one male VHT, the movement of VHTs was restricted during lockdown: a lack of emergency preparedness, with no protocols in place to ensure client needs could be met during the pandemic, and government restrictions did not include an exception for outreach of family planning services.As the above quotation explains, there was Health workers, VHTs, and community leaders recognized a high need for family planning in the community based on a shared perception that contraceptive use in the community was low alongside high fertility and limited resources to support large families. While women endorsed family planning much more than men, both women and men perceived a need for family planning from a socioeconomic standpoint; there was consensus that families should only have the number of children they can afford to care for. In addition, women discussed the health and social benefits of spacing their children. While participants recognized that COVID-19 lockdown measures had a negative effect on access to contraceptives, and thus, a need for increased access to services during the pandemic, they did not express any new need for or reasons for wanting contraceptives related to COVID-19 itself. That is, women and men in the FGDs did not say COVID-19 changed their pregnancy intentions or the spacing and timing of their future pregnancies.As described above, participants perceived that COVID-19\u2019s effects on predisposing and enabling factors likely resulted in lower contraceptive use through restrictions that affected health service delivery and access. As such, risk of unintended pregnancy was thought to have increased due to a lack of access to services, but also through the increased occurrence of sex. Further, participants perceived a rise in IPV at home due to COVID-19, which could further diminish women\u2019s autonomy of contraceptive use and ability to refuse sex with one\u2019s husband, also contributing to risk of unintended pregnancy.\u201cThere should be prior arrangements to equip health facilities by [the] government with other stakeholders, with means of transport like motorbikes, vehicles, and the government should train staff for outreaches in case of similar eventualities as this one [COVID-19 lockdown].\u201d As this quotation from a female health worker exemplifies, recommendations included making special provisions for transportation that would allow family planning users to continue to access services through public transport in the event of a COVID-19 transportation ban, as well as strengthening community-based family planning (CBFP). Participants suggested adapting existing CBFP approaches so that they could be safely implemented during a COVID-19 outbreak, including continued distribution through Marie Stopes International and VHTs. Health workers, VHTs, and community members were in support of building VHT capacity to deliver methods, such as injectable contraceptives irrespective of COVID-19, and noted that it would be particularly beneficial during a COVID-19 outbreak. An external project had previously trained some VHTs in the district in injectable contraceptives, but implementation became inconsistent after the project ended.Participants\u2019 recommendations to improve contraceptive use in the context of COVID-19 centered on strengthening emergency preparedness and response. \u201cThe community dialogues, in my view, can easily create hostilities and conflicts in homes. Remember that in our community men discourage family planning use because of religion and culture. The men will have to also attend those dialogues, or someone would tell them what transpired in those meetings. I see that this kind of strategy would not be effective, unless you first provide counseling and education [for] men separately and women separately and make sure that their spouses are in agreement.\u201dRecommendations for new CBFP approaches to ensure contraceptive access amid COVID-19 included the creation of a voucher system that would link governmental facilities to private shops/pharmacies, allowing people to access contraceptives from local shops for free. Participants explained that bringing free methods to nearby shops would reduce barriers to access during a COVID-19 outbreak, including transportation barriers and partner disapproval, as one could access the private shops more discreetly. Participants also recommended mobile services, such as pop-up tent clinics or delivering methods as part of community dialogues, which would simultaneously generate demand for family planning. Participants discussed how such venues could be set up to incorporate COVID-19 prevention protocols in an outdoor or semi-outdoor space, allowing for ventilation and social distancing. While VHT and private shop distribution were viewed favorably by women and health workers because they could allow women to access contraceptives without their partners\u2019 knowledge, FDGs and KII narratives made clear that issues of gender inequity and male control over contraceptives need to be considered when planning more public outreach events. Specifically, engaging and sensitizing men was viewed as essential to the success of such efforts, as the following quotation from a male VHT demonstrates:We need psychosocial counseling [for] health workers because everyone was in panic saying, \u2018I might infect my family.\u2019 The In-Charge had to explain to the people all the time that they had to work.\u201d Pointing to health system weaknesses that pre-date the pandemic, providers also recognized the need for capacity building and refresher trainings on family planning services generally, as the following exchange between a male health worker and the moderator exemplifies:Respondent: I think training is key, because if we are aware that indeed the disease is spread, and if you have the protective equipment, I think that gap can be reduced.Moderator: So, you are saying sensitizing health workers or educating them about the outbreak and equipping them?Respondent: Yes, and also providing confidence to them [health workers].Moderator: What else?Respondent: Even training on the skills, for example, in general; it may not be for COVID-19 but like this refresher training, like in general, inserting IUDs and also training us on managing side effects.Finally, health workers emphasized the need for protective gear  and COVID-19-related health worker training. Training was requested to ensure methods could be delivered while minimizing risk of transmission, but health workers recognized the need for training to also reduce fear and panic, as a male health worker stated, \u201cThis qualitative study used the Andersen Behavioral Model of Health Services (ABM) to understand the effects of COVID-19 on family planning barriers and facilitators in a rural area of Uganda. Participants described significant disruptions to the delivery of family planning services, and access to health services generally, due to COVID-19 during and after Uganda\u2019s first government-mandated COVID-19 lockdown in 2020. COVID-19 had direct effects on enabling factors at the individual-level, such as reduced income negatively affecting individual\u2019s access to transportation and private services, but the larger consequences were at the community-level, with the suspension of CBFP\u00a0being particularly disruptive. In addition, COVID-19 exacerbated contextual predisposing factors that served as barriers to family planning before the pandemic, including poverty and those related to gender inequity, such as IPV and power inequities between men and women that diminish women\u2019s ability to refuse sex with their husband and their autonomy to use contraceptives. Recommendations to improve family planning service delivery in the context of COVID-19 centered on emergency preparedness and strengthening existing community distribution and creating new ways to safely deliver contraceptive methods directly to communities during future COVID-19 lockdowns. Although this qualitative study is not a direct measure of COVID-19\u2019s effect on contraceptive use or unintended pregnancy, this study highlights potential pathways in which COVID-19 may directly  and indirectly  result in unintended pregnancies via reduced contraceptive use, increased sex from men being at home, and increased IPV.While a number of commentaries and modeling studies exist that project the effects of COVID-19 on women\u2019s reproductive health outcome , few stuTo our knowledge, the present study is one of the first qualitative studies to examine the potential effects of COVID-19 on family planning in a LMIC. Thus, this study adds context to the limited quantitative research that exists by illuminating different ways in which COVID-19 and its consequential lockdown and prevention measures have affected family planning barriers and exacerbated existing gender disparities and health system weaknesses. Narratives from our community sample described COVID-19\u2019s disruption to community resources that enable access to family planning services . This included reduced facility capacity and community outreach disruptions, as researchers predicted early in the pandemic , 14, 41.These findings point to a lack of emergency preparedness that would allow for the continued and safe provision of family planning services amid an infectious disease outbreak or other humanitarian crises. Participants\u2019 recommendations highlighted the need for COVID-19 training and capacity building, access to protective supplies, and client access/transportation to the facility by deeming family planning an essential service. In addition, community members and health workers alike in our sample recommended the strengthening of CBFP to bring services safely to communities. Mobile services, VHTs , and distribution of methods through local pharmacies and shops were strategies recommended by our sample to deliver family planning while limiting facility-based contact and reducing barriers to care resulting from travel restrictions. These methods are considered High Impact Practices (HIPs), or evidence-based strategies for family planning , and havOur findings suggest that the success of CBFP during a public health or other humanitarian crisis, however, would be contingent on simultaneous efforts to increase male support for family planning. In this rural community, men largely opposed family planning and had a strong influence over women\u2019s autonomy to use contraceptives. CBFP would make contraceptive use more public, reducing women\u2019s ability to use contraceptives in secret. These findings align with a large literature demonstrating the need to increase male support of family planning and women\u2019s use of reproductive healthcare generally in order to increase service uptake in LMICs \u201351. PartThese findings point to the need to address the underlying gender inequities that already impede women\u2019s use of contraceptives in rural settings. Interventions to engage men in family planning or sexual and reproductive health services have had mixed success \u201357. HoweReaders should interpret the findings of the present study with the study\u2019s limitations in mind. While this study can shed light on the effects of COVID-19 on family planning barriers and facilitators in rural LMIC settings, the findings may not be generalizable to other dissimilar settings. This qualitative study explores the perceived effects of COVID-19 on family planning outcomes but is not a direct measure of these outcomes. For our focus groups, we sampled men and women of reproductive age with an unmet need for family planning . Thus, these participants were able to share their reasons for non-use, including those related to COVID-19, but do not provide insight into barriers to continued use of contraceptives among current users.As the COVID-19 pandemic continues to devastate LMICs globally, and inequities in global vaccine distribution continue to favor high-income countries , efforts"}
{"text": "Bis-(3\u2032-5\u2032)-cyclic dimeric guanosine monophosphate (c-di-GMP) is a bacterial second messenger that affects diverse processes in different bacteria, including the cell cycle, motility, and biofilm formation. Its cellular levels are controlled by the opposing activities of two types of enzymes, with synthesis by diguanylate cyclases containing a GGDEF domain and degradation by phosphodiesterases containing either an HD-GYP or an EAL domain. These enzymes are ubiquitous in bacteria with up to 50 encoded in some genomes, the specific functions of which are mostly unknown.ori) and terminus (ter) of replication and at ter while the EAL-encoding genes peaked near ori. The patterns were more complex in the Rhizobiales, but the GGDEF-encoding genes were biased for localization near ter.We used comparative analyses to identify genomic patterns among genes encoding proteins with GGDEF, EAL, and HD-GYP domains in five orders of the class Alphaproteobacteria. GGDEF-containing sequences and GGDEF-EAL hybrids were the most abundant and had the highest diversity of co-occurring auxiliary domains while EAL and HD-GYP containing sequences were less abundant and less diverse with respect to auxiliary domains. There were striking patterns in the chromosomal localizations of the genes found in two of the orders. The Rhodobacterales\u2019 EAL-encoding genes and Rhizobiales\u2019 GGDEF-EAL-encoding genes showed opposing patterns of distribution compared to the GGDEF-encoding genes. In the Rhodobacterales, the GGDEF-encoding genes showed a tri-modal distribution with peaks mid-way between the origin (The observed patterns in the chromosomal localizations of these genes suggest a coupling of synthesis and hydrolysis of c-di-GMP with the cell cycle. Moreover, the higher proportions and diversities of auxiliary domains associated with GGDEF domains and GGDEF-EAL hybrids compared to EAL or HD-GYP domains could indicate that more stimuli affect synthesis compared to hydrolysis of c-di-GMP.The online version contains supplementary material available at 10.1186/s12864-022-09072-9. Gluconacetobacter xylinus [Bis-3\u2032-5\u2032)-cyclic dimeric guanosine monophosphate (c-di-GMP) is a second messenger that was first described for its role in regulating cellulose biosynthesis in  xylinus , 2, but \u2032-5\u2032-cycl xylinus . Cellula xylinus . There a xylinus , 8 which xylinus , 10. PDE xylinus , 12. In  xylinus , with a  xylinus  or dimer xylinus . However xylinus .C-di-GMP levels can be controlled via transcriptional and translational regulation of gene expression, or through post-translational modification of the synthesis and degradation enzymes as a quicker response. Auxiliary domains can be present on the enzymes and include sensory, signalling and protein binding domains, and these can allow for rapid adaptation . CellulaSinorhizobium meliloti with plant roots [Caulobacter crescentus [Rhodobacter capsulatus and Dinoroseobacter shibae [In the Alphaproteobacteria, c-di-GMP has been examined for its role in many different processes, such as the symbiosis of nt roots  and relant roots , which int roots .The CtrAnt roots . It has nt roots , 24, butescentus , 25 and r shibae , 27. C-dr shibae , 29. Ther shibae .ori) are replicated earlier and are therefore temporarily present in higher copies than genes that are closer to the terminus of replication (ter) [Bacillus subtilis, where it was shown that the temporal copy number imbalances due to the opposite localization of genes encoding members of a regulatory network influenced its output [ori, and methylation status can affect regulatory protein binding and transcription [ctrA initiates is only activated in the hemi-methylated state in C. crescentus [The chromosomal positioning of genes can affect their functions in different ways and have effects on multiple cellular processes. For example, gene location can influence the spatial distribution of proteins within cells due to transcription-coupled translation . Positioon (ter) . An exams output , 34. Addcription . For exaescentus . It seemescentus .C-di-GMP-modulating enzymes are broadly distributed in phylogenetically and metabolically diverse bacteria. They are also very diverse with respect to their roles and regulation, with a wide range of stimuli affecting c-di-GMP levels, and only a small proportion of the total diversity of these enzymes has been characterized in detail . Therefohttp://pfam.xfam.org/family/PF00990#tabview=tab7; EAL: http://pfam.xfam.org/family/PF00563#tabview=tab7; HD: http://pfam.xfam.org/family/PF01966#tabview=tab7) [Protein sequences with identified EAL (PF00563), GGDEF (PF00990) or HD (PF01966) domains from genomes of bacteria within five orders of the Alphaproteobacteria  were downloaded from the EMBL website on 6 August 2020 (GGDEF: ew=tab7) . ProteinAll analyses were done in R version 4.0.3 with the appropriate packages as needed Table S.https://www.uniprot.org/uniprot/V4RSF5.txt) or EBI  [http://pfam.xfam.org/protein/A0A0N0K049#tabview=tab0). Domain annotations could not be withdrawn for all sequences due to inconsistent html path formatting, which reduced the dataset (Table https://www.uniprot.org/uniprot/A0A0N0K3V8.txt). Due to inconsistencies some sequences have different version numbers  and only version 1 was subsequently considered in such cases. All sequence identifiers and html paths can be found in Table SSequence identifiers were extracted from the EMBL fasta files and used to access the respective organism information from UniProt  . The ideet Table . The ideori) was identified for each chromosome using Ori-Finder and default settings [https://github.com/sgivan/gb2ptt#gb2ptt) from gbff files, downloaded from NCBI on 23 April 2019. Only chromosomes with one unambiguously identified ori were subsequently included in the investigation, which reduced the dataset (Table ter) was assumed to be opposite ori on the circular chromosomes [The origin of replication  were downloaded for the members of each order and their NCBI identifiers were determined. Alignments were done using MAFFT with L-INS-i option  in GeneiWe quantified the genes encoding the domains associated with c-di-GMP synthesis and degradation in members of the five alphaproteobacterial orders. This included those that contained one of the GGDEF, EAL, or HD-GYP domains or both GGDEF and EAL domains. The GGDEF and GGDEF_EAL sequences accounted for the highest proportions in all five orders at 35\u201348%, followed by proteins containing an EAL domain that ranged between 8.9% and 23.4% of all sequences Fig.\u00a0. The HD-Rhodomicrobium and Neorhizobium), 1.7\u201351 , 3.6\u201314.2 (Phenylobacterium and Caulobacter), 3\u201325.4 (Croceicoccus and Novosphingobium), and 1\u201349  were observed in the respective individual orders.Next, the numbers of c-di-GMP-metabolizing sequences in different genera were compared by calculating the mean number of sequences per genus Fig.\u00a0. The c-dFor the subsequent investigation of the numerical relationships among the various domains, all orders were analyzed Figure S, but dueDevosia, Fulvimarina and Rhizobium. Smaller additional clusters with increased c-di-GMP numbers that were less closely related were also observed. In the Rhodobacterales, the closely related genera Stapia and Labrenzia stood out with their high c-di-GMP-metabolizing gene numbers. A connection between phylogeny and c-di-GMP-metabolizing gene number could also be observed in the Rhodospirillales. Here there were three clusters of organisms that had increased gene numbers and one notable group was made up of three genera including Magnetospirillum, Magnetovibrio and Telmatosprillum. A clear connection between phylogenetic relationships and numbers of c-di-GMP-metabolizing genes was not observed in the Sphingomonadales, and it is difficult to make any statement for the Caulobacterales because of the lower genome and gene numbers.The large variability in numbers of c-di-GMP-metabolizing proteins among organisms stimulated us to investigate their evolutionary relationships. Therefore, the number of c-di-GMP enzymes present in different species was evaluated in a phylogenetic context Figure S. Some clNitrospirillum amazonense CBAmc , Rhizobium sp. NXC24  and Asticcacaulis excentricus CB 48  more c-di-GMP genes were found on the second-largest replicon and in Paracoccus denitrificans PD1222  equal numbers of c-di-GMP-metabolizing genes were found on the largest and second-largest replicons.There was a statistically significant positive correlation between chromosome size and the number of c-di-GMP-metabolizing genes in all five orders Figure S. We onlySecondary chromosomes (defined as replicons\u2009>\u2009800\u00a0kb that are not the largest replicons in the genome) contain genes that evolve faster  and are ori) and terminus (ter) of replication. No obvious trend was observed in the Rhodospirillales, while GGDEF and GGDEF_EAL sequences seemed less prevalent near ter in the Sphingomonadales  while the EAL and GGDEF as well as the GGDEF and GGDEF_EAL pairs were distributed differently . The Rhizobiales GGDEF and GGDEF_EAL genes were also distributed differently .Comparison of the similarities of distributions among the groups of genes indicated that the Rhodobacterales EAL and GGDEF_EAL genes were similarly distributed .In the two orders with the most available data, the Rhodobacterales and Rhizobiales, there is a clear conservation of the Rhodobacterales EAL- and GGDEF_EALori are replicated earlier than genes that are close to ter, which leads to a temporary copy number imbalance between genes at these two locations [B. subtilis, the opposite location of two genes encoding components of a phosphorelay with respect to ori and ter leads to temporal copy number imbalances, and this allows spore formation to only take place at the end of the cell cycle when the balance between the regulators is restored [Vibrio cholerae, moving genes from ori to ter and thus reducing their copy number during the cell cycle has an impact on growth and infectivity [Escherichia coli [There are multiple potential effects caused by the chromosomal locations of specific genes. The observed chromosomal localization patterns revealed in this study might affect cellular c-di-GMP concentrations during the cell cycle. Genes that are close to ocations . In B. srestored , 34. In ectivity , 62. Suchia coli , althougctrA gene in C. crescentus is only active in the hemi-methylated state [ctrA, which is localized near ori, is transcribed more during DNA replication because it is hemi-methylated right at the beginning of the cycle. However, any broad role of methylation in regulating transcription of genes encoding c-di-GMP-metabolizing enzymes is currently unknown and future work is required to investigate this possibility.Another effect of localization could be manifested through DNA methylation, where the chromosomal DNA changes from fully methylated to hemi-methylated during replication. This change in methylation can affect gene transcription. For example, the p1 promoter of the ed state . Thus, cter while GGDEF sequences are biased towards ter. Additionally, the EAL and GGDEF_EAL domain-containing sequences show lower diversity and occurrence of auxiliary domains compared to the GGDEF sequences. There are several known examples in which chromosome localization of genes is important, and this can manifest in different ways such as through changes in copy number and methylation status during the cell cycle. The patterns we found support the suggestion that the chromosomal localization of c-di-GMP-metabolizing genes is important in these bacteria. Our findings also support the notion that the synthesis of c-di-GMP is more regulated and responsive to a variety of specific signals whereas its degradation might be less regulated and dependent on different stimuli.C-di-GMP-metabolizing enzymes are very diverse, and the specific roles and functions of only a few of these proteins are known. In this study new patterns and common properties for these proteins were identified in members of the Alphaproteobacteria. We systematically examined gene occurrence, localization on the genome, and the presence of auxiliary domains. In the Rhodobacterales and Rhizobiales, the EAL and GGDEF_EAL sequences, respectively, are primarily located away from Additional file 1:Figure S1. Numerical relationships between the number of GGDEF and EAL (GGDEF:EAL) sequences by genera. The ratios were calculated per genome and the mean per genus was plotted. Figure S2. Numerical relationships between the number of GGDEF and GGDEF_EAL (GGDEF:GGDEF_EAL) sequences by genera. The ratios were calculated per genome and the mean per genus was plotted. Figure S3. Numerical relationships between the number of GGDEF and HD-GYP (GGDEF:HDGYP) sequences by genera. The ratios were calculated per genome and the mean per genus was plotted. Figure S4. Numbers of c-di-GMP sequences in a phylogenetic context. Phylogenetic relationships are based on RpoB sequences. All alignments were done using MAFFT with LINS-i option. Bootstrap values based on 1000 replicates and hill-climbing nearest-neighbor interchange search were used. A. Rhizobiales. B. Caulobacterales. C. Rhodobacterales. D. Rhodospirillales. E. Sphingomonadales. Figure S5. Relationships between chromosome size and the number of encoded c-di-GMP enzymatic domains. Spearman's rank correlation was used to evaluate the significance. Only the biggest replicon, considered the main chromosome, was included in this analysis. Figure S6. Chromosomal locations of c-di-GMP-associated genes. Cumulative distributions of cdi-GMP-associated genes on the chromosomes, with lengths normalized to 100% where ori is at 0% and 100% and ter is at 50%. The red line indicates the estimate of the kernel density. In this analysis only closed genomes with one unambiguously identified ori were used. Figure S7. Secondary domains that are present along with the different c-di-GMP-associated enzyme groups. A. Shared and individual secondary domains. The c-di-GMP-modulating domains are not included in this analysis. The color code of the Venn diagram represents domain counts from highest(red) to zero (white). B. Number of sequences that have zero, one, or more than one secondary domain. Figure S8. Relationships between protein length and presence of detected auxiliary domains. The sequences with EAL and GGDEF domains were segregated based on the occurrence of auxiliary domains. The minimal amino acid lengths for proteins containing auxiliary domains (left panel) were identified as 375 for EAL proteins and 275 for GGDEF proteins (blue dashed lines). This threshold was then used to calculate the percentage of sequences without identified auxiliary domains that were shorter and longer than these minimal lengths (right panel).Additional file 2:Table S1. R packages used for analyses.Additional file 3:Table S2. Compilation of Pfam, EBI and NCBI sequence identifiers.Additional file 4:Table S3. Sequence counts by genera. The mean number of sequences is calculated per genus. Blue indicates a \"genus\" that is not included in the analysis because it does not represent an actual genus.Additional file 5:Table S4. Domains found in all c-di-GMP-associated protein sequences. The cyclic di-GMP-associated domains are indicated in light blue. Values >0 for other domains are indicated in red.Additional file 6:Table S5. Count of c-di-GMP-associated genes on chromosomes and plasmids. The primary chromosome is defined as the largest replicon of a genome. A \"c\" at the start of a column name indicates information regarding the chromosome while \"p\" indicates plasmids. Blue coloration indicates those genomes that have c di GMP-associated genes on secondary chromosomes or extrachromosomal replicons.Additional file 7:Table S6. Occurrence of secondary domains with cyclic di-GMP-modulating domain sequences.Additional file 8:Table S7. Frequency of association of all secondary domains that co-occur with c-di-GMP-associated domains.Additional file 9:Table S8. All domains found associated with one of the c-di-GMP-associated domains examined in this study with associated Pfam HTML paths and Pfam IDs."}
{"text": "Scientific Reportshttps://doi.org/10.1038/s41598-021-89473-0, published online 11 May 2021Correction to: The original version of this Article contained an error.The accession codes for the raw sequencing data generated in the course of the study were omitted from the Data Availability statement.\u201cData generated in this study are available in the main table, figures, and additional files.\u201dnow reads:\u201cData generated in this study are available in the main table, figures, and additional files, and the raw sequencing data are available at the National Center for Biotechnology Information SRA database under the accession PRJNA860974.\u201dThe original Article has been corrected."}
{"text": "Little is known on the burden of co-infections and superinfections in a specific setting such as the respiratory COVID-19 sub-intensive care unit. This study aims to (i) assess the prevalence of concurrent and superinfections in a respiratory sub-intensive care unit, (ii) evaluate the risk factors for superinfections development and (iii) assess the impact of superinfections on in-hospital mortality.Single-center retrospective analysis of prospectively collected data including COVID-19 patients hospitalized in a newly established respiratory sub-intensive care unit managed by pneumologists which has been set up from September 2020 at a large (1200 beds) University Hospital in Rome. Inclusion criteria were: (i) COVID-19 respiratory failure and/or ARDS; (ii) hospitalization in respiratory sub-intensive care unit and (iii) age\u2009>\u200918\u00a0years. Survival was analyzed by Kaplan\u2013Meier curves and the statistical significance of the differences between the two groups was assessed using the log-rank test. Multivariable logistic regression and Cox regression model were performed to tease out the independent predictors for superinfections\u2019 development and for mortality, respectively.Acinetobacter baumannii (CR-Ab) isolated in 47%. Overall mortality rate was 30%. Prior (30-d) infection and exposure to antibiotic therapy were independent risk factors for superinfection development whereas the development of superinfections was an independent risk factors for in-hospital mortality. CR-Ab resulted independently associated with 14-d mortality.A total of 201 patients were included. The majority  presented severe COVID-19. Co-infections were 4 (1.9%), whereas 46 patients (22%) developed superinfections, mostly primary bloodstream infections and pneumonia. In 40.6% of cases, multi-drug resistant pathogens were detected, with carbapenem-resistant In a COVID-19 respiratory sub-intensive care unit, superinfections were common and represented an independent predictor of mortality. CR-Ab infections occurred in almost half of patients and were associated with high mortality. Infection control rules and antimicrobial stewardship are crucial in this specific setting to limit the spread of multi-drug resistant organisms.The online version contains supplementary material available at 10.1186/s12890-023-02315-9. As of 28th July 2022, more than 570,000,000 people had been infected with SARS-CoV-2 worldwide, with more than 6,000,000 deaths . Around Viral respiratory illnesses predispose patients to bacterial and fungal infections; while this link has been widely described in relation with influenza pneumonia, it is still unclear the exact roles co-pathogens play in patients with COVID-19 . Indeed,During the first wave of COVID-19 pandemic, although few papers reported a low incidence of bacterial co-infections , most paWhile the rate of co-infections has an important role in deciding whether to use empiric antibiotic therapy, superinfection rate tends to be higher in patients with prolonged hospital stay, worst clinical presentation, and need for Intensive Care Unit (ICU) . Wide spIn most centers in Italy, COVID-19 patients were admitted to ICU or ordinary wards based on their clinical conditions. Italian hospitals faced an unpreceded massive inflow in a short period of time . In centTo our knowledge, little is known about the prevalence of concurrent and superinfections in this peculiar setting.Based on these premises, we carried out a study specifically targeting patients hospitalized in a respiratory sub-intensive care unit with the aims to (i) assess the prevalence and etiology of co- and superinfections, (ii) evaluate the risk factors for superinfection development and (iii) assess the impact of superinfections on in-hospital mortality.We performed a single-center, retrospective analysis of prospectively collected data on patients with COVID-19 pneumonia hospitalized in a respiratory sub-intensive respiratory care unit at Azienda Ospedaliero-Universitaria Policlinico Umberto I, Sapienza University of Rome, from November 2020 for the following 6\u00a0months, until April 2021.Inclusion criteria were: (i) diagnosis of COVID-19 respiratory failure and/or acute respiratory distress syndrome (ARDS), (ii) hospitalization in a sub-intensive respiratory care unit for\u2009>\u200948\u00a0h and (iii) age\u2009>\u200918\u00a0years. Exclusion criteria included: age\u2009<\u200918\u00a0years, hospitalization in a sub-intensive respiratory care unit for\u2009<\u200948\u00a0h and missing data.Diagnosis of SARS-CoV-2 infection was made with molecular analyses. Diagnosis of respiratory failure was made on clinical presentation and arterial blood gases (ABGs), a lung CT scan was performed to detect ground glass opacity and/or others lesions compatible with COVID-19 pneumonia. Acute respiratory distress syndrome was diagnosed on clinical and ABGs data according to Berlin definitions . The decStarting from September 2020, a sub-intensive respiratory care unit with 42 beds managed by pneumologists was set up in our 1200-bed Academic Hospital. Patients were admitted in case of severe respiratory failure and/or ARDS due to COVID-19 pneumonia requiring oxygen therapy and/or Helmet continuous positive airway pressure (CPAP) treatment or non-invasive mechanical ventilation (NIMV) . OxygenPatients required the use of continuous vital signs monitoring, and, in most cases, central venous catheter (CVC) or arterial catheters\u2019 placement, total parenteral nutrition and, in some cases, sedation. Sedation was performed in case of non-adaptation to ventilation. Drugs administered in case of sedation were midazolam or dexmedetomidine. The level of sedation was related to the possibility of maintaining non-invasive ventilation.We managed also critically patients with septic shock, or heart failure or requiring renal replacement, in this case with integrated management with nephrology specialists. We collaborated with an infectious disease specialist to treat superinfections.Criteria for ICU-transfer was: if clinical conditions worsened despite ventilation and clinical care, an anesthesiologist consultation was required, and patients were transferred to ICU in case orotracheal intubation was needed.Main differences with ICU setting were: (i) we did not manage intubated patients; (ii) most patients were not sedated and (iii) we have a different number of nurses, with one nurse assisting almost height patients during the work shift (nurse/patient ratio 1:8); (iv) ICU was managed by anesthesiologists.Nasopharyngeal swab samples were collected, and SARS-CoV-2 RNA was detected by using real time RT-PCR assay .All patients received oxygen therapy and/or HFNC or CPAP or NIMV treatment based on respiratory failure severity.Staphylococcus aureus (MRSA), vancomycin-resistant Enterococcus faecium (VRE), or carbapenem resistant (CR) gram-negative bacilli] colonization was systematically performed by means of rectal swab, at admission to the sub-intensive respiratory unit and every 7\u00a0days afterwards.Screening for multi-drug resistant (MDR) bacteria .As shown in Table\u00a0At multivariable analysis, independent risk factors for in-hospital mortality were the development of superinfections , age\u2009>\u200965\u00a0years , CCI\u2009>\u20095 , lymphocytes count\u2009<\u2009750/mmc , use of sedation  and NIMV  , were older  and had a higher rate of diabetes, chronic ischemic heart disease, chronic heart failure, atrial fibrillation and malignancy, with a higher Charlson Comorbidity Index (CCI) (p\u2009=\u20090.0001)  and antibiotic exposure in the previous 30-d before superinfections development  were more common in the Infection group. Given the severity of COVID-19 pneumonia, corticosteroid treatment was similar in both groups . Colonization with MDR pathogens was higher in the group of patients with super-infections . No differences were observed for pronation and sedation use in the two groups, whereas NIMV was more frequent in patients developing superinfections (23.9% vs 6.4%).Mortality rate was higher in patients with superinfections . Furthermore, they presented a longer in-hospital stay .At multivariable analysis, prior (30-d) infection  and exposure to antibiotic therapy in last 30-d  were independent risk factors for new onset superinfections development (Table Clostridioides difficile infection (1.5% each).Overall, 46 patients (22%) developed superinfections, with the different causative pathogens shown in Supplementary Table 1. Several patients experienced\u2009>\u20091 infective episode and therefore we recorded 64 infections. Primary BSI was the most frequent superinfection with 23 episodes (35.9%), followed by pneumonia (29.6%), urinary infections (28.5%), CR-BSI (3.1%), skin/soft tissue infections and Acinetobacter baumannii (CR-Ab) isolated in 11 (47%) of them. Others MDR involved were MRSA, VRE and CR Klebsiella pneumoniae (CR-Kp) . All the strains of A. baumannii were resistant to meropenem; all but one exhibited colistin susceptibility. Cefiderocol susceptibility was available only for 6 strains; all the tested strains were susceptible at disk diffusion method (Supplementary Table2).First infective episode was diagnosed after a median of 14.5\u00a0days (IQR 7\u201322) from sub-intensive unit admission. In 23 cases (40.6%), MDR pathogens were detected, with CR A. baumannii as etiologic agents of first infective episode , p\u2009=\u20090.018]  co-infections were uncommon while the development of superinfections occurred in almost one quarter of patients and were independently associated with mortality; (ii) MDR organisms were isolated in approximately 40% of patients, with CR-Ab accounting for almost half of cases and (iii) CR-Ab as the causative agent of the first infective episode was associated with early (14-d) mortality.To the best of our knowledge, the prevalence and characteristics of superinfections in COVID-19 patients hospitalized in a respiratory sub-intensive care unit are not well understood and represent a significant knowledge gap in literature data.Staphylococcus aureus [Indeed, from the spread of SARS-CoV-2 pandemic, several studies reported the rates of bacterial, viral and/or fungal infections in COVID-19 patients, especially in ICU. A study conducted during the first pandemic wave reported a high rate of incidence and prevalence of co-infections during COVID-19 . This ars aureus , thus juMycoplasma pneumoniae as the etiologic agent in all the cases, although concerns were raised about diagnosing M. pneumoniae infection in COVID-19 patients only by means of serology diagnostic testing. These data are in accordance with our previous data collection referred to the first pandemic wave in which Mycoplasma pneumoniae was responsible for the 1.1% of co-infections [Nevertheless, according to the following literature \u201326 co-infections  and sustfections  the possOverall, 46 patients (22%) developed superinfections. Our data seems in line with literature , 30 in tChong et al. reported an overall time to diagnose pulmonary superinfections of 10\u00a0days (2\u201321\u00a0days) from initial hospitalization and 9\u00a0days (4\u201318\u00a0days) after ICU admission . LikewisCOVID-19 severity could in part explain the association between critical conditions and superinfections. Ripa M et al. concluded that factors associated with superinfections were low baseline lymphocyte count, baseline P/F ratio, and ICU admission , while FWe reported an overall mortality rate of 30%, with a higher rate in patients with superinfections, especially when sustained by CR-Ab. The development of superinfections represented an independent risk factor for in-hospital mortality, together with age\u2009>\u200965\u00a0years, CCI\u2009>\u20095, severe COVID-19 and a count of lymphocytes\u2009<\u2009750/mmc on admission. In a previous study conducted in 24 ICUs, trends of clinical, ventilatory and laboratory parameters throughout the entire ICU stay showed different slopes between survivors and non-survivors . FurtherA. baumannii and CR-K. pneumoniae were detected in 40.6% of cases, with CR-Ab, a common colonizer in the ICU setting, isolated in almost half of cases. This prevalence could be explained by considering that patients hospitalized in our sub-intensive unit presented several risk factors usually associated with A. baumannii infections, such as prolonged hospitalization, need of intensive care, presence of devices, older age, prior colonization, and prior use of antibiotics [As reported for patients hospitalized in ICU \u201335, in tibiotics .Pseudomonas aeruginosa and Acinetobacter baumannii have been increasingly reported during the hospital stays of patients with severe COVID-19 [MDR in Gram-negative bacilli represent a major threat to human health and significantly contribute to global deaths attributable to and associated with bacterial antimicrobial resistance . With thCOVID-19 .P. aeruginosa, A. baumannii and S. maltophilia [Indeed, a recent study by Falcone and colleagues during the first pandemic wave in Italy (March\u2013April 2020) showed that MDR organisms caused 65.1% of superinfections, slightly higher than our report. Interestingly, the rate of MDR infections increased during the hospital stay, from 50% in the first 7\u00a0days up to 70.4% if hospitalized for\u2009>\u200930\u00a0days. Although the majority of MDR organisms were represented by CRE, the increase during hospitalization mostly regarded non fermenters such as tophilia .These findings are in line with other reports showing that more than 60% of patients with COVID-19 who had a bacterial infection carried a highly resistant organism . FurtherMore recently, national Italian data evaluating superinfections caused by CRE in hospitalized patients with COVID-19 from March to December 2020 found that the majority of infections occurred in the ICU, although almost one third of episodes occurred in medical wards; however, no data on sub-intensive respiratory units was present. Thirty-day mortality was 33.3% .A. baumannii infection in COVID-19 patients [In a previous study, we evaluated the impact of COVID-19 on MDR Gram-negatives BSIs in a single ICU: while before pandemic patients were more likely to present CR-Kp BSIs, after COVID-19 CR-Ab BSIs were more commonly observed . Furtherpatients .Candida auris [Acinetobacter baumannii seems to be the main pathogen involved, with several outbreaks reported worldwide [Many hospitals have reported MDR outbreaks in ICU during the COVID-19 pandemic, mostly caused by Gram-negative bacteria or da auris . Carbapeorldwide , 43.Another Italian study compared colonization and infection rates before and after COVID-19; authors found that in the COVID-19 period, the incidence rate ratios of colonization and infection with CR-Ab increased 7.5- and 5.5-fold, respectively. Genome sequencing showed that all CR-Ab strains belonged to the CC92/IC2 clonal lineage Pseudomonas aeruginosa or Acinetobacter baumannii) was observed, particularly in settings where enhanced infection control policies and/or antimicrobial stewardship programs were not reported. Furthermore, there was a small increase in the proportion of infections due to resistant Acinetobacter spp [More recently, a systematic review and meta-analysis analyzed the impact of the COVID-19 pandemic on MDR organisms across different healthcare settings by providing data on antimicrobial resistance before or during the COVID-19 pandemic. Authors found that the pandemic was not associated with a change in the incidence or proportion of MRSA or VRE; conversely, although not significant, an increase of resistant Gram-negatives  in patients with severe influenza, which accounted for up to 22\u201328% of total cases of pulmonary co- and superinfections and were associated with a high mortality rate [In our study, MRSA was detected in 6/64 (9.4%) infective episodes, mostly represented by BSIs. Our results are in line with those recently observed by Falcone et al., who found that MRSA accounted for 5.5% of superinfections episodes . Conversity rate .The low percentage of pulmonary Aspergillosis (1.9%) is in line with the data recently observed in our hospital context, where we found COVID-19 associated pulmonary aspergillosis (CAPA) in only a minority of ICU patients . The incOur study presents some limitations: (i) this is a single-center retrospective observational study with a limited number of patients, that does not include all hospitalized patients; (ii) patients usually received empiric antibiotic therapy at admission, so that the prevalence of co-infections could be possibly underestimated, even if administering antibiotics was a common practice worldwide in that phase of pandemic and we reported similar prevalence of literature; (iii) lack of control group, such as COVID-19 patients hospitalized in ordinary wards or ICUs or patients without COVID-19; (iv) we were unable to investigate with specific microbiological analyses whether the isolation of CR-Ab was a cluster. Moreover, we developed this study in an emergency setting in the middle phase of the second wave, so we should acknowledge that the hospital surge during the pandemic may have affected patients\u2019 outcome.Nevertheless, our study offers important explanations on the prevalence and clinical impact of superinfections in COVID-19 patients hospitalized in a highly intensive care setting other than ICU. Accordingly, we believe that additional studies specifically focused on respiratory sub-intensive care units are warranted, in order to elucidate similitudes and differences, if any, between this special setting and the ICU.In conclusion, we showed that in a COVID-19 respiratory sub-intensive care unit, superinfections were common and represented an independent predictor of mortality. Conversely, co-infections had a low prevalence, supporting an antibiotic sparing strategy in the first phase of SARS-CoV-2 infection. Indeed, exposure to antibiotic therapy was independently associated with superinfections\u2019 development. MDR organisms were found in almost half of patients with superinfections, and CR-Ab as the causative agent was associated with high mortality. For all these reasons, infection control rules and antibiotic stewardship programs represent critical points also in sub-intensive care units to limit the spread of MDR organisms.Additional file 1. Supplementary Table 1. Pathogens isolated for type and site of infection. Supplementary Table 2. Antimicrobial susceptibility testing of the 11 CR-Ab isolates causing superinfections."}
{"text": "TP53 gene. We report the first case of endometrial cancer after yolk sac tumor with LFS.Li-Fraumeni syndrome (LFS) is a rare autosomal dominant disease with high penetrance caused by a germline variant of TP53 c.844C\u2009>\u2009T, p.( R282 W) with NM_000546.5 variant, a class 5 (C5) variant. This is the first reported case of a yolk sac tumor accompanied by subsequent endometrial cancer that is associated with LFS.The presented female patient underwent right adnexectomy at age 23 because of a yolk sac tumor of the ovary. At the age of 27, the patient was diagnosed with endometrial adenocarcinoma, received cytoreductive surgery and chemotherapy. Given that her personal cancer history along with a strong family history of cancer, her father passing away from lung cancer at age 48 and her grandmother dying of ovarian cancer at age 50, the patient was referred for genetic counseling and testing. Genetic screening revealed a heterozygous pathogenic TP53 pathogenic variation which expanded types of tumor that can be presented in patients with LFS. This case highlights the importance of genetic testing for patients with malignant tumors, as well as patients with a family history of malignant tumors. And our case highlights the necessity of screening for gynecologic tumor in LFS patients.We reported a first case of an endometrial cancer after yolk sac tumor patient with a tumor family history of harboring the germline The online version contains supplementary material available at 10.1186/s12905-023-02426-9. TP53 gene, located on the 17p13.1 chromosome that codes for p53, the most commonly inactivated protein in human cancer. Germline TP53 variants most often occur in the DNA-binding domain, resulting in the production of a dysfunctional p53 protein [TP53 gene encodes a transcription factor that controls the expression of multiple genes, which activate cell cycle arrest for genomic repair or apoptosis, depending on the level of DNA damage [Li-Fraumeni syndrome (LFS) tends to be a widespread, early-onset cancer associated with a germline variant in the A damage . LFS is A damage , 5. WomeA damage . HoweverA 28-year-old female presented with right abdominal discomfort for two weeks in 2017 (age 23) without previous gynecologic abnormalities. Computed tomography (CT) revealed a 14\u00a0cm solid cystic mass in the right adnexa without other imaging abnormalities , PR (40%\u2009+), P53 (60%\u2009+), Ki-67 (30%\u2009+), cytokeratin 8/18 (90%\u2009+), MLH1(\u2009+), PMS2(\u2009+), MSH2(\u2009+), MSH6(\u2009+) and NapsinA negative  and carboplatin for 2 cycles. At the beginning of the third cycle of paclitaxel, the patient showed allergic symptoms including facial flushing, urticaria and labored breathing, so we changed the protocol to bevacizumab, liposomal doxorubicin, and carboplatin for 6 cycles. She eventually received 8 cycles chemotherapy and received maintenance therapy with bevacizumab q 21\u00a0days for 16cycles as a meta-analysis showed there were significant differences in progression-free survival (PFS) between patients receiving chemotherapy combined with and without bevacizumab [otherapy . In lighTP53 c.844C\u2009>\u2009T, p.( R282 W) with NM_000546.5 was confirmed as a germline variation, the rest were verified as the somatic variations, Table For molecular diagnosis, the Qiagen DNeasy Blood & Tissue Kit  was used to extract genomic DNA (gDNA) from FFPE tissues, following the manufacturer\u2019s protocol. Qubit  and agarose gel electrophoresis were used to detect DNA concentration and quality. gDNA 250\u00a0ng) was used to construct the sequence library using the method described in previous literature . The hyb50\u00a0ng wasTP53 c.844C>T, p.( R282 W) with NM_000546.5 was found in a germline variant, a class 5 (C5) variant, inheritance of which is autosomal dominant. Her father and grandmother suffered from malignant tumor at a young age, it is very likely that her patrilineal family carried the TP53 gene mutation and passed it on to the patient, she got YST accompanied by subsequent EC that is associated with LFS, these two tumors\u00a0rarely\u00a0occur in a\u00a0patient\u00a0with LFS, this case represented a new finding that extends the clinical scope of LFS; since her father and grandmother had passed away, family verification could not be performed, we confirmed the mutation as a germline heterozygous variation  gene were not detected, as the same as microsatellite instability. Through\u00a0this germline analysis, we suggested her mother and other patrilineal relatives received the germline testing, which would help the whole family discover or eliminate the risk of tumor in time. Sanger sequencing was performed on her mother in order to rule out carrying the TP53 variant during the follow-up, and the result was negative. It was further proved that her paternal family carried the TP53 variant. She is undergoing gynecological pelvic examinations, tumor markers and regular imaging for the progression of her disease. In addition, regular gastroenteroscopy, head and abdominal CT scans are also included during follow up to rule out other tumors.The timeline of major events in the patient\u2019s treatment is shown in Table TP53 variant (p.R282 W). LFS patients are prone to ovarian and endometrial cancers [TP53 germline variants. TP53 variants are often inherited, and family history is still the key criterion for considering LFS [Patients with LFS have a significant lifetime cancer risk \u201313. Here cancers  while thring LFS .TP53 is the most mutated gene in tumors with some hot spots. In LFS, most TP53 variants are located in the highly-conserved regions of exons 5\u20138 of the DNA-binding domain, especially in exons 7 and 8 [TP53 variant in this patient is that a cytosine-to-thymine transition leads to a missense arginine-to-tryptophan transition at amino acid 282 (p. R282W) within exon 8. The R282W germline variant has previously been observed in cohorts that tend to develop mixed adenoneuroendocrine carcinoma of the gallbladder and breast cancer [ 7 and 8 . The spet cancer , 18. Thet cancer , this vat cancer . An in vt cancer . The R28TP53 variantal status and p53 protein expression by immunostaining [Pathological consequences of p53 variant include loss of normal p53 function, dominant-negative variants that can alter wild-type p53 function, and even a rare form of translocation defects with cytoplasmic accumulation and nuclear exclusion, particularly in certain regulatory domain variants . In partstaining . p53 immstaining . A cohorPTEN, frequently detected in EC and often appears in 80% of Cowden syndrome, has the most somatic copy number variations [PTEN is part of the PI3K/AKT/mTOR pathway regulation [PTEN function in EC, via inactivating variant, deletion, or loss of protein expression, is associated with elevated levels of phosphorylated AKT [PTEN in EC was 66.42%. Loss or alteration of PTEN occurs in 45% of EC and is more commonly found in endometrioid EC than in other histological subtypes. A study showed that the TP53 variant frequency in serous endometrial carcinomas (>\u200990%) differentiated them from the endometrioid subtypes (11.4%) [TP53-mutated endometrial carcinomas is uterine serous carcinoma [TP53 variant also have non-silent variants in PTEN, compared to only 2.6% serous tumors with non-silent TP53 variants, although TP53 variants are not restricted to serous tumors, the co-existing PTEN variants in the endometrioid cases suggest a distinct tumorigenic mechanism [In addition, the current patient carried six types of somatic cancer variants, especially riations , 26. PTEgulation . Loss ofated AKT . The Can (11.4%) , anotherarcinoma . Howeverechanism , which iTP53 germline variants [TP53 germline variants. This paper reports for the first time, a LFS patient with a rare ovarian germ cell tumor. The current understanding of YST at the molecular level is very limited, despite recent cancer genomic characterization efforts. The genomic landscape, evolutionary pattern, and chemoresistance-related mechanisms of this disease are largely unknown, due to lack of molecular evidence in this kind of tumor, further researches are needed with clinical trials and studies dedicated to better understanding the rare gynecological tumor molecular profile and pathogenesis.Ovarian tumors reported in cases of LFS usually correspond to common epithelial tumors . It had variants . HoweverTP53 variant carriers. The results showed that approximately 49% of people carrying with TP53 variants developed a subsequent cancer within 10\u00a0years of the first cancer. The average age-specific risk of developing a second cancer was comparable to the risk of developing a first cancer [TP53 variant had an increased risk of developing a second cancer; 30\u00a0years after the first cancer was diagnosed, the cumulative probability of developing the second cancer was 57% [In the National Cancer Institute\u2019s LFS study, Phuong L. Mai reported the risk assessment of the first and subsequent cancers and the annual cumulative risk of the first and second cancer in t cancer . Hisada  was 57% . In this was 57% .Genetic counselling and predictive testing should be offered to patients fulfilling the classic LFS criteria as well as to their relatives, with intensified cancer screening if LFS is confirmed. This patient was very cooperative with our recommendation for genetic testing, and she understood that it is very important to her prognosis. As increasingly comprehensive genetic testing is provided to individuals who do not display a confirmed syndrome phenotype or family history, a wider range of aberrant expressions associated with germline variants of cancer-susceptibility genes may be realized. When pathology results show aberrant p53 patterns, as in this case, germline testing should be performed, particularly in young patients.This study represents the first reported case of a young, female patient with LFS who developed EC after a YST, highlighting the importance of screening and surveillance in hereditary cancer-susceptibility syndromes. This case highlights the importance of genetic testing for patients with malignant tumors, as well as patients with a family history of malignant tumors. Genetic screening not only provides enhanced cancer monitoring to improve the prognosis of patients, but also supports individualized and risk-based treatment decisions.Additional file 1:\u00a0Supplementary Table 1. The genes list of the 688 genes detected in this case."}
{"text": "In this paper, we propose a novel approach to utilize silicon nanowires as high-sensitivity pH sensors. Our approach works based on fixing the current bias of silicon nanowires Ion Sensitive Field Effect Transistors (ISFETs) and monitor the resulting drain voltage as the sensing signal. By fine tuning the injected current levels, we can optimize the sensing conditions according to different sensor requirements. This method proves to be highly suitable for real-time and continuous measurements of biomarkers in human biofluids. To validate our approach, we conducted experiments, with real human sera samples to simulate the composition of human interstitial fluid (ISF), using both the conventional top-gate approach and the optimized constant current method. We successfully demonstrated pH sensing within the physiopathological range of 6.5 to 8, achieving an exceptional level of accuracy in this complex matrix. Specifically, we obtained a maximum error as low as 0.92%  using the constant-current method at the optimal current levels (1.71% for top-gate). Moreover, by utilizing different pools of human sera with varying total protein content, we demonstrated that the protein content among patients does not impact the sensors\u2019 performance in pH sensing. Furthermore, we tested real-human ISF samples collected from volunteers. The obtained accuracy in this scenario was also outstanding, with an error as low as 0.015 pH unit using the constant-current method and 0.178 pH unit in traditional top-gate configuration. Metabolic acidosis in patients admitted to the intensive care unit (ICU) is commonly associated with various causes and unfavorable outcomes. Studies indicate that the rate of pH change in blood may serve as a better predictor of ICU mortality compared to other metabolic indicators ,2,3,4. LIn this context, field-effect transistors (FETs) present excellent potential for the development of wearable and continuous biosensors. They offer advantages such as miniaturization, low power consumption, and the ability to develop label-free bioassays, enabling continuous monitoring. Specifically, fully depleted silicon nanowires (SiNWs) have emerged as promising candidates for integrating a multiplexed biosensing platform ,6,7,8.The objective of our work is to lay the groundwork for the development of wearable and continuous biosensors capable of detecting pH and potentially other biomarkers in human ISF using silicon nanowire transistors a. To achPrevious studies have demonstrated the use of silicon nanowire dual-gate field-effect transistors for ultra-high sensitivity pH sensing ,10. HoweThe fabrication of silicon nanowire arrays on Silicon-On-Insulator (SOI) substrates have been performed at CEA LETI . In our All electrical measurements were performed on a Keithley 4200A. The silicon nanowires ISFETs were cleaned with 99% ethanol and abundantly rinsed with deionized water before each experiment.We propose to investigate a constant drain current operating method for the SOI field-effect transistor, wherein the front gate, back gate, and source terminals are biased with a constant voltage, and the output drain voltage is monitored as the output voltage while the drain current is kept constant a. Our fiREF b. Througnversion a, the trOn the contrary, when operating in strong inversion, the SiNWs transistor can function as a pH sensor with a lower sensitivity but an expanded linear range, particularly when biased in the linear operation region , it leads to a charge perturbation on the oxide surface, which, in turn, is counterbalanced by a modification in the channel conductance or carrier density. In our particular use case, where the drain current flowing in the channel is maintained constant, any alteration in conductance triggers an automatic adjustment in the drain voltage. To establish a relationship between the shift in drain voltage and the pH change in the solution, we can express it using the following equation:The creation of an all-region model of the pH sensor while working in constant current operation is not straightforward. When a pH shift occurs in a solution  three times in PBS 1X at 150 mM. The dilution factor of three was chosen to replicate the concentration of total protein content typically found in human interstitial fluid, which accounts for approximately one-third of the total plasma protein content ,15,16. IS1), Human serum H4522 (S2), and 6914 from Sigma-Aldrich (S3). These samples were diluted three times in PBS 1X at 150 mM. We tested these samples on the same silicon nanowire sensors, and their pH values were determined by back-calculation using the calibration curve obtained from the first set of ISF-like samples. The pH values obtained were then compared to those obtained using a benchtop pH meter (Fisherbrand accumet AE150).The selected pH range corresponds to what is believed to be the relevant range for interstitial fluid, as suggested by clinicians and literature, which considers the interstitial fluid pH to vary between approximately 6.5 and 8 under physiopathological conditions ,18. AddiFinally, real human ISF samples were collected from three different healthy volunteers a. Each vTo compare the pH sensitivities of the silicon nanowires in both \u201cbuffer\u201d and \u201cISF-like\u201d matrices, we conducted voltage sweeping experiments in top-gate configuration. The reference voltage was swept from \u22120.5 V to 1.5 V using an external Ag/AgCl reference electrode immersed in the liquid under test. The applied back-gate voltage , were injected for 120 seconds. The pH of these \u201cunknown\u201d samples was back-calculated using the pH calibration curve and compared to the readings from the benchtop pH meter.Following the sensitivity assessment in voltage sweeping mode, we proceeded to real-time pH sensing in top-gate configuration. The reference voltage was biased at 0.2 V, the drain voltage at 0.5 V, and both the back gate and the source were biased at 0 V. The drain current was recorded over time. The ISF-like calibrators were injected for 120 seconds, forming a \u201cpyramid\u201d as the pH transitioned from high to low. One of the calibrator samples was retested after the pyramids to assess the accuracy of the calibration curve. Subsequently, three different ISF-like samples with unknown pH  was collected from three healthy volunteers, similarly to other works ,20. The To assess the pH accuracy of our SiNWs platform in real human ISF, we prepared four ISF-like calibration solutions following the method described in the previous section. For each testing method, we generated a calibration curve using these solutions and subsequently tested the \u201cunknown\u201d ISF sample. All experiments were conducted using the same SiNWs sensor.Initially, we tested the SiNWs in voltage sweeping mode in top-gate configuration. In ISF-like solutions, we observed a lower sensitivity a compare fitting b.Following the voltage sweeping test, we proceeded to real-time pH sensing in top gate configuration. We followed the same protocol as described in the previous section, injecting the ISF-like calibrators for 120 seconds to form a pyramid shape, followed by injection of the \u201cunknown\u201d ISF sample c. The pHThe results of this section are summarized in Surprisingly, the pH of the pooled human interstitial fluid sample was notably higher than anticipated, measuring at 8.60. Previous works have measured pH in skeletal muscles interstitial fluid using microdyalisis and found values between 6.9\u20137.4 , others In summary, our study presents a novel approach to use silicon nanowires ISFETs as high-sensitivity pH sensors for wearable applications. By fixing the current bias of silicon nanowires and monitor the resulting drain voltage as sensing signal, we were able to outperform the accuracy of conventional top-gate methods. We provided a phenomenological explanation on how this constant current method works and what parameters influence the sensing performance. It was demonstrated that by fine tuning the injected current levels and operating the transistors in different regimes, we can optimize the sensing conditions according to different sensor requirements. Typically, we deduced that the weak inversion regime demonstrates superior sensitivity but poor stability and sensing range, while the strong inversion regime shows poorer sensitivity but superior stability and sensing range. We established that the moderate inversion regime provided the optimized balance for pH sensing by offering high sensitivity and good stability across a practical pH range. Additionally, our proposed approach simplififes the requirements of the wearable readout circuit, by enabling voltage measurement instead of current at nanoamper range.In our study, we found that human serum diluted three times in PBS 1X exhibited a similar total protein content to human ISF. We validated this threefold difference in total protein content by conducting BCA assays on three different human ISF samples. Using the three times diluted human serum as ISF-like calibrators, we successfully measured pH in ISF-like solutions with high accuracy (0.07 pH unit) through a constant current method, which outperformed conventional top-gate methods (0.13 pH unit). Subsequently, we applied the constant current method to real human ISF sensing, obtaining a pH value of 8.60 for the pooled human ISF sample. This value was notably higher than what is typically reported in the literature for ISF in general, making us the first group to measure dermal interstitial fluid pH using silicon nanowire ISFETs. Further research is needed to explore the pH baseline and dynamics of dermal human interstitial fluid, as well as to assess the long-term stability and potential applications of our constant current method for continuous and real-time biosensing."}
{"text": "The development ofnew methods and protocols for thesynthesisof biologically active substances remains one of the most importantpillars in organic chemistry, and one of these privileged structuralmotifs are allylic alcohols. The method of choice to date for thesynthesis of these is the Nozaki\u2013Hiyama\u2013Takai\u2013Kishireaction. We describe here a valuable alternative to the synthesisof allylic alcohols via 1,2-metallate rearrangement. In this work,various vinyl boronic esters with different functional groups havebeen applied in the Hoppe\u2013Matteson\u2013Aggarwal reaction.In addition, two monoterpenoids were constructed via this convergentsynthetic strategy. This setup mimics the NHTK reaction2 albeit with reversed polarities, where the alcohol is maskedas a Hoppe anion acting as the nucleophile, while the vinyl compoundfunctions as the electrophile  synthesis,making this disconnection approach even more useful  analogues were designed to reflect the situation inpolyketide frameworks. For example, TIB esters 18, ethers/enol ethers (29-31), and aromatic residues (32-35) were used in any matched or mismatched cases. A tendency of increasing yieldwith the degree of substitution was identified (52\u201379%). Thedecisive factor for this observation is probably the enhanced migrationability in the 1,2-metallate rearrangement due to the inductive effectof the aliphatic substituents. Only fully substituted vinyl boronicester 26 stands out by showing a comparable yield tounsubstituted 23 (50% vs 52%), possibly due to the sterichindrance in the ate-complex overruling the increased migration ability.At the beginning of our studies,vinyl boronic esters 23-27 with dif23-272a. The e8. After protection of the generatedalcohol, the vinylsilane unit in 44 could be used innumerous reactions such as electrophilic substitutions, Heck-likereactions, or transmetalations and could thus represent an importantbuilding block in total synthesis.14 Inaddition to the vinylsilane unit, enol ether functions were also introduced.Here, the observed yield of the cyclic enol ether 46 (39%)was significantly lower than that of the open-chain enol ether 45 (64%). The reaction of TIB ester 18 and moderate yield (45%).The low selectivity in the case of the TIB ester could be attributedto \u03c0\u2013\u03c0 interactions between the TIB group and thearomatic substituent of the vinyl boronic ester. As a result of thisattractive interaction, the seven-membered transition state ate-II could occur during ate-complex formation, which would favorthe ate-complex formation under inversion. In 2017, the group of Aggarwalinvestigated the SE2\u2032 reaction of allyl-boronatesby treating the Hoppe anion derived from TIB ester 21 in the presence of (+)-sparteine with elongated vinyl boronic ester 52.8 In contrast to our observationswith the directly substituted vinyl boronic esters, they did not observean inversion process. Therefore, it can be assumed that both the directconjugation to the double bond and the enormous rigidity are crucialfor the inversion. This inversion process probably runs in strongcompetition with the usually observed retention and could explainthe low selectivity for the TIB ester. This attractive interactionis not possible in the case of the Cb group; therefore, no inversionprocess can occur here, and accordingly, the excellent selectivity(\u226519:1) induced by (+)-sparteine is maintained. Based on theseobservations, the other vinyl boronic esters with aromatic substituentswere converted with carbamate 22 and in an excellent selectivity(\u226519:1). In addition to the simple phenyl substituent, electron-richand -poor aromatic substituents were introduced in moderate to goodyields .A remarkableobservation was made when vinyl boronic esters witharomatic substituents were used in the 1,2-metallate rearrangement3 in comb21 with vin2115 and (\u2212)-rosiridol(56)16 were constructed via our Hoppe\u2013Matteson\u2013Aggarwalprotocol (Rhodiola rosea (golden root) and Rhodiola sachalinensis.17 Sachalinol A (55) was first described by the group of Kadota in 2001.15a The strong cytotoxic property and good anticanceractivity18 make Sachalinol A (55) an attractive synthetic target. Rosiridol (56) isthe aglycone of the MAO inhibitor rosiridin and thus also a syntheticallyvaluable target.19 The synthesis of thesetwo natural products will be carried out via a convergent approachof the previously described Hoppe\u2013Matteson\u2013Aggarwalprotocol, requiring in both cases the literature-known vinyl boronicester 58.20In order to show that this chemistry can be applied tonaturalproduct classes other than polyketides, the two monoterpenoids (\u2212)-sachalinolA -sparteine and subsequent treatment with vinyl boronic ester 58 (78% o2s)20 afforded allylicalcohol 62 in a good yield of 68% over two steps andin excellent selectivity (\u226519:1). The synthesis of sachalinolA (55) was completed by global deprotection using TBAFin an overall yield of 35% (6 steps lls).The first step in the synthesis of TIB ester etone 60 5. Additi59 requiredfor the synthesisof (\u2212)-rosiridol (56) was carried out under phasetransfer conditions22 with commerciallyavailable homoallylic bromide 63 (sBuLi and (+)-sparteinewith vinyl boronic ester 58 (78% o2s)20 afforded allylic alcohol 64 in a very goodyield of 69% after oxidation. Deprotection of the primary TBS etherwith TBAF afforded (\u2212)-rosiridol (56) in an overallyield of 51% (5 steps lls).The synthesis of TIBester omide 63 6. The su23 However, the use of the corresponding carbamates again led to theusual excellent selectivities. Moreover, the applicability of ourprotocol in convergent synthesis planning was impressively demonstratedby the total synthesis of two monoterpenoids. Thus, to the best ofour knowledge, our synthesis of sachalinol A (55) representsthe shortest synthesis of this cytotoxic compound to date.24 Accordingly, this protocol of the Hoppe\u2013Matteson\u2013Aggarwalchemistry represents a synthetically very valuable alternative tothe NHTK reaction.Inconclusion, our protocol of the Hoppe\u2013Matteson\u2013Aggarwalchemistry allowed us to convert a broad range of vinyl boronic estersinto allylic alcohols in consistently good yields and excellent selectivities.Only the vinyl boronic esters featuring aromatic substituents in combinationwith the TIB group were an exception. Here, in addition to the usualretention, inversion was also observed during ate-complex formation.This observation clearly contradicts the established thesis that boronicesters react exclusively under retention."}
{"text": "Escherichia coli in milk, is a serious public health concern as milk is considered a complete food and an important part of daily human diet worldwide, including in Bangladesh. However, there have been no reports on the molecular characterization and antibiotic resistance profile of extended-spectrum beta-lactamase (ESBL)-producing E. coli from milk of healthy cows in Bangladesh. Therefore, this study aimed to detect and characterize ESBL-producing E. coli (ESBL-Ec) in milk samples from healthy cows in smallholder dairy farms in Mymensingh district, Bangladesh, and assess the potential risk of consuming this milk.The emergence of antimicrobial-resistant bacteria, such as Escherichia coli was isolated from the collected samples using standard methods. The detection of ESBL-Ec was performed phenotypically using cultural methods and genotypically by ESBL genetic determinants using multiplex polymerase chain reaction. Antimicrobial susceptibility testing of the ESBL-Ec isolates was performed using the disk diffusion method with 15 common antimicrobials.A total of 100 milk samples were collected from apparently healthy cows on smallholder dairy farms. E. coli. Among these, 41 (58.6%) strains were identified as ESBL-producing, both phenotypically and genotypically, with the presence of blaCTX-M, blaTEM, and blaSHV individually or combined (blaCTX-M plus blaTEM plus blaSHV). The antibiogram of these ESBL-positive isolates revealed high resistance against commonly used antibiotics, such as ampicillin, cefotaxime, and gentamicin (100%), azithromycin (88%), oxytetracycline (27%), nalidixic acid, cotrimoxazole/trimethoprim (24%), and streptomycin (22%). In addition, one isolate showed resistance to 4th generation of cephalosporin (cefepime). Most importantly, extensive multidrug resistance was found in many ESBL-Ec isolates. However, the isolates were highly sensitive to drugs such as ceftriaxone (100%) and imipenem (100%). This is the first study to detect ESBL-Ec in raw milk from healthy cows on smallholder dairy farms in Bangladesh.In this study, out of the 100 samples tested, 70 (70%) were found to be positive for E. coli isolated from raw milk of healthy cows tested positive for ESBL production and showed resistance to most commonly used antimicrobials which may be alarming for human health. A limitation of our study is that we had a small size of sample collected from one district in Bangladesh. Therefore, a larger sample size covering a wider geographic area, and using multi-locus sequence typing and whole genome sequencing could provide a more comprehensive understanding of the prevalence and characteristics of ESBL-Ec in Bangladesh.More than 58% of the  Escherichia coli harboring extended-spectrum beta-lactamase (ESBL) gene has been considered as a global threat to human health in the past decade [E. coli (ESBL-Ec) [E. coli is widely distributed in food and wild animals, hospital settings, humans, environment and food supply chain, etc. [blaCTX-M gene based on amino acid sequence homology  [blaCTX-M-15 member of blaCTX-M-1 group is the most dominant globally, including Bangladesh [blaCTX-M-1 and blaCTX-M-2 are prevalent [Enterobacteriaceae [Enterobacteriaceae bacteria, enterohemorrhagic E. coli strains can cause infections through milk, posing a significant health risk to humans [t decade , 2. The ESBL-Ec) . Extendein, etc. . There ain, etc. . GloballTX-M-25) . The blangladesh . In Bangrevalent , 8. Ceforevalent , 9. In Beriaceae . In addieriaceae . Among Eo humans . The preo humans , 13. Theo humans . Hence, The smallholder farming system contributes greatly to our national economy. However, farmers of smallholder dairy farms lack awareness about the rational use of antimicrobials, leading to frequent irrational use of antimicrobials as therapeutics or prophylaxis for dairy cows. Although there are a few reports on the prevalence of ESBL-Ec in drinking water , retail Therefore, this study was conducted to detect and characterize ESBL-Ec from healthy cow raw milk samples from smallholder dairy farms in Mymensingh district in Bangladesh.Ethical approval was not required for this study because animals were only subjected to milk collection. However, written informed consent was obtained from the owners for the participation of their animals in this study.The study was conducted from April 2021 to January 2022. A total of 100 raw milk samples were collected from healthy cows from smallholder dairy farms of 4 Upazilas  in Mymensingh district.Approximately, 15 mL of milk was collected in sterile plastic containers directly from the cow\u2019s teat. The samples were transported to the laboratory of Department of Medicine, Faculty of Veterinary Science, Bangladesh Agricultural University while maintaining a cold chain within 5\u20136 h. All samples were tested on the same day they were received in the laboratory. The cows were healthy and did not show any signs of mastitis. Before collecting milk samples, the udder was thoroughly cleaned and wiped with a clean, dry towel, and each teat was disinfected using 70% alcohol.E. coli like colonies were collected from each sample.The milk samples were enriched using a modified protocol based on a previously described method . SpecifiE. coli [All the isolates were subjected to biochemical tests such as triple sugar iron, lysine indol motility, Simmon\u2019s citrate test, and Voges\u2013Proskauer test to identify E. coli .E. coli isolates was determined using the double-disk synergy test. The test involved using CTX and ceftazidime (CAZ) with or without clavulanic acid (CA), as recommended by the Clinical and Laboratory Standards Institute (CLSI) [The ESBL production of e (CLSI) . An isolet al. [blaTEM, blaSHV, blaCTX-M-1, and blaCTX-M-2) was performed by multiplex polymerase chain reaction (PCR) using primer set and PCR conditions [Bacterial DNA was extracted by boiling 1 mL of overnight culture, as described by Parvin et al. . Extendenditions . In brieE. coli colonies were collected and suspended in 5 mL of sterilized saline. The suspension was adjusted to achieve turbidity equivalent to 0.5 McFarland standards. An evenly distributed bacterial lawn was prepared on Mueller\u2013Hinton agar plates using sterile cotton swabs. Antimicrobial disks were placed on each bacterial lawn. The inhibition zone of each antimicrobial agent was analyzed after 16\u201318 h of incubation at 37\u00b0C. Results were interpreted according to the CLSI guidelines [E. coli strain ATCC 25922 as a control strain. Multidrug resistance (MDR) was defined as resistance to at least one antimicrobial agent from three or more antimicrobial classes [The antimicrobial susceptibility of the ESBL-Ec isolates was tested by the disk diffusion method  using coidelines . The sus classes .Escherichia coli like colonies were isolated and identified from 70 out of 100 raw milk samples. The percentage of E. coli isolated from healthy cow raw milk in smallholder dairy farms from different upazilas was 67% in Mymensingh Sadar, 83% in Muktagacha, 75% in Phulpur, and 50% in Tarakanda , blaTEM, and blaSHV. The analysis of ESBL genotype exhibited that 54% (22/41) of the ESBL-Ec carried blaCTX-M, followed by blaTEM at 24% (10/41) and blaSHV at 5% (2/41), whereas the combination of blaCTX-M with blaTEM was observed in 5% (2/41) and blaTEM with blaSHV in 12% (5/41)  . The stuE. coli carrying one ESBL group or their combination, including blaCTX-M-1 (99.9%), blaCTX-M with blaTEM (100%), blaTEM (80%), blaTEM with blaSHV (80%), and blaSHV (100%) (E. coli harboring blaCTX-M-1 (27%), blaCTX-M with blaTEM (50%), blaTEM (30%), and blaTEM with blaSHV (20%) (All the isolates of ESBL-Ec obtained from raw milk showed resistance to AMP and CTX . The higV (100%) . Most imHV (20%) .We described the detection of ESBL-Ec in healthy cow raw milk for the first time in Bangladesh. The high prevalence of ESBL-Ec in raw milk and the multidrug-resistant nature of the isolates indicate a potential risk to human health. The consumption of raw milk should be avoided. The treatment of human illness caused by ESBL-Ec should be based on the antibiogram study findings to avoid further developing antimicrobial resistance.E. coli isolates, which is much higher than a previous report (38.0%) in Sudan [blaCTX-M (59%), blaTEM (41%), and blaSHV (17%). In contrast, in Bangladesh, 38.9% of E. coli isolated from milk of cows suffered with mastitis [blaTEM. This variation may be due to the difference in isolation protocol or sample sources. However, Batabyal et al. [blaCTX-M. The blaCTX-M gene in E. coli is thought to be circulating among dairy cattle in Bangladesh. Among blaCTX-M genes, the isolates carried blaCTX-M-1 gene-group (54%) and a combination of this gene with blaTEM (5%) but no isolates harbored blaCTX-M-2 gene-group. According to geographical distribution, the prevalence of blaCTX-M-1, blaCTX-M-2, and blaCTX-M-9 genes under blaCTX-M group have been reported in Asia [blaCTX-M-1 in E. coli from raw milk origin may be relevant. Moreover, many ESBL-Ec isolates harbored the combination of blaCTX-M plus blaTEM and blaTEM plus blaSHV genes. This indicates the increasing emergence of ESBL-Ec in Bangladesh, possibly due to travelers from abroad where ESBL-Ec is prevalent.Our study revealed that 70% of the raw milk carried in Sudan . The prein Sudan \u201224. Thesin Sudan . We founin Sudan , 26. Themastitis  and 100%l et al.  reported in Asia , 28. HenEnterobacteriaceae, causing gastrointestinal diseases in humans in many countries, including Bangladesh [E. coli isolated from raw milk. The high prevalence of MDR and XDR ESBL-Ec in this study highlights the potential for these bacteria to serve as a reservoir of resistance genes and pose a threat to public health [It is well known that the plasmids harboring ESBL genes can also carry resistant genes against many other antimicrobials such as aminoglycosides, sulfonamide chloramphenicol, and tetracycline . In thisngladesh , which mc health .The prevalence of ESBL-Ec in healthy cow raw milk is very high and consumption of raw milk should be avoided. Most of the ESBL-Ec we detected were MDR and XDR, which can easily be transmitted to humans as consumers and, thus, result in potential health hazards. Therefore, it is important to raise awareness among the public and stakeholders about the potential risks associated with the consumption of raw milk and need to adopt appropriate measures to prevent the spread of AMR pathogens. This is the first study to report the detection of ESBL-Ec in healthy cow raw milk in Bangladesh.AN, MMA, and AKMAR: Conceptualization. AN, AKMAI, MNI, MKK, and MSK: Methodology. AN, AKMAI, MNI, MKK, and MSK: Original draft preparation. MMA and AKMAR: Editing and supervision. All authors have read, reviewed, and approved the final manuscript."}
{"text": "Valeriana jatamansi,exhibited an association with beta-amyloid binding activity, a potential therapeutic approach for AD. From our study we could understand how these plants modulateour body to manage these diseases. However, further in vitro and in vivo validation is needed before commercial and public use of this data.Neurodegenerative diseases, such as Alzheimer's disease (AD), Parkinson's disease (PD), and epilepsy, pose a growing global health challenge due to an agingpopulation. These conditions share common processes, including protein accumulation, oxidative stress, and neuro-inflammation, making their treatment complexand costly. Network pharmacology, an innovative approach integrating systems biology and computational biology, offers insights into multi-target formulationsand the repurposing of existing medications for neurodegenerative diseases. We shortlisted 730 bioactive compounds from 25 traditional Himalayan plants, assessedtheir drug-like properties using ADME criteria, and predicted their potential target proteins through reverse docking and pharmacophore mapping. Our studyidentified 287 compounds with high gastrointestinal absorption and good blood-brain barrier permeability. These compounds were subjected to target prediction,yielding a list of 171 potential target proteins. Functional annotation and pathway enrichment analysis highlighted their involvement in steroid hormone-relatedpathways, MAPK signaling, FOXO signaling, TNF signaling, VEGF signaling, and neurotrophin signaling. Importantly, one plant,  Neurodegenerative diseases are the progressive deteriorating conditions characterized by the death of nerve cells and supreme loss of neurons.Neurodegenerative diseases are age-related conditions that have an effect on the brain as well as the nerves found throughout the human body and the spinalcord. These age-dependent disorders have become progressively rife, partly as a result of the senior population has risen in recent years. Neurodegenerativediseases mainly include Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), Amyotrophic lateral sclerosis (ALS), front temporaldementia and the spinocerebellar ataxias . NeurodeAmong all, presence of AD is considerably high and is increasing per annum. The global burden of AD is anticipated to accelerate from 26.6 million cases in2006 to 106.8 million by 2050 . AD is cUnfortunately, the complex etiology and pathogenesis of neurodegenerative diseases limit the efficacy of drugs for their treatment, and higCannabis sativa, Cyperus rotundus, Ravoulfia serpentina,and many others [Here, we studied twenty-five Himalayan plants mainly from Darjeeling and some Sikkim region which are traditionally used treating neural diseases likeepilepsy, headache, and other CNS related diseases. Traditionally many plants are used in different regions by local healers to treat many of these neurologicaldisorders. The sub-Himalayan region of Eastern-India is also rich in such traditional knowledge. Darjeeling, the northern most part of the state West Bengal,India, is situated in the foothills of the Himalayas. It is rich in culture and is inhabited by different tribes. These tribes have treated diseases like epilepsy,headache and other neurological disorders using plants such as y others ,9,10,11y others . TherefoAn extensive study was done to understand the traditionally used plants of Darjeeling Hills and Sikkim which are used for treating neural diseases likeepilepsy, headache and other CNS related diseases. Along with literature survey, we also talked with some of the locals of the region and validated thedocumented knowledge. A total of 25 plants from Himalayan region which are traditionally used in treating neural disease were selected using literature study.The bioactive compounds of the selected plants were obtained from Dr. Duke's Phytochemical and Ethnobotanical database .Dr. DukThe drug likeliness of the phytocompounds is determined on the basis of their ADME property. ADME  propertyevaluation helps to get an idea regarding how a chemical is processed by a living organism . Thus, wThe phytocompounds interact with numerous proteins of our body and modulate them. PharmMapper predicts potential target candidates for the given smallmolecules on the basis of reverse docking and pharmacophore mapping approach . The selTo understand the role of a set of genes in metabolic pathways, gene ontology analysis is important. The target-gene list of each plant was submitted inDAVID Bioinformatics Resources v6.8 (https://david.ncifcrf.gov/tools.jsp) for functional annotation and KEGG pathway enrichment analysis. It gives an insightin role of these proteins in different metabolic pathways. Gene ontology (GO) enrichment analysis comprised Biological Process (BP), Cell Component (CC), andMolecular Function (MF). The results with significant p-Value  were taken into consideration.A total of 25 plants from Himalayan region which are traditionally used in treating neural disease were selected using literature study. The plant list isprovided in the supplementary file.Total 1362 phytochemical compounds were obtained from the studied plants, out of which 730 compounds having canonical smiles and CID number. The ADMEproperties of the acquired compound were analyzed, which shows 287 compounds with High Gastrointestinal Absorption (GI) and good Blood Brain Barrier (BBB), 34compounds with low Gastrointestinal (GI) absorption but good Blood Brain Barrier (BBB) permeability, 139 Compounds with high Gastrointestinal absorption (GI) butno Blood Brain Barrier (BBB) permeability, and 273 compounds with low Gastrointestinal absorption (GI) and no Blood Brain Barrier permeability (BBB). Thecompounds having both high GI and good BBB permeability were considered and further analysis was carried out. A plant phytocompound network of the compoundswith best results is shown in Panax ginseng has the highest number of targets (51), followed by Curcuma longa and Cannabis sativa. Thecompound Yohimbine is the best compound as it has 15 targets. Functional annotation and pathway enrichment analysis of the targets show association of theplants with various pathways that are related to nervous system pathways in Homo sapiens were found to target several genes related to steroidhormone metabolic pathways. They show ability to modulate genes related to \"steroid hormone mediated signalling pathway\", \"steroid hormone receptor activity\",\"Steroid hormone biosynthesis\" and \"steroid binding\" activity. The plants Centella asiatica and Ravoulfia serpentine mainlyact through these pathways only. Cannabis sativa and Panax ginseng too modulate a number of these pathways.The selected traditionally used plants for neural disorders , Parkinson's disease (PD), amyotrophic lateral sclerosis(ALS) and various types of cancers [Functional annotation and pathway enrichment analysis show association of the plants with MAPK signalling pathway, MAP kinase activity, activation ofMAPK activity, protein tyrosine kinase activity, etc. that play role in cell proliferation. The plants  cancers .Apart from MAPK signalling and kinase activity, the plants target various pathways like FoxO signaling pathway, VEGF signaling, Neurotrophin signallingpathway, etc. Foxo (Forkhead box) proteins help in regulation of growth factor and stress regulating factor. FOXO3 has been found to cause axonal degenerationupon withdrawal of neurotrophic factors and can influence both CNS and PNS . AbnormaThe plants also modulated TNF (Tumour necrosis factor) signalling pathway and VEGF signalling pathway. Both pathways are associated with neuroprotection inthe brain. Another modulated significant pathway is Neurotrophin signalling which pathway plays an important role for neural development and additionalhigher-order activities such as learning and memory . Thus, by regulating this pathway, development and enhancementof neural cells can be modulated, which may be helpful in preventing various neural diseases.V. jatamansitargets a different set of genes for treatment of neurological disorders, then the rest of the selected plants. Its phytocompounds interact with target proteinsthat have \"beta-amyloid binding activity\". It is known that beta-amyloid protein accumulation causes AD [Modulation of all these targets and pathways may be the mode of action for these plants that have been used to treat neurological diseases from timeimmemorial. These may also help in finding a new approach in treating such diseases. However, in our studies it was seen that the plant auses AD . Thus, tin vivo and in vitrostudies is essential to gain a deeper understanding of these results and their potential implications for the management of neurological disorders.In conclusion, while the human race has long been regarded as unique and superior among living organisms due to its intelligence and cognitive capabilities,the contemporary lifestyle and increasing levels of stress pose a significant threat to this exclusivity. Today's lifestyle significantly elevates the risk ofvarious cerebrovascular diseases, potentially contributing to degenerative forms of cognitive impairment, as indicated by researchers. Neurological disorders,as defined by the World Health Organization (WHO), encompass conditions affecting both the brain and the nervous system, which extends throughout the human body.Our study sheds light on the underlying mechanisms of traditionally employed plants in addressing these issues. Notably, steroid hormones play a direct role inthe aging process and the development of neural diseases, suggesting that the modulation of these pathways may be central to the action of these plants. Ourfindings suggest that the modulation of steroid hormone pathways and pathways related to cell viability may hold promise in managing cognitive diseasesassociated with neural cell damage. However, it is imperative to note that further validation through AS conceived the idea. TDL and SD collected data and executed the analysis. JL, MAA, SD & AS helped in data analysis using Bioinformatics tools. All theauthors have contributed in writing the manuscript and approved it."}