{"text": "In 2001 the National Cholesterol Education Program (NCEP) provided a categorical definition for metabolic syndrome (c-MetS). We studied the extent to which two ethnic groups, Blacks and Whites were affected by c-MetS. The groups were members of the Hypertension Genetic Epidemiology Network (HyperGEN), a part of the Family Blood Pressure Program, supported by the NHLBI. Although the c-MetS definition is of special interest in particular to the clinicians, the quantitative latent traits of the metabolic syndrome (MetS) are also important in order to gain further understanding of its etiology. In this study, quantitative evaluation of the MetS latent traits (q-MetS) was based on the statistical multivariate method factor analysis (FA).The prevalence of the c-MetS was 34% in Blacks and 39% in Whites. c-MetS showed predominance of obesity, hypertension, and dyslipidemia. Three and four factor domains were identified through FA, classified as \"Obesity,\" \"Blood pressure,\" \"Lipids,\" and \"Central obesity.\" They explained approximately 60% of the variance in the 11 original variables. Two factors classified as \"Obesity\" and \"Central Obesity\" overlapped when FA was performed without rotation. All four factors in FA with Varimax rotation were consistent between Blacks and Whites, between genders and also after excluding type 2 diabetes (T2D) participants. Fasting insulin (INS) associated mainly with obesity and lipids factors.MetS in the HyperGEN study has a compound phenotype with separate domains for obesity, blood pressure, and lipids. Obesity and its relationship to lipids and insulin is clearly the dominant factor in MetS. Linkage analysis on factor scores for components of MetS, in familial studies such as HyperGEN, can assist in understanding the genetic pathways for MetS and their interactions with the environment, as a first step in identifying the underlying pathophysiological causes of this syndrome. Metabolic and physiologic disorders for cardiovascular disease (CVD) and type 2 diabetes (T2D), including abdominal obesity, insulin resistance, hyperglycemia, dyslipidemia, and hypertension often cluster. This cluster is frequently identified as the \"metabolic syndrome\" (MetS). Reaven  related Different definitions and multivariate statistical approaches have been applied to characterize the increasing high-risk MetS premorbid state. Recently, special attention has received the categorical definition of metabolic syndrome (c-MetS) of the National Cholesterol Education Program Adult Treatment Panel III (NCEP) . The NCEa. The trait characterized as the categorical MetS (c-MetS) was studied according to the NCEP definition; b. The underlying (latent) traits or clusters of MetS (q-MetS) were evaluated by performing FA with and without Varimax rotation on 11 risk factors. All data were grouped by ethnicity and gender. Subgroups were created by excluding T2D participants, under the assumptions that T2D individuals may have a different pattern of glucose and insulin levels. Finally, our goal was to compare the expression of c-MetS and q-MetS in the Hypertension Genetic Epidemiology Network (HyperGEN) study.The objective of this study was to exemplify important facets of the MetS in the HyperGEN study. Two MetS aspects were assessed: For c-MetS the sample sizes varied from 2,025 observations for fasting triglycerides (TG) to 2,300 for high density lipoprotein (HDL) cholesterol in Blacks, and from 2,171 observations for TG to 2,471 for HDL in Whites. In the HyperGEN study, a high percentage of individuals have body waist (WAIST) and systolic blood pressure (SBP) / diastolic blood pressure (DBP) above the NCEP thresholds , fasting plasma glucose (GLUC), fasting insulin (INS), HDL, SBP, DBP, WAIST, and percent body fat (%BF), similar low density lipoprotein (LDL) cholesterol and waist to hip ratio (WHR), and lower TG. Kurtosis after adjustments varied from 0.11 for WHR to 0.85 for DBP in Blacks, and 0.17 for WHR to 1.43 for GLUC in Whites, which demonstrates normal distributions for the traits in study and also for the factors created by performing FA .Pearson correlations among the 11 adjusted and normally distributed variables are presented in Table FA with no rotation identified a factor (Factor 1) that was loaded mostly by central obesity, obesity risk factors and INS  method in S-PLUS (Insightful Corporation software), we found that the model p-values were significant, suggesting that additional factors may exist. However, although additional factors must exist to explain approximately 40 percent of the variance in the original variables, none of the remaining factors individually can explain more than about 5 percent of the variance. Therefore, we concluded that the quantitative structure of MetS can be described in terms of three to four factors when no rotation was performed, and four factors with Varimax rotation. One may even argue whether the fourth factor in the Varimax rotation is very meaningful. We chose to retain the \"Central Obesity\" factor particularly because it tends to reflect the well-known gender asymmetry Table . FA withWe tested the pattern of the factors between genders only for FA with Varimax rotation. This pattern was stable among ethnicities between genders Table . WHR on Another characteristic of the HyperGEN study was that at least two participants in each sibship had hypertension. A large proportion of the hypertensive participants have used anti-hypertensive and anti-cholesterol medications. Maison et al.  have comIt is a common belief that T2D participants may have a different expression of INS and GLUC, therefore it may influence also the factors pattern in the MetS analysis. In the present study, we found a consistency of the factors before and after removing type 2 diabetics. This finding is supported also by Hanson et al.  who studOther studies have provided similar results about the latent traits of MetS ,16,17. FOur study and several others have shown that FA is a useful method for studying the underlying traits of MetS. Nevertheless this methodology has not passed without been criticized. Lawlor et al.  reviewedIf c-MetS and q-MetS are explaining the same disorder in two different aspects in the HyperGEN study, can FA contribute to MetS gene finding? MetS is recognized as a precursor for cardiovascular disease and type 2 diabetes . There aThese analyses demonstrated that obesity and hypertension were the most important factors contributing to the MetS in the HyperGEN Study. Three to four distinct factor domains were identified depending on the FA rotation applied and decisions made. Results support the hypothesis that MetS is a compound phenotype, where obesity and its relationship to lipids and insulin are clearly the driving force of MetS. Insulin may play a connecting role between obesity and lipid domains.In genetic analysis, it is well known that categorical data, especially a complex trait such as MetS, encounter reduced power as compared to quantitative variables. Therefore, we suggest that genetic analysis should be performed on specific combinations of traits that belong to a factor. It is possible that some common genes may exist in the pathways for the factors identified. Linkage analysis investigating putative quantitative trait loci for MetS factor domains can be a first step which may help discover the underlying mechanisms, or generate new hypotheses, in finding the causes of MetS.The sample represents data from the HyperGEN network, part of the Family Blood Pressure Program, supported by the NHLBI as described by Williams et al.  and ProvA participant was classified as having T2D if (s)he had a fasting plasma glucose value \u2265 126 mg/dl, or is a current user of hypoglycemic medication or insulin that was documented at examination in the clinic, or if diabetes was reported in the HyperGEN questionnaire. Also, an age at diagnosis \u2265 40 years was required for T2D individuals .c-MetS according to the NCEP definition, was identified in participants by the simultaneous presence of 3 or more of the following conditions: WAIST > 102 cm in men, and > 88 cm in women; TG \u2265 150 mg/dl; high density lipoprotein (HDL) < 40 mg/dl in men, and < 50 mg/dl in women; systolic blood pressure (SBP) \u2265 130 mm Hg and/or diastolic blood pressure (DBP) \u2265 85 mm Hg or using antihypertensive medications; GLUC \u2265 110 mg/dl or on treatment for diabetes [2); WAIST measured at the level of the umbilicus in cm; WHR defined as waist circumference divided by hip circumference; GLUC in mg/dl; INS in \u03bcU/ml (where fasting time was defined as \u2265 12 hours before blood draw); LDL in mg/dl; HDL in mg/dl; TG in mg/dl; Sitting SBP in mm Hg; DBP in mm Hg ; %BF derived from the bioelectric impedance measurements based on the Lukaski formula [Factor analysis was founded on 11 variables: BMI expressed as the ratio of body weight divided by body height squared (in kg/m formula .2) and the squared transformation of %BF (%BF2) reduced the excess kurtosis considerably. The procedure transreg in SAS (version 9 for PC) was employed for finding power transformations.TG and INS had skewed distributions. A relatively skewed distribution was also present for HDL. Log transformation brought these variables distributions to approximately normal. GLUC and %BF were highly kurtotic. Using Box-Cox transformation, it was found that the inverse of the squared transformation of GLUC . Any variables with outliers beyond \u00b1 4 standard deviations (SD) were also adjusted for heteroscedasticity of the variance. After the adjustments for each variable, outliers beyond \u00b1 4 SD were eliminated. Each final adjusted variable was standardized to a mean 0 and variance 1.There were two field centers recruiting Blacks and four field centers recruiting Whites. Accordingly, dummy  field center variables, one for Blacks and three for Whites, were created. All 11 risk factors were adjusted within ethnicity and gender for age, agea priori information about the structure underlying the variables. FA can be used also for a confirmatory analysis, when validation (or refutation) of a postulated structure is sought. In either case, FA seeks parsimony by summarizing a large group of interrelated variables (risk factors for a complex disease such as MetS) in terms of a small number of latent factors, thereby reducing the dimensionality. Theoretical statistical descriptions of FA can be found in the literature [factanal function, in which the MLE was employed. FA evaluated latent factors underlying the 11 original variables.Prevalence of c-MetS was estimated with the FREQ procedure of SAS. The multivariate method of factor analysis was employed for reducing a group of risk factors to a subset of latent factors. The primary goal of FA is to identify the interrelationships among a set of variables. In this study FA was used for exploratory analysis, because there was no terature -26. FA wFA was performed with and without the Varimax rotation. \"No rotation\" achieves the simplest latent factor structure, in the extreme case loading any variable in one of the factors and almost negligible loadings in the rest of the factors. That is the reason why some studies (extracting factors with no rotation) find a concentration of the major variables' loading on the first factor. This is also the reason why some investigators named the first factor in their studies as the \"Metabolic syndrome\" factor ,27. ConvMetS, metabolic syndrome; c-MetS, categorical MetS; q-MetS, latent traits of MetS; FA, Factor analysis; MLE, maximum likelihood estimate; T2D, type 2 diabetes; CVD, cardiovascular disease; BMI, body mass index; INS, fasting insulin; GLUC, fasting glucose; WHR, waist to hip ratio; SBP, systolic blood pressure; DBP, diastolic blood pressure; BP, blood pressure; TG, fasting triglycerides; LDL, low density lipoprotein cholesterol; HDL, high density lipoprotein cholesterol; %BF, percent body fat.The author(s) declare that they have no competing interests.All authors were equally involved in designing the MetS study, evaluating statistics, interpreting the data, writing the manuscript, and organizing the figure and tables.Table 4. This table contains information on factor loadings result of FA with and without rotation performed on 11 risk factorsClick here for file"}
{"text": "The lipoprotein lipase (LPL) hydrolyses circulating triacylglycerol-rich lipoproteins. Thereby, LPL acts as a metabolic gate-keeper for fatty acids partitioning between adipose tissue for storage and skeletal muscle primarily for energy use. Transgenic mice that markedly over-express LPL exclusively in muscle, show increases not only in LPL activity, but also in oxidative enzyme activities and in number of mitochondria, together with an impaired glucose tolerance. However, the role of LPL in intracellular nutrient pathways remains uncertain. To examine differences in muscle nutrient uptake and fatty acid oxidative pattern, transgenic rabbits harboring a DNA fragment of the human LPL gene (hLPL) and their wild-type littermates were compared for two muscles of different metabolic type, and for perirenal fat.ex vivo using [1-14C]oleate as substrate, was lower in hLPL rabbits than in wild-type rabbits for the two muscles under study. Both insulin-sensitive glucose transporter GLUT4 and muscle fatty acid binding protein (H-FABP) contents were higher in hLPL rabbits than in wild-type littermates for the pure oxidative semimembranosus proprius muscle, but differences between groups did not reach significance when considering the fast-twitch glycolytic longissimus muscle. Variations in both glucose uptake potential, intra-cytoplasmic binding of fatty acids, and lipid oxidation rate observed in hLPL rabbits compared with their wild-type littermates, were not followed by any modifications in tissue lipid content, body fat, and plasma levels in energy-yielding metabolites.Analyses of skeletal muscles and adipose tissue showed the expression of the hLPL DNA fragment in tissues of the hLPL group only. Unexpectedly, the activity level of LPL in both tissues was similar in the two groups. Nevertheless, mitochondrial fatty acid oxidation rate, measured Expression of intracellular binding proteins for both fatty acids and glucose, and their following oxidation rates in skeletal muscles of hLPL rabbits were not fully consistent with the physiology rules. The modifications observed in muscle metabolic properties might not be directly associated with any LPL-linked pathways, but resulted likely of transgene random insertion into rabbit organism close to any regulatory genes. Our findings enlighten the risks for undesirable phenotypic modifications in micro-injected animals and difficulties of biotechnology in mammals larger than mice. The endothelial cell-associated lipoprotein lipase (LPL) works to break down triacylglycerol-rich dietary fats absorbed after a meal, thus generating free fatty acids transported in the blood. Earlier works suggested that LPL acts as a metabolic gate-keeper for fatty acid partitioning between adipose tissue for storage and muscle primarily for energy use . Then, vAltogether, metabolic studies in muscles of transgenic animals help to understand the biological links between fatty acid uptake, intracellular lipid metabolism, and some metabolic disorders such as diabetes in human beings. However, most data have been established in mice. Potential advantages of rabbit compared with mouse as human disease model ,16 relatsemimembranosus proprius and longissimus muscles of hLPL group, proving the expression of the transgene in tissues of the rabbit organism. On the contrary, no signal was detected in the same tissues of wild-type animals  was 36% higher (P = 0.07) in hLPL rabbits than in wild-type animals for semimembranosus proprius muscle, but it did not vary in other sites under study (table P < 0.05) in semimembranosus proprius and longissimus muscles, respectively (figure Muscle content in H-FABP (responsible for cytoplasmic binding of fatty acids in muscle cells), was 30% higher in y figure , in hLPLDespite a clear evidence for expression of the hLPL transgene in the tissues under study in the hLPL rabbits only, total LPL (human +native) activity in skeletal muscles or perirenal adipose tissue was similar in hLPL rabbits and in their wild-type littermates. This situation contrasts with the moderately enhanced LPL activity in post-heparin plasma reported in another line of hLPL transgenic rabbits , and witsemimembranosus proprius (a muscle composed exclusively of slow-twitch type I fibers), and to a lesser extent in the fast-twitch glycoytic longissimus muscle. However, unlike results in mice, our findings reported a lower muscle fatty acid oxidation rates in hLPL rabbits. Others have observed that over-expression of hLPL gene specifically in skeletal muscle of transgenic mice rather led to a dose-dependent increase in oxidative enzymes and to a proliferation of the oxidative specialized organelles  triolein has been incorporated, was used as the substrate. Liberated [3H]-free fatty acids were quantified by liquid scintillation.Lipoprotein lipase (LPL) activity was assessed after homogenization of the tissues in a buffer composed of ammonia-HCl (25 mM) pH 8.2, containing EDTA (5 mM), Triton-X-100 (8 g/l), sodium dodecyl sulfate (0.10 g/l), heparin (5000 IU/l) and peptidase inhibitors. Insoluble material was discarded by centrifugation at 20000 \u00d7 escribed , rat serTissue lipid content was determined after chloroform/methanol extraction . Muscle 14C]oleic acid bound to defatted albumin in a 5:1 molar ratio was used as substrate. Oleate oxidation was measured using L-carnitine and other cofactors, in the absence  or presence  of mitochondrial inhibitors of the respiratory chain . The difference between total oxidation and peroxisomal oxidation was considered to be mitochondrial oxidation. All assays were performed in triplicates.Oxidation rate of oleic acid was determined in freshly excised muscles as described earlier for rat and bovine muscles , with miThe Kruskal-Wallis non-parametric test was used to analyze differences between groups . All data are presented as mean \u00b1 SEM.FG, JFH and PH conceived of the study, participated in its design and co-ordination. FG, SBJ and JFH carried out biochemical analyses. MD carried out pup genotyping. CV and LMH carried out micro-injection and provide transgenic breeder animals. FG, JFH and MD drafted the manuscript. All authors read and approved the final manuscript."}
{"text": "Lipoprotein lipase (LPL) is anchored at the vascular endothelium through interaction with heparan sulfate. It is not known how this enzyme is turned over but it has been suggested that it is slowly released into blood and then taken up and degraded in the liver. Heparin releases the enzyme into the circulating blood. Several lines of evidence indicate that this leads to accelerated flux of LPL to the liver and a temporary depletion of the enzyme in peripheral tissues.125I and injected. Already two min after injection about 33 % of the injected lipase was in the liver where it initially located along sinusoids. With time the immunostaining shifted to the hepatocytes, became granular and then faded, indicating internalization and degradation. When heparin was injected before the lipase, the initial immunostaining along sinusoids was weaker, whereas staining over Kupffer cells was enhanced. When the lipase was converted to inactive before injection, the fraction taken up in the liver increased and the lipase located mainly to the Kupffer cells.Rat livers were found to contain substantial amounts of LPL, most of which was catalytically inactive. After injection of heparin, LPL mass in liver increased for at least an hour. LPL activity also increased, but not in proportion to mass, indicating that the lipase soon lost its activity after being bound/taken up in the liver. To further study the uptake, bovine LPL was labeled with This study shows that there are heparin-insensitive binding sites for LPL on both hepatocytes and Kupffer cells. The latter may be the same sites as those that mediate uptake of inactive LPL. The results support the hypothesis that turnover of endothelial LPL occurs in part by transport to and degradation in the liver, and that this transport is accelerated after injection of heparin. Lipoprotein lipase (LPL) hydrolyses triglycerides in chylomicrons and VLDL and thereby makes fatty acids available for cellular uptake and use in metabolic processes ,2. RelatHeparin releases LPL from its endothelial binding sites into the circulating blood. The uptake in the liver is retarded, but not abolished ,14. ThisLPL activity in rat liver was 26 \u00b1 1 mU/g (Table To study the distribution of endogenous LPL in rat liver we used affinity-purified chicken antibodies raised against bovine LPL. These antibodies have previously been used for ELISA of LPL in rat tissues . There wLPL activity and mass in plasma increased many-fold after heparin injection Table . The higHepatic lipase (HL) was also measured in the livers Table . As expeThe pattern of immunofluorescence for LPL after heparin was similar to that before heparin, with faint staining over most cells and more intense staining over scattered cells, some of which were ED2 positive (not shown).To explore the origin of the LPL released into plasma and taken up by the liver we measured LPL activity in heart and adipose tissue before and 20 min after injection of heparin . Double staining with the ED2 antibody showed that the intensively LPL-positive cells were Kupffer cells. After 15 min the immunofluorescence had changed to a more punctuate pattern that still co-localized with Kupffer cells Figure . This inHeparin markedly changed the pattern of localization for the active lipase. The initial (two min after injection) staining along the sinusoids was much weaker than in sections from rats that had not received heparin. The staining was generally more intense at 15 min compared to at two min after injection of the lipase Figure . This isElectron microscopic autoradiography showed that when heparin was injected ten min after active LPL there was a strong reduction in the amount of LPL in the spaces of Disse and on endothelial cells, while the radioactivity found in hepatocytes and Kupffer cells remained (data not shown).Heparin had no marked effect on the distribution of the inactive LPL Figure . Most ofThis study shows that after injection of heparin, LPL activity and mass in liver increases several-fold, in concert with the hypothesis that heparin causes accelerated transport of LPL to the liver. In other parts of the body LPL is attached to HSPG ,2. Hepar125I-tyramine cellobiose and isolate the different cell types.Heparin markedly decreased the binding of LPL along the sinusoids. This presumably reflects that binding to HSPG was competed by heparin. Staining associated with Kupffer-like cells increased. This may be the same sites as those that bind inactive LPL. Another possibility is that the LPL-heparin complexes were recognized and taken up as such. There is evidence for binding and uptake of heparin by Kupffer cells . Most ofIt has been suggested that LPL and HL bind, at least in part, to the same sites in the liver ,28. It i125I-LPL to rats and found that about 10% of the lipase that had bound in the liver could be released [125I-LPL in a recirculating system for 10 min. After wash the perfusion was then continued in single pass mode with a heparin-containing medium. About 50% of the LPL that had bound in the liver reappeared in the perfusion medium within four min [125I-radioactivity in the liver observed in the present study.Earlier studies have shown that there are also heparin-sensitive sites that bind LPL in liver . Wallindreleased . Vilar\u00f3 four min ,29. At lfour min ,31. Vilafour min . The enzfour min ,34. Immufour min ,35,36 anfour min ,25,35,37four min . The lipfour min ,40. The in vivo [Inactive LPL, as prepared here, was taken up in Kupffer cells. Most of the LPL in plasma is inactive ,10 and tin vivo  and on pin vivo . In thesin vivo ,42. Our 125I-labeled LPL in liver to that for asialofetuin, which is taken up by the galactose receptor [Before heparin, the ratio of LPL activity to LPL mass was about 0.2 mU/ng in liver and 0.3 mU/ng in blood Table . After hreceptor . The halSoleus muscle. Kuwajima et al perfused some of the rat hindlimb muscles  with heparin in situ and observed a large release in fasted but not in fed rats [To explore the source of LPL released into plasma and taken up by the liver we measured LPL activity in adipose tissue and heart before and after injection of heparin. In fed rats there was a large decrease of LPL activity in adipose tissue, in accord with a previous study . From thfed rats . These dLPL in plasma is bound to lipoproteins and it has been suggested that the lipase serves as a ligand for binding and uptake of lipoproteins in the liver. Chevreuil et al injected doubly labelled chylomicrons to rats shortly after heparin . The res\u2022 In the liver, the active form of LPL initially binds to sinusoidal surfaces but then transfers to and is taken up mainly in hepatocytes\u2022 An inactive form of LPL, presumably monomers, was mainly taken up in Kupffer cells\u2022 Heparin retards the uptake of active LPL in liver, but there are heparin insensitive binding sites for LPL both on hepatocytes and on Kupffer cells\u2022 Release of LPL into blood by heparin results in accelerated transport of the lipase to the liver\u2022 The observation that rat liver contained substantial amounts of LPL, most of which was inactive, is in accord with the hypothesis that one route for turnover for endothelial LPL is transport to and degradation in the liver\u2022 The observations that most of the LPL in blood is inactive, that injected inactive bovine LPL located to Kupffer cells, and that the immunostaining for endogenous LPL was more intense over Kupffer cells than over hepatocytes suggest that a substantial fraction of the transport from extrahepatic tissues occurs with LPL that has lost its activity.\u2022 The main source of LPL released into plasma and taken up by the liver in fed rats is the adipose tissue, whereas in fasted rats the main sources are heart and skeletal muscles.125I-albumin and Cr51-labeled red blood cells [Male Sprague-Dawley rats  weighing 180\u2013220 g were used. They were kept on a standard pellet diet in a 12-hour light cycle. In order not to disturb blood circulation or the metabolic functions of the liver, we performed all experiments on unanaesthetized rats. They were killed through decapitation at the time of tissue removal. Injections were made in the tail vein. Mean liver weight for the rats was about 9 g. In some of the rats we dissected out all visible adipose tissue. The mean total weight was 14 g, including fibrous tissue removed with the subcutaneous adipose tissue. To correct values for LPL mass/activity in the liver we used an estimated figure of 3% for the amount of blood plasma remaining in the liver after exsanguination. This was based on earlier experiments with od cells ,46. The Vectashield mounting medium was from Vector Laboratories, Burlingame, CA. Tissue-Tec OCT compound was purchased from Sakura Finetek Europe BV, Zoeterwoude, The Netherlands. Microscope slides and cover slips were from Menzel \u2013 Gl\u00e4ser, Germany. Plasma, used in the preparation of catalytically inactive LPL, was taken from fasted rats with EDTA as anticoagulant. Heparin was obtained from Leo Pharma AB, Malm\u00f6, Sweden. The dose given was 500 IU/kg body weight.125I using the lactoperoxidase/glucose oxidase method [in vivo experiments and incubated this at different temperatures. On incubation at 37\u00b0C the LPL activity remained essentially stable for one hour. At higher temperatures the lipase became unstable. Based on these results we decided to use 45\u00b0C for gentle inactivation of LPL aimed to prevent aggregation of the enzyme. Chromatography on heparin-Sepharose of active and inactivated LPL showed, as expected [125I-labeled LPL was included in the preparation, to enable us to follow the distribution and metabolism of the injected material. Each rat received about 40 \u03bcg lipase protein, except in the electron microscopy studies where only a trace amount of the labeled lipase was injected.LPL was purified from bovine milk as previously described  and was e method . The labe method . To findexpected , that thAntibodies against bovine LPL were raised in a chicken (chicken no 225) and IgG were isolated from egg yolks as previously described . AntibodSmall pieces of liver were mounted in Tissue \u2013 Tec OCT and snap frozen in propane chilled with liquid nitrogen. The tissue pieces were then stored at -70\u00b0C until sectioning. Cryosections were fixed for 10 min in 4 % paraformaldehyde. After rinsing, the sections were blocked in 5 % goat serum for 10 min and then incubated overnight with the primary antibody. All these procedures were made at room temperature. Incubation with the secondary antibody was then for 30 min at 37\u00b0C. The sections were rinsed in 0.01 M phosphate 0.15 M NaCl at pH 7.4 and mounted in Vectashield medium . The immunostained samples were analyzed by confocal laser scanning microscopy (Leica SP2 or Nikon Eclipse E 800). To avoid potential signal crossover the two fluorophores were sequentially scanned. Data were collected with sequential laser excitation to eliminate bleed through and with confocal parameters such as pinhole size set to minimize the thickness of the optical sections. The images were digitally optimized using the Adobe Photoshop software.125I-labeled LPL was injected to rats and 10 min later, the livers were perfused with 2% paraformaldehyde, 2.5% glutaraldehyde in 0.1 M phosphate buffer at pH 7.4 for 10 min. After fixation the livers were washed in 0.1 M phosphate buffer, cut in small pieces, dehydrated through graded acetone solutions and embedded in Spurr resin. Postfixation with 1% osmium tetroxide was not performed due to its known effect of fading latent images in autoradiography. Ultrathin sections, 70 nm thick, were collected over Formvar-carbonated copper grids. These sections were coated with a monolayer of Ilford L4 nuclear emulsion, diluted 1:4 with distilled water, by means of a tungsten wire loop following the \"loop interference\" technique. After an exposure of 8 months, the silver grains were revealed with Phenidon development. Sections were stained with uranyl acetate and lead citrate and examined in a Hitachi MT 800 electron microscope at 75 kV. Quantitative analysis was performed by counting the number of silver grains per area in each experimental condition. The area analyzed was about 25 \u00d7 104 \u03bcm2.For autoradiographic studies, 3H oleic acid-labeled triolein in egg yolk phospholipids. Hepatic lipase (HL) was inhibited by incubation of the samples on ice for two h with rabbit anti-HL IgG. In the HL assay, LPL is inactivated by 1 M NaCl. Both assays were run at 25\u00b0C for 30 min. All determinations were carried out in triplicate. The activities are expressed in mU/ml plasma. One mU corresponds to 1 nmol of fatty acid released / min. All determinations were carried out in triplicates.The activities of LPL and of hepatic lipase were determined as described . In the Plasma samples were stored frozen at -70\u00b0C before the analysis. Tissue samples were rinsed in cold 0.9 % NaCl, blotted dry, weighed and then immediately frozen in liquid nitrogen in 9 volumes of buffer at pH 8.2 containing per ml: 1 mg BSA, 10 mg Triton X-100, 1 mg SDS, 5 IE heparin, and protease inhibitor Complete Mini (Roche) 1 tablet / 50 ml buffer. They were stored at -70\u00b0C and later thawed and homogenized with a Polytron homogenizer . The homogenates were centrifuged for 15 min at 3000 rpm in a Beckman Microfuge and the supernatants were used for the assays. For assay of LPL in liver and post-heparin plasma, the activity of hepatic lipase was suppressed by incubating the extract with an excess of anti-HL immunoglobulins before assay.Detergent containing extraction buffers are needed to solubilize and stabilize active and inactive forms of LPL efficiently ,50, but LPL protein mass was measured by an ELISA, using chicken antibodies for capture and the monoclonal 5D2 antibody coupled to peroxidase for detection . Bovine LRP \u2013 low density lipoprotein receptor-related protein, LPL \u2013 lipoprotein lipase, HSPG \u2013 heparan sulphate proteoglycan, HL \u2013 hepatic lipase, ELISA \u2013 enzyme-linked immunoassay, BSA \u2013 bovine serum albumin, SDS \u2013 sodium dodecyl sulphate, VLDL \u2013 very low density lipoproteinLN carried out the immunolocalization studies, C L-I carried out the electron microscopic studies, SV participated in the design of the study and supervised the electron microscopy, JG carried out the studies on wash-out of LPL from tissues after heparin, TO conceived of the study, participated in its design and drafted the manuscript. GO participated in the design of the study and coordinated the work. All authors read and approved the final manuscript."}
{"text": "Increases in urokinase-like plasminogen activator (uPA) activity are reported to be amongst the earliest events occurring in remnant liver following partial hepatectomy in rats, and have been proposed as a key component of the regenerative response. Remodelling of the extracellular matrix, conversion of single chain hepatocyte growth factor to the active two-chain form and a possible activation of a mitogenic signalling pathway have all been ascribed to the increased uPA activity. The present study aimed to determine whether similar early increases in uPA activity could be detected in the remnant liver following resection of metastatic tumours in surgical patients.Eighteen patients undergoing partial hepatectomy for the removal of hepatic metastases secondary to primary colonic tumours were studied. Increased plasminogen activator activity was found in the final liver samples for the group of patients in whom the resection size was at least 50%. For smaller resections, the increased activity was not observed. The increased activity did not correlate with the age of the patient or with the time between the start of resection and the end of the operation. There was, however, a negative correlation between plasminogen activator activity and the time for which blood supply to the liver was clamped.Our findings are in accordance with those from experimental animal models and show, for the first time, that rapid increases in plasminogen activator activity can occur following similarly large liver resection in humans. Thus, increases in plasminogen activator activity are an early event in the remnant liver following major liver resection in man. Our observations provide support for the contention that increases in plasminogen activators play a key role in the initiation of hepatic regeneration in man. In vitro uPA and tissue-like plasminogen activator (tPA) have been shown to convert single chain inactive HGF into the active two chain form -thymidine into DNA and mitotic index were reduced by almost half at 44 h post-hepatectomy (the peak time for control mice), suggesting a slower hepatocyte growth response  are alsHowever, clear differences between species do exist; a notable example being the differences in the time at which DNA synthesis peaks in the remnant liver. In rats, this is at about 24 h; in mice, at about 40 h; and in man, at 180\u2013200 h following hepatectomy. In the case of the human studies, this may partially reflect the relatively greater age of the patients since the rate of regeneration slows with age. Such age related effects are less likely in the rodent studies where the timing of hepatocyte entry into DNA synthesis following partial hepatectomy has been shown to be an intrinsic, cell-autonomous, feature . Thus, aThe unique sensitivity of the human hepatocyte to TRAIL (tumour necrosis factor-related apoptosis-inducing ligand)  likewiseThe vast majority of the literature concerns regeneration in rats and mice and much less information is available from human studies since the opportunity to study liver regeneration in humans is generally limited to units specialising in liver surgery and is necessarily constrained by ethical considerations. Surgical removal of liver metastases affords the opportunity to obtain small samples of liver at the start, time of resection and time of wound closure approximating to the early sampling times in the animal studies. In this vein, the aim of the present study was to determine whether very early increases in uPA activity occur in the remnant liver following resection in man.p = 0.7), nor there was any difference between the values for male patients  and female patients  with a non-significant unpaired Student's t test (p = 0.61).The basal uPA activity associated with the membrane preparations showed a wide patient to patient variation ranging from 4 to 24 nmol/min/mg protein with a mean of 9.94 nmol/min/mg protein . This variation in basal activity correlated neither with the age of the patient \u2013 linear regression analysis gave a slope of -0.03 and correlation analysis gave a Spearman coefficient of -0.097 .Standard operative procedures were followed. The liver was mobilised and the resection delineated with diathermy. The portal inflow was clamped while resection with an ultrasonic dissector was carried out. Typically, the portal inflow was released every 15 minutes for 5 minutes intervals to prevent ischaemic damage and the total clamping time was recorded. Resection margins were sent separately for histopathology. The magnitude of the resection was estimated as percentage of the total liver volume, by the surgeon.The following samples were taken from tumour-free regions of the liver during the operation. A sample was obtained before the resection was started (this was labelled 'Start'). Immediately following resection samples were taken from the remnant liver (labelled 'Rem 0' for remnant liver at time 0) and from the resected liver as far away from the tumour as possible (labelled 'Res 0' for resected liver at time 0). The samples were placed in cryovials and immediately frozen in liquid nitrogen in the operating theatre. A second sample of the resected liver (labelled 'Res end') was kept at room temperature until the end of the operative procedure and was only transferred to liquid nitrogen when the final sample from the remnant liver was taken. The final sample ('Rem end' for remnant end) was taken from the remnant liver as late into the operation as possible and frozen immediately. The 'Res end' sample was also frozen at this time. The interval between the time of sampling 'Rem 0' and 'Rem end' ranged from 7 to 90 minutes. The median was 20.5 minutes and 15 of the 18 intervals were between 10 and 33 minutes. Samples were stored in liquid nitrogen in the laboratory and only thawed immediately prior to analysis.Casein, plasminogen, uPA (high and low molecular weight forms) and tPA were purchased from Calbiochem . The fluorometric substrates 7-amino-4-methylcoumarin (AMC), Z-Gly-Gly-Arg-AMC and EGR-CMK (Glu-Gly-Arg-Chloromethylketone) were from Bachem Ltd. (UK). Electrophoresis reagents were from BioRad and Geneflow Ltd. Other reagents were from Sigma-Aldrich Co Ltd. .Liver samples were homogenised in a ten-fold volume of homogenisation buffer: 250 mM sucrose / 10 mM MOPS pH 7.4 containing the protease inhibitors E-64 (20 \u03bcM), Pepstatin A (20 \u03bcM), and EDTA (0.2 mM). Inhibitors against the serine proteases, which include uPA, were not included.A membrane preparation was made by differential centrifugation of the homogenate in a TLS 55 swinging bucket rotor in a Beckman TL-100 bench top ultracentrifuge . The homogenate was initially centrifuged at 40,000 g, for 20 minutes, to pellet large cell organelles such as nuclei and mitochondria. After centrifugation the fat at the top of each tube was removed with a piece of tissue and the supernatants transferred to clean tubes and recentrifuged at 105,000 g, for 1 hour. The membranous pellets were then washed twice by resuspending in homogenisation buffer and recentrifuged at 105,000 g, for 1 hour. All centrifugations were carried out at 4\u00b0C.The protein content of the homogenates and membrane preparations was determined by the BCA (bicinchoninic acid) method  using a uPA activity was determined by a fluorimetric continuous rate assay of Z-Gly-Gly-Arg-AMC hydrolysis using a Perkin Elmer LS50B fluorimeter linked to an IBM compatible computer running the FLUSYS software . CleavagAt the end of the assay, EGR-CMK (Glu-Gly-Arg-Chloromethylketone), a chemical inhibitor of uPA, was added to check that this compound inhibited the measured activity. Any activity still persisting was taken as not uPA-mediated and subtracted from the rate measured in the absence of EGR-CMK.Since the biologically relevant fraction of uPA is generally considered to be associated with its receptor uPAR and therefore localised to the cell membrane, uPA activity measurements were performed with washed membrane preparations rather than with total liver homogenates. Preliminary experiments demonstrated the necessary linear response between the measured activity and the volume of membrane preparation assayed (data not shown).All samples were assayed in triplicate at two sample volumes to ensure linearity of activity with amount of extract. The measured rates were then adjusted for the protein concentration of each sample to give a rate in nmoles/min/mg of protein.et al. [Zymography was carried out with 7.5% SDS PAGE two-substrate gels essentially as described by Bryson et al. . The cont tests, simple linear regression, Spearman correlations) were performed using the software in the cited package.All Figures were generated and analysed with the GraphPad Prism package (version 3.0). Statistical analyses (Student's DM initiated the study, carried out the zymography experiments, prepared tissue extracts and drafted the manuscript. KS prepared tissue extracts and carried out the fluorometric assays. AWM and NCB participated in the design and coordination of the study. All authors have read and approved the final manuscript."}
{"text": "Lipoprotein lipase (LPL) has a central role in the catabolism of triglyceride-rich lipoproteins. The enzyme is anchored to the vascular endothelium through interaction with heparan sulphate proteoglycans and is displaced from this interaction by heparin. When heparin is infused, there is a peak of LPL activity accompanied by a reduction in triglycerides (TG) during the first hour, followed by a decrease in LPL activity to a stable plateau during the remaining session while TG increase towards and beyond baseline. This suggests that tissue stores of LPL become depleted. It has been argued that low molecular weight (LMW) heparins cause less disturbance of the LPL system than conventional heparin does.We have followed LPL activity and TG during a dialysis-session with a LMW heparin  using the same patients and regime as in a previous study with conventional heparin, i.e. a primed infusion.The shape of the curve for LPL activity resembled that during the earlier dialyses with conventional heparin, but the values were lower during dialysis with dalteparin. The area under the curve for LPL activity during the peak period (0\u2013180 minutes) was only 27% and for the plateau period (180\u2013240 minutes) it was only 36% of that observed with conventional heparin (p < 0.01). These remarkably low plasma LPL activities prompted us to re-analyze LPL activity and to measure LPL mass in frozen samples from our earlier studies. There was excellent correlation between the new and old values which rules out the possibility of assay variations as a confounding factor. TG increased from 2.14 mmol/L before, to 2.59 mmol/L after the dialysis (p < 0.01). From 30 minutes on, the TG values were significantly higher after dalteparin compared to conventional heparin (p < 0.05).These results indicate that LMW heparins disturb the LPL system as much or more than conventional heparin does. Lipoprotein lipase (LPL) hydrolyses triglycerides (TG) in circulating lipoproteins ,2. This et al. found that on a weight basis, decasaccharides released more LPL from perfused rat hearts than conventional heparin did -oleic acid-labelled triolein, 100 mg soybean TG and 10 mg egg yolk phospholipids per mL, prepared by Fresenius-Kabi, Uppsala, Sweden. Hepatic lipase was inhibited by pre-incubation of the plasma samples with immunoglobulins from a rabbit antiserum to human hepatic lipase. The assay medium contained a relatively high concentration of heparin, and possible differences in the heparin concentration or type in the sample would not affect the activity. All assays were made in triplicate and the mean value was used. A standard sample of human post-heparin plasma was run on each assay day and the value was used to calibrate for between-assay-variations. LPL protein mass was determined with an enzyme-linked immunosorbent assay, as previously described [\u00ae, Chromogenix AB, M\u00f6lndal, Sweden).Blood samples for measurement of LPL activity were collected in heparinized tubes. They were immediately chilled in ice water and centrifuged in a cooling centrifuge within 15 minutes. The plasma was frozen at -20\u00b0C and then stored at -70\u00b0C until analyses. LPL activity was measured as described  using anescribed , using iescribed . AntifacThe values are expressed in terms of median and range and were examined for significant differences by paired Wilcoxon signed-rank test. Simple linear regression and the Spearman rank correlation test were used to evaluate relationships between variables. Two-tailed P values below 0.05 were considered to be statistically significant.Table During the dialysis with dalteparin, the anti-Factor Xa activity was between 0.52 and 0.87 IU/mL. The target value recommended by the manufacturer is 0.5\u20131.0 IU/mL. Hence, the plasma dalteparin concentration remained well within the range for effective anticoagulation throughout the dialysis-session.The LPL-activity rose rapidly when dalteparin was administered. The highest value was at 15 minutes, median 15 mU/mL (range 9\u201332). The activity remained high at 30 minutes, but then decreased so that at 120 minutes the median was only 9 mU/mL (range 5\u201315)  at the start, to 2.59 mmol/L (range 1.49\u20135.04) at the end of the dialysis represents a 21 % increase (p < 0.01). Compared to the values during the earlier dialysis with conventional heparin, there was no statistically significant difference at the start of dialysis, but from 30 minutes and through the remaining session TG values were significantly higher during the dialysis with dalteparin (p < 0.05)  at start, to 6.1 mmol/L (range 3.8\u20138.4) at the end . This differs from the earlier dialysis with conventional heparin, when total cholesterol did not change from baseline .HDL-cholesterol did not change from baseline. Again, this differs from the dialysis with conventional heparin when HDL-cholesterol increased from 1.09 mmol/L (range 0.67\u20132.06) at start to 1.19 mmol/L (range 0.67\u20132.31) at the end (p < 0.05). No correlation was found between LPL activity and total or HDL-cholesterol changes during any of the dialysis-sessions.The median LDL-cholesterol, calculated by the Friedewald formula, was 2.9 mmol/L (range 2.1\u20134.9) before the dialysis and increased to 3.75 (2.1\u20135.6) at 240 min. This corresponds to an increase of 29% (p < 0.05).This study shows the same pattern of plasma LPL activity in HD patients given dalteparin as observed in previous studies with control subjects given dalteparin  or conveet al. found that the early LPL activity was only about half as high compared to values observed after conventional heparin [There are several earlier studies that show that administration of LMW heparin results in lower plasma levels of LPL than conventional heparin -30. LMW  heparin ,29. This heparin .et al. have, however, found that the amount of LPL released by a bolus of heparin is restored within 24 hours [The LPL activities were lower in HD patients than observed in controls given dalteparin . A simil24 hours . In rats24 hours  and chyl24 hours . A more 24 hours . Yet ano24 hours ,35.et al. found that the clearance of injected radioactively labeled chylomicron TG was dramatically increased five minutes after rats had been given conventional heparin or LMW heparin [Administration of heparin causes a temporary derangement of lipoprotein metabolism. In our studies with control subjects given conventional heparin or dalteparin the TG concentration decreased after heparin and then gradually increased again so that at the end of the study period TG exceeded the baseline level  declare that they have no competing interests.BN participated in the design of the study, carried out the patient studies, assembled the data, did the statistical analyses, and participated in writing of the manuscript; BS and GO conceived of the study and coordinated the work. TO participated in the design of the study and in writing of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "It has not been possible to reproduce this process with isolated adipocytes suggesting that other cells are needed, and perhaps mediate the regulation. The objective of the present study was, therefore, to explore if explants of adipose tissue could be used for studies of the regulatory process.Recent studies 125I-labeled LPL added to the medium was degraded to acid soluble products, indicating that the degradation occurred extracellularly. Fragmentation of the labelled lipase occurred in conditioned medium and this process was virtually abolished by two MMP inhibitors.When explants of rat epididymal adipose tissue were incubated, LPL mass and activity decreased rapidly. Mass and activity within adipocytes remained constant for at least six hours, demonstrating that it was the extracellular portion of the enzyme that decreased. Adipocytes isolated from the explants after three or six hours of incubation retained their ability to secrete LPL to the medium. Addition of a cocktail of protease inhibitors to the incubation medium slowed down the decrease of LPL mass. Chloroquine was without effect, indicating that the degradation was not lysosomal. The decrease of LPL mass and activity that occurs when explants of rat adipose tissue are incubated is due to proteolysis of extracellular LPL. The adipocytes continue to produce and secrete the enzyme. The effect of inhibitors indicates, but does not prove, that the degradation is mediated by MMPs. It appears that this process is accelerated in the tissue fragments compared to intact tissue. To study the underlying mechanism an in vitro model is urgently needed. Experiments with isolated adipocytes do not seem to bring out the mechanism and the in vivo experiments indicate that it is the extracellular LPL that is the target for the regulation [Lipoprotein lipase (LPL) hydrolyzes triglycerides in very low-density lipoproteins and chylomicrons . Tissue-gulation . We haveIn the first set of experiments we incubated explants of rat adipose tissue and followed LPL mass and activity Figure . LPL masWe tried variations in technique and several different incubation media in experiments such as those in Figure One possible explanation could be that LPL was released from the tissue into the medium. The amounts of LPL mass or activity that appeared in the medium were, however, small Table . To testAnother possibility was that the cells lost their ability to produce LPL. Isolated adipocytes, incubated under the same conditions as the tissue explants, released LPL activity Figure  and massHeparin release is often used to assess the LPL activity of tissues and releases mainly extracellular LPL . Figure These results indicated that the decline of LPL mass occurred through proteolytic cleavage of the extracellular enzyme. To test this hypothesis, we included a cocktail of protease inhibitors in the medium used for incubation of tissue explants. This slowed down the decrease of LPL mass Figure . Chloroq125I-LPL was added to the incubations. TCA soluble material appeared in the medium demonstrating that proteolytic degradation took place . Unless otherwise stated, the rats were 23 days old and weighed around 60 g. After transport to Ume\u00e5 they were allowed to acclimatize for seven to ten days by which time they had reached a weight of approximately 120 g. The rats were kept in a well ventilated, temperature (21\u00b0C) and humidity (40\u201345%) controlled room with free access to a standard laboratory chow  and tap water. The light in the room was on between 6 a.m. and 6 p.m. In experiments where the rats were to be fasted, food was withdrawn from the cages at 6 a.m. and a grid was placed at the bottom of the cages to prevent coprophagia. The adipose depot used in all experiments was the periepididymal one. The rats were killed by decapitation. Animal experiments were approved by the animal ethics committee in Ume\u00e5.3H-labelled triolein in Intralipid (10%) kindly prepared by Pharmacia-UpJohn . Parker medium (Parker 199) was from SBL . 125 I-LPL was prepared as before [Cycloheximide, bovine serum albumin (BSA), the MMP inhibitors GM6001  and Captopril, chloroquine and collagenase were from SIGMA . Protease inhibitor cocktail tablets \"Complete Mini\" were from Roche Diagnostics, Mannheim, Germany. Heparin was from L\u00f6vens . Substrate for the LPL activity assay was m Parker 9 was froLPL was extracted from tissues by homogenization in a Tris-HCL buffer (pH 8.2) containing detergents and protease inhibitors as described . The homLPL activity was measured as described previously . BrieflyLPL mass was measured with an ELISA as described . The chiDNA content was assayed using Labarca's method .2: 95 % O2 with continuous gentle shaking motion in a Cellstar Incubator . After incubation, the tissues were prepared for measurement of LPL activity and mass as described above. In some experiments samples of the medium were taken for assay of LPL activity and/or mass.Epididymal adipose tissue was dissected out from fed or 24 h fasted rats. The tissue was cut into small pieces (5 mg or less). A total of about maximal 100 mg tissue pieces were immediately put into culture plates. Each well contained 15 ml of Parker Medium 199 supplemented with 2% BSA, 0.5% casein hydrolysate, 10 mM glucose and adjusted to pH 7.4. Incubations were at 37\u00b0C and 5 % COIn some experiments adipocytes were prepared after collagenase treatment of the tissue pieces as described . To measStudent's t-test was used for analysis of the data.GW carried out the experiments and participated in their design and in writing of the manuscript, TO participated in the design of the study and drafted the manuscript. GO conceived of the study and coordinated the work. All authors read and approved the final manuscript."}
{"text": "The metabolic syndrome (MetS), as well as postprandial hypertriglyceridemia, is associated with coronary heart disease. This study aimed to evaluate the postprandial lipemia after oral fat tolerance test (OFTT) in subjects with MetS and compare them to hypertensive (HTN) and healthy subjects.OFTT was given to 33 men with MetS (defined by the Adult Treatment Panel III), 17 HTN and 14 healthy men. The MetS group was further divided according to fasting triglycerides (TG) into TG \u2265 150  or <150 mg/dl [MetS-TG (n = 11)], and into those with or without hypertension . TG concentrations were measured before and at 4, 6 and 8 h after OFTT and the postprandial response was quantified using the area under the curve (AUC) for TG.The postprandial response was significantly higher in MetS compared to HTN and healthy men . The TG levels were increased significantly in MetS+TG compared to MetS-TG subjects at 4 (p = 0.022), 6 (p < 0.001) and 8 hours (p < 0.001). The TG were increased significantly in MetS-TG compared to healthy subjects at 4 (p = 0.011), 6 (p = 0.001) and 8 hours (p = 0.015). In linear regression analysis only fasting TG levels were a significant predictor of the AUC .Fasting TG concentration is the main determinant of postprandial lipemia. However, an exaggeration of TG postprandialy was found in normotriglyceridemic MetS and HTN compared to healthy subjects. This suggests that intervention to lower fasting TG levels should be recommended in MetS subjects. In 1988, Reaven et al. proposed insulin resistance as the underlying metabolic aberration linking essential hypertension (HTN), dyslipidemia, type 2 diabetes and other abnormalities associated with an increased risk of atherosclerotic cardiovascular disease in adults . MetS isPostprandial hypertriglyceridemia is also associated with cardiovascular disease . During All participants ingested their fatty meal and tolerated it well. The amount of fatty meal ingested by the MetS group was 362(28) g, by the HTN was 333(23) g, and by the Healthy was 347(16) g.Clinical characteristics of main groups  are shown in Table Plasma total and HDL cholesterol, apolipoproteins A and B, and lipoprotein (a) were measured postprandialy in a 60% of the study population and no significant difference was found between groups.The following changes were noticed pre and post OFTT:A) Comparison of the TG concentrations at 0, 4, 6, 8 h in MetS, HTN and Healthy subject groups are shown in Figure B) In MetS+HTN and HTN groups: The TG levels were significantly increased in MetS+HTN vs. HTN subjects at 4 hours p = 0.022), 6 p < 0.001) and 8 hours (p < 0.001). .All participants gave their informed consent and the Ethics Committee of the Onassis Cardiac Surgery Centre, Athens, Greece, approved the study protocol.2).All patients were studied in the outpatient clinic between 8.00\u20139.00 am after 12 h overnight fast. The fatty meal was consumed within 20 min and plasma TG concentrations were measured before and 4, 6 and 8 h after the fat load. During this 8 h period, the participants did not eat and did not smoke. They were only allowed to drink water. Blood samples were drawn at 8:00 , at 12:30 am , at 2:30 pm , and at 4:30 pm . In all four samples total cholesterol, TG, HDL cholesterol, apolipoproteins A and B, and lipoprotein (a) were measured. The content of the fatty meal has been described in a previous study . BrieflyPlasma total cholesterol, TG and HDL cholesterol were measured using enzymatic colorimetric methods on a Roche Integra Biochemical analyzer with commercially available kits . The serum LDL cholesterol levels were calculated using the Friedewald formula  only in The body mass index was calculated as weight divided by height expressed in kg/m2. We assessed the whole-body insulin resistance with the following formula: HOMA-IR = (fast glucose \u00d7 fast insulin)/22.5 .Categorical variables are presented as percentages. Values of numerical characteristics were tested for normality and are presented as mean value (\u00b1 SD), if normally distributed. An ANOVA or Kruskal-Wallis H test with a Bonferroni correction (whichever appropriate) was performed for three group comparisons. The t-test for independent samples or the Mann Whitney U test was used for the comparison of numerical values between two groups. Areas under the curve (AUC) for serial measurements of TG levels at baseline and after the fatty meal were calculated using the trapezoid rule. Linear regression analysis, where the AUC was the dependent variable and age, BMI, HDL cholesterol, fasting TG, fasting glucose and HOMA-IR were the independent variables was performed in order to uncover the significant predictors of postprandial lipemia . The level of significance was set at p < 0.05.GDK conceived the study and participated in the development of the hypothesis, the study design and drafting of the manuscript. KKA is a research associate who participated in the development of the hypothesis, the study design and drafting of the manuscript. ANP is a physician who participated in the study design, recruitment of subjects and clinical evaluation. KDS is a research associate who participated in data analysis and interpretation of the findings. SAI, KT and DSD are physicians who participated in the study design, recruitment of subjects and clinical evaluation. AM is a physician who participated in the study design and drafting of the manuscript. DVC is a physician who participated in the design of the study and its coordination."}
{"text": "Clinical performance targets are intended to improve patient outcomes in chronic disease through quality improvement, but evidence of an association between multiple target attainment and patient outcomes in routine clinical practice is often lacking.2/dl2), dialysis dose (Kt/V\u22651.2), and vascular access type (fistula). Outcomes included mortality, hospital admissions, hospital days, and hospital costs.In a national prospective cohort study , we examined whether attainment of multiple targets in 668 incident hemodialysis patients from 74 U.S. not-for-profit dialysis clinics was associated with better outcomes. We measured whether the following accepted clinical performance targets were met at 6 months after study enrollment: albumin (\u22654.0 g/dl), hemoglobin (\u226511 g/dl), calcium-phosphate product  = 0.55, 95% confidence interval (CI), 0.41\u20130.75], hospital admissions , hospital days , and hospital costs , relative to those who did not. Increasing numbers of targets attained were also associated, in a graded fashion, with decreased mortality (P = 0.030), fewer hospital admissions and days (P < 0.001 for both), and lower costs (P = 0.029); these trends remained statistically significant for all outcomes after adjustment (P < 0.001), except cost, which was marginally significant (P = 0.052).Attainment of each of the five targets was associated individually with better outcomes; Attainment of more clinical performance targets, regardless of which targets, was strongly associated with decreased mortality, hospital admissions, and resource use in hemodialysis patients. Both improvement in the quality of delivered care and its measurement are of considerable interest to healthcare providers and researchers -3. In paHigher serum albumin, a marker of better nutrition and lower inflammatory burden, has been well-established as a predictor of better survival in dialysis patients -10. LoweThese guidelines have led to improvement in the process of kidney disease care, as evidenced by improvement in clinical performance measures, and have even led to calls for financial incentives for further improvement . HoweverThe ESRD Quality (EQUAL) study was designed to measure processes of care and outcomes in the Choices for Healthy Outcomes in Caring for End-Stage Renal Disease (CHOICE)  cohort. 2/dl2; dialysis dose, Kt/V\u22651.2; and vascular access type, presence of functioning arteriovenous fistula. In addition to individual targets, the total number of targets attained was also used as an independent variable. For total number of targets attained, data were collapsed into four categories . The numbers of patients attaining no (n = 3) or all five targets (n = 17) were small. We also examined a subset of targets  that are regularly measured as part of the usual laboratory panels.Measures of whether patients attained clinical performance targets at 6 months after enrollment in the study served as the independent variables for this study. The clinical performance measures examined included 6-month values for albumin, hemoglobin, Ca-P product, and dialysis dose and ascertainment of the type of vascular access in use at 6 months. Albumin, hemoglobin, calcium, and phosphate levels were obtained from routine laboratory data. All serum albumin levels were measured at a central laboratory using the Bromocresol Green method . Calcium levels were corrected for albumin [corrected calcium = calcium level + 0.8*] before Ca-P products were calculated. Vascular access information was obtained on a subset of individuals through review of discharge summaries, dialysis flow sheets, and dialysis clinic progress notes . DialysiOutcome variables included all-cause mortality, number of hospitalizations, days hospitalized, and hospitalization costs. Mortality information was ascertained from clinic report, medical records, and Centers for Medicare & Medicaid Services . Follow-up continued until death, transplantation, loss to follow-up, or the last follow-up date of November 2003. Hospitalization data were obtained through the United States Renal Data System (USRDS)  and wereWe also collected data on demographic, laboratory, and clinical characteristics. Data regarding patient demographics  and socioeconomic status (education and employment) were collected from a baseline self-report questionnaire. Laboratory values and height and weight [used to calculate body mass index (BMI)] were obtained from clinic records and from the CMS Medical Evidence report (CMS Form 2728). Comorbidity was assessed at baseline using the Index of Coexistent Disease (ICED), a validated measure whose composite integer score ranges from 0 to 3 (with 3 as the highest severity level) and is a measure of both the presence and severity of comorbid conditions -32. The 2 tests for categorical variables and two-sided t tests or ANOVA for continuous variables. Observed survival time was assessed starting at time of patient enrollment and ending at death or censoring , and we assessed individual cumulative mortality by whether patients attained targets by calculating overall crude mortality rates at the average follow-up (2.8 years) and by using Kaplan-Meier methods. We used Cox proportional hazards models to assess the strength and independence of an association between target attainment and survival. The proportional hazards assumption was not violated for any of the targets or for the total number of targets attained . Crude hospitalization rates were calculated, and Poisson regression models were used to assess the relation between target attainment and hospitalization (incidence rate ratio). Linear regression was used to assess the association between attainment of targets and hospitalization (after logarithmic transformation) costs per year. For all regression models, attainment of individual targets, the subset of three laboratory targets, and all five targets were examined.We first compared patient characteristics by whether patients attained individual targets and by the total number of targets they attained using Pearson's \u03c7i.e., significantly associated with both target attainment and the outcome measure) or prior evidence of their association with the outcome. Adjustment for both baseline target values (the major confounders) and other confounders of the outcome was performed. We also used models incorporating both target attainment and propensity scores for target attainment. Propensity score modeling is an established technique used to address selection bias [P value of 0.05/5 = 0.01 for the individual target analyses. All analyses were performed using STATA v. 8.2 .Variables were considered for adjustment in the multivariable regression models based on either their demonstration to be confounders (ion bias . For muli) albumin target attainers were younger, more likely to be male, and less likely to have a fistula at the start of hemodialysis, and had lower comorbidity scores, higher baseline albumin and creatinine, and lower initial CRP; (ii) Ca-P target attainers were older and less likely to be employed or noncompliant with dialysis and had higher comorbidity scores, higher Kt/V, lower creatinine, higher hemoglobin, and lower initial Ca-P product; (iii) hemoglobin target attainers were older and more likely to be male and white and had less frequent physician visits, lower BMI, higher Kt/V, and higher initial hemoglobin; (iv) dialysis dose target attainers were older and less likely to be male and had more frequent physician visits lower BMI, lower creatinine, higher hemoglobin, lower Ca-P, and higher initial dose (Kt/V); and (v) access target attainers were younger and more likely to be male and white and had lower dose, higher albumin, lower CRP, and fewer fistulas (none) at start of dialysis, relative to those not attaining the target. For those who were at or above targets at 6 months, 26.1%, 81.2%, 23.2%, 61.5%, and 56.5% of patients were already at the albumin, Ca-P product, hemoglobin, dialysis dose, and vascular access targets, respectively, at baseline. Finally, those patients attaining a greater number of targets at 6 months (Table n = 344) at 6 months, 39% (n = 133) had attained 0 or 1 target at baseline; 41%, 16%, and 4% of these patients had attained 2, 3, and 4 or 5 targets at baseline, respectively.Relative to patients not attaining 6-month targets Table , (i) albThe crude mortality rates at the median follow-up of 2.8 years were lower in the patients who attained the albumin target and in those who attained multiple targets Table  suggesten = 558, 159, 517, 244, and 356 for albumin, Ca-P product, hemoglobin, dialysis dose, and access type, respectively), only albumin remained statistically significant as a predictor of decreased mortality (data not shown). By likelihood ratio tests in multivariable-adjusted models, albumin and hemoglobin (P < 0.001 for both) and Ca-P product (P = 0.039) contributed most to the variation in mortality. Dialysis dose (P = 0.052) and access (P = 0.806) did not significantly contribute to variation in mortality.In adjusted models, the attainment of all individual targets was associated with a decreased risk of mortality Table . These aAttaining one or more of the laboratory targets was associated with decreased risk of mortality Table . When alP = 0.091; n = 154). By likelihood ratio test, albumin, Ca-P, hemoglobin and access  all contributed significantly to the variation in hospital admission rate, whereas dialysis dose (P = 0.903) did not.All individual targets were associated with a decreased incidence of hospitalizations, with the exception of attaining the dialysis dose target, which was only statistically significantly associated with decreased hospitalizations with propensity score adjustment Table . Addition = 23), results were not significant (P = 0.435). Again, history of cardiovascular disease was significantly associated with hospital admissions, but adjusting for it did not change our results. Less frequent physician contact, less frequent sit-down rounds, and noncompliance were all associated with increased hospital admissions but did not affect our estimates of the association of targets with hospital admissions when they were added as adjusters.Each increase in number of targets attained among the laboratory targets was associated with a statistically significantly decreased incidence of hospitalization Table . There wP < 0.001 for all). By likelihood ratio test, all five individual targets  all contributed significantly to the variation in number of days hospitalized.All individual targets except dialysis dose were associated with a decreased hospital days Table , but pron = 23) still gave a significant trend (P = 0.030) toward decreased hospital days with more targets attained at 6 months.Each increase in number of targets attained among the laboratory targets was associated with decreased hospitalized days Table , and theP = 0.002) and access (P = 0.039) contributed to variation in hospital costs, but Ca-P product (P = 0.977), hemoglobin (P = 0.679), and dialysis dose (P = 0.535) did not.The attainment of the albumin target was associated with a reduction of approximately $3000 per patient-year in Medicare hospital payments Table  with mulP for trend = 0.129 for all five targets). Subpopulation analyses of those attaining 0 or 1 targets at baseline showed that hospital payments decreased with each additional 6-month target attained , but the trend was not significant (P = 0.470).Increases in the number of targets attained among the laboratory targets were generally associated with decreased payments Table . Also, tAttainment of clinical performance targets in patients requires considerable time and effort on the part of providers and patients. Resistance to work on quality improvement may in part be due to skepticism that attainment will lead to meaningful improvement in health and other outcomes ,3. This e.g., through provider education, competition from public reporting, and rewards, such as payment for performance) might reap large benefits in morbidity, mortality, and efficiency for both patients and payers.For example, we found that attainment of each additional target resulted in a mortality risk reduction of approximately 35%, a hospitalization risk reduction of approximately 20%, a reduction in number of days hospitalized of approximately 24%, and a decrease in annual Medicare hospital payments of approximately $762 per patient-year. The results support the idea that efforts to improve clinical performance  or outcomes .Although this study was observational, the associations we report do meet many of the criteria for causality, including plausibility, temporality, dose-response relationship, and consistency. It is certainly plausible that attaining clinical performance targets would improve patient outcomes, and it is just as plausible that increasing numbers of targets attained in a patient would result in incrementally better outcomes. The use of an incident dialysis cohort, capturing patients at the inception of their dialysis treatment, ensures temporality, as the exposure to provider efforts to meet clinical performance targets for ESRD patients begins with the initiation of kidney replacement therapy. We observed a dose-response relationship, reflected in the graded trend toward better outcomes with more targets attained. Also, our results were consistent across various modeling strategies and consistent with other studies focusing on single static measures  than others . Importantly, there may be fixed and possibly unmeasurable patient characteristics that might or might not allow target attainment with exposure to same quality of provider care. Such characteristics might also affect the amount of time needed to attain a goal, which may be more or less than 6 months for some patients and some targets. Finally, despite collection of and adjustment with extensive data on determinants of patient outcomes, selection bias and residual confounding due to lack of data on variables for which we could not account may still exist.Some possible limitations to this study deserve mention. First, this study was underpowered to determine which particular individual targets or combinations among the five performance targets examined yield the most benefit in terms of each outcome. Second, it should be remembered that this is an observational study and that only the associations between target and outcome can be ascertained, not cause and effect. Despite the fact that some clinical performance targets have been chosen based upon observational data and consensus , the value of observational data should not be overstated. Because some of the factors that we studied here were not the subject of national guidelines at the time we started our study, guideline-directed therapeutic intent cannot be shown. The hemoglobin, dialysis dose, and vascular access targets were in place in 1997 and have not changed since this time, although they were not yet widely implemented by 1998. The albumin and Ca-P targets used here were not introduced until well after the study period. Third, as with any study of clinical performance targets, the biological markers studied may be influenced by other factors than the quality of providers' care. For example, albumin and hemoglobin levels could be affected in part by the degree of ultrafiltration achieved. Of course, some targets may be more easily modified  declare that they have no competing interests.LP performed the statistical analyses and drafted the manuscript; NEF participated in the design of the study and helped to draft the manuscript; BGJ assisted in data interpretation and drafting of the manuscript; JHS, NWL, JC, & MJK participated in the design of the study and provided feedback on the manuscript; NRP conceived of the study, participated in its design, assisted in data interpretation, and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "A goal of systems biology is the quantitative modelling of biochemical networks. Yet for many biochemical systems, parameter values and even the existence of interactions between some chemical species are unknown. It is therefore important to be able to easily investigate the effects of adding or removing reactions and to easily perform a bifurcation analysis, which shows the qualitative dynamics of a model for a range of parameter values.E + S <-> C) into scripts for analytical analysis (Mathematica and Maple), for simulation (XPP and Matlab), and for bifurcation analysis (AUTO). Facile automatically identifies mass conservations and generates the reduced form of a model with the minimum number of independent variables. This form is essential for bifurcation analysis, and Facile produces a C version of the reduced model for AUTO.We present Facile, a Perl command-line tool for analysing the dynamics of a systems biology model. Facile implements the law of mass action to automatically compile a biochemical network (written as, for example, Facile is a simple, yet powerful, tool that greatly accelerates analysis of the dynamics of a biochemical network. By acting at the command-line and because of its intuitive, text-based input, Facile is quick to learn and can be incorporated into larger programs or into automated tasks. Biology is becoming a quantitative science. Driven by the introduction of the Systems Biology Markup Language , an XML-The quantification of the life sciences is also attracting to systems biology members of the mathematical biology and biophysics communities. These scientists are usually mathematically and computationally sophisticated and already have standard computational tools for investigating many questions posed by systems biology. They typically work at the command-line in a UNIX programming environment and prefer text-based rather than GUI-based methods of model entry.Here we introduce Facile, a network compiler for investigating the dynamics of biochemical networks. Facile is aimed specifically at mathematicians, engineers, and physicists working in systems biology. From a textual description, Facile compiles the biochemical network into formats for the standard computational tools used in studies of non-linear dynamics. Facile has several advantages: (1) with one command invocation, it links to all the standard analysis tools used by the mathematical biology and non-linear dynamics communities; (2) it has an intuitive, text-based input, with a format for representing chemical reactions similar to that adopted by most textbooks, making it easy to learn; (3) it is command-line oriented and therefore, like any UNIX command, can be easily incorporated into automated tasks or other software; and (4) it outputs SBML and therefore allows, for example, a mathematical biologist familiar with UNIX to use the SBML tool set with minimal effort.Biochemical networks are non-linear systems. Within non-linear dynamics, three methods have been developed to analyse non-linear behaviour: analytical approaches, simulation, and bifurcation analysis.Facile greatly aids bifurcation analysis. It compiles a version of the model from text into the C programming language to interface directly with AUTO, a standard bifurcation analysis tool . It autoIn addition, Facile converts a network model into a format for analytical analysis by computer algebra packages \u2013 Mathematica  or Maple  \u2013 and into a format for simulation \u2013 XPP  or MatlaFacile is not intended to compete with SBML, but is complementary through its command-line character and its ability to convert an intuitive, text-based form of a model into SBML. Unlike other SBML converters, such as CellDesigner , JDesignFacile is modular and coded in Perl using an object-oriented methodology with a distinct module to generate each output. A new output option or a modification of an existing option can be easily implemented.Facile uses the method proposed by Sauro and Ingalls  to automFacile's input is simple: a system of chemical reactions. Facile automatically calculates reaction rates using the law of mass action. Therefore, for example, the Michaelis-Menten reaction is specified asE + S <-> C ; f = 1.6e7; b = 6C -> P + E ; k = 0.157 M-1 s-1, and the complex, C, dissociates into the product, P, and enzyme with rate 0.15 s-1. Backward reactions can also be written explicitly, e.g.The association rate between the enzyme, E, and the substrate, S, is 1.6 \u00d7 10E + S <- C ; b = 6Sources, for example gene expression, and sinks, for example protein degradation, are denoted by null:null -> A ; s = 10A -> null ; d = 0.1-1 and degrades at a rate of 0.1 s-1.implying that protein A is produced at a rate of 10 sFacile also allows explicit specification of reaction velocities, time-varying system parameters, and effective rate expressions, such as Hill functions. A thick arrow, =>, indicates a reaction velocity and overrides the law of mass action. The reaction velocity may be a constant or an expression enclosed in double quotes. For example, the Michaelis-Menten equations could be specified asE + S < = > C; f = \"1.6e7*E*S\"; b = \"6*C\"C = > P + E; k = \"0.15*C\"or asS = > P; f = \"S*V/(K + S)\"in the quasi-steady state approximation. Variables can also be defined, such asvariable V = 0.15*0.2variable K = (0.15+6)/16\u03bcM. Once a variable has been specified, its value is available throughout the rest of the input file.for the quasi-steady state approximation with a total enzyme concentration of 0.2 Time can be included in a reaction rate by using t. For example, the expression of a gene may be periodically modulated by the cell cycle:null -> A ; s = \"10*(1+cos(2*pi*t/2400))\"for a cell cycle of 40 minutes or 2400 seconds.INIT keyword in the input file. Any concentration not specified is set to zero. For the Michaelis-Menten example, we haveTo run simulations, initial concentrations are also needed. Concentrations are specified beneath the INITE = 0.2 uMS = 3P is initially zero, S is initially 3 M, and E is initially 0.2 \u03bcM. The substrate could also be initialized as S = 3 M.implying that Mathematica and Maple are two standard computer algebra packages. They can be used to derive analytical expressions for steady-state concentrations, for the eigenvalues determining the stability of the steady-state, or to evaluate perturbation expansions, such as the method of multiple scales.The commandfacile.pl -M modelconverts the textual input for the Michaelis-Menten system shown earlier (and contained in the file model) into Mathematica format. Since Facile automatically applies the law of mass action, it generates the expressionsdEdt = + b C - f E S + k C ;dSdt = + b C - f E S ;dCdt = + f E S - b C - k C ;dPdt = + k C ;-L option generates an equivalent format for Maple.These expressions can be cut-and-pasted or loaded into Mathematica and then algebraically manipulated. For example, they can be solved for the quasi-steady state solution. The -m option, or XPP, via the -x option. These software packages provide tools for numerically integrating ordinary differential equations and visualizing their solutions. Two files are created for Matlab: one describing the model as a system of ordinary differential equations and another (driver) file for the user. An ode file is created for XPP.Analytical solutions are usually only possible for an approximate form of a model, if at all. Facile provides an ordinary differential equation version of the model for input to Matlab and Octave , via theNevertheless, intracellular molecular numbers are often small, and significant stochastic fluctuations can exist in biochemical networks . ThroughA bifurcation analysis is frequently used to show how the qualitative behaviour of a system changes when parameter values are altered. It is particularly important in systems biology where many parameters are unknown and where the dynamical behaviour of the systems is often expected to be robust to parameter changes .AUTO is a standard tool for numerical bifurcation analysis . Like anE or C form, and the total amount of substrate is conserved, in either the S, C, or P form. Running Facile with the -rM option, produces a Mathematica version of the model in the reduced form:Facile automatically finds any mass conservations and incorporates them into a reduced system model which is only a function of the independent variables . For example, consider again the Michaelis-Menten system. It has two mass conservations: the total amount of enzyme is conserved, in either the E = - C + E_tot ;S = - P - C + S_tot ;dCdt = + f E S - b C - k C ;dPdt = + k C ;E_tot is the total amount of enzyme and S_tot is the total amount of substrate. Facile determines the numerical value of these two constants from the initial conditions specified in the input file.where C and P could be related to E_tot and S_tot in the Michaelis-Menten example, and E and S would then be the independent variables. In the input file to Facile, the user can specify the chemical species that should be independent and those that should be dependent. Any chemical species not specified will have its dependency assigned automatically. The MOIETY section in the input file is used for these specifications. For example,Once the mass conservations have been identified, there is not a unique reduced form for the system. For example, MOIETYdependent E, Sensures that the Michaelis-Menten equations are reduced to the form above. So, too, doesMOIETYindependent C, PA combination of independent and dependent variables is also valid.Although XPPAUT does allow bifurcation analysis (and is supported by the -x option in Facile), the complex biochemical networks studied in systems biology usually require the stand-alone version of AUTO because it allows the user to tune more of AUTO's parameters. Via its -a option, Facile produces a C version of the reduced model in the format expected by AUTO. AUTO also needs to know the parameters to be varied for the bifurcation analysis. These are specified in the BIFURC_PARAM section of the Facile input file and are incorporated into the C version of the reduced model. For example, if the user wished to investigate whether the system bifurcates as the association rate, f, and dissociation rate, b, for the Michaelis-Menten reaction are varied, Facile requiresBIFURC_PARAMf, bin its input file.-A option will automatically load the values of the steady-state concentrations from a text file, generated by Matlab or XPP, and incorporate them into the C version of the model required by AUTO.As a starting point for generating the bifurcation diagram, bifurcation analysis software uses the concentrations of the chemical species in a system at an attractor of the system. Usually a starting point is found by integrating the system to steady-state. Facile with its facile.pl -rx model at the command-line to generate model.ode. This XPP file is a reduced form of the model in the form of ordinary differential equations: rates are automatically calculated by the law of mass action and any mass conservations are found and used to reduce the model to the minimum number of independent variables. We then integrate the model to a steady-state and use the XPP data browser to save the corresponding time course data to a space-delimited text file, output.dat. Alternatively, we could run XPP without an interface with the command xppaut model.ode -silent. This command runs XPP and saves the time series generated in output.dat. By running facile.pl -aA output.dat model, we create a C version of the model, which includes the steady-state concentrations taken from the last time point of output.dat. We then directly load into AUTO the model.c file created. Matlab could also be used to integrate the model equations (with the -rm option in Facile). In summary, the single-line command facile.pl -rx model; xppaut model.ode -silent; facile.pl -aA output.dat model builds both the C model expected by AUTO and an XPP simulation file.Facile greatly speeds up bifurcation analysis of biochemical models. Here we illustrate the steps that a user could follow to set up a bifurcation analysis. Facile can be used to generate both the simulation file and the C AUTO file. The simulation file is useful for finding the initial point for the bifurcation analysis and for exploring the dynamics of the model in different regions of the bifurcation diagram. As an example, we will use XPP as the integrator. We specify the model as a system of chemical reactions in the text file model. For XPP output, we run SBML export is enabled by the -S option and uses the libSBML package, which must also be installed.As mentioned, variables or parameters can be defined in the Facile input file using the variable command. The input file also has a CONFIG section where if desired the user can specify the time interval to run simulations, the particular differential equation solver to be used by Matlab, and XPP configuration commands. See the online Facile manual.Facile is a tool to quickly create models of biochemical networks and to analyse their dynamics. Although specifically aimed at systems biologists from the non-linear dynamics community, Facile should be useful to any computational biologist modelling biochemical networks. It links directly to the standard analysis tools used for non-linear systems and indirectly to many more via SBML.A major feature of Facile is its ability to generate a reduced form of a model in C for the bifurcation analysis software AUTO. Bifurcation analysis gives the global behaviour of non-linear systems for ranges of parameter values. It is particularly important in systems biology where many parameter values are unknown or are only known approximately. It is essential for bifurcation analysis that any mass conservations in a model are identified and used to write the model in a form with a minimum number of independent variables. In the Michaelis-Menten system, for example, the sum of the free enzyme and complex is equal to the total amount of enzyme. If this mass conservation is not identified, varying the initial conditions for the free enzyme and for the complex, will create a system with a different amount of total enzyme that has its own steady-state. AUTO will therefore find a line of steady-states rather than the expected single steady-state. Facile automatically identifies and uses mass conservations to produce a reduced form of any model.The input to Facile is a text file of chemical reactions written in a notation very similar to that used by most undergraduate text books. Facile automatically calculates reaction rates and generates rate equations. Exploring changes in model structure with Facile is therefore straightforward. Chemical reactions can be added to or removed from the input file, and Facile ensures that the rate equations are generated consistently.By using a text file as input and because it operates at the command-line, Facile can be run automatically and embedded into larger programs. In addition, there are several problems in systems biology where a GUI interface would not be suitable to build a model. In signal transduction, for example, the number of proteins that can both exist in different phosphorylated states and bind together in complexes rapidly leads to a large number of distinct chemical species. An example is the Ste5 scaffold protein in the yeast pheromone response pathway which is involved in 1300 different chemical species . A GUI bWritten in Perl, Facile fits naturally into the UNIX programming environment. It is an easily learned addition to a systems biologist's toolbox. [see also Additional file Facile runs in any programming environment that can support Perl, such as Linux, Mac OS X, and Windows. Facile and its manual are available and can be used online at FSN and JFO wrote Facile; PSS wrote an early version. JFO wrote the online manual. FSN, JFO, and PSS wrote the paper.Facile source code. the Perl source code for the Facile command-line tool.Click here for file"}
{"text": "The rising prevalence of obesity and metabolic syndrome (MetS) has received increased attention since both place individuals at risk for Type II diabetes and cardiovascular disease. Insulin resistance (IR) has been implicated in the pathogenesis of obesity and MetS in both children and adults and is a known independent cardiovascular risk factor. However measures of IR are not routinely performed in children while MetS or severe obesity when present, are considered as clinical markers for IR.The study was undertaken to assess the utility of ATPIII defined metabolic syndrome (MetS) and severe obesity as predictors of insulin resistance (IR) in a group of 576 overweight children and adolescents attending a pediatric obesity clinic in Brooklyn.Inclusion criteria were children ages 3\u201319, and body mass index > 95th percentile for age. MetS was defined using ATP III criteria, modified for age. IR was defined as upper tertile of homeostasis model assessment (HOMA) within 3 age groups . Sensitivity, specificity, positive predictive values and odds ratios (OR) with 95% confidence intervals (CI) were calculated within age groups for predicting IR using MetS and severe obesity respectively.MetS was present in 45%, 48% and 42% of the respective age groups and significantly predicted IR only in the oldest group . Sensitivities were <55%; specificities <63% and positive predictive values \u2264 42% in all groups. Severe obesity was significantly associated with IR in both the 9\u201311 (p = .002) and 12\u201318 (p = .01) groups but positive predictive values were nonetheless \u2264 51% for all groups.The expression of IR in overweight children and adolescents is heterogeneous and MetS or severe obesity may not be sufficiently sensitive and specific indicators of insulin resistance. In addition to screening for MetS in overweight children markers for IR should be routinely performed. Further research is needed to establish threshold values of insulin measures in overweight children who may be at greater associated risk of adverse outcomes whether or not MetS is present. Insulin resistance (IR) and/or compensatory hyperinsulinemia are usually associated with obesity and are risk factors for cardiovascular disease (CVD) and type 2 diabetes in both adults and children -8. FurthData were collected on all overweight children and adolescents(3\u201319 years) with BMI > 95th percentile for age,  who attended a pediatric obesity program at an inner city University Hospital, in Brooklyn, New York from January1, 2002 through December 31, 2005. Five hundred and seventy six (576) patients with complete data for metabolic risk factors constituted the study sample. The study was approved by the Internal Review Board and informed consent to participate in the community based obesity program and to be included in the database was obtained from the parent or guardian and assent from the children when first enrolled. Each individual was assessed for the presence of MetS. Fasting plasma concentrations of glucose, insulin, triglycerides, and HDL cholesterol were assessed using standard laboratory methods. Weight and height were measured to the nearest 0.1 kg and 0.5 cm respectively. BMI was calculated as weight in kilograms divided by height in meters squared and converted to BMI-Z score standard units according to CDC age-sex tables . Waist cSince IR is affected by age and pubertal status, and tanner stages were not recorded on all patients in the database, the population was further divided into 3 age groups  reflecting prepubertal, pubertal and post pubertal stages and also to assess the age related associations of MetS and IR. Currently there are no accepted values to define insulin resistance in normal and overweight children, so we used the upper tertile of homeostasis model assessment (HOMA: fasting serum insulin (\u03bcunits/ml) \u00d7 fasting plasma glucose (mmol/l)/22.5) within age group to denote higher IR consistent with previous work in both adults  and chilSensitivity, specificity, and positive predictive value of using MetS to identify higher IR were computed. In addition, similar to Weiss et al we dividOf the 576 participants, 122 were ages 3\u20138, 164 were ages 9\u201311 and 290 were 12\u201319. Almost all were African American (81.4 %) or Hispanic (16.0%). Table Defining higher IR by upper age-specific tertiles of HOMA, threshold values of 2.31 for ages 3\u20138, 4.29 for those 9\u201311 and 4.26 for the 12\u201319 year olds were obtained. Upper tertiles of fasting insulin for these age groups were 11.8, 21.1 and 20.5 (units) respectively. Adolescents with MetS , there was a prevalence of higher IR in 31% of the 3\u20138 yr old, 29% in the 9\u201311 yr old and 20% in those 12\u201319 yr old.Table In binary logistic regression models adjusting for sex, age and race, we found MetS and BMIZ were not significant predictors of higher IR (p = .55 and p = .24 respectively) for 3\u20138 year olds. For 9\u201311 year olds, MetS showed a non-significant trend (p = .13) while BMIZ was a significant predictor (p < .01). Both MetS and BMIZ were significantly associated with higher IR for 12\u201319 year olds (p < .01 for each). In sensitivity analyses, using upper quartile of HOMA instead of upper tertile to indicate higher insulin resistance gave similar results.The principle findings in our study were that the ATP III definition of MetS, as modified for the pediatric populations, and severe obesity are but modest predictors of IR, defined here as upper tertile of HOMA in this sample of overweight, children and adolescents. We found that although the prevalence of MetS was high and relatively similar in the three age groups, a statistically significant association with IR was evident only in adolescence. As described in table Although MetS is believed to be closely related to IR, and both are independently associated with serious adverse outcomes among adults, recent Currently there are no widely accepted values to define IR in either normal or overweight children. Hence, markers of IR such as HOMA as described by Matthews and coworkers  have beeSeveral reasons may account for the relatively low MetS sensitivity and specificity for identifying IR in this pediatric population. One is that in the ATP III definition all criteria are given equal importance in defining the syndrome such that impaired fasting glucose(IFG), the factor most closely associated with IR, need not be one of the \u2265 3 criteria for an individual to have MetS. If on the other hand IFG was a required criterion, the specificity for such a definition of MetS would be greater, while the sensitivity and positive predictive value would be far lower since very few (<4%) of the overweight children and adolescents in this sample had (IFG) \u2265 100 mg/dL. One reason for the relatively low proportion with elevated glucose may be that insulin resistance is generally associated with increased levels of insulin production. The ability of an insulin insensitive individual's beta cells to compensate for IR by producing extra quantities of insulin in response to a glucose load may decrease with age and elevSecond unlike the WHO definition for MetS , the cluOther reasons for the low sensitivity of Mets criteria to identify IR are that, the deleterious effects of the prolonged presence of elevated insulin levels may take time to manifest themselves with regard to increase in triglycerides, blood pressure as well as circulating glucose levels as shown in this study where the associations of IR and metabolic risk factors were evident in the adolescents but not in the younger age groups. Alternately, as shown in a recent study by Lambert et al for the Our study has several limitations. The sample was drawn from participants in an obesity clinic situated with a predominantly African American and Hispanic catchments area. Thus our findings can only be generalized to overweight non-white youth. Our findings are nonetheless relevant given the higher prevalence of MetS found in this population compared to other studies  in patieIn this study, we followed the example of others ,47, in uIt is also possible that the modified ATP III criteria for MetS that we used in this study may not be the most meaningful with regard to long-term clinical outcomes. The individual components and the specific cutoffs for children are not based on any prospective studies but have been defined by a consensus statement of an expert panel for adults. Since there is no universally accepted definition of MetS for children and the thresholds for adult ATP III criteria cannot be applied to a pediatric population given there are changes in the metabolic parameters as a function of age, we used modified ATP III adult criteria for children similar to that used by Cook et all which has been widely quoted and applied in different populations. It is pIn conclusion, the growing epidemic of childhood obesity, early onset of type II diabetes and clustering of cardiovascular risk factors has raised great concern. To date, this concern has led to increasing attention to the presence of MetS in children and adolescents. Even if MetS is an important marker or risk factor for CVD and type II diabetes in itself in a pediatric population, IR unaccompanied by MetS is also important.The major benefit of defining MetS in children is to draw attention to risk factor clustering associated with obesity and insulin resistance. While the convergence of IR and MetS becomes evident over time these data suggest that in addition to screening for Mets, surrogate markers of insulin resistance such as fasting insulin, HOMA or if resources allow, glucose tolerance test, could be a useful addition to routine evaluations of overweight children in order to alert clinicians to potential increased risk in those with IR even without MetS. Further studies are needed to assess clinically relevant threshold values of insulin measures in overweight children and adolescents of different ethnicities that can predict the development of CVD, diabetes and other clinical syndromes in patients both with and without the metabolic syndrome.National Cholesterol Education Program (NCEP)Cardiovascular Disease(CVD)Adult Treatment Panel (ATP)Metabolic Syndrome (MetS)Insulin Resistance (IR)Homeostasis model assessment (HOMA)Center for disease control (CDC)Impaired Fasting glucose (IFG)World Health Organization(WHO)The author(s) declare that they have no competing interests.All authors made a significant contribution in the conception, design and manuscript preparation."}
{"text": "One of the major controversies surrounding the metabolic syndrome (MetS) in type 2 diabetes is whether its single components act synergistically as risk factors for atherosclerotic vascular disease (AVD). We aimed to answer this by evaluating the relationship, and its various combinations to AVD in comparison to single traits in a population-based study with type 2 diabetes in Germany.4020 unselected patients with type 2 diabetes aged 35 \u2013 80 years. MetS was: diabetes plus \u2265 2 traits of the MetS by AHA/NHBLI definition.AVD was: history of myocardial infarction and/or coronary revascularization and/or stroke. The occurrence of AVD in relation to overall MetS/single traits/combinations was presented as OR (95% CI). Multiple logistic regression, including established cardiovascular risk factors, modeled their associations.The prevalence of overall MetS was 74.4% and the OR for AVD was 1.41 (1.12\u20131.78), which however was higher for hypertension as single trait (OR 4.76). Different combinations of MetS presented a wide range of ORs (0.47 to 10.90) and strong sex differences. Some clusters of MetS including hypertension and low HDL-cholesterol presented a higher risk factor than single traits or their sum, whereas the others out of 11 possible carried no increased AVD risk. Multiple logistic regression showed independent association between AVD and overall MetS.The overall MetS in type 2 diabetes comprises 11 heterogenous clusters of traits. Overall MetS increases the risk of AVD in type 2 diabetes and individual traits in some clusters with hypertension and low HDL-cholesterol may act synergistically as risk factors particularly in women. Type 2 diabetes is associated with a high prevalence of the metabolic syndrome (MetS) -3. SinceIt is commonly recognized that T2DM is associated with multiple AVD risk factors. However data on the epidemiology of MetS in unselected patients with T2DM are scarce. The AHA/NHBLI criteria  provide The Diabetes in Germany (DIG) study is a population-based, prospective, observational study in patients with T2DM. This report will analyse the following questions in a large cross-sectional sample:1) What is the prevalence of the MetS by AHA/NHBLI criteria, its single traits and their combinations in a representative German population with T2DM?2) Is the MetS an independent risk factor for AVD compared to its single components in men and women?3) What is the AVD risk for different clusters of the MetS?1C, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides, and creatinine. The traits of the MetS were defined based on the AHA/NHBLI criteria with one modification. Obesity was defined as BMI \u2265 30 kg/m2 since waist circumference was not measured routinely. Hypertension was diagnosed if blood pressure at the time of inclusion was \u2265130/85 mmHg and/or the patients were treated with antihypertensive drugs. The same applies for dyslipidemia with respect to fibrates and nicotinic acid. Statines, however were not considered as equivalent of dyslipidemia.Two hundred and thirty eight practices , that represent a cross section of daily practice diabetes care in Germany, took part in the study. With respect to the distribution of sites in the federal states of Germany was found out an average frequency of 1.7 to 3.5 per 10,000 inhabitants, with exception of Saxony where the ratio was 16.9 to 10,000 resp. Inclusion criteria were clinical T2DM and age between 35 and 80 years. Exclusion criteria were: major cardiovascular event <3 months before entry , stroke, amputation), heart failure NYHAIV, macro-proteinuria >300 mg/24 h or creatinine >2 mg/dl, cancer disease <5 years before entry. The participating physicians  were asked to include \u2265 10 consecutive patients with T2DM per site. A total of 4,331 patients were recruited of whom 311 had to be excluded due to protocol violations; thus 4,020 were included in the final analysis. Medical history and drug intake were registered by a standardized questionnaire. Body mass index (BMI) and blood pressure were measured according to a standard protocol and all laboratory measurements were done by local laboratories that held a quality control certification. The following parameters were registered as baseline characteristics: sex, age, duration of diabetes, current smoking, BMI, waist circumference, systolic and diastolic blood pressure, fasting and postprandial blood glucose, HbAWe diagnosed triads (6) of the MetS (diabetes plus two other traits), quartets (4) (diabetes plus 3 other traits) and a quintet presenting all the 5 traits. Overall MetS was diagnosed when T2DM coexisted with \u2265 2 other traits of the MetS. Cardiovascular events were identified based on the medical history obtained by the physicians at the participating sites. The diagnosis of AVD was established if the following aggregated events were present: MI and/or coronary revascularization and/or stroke. Since the database did not allow differentiating amputations by cause we did not include peripheral vascular disease in the calculations for AVD. The Saxon Ethics Committee approved the study and informed consent was obtained from all patients.2 tests. The probability in the occurrence of AVD in relation to the MetS, its single traits and their combinations were estimated as odds ratio (OR) (95% CI). Binary logistic regression was used to model the associations of the overall MetS, its single traits, their combinations and of major established risk factors with AVD and the test of interaction by collinearity diagnostics.All data were analyzed using statistical software SPSS Version 11.5. Baseline characteristics were presented as means (SD) for continuous variables and frequency for all categorical variables. The statistical significance of the differences by sex was assessed by t-tests or \u03c71C of 7 (1.2)% for both sexes. Males had significantly higher postprandial glucose levels than females. Average LDL-cholesterol was 3.2 (1.0) mmol/l with significantly higher levels in women. Triglycerides (2.2 (1.7) mmol/l) were significantly higher in men and the same applied to creatinine. HDL-cholesterol was significantly higher in women with an overall level of 1.3 (0.4) mmol/l.Baseline characteristics of the patients by sex are given in table With respect to the prevalence of major cardiovascular diseases, 7.6% of the patients reported a previous MI  and 4.3% a stroke . The frequency of coronary revascularization was high  in relation to the frequency of MI. Coronary revascularization and MI were 2\u20133 times more frequent in males, but there was no significant sex difference for stroke. According to our definition 15.2% of our patients had AVD. Males had a significantly higher frequency than women: 20.0% and 9.8% resp. (p < 0.001).2and more than half (55.4%) had hypertriglyceridemia. In contrast, the percentage of people with low HDL-cholesterol was less than 10%. The only significant sex difference for single traits found was in the percentage of obesity with 44.4% in men and 55.9% in women (p < 0.05). Only 2.4% of the patients had no additional trait of the MetS with no sex difference. Duration of diabetes had no significant effect on prevalence of MetS.Elevated blood pressure was by far the most frequent single trait of the MetS found in 91.3%. Approximately every second patient had a BMI of \u226530 kg/mThe prevalence of different combinations which meet the diagnosis MetS is presented in table The ORs for AVD risk are presented in table We conducted logistic stepwise regression analysis to determine the relevance of the MetS as an independent risk factor for AVD in T2DM in the context of other major cardiovascular risk factors. We used 2 models; in the first we included the well-established risk factors: age, sex, smoking habit and LDL-cholesterol levels along with the single traits of the MetS. In the second model we considered the MetS as a whole, independently of the combination used, along with the above-mentioned established risk factors. In both models age, male sex, LDL-cholesterol levels and smoking were independently associated to AVD. In the first model T2DM with hypertension remained also independently associated to AVD as a trait of the MetS, while in the second model the MetS as a whole showed an independent association with AVD. There was no significant influence of interaction between the single traits of MetS on AVD. The calculated models predicted 85.1% in model 1 and 85.0% in model 2 resp of AVD or non AVD correctly.We found in this large population based study of patients with T2DM in Germany a prevalence of the overall MetS according to AHA/NHBLI criteria of 74.4% with no sex difference. However, the analysis of the 11 possible combinations which meet the diagnosis MetS reveals a striking heterogeneity in the prevalence of phenotypes and their ORs as AVD risk factors resp. Furthermore, we observed a distinct sex difference with respect to ORs for single traits as well as for all phenotypes of the MetS.III [The prevalence of overall MetS in DIG is comparable to other studies with T2DM in Europe, also they use different definitions -11 and s1C level of 7% and that 44.8% of them were receiving insulin treatment, which is known to increase HDL-cholesterol [As already described in other epidemiological investigations with T2DM and MetS hypertension was the most frequent co-morbidity with not less than 91.3%, with no sex difference. In a recently published study triglycerides were the strongest predictor to indicate the presence of MetS among patients with type 2 diabetes of a outpatient clinic . In contlesterol . ObesityFor the first time we present data on the distribution and prevalence of the 11 possible clusters hidden in the unspecified diagnosis overall MetS. In the DIG sample 62.5% of the people had two or three additional traits  and only 4.4% had a complete set of components of MetS. As expected from the high prevalence of hypertension, hypertriglyceridemia and obesity the prevalence of triads with these components was high: 55.9% for combination with hypertension plus hypertriglyceridemia, 50.7% for combination with hypertension plus obesity and 33.7% for hypertriglyceridemia and obesity as companions. Among quartets only the combination with these three traits was of relevance (31.9%). Of notice was the low frequency of remaining phenotypes with prevalences between 4.7 and 9.7%.Our data on OR for AVD suggest on the first look that the overall MetS is associated with an increased risk: OR for men 1.38 and for women 1.67 resp., but the corresponding ORs for hypertension as single trait were 4.22 and 7.69 resp. In the Botnia study the MetS by WHO definition in patients with T2DM did not increase the AVD mortality (RR 1.15 CI 0.68\u20131.94), while some of its individual components such as hypertension and albuminuria were highly significant predictors of cardiovascular events. Therefore a critical appraisal put a question to the clinical relevance of MetS  dyslipidIn the DIG study overall MetS could be confirmed as independent AVD risk factor in multiple regression analysis including established risk factors such as LDL-cholesterol, age, sex and smoking. The predictive power of this model was as good as for multivariate analysis taking the single traits into the model. We did not find a statistical interdependence of the single traits as risk factors. In a prospective, community-based study, using modified AHA/NHBLI definition, in patients with T2DM the increase in the number of traits was associated with higher CVD rates . AnotherThere are some limitations to our analysis. We made a cross-sectional evaluation and our results are subject, therefore, to survival bias. Some of the combinations of traits were present in a very low number so that the ORs could not be calculated or resulted no significant. In addition, the diagnosis of AVD was based on medical history and information obtained by home physicians without the participation of an adjudicator committee. On the other hand, this population sample represents the real-world scenario of T2DM in Germany.The metabolic syndrome is not more or less than a concept for an integrated approach to a cluster of metabolic diseases with hypertension . This stIn conclusion the MetS was found to be an independent risk factor for AVD in the DIG study together with established risk factors such as age, sex, LDL-cholesterol and smoking. The prognostic power was equal to models with the single trait as categorical variable. Hypertension as single variable had a higher AVD risk than overall MetS. However, triads of the MetS including hypertension and/or low HDL-cholesterol had twice as high a risk as hypertension alone. There are however other phenotypes of the MetS with no increased risk. Thus the metabolic syndrome comprises heterogenous clusters with respect to AVD risk. The data of the DIG study support the concept to focus on multiple risk factor strategy to prevent AVD in diabetes.The author(s) declare that they have no competing interests."}
{"text": "The binding of ring-labelled and side-chain labelled misonidazole to hypoxic cells in monolayer and spheroid cultures of mammalian cells has been compared. The kinetics and patterns of binding for the two labelled compounds are indistinguishable. This finding has implications for the mechanism of binding and for the design of misonidazole analogues which might be used to identify hypoxic zones in tumours."}
{"text": "We report longitudinal changes in the metabolic syndrome (MetS) in 2,458 participants from 480 families in the Family Heart Study. Participants were examined between 1994\u201396 (FHS-T1) and 2002\u201303 (FHS-T2), about 7.4 years apart. Additionally, the impact of medication on estimates of MetS prevalence, and associations of MetS with prevalent coronary heart disease (CHD) and type 2 diabetes (T2D) were studied.o) National Cholesterol Education Program (NCEP) MetS criteria. Two others considered the confounding of medications effects, respectively (m) lipid medications constituted a categorical diagnostic criterion for lipids variables, and (c) lipids and blood pressure variables were corrected with average clinical trials medications effects. Logistic regression of MetS on CHD and T2D, as well as the trend analysis of MetS by age, were performed.Three definitions for MetS prevalence were considered. One represented the original (o) to 28.8% in FHS-T2(o); from 19.7% in FHS-T1(m) to 42.5% in FHS-T2(m); and from 18.4% in FHS-T1(c) to 33.6% in FHS-T2(c). While we observed adverse changes in all risk factors, the greatest increase was for waist circumference (25%). The percentages of MetS were about 2 to almost 3 times higher in ages 50 years and older than in younger ages. The odds of having prevalent CHD were about 2.5 times higher in the subjects classified with MetS than without.MetS increased from 17.1% in FHS-T1(MetS percentages increased noticeably longitudinally and cross-sectionally with older age. These conclusions were reached with and without considering medication use, but correcting risk factors for medications use affects the MetS prevalence estimates. As found in other studies, MetS was associated with increased odds for prevalent CHD. The metabolic syndrome (MetS) is a combination of interconnected risk factors for obesity, insulin resistance and glucose intolerance, dyslipidemia, and hypertension. The Adult Treatment Panel III of the National Cholesterol Education Program (NCEP) defined a group of five clinical criteria for effective classification of MetS (see Methods) . An indiBased on the NCEP classification, it is reported, that a rapidly growing epidemic of metabolic syndrome is taking place in the United States -4. For eMetS is of special interest because it represents a complex disorder expressed by interrelated risk factors with unknown genetic and not well known environmental influences. Previous familial studies have shown that MetS has an important heritable component -8. WhileFHS) \u2013 Time 1 (FHS-T1) and FHS \u2013 Time 2 (FHS-T2), which represent two clinical visits with a mean age interval of about 7.4 years. The main purpose of our study was to assess the longitudinal trends of MetS, its association with age, prevalent CHD and T2D, and the impact of medication on the prevalence estimates of MetS.One of the main features of MetS is an increased risk of CHD and Type 2 diabetes (TD2) -12. AlexThe sampled population is part of the multi-center FHS supported by the National Heart, Lung, and Blood Institute. It is important to mention that the original FHS white familial sample was separated into two large groups, one random and one non-random, based on the participants' recruitment criteria for CHD and their familial risk for CHD. Details are provided elsewhere . Toriginal MetS definition as (o). The second method, labeled (m), considered medication use for TG and HDLC as a categorical effect and anyone on lipid lowering drugs was classified as positive for the NCEP lipid threshold (Table m) is similar to the recent criteria proposed by the Scientific Statement of AHA/NHLBI for diagnosing and managing MetS, with a difference that they defined the threshold of fasting glucose to be 100 mg/dl , but larger at the follow-up visit [FHS-T2(m) and FHS-T2(o) (7.9%). This emphasizes the fact that the expansion of the prevalence of lipid lowering medication use can raise the MetS prevalence estimation, and should be considered.The precision of defining MetS for epidemiological studies is made difficult by the fact that medication treatment can potentially change the level of each risk factor ,17. MediA third approach was performed in an attempt to impute the original levels of treated BP/lipids MetS risk factors (see Methods). This third method resulted in MetS percentages of 18.4% at baseline and 33.6% at follow-up , (m), and (c) methods.For the three methods applied, similar trends were noticed when familial samples were selected random/for CHD  and FHS-T2(c). Higher presence of prevalent CHD and T2D when participants were classified with MetS may imply that MetS and/or its contributing risk factors are associated with the development of CHD and T2D. Similar findings were reported in other publications [It was apparent, when comparing results of FHS-T1 vs. FHS-T2, that the presence of MetS in the sample was associated with higher odds for prevalent CHD. The odds of having prevalent CHD in the presence of MetS were about 2.5 times higher than in its absence in FHS-T1, in this study we assumed that there are correlated medication effects on LDL, HDL, and TG traits. Also for each medication prescribed there are over and under responders. By adjusting everyone on a medication, , by an average medication efficacy or a percentage there is a potential to over-/under estimate the original imputed HDL, TG, BP, and concurrently the MetS prevalence. Therefore to overcome this limitation, (where data are available), we recommend in similar studies for treated risk factors, their correction per participant with average effects of specific classes of medications matched to specific medication labels .We conclude that when estimating the MetS prevalence it is important to account for the medications use that confounds MetS risk factors. To account categorically for anti-hyperlipidemic medication use is a difficult task that can overestimate MetS prevalence. Our study demonstrated also that MetS is associated with a higher risk for prevalent CHD and T2D. This finding is supported by the scientific literature, which in addition shows that CHD mortality is higher in individuals with MetS than without ,28. MetSThe author(s) declare that they have no competing interests.All authors contributed equally."}
{"text": "The Family Blood Pressure Program is an ongoing, NHLBI-sponsored, multi-center program to study the genetic determinants of high blood pressure. The goal of this particular study was to study patterns of metabolic syndrome (MetS) in four ethnic groups: African Americans, Caucasians, Hispanics, and Asians.A major part of participants in three networks GENOA, HyperGEN and SAPPHIRe were recruited mainly through hypertensive probands. MetS was defined as a categorical trait following the National Cholesterol Education Program definition (c-MetS). MetS was also characterized quantitatively through multivariate factor analyses (FA) of 10 risk variables (q-MetS). Logistic regression and frequency tables were used for studying associations among traits.Using the NCEP definition, the Hispanic sample, which by design was enriched for type 2 diabetes (T2D), had a very high prevalence of MetS (73%). In contrast, its prevalence in Chinese was the lowest (17%). In African Americans and Hispanics, c-MetS was more prevalent in women than in men. Association of c-MetS with type 2 diabetes (T2D) was prominent in the Hispanics and African Americans, less pronounced in the Whites and Japanese, , and weakest in the Chinese sample.Using FA without rotation, we found that the main factor loaded obesity (OBS) and blood pressure (BP) in African Americans; OBS and insulin (INS) in Hispanics, in Japanese, and in Whites; and OBS alone in Chinese. In Hispanics, Whites, and Japanese, BP loaded as a separate factor. Lipids in combination with INS also loaded in a separate factor. Using FA with Varimax rotation, 4 independent factors were identified: \"Obesity-INS,\" \"Blood pressure,\" \"Lipids-INS,\" and \"Central obesity.\" They explained about 60% of the variance present in the original risk variables.MetS ethnic differences were identified. Ascertaining for hypertension or T2D increased the MetS prevalence in networks compared with the one in the US general population. Obesity was the most prominent risk factor contributing to both c-MetS and q-MetS. INS contributed in two important factors (obesity and lipids). The information imbedded into c-MetS trait /q-MetS factors scores can contribute in future research of the MetS, especially its utilization in the genetic analysis. Metabolic syndrome (MetS) is defined as a clustering of cardiovascular and type 2 diabetes risk factors including obesity, insulin resistance, dyslipidemia, and hypertension (HT). The genetic control of MetS is expected to be complex since it represents a syndrome of multifaceted abnormalities. Categorical and clinically applicable criteria were developed by the National Cholesterol Education Program (NCEP), which defined MetS as the presence in an individual of at least 3 out of 5 risk factors (increased waist circumference (WAIST), increased level of triglycerides (TG), low levels of high density lipoprotein cholesterol (HDL), HT, and fasting glucose (GLUC) \u2265 110 mg/dl) [We designated this dichotomous definition of MetS (presence or absence) as c-MetS . Quantitative factor analytic treatment of MetS was designated as q-MetS . Several earlier studies have employed multivariate techniques such as factor analysis (FA) to investigate MetS. This method transforms a set of MetS risk variables to a smaller set of latent factors. Most studies have reported 2 to 4 underlying factors, depending on the number of risk factors included, whether or not the Varimax rotation was used, and statistical decisions made .This study is an investigation of MetS in the Family Blood Pressure Program (FBPP) . The FBPThe goal of this particular study was to evaluate MetS in the rich FBPP database using both the c-MetS and q-MetS definitions. Common features and differences among the major ethnic groups were explored. Finally, the relationships of c-MetS with T2D and vascular heterogeneous atherosclerotic (VHA) events were also investigated.FBPP pooled database (version 3) of 13,592 participants from 4 different networks represents one of the largest compilations of ethnically diverse data. GenNet had only partial data for defining c-MetS and therefore, data from GenNet were excluded from analysis. GENOA (Genetic Epidemiology Network of Atherosclerosis) includes 3 field centers: the Jackson, MS center recruited African Americans; the one in Starr County, TX recruited Hispanics; the one in Rochester, MN, recruited Whites. HyperGEN (Hypertension Genetic Epidemiology Network) included field centers in Birmingham AL, which recruited African Americans; the rest of centers in Forsyth County, NC, in Framingham, MA, in Minneapolis, MN, and in Salt Lake City, UT recruited Whites. SAPPHIRe (Stanford Asian Pacific Program in Hypertension and Insulin Resistance), with 3 major field centers, recruited Asian Pacific populations of Chinese origin residing in Taiwan and of Japanese origin residing in Hawaii, and California. GENOA recruited African American, Hispanic, and White sibships with at least 2 hypertensive sibs (with HT onset before the age of 60). The Hispanic sibships were recruited with at least 2 sibs who were each diagnosed as type 2 diabetic (T2D). HyperGEN recruited African American and White hypertensive sibships with 2 or more hypertensive sibs, at least 1 of them having severe HT. In addition, HyperGEN recruited random samples of African American and White participants, and parents. SAPPHIRe recruited sib-pairs concordant and/or discordant for hypertension. For all participants the diet was uncontrolled and reflective of the \"free-living\" dietary habits of these populations.The We analyzed data from the FBPP where participants with data for defining c-MetS included: 1857 African Americans, 1799 Hispanics, and 1578 Whites in GENOA; 2010 African Americans, and 1888 Whites in HyperGEN; 1630 Chinese, and 581 Japanese participants in SAPPHIRe). In all networks, subjects with unknown ethnicity were excluded. As a result, information on a total of 11,343 participants was considered in the c-MetS study  > 35 kg/m2), WAIST (cm), waist-to-hip ratio (WHR), fasting insulin , fasting GLUC (mg/dl), SBP and DBP, mm Hg), low density lipoprotein cholesterol , HDL (mg/dl) and fasting triglycerides . To maintain consistency among the three networks, the minimum fasting time required was set at 8 hours.The categorical trait c-MetS was created employing the NCEP definition. c-MetS was defined by the presence of 3 or more of the following abnormalities in an individual: WAIST > 102 cm in men or > 88 cm in women, TG \u2265 150 mg/dl, HDL < 40 mg/dl in men or < 50 mg/dl in women, systolic blood pressure (SBP) \u2265 130 mm Hg and/or diastolic blood pressure (DBP) \u2265 85 mm Hg, or on treatment for HT, and GLUC \u2265 110 mg/dl or on treatment for diabetes [Type 2 diabetes was defined by a fasting GLUC \u2265 126 mg/dl, or current use of hypoglycemic medication or insulin that was documented at examination in the clinic, or diabetes reported on questionnaires. An age of onset \u2265 40 years was also required to diagnose T2D .In the FBPP pooled database, three important VHA variables were available from questionnaires: stroke or transient ischemic attacks, heart attack, and bypass or angioplasty. If any of these were reported in an individual, it was used to define the VHA status.2, age3, and field center within each gender-by-race-by-Network group. INS, TG, and HDL were transformed by natural logarithm to render them approximately normal. Likewise, GLUC was transformed as the inverse of the squared value (1/GLUC2). These transformations, together with standardization to zero mean and unit variance, prepared the data for FA. FA was performed by employing the FACTANAL function in S-plus version 6.1, Insightful Corp., Seattle. We applied an exploratory factor analysis where the extraction of the latent factors was performed based on the maximum likelihood estimation [The 10 risk variables of MetS were checked for normality and outliers. Each variable was adjusted for age, agetimation ,12. In stimation . The twotimation . Factor FREQ and LOGISTIC regression procedures of SAS. Means and standard deviations were estimated with SAS software v. 9.0., SAS Institute, NC [Odds ratios, prevalence rates, and their confidence intervals were estimated by utilizing the tute, NC .Mean age of participants ranged from 48 years in the HyperGEN African Americans to 58 years in the GENOA African Americans Tables , 2, 3. MAmong African Americans, twice as many were hypertriglyceridemic in GENOA than in HyperGEN, even though they were very comparable for all other MetS risk factors. This difference contributed to a relatively higher percentage of c-MetS in GENOA African Americans 41%) than in HyperGEN African Americans (34%). Whites in both networks were similar with respect to all NCEP thresholds  in African Americans, Hispanics, and Whites; TG had smaller weight in African Americans, but higher in Hispanics and Whites; in the Japanese, TG, HDL, BP, and to a smaller degree WAIST; and in the Chinese, HDL, BP, and less of TG. Hispanics also had a higher contribution of GLUC. Hispanics had a total of 73% of participants with at least 3 risk factors beyond the thresholds . Levels lower than the NCEP thresholds were more frequent in the Chinese and in the Japanese samples than in Hispanics, African Americans, or Whites. As expected, all networks and ethnicities selected had a high percentage of participants above the NCEP threshold for SBP/DBP or using hypertensive medications. For a better comparison, similar ethnicities were combined across networks . Looking at the q-MetS patterns, Asians had more a contribution of hypertension and dyslipidemia. Whites and African Americans showed a classical MetS as a combination of obesity, dyslipidemia, and hypertension, much like the Hispanics  using data from the National Health and Nutrition Examination Survey (NHANES), it is evident that our US samples have a higher prevalence of MetS than the general US population . In our The prevalence of MetS was comparable across Networks within the same ethnicity. However, there are ethnic differences in the prevalence of MetS. Prevalence of c-MetS is high in GENOA Hispanics Figure . They alConversely, Asians  are leaner than others. We recognize that SAPPHIRe exclusion criteria biased the obesity findings. They also had lower T2D prevalence . Other authors have concluded that African-American women and Hispanic men and women have the highest prevalence of MetS. They attributed this to higher BP, obesity, and diabetes in African Americans, and the high prevalence of obesity and diabetes in Hispanics . In the In our study, each of the ethnicities considered showed significant MetS and T2D associations. Young et al. (2003), in a longitudinal cohort study of 429,918 veterans with diabetes, found that African Americans and Native Americans had a higher odds ratio (1.3 and 1.5 respectively) for having early diabetic nephropathy than Whites . In the Four independent factors were identified when factor analysis was performed with Varimax rotation. Their pattern was very similar in African Americans, Hispanics, Whites, and Japanese, but not entirely so in Chinese. BMI, WAIST, and INS contributed together mainly in a factor labeled by us as \"Obesity-INS.\" SBP and DBP contributed in a separate \"BP\" factor. A \"Lipids-INS\" factor was constructed mainly from contributions of LDL, HDL, TG, and INS. The last, \"Central obesity\" factor, was mostly an involvement of WAIST and WHR. These 4 factors were persistent also by gender in the HyperGEN data . When noIn general, our results about the structure of the factors, which reflect multivariate correlations of the variables studied, are supported by the literature. However, there are also differences that could be the result of variations in recruitment. In a study of Japanese Americans, it was found that visceral fat was a significant correlate of hypertension and independent of fasting INS . In contIn conclusion, patterns of the MetS were relatively similar across networks within ethnicity, but were statistically different among ethnicities. Overall, obesity was the most prominent compound risk factor expressed in both c-MetS and q-MetS. However, the degree of consistency in factor structures observed across ethnicities and networks is remarkable given that there are considerable differences in the Network-specific study designs. The notable exception of Hispanics in GENOA is quite understandable since the sample was also enriched for T2D. Thus, some of the differences especially in the prevalence of MetS are, at least in part, attributable to the study design differences. Nevertheless, the increase of MetS prevalence in our U.S. samples compared to the U.S. general population confirmed that there is an important link between HT and MetS. Together, our results underline that MetS is a compound phenotype, where obesity, dyslipidemia, and hypertension enable MetS. If we assume that obesity and dyslipidemia have separate biochemical pathways for their expression, it appears that the presence of INS in both latent obesity and lipids factors may be an indication that INS is an important contributor and possibly a connector of pathways in the development of MetS.The reported findings will be useful if they lead to innovations. One application of these results can be the genetic analysis of the new MetS created data. It is well known that a categorical trait has less power in detecting genetic linkage as compared to a quantitative trait for a complex phenotype. Two types of q-MetS factor scores (with and without Varimax rotation) provide ample opportunity to discover quantitative trait loci for MetS. Parallel with this work, we have undertaken a detailed genetic analysis of the MetS factors that will be reflected in another publication (unpublished observations). Qualitative and quantitative characterization of MetS in the rich Family Blood Pressure Program pooled data will help in getting a better understanding of the genetic inheritance underlying MetS and its interaction with the environmental causes.FBPP, Family Blood Pressure Program; NCEP, National Cholesterol Education Program; MetS, metabolic syndrome; c-MetS, qualitative MetS; q-MetS, quantitative MetS; OBS, obesity; T2D, type 2 diabetes; FA, factor analysis; VHA, vascular heterogeneous atherosclerotic events; HT, hypertension; BMI, body mass index; WAIST, waist circumference; WHR, waist to hip ratio; INS, insulin; GLUC, glucose; TG, triglycerides; LDL, low density lipoprotein cholesterol; HDL, high density lipoprotein cholesterol; SBP, systolic blood pressure; DBP, diastolic blood pressure; BP, blood pressure, CI-confidence interval.The author(s) declare that they have no competing interests."}
{"text": "Panax quinquefolius  on diabetes is yet to be elucidated. Recent studies show that Panax quinquefolius increases insulin production and reduces the death of pancreatic beta cells. Mechanism studies indicate that Panax quinquefolius improves cell's immuno-reactivity and mitochondrial function through various factors. Clinical studies show that Panax quinquefolius improves postprandial glycemia in type 2 diabetic patients. Further studies to identify the component(s) of Panax quinquefolius linked with pancreatic islets/beta cells in vitro and in vivo are warranted for better understanding of the full effects of Panax quinquefolius.The mechanism of the beneficial effects of  Increasing steadily in case numbers, diabetes mellitus has become a devastating illness with significant morbidity and mortality around the globe ,2. TherePanax quinquefolius L.  and Panax ginseng CA Meyer  [Panax ginseng increases blood flow and decreases fatigue. Experimental studies indicate that Panax ginseng alleviates oxidative stress generated by diabetes through the inhibition of lipid peroxidation [Panax quinquefolius has anti-aging effects, aids digestion [Panax quinquefolius may improve psychological conditions, immune function and conditions associated with diabetes  ,8,9. Accxidation . On the es Table . Overallenelzine . HistoriPanax ginseng can be distinguished from Panax quinquefolius by using ginsenoside profiles because Panax ginseng contains ginsenoside Rf which is absent in Panax quinquefolius [Panax ginseng were studied in diabetic C57BL/6J ob/ob mice. The results indicate that the total ginsenoside extract has significant anti-hyperglycemic and anti-obesity properties [-diabetic rats in a dosage dependent manner [The main active components in ginseng responsible for ginseng's medical value have been identified as glycosides. Glycoside is a naturally occurring substance consisting of a sugar and non-sugar moiety. Some glycosides belong to a family of compounds named saponins which produce froth under agitation by reducing water surface tension. A group of saponins in ginseng have been named ginsenosides and classified into subclasses as Ro, Ra, Rb, Rc, Rd, Re, Rf, Rg and Rh. These ginsenosides can be differentiated in thin layer chromatography (TLC) based on their retention factor value, which is the distance that ginsenosides travel up the TLC column . Panax guefolius . The antoperties . In the operties . Rh2, ant manner . Recent t manner .Panax quinquefolius lowers blood glucose in diabetic patients [Panax quinquefolius in stimulating insulin production/secretion and anti-apoptosis are dosage dependent, suggesting a biological specificity of ginseng water extracts on beta cells. A high dosage of Panax quinquefolius is probably required to reverse IL-1 beta induced apoptosis. According to a clinical study by Vuksan et al., Panax quinquefolius attenuated postprandial glycemia in both type 2 diabetic and non-diabetic patients. While no difference was found in postprandial glycemia between placebo and ginseng groups in non-diabetic subjects when administered together with glucose challenge, in subjects with type 2 diabetes significant reductions were observed when ginseng was taken 40 minutes before the glucose challenge [patients , increaspatients . The reshallenge .Panax quinquefolius has not been fully elucidated. According to our findings, Panax quinquefolius water extracts reversed an IL-1 beta induced increase of uncoupling protein-2 , decreased pro-apoptotic protein caspase-9 and increased the level of anti-apoptotic protein Bcl-2. This indicates that the anti-apoptotic effects of Panax quinquefolius may be achieved through regulating mitochondrial UCP-2 and ATP levels, thereby influencing insulin synthesis and apoptotic cascades in beta cells [Panax quinquefolius, there are other reports on additional factors targeted by ginseng such as immuno-reactivity [et al. reported that Panax quinquefolius exerted an anti-lipolytic effect on type 2 diabetic conditions through a signaling pathway different from that of insulin, suggesting that Panax quinquefolius not only affects pancreatic cells through increasing insulin production and cell viability, but also through creating an anti-lipolytic effect and targeting glucose receptors to counter hyperglycemia [Panax quinquefolius to improve hyperglycemia and treat diabetes.The mechanism for the beneficial effects of ta cells   significantly hinders insulin production and inhibits cell viability. During apoptosis, cells shrink; chromatin condenses; DNA is cleaved into pieces at internucleosomal regions . The celpoptosis . Previoucapase-9 . In a stpression . IL-1 bepression . Panax qof Bcl-2 . FurtherPanax quinquefolius products. It is also not certain whether different ginseng species would have the same effects on hyperglycemia. Sievenpiper et al. discovered that Panax ginseng showed both null and opposing effects on acute postprandial plasma glucose and insulin, which did not coincide with the findings with Panax quinquefolius [Panax ginseng has the same effects on humans as it does in animal models.Due to a lack of standardization in the herbal medicine industry, it is not certain whether the beneficial effects on hyperglycemia hold true for all uefolius . Reproduuefolius . FurtherPanax quinquefolius increases cell insulin production and cell viability through mediating mitochondrial proteins and apoptosis factors. These findings confirm that Panax quinquefolius improves pancreatic islet functions. The components of Panax quinquefolius that improve pancreatic beta cell function have not been identified. The precise actions of Panax quinquefolius components on other human cells such as muscle cells and lipocytes under diabetes therapy are yet to be investigated.The author(s) declare that they have no competing interests.ZW proposed to cooperate in this project and provided information for the manuscript. JL conceived this project, collected information and wrote the first draft of the manuscript. LL worked with JL to conceive this project, collected references andinformation, wrote and approved the manuscript. All authors approved the final manuscript."}
{"text": "The metabolic syndrome (MetS) concept is widely used in public health and clinical settings without an agreed pathophysiology. We have re-examined the MetS in terms of body fuels, so as to provide a coherent cross-cultural pathogenesis.National Health and Nutrition Examination Survey (NHANES 2001-2) with n = 2254 and Taiwanese National Health Interview Survey (NHIS) sub-set for hypertension, hyperglycemia and hyperlipidemia assessment (TwSHHH 2002), n = 5786, were used to compare different ethnicities according to NCEP-ATPIII (NCEP-tw) criteria for METS. Exploratory factor analysis (EFA) using principal components (PC) was employed to differentiate and unify MetS components across four ethnicities, gender, age-strata, and urban-rural settings.The first two factors from the PC analysis (PCA) accounted for from 55.2% (non-Hispanic white) to 63.7% (Taiwanese) of the variance. Rotated factor loadings showed that the six MetS components provided three clusters: the impaired energy regulation (IER) components , systolic and diastolic blood pressures (BPs), and HDL-cholesterol, where the IER components accounted for 25-26% of total variance of MetS components. For the three US ethnic subgroups, factor 1 was mainly determined by IER and HDL-cholesterol, and factor 2 was related to the BP components. For Taiwanese, IER was determinant for both factors, and BPs and HDL-cholesterol were related to factors 1 and 2 respectively.There is a MetS core which unifies populations. It comprises WC, TG and FPG as a core, IER, which may be expressed and modulated in various second order ways. The metabolic syndrome (MetS) was conceptualized on the basis that a cluster of metabolic phenomena could be observed in those prone to cardiovascular disease ahead of frank diabetes. It combined features of possible pathogenesis with risk evaluation. Its definition has been in evolution, but those currently used include that of the International Diabetes Federation (IDF) in 2005 ,2 and thThere have been efforts to create a unified explanatory model for this syndrome. The best known of these is that the MetS is a disorder of insulin sensitivity i.e. basically 'insulin resistance' and its sequelae, however it may be caused, as suggested by the IDF .It could be argued that the anatomico-physiological basis of the syndrome is in the splanchnic region  with disThe MetS and energy dysmetabolism are modulated by a number of factors including the psycho-social ,17 and eThere are often striking differences in the presentations of the MetS in Western and Eastern populations. We have taken advantage of such differences between the USA and Taiwan to test for hypothesis generation. In the case of the USA, we have used the National Health and Examination Survey (NHANES) of 2001-2002 data  and in tExploratory factor analysis (EFA) has been used for hypothesis generation. It is a multivariate correlation method to reduce a number of inter-correlated variables into smaller sets of factors with less or no association; it has been applied to study the clustering of metabolic abnormalities that contribute to the metabolic syndrome ,20,24,25The study was approved by the Institutional Review Board (ethics committee) of the NHRI  of Taiwan.lins  were selected with PPS. Four households were selected randomly from each selected lin, with each member of these households to be interviewed. The response rate for households was 91.1%, and it was 94.2% for individuals [Two datasets, one from each of Taiwan and the US were used for this study. The Taiwan data came from the Taiwanese Survey on Hypertension, Hyperglycemia, and Hyperlipidemia (TwSHHH) in year 2002 , a subseividuals . The deshttp://www.cdc.gov/nchs/nhanes.htm[The other dataset was the NHANES which comes from interviews, examinations, and laboratory tests based on blood and urine samples hanes.htm. The 200hanes.htm.As with the Taiwanese sample, when data were missing, or biologically implausible, the subject was not included in the analyses.When examining the relationships between measurements, sampling weights were not necessaryvarimax criterion for the clustering patterns of the six components from the first two factors for each of the ethnic groups. To assess the sensitivity of the estimated proportions, for each of the four ethnic groups, the EFA procedure was applied repeatedly for their communalities in each of the one thousand resampled datasets by bootstrapping [th and 975th millile of the sorted added-up communalities of the corresponding clustered components among one thousand bootstrapped datasets.Descriptive statistics, such as mean and standard deviation, were used to present the characteristics of the study populations. An EFA using the method of principal components  was appltrapping . The 95%The average ages and the metabolic components for the several ethnic groups are presented in Table In regard to urbanization, the analysis was only possible for Taiwanese Table . There wWe have not shown the findings for physical activity or alcohol consumption because of the high frequencies (>20%) of missing values in NHANES. However, in Taiwan, this was not the case .Pearson correlations are shown in Table The correlation between BMI and WC is less in Taiwanese (r = 0.75) than in US ethnic groups . With the exception of blood pressure, the remaining correlations between the metabolic syndrome components are similar for the various ethnic groups.For both the TW3HHH and NHANES datasets, all the distributions of the six components were skewed to the left. Therefore, a log-transformation was applied to each of the six components before analysis, so that the component variables were approximately normally distributed. Figure In the case of Taiwan, the IER cluster was closer to the BP cluster than in the US ethnic groups.Figure In contrast, females tended to have lower communalities in BPs than males except for Mexican-Americans, for whom the females had substantially higher communality. The 95% CIs obtained from bootstrap resamplings were reasonably narrow and homogeneous for all the clustered components across the four ethnic groups as well as the males and females separately, with Taiwanese having the narrowest bounds possibly due to the relatively large sample size Figure , Table 4Table In Figure The factor analysis for elderly Taiwanese (\u2265 65 y) is similar to a factor analysis of the MetS in elderly Swedes (\u2265 75 y)  where a This study utilized factor analysis to discover a consistent component core as a likely core of the metabolic syndrome. We found a similar pattern in different ethnic groups. It confirms our hypothesis about IER. Wijndaele et al.  also use\u00d6hrvik et al.  have expAt present we can say that ethnicity, and urbanisation and, with the exception of elderly women in urban settings, display a common core to the MetS which could reflect IER. Where this does not apply may provide clues to the pathogenesis and consequences of the MetS. An example of this could be the report of Malan et al (2008)  that theVarious attempts have been made to provide a mechanistic construct on the many observations of the MetS cluster of 6 components with insulin resistance being the earliest and most preferred. For example, Alberti and colleagues recommended one single set of cut points for all components except waist circumference . NeverthA somewhat similar conceptualization of the patho-physiological basis of the MetS has been advanced by others ,37. DespIf additional components, like insulin, are included in the MetS definition, they will direct the unifying concept accordingly, in this case towards insulin resistance . In thisWhile we have not formally assessed insulin resistance, fasting glucose represents a partial measure of it, at least insofar as nocturnal gluconeogenesis and its determination by FFA flux in the splanchnic circulation is concerned. Seen this way, insulin resistance may be embraced by the broader and unifying phenomenon of IER.manipulate the datasets in accordance with a hypothesis and then test for it. Hence, we used an exploratory rather than a confirmatory approach.We propose that IER components  rather than the usual six components of MetS are the core metabolic disorder in the MetS, and have employed an exploratory factor analysis (EFA) to differentiate the clustering and inter-relationships among the 6 components of MetS. As the EFA has showed, this hypothesis is \"confirmed\" by the invariant (or homogeneous) pattern across four different ethnic groups. It might be asked why we did not employ a confirmatory factor analysis (CFA) to confirm our hypothesis at the beginning? It is the starting point for those authors who adopt the CFA approach ,40,41 inAs indicated, the conceptual IER segregates from the rest of the components of the MetS and provides a unifying capacity with which to consider inputs and consequences in more systematic ways. Greater sophistication in our hypothesis would involve reference to insinuated, but unobserved measurements (such as free fatty acid) or latent or partially captured factors (such as insulin resistance), at which point the CFA approach would be appropriate. Our findings provide a near-fundamental basis with which to take IER further through more structured hypotheses about phenotype, cellular biology and genomics. Such an enquiry would have public health and clinical relevance.The extent to which the non-IER MetS components and their health outcome significance differ between the ethnic groups studied is of interest We have noted in the results that, for Taiwan, the BP cluster is closer to the IER cluster than in the US ethnic populations. Furthermore, in the case of diastolic BP, where Taiwan has the highest values and prevalence, it is against a background of preference for a high Na/K molar ratio diet, and relatively high incidence of hemorrhagic stroke as featured in the annual Public Health reports. On the other hand, relatively greater North American lipoprotein cholesterol abnormalities Tables  and 2 apA more analytical study of the representative Taiwanese subjects by age, gender and locality provides further insights into the core and second order of the MetS components Table . With reOur segregation of the MetS into an energy-dependent core (IER) and other phenomena is consistent with emerging evidence on the regulation of cellular fuel metabolism and about mitochondrial function and disorder. In particular, the AMP-activated protein kinase cascade has been identified as a unifying system for energy control by Carling and others . It alsoIn both the US and Taiwan, the study populations were community-based and representative, not selected for health status and not institutionalised in this cross-sectional study. Their health characteristics are shown in part, by reported behaviours (eg tobacco smoking) and various risk factors, by the medication history, by anthropometry to detect body fatness and its distribution and by virtue of the components of the MetS itself. Although physical activity and alcohol intake were recorded, the frequency of missing values in the US ethnic groups precluded their reliable evaluation.The interpretation of the medication use is difficult. First, it is some confirmation of a risk or disease state eg hypertension, hyperlipidaemia or diabetes. Second, it means the observed MetS components will have been somewhat corrected depending on compliance, affordability, access to health care and public health education. In these respects the US and Taiwan are strikingly different, since Taiwan has a universal health insurance scheme , with 99% of the population covered, and the US does not. Nevertheless, in both places, remoteness, culture, education, socio-economic circumstances and other equity issues are likely to have influenced MetS component profiles. For example, our data showed age and gender might have effects on MetS, especially on urban older women. Notwithstanding these considerations, the MetS core is robust by setting, health status and where other differences will be inevitable.If the MetS can be understood in clearer etiologic and pathogenetic terms, it will pave the way for more rational and supportable public health preventive strategies and clinical interventions.It remains unclear as to how important the MetS is in the prediction of morbidity and mortality in different clinical settings and the understanding of IER may clarify this situation. From the public health point of view, the \"physical activity transition\" and its role in the genesis of MRFs as proposed by Katzmarzyk and Mason may operate principally through the IER pathway .Energy dysnutrition is a fundamental problem at all stages of economic development. It may operate at different levels from the environmental-human biology interface to every human cell, in turn to determine the likelihood of health and well-being. However, in public health and clinical practice, its measurement is available, not only by way of intake and expenditure with difficulty, but also by way of waist  circumference for abdominal fat stores and by fasting plasma glucose and triglycerides as fuels generated in the splanchnic circulation and region. These 3 components (IER) of the MetS cluster consistently across several ethnic groups in different localities; nevertheless, the phenomenon is not as pronounced in Taiwan as the US and its persistence into later life is less evident in urban Taiwanese women The IER cluster allows a step-wise first (core) and then second order approach to the understanding and application of the present form of the MetS, in relation to cardiovascular disease. This also allows for other variants of the MetS, more relevant, for example, to inflammatory or neoplastic disease, to be developed as second order phenomena. We are encouraged to take advantage of these findings in cohort and intervention studies, especially those which include genetic markers for energy metabolism, fat distribution, and various clinical outcomes.AHA: American Heart Association criteria for metabolic syndrome in 2004; BMI: Body Mass Indices; BPs: systolic and diastolic blood pressures; CFA: confirmatory factor analysis; CI: confidence interval; DBP: diastolic blood pressure; EFA: Exploratory factor analysis; FFA: free fatty acids; FPG: fasting plasma glucose; HDL: high-density lipoprotein; IDF: International Diabetes Federation criteria for metabolic syndrome; IER: Impaired Energy Regulation; LDL: low-density lipoprotein; MRF: metabolic risk factors; MetS: metabolic syndrome; NCEP-ATP III: National Cholesterol Education Program-Adult Treatment Panel III criteria for metabolic syndrome; NHANES: National Health and Nutrition E1xamination Survey; NHIS: National Health Interview Survey; NHLB: National Heart Lung and Blood Institute; PC: principal components; PCA: PC analysis; PPS: probability proportional to their size; SBP: systolic blood pressure; TG: fasting triglycerides; TwSHHH: Taiwan Three High Prevalence Survey on Hypertension, Hyperglycemia, and Hyperlipidemia; VLDL: very low density lipoprotein; WC: waist circumference.The authors declare that they have no competing interests.MLW, HYC, CCC and CCH were involved in the conception and design. WCC WSW and CCC were involved in the analysis and interpretation of the data. MLW, HYC, CCC and CCH drafted the article. MLW, HYC and CAH were responsible for critical revision of the article for intellectual content. MLW, HYC, CCC, CCH, WCC, WSW and CAH gave final approval of the article. HYC, CCC WCC, and WSW provided statistical expertise. HYC, WCC and WSW were involved in the collection, where relevant, and assembly of the data. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6823/10/11/prepub"}
{"text": "A 44-year-old male developed acute fulminant hepatic failure of unknown etiology and expired within four days. His serial electroencephalograms (EEGs) showed diffuse background slowing on day one, which evolved into \u201calpha coma\u201d and later into \u201cspindle coma\u201d over the ensuing two days. Such EEG transition is hitherto undescribed in patients with hepatic encephalopathy and gives fresh insight into the etiopathogenesis of specific EEG patterns in diffuse encephalopathy. Electroencephalogram (EEG) changes in hepatic encephalopathy vary from low-frequency alpha rhythm (8 Hz) admixed with bilateral theta activity that may later evolve into theta-delta slowing over both hemispheres, with or without triphasic waves. Presence of alpha coma and spindle coma pattern in the same patient has hitherto not been highlighted in cases of coma due to fulminant hepatic failure. We report this unusual EEG evolution occurring within a span of three days and discuss its possible electrophysiological basis and prognostic implications.A 44-year-old male with headache and malaise of one-day duration was found unconscious at home. He was last seen by his relative 4-5 hours prior to the present state, ambulant, and verbalizing. He had a history of complex partial seizures of extra temporal origin of 20 years duration with infrequent secondary generalization and was on Phenytoin 350 mg/day. His neuroimaging (MRI brain-1.5T) was normal. On admission, he was febrile with a Glasgow Coma Score of 3/15 without other focal abnormalities on neurological examination and was put on mechanical ventilation. His liver function tests revealed elevated serum glutamic-oxaloacetic transaminase  and glutamic-pyruvic transaminase . During serial monitoring they further rose to 50-100 times respectively in the next 48 hours. His total bilirubin was 4.5 mg% [N = 0.2-1.0 mg], with a direct fraction of 3.2 mg% [N = 0.4-0.6 mg%], serum ammonia 65 \u00b5mol/L [N = 11-35 \u00b5mol/L], alkaline phosphatase 156U/L [N = 50-136 U/L], and albumin 4.1 gm% [N = 4-5 g]. He had progressively worsening coagulation parameters [INR 2.1 to 3.4]. CSF study was normal and blood culture, urine toxic screen  and viral markers  were negative. Ultrasound scan of abdomen and CT scan of brain were normal.Serial EEGs were acquired on daily basis, ranging from forty- five minutes to four hours, but no continuous monitoring was done. On day one, it showed diffuse back ground slowing, which evolved into frontally dominant alpha frequency waves without reactivity, suggestive of \u201calpha coma\u201d on day 2 . On the EEG changes in hepatic encephalopathy depend on the stage of coma. From low-frequency alpha rhythm (8 Hz) admixed with bilateral theta slowing (early stages), it may later evolve into theta-delta slowing over both hemispheres with or without triphasic waves. With increasing stupor sleep activity disintegrates. In severe coma, arrhythmic delta activity decreases, both in frequency and amplitude, evolving into electrocerebral silence.de novo abnormal pattern. Animal studies have shown that after hypoxic brain insult, alpha-like activity appears first with maximum amplitude in the amygdala. This activity could be blocked by bilateral ablation of the amygdala, but not by destruction of cerebral hemispheres.[Our patient's EEG done on day 1 showed nonreactive, generalized delta slowing, suggestive of a diffuse electrophysiological disturbance. This evolved into \u201calpha coma pattern\u201d on second day. On the third day, his EEG revealed \u201cspindle coma pattern\u201d. Alpha coma is a term used when a predominant alpha frequency activity is noted in a comatose patient which is not posterior dominant, continuous and nonreactive. Three maispheres.5 Howeverispheres. In the aSpindle coma is an electroclinical entity in which physiologic sleep patterns, such as sleep spindles in the 12 to 14 Hz range, vertex sharp waves, and K complexes, superimposed on a background of delta and theta activity, occur synchronously in patients with altered consciousness. Spindle coma pattern is distinguished from physiologic slow wave sleep by the inability to rouse the patient to a normal level of consciousness. Head injCycling slow wave sleep patterns in EEG have been reported rarely during prolonged nocturnal recordings in patients with alpha coma. AlthoughPrevious reports denoted better outcomes with spindle coma rather than alpha coma. However,"}
{"text": "FTO gene has previously been found to be associated with obesity in European Caucasian samples. The objective of this study is to examine whether this association extends to metabolic syndrome (MetS) and applies in non-Caucasian samples.The rs9939609 T>A single-nucleotide polymorphism (SNP) in the FTO rs9939609 SNP was genotyped in 2121 subjects from four different non-Caucasian geographical ancestries. Subjects were classified for the presence or absence of MetS according to the International Diabetes Federation (IDF) and National Cholesterol Education Program Adult Treatment Panel (NCEP ATP) III definitions.The Carriers of \u2265 1 copy of the rs9939609 A allele were significantly more likely to have IDF-defined MetS (35.8%) than non-carriers (31.2%), corresponding to a carrier odds ratio (OR) of 1.23 , with a similar trend for the NCEP ATP III-defined MetS. Subgroup analysis showed that the association was particularly strong in men. The association was related to a higher proportion of rs9939609 A allele carriers meeting the waist circumference criterion; a higher proportion also met the HDL cholesterol criterion compared with wild-type homozygotes.FTO rs9939609 SNP was associated with an increased risk for MetS in this multi-ethnic sample, confirming that the association extends to non-Caucasian population samples.Thus, the  The metabolic syndrome (MetS) is a clinical entity characterized by abdominal obesity, hypertension, hypertriglyceridemia, depressed plasma high-density lipoprotein (HDL) cholesterol and elevated glucose ,2. MetS FTO (fat mass and obesity associated) gene, encoding the human analogue of fused toes in mice. The FTO gene encodes a 2-oxoglutarate-dependent nucleic acid demethylase that is present in many tissues, but most abundant in the hypothalamus, the control center of energy balance ). Subgroup analysis of males showed that the carrier OR was 1.46 . By individual ethnic populations, a significant increased risk for MetS was observed for FTO rs9939609 A allele carriers only in the South Asian group (P = 0.027). Analysis of the NCEP ATP III definition for MetS showed a similar trend towards increased risk for FTO rs9939609 A allele carriers compared to TT homozygotes  .Analysis across the 4 study populations indicated that FTO rs9939609 A allele. The non-significant trends suggested that sample numbers were insufficient for detecting an association with this particular trait.No significant increased risk of MetS was observed overall for AA homozygotes, for either the IDF or NCEP ATP III definitions, upon repeating the analyses using a recessive model for the FTO rs9939609 A allele carriers met the MetS criteria for depressed HDL cholesterol (P = 0.0089), and there was a nonsignificant trend towards increased waist circumference and increased BMI for FTO rs9939609 A allele carriers   Table .FTO as a candidate gene for MetS in a sample from multiple non-Caucasian geographical ancestries showed 1) significant association with the FTO gene, with rs9939609 A allele carriers, particularly males, having an increased risk of MetS   a direct function of FTO [FTO locus.This is the first report of an association between the mitation . Despitefindings -11. Howey sample . Aside fFTO rs9939609 A allele carriers met the MetS criteria for depressed HDL cholesterol (P = 0.0089) than non-carriers. In addition, values were close to significance also for increased waist circumference (P = 0.080) and increased BMI (P = 0.060) among A allele carriers  and Greenland Inuit (NCEP ATP III definition). Thus, the overall association is primarily due to these two populations, with little influence from the Chinese and Oji-Cree. Again, replication of the FTO association in other larger study samples is essential for clarification. Further evidence against an association for the Chinese can be found in a recent study of 3,210 unrelated Chinese Han subjects from Shanghai and Beijing where no association found between the rs9939609 SNP and obesity [Although the meta-analysis across the four non-Caucasian study populations showed an association between MetS and the common rs9939609 SNP in  obesity .FTO. The observed consistent association between MetS and FTO in a non-Caucasian multi-ethnic study group, including populations which differ considerably in MetS prevalence, strengthens the likelihood that the FTO locus is related to obesity and MetS. Future replication of this association in larger sized samples and devising functional molecular studies will further enhance the validity of association and the causative relationship between the FTO variant and MetS.In summary, we report an association between MetS and the common rs9939609 SNP in The author(s) declare that they have no competing interests.SAA and RLP participated in the experimental design, data acquisition and analysis, interpretation of results, and manuscript writing. MRB participated in the analysis of the data. TKY, PB, SSA, SY, BZ, SBH, AJGH, PWC, and MWH were involved in the provision of patient samples and/or clinical data. RAH participated in the experimental design, data analysis and interpretation of results and manuscript writing. All authors approved the final manuscript."}
{"text": "The metabolic syndrome (MetS) may contribute to the excess cardiovascular burden observed in rheumatoid arthritis (RA). The prevalence and associations of the MetS in RA remain uncertain: systemic inflammation and anti-rheumatic therapy may contribute. Methotrexate (MTX) use has recently been linked to a reduced presence of MetS, via an assumed generic anti-inflammatory mechanism. We aimed to: assess the prevalence of the MetS in RA; identify factors that associate with its presence; and assess their interaction with the potential influence of MTX.MetS prevalence was assessed cross-sectionally in 400 RA patients, using five MetS definitions . Logistic regression was used to identify independent predictors of the MetS. Further analysis established the nature of the association between MTX and the MetS.P = 0.004).MetS prevalence rates varied from 12.1% to 45.3% in RA according to the definition used. Older age and higher HAQ scores associated with the presence of the MetS. MTX use, but not other disease modifying anti-rheumatic drugs (DMARDs) or glucocorticoids, associated with significantly reduced chance of having the MetS in RA (OR = 0.517, CI 0.33\u20130.81, The prevalence of the MetS in RA varies according to the definition used. MTX therapy, unlike other DMARDs or glucocorticoids, independently associates with a reduced propensity to MetS, suggesting a drug-specific mechanism, and makes MTX a good first-line DMARD in RA patients at high risk of developing the MetS, particularly those aged over 60 years. The MetTo date, five definitions for the MetS have been developed: The National Cholesterol Education Programme (NCEP) 2004  and NCEPSeveral of the individual components of the MetS have been shown to be influenced by demographic, anthropometric and RA-specific factors ,8,29, buIn this study we aimed to: (1) assess the prevalence of the MetS in a large RA population according to all definitions currently used, in order to develop a bench-mark allowing comparisons between other relevant studies in the future; (2) to identify demographic, anthropometric and RA-disease specific factors that may be associated with the presence of the MetS in RA patients; (3) to establish if anti-rheumatic drug use (in particular methotrexate), is associated with the presence of the MetS, and whether this occurs in a drug-specific manner or as a result of an overall anti-inflammatory effect.Four hundred RA patients fulfilling the 1987 revised American College of Rheumatology classification criteria , were rePatient data was obtained via case note analysis and a face-to-face interview performed by a rheumatologist. The dual approach facilitated the documentation of a detailed history to include: disease course/characteristics (including disease duration), drug use , co-morbid conditions, and family history of rheumatic and cardiovascular diseases. Details of current medication prescriptions were recorded at baseline (no prospective data was collected), and previous anti-rheumatic drug use were recorded via retrospective case note analysis and patient interview. Baseline demographics were recorded and anthropometric characteristics were measured as previously described . Current\u00ae 5,1FS chemistry system , with multilayered slides used to measure TC, HDL, and TGs, whereas a dual chamber package was used to assess LDL, apolipoprotein (Apo) A and ApoB. Insulin resistance was evaluated from fasting glucose and insulin using the Homeostasis Model Assessment of Insulin Resistance (HOMA IR) [Baseline blood samples were obtained from each patient and were analysed in a single laboratory. Blood tests included: C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), fasting lipid profile , HDL, low density lipoproteins (LDL), TG), rheumatoid factor, anti-cyclic citrullinated peptide antibodies, thyroid function tests), liver function tests, renal function, insulin and fasting glucose. All lipid components were analysed using the Vitros HOMA IR)  and the HOMA IR) , and wasHOMA IR) .For the purposes of this study, the prevalence of the MetS was analysed according to all existing definitions , or percentages, as appropriate. For the univariate analysis, chi-squared, t-test and Mann-Whitney U tests were used to test categorical, normally and not normally distributed data, respectively. The independence of the predictors of the MetS was tested in the multivariate models using binary logistic regression.This was carried out using SPSS 15.0 . The distribution of each variable was examined using Kolmogorov-Smirnov function. Results are expressed as mean \u00b1 standard deviation, median  and had a median age of 63.1 years. Patients had a median disease duration of 10 years, and had moderate disease activity (mean DAS28 score 4.2).Disease-modifying anti-rheumatic drugs (DMARDs) were widely prescribed among this cohort (340/387), either as monotherapy (218/387) or combination therapy (122/387). The breakdown of DMARD usage was: 218 (56%) patients were taking methotrexate, 114 (29.5%) sulphasalazine, 77 (19.9%) hydroxychloroquine and 16 (4.1%) leflunomide. Biologic therapy and glucocorticoids were prescribed in 45 (11.6%) and 56 (14.5%) patients, respectively. The use of other drugs known to influence components of the MetS included: statins in 83 (21.4%), anti-hypertensives in 171 (44.2%) and NSAIDs/cyclo-oxygenase-II inhibitors in 108 (27.9%) patients.P = 0.429; Table There was great diversity in the reported prevalence rates according to the definition used Table . The preResults presented are only for the MetS as defined by NCEP 2004, but were very similar using any of the other definitions, despite the difference in prevalence.P = 0.001), had shorter disease duration (P = 0.008), higher ESR (P = 0.006), higher HAQ scores (P = 0.036) and significantly less of them were treated with methotrexate (P = 0.001), compared with those who did not have the MetS , higher HAQ scores  and less methotrexate use  values remained significant independent predictors of the presence of the MetS in RA patients. Patients on methotrexate had half the odds of having the metabolic syndrome compared with those not taking methotrexate (odds ratio (OR) = 0.525, 95% confidence interval (CI) = 0.96 to 1.56, P = 0.003). The odds were not significantly altered when other DMARD, anti-TNF therapies, glucocorticoid use and NSAID medications were added to the model  were tested in a multivariate logistic regression model. Older age .The multivariate model was repeated, replacing ESR with DAS28 score and subsequently with CRP, to check for any differences among these potential confounders. The results were not found to differ significantly by using DAS28 or CRP instead of ESR , higher HDL levels (P \u2264 0.001), and lower fasting plasma glucose levels  but its prevalence depends on the definition used, in a very similar manner to that seen in the general population, with the IDF criteria reporting the highest and the EGIR criteria the lowest rates. We also demonstrate for the first time that, irrespective of the definition used, factors including older age and disease severity (HAQ) are associated with the presence of the MetS in patients with RA. More importantly, methotrexate therapy appears to significantly decrease the odds of having the MetS, independently of any of these factors, suggesting the possibility of a drug-specific protective mechanism.To date, four other studies have commented on the prevalence of the MetS in patients with RA, reporting prevalence rates ranging from 14% to 44% ,17,28,30P = 0.429). This was consistent across all definitions of the metabolic syndrome, apart from the EGIR classification, which diagnosed significantly more males than females (P < 0.001). These findings differ from those observed in the general population, where age-matched females have been reported to have significantly higher rates of the MetS [In this study we observed similar prevalence rates of the MetS among males and females . This demonstrated that the 'protective' effects of methotrexate on the presence of the MetS are only present in patients over the age of 60 years. These findings are unsurprising given that patients over the age of 60 years have a higher prevalence of the metabolic syndrome, upon which methotrexate can act.In order to gain further understanding of potential mechanisms that may underlie this phenomenon, we analysed the impact of methotrexate on the individual components of the MetS. Methotrexate use is associated with lower TG, higher HDL and lower fasting glucose levels, but did not appear to be associated with either blood pressure or obesity (as assessed by waist circumference). Although the inflammatory process has been shown to directly modify many of these parameters ,45,46, t2A, thus promoting reverse cholesterol transport [per se, but as a consequence of concurrent folic acid supplementation. Folic acid has been shown to suppress plasma homocysteine levels [P < 0.001), this did not result in significantly lower levels of homocysteine (P = 0.406). We also failed to demonstrate any significant impact of folate levels on the development of the MetS in a binary logistic model . Thus, although this mechanism is still plausible it is not supported by the findings of this study. All of the possible underlying mechanisms of action require further investigation in studies designed specifically for the purpose. However, it remains that the observation described in this study may be important in the clinical context. Methotrexate may be the most appropriate first-line DMARD therapy for RA patients at particular risk of developing the metabolic syndrome, such as the elderly and obese with severe, active RA of relatively short duration.These observations provide interesting insights into the potential mode of action of MTX. One possible mode of action may be through alterations in adenosine concentrations. Extracellular adenosine levels are increased by methotrexate and are known to mediate its anti-inflammatory effect ,48. To aransport . Anothere levels . This mae levels . Insuline levels . Thus, sThe association between methotrexate use and the MetS carries further complexities. A strongly significant negative association is apparent with all but the WHO definition. This phenomenon may be explained by differences in the components and cut-off values used in the definitions. The WHO is the only definition to include albumin/creatinine ratio as a criterion, a factor that was not found to be influenced by methotrexate use. Conversely, it could be explained in differences in the sensitivity and specificity of each definition. The use of the NCEP criteria in RA has been questioned over recent years, because it has been found to confer a low sensitivity for predicting insulin resistance  and may P < 0.001). However, apart from diabetes mellitus , all other components of the MetS had a non-significant association (data not shown).Over recent years, scepticism has arisen over whether the MetS is independently associated with CVD . This isIn addition to the originality of most of the findings, this study has several other strengths. These include the use of all of the existing MetS criteria for the first time in RA, in the largest RA population studied thus far: these data can be used for benchmarking purposes to compare past or future studies, irrespective of the MetS criteria they use. Also, the detailed, prospective data collection minimised selection and recall bias as well as missing data and allowed meaningful sub-analysis with corrections for multiple potential confounders. Despite this, the cross-sectional design is a major limitation and precludes the ability to prove the causality or directionality of the associations found. Our study was also limited to secondary care RA patients from a single geographical location in the UK and did not assess the MetS in local general population controls, although another study of patients with diabetes from the geographically neighbouring (6 miles) area of Wolverhampton suggest that the local population is demographically representative of the total UK population . We cannThe MetS is common among RA patients, and may contribute significantly to their excess cardiovascular morbidity and mortality. In order to aggressively address this issue and minimise the associated risk we suggest that the NCEP 2004 criteria should be used as an annual screening tool in RA patients over the age of 60 years to identify RA patients with the MetS. Consideration should be given to using methotrexate with folate supplementation as first-line DMARD therapy in RA patients deemed to be at the highest risk, such as the elderly with early severe active disease.Apo: apolipoprotein; CI: confidence interval; CRP: C-reactive protein; CVD: cardiovascular disease; DAS28: 28-joint disease assessment score; DMARD: disease-modifying anti-rheumatic drugs; EGIR: European Group for Study of Insulin Resistance; ESR: erythrocyte sedimentation rate; HAQ: health assessment questionnaire; HDL: high-density lipoprotein; HOMA IR: homeostasis model assessment of insulin resistance; IDF: International Diabetes Federation; LDL: low-density lipoprotein; MetS: metabolic syndrome; NCEP: National Cholesterol Education Programme; NSAIDs: non-steroidal anti-inflammatory drugs; OR: odds ratio; QUICKI: quantitative insulin sensitivity check index; RA: rheumatoid arthritis; TC: total cholesterol; TG: triglycerides; TNF: tumour necrosis factor; WHO: World Health Organization.The authors declare that they have no competing interests.TET analysed and interpreted the data and drafted the manuscript. VFP acquired, analysed and interpreted the data. HJ drafted the manuscript. KMD acquired the data. GDK made substantial contributions to the conception and design of the study and revised the draft manuscript. All authors read and approved the final manuscript."}
{"text": "E. coli only and 4243 non-drug targets from E. coli to identify differences in their properties and to predict new potential drug targets.We analysed 48 non-redundant antibiotic target proteins from all bacteria, 22 antibiotic target proteins from E. coli proteins, allowing the assignment of any sequence to the drug target or non-target classes, with an accuracy in the training set of 94%. We identified 319 proteins (7%) in the non-target set that have target-like properties, many of which have unknown function. 63 of these proteins have significant and undesirable similarity to a human protein, leaving 256 target like proteins that are not present in humans.When compared to non-targets, bacterial antibiotic targets tend to be long, have high \u03b2-sheet and low \u03b1-helix contents, are polar, are found in the cytoplasm rather than in membranes, and are usually enzymes, with ligases particularly favoured. Sequence features were used to build a support vector machine model for We suggest that antibiotic discovery programs would be more likely to succeed if new targets are chosen from this set of target like proteins or their homologues. In particular, 64 are essential genes where the cell is not able to recover from a random insertion disruption. Staphylococcus aureus, Streptococcus pneumoniae and group A Streptococcus, and gram negative bacteria, such as E. coli and Helicobacter pylori. Antibacterial drugs are the major weapons to kill bacteria or suppress their activity. Due to the inevitable evolution of antibiotic resistance, the development of novel antibiotics is essential.Infectious and parasitic diseases caused by pathogenic microorganisms, including bacteria, viruses and fungi, are major threats to human health. In particular, diseases commonly result from exposure to gram positive bacteria, such as Antibiotics work either by stopping bacterial growth or by killing the bacteria, without harming the human host. The following are the most common modes-of-action of antibiotics:1) Inhibit synthesis of peptidoglycan. These antibiotics work by interfering with the synthesis of bacterial cell walls by either: blocking the transport of peptidoglycan monomers synthesized in the cytosol across the cytoplasmic membrane, inhibiting a transpeptidase and hence the formation of the peptide cross-links, or blocking both the transglycosidase and transpeptidase enzymes. The transglycosidases are essential for the formation of glycosidic bonds between sugars and transpeptidases are essential for the formation of peptide cross-links [ Inhibit 2) Alter the microbial cytoplasmic membrane. The polymixins are cationic peptides consisting of a cyclic peptide with a fatty acid chain. The interaction between the cationic peptide and the membrane causes disruption of the bacterial cell membrane and increases the permeability of cell components [ Alter th3) Alter translation. Many antibiotics work by binding to bacterial ribosomes. Examples of antibiotics that work by binding to the 30S ribosomal subunit are aminoglycosides and tetracyclines, which prevent the binding of tRNA  Alter tr. Other m(4) Inhibit nucleic acid replication by blocking topoisomerases that are essential for supercoiling, bacterial DNA replication and separation of circular bacterial DNA. The fluoroquinolone antibiotic class contains potent inhibitors for topoisomerases or DNA gyrase .(5) Inhibit transcription. Some antibiotics, such as rifampin or rifampicin, work by binding to RNA polymerase and inhibiting the transcription of DNA to mRNA .et al. addressed this problem by identifying essential bacterial genes  that have no human homologues[After the first widespread use of antibacterial drugs in the 1940s, bacterial pathogens started to develop resistance to existing drugs, particularly after excessive antibiotic use. The three basic mechanisms of bacterial resistance to antibiotics are: (1) Production of an enzyme to inactivate the antibiotic, such as a \u03b2-lactamase to hydrolyse penicillin. (2) Mutation in the target site receptor of the enzyme or the ribosomal subunit that leads to ineffective drug binding. (3) Alteration in transport proteins to prevent antibiotic entry or promote active efflux from the cell . There iHere, we determine key properties of antibiotic target proteins and use machine learning to identify new potential targets.E. coli respectively compared to 316 for non-targets. Bacterial targets show significant preferences for Pro and Val and disfavour Trp, Met, Leu and Gln. Secondary structure analysis shows that bacterial targets have less \u03b1-helix and more \u03b2-Sheet. The percentage of target helices is 32% compared to 42% for non-targets with significant p-values . The prediction of transmembrane helices shows that targets tend to have fewer helices  compared to 1.4 for non-targets. Antibiotic and E. coli targets are less hydrophobic  compared to non-targets (-21) with significant p-values . No statistically significant differences were observed for pI, SignalP, NetNGlyc and NetOGlyc and LCR between the bacterial or E. coli targets and non-targets. This indicates that these features do not contribute to the druggability of a bacterial protein. This is expected for glycosylation, as the glycosylation site prediction programs are optimised for use in metazoa; indeed the predicted frequencies for this property are low. Nevertheless, it is possible to use any sequence feature (including these) for machine learning.All the proteins in the targets and non-targets data sets were analysed for their primary sequence properties and post-translational modifications. As all features showed a non-normal distribution using the Kolmogorov-Smirnov test, p-values were calculated using the Mann-Whitney test. Table E. coli (14.3%) and in all targets (14%) compared to non-targets (12.5%) . The mean frequency of polar amino acids in E. coli (45.1%) and all targets (45.3%) was higher compared to non-targets (42.8%) with a significant p-value of 0.0251 for all targets; similarly, there was a higher proportion of non-polar amino acids in non-targets compared to all targets  with a p-value of 0.0281 for all targets. The frequencies of negative amino acids were greater for E. coli (11.9%) and all targets (11.9%) compared to non-targets (10.8%) .Targets were found to contain more polar, charged, basic and acidic amino acids. The mean frequency of positively charged amino acids was greater in E. coli and 71% (34/48) for bacterial targets. Figure E. coli (17%), compared to 5% for non-targets. Ligases are common antibacterial drug targets as they are involved in the formation of the cell wall. Lyases were not found in either the bacterial or E. coli target sets.The percentage of enzymes was found to be 33% 1420/4243) in non-targets compared to 81% (18/22) for 420/4243 E. coli targets and 47% (23/48) of the bacterial targets have subcellular location annotations in SwissProt. These percentages might be misleading due to bias of annotated sequences to a specific family or incomplete annotation. Figure membrane single-pass type II, peripheral membrane protein, peripheral membrane protein, multi-pass membrane, cell membrane and cell inner membrane . The next highest preferences for drug targets are in the cytoplasm and periplasm.43% (1829/4243) of the non-targets, 40% (9/22) of the E. coli targets and non-targets. Non-targets are localised in the cytoplasmic membrane more than the cytoplasm, and vice versa for E. coli targets. Unknown assignments, where the program is unable to make a prediction, are frequent for both E. coli targets (50%) and non-targets (65%).A prediction method (PSORTb)  was usedE. coli targets and non-targets.Additional file metabolic process and cellular process are found with similar percentages in bacterial targets, E. coli targets and non-targets. Response to antibiotic is unsurprisingly found in bacterial targets and E. coli targets, but not non-targets. Terms including localization and establishment of localization are common for non-targets, but they are not associated with bacterial or E. coli targets. The distribution of biological process at level 2  and in all bacterial targets (6%), but no proteins are associated with this process in the non-targets. Other processes favoured for bacterial and E. coli targets are biosynthetic process and cell wall organization. Transport proteins are more prevalent for non-targets.The distribution of biological process at level 1 . At level 2, more bacterial and E. coli targets are localised in the intracellular part compared to non-targets  for an incorrect prediction and the radial basis function parameter (\u03b3) which controls how smooth the boundary is in hyperspace between the target and non-target areas. The accuracy is defined as the overall probability that the prediction is correct. A PERL program was coded to search for the optimal C and \u03b3 values by performing a coarse grid and a fine grid search. The optimal parameters for C and \u03b3 were found to be 0.9 and 0.1, respectively. This model had an accuracy of 94.2% using 32 features including 20 amino acids, length, hydrophobicity, signalP, netNglyc, netOlgyc-S, netOglyc-T, LCR, secondary structure (\u03b1 and \u03b2), TMHMM and pI. This accuracy is based on 5-fold cross validation using 22 E. coli targets as the positive training dataset and 200 proteins for the E. coli non-targets. The area under curve in a ROC plot was 0.996, confirming the high accuracy of the model.The features described above were used with the support vector machine algorithm to develop a model that is able to assign any sequence to the E. coli non-target sequences. 319 of them were assigned as targets, suggesting that 7% of bacterial proteins have target-like properties  are annotated as uncharacterised proteins and 8% (28/319) as 50S or 30S ribosomal proteins. 8% (26/319) of the new predicted targets are transferases and 5% (16/319) are hydrolases, in broad agreement with annotation data  algorithm was used to classify 4243 a Figure . Other EE. coli target proteins were further analysed to check for similarity to human proteins. If any similarity is found, the predicted antibiotic targets may well be problematic, as their inhibition could lead to toxic effects in the patient. 63 proteins were found to have maximal sequence similarities to a human protein of 25% to 63% using BLAST  of the new predicted targets showed a high similarity to an essential gene where 11 proteins had a sequence identity of 50% to 70% and 53 proteins had a sequence identity > 70%. Additional File E. coli colonies in humans, so targeting E. coli may have unwanted effects.The list of 319 proteins was subjected to a BLAST search against the es. 20% 6/319 of tet al. recently performed a detailed and thorough analysis of orphan E. coli proteins, giving many new functional assignments [Hu ignments . In partE. coli targets and those from all bacteria. Targets are more likely to be enzymes than non-targets. Major antibiotic mechanisms include inhibiting enzymes responsible for translation, transcription, replication and bacterial cell wall biosynthesis. Inhibition of such mechanisms usually results in cell growth inhibition or bacterial death. The molecular function analyses of Gene Ontology and enzyme class data show a preference for ligases as targets, such as those involved in peptidoglycan biosynthesis. The biological process analysis shows that response to antibiotic, regulation of cell shape and cell wall organization terms are favoured for targets. The cellular components data showed a high preference for intracellular part targets, with the cytoplasm subdivision favoured in particular, perhaps because enzymes are abundant in the cytoplasm and despite the difficulty of a drug crossing the membrane. The membrane distribution for targets was lower that non-targets, supporting the predicted subcellular locations. While the annotated results had a higher preference for targets to be localised in the membrane, the predicted results had a higher preference for the cytoplasm. There are fewer predicted transmembrane helices in targets, supporting the subcellular location data.Even though we have only a fairly small number of distinct targets in our data set, we still find many properties that are significantly different between antibiotic targets and non-targets.  There was little difference between Bacterial targets tend to be larger and more polar than non-targets. Larger proteins have more potential surface of interaction between the drug and the target and may participate in more protein-protein interactions, thus having a larger effect when a drug binds. The presence of charged amino acids might facilitate the interaction between the drug and the target, as bonds to charged amino acids from target groups are common -14. PosiE. coli showed that 35% of metabolic enzymes, including amino acid, purine and pyrimidine biosynthesis, are non-essential genes for cell growth [Studies on l growth . This meAn ideal drug should have no similar protein in the host cell, as the drug might interact with it and lead to adverse effects in the patient. There exist some exceptions for this rule: Trimethoprim is such an example of an antibiotic used to treat urinary tract infections. It works on inhibiting dihydrofolate reductase, despite the presence of a close human homologue . On the Our previous work analysed desirable properties in human drug target proteins , so we cIn summary, the following seem to be desirable features for an antibiotic drug target:\u2022 Essential for the survival of the bacterial cell\u2022 No close human homologue\u2022 Must be present in a number of pathogens if broad-spectrum action is required. Narrow spectrum antibiotics target specific pathogens\u2022 The most targeted biological processes are peptidoglycan biosynthesis, cell wall synthesis, transcription and translation\u2022 Capable of binding to a small molecule, implying the presence of a binding site\u2022 Favoured to be localized in the cytoplasm and less frequent in membranes\u2022 Favoured to be ribosomal proteins\u2022 More likely to be enzymes, transferases, hydrolases or ligase, but not lyases. Although enzymes are highly targeted, metabolic enzymes are disfavoured for antibacterial drug targets.While many of the above properties have been reported in qualitative terms, they have not been previously quantified, to our knowledge. In addition, some of the preferences we find appear to be new, such as EC class, length, amino acid frequencies, post-translational modifications, secondary structure contents, pI, SignalP and transmembrane helices.E. coli protein to the target or non-target classes. The use of cross-validation and the generalisation parameter in the SVM ensures to a certain extent that the model can generalise to data not used in the training process. After classifying the entire E. coli proteome to identify novel target-like proteins and pruning it to remove those that are similar to a human protein, we find 256 proteins that may be potential antibiotic targets, especially those 64 proteins highly similar to essential genes. While 40 previously identified orphan genes can now be assigned to cell envelope biogenesis or translation, many are currently of unknown function and thus deserve further investigation. The rules listed above and our list of potential new antibiotic targets may help in the identification of new antibiotics drug target.The machine learning work can accurately assign an E. coli has allowed the identification of a number of properties that are desirable in drug targets. Even though the number of unique known targets is not large, statistically significant differences in property frequencies were found. Using sequence features for machine learning allows accurate identification of targets, as shown by a cross-validation accuracy of 94%. Applying the optimised support vector machine to the E. coli proteome identifies hundreds of proteins that have similar properties to known antibiotic drug targets. These proteins may therefore be considered as potential new targets for novel antibiotics.Comparison of antibiotic protein targets with non-target proteins from E. coli (strain K-12). This E. coli targets dataset consists of 22 proteins. The non-targets dataset was downloaded from the High-quality Automated and Manual Annotation of microbial Proteomes (HAMAP) at Expasy http://www.expasy.ch/sprot/hamap/. It is not obvious what a bacterial non-target protein data set should be, as it is always arbitrary which species are included. We therefore picked just one species, namely E. coli strain K-12, as this is the most common species for targets. As of 2006, the E. coli proteome contains highly accurate and complete sequences for the K-12 strain with 4338 entries. This set was culled with a 20% sequence identity cut-off to leave 4265 entries for the non-redundant dataset. Known antibiotic drug targets were removed from the set to give a non-redundant non-targets dataset of 4243 entries. Full lists of bacterial targets and non-targets data sets are found in Additional File The bacterial target dataset was downloaded from DrugBank  in FebruE. coli strain. Hence, we may be picking up differences in protein features arising from differences between species, rather than between targets and non-targets. Comparing targets with non-targets entirely within the E. coli K-12 strain avoids this problem, though the number of targets is considerably fewer. We therefore analysed three data sets, namely all antibiotic targets, E. coli K-12 strain targets and E. coli K-12 strain non-targets. The non-drug target dataset may contain proteins that could be drug targets, making it less well defined. However, as it is doubtful whether more than a small fraction of the bacterial proteome will ever be a target, this error should not be large.When comparing all targets to non-targets, differences between the sets may arise since the targets are taken from a wide range of bacteria and they are compared only to one Properties were tested for normality using the Kolmogorov-Smirnov test. As all the distributions were not normal, the Mann-Whitney U test was used to test for statistically significant differences between the sets using SPSS .SWISS-PROT annotations were used for some sequence properties, such as sub-cellular locations. We were concerned, however, that variations in the frequency of annotation may bias the results. For example, one would expect that drug target proteins are better studied than non-targets, leading to a possible increase in annotation of targets compared to non-targets. We therefore also often used predicted properties, as well as annotations, where possible.http://emboss.cbr.nrc.ca/cgi-bin/emboss/pepstats was used to output protein sequence information statistics including isoelectric points , and numbers of positively charged and negatively charged amino acids. A PERL script was written to extract protein sequence features and calculate the mean frequencies.The frequency of each amino acid in each protein is divided by protein length to give percentage frequencies. Amino acids were grouped as follows: non-polar ; polar ; positive  and negative . Hydrophobicity was calculated as the sum of hydrophobicity values using the Kyte & Doolittle index , dividedPrimary EC numbers were taken from the description line \"DE\", as this line contains the EC numbers corresponding to an entry, where primary EC numbers 1-6 are oxidoreductase, transferase, hydrolase, lyase, isomerase and ligase, respectively.http://www.geneontology.org/GO.downloads.shtml, dated September 2006. GO ID annotations are in SWISS-PROT in the database reference line \"DR\". A PERL program was coded to extract the Gene Ontology IDs for each datasets and to parse a GO file and write child/parent relationship as a full path for every GO term and to output the highest level and next highest level for every path as levels 1 and 2. If a GO term id was present more than once at level 1 or 2, it was only counted once at that level.Gene Ontology (GO) provides a controlled vocabulary to describe gene function , using thttp://www.cbs.dtu.dk/services/NetOGlyc/ was used for identification of O-glycosylation sites using neural networks [http://www.cbs.dtu.dk/services/NetNGlyc/ was used for identification of N-glycosylation sites [http://wolfpsort.seq.cbrc.jp/[http://www.cbs.dtu.dk/services/SignalP/ was used to perform signal peptide prediction [http://www.cbs.dtu.dk/services/TMHMM/[ftp://ftp.ncbi.nih.gov/pub/seg/seg/ to detect low complexity regions. It is used to mask composition-biased regions in the query, based on a statistical approach. The JPred program http://www.compbio.dundee.ac.uk/~www-jpred/[The NetOglyc program networks . The Neton sites . The WoL.cbrc.jp/ was usedediction . The TMHes/TMHMM/ was usedes/TMHMM/ was downww-jpred/ was usedE. coli targets from non-targets, using features that can be calculated from any protein sequence. The features we used were: amino acid compositions, length, hydrophobicity, SignalP, NetOglyc Ser, NetOglyc Thr, low complexity regions, \u03b1-helix, \u03b2-sheet, transmembrane helices and pI. A scaling scheme was used for every vector by restricting all entries to be between 0 and 1, by calculating for every feature (X - Min)/(Max - Min) where X is the feature score, and Min and Max are the minimum and maximum values of X in the set.Support vector machines , using aE. coli targets were used as the positive training dataset and 200 proteins were randomly selected from the E. coli non-targets dataset to represent the negative set. This model is therefore based on training E. coli targets versus non-targets, rather than training all targets versus non-targets because differences to all targets may reflect species differences instead of differences between targets and non-targets. As the target and non-target sets have different sizes, an error penalty parameter (C) is introduced to ensure generalization of the classifier. The ratio of the error penalty for targets:non-targets is set to 9:1, in proportion to the data set sizes of 200:22 and applied in the LIBSVM program using the weight parameter (wi) for both classes . The program (svm-predict-margins) was downloaded from http://www.work.caltech.edu/~htlin/program/libsvm/#margin[The SVM was assessed using 5-fold cross validation using the following training set splits: 22 m/#margin. This toE. coli essential genes were downloaded from the National Microbial Pathogen Data resource (NMPDR) http://www.nmpdr.org/FIG/wiki/view.cgi/Main/EssentialGenes. The database consists of 603 non-redundant putative essential genes, updated in September 2008. The list is checked for any redundancy using BLASTCLUST[Essential genes are those that play an important and essential functional role in a specific pathway. The presence of these genes is vital to the cell, as their inhibition would lead to cellular growth arrest or death of the pathogen. Essential genes are those that are not able to recover from a random insertion disruption . E. coliLASTCLUST, so thatTB participated in the design of the study, carried out the work and helped to draft the manuscript. AD conceived of the study, participated in its design and coordination and helped to draft the manuscript. Both authors read and approved the final manuscript.Gene Ontology Terms. Pie charts for frequencies of Gene Ontology terms for E. coli targets, bacterial targets and non-targets. Supplemental Figure 1a - Distribution of molecular functions at level 1 for E. coli targets. Supplemental Figure 1b - Distribution of molecular functions at level 1 for bacterial targets. Supplemental Figure 1c - Distribution of molecular functions at level 1 for non-targets. Supplemental Figure 1d - Distribution of molecular functions at level 2 for E. coli targets. Supplemental Figure 1e - Distribution of molecular functions at level 2 for bacterial targets. Supplemental Figure 1f - Distribution of molecular functions at level 2 for non-targets. Supplemental Figure 1g - Distribution of biological processes at level 1 for E. coli targets. Supplemental Figure 1h - Distribution of biological processes at level 1 for bacterial targets. Supplemental Figure 1i - Distribution of biological processes at level 1 for non-targets. Supplemental Figure 1j - Distribution of biological processes at level 2 for E. coli targets. Supplemental Figure 1k - Distribution of biological processes at level 2 for bacterial targets. Supplemental Figure 1l - Distribution of biological processes at level 2 for non-targets. Supplemental Figure 1m - Distribution of cellular components at level 2 for E. coli targets. Supplemental Figure 1n - Distribution of cellular components at level 2 for bacterial targets. Supplemental Figure 1o - Distribution of cellular components at level 2 for non-targets.Click here for fileNew predicted antibiotic targets. E. coli proteins with target-like properties. Results from applying SVM trained on distinguishing bacterial targets from non-targets.Click here for filePredicted bacterial protein targets with sequence similarity to human proteins. Predicted bacterial protein targets (Additional File Click here for fileNew predicted targets with high similarity to essential genes. Predicted bacterial protein targets was subjected to a BLAST search against the E. coli essential genes. The 64 targets that have a high similarity to an essential gene are listed here, along with their p-values, identities and BLAST scores.Click here for fileE. coliComparison to global functional atlas of . Hu et al. analysed E. coli orphan proteins, giving many new functional assignments [ignments . In partClick here for fileBacterial targets and non-targets data sets. Non-redundant bacterial targets and non-targets data sets.Click here for fileNon-redundant putative essential genes. Essential genes are those that are not able to recover from a random insertion disruption [http://www.nmpdr.org/FIG/wiki/view.cgi/Main/EssentialGenes.sruption . 603 nonClick here for file"}
{"text": "Lipoprotein lipase (Lpl) acts on triglyceride-rich lipoproteins in the peripheral circulation, liberating free fatty acids for energy metabolism or storage. This essential enzyme is synthesized in parenchymal cells of adipose tissue, heart, and skeletal muscle and migrates to the luminal side of the vascular endothelium where it acts upon circulating lipoproteins. Prior studies suggested that Lpl is immobilized by way of heparan sulfate proteoglycans on the endothelium, but genetically altering endothelial cell heparan sulfate had no effect on Lpl localization or lipolysis. The objective of this study was to determine if extracellular matrix proteoglycans affect Lpl distribution and triglyceride metabolism.We examined mutant mice defective in collagen XVIII (Col18), a heparan sulfate proteoglycan present in vascular basement membranes. Loss of Col18 reduces plasma levels of Lpl enzyme and activity, which results in mild fasting hypertriglyceridemia and diet-induced hyperchylomicronemia. Humans with Knobloch Syndrome caused by a null mutation in the vascular form of Col18 also present lower than normal plasma Lpl mass and activity and exhibit fasting hypertriglyceridemia.This is the first report demonstrating that Lpl presentation on the lumenal side of the endothelium depends on a basement membrane proteoglycan and demonstrates a previously unrecognized phenotype in patients lacking Col18. Col18a1\u2212/\u2212) are viable but exhibit major ocular defects including abnormal retinal vessel development and poor anchoring of vitreal collagen fibrils to the inner lining membrane of the retina Heparan sulfate proteoglycans present in basement membranes aid in the formation of tissue barriers and facilitate cell adhesion and migration during development Gpihbp1 reduces vascular presentation of Lpl and plasma levels of Lpl activity and mass, which causes striking hypertriglyceridemia. Injection of heparin releases Lpl into the circulation and rescues the hyperlipidemic phenotype in Gpihbp1-deficient mice; however, both Lpl release and the subsequent decline of plasma triglycerides occur more slowly in the mutant compared to wild-type animals Lipoprotein lipase (Lpl) hydrolyzes triglycerides in triglyceride-rich lipoproteins in the circulation, liberating free fatty acids and monoacylglycerol for storage and energy production. This essential enzyme is synthesized in parenchymal cells of adipose tissue, heart, and skeletal muscle and migrates to the luminal side of the vascular endothelium where it acts upon circulating lipoproteins \u03943/\u03943Hspg2) did not have mild hypertriglyceridemia. These findings are of clinical relevance because we show that patients lacking the primary vascular form of Col18  also exhibit fasting hypertriglyceridemia and decreased plasma Lpl, previously unrecognized phenotypes in these patients.Lpl binds to heparin, suggesting that it might associate with heparan sulfate that is covalently attached to extracellular matrix or cell surface proteoglycans \u2212/\u2212Col18a1 mice and \u03943/\u03943Hspg2 mutant mice that lack the heparan sulfate attachment sites in the basement membrane proteoglycan, perlecan \u2212/\u2212Col18a1 mice vs. 119\u00b125 mg/dl in mutants, n\u200a=\u200a10, P<0.0001). These values did not vary significantly according to the duration of fasting (4\u20138 hr), age of the animals (2\u201312 months) or their sex. Plasma cholesterol levels were slightly lower in mutants, but the difference did not achieve statistical significance . Col18a1+/\u2212 heterozygotes did not display any changes in plasma lipids compared to the wild-type controls (data not shown). In contrast to Col18a1\u2212/\u2212 mice, \u03943/\u03943Hspg2 mice did not exhibit any change in fasting plasma triglycerides and cholesterol compared to wild type , consistent with the studies in \u03943/\u03943 apoE\u2212/\u2212Hspg2 mutants by Tran-Lundmark et al To investigate the possibility that sub-vascular heparan sulfate proteoglycans participate in lipoprotein metabolism, we examined ificance  . Further analysis of plasma lipoproteins 2 hrs after gavage showed that the majority of the triglycerides and [3H]retinol counts were recovered in the large buoyant lipoproteins of \u03b4<1.006 g/ml (data not shown). These lipoproteins were larger  To determine if turnover of dietary lipids was affected, we examined the rate of lipoprotein clearance after oral gavage with corn oil containing [ 4 hours . Thereaf3H]triolein, which are proposed to resemble chylomicrons 2\u200a=\u200a.96) and 2%\u00b10.5/min (R2\u200a=\u200a0.88) for the mutant. In contrast to these findings, hepatic clearance appeared to be normal in Col18a1\u2212/\u2212 mice based on clearance of intravenously injected human VLDL . Recent studies indicate that Lpl is localized to the vascular endothelium, bound to its receptor, Gpihbp1 Col18a1\u2212/\u2212 mice and colocalized with the blood endothelial cell marker, CD31 . The time course of release of Lpl was also comparable . Since Lpl is rapidly cleared in the liver \u2212/\u2212Col18a1 mice compared to wild-type mice.Reduced presentation of Lpl at the lumenal side of capillaries could explain the phenotype of P\u200a=\u200a0.006). Attempts to measure enzyme activity in the plasma were not successful because the signal-to-noise ratio for the assay was not sufficient, even after enrichment of plasma samples by heparin-Sepharose chromatography.Inspection of the curves in Col18a1\u2212/\u2212 mice. However, transcript levels of Gpihbp1 were comparable in mutant and wild-type mice in adipose, heart, and muscle . This extremely rare disorder is characterized primarily by ocular defects, including myopia, vitreoretinal and macular degeneration, retinal detachments, and occipital encephalocele defects thought to arise from altered basement membrane structures Col18a1\u2212/\u2212 mice The hypertriglyceridemia and reduction in plasma and endothelium-bound Lpl in COL18A1 common to vascular basement membranes, which is distinct from a long form splice variant expressed abundantly in the liver and heart and regulated by a different promoter P<0.05), but no significant difference was noted in heterozygotes compared to normal or affected subjects .A large consanguineous family of Knobloch patients was identified in a remote farming community in Bahia State, Brazil subjects . Ultracesubjects  was bordP<0.01; and 51.4\u00b115 for normal family members, P<0.01). Unlike mouse plasma, human plasma had sufficient Lpl activity to measure reliably. Knobloch patients also exhibited reduced plasma Lpl activity . The extreme remote location of most family members and local dietary restraints precluded other postprandial studies and interventions.Finally, fasting plasma samples from Knobloch, heterozygous and normal control related family members were compared for differences in Lpl mass and activity levels. Results demonstrated that the plasma levels of LpL enzyme in Knobloch subjects were reduced compared to related heterozygous and normal control family members  How does a proteoglycan located in basement membranes affect presentation of Lpl in the plasma and at the endothelial surface? Lpl is secreted by the parenchymal cells of adipose, cardiac and skeletal muscle and migrates from its site of secretion through the interstitial space, across basement membranes and eventually the endothelium \u2212/\u2212Col18a1 mice resembles that seen in mutants that affect Lpl expression or presentation. For example, Lpl heterozygotes have reduced plasma levels of Lpl, mild hypertriglyceridemia in both the fasted and post-prandial states, and acute accumulation of plasma lipids after oral gavage Gpihbp1\u2212/\u2212 mice differ significantly from Col18a1\u2212/\u2212 mice in the extent of hypertriglyceridemia and localization of Lpl in tissues Col18a1\u2212/\u2212 mice, Lpl colocalized with CD31+ endothelium , and perlecan (\u03943/\u03943Hspg2 ) were described previously ad libitum with water and standard rodent chow (Harlan-TekLad) unless indicated otherwise. Genotyping of Col18A1\u2212/\u2212 was performed as described Mice deficient in Col18 . Pooled mouse plasma lipoproteins were also separated by gel filtration FPLC . Plasma samples were centrifuged for 20 hr at 45,000\u00d7 rpm in a Beckman 50.3Ti rotor at \u03b4\u200a=\u200a1.006 g/ml to collect triglyceride-rich lipoproteins. Isolated lipoproteins were dialyzed against PBS and analyzed for lipid content.Lipoproteins of \u03b4<1.006 g/ml were purified from pooled plasma obtained from fasted animals or after oral gavage of 0.2 ml corn oil (n\u200a=\u200a3 or each genotype). To determine particle size, samples were coded, negatively stained with 2% potassium phosphotungstate (pH 7.6), and imaged by transmission electron microscopy . The diameters of particles in 8 fields were measured, and the data from two separate experiments were pooled.via the tail vein into mice fasted for 4 hr, and triglycerides were measured in plasma samples taken 30, 60, and 90 min post-injection. The secretion rate (mg/min) was calculated from the increment in triglyceride concentration per minute multiplied by the plasma volume of the mouse (estimated as 0.035% of body weight in grams). To determine the intestinal triglyceride secretion rate, Triton WR-1339 was injected into mice that had been given a bolus of corn oil by gavage (0.2 ml/mouse).Triglyceride secretion rates were determined by the method of Hirano et al. 3H]triolein-labeled Intralipid particles were made as described previously 5 cpm) were injected into the tail vein, blood samples were taken at the indicated times, and radioactivity was measured (10 \u00b5l of serum) by scintillation counting. Retinol excursion studies were done essentially as described 3H]retinol  in ethanol was mixed with 1 ml of corn oil (Sigma) and administered by oral gavage (200 \u00b5l/mouse). Blood was sampled at the times indicated by retro-orbital sinus bleed and radioactivity was measured in triplicate (10 \u00b5l of serum) by scintillation counting.Clearance of human VLDL was performed by measuring the level of human apoB-100 present in plasma at timed intervals following intravenous injection of VLDL purified from fasted, healthy human donors. Human apoB-100 was measured by ELISA using mAb MB47, which binds human but not murine apoB-100, exactly as described in Col18a1\u2212/\u2212 mice . RNA was isolated , reverse transcribed  and amplified using gene specific intron spanning primers to Lpl or Gpihbp1. Primer sequences, Lpl, 5\u2032-AGGTGGACATCGGAGAACTG and 3\u2032- TTTGTCCAGTGTCAGCCAGA and, Gpihbp1, 5\u2032- AACATGATCCCTGGAAGCAG and 3\u2032- ACAGTGTGGACTGGCAACAG. Quantitation was done by the 2\u2212\u0394\u0394Ct method using \u03b2-actin as a control RNA in a Stratagene MxP3500. Final numbers represent fold-expression compared to \u03b2-actin (100%). Ct values from triplicate assays were used to calculate fold-expression according to Stratagene manual. Results were verified in two independent assays.Lpl and Gpihbp1 mRNA expression were determined in RNA samples isolated from gonadal fat pad, heart and soleus muscle from wild-type and Intravenous injection of heparin (0.5 U/g body weight) or 20% Intralipid (7.5 ml/kg body weight) was used to release Lpl into the plasma. Blood samples were taken by retro-orbital bleeding prior to and at various times after injection. Lpl mass in plasma samples was measured by ELISA with a specific antibody as described previously 3H]olein, \u223c0.5 mCi/ml; Perkin Elmer) and calculated as nmol triolein hydrolyzed per min (i.e. mU activity) for each sample Lpl activity in plasma or tissues was determined using sonicated radiolabeled triolein substrate -Mice were perfused through the left ventricle with \u223c10 ml phosphate-buffered saline at a rate of 2\u20133 ml/min after cutting the inferior vena cava, then perfused with 10 ml 3% paraformaldehyde in PBS. Excised tissues were post-fixed in 3% paraformaldehyde for 1 hr at room temperature, placed in 30% sucrose dissolved in PBS overnight at 4\u00b0C and embedded the next day in OCT.To detect LPL in mouse tissues, 10 \u00b5m-thick frozen sections were prepared and incubated overnight with primary antibodies [1\u2236400 for the hamster anti-CD31 antibody , 1\u2236800 for the rat anti-GPIHBP1 antibody COLA18 and characterized previously at the Human Genome Center in S\u00e3o Paulo, SP, Brazil Knobloch patients were recruited from a large family diagnosed with a loss of function mutation affecting the expression of the vascular isoform of \u2212/\u2212Col18a1 mice were determined using an unpaired Student's (two-tailed) t test. Knobloch, heterozygote carriers and unaffected family members were compared by the non-parametric Kruskal-Wallis test with Dunns post-test comparisons between all pairs of genotypes. Significance was taken as P<0.05.Statistical analyses were performed using PRISM (GraphPad Software). All data are expressed as mean values \u00b1 SD unless otherwise indicated. Comparisons between wild-type and Table S1Knobloch patient data.(0.05 MB DOC)Click here for additional data file."}
{"text": "The past two decades have seen a rise in the number of investigations examining the health-related effects of religiously motivated fasts. Islamic Ramadan is a 28 - 30 day fast in which food and drink are prohibited during the daylight hours. The majority of health-specific findings related to Ramadan fasting are mixed. The likely causes for these heterogeneous findings are the differences between studies in the following: 1) the amount of daily fasting time; 2) the percentage of subjects who smoke, take oral medications, and/or receive intravenous fluids; and 3) the subjects' typical food choices and eating habits. Greek Orthodox Christians fast for a total of 180 - 200 days each year, and their main fasting periods are the Nativity Fast (40 days prior to Christmas), Lent (48 days prior to Easter), and the Assumption (15 days in August). The fasting periods are more similar than dissimilar, and they can each be described as a variant of vegetarianism. Some of the more favorable effects of these fasts include the lowering of body mass, total cholesterol, LDL-C, and the LDL-C/HDL-C ratio. The Biblical-based Daniel Fast prohibits the consumption of animal products, refined carbohydrates, food additives, preservatives, sweeteners, flavorings, caffeine, and alcohol. It is most commonly partaken for 21 days, although fasts of 10 and 40 days have been observed. Our initial investigation of the Daniel Fast noted favorable effects on several health-related outcomes, including: blood pressure, blood lipids, insulin sensitivity, and biomarkers of oxidative stress. This review summarizes the health-specific effects of these fasts and provides suggestions for future research. Fasting is defined as a partial or total abstention from all foods, or a select abstention from prohibited foods. As a potential non-pharmacological intervention for improving health and increasing longevity, fasting has been the subject of numerous scientific investigations. The three most commonly studied fasts are caloric restriction (CR), alternate-day fasting (ADF), and dietary restriction (DR). A summary of the main findings is presented below.ad libitum consumption. CR has been demonstrated to improve health and increase longevity in a diverse group of species, including: dog, fruit fly, nematode, rodent, rotifer, spider, non-human primate, and zebrafish [CR is the reduction of kilocalorie  intake by a certain percentage  of ebrafish . Additioebrafish . Regardiebrafish ,6.ad libitum; during the \"fast period,\" food consumption is restricted or halted altogether. Water is allowed ad libitum during all times. Animal ADF trials have reported extended lifespan [ADF consists of alternating 24-hour periods: during the \"feast period,\" fasters may consume food lifespan  as well lifespan . ADF haslifespan ,9. Regarlifespan . Furtherlifespan .DR is a reduction of one or more components of dietary intake  with minimal to no reduction in total kcal intake. Research suggests that neither carbohydrate restriction nor lipid restriction extend life . On the While religious fasts are partaken primarily for spiritual purposes, they also have the potential to greatly affect one's physical health. Accordingly, the health effects of religious fasting have recently been the subject of scientific inquiry, with most of the research being performed in the last two decades. The following religious fasting periods are featured in this review: 1) Islamic Ramadan; 2) the three principal fasting periods of Greek Orthodox Christianity ; and 3) the Biblical-based Daniel Fast. The reason for the inclusion of these specific forms of religious fasts and the exclusion of others is that, to our knowledge, these are the only fasts about which scholarly research has been performed that explicitly detailed the subjects' dietary intake and health-related outcomes. Specifically, this review will examine the effects of these fasts on energy and nutrient intake, anthropometry, hematometry, blood pressure, and other health-related biomarkers. This paper concludes with a summarization of the findings and suggestions for future research.Each year, millions of Muslims refrain from eating or drinking from sunrise (Sahur) to sunset (Iftar) during the holy month of Ramadan, which lasts between 28 and 30 days. Thus, Ramadan fasting is similar to ADF, because both fasts incorporate feast periods and fast periods. The feast periods and fast periods of Ramadan fasting are each 12 hours in length on average , which aThe common dietary practice of Ramadan fasting is to consume one large meal after sunset and one lighter meal before dawn , but somUpon reaching puberty, all healthy Muslims are required to partake in the fast. Individuals who are sick, traveling, pregnant, breast-feeding, menstruating, or debilitated are exempt from fasting ,19. HoweDue to the fact that the Islamic calendar (Hijra) is a lunar calendar, the first day of Ramadan advances 11 days each year in relation to the Gregorian calendar. Consequently, Ramadan falls on different parts of the seasonal year over a 33-year cycle. This seasonal shift dramatically impacts the amount of daily fasting time that occurs in any given location. Moreover, a location's latitudinal distance from the equator also substantially impacts daily fasting time. While the average fast period during Ramadan is 12 hours in length , it can The variability in daily fasting time is one of several confounding variables that influence the effect of Ramadan fasting on health-related biomarkers. Other confounding variables include smoking status, medication, diet, and cultural habits -24. SmokFew definitive conclusions can currently be made regarding the effects of Ramadan fasting on human health, because the collective body of research has noted mostly heterogeneous findings regarding both dietary intake and health-related outcomes. The above-listed confounding variables in studies of Ramadan fasting - particularly the dietary norms of the subjects - are likely the main causes of these heterogeneous findings.As mentioned above, the majority of findings related to energy and macronutrient intake during Ramadan fasting are mixed. A summary of available findings pertaining to daily energy intake as well as the percentage intake of carbohydrate, protein, and fat is presented in Table Aside from macronutrients, vitamins and minerals are generally consumed in similar amounts during Ramadan. Examples include: thiamin ; niacin Mixed findings exist regarding the intake of sodium and fiber during the fast. Regarding sodium, studies reported either decreased consumption  or no chCollectively, the literature indicates that dietary changes pertaining to kcal intake, as well as macro- and micro-nutrient intake, may or may not differ over the period of Ramadan. These differences, or lack thereof, may be responsible for the discrepancies in health-related outcomes across studies.Regarding anthropometric variables, body mass index (BMI) may or may not decrease in response to Ramadan fasting. See Table The majority of findings related to total cholesterol, low density lipoprotein cholesterol (LDL-C), and high density lipoprotein cholesterol (HDL-C) are mixed. See Table Heterogeneous findings have been noted regarding other biochemical outcomes during Ramadan fasting, including blood triglyceride and blood glucose levels. See Table Little consensus exists regarding blood count outcomes during Ramadan. Hematocrit has been reported to either decrease ,30, incrTwo studies to date have examined the effects of Ramadan fasting on oxidative stress and antioxidant status. Ibrahim and coworkers  observedThere are mixed results regarding the effects of Ramadan fasting on blood pressure. Studies have reported that neither resting systolic pressure nor resting diastolic pressure changes during the fast ,41, but To summarize, little consensus exists regarding the effects of Ramadan fasting on the majority of health-related outcomes. Many of the discrepancies regarding findings are likely due to differences between studies in daily fasting time, smoking status, medication consumption, and/or dietary norms. Although most manuscripts report daily fasting time, many do not report one or more of the other confounding variables. Future research should be designed so as to eliminate - or minimize the effect of - as many confounding variables as possible. For example, future studies should likely exclude smokers from the subject population so that the effects of daytime smoking cessation are not conflated with the effects of the fast itself. Alternatively, smokers should be allocated to a separate group of fasters, which may then be compared to non-smokers undergoing the fast. The same care should be taken to control for other potential confounding variables, as only through such careful control within the research design will reliable results pertaining to the health effects of Ramadan fasting be obtained.th and Palm Sunday. During the Assumption (15 days), fasters abstain from dairy products, eggs, and meat. Also, fasters abstain from olive oil on weekdays during this period and abstain from fish every day except for August 6th. In addition to these principal fasts, every Wednesday and Friday that falls outside of a principal fasting period calls for the proscription of cheese, eggs, fish, meat, milk, and olive oil. Exceptions to these proscriptions occur on the week following Christmas, Easter, and the Pentecost. Collectively, dietary consumption is restricted for 180 - 200 days each year. The Greek Orthodox Christian diet consists largely of bread, fruits, legumes, nuts, seafood, snails, and vegetables during fasting periods [There are three principal fasting periods for Greek Orthodox Christians. During the Nativity fast (40 days), fasters abstain from dairy products, eggs, and meat every day. Also, fasters abstain from fish and olive oil on Wednesdays and Fridays during this period. During Lent (48 days), fasters abstain from dairy products, eggs, and meat every day. Additionally, fasters abstain from olive oil on weekdays during this period and abstain from fish every day except for March 25 periods . This diDaily kcal intake may or may not decrease during the fasting periods -46. In t12 may or may not decrease during Greek Orthodox Christian fasting [In terms of vitamin and mineral intake, both riboflavin  and calc fasting ,44,46.In terms of anthropometric outcomes, BMI may or may not decrease during fasting periods ,46. AlsoRegarding biochemical outcomes, both total cholesterol and LDL-C levels decrease during fasting periods ,43,46. OSarri and coworkers compared other hematological changes in fasters and non-fasters during the Christmas fasting period : the autThere are conflicting findings on the effects of Greek Orthodox Christian fasting on blood pressure. One study found that systolic blood pressure increased during fasting periods , while aAlthough no study to date has examined oxidative stress in response to Greek Orthodox Christianity fasting, a recent study measured serum antioxidant levels before and after the Nativity fast . This inIn sum, Greek Orthodox Christian fasting appears to lower body mass. Carbohydrate intake appears to increase, while the intake of protein, total fat, saturated fat, and trans fatty acids decrease during fasting periods. Both total and LDL-C decrease, although the LDL-C/HDL-C ratio does not appear to change. Fiber intake increases during fasting periods, which may partly explain the change in serum lipids. The intake of most vitamins and minerals does not appear to change during these periods, although riboflavin and calcium intake each appear to decrease, and magnesium intake appears to increase. Also, one investigation reported increases in serum retinol and serum \u03b1-tocopherol. More research remains to be performed on hematological variables and blood pressure during fasting periods due to both the lack of previous research and the mixed findings. Moreover, given that each fasting period has unique durations and dietary precepts, future research should examine these fasting periods both separately and collectively.ad libitum intake of specific foods, but the food choices are restricted to fruits, vegetables, whole grains, legumes, nuts, seeds, and oil. This plan resembles a vegan diet, which has been reported to yield health-enhancing properties [A popular fast practiced by Christians, the Daniel Fast derives from the Biblical story of Daniel (1:8-14 NIV), in which Daniel resolved not to defile himself with the royal food and wine and requested permission to consume nothing but vegetables (pulse) and water for 10 days. Later in the same book (Daniel 10:2-3 NIV), Daniel again followed a 21 day period of fasting, during which time he ate no choice food (meat or wine). Based on these two passages, a modern day Daniel Fast involves operties ,49.Like Greek Orthodox Christian fasting, the Daniel Fast may be viewed as a form of DR. However, unlike the Greek Orthodox Christian fasts, or a simple vegetarian diet, a Daniel Fast is much more stringent; this is because refined foods, white flour, preservatives, additives, sweeteners, flavorings, caffeine, and alcohol are each forbidden. Nonetheless, because individuals traditionally follow the Daniel Fast for strict religious purposes in an attempt to become closer to God during a time of extended prayer, anecdotal reports and preliminary scientific study have indicated excellent compliance. The Daniel Fast is most commonly partaken for 21 days, although longer  and shorter  fasts have been observed. While the Daniel Fast can be partaken at any time of the year, it is often practiced during the month of January in order to begin the New Year through fasting and prayer.To test the health benefits of the Daniel Fast within a laboratory-based protocol, we recently enrolled men and women of varying age (20-62 yrs) into a 21-day Daniel Fast . Pre andWe noted excellent compliance to the fast (> 98%), as well as both excellent results for overall mood and satiety . As expected, a reduction was noted in the following variables from the seven days prior to starting the fast to the final seven days of the fast: total kcal, protein, total fat, saturated fat, trans fat, and cholesterol. Also, an increase was noted in the following: carbohydrate, fiber, and vitamin C.-1). Although body weight and body fat were reduced slightly, no significant difference was noted. In regards to measures of blood antioxidant status and oxidative stress, a significant increase was noted in Trolox Equivalent Antioxidant Capacity and nitrate/nitrite (a surrogate marker of nitric oxide), while a significant decrease was noted in MDA (manuscript in progress).The following variables related to cardiovascular disease risk were significantly lower following the fast as compared to before the fast: total cholesterol, LDL-C, SBP, and DBP. Insulin, HOMA-IR, and C-reactive protein were all lowered to a clinically meaningful extent, but this decrease failed to reach statistical significance. Due to the drastic decrease in total cholesterol (~19%), HDL-C was lower after the fast as compared to before the fast  increase, while no changes occur regarding the intake of monounsaturated fat as well as most vitamins and minerals. To date, only a few investigations have examined the health-related effects of these fasting periods. Clearly, more work remains to be performed, particularly regarding hematological and blood pressure variables. Also, each principal fasting period should be studied both separately and aggregately due to their differences in food proscriptions and durations.Only one study to date has examined the health-related effects of a Daniel Fast. This study reported meaningful improvements in blood pressure, blood lipids, and biomarkers of oxidative stress. Moreover, insulin, HOMA-IR, and C-reactive protein were all lowered to a clinically meaningful extent. However, the study also noted an undesirable lowering of HDL-C. Future work should modify food choices in an effort to maintain HDL-C. Also, future research should examine the tolerability and health-related effects of partaking in a Daniel Fast for longer durations.quality dietary intake in eliciting favorable effects on health. Both the Daniel Fast and the Greek Orthodox Christian fasts are associated with many favorable health outcomes despite the fact that fasters can eat as much as they desire. On the other hand, whether or not Ramadan fasting elicits favorable health outcomes appears to greatly depend on the food choices of the fasters. This is not to suggest that the quantity of food intake has no bearing on health; hundreds of studies have demonstrated the virtue of restricting kcal consumption [Collectively, the religious fasts featured in this review emphasize the importance of sumption . Rather,Diet plays an integral role in the religious customs of a variety of faiths. For many religions, this role is manifested in the form of specialized fasting periods. Although religious fasting is often a time of great spiritual growth, it can also be a time of great improvement to one's physical health. This review highlights the potential of different religious fasts as forms of dietary modification. It is our hope that the information provided within this review will initiate the design and performance of future investigations focused on the health benefits of religious fasting.The authors declare that they have no competing interests relative to the material presented within this article.JFT was chiefly responsible for reviewing the relevant literature and writing this article. RJB provided the article outline and assisted with the writing and editing of this article. Both authors read and approved the final manuscript."}
{"text": "After simple geometric and atmospheric correction, we found a significant relationship  between in situ measured TSM concentrations and MODIS band normalization difference of band 3 and band 1. From this, we retrieved TSM concentrations in eight regions of Lake Taihu in 2007 and analyzed the characteristic distribution and variation of TSM. Synoptic maps of model-estimated TSM of 2007 showed clear geographical and seasonal variations. TSM in Central Lake and Southern Lakeshore were consistently higher than in other regions, while TSM in East Taihu was generally the lowest among the regions throughout the year. Furthermore, a wide range of TSM concentrations appeared from winter to summer. TSM in winter could be several times that in summer.Although there has been considerable effort to use remotely sensed images to provide synoptic maps of total suspended matter (TSM), there are limited studies on universal TSM retrieval models. In this paper, we have developed a TSM retrieval model for Lake Taihu using TSM concentrations measured  It determines the transparency of water and can also serve as a transport medium for various pollutants , e.g., hWith the development of remote sensing technology, satellite estimates of water quality significantly complement conventional monitoring techniques and have found widespread applications. Remotely sensed monitoring of TSM started in 1974 using ERTSA data . Since tFor water quality management of large lakes like Lake Taihu, a severely eutrophic lake, it is essential to quickly and accurately understand the dynamic variations in water quality. TSM monitoring from remote sensing in Lake Taihu has been studied for many years, and the methodologies used can be divided into three types: (1) analytical methods, also referred to as bio-optical algorithms, in which reflectance spectra are simulated by theoretical formulas based on the specific inherent optical properties of substances in the water ,9; (2) eIn this paper, Lake Taihu was selected as the study area, and a common yearly-scaled TSM retrieval model is developed. Synoptic maps of TSM in 2007 are obtained using this model, and the characteristic temporal and spatial variability of TSM is analyzed. In addition, considering that atmospheric correction is essential, especially for multi-temporal MODIS images, a simple but effective image-based relative radiometric normalization method is presented. The significance of this study is that it is the first attempt to establish a common TSM retrieval model for practical application in Lake Taihu.2.2. It is a shallow lake, with mean depth 1.9 m, and maximum depth 2.6 m at a water surface elevation of 3.0 m above sea level. The Lake Taihu drainage basin (Microcystis spp.) have occurred frequently, which badly affects the function of the lake as a drinking water supply. More efficient water quality monitoring of the lake is urgently needed [Lake Taihu is located in eastern China between 30\u00b0 55\u2032 40\u2033 N and 31\u00b0 32\u2032 58\u2033 N, and 119\u00b0 52\u2032 32\u2033 E and 120\u00b0 36\u2032 10\u2033 E. It is the third largest freshwater lake in China, with a total water area of about 2,338.11 kmge basin  is the my needed .3.3.1.in situ measurements were carried out once a month in 2005 by the Taihu Ecosystem Research and Field Observation Station, Chinese Academy of Sciences . Twenty-eight sampling sites were selected, which were considered representative of surface distributions of TSM encompassing the whole of Lake Taihu. February, May, August and November water samples were collected at all 28 sampling sites, while in the other eight months the field survey was only conducted at 13 sites, mainly located in the north part of Lake Taihu. The distribution of the 28 sampling stations in Lake Taihu is shown in TSM TSM concentrations were measured by filtering the water samples (taken from 0.5 m below the water surface) on Whatman Grade GF/F filters, which were dried and weighed on an electronic balance.3.2.MODIS images provide high radiometric sensitivity (12 bit) in 36 spectral bands from 0.4 \u03bcm to 14.4 \u03bcm in wavelength. The spatial resolution is 250 m for bands 1\u20132, 500 m for bands 3\u20137, and 1,000 m for bands 8\u201336. As mentioned above, numerous studies have demonstrated that MODIS has the potential for use in water quality monitoring. In particular, the MODIS 250 m and 500 m bands, centered at 469 nm (b3), 555 nm (b4), 645 nm (b1) and 858 nm (b2), can provide sufficient sensitivity for water applications [MODIS-Terra level 1B calibrated radiance products, with spatial resolutions of 250 m and 500 m, covering the region of interest in the middle November of 2003 and the whole of 2005 and 2007 were downloaded via the web interface of the Level 1 and Atmosphere Archive and Distribution System (LAADS) of the National Aeronautics and Space Administration (NASA). MODIS images from 2005 were obtained for days corresponding to field measurements of TSM, and the time difference between the field measurements and MODIS images was no more than three days. Because of cloud coverage over the target no appropriate images were available for March and June of 2005. Two cloud-free MODIS images from every month (except June) in 2007, were downloaded to analyze the distribution variation of TSM in Lake Taihu.(1) Geometric correctionEach image was geo-referenced based on the WGS 84 UTM zone 51 North coordinate system. The 500 m resolution images were resized to 250 m using the nearest neighbor resampling method during geo-referencing.(2) Atmospheric correctionBesides the changes in target reflectance, changes in satellite sensor calibration, differences in illumination and observation angles, and variations in atmospheric effects can induce variation in a sensor\u2019s response to a given target over time. Therefore, to detect the actual changes in ground target from the total signal measured at the spacecraft sensor, atmospheric correction is necessary. Two types of atmospheric corrections, absolute correction and relative correction, are commonly employed to normalize remotely sensed images for time-series inter-comparison \u201317. Absoet al. [band1R and band2R are the radiance of band 1 and band 2 respectively. These PIFs are mainly situated in the new industrial zone around Taihu Lake, such as Changzhou National Hi-tech District, Wuxi Economic District and Suzhou National Hi-tech District. The other set of PIFs is located in clean sea, where water quality is good and little influenced by TSM. Following the normalization procedure of Du, these two screened PIFs sets were achieved. After identifying the PIFs centers in the density map, the normalization regression line is obtained as that intersecting these two PIFs centers. The last step is to recalculate the target image pixel values based on the normalization regression function. Now, the target image has been normalized to the scale of the base image [A variety of relative radiometric correction techniques have been developed , most ofet al.  developeet al.  developeet al.  proposedet al. , and theet al. . Assumptet al. ,24. Ther3.3.in situ measured TSM concentration data in 2005. All 166 data pairs were used for the development of the TSM retrieval model, and another 16 data pairs from 2003 were used for model validation.In total, there were 166 pairs of radiometric normalized MODIS radiance data and \u22121) to atmospherically corrected MODIS band data. This included single band (band 1\u20134) and band combinations . The best fitting model was selected to map the temporal and spatial variability of TSM in 2007.Instead of using a sophisticated optical model, simple linear and non-linear models  were used to correlate TSM concentration (mg L4.\u22121) and MODIS single band, band difference, band ratio and band normalized difference, showing that the last two models performed better than the first two models in terms of R and standard error. Comparison between in situ measured TSM and model-estimated TSM from the last two models using both the 166 data pairs for model development and the 16 data pairs for model validation is shown in Finally, the synoptic maps of TSM concentrations in 2007 were obtained see , which r\u22121; Meiliang Bay, Western and Eastern Lakeshore also show relatively high TSM concentrations; while there is good water quality in East Taihu and Zhushan Bay, with the maximum TSM concentrations being <100 mg L\u22121. Moreover, the variation ranges of TSM concentration in the open areas are much larger than in the bays, and the minimum variation range is located in East Taihu due to the sheltered environment and dense hydrophytes. Furthermore, obvious seasonal variations in TSM are also characterized in the lake. The water body of Lake Taihu is divided into eight water regions. These include Meiliang Bay (MB), Zhushan Bay (ZB), Gonghu Bay (GB), Central Lake (CL), Western Lakeshore (WL), Southern Lakeshore (SL), East Taihu (ET) and Eastern Lakeshore (EL) . Figure 5.5.1.\u22121) and relatively corrected MODIS Terra band 1 data used in this study  and TSM [a concentration is >10 \u03bcg L\u22121, there are an absorption peak and a reflectance peak in 672 nm and 695 nm respectively [a strongly absorb spectrum in the blue region (440 nm). Hence MODIS band 3 data (blue band reflectance) could assist band 1 data (red band reflectance) to weaken the influence from chlorophyll a and CDOM.A significant  relationship was observed between TSM concentration  measured in situ and relatively corrected MODIS Terra band 1 data, which is consistent with the conclusions of other studies. The model performance analysis indicated that this empirical model could map TSM concentrations successfully except when TSM concentration is higher than 200 mg L\u22121. The temporal and spatial distribution of TSM concentrations in Lake Taihu from January to December 2007 revealed that Central Lake and Southern Lakeshore are characterized by extremely high TSM concentrations, and there is good water quality in East Taihu. The variation range of TSM concentration in the open area is much larger than that in the bays, affected by higher wind velocities in the open area. The minimum variation range is located in East Taihu due to the sheltered environment and dense hydrophytes. On the whole maximum TSM concentrations appear in winter and the minimum appear in summer. This pattern is notable in the Central Lake, but very weak in East Taihu.The common model retrieving TSM concentration showed that a significant  relationship was observed between TSM concentrations (mg Li.e., the slope of the regression line, It should be noted that the approach developed in this study could be applied to other inland regions, but the specific relationship between TSM concentration and MODIS data ("}
{"text": "The metabolic syndrome (MetS), in addition to its lipid, metabolic, and anthropomorphic characteristics, is associated with a prothrombotic and the proinflammatory state. However, the relationship of inflammatory biomarkers to MetS is not clear.To study the association between a group of thrombotic and inflammatory biomarkers and the MetS.Ten conventional MetS risk variables and ten biomarkers were analyzed. Correlations, factor analysis, hexagonal binning, and regression of each biomarker with the National Cholesterol Education Program (NCEP) MetS categories were performed in the Family Heart Study .Subjects in the top 75% quartile for plasminogen activator inhibitor-1 (PAI1) had a 6.9 CI95 [4.2\u201311.2] greater odds (p < 0.0001) of being classified with the NCEP MetS. Significant associations of the corresponding top 75% quartile to MetS were identified for monocyte chemotactic protein 1 , C-reactive protein , interleukin-6 , sICAM1 (OR = 1.61), and fibrinogen (OR = 1.86). PAI1 correlated significantly with all obesity and dyslipidemia variables. CRP had a high correlation with serum amyloid A (0.6) and IL6 (0.51), and a significant correlation with fibrinogen (0.46). Ten conventional quantitative risk factors were utilized to perform multivariate factor analysis. Individual inclusion, in this analysis of each biomarker, showed that, PAI1, CRP, IL6, and fibrinogen were the most important biomarkers that clustered with the MetS latent factors.PAI1 is an important risk factor for MetS. It correlates significantly with most of the variables studied, clusters in two latent factors related to obesity and lipids, and demonstrates the greatest relative odds of the 10 biomarkers studied with respect to the MetS. Three other biomarkers, CRP, IL6, and fibrinogen associate also importantly with the MetS cluster. These 4 biomarkers can contribute in the MetS risk assessment. Metabolic syndrome (MetS) is a cluster of physiologic markers that includes obesity, insulin resistance, dyslipidemia, and hypertension. The National Cholesterol Education Program ATP III (NCEP) considers a proinflammatory and prothrombotic state as characteristic of metabolic syndrome (MetS) . A groupInflammation and thrombosis are considered to influence the pathogenesis of coronary heart disease. Inflammation in general is associated with increased levels of leucocytes, fibrinogen, and C reactive protein (CRP) as well as other biomarkers. For example, Interleukin-6 (IL6) is considered an important inducer of the hepatic secretion of CRP. Plasma levels of IL6 and CRP have been reported to predict type 2 diabetes in humans . It is aet al.[et al.[et al.[et al.[et al.[Although several studies have used multivariate factor analysis as a tool for characterizing MetS clusters of risk variables -11, onlyet al. studied et al. commentel.[et al. showed tl.[et al. . Their combinations in a multivariate factor analysis generated factors of MetS. A subgroup of the conventional variables in our study represented the set of the variables utilized to qualitatively characterize MetS . Consequently, the 10 conventional variables served as a representative construct for MetS. Adding ten prothrombotic and proinflammatory biomarkers in the study provided an ample vision to assess the role of ten biomarkers in the MetS cluster.We studied ten conventional MetS risk variables in the NHLBI Family Heart Study  was recruited through 2002\u20132003 at five centers. Details of this study are reported elsewhere [The NHLBI Family Heart Study (FHS-Time 2) is a family-based study that investigates genetic and non-genetic causes of coronary calcification, atherosclerosis, and cardiovascular risk factors during a 2lsewhere ,17. The 2), waist circumference , waist to hip ratio (WHR), percent body fat (PBF), fasting (\u2265 12 hours) glucose , high density lipoprotein cholesterol , tryglicerides , low density lipoprotein cholesterol , and systolic  and diastolic blood pressure . PBF was measured as the bioelectric impedance of the body and was calculated based on the Lukaski formula [Ten MetS conventional risk variables were studied: body mass index , fibrinogen, interleukin-2 soluble receptor alpha (IL2SR), IL6, monocyte chemotactic protein 1 (MCP1), matrix metalloproteinase (MMP3), PAI1, serum amyloid A (SAA), and soluble intercellular adhesion molecule 1 (sICAM1) (Table CRP (mg/l) was measured using the BNII nephelometer from Dade Behring utilizing a particle enhanced immunonepholometric assay. Intra-assay coefficient of variation (IACV) ranged from 2.3 \u2013 4.4% and inter-assay coefficient of variation (IRCV) ranged from 2.1 \u2013 5.7%.DDIMER (ug/ml) was measured using an immuno-turbidimetric assay  on the Sta-R analyzer (Stago) [ (Stago) .Fibrinogen (mg/dl) concentrations were quantified by the STAR automated coagulation analyzer (Diagnostica Stago), and the clotting method of Clauss [f Clauss . In thisIL2SR (pg/ml) was measured by ultra-sensitive ELISA  [lis, MN) . IACV waIL6 (pg/ml) a pro-inflammatory cytokine was measured by ultra-sensitive ELISA  [lis, MN) . The IRCMCP1 (pg/ml) was measured using an ultra-sensitive ELISA assay . The sample type used was citrated plasma. The IACV and IRCV ranged 4.7\u20137.8% and 4.6\u20136.7% respectively.MMP3 (ng/ml) was measured by an ultra-sensitive, solid-phase sandwich ELISA using a polyclonal antibody specific for both the pro- and active forms of MMP-3  Immunoassay; R&D Systems, Minneapolis, MN). The IACV and IRCV ranged from 5.7\u20136.4% and 7.0\u20138.6%, respectively.PAI1 (ng/ml) assay is sensitive to free PAI1 (both latent and active), but not PAI1 in complex with t-PA. It is done as a two-site ELISA. The analytical CV for this assay was 3.47% [as 3.47% -25.SAA (mg/l) was measured with the BNII nephelometer from Dade Behring utilizing a particle enhanced immunonepholometric assay . IACV ranged from 4.3\u20136.2% and IACV ranged from 2.8\u20134.7%.sICAM1 (ng/ml) was measured by an ELISA assay . The laboratory CV was 5.0% [was 5.0% ,27.MetS categories beyond the NCEP defined thresholds in a subject, was considered as a clinical expression of the NCEP MetS: Abdominal obesity, given as large WAIST for men >102 cm and > 88 cm for women; high fasting GLUC \u2265 110 mg/dl or medication for diabetes; high TG \u2265 150 mg/dl; low HDLC < 40 mg/dl in men or < 50 mg/dl in women; high blood pressure (SBP/DBP) \u2265 130/\u2265 85 mm Hg or antihypertensive medication use [A grouping of at least any 3 of the 5 following Variables of interest were expressed as mean \u00b1 SD Table . In addiFACTANAL function, with the maximum likelihood estimate option and the \"Varimax\" rotation, in Splus version 6.2 of Insightful Corp., Seattle, WA. This method was performed first on 10 conventional MetS risk variables. After, one biomarker was added in the analysis, subject to the sample sizes available, to discover any cluster of each biomarker onto the identified latent factors. The acceptance of an extra factor in the model was made by applying two general rules, the p-value of the model had to be < 0.05, and the last factor had to have at least two contributing risk variables (with a contributing coefficient about 0.4 or above). We stopped beyond the 5-th factor because the additional factors represented only single variables. The contributing coefficients for the standardized variables correspond to correlation coefficients of the original risk variables to the latent factors. A contributing coefficient value in the tables greater/equal to 0.4 was highlighted in bold and is considered as having a substantial influence on the factor. In advance to factor analysis, distributions of all risk variables were checked for their fit to a normal distribution. Variables BMI, WHR, HDLC, TG, CRP, DDIMER, fibrinogen, IL2SR, IL6, MCP1, MMP3, PAI1, SAA, and SICAM1, were natural log transformed. GLUC was expressed as the inverse of a power transformation (1/GLUC2). Risk variables went also through covariate adjustments, in a stepwise regression in SAS v. 9.1.3 for Linux OS, for age, age2, age3 and recruitment center, within gender. The residuals were standardized to mean 0 and variance 1.First, the multivariate factor analysis was performed with the Second, Pearson correlations were produced on the above preprocessed data, by using the PROC CORR of SAS Table .Third, a binary association between the PRESENCE/ABSENCE of a participant in the top 75% quartile, as well as in the 50% of the data for each biomarker and if CLASSIFIED/NOT with MetS was evaluated through logistic regression (PROC LOGISTIC of SAS).Appendix.In addition, a graphical technique named \"hexagonal binning\" was implemented . For its25) and 75% quartile (q75) , IL6 (0.49), dyslipidemia, even with SBP and DBP, reaching almost the lowest but still significant correlation with fibrinogen Table . CRP hadThe above correlation matrix reflected in the results of factor analysis. The factor analysis with \"Varimax\" rotation on the 10 conventional risk variables produced 4 latent factors. The first factor was a contribution of BMI, WAIST, PBF, and more modest contributions of WHR and GLUC. The second factor was mostly SBP and DBP contributions. The third factor was contributed by TG, HDLC, with less contribution of GLUC, LDLC, and PBF. The last factor represented a contribution of WHR and WAIST. The MetS cluster of latent factors explained about 60% of the total variance of the conventional risk variables.Figure Statistical analysis in the Methods section). A red color annotates PAI1 values above the 75th PAI1 percentile; a green color annotates PAI1 values below the 25th percentile; and a black color annotates the 50% central data of PAI1 distribution. The locations of these points in Figure Figure Appendix, and Figures 2 or greater). Of them, from the BMI top 75% percentile only a subset, 16.3% classified with MetS. Another 18% of the data, located in the BMI central 50%, classified with MetS. PAI1 showed a similar pattern as BMI. PAI1 fitted regression line intersected with the 75% quartile line at the graphical point of 3 MetS categories, confining 17.1% of the sample with MetS, and an additional 15.7% with MetS between q25 and q75 lines. Differently, the CRP fitted regression line intersected with the CRP top 75% quartile line at the graphical point of 1 MetS NCEP category. At CRP values 4.2 mg/l or greater, 11.8% of the sample were classified with MetS. A subsample (20.7%) classified with MetS was represented by participants having CRP values between q25 and q75 lines. IL6 and fibrinogen respectively confined 13.2% and 11.6% of the sample, with MetS and placed at the top biomarkers' 75% percentiles. In contrast, DDIMER and MMP3 had flat regression lines.The other graphical technique employed by us to better understand relationships of MetS NCEP categories and biomarkers is hexagonal binning. This technique helps visually to better investigate the predictive evidence of biomarkers to the NCEP MetS categories  and comparable with BMI odds  when participants were in the top 75% quartile and classified as having the NCEP MetS. Other biomarkers MCP1 , CRP , IL6 , sICAM1 , and fibrinogen  had also significant odds for participants being in the top 75% quartile of the biomarker distribution and classified as having the NCEP MetS. The association of biomarker values per participant within the corresponding central 50% of the data and being classified with MetS, was significant only for CRP .et al.[et al.[et al.[et al.[et al.[Inflammation, procoagulation and fibrinolysis biomarkers have been recently hypothesized to be associated with MetS  and the et al. and in tl.[et al., and in l.[et al.. PAI1 wal.[et al.. PAI1 prl.[et al., and of l.[et al.. Similarl.[et al.. PAI1 isl.[et al.-37. Tranl.[et al.. Transgel.[et al.. Smith el.[et al. concludel.[et al.. Skurk al.[et al. reviewedl.[et al. studyinget al.[et al.[et al.[et al.[et al.[et al.[A large number of studies have scrutinized the role of CRP. Bassuk et al., Ridker l.[et al., and Bial.[et al. summarizl.[et al. argued tl.[et al. who founl.[et al.) and 0.5l.[et al.) with fiAnother interesting biomarker with significant findings in our data was IL6. On severe exercise, IL6 is released in large quantities from the skeletal muscle . IL6 hassICAM1 is an important adhesion molecule and is implicated to mediate the firm adhesion of leukocytes into endothelium . sICAM1 et al.[It has been hypothesized that a chronic, mild inflammatory state is the ground of MetS. Besides, Dancan and Schmidt  suggesteet al. showed tet al..To our surprise, LDLC was not a good measure of the relationships with the biomarkers studied. Its correlation coefficients with biomarkers were practically insignificant. Therefore, we would suggest that future studies of MetS use HDLC and TG as more reliable measures for the lipids component.Our study has also limitations. We studied only 10 biomarkers. Their sample size depended on the cost of the biochemical assays. We have previously reported that about 25% of the FHS Time 2 participants studied used anti-hyperlipidemics, and that these medications were a confounder when studying the MetS prevalence . It is kIn conclusions, PAI1 significantly correlated with most of the MetS conventional variables. PAI1 clustered in obesity and lipids factors, and participants in the PAI1 top 75% percentile had higher odds, than other 9 biomarkers, to be classified with MetS. PAI1 is an important risk factor for MetS. Three other biomarkers, CRP, IL6, and fibrinogen associate importantly with MetS cluster. In contrast DDIMER, SSA, and MMP3 did not associate directly with MetS cluster.All authors contributed equally.Metabolic syndrome paragraph in the Methods section). In the hexagonal binning graphs  were classified with MetS. Although a small group of subjects were with BMI less than 25 (q25), they also were classified with MetS. This shows that MetS is not only result of obesity in combination with other components of MetS, but it can also be a hypertension-dyslipidemic-hyperglycemic combination. For the PAI1 biomarker,  were predominantly classified with MetS. In conclusion, hexagonal binning was a spatial graphical attempt to better characterize and understand the contributions of each biomarker studied in relation to MetS NCEP categories.To the best of our knowledge, hexagonal binning is a technique that is not implemented in the epidemiological studies including MetS studies. It is applied in other areas of research, for example, earthquake graphical pattern detections . Its mai"}
{"text": "The metabolic syndrome (MetS) is a cluster of risk factors associated with morbidity from cardiovascular disease (CVD) and associated mortality. Russia has one of the highest CVD mortality rates in the world. However, the prevalence of MetS in Russia remains largely unknown. The aim of this study is to estimate the prevalence of MetS and its components in an urban Russian setting.Altogether, 3705 Russian adults aged 18-90 years were enrolled in a cross-sectional study in Arkhangelsk (Northwest Russia). All subjects completed a questionnaire and underwent a physical examination. Blood samples were taken and analyzed in Troms\u00d8, Norway. Three separate modified definitions of MetS were used, namely, the National Education Cholesterol Education Program Adult Treatment Panel III (NCEP), the American Heart Association/National Heart, Lung and Blood Institute (AHA/NHLBI) and the International Diabetes Federation (IDF). To ensure comparability of the findings, the prevalence data were standardized using world and European standard populations and Russian population.The age-standardized (Segi's world standard population) prevalence rates of the MetS among women were 19.8% (95% CI: 18.1-21.5), 20.6% (95% CI: 18.9-22.3) and 23.1% (95% CI: 21.3-24.9) by the NCEP, AHA/NHLBI and IDF criteria, respectively. The corresponding rates for men were 11.5% (95% CI: 10.1-12.9), 13.7% (95% CI: 12.2-15.2) and 11.0% (95% CI: 9.7-12.4). Among subjects with MetS, central obesity was more common among women, while elevated triglycerides and blood glucose were more common among men. Almost perfect agreement was found between the NCEP and AHA/NHLBI criteria (\u03ba = 0.94). There was less agreement between the used definitions of MetS in men than in women.While the prevalence of MetS among Russian women is comparable to the data for Europe and the U.S., the prevalence among Russian men is considerably lower than among their European and North-American counterparts. Our results suggest that MetS is unlikely to be a major contributor to the high cardiovascular mortality among Russian men. Further studies of MetS determinants and associated cardiovascular risk are needed for a better understanding of the mechanisms leading to the exceptionally high cardiovascular mortality in Russia. MetS is an unfavourable cluster of factors that increases the risk of CVD and type-2 diabetes -3. MetS Internationally, there is no uniform accepted definition of MetS. Altogether, six sets of diagnostic criteria have been proposed by different expert groups. Despite considerable similarity among the definitions, the prevalence of the MetS in the same population may vary dramatically depending on the specific diagnostic criteria considered . This coWhile cardiovascular mortality in Western Europe and the U.S. has decreased during recent decades, the opposite trend has been observed in Russia where it has increased from 412 per 100,000 in 1970 to 927 per 100,000 in 2003. Mortality from cardiovascular diseases in Russia is currently the highest in Europe. In 2003, CVDs accounted for about 56% of all deaths . CoronarGiven that MetS is a strong predictor of cardiovascular mortality and morbidity -6, one mThe aim of the present study is to estimate the prevalence of MetS and its components in an urban Russian setting using several international definitions and reference populations to ensure comparability of the findings.The survey was conducted in 2000 in Arkhangelsk, the capital of the Arkhangelsk Region of Russia. The population of Arkhangelsk prior to the study's initiation was approximately 170,000 men and 197,000 women. The city is ethnically homogenous: 95% of inhabitants are registered as Russians and most of the reminder are ethnically and culturally close to Russians (e.g. 2% of the population are registered as Ukrainians and 1% as Byelorussians).No population register for medical research exists in Arkhangelsk. Primary health care departments provide medical services to the general population within the regional general health and occupational health network. People are registered at polyclinics according to their home address and/or place of work. All study participants when registered at the same out-patient clinic in Arkhangelsk. Of those who were invited, only 40 persons (1.1 %) refused to participate with \"lack of time\" as the primary reason given. Individuals coming for their annual medical check-up at the out-patient clinic were recruited consecutively to avoid the \"healthy volunteer effect\". Workers and students were similarly invited either through the obligatory annual medical examination or through their places of work or study. Pensioners were recruited through the clinic's register. About 90% of males and 70% of females were recruited through an annual medical examination consisting mainly of working people but also students, pensioners and unemployed individuals. Other subjects were invited to the study. Students constituted approximately 12%, pensioners 19%, unemployed 3% and working subjects 66 % of the study population.Altogether, 1968 men and 1737 women aged 18-90 years participated in the study. It involved a physical examination, completion of a comprehensive questionnaire and donating blood for tests. Data were collected by trained medical personnel. The study was approved by the Regional Ethics Committee, Troms\u00d8, Norway. Verbal informed consent was obtained from all participants.Anthropometric measurements included weight, height, waist and hip circumference. Body mass index (BMI) and waist-to-hip ratio (WHR) were calculated. Blood pressure and heart rate were measured (upper right arm) in a sitting position three times at two minute intervals using a semiautomatic electronic device . Averages of the second and third systolic and diastolic blood pressure readings were used in the analysis. In addition, all subjects completed a six-page questionnaire on socio-demographic characteristics, medicines used (including regular intake of antihypertensive and anti-diabetic medications), smoking habit, alcohol consumption, diet and level of physical activity during leisure time and at work. History of cardiovascular diseases and diabetes were assessed by additional questions preceded by \"do you now have or have you ever had\" angina pectoris (AP), myocardial infarction (MI), stroke or diabetes mellitus (DM). Only basic socio-demographic data and self-reported diseases are presented for descriptive purposes in this paper. Age was categorized into five groups: 18-29, 30-39, 40-49, 50-59 and 60+ years. Education was classified as secondary or lower, vocational, incomplete higher, or higher. Income level was very difficult to determine during the year 2000 owing to high inflation and a collapsing economy, with about 30% of the population  having incomes below the survival minimum. ConsequVenous blood samples were drawn in the morning and centrifuged within 15-25 minutes in the laboratory at the study site in Arkhangelsk. Because subjects generally fast in preparation for these annual medical check-ups, since screening for diabetes and impaired glucose tolerance is part of the examination, we assume that most of the study participants indeed fasted. Nevertheless, none of them was directly asked by the study team to fast prior to the medical examination. The serum samples were stored at -20\u00b0C and then transported frozen to Norway where they were kept at -80\u00b0C pending analysis. Total serum cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), serum glucose (SG) and glycosylated hemoglobin (HBA1c) were measured. All laboratory analyses were carried out at the Department of Clinical Chemistry, University Hospital of Northern Norway (UNN) in Troms\u00f8.Enzymatic colorimetric tests were used to measure TC  and TG . HDL-C was measured by a homogenous enzymatic colorimetric test . The coefficients of variation (CV) were, respectively, 5%, 2% and 3% for the TC, TG and HDL-C determinations. All biochemical analyses of serum lipids were performed using a Hitachi 737 analyzer. SG was measured by the hexokinase method using a Hitachi 917 analyzer (CV = 2%). HBA1c concentration was determined using the Bio-Rad Variant II HPLC system with reagents from Bio-Rad Laboratories , with CV <5%. The laboratory routinely participates in formal quality assurance exercises.MetS was defined according to the National Cholesterol Education Program Adult Treatment Panel III (NCEP) , the Ame2 and \u226530 kg/m2, a receiver operating characteristic (ROC) analysis was carried out. Agreement between different diagnostic criteria for MetS was assessed by Cohen's kappa statistic. All analyses were performed using SPSS version 14 .The prevalence estimates were standardized by age using Segi's world standard population, European standard population and Russian population  . The folAmong the 3705 study participants, 150 (4.0%) had missing data on one or more variables and were therefore excluded. The final study group included 1918 men and 1637 women, corresponding to 95% of all those invited.The women were slightly older and were better educated, but had much lower income and a higher prevalence of self-reported diseases than men. The men smoked more and took alcohol more frequently Table .The prevalence of abnormally high components of MetS as well as BMI and WHR increased with age in both genders Table , as did 2 with sensitivity (Se) of 0.35 and specificity (Sp) of 0.99. The WC cut-off \u2265102 cm identified men having BMI \u226530 kg/m2 with a Se of 0.41 and Sp of 0.99. In men of our study setting, the BMI cut-offs of \u226525 kg/m2 and \u226530 kg/m2 corresponded best to WC of \u226584 cm  and 92 cm , respectively. The standard WC cut-offs of \u226580 cm and \u226588 cm applied in women, which corresponded respectively to BMIs of \u226525 kg/m2 and \u226530 kg/m2, were originally characterized by good test properties .The prevalence of obesity Table  varied sThe overall prevalence of the MetS varied with the definition and reference population used Table . StandarUsing the NCEP definition of MetS, hypertension was the most frequent element in both sexes, followed by dyslipidemia Table . The preAlmost three quarters of the men and more than two thirds of the women in the total study sample had at least one MetS component Table . AltogetTo our knowledge, this is the first relatively large study addressing the prevalence of MetS and its components in Russia. While the prevalence of MetS among Russian women is comparable to the European and the USA data, the prevalence among Russian men is considerably lower than among their European and North-American counterparts. The low prevalence rates of MetS combined with the high cardiovascular mortality among Russian men need to be explored in further studies.Assessment of the MetS' burden is the first step towards monitoring the occurrence of the syndrome and developing effective preventive measures for this condition in Russia. The use of different internationally accepted diagnostic criteria and different standardization procedures provide a unique opportunity for comparison with both international and Russian studies. However, the results should be interpreted with caution, taking into account several limitations of the study.The method used to recruit the study population might to a certain degree have resulted in a residual \"healthy worker effect\". Unemployed and marginalized subsets of the population such as alcohol or drug abusers and the homeless were underrepresented. Exclusion of 150 individuals from the sample because of missing values might represent another weakness. However, the prevalence of individual metabolic components in this group did not differ significantly from the group included into analyses.ad hoc definitions of hyperglycemia was relatively fair (kappa = 0.68). However when comparing the MetS rates defined by the NCEP criteria based on these two ad hoc definitions of hyperglycemia, corresponding agreement was very good (kappa = 0.97). Similar results were seen for other definitions . This might be rationalized by the cluster nature of MetS and by the fact that hyperglycemia was the least prevalent metabolic abnormality in both genders. The impact of the latter on the probability of having MetS was minimal.There was a potential for clinical-chemical measurement errors in the study. Glucose was measured in serum, not in plasma. Because serum has a higher content of water, the cut-off point for defining hyperglycemia should be slightly higher. Moreover, we assumed that all blood samples were fasting but this was not ensured. Thus, the estimate of the prevalence of MetS may be inaccurate. To address these methodological problems, we also calculated the prevalence of MetS using two alternative criteria for hyperglycemia. The first criterion involved accepting one of the following: HBA1c \u2265 6.1 %, or self-reported DM, or receiving treatment for high blood sugar. The HBA1c marker reflects the average level of glycemia over the preceding 2'3 months and does not depend on fasting. In this study, HBA1c was measured using a precise and reliable method certified by the US National Glycohemoglobin Standardization Program . An earlThe new estimates obtained by applying these modified criteria were slightly lower than previously described (data not shown), but the agreements between all three estimates were \u22650.95, suggesting that the degree to which the prevalence of MetS was overestimated in this study is small.Our findings on the prevalence of MetS among Russian women are comparable to corresponding studies from Europe -11 and tOnly one research publication was found that examined the prevalence of MetS among Russians . It was A population-based study of men living in Kuopio in Eastern Finland  reportedThe prevalence of MetS in the Arkhangelsk study increased progressively with age. This has also been observed in other studies, but to a lesser extent -11. In o2 and 30 kg/m2. The cut-offs for obesity using WC depend on ethnicity [2 and \u226530 kg/m2 were about 10 cm lower  than the original one  suggesting a lower tendency for central adiposity at a given BMI among the men in our study setting. Similar results were reported from a study of middle-aged eastern Finnish men in the late 1980th [2 and 30 kg/m2. Therefore, the original cut-offs used for WC in NCEP and IDF definitions of MetS may be inappropriate for men living in Northwest Russia. This is an important finding that might largely explain the unequal distribution of MetS by sex. The finding needs further verification.The method used to define obesity  strikingly affected the reported prevalence of this condition in both genders. The variation was particularly striking among men, ranging from 6% to 26% using the WC and WHR definitions, respectively. By contrast, among women, the frequency was highest when obesity was defined by the WC-criteria. The original sex-specific thresholds for WC were originally (at least partly) established in cross-sectional studies from Holland and the UK ,34, usinthnicity . Accordie 1980th . On the The most reasonable explanation for our main findings is the difference in life-style between Russian men and women: women smoked less, had lower alcohol consumption and, what is more important, lower levels of physical activity. In general, Russian women have occupations involving low levels of physical activity at work , whereas men have higher levels of work-related physical activity.Our study did not support the hypothesis that the high burden of cardiovascular morbidity and mortality among Russian men could be attributed to a high prevalence of MetS. A high prevalence of smoking and life-style associated with excessive alcohol consumption and specific drinking patterns may be other contributors to the high cardiovascular morbidity and mortality among Russian men. Alcohol consumption was high in our study population , especiaDifferences in life expectancy between Russian men and women  may contribute to an explanation of the observed differences between genders in the prevalence of MetS , suggestWhile the prevalence of MetS among Russian women is comparable to the data for Europe and the USA, the prevalence among Russian men is considerably lower than among their European and North-American counterparts. Our results suggest that MetS is unlikely to be a major contributor to high mortality from cardiovascular diseases among Russian men. Further studies of determinants for MetS and its components, and MetS and cardiovascular risk are needed for a better understanding of the mechanisms leading to the exceptionally high cardiovascular mortality in Russia.The authors declare that they have no competing interests.OS, AMG and ON drafted the manuscript. ON, TB, VA and SM planned the study and collected the data. OS and TB analyzed the data. All authors read and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/23/prepub"}
{"text": "A major portion of available fatty acids for adipocyte uptake is derived from lipoprotein lipase (LPL)-mediated hydrolysis of circulating lipoprotein particles. In vivo studies aimed at identifying the precise role of adipocyte-derived LPL in fat storage function of adipose tissue have been unable to provide conclusive evidence due to compensatory mechanisms that activate endogenous fatty acid synthesis. To address this gap in knowledge, we have measured the effect of reducing adipocyte LPL expression on intracellular lipid accumulation using a well-established cultured model of adipocyte differentiation.siRNA specific for mouse LPL was transfected into 3T3-L1 adipocytes. Expression of LPL was measured by quantitative real-time PCR and cell surface-associated LPL enzymatic activity was measured by colorimetric detection following substrate (p-nitrophenyl butyrate) hydrolysis. Apolipoprotein CII and CIII expression ratios were also measured by qRT-PCR. Intracellular lipid accumulation was quantified by Nile Red staining.During differentiation of 3T3-L1 pre-adipocytes, LPL mRNA expression increases 6-fold resulting in a 2-fold increase in cell surface-associated LPL enzymatic activity. Parallel to this increase in LPL expression, we found that intracellular lipids increased ~10-fold demonstrating a direct correlation between adipocyte-derived LPL expression and lipid storage. We next reduced LPL expression in adipocytes using siRNA transfections to directly quantify the contributions of adipocyte-derived LPL to lipid storage, This treatment reduced LPL mRNA expression and cell surface-associated LPL enzymatic activity to ~50% of non-treated controls while intracellular lipid levels were reduced by 80%. Exogenous addition of purified LPL (to restore extracellular lipolytic activity) or palmitate (as a source of free fatty acids) to siRNA-treated cells restored intracellular lipid levels to those measured for non-treated controls. We also found that adipocytes express apolipoprotein CII and CIII and, in addition, the apoCII/apoCIII ratio remains largely unchanged in cells with reduced LPL expression.We provide evidence that adipocyte-derived LPL is required for efficient fatty acid uptake and storage, and that adipocytes express their own source of apoCII and apoCIII for regulating extracellular LPL activity. These findings demonstrate that adipocytes are capable of producing the necessary enzymatic components and co-factors for efficient lipid storage independent of vascular sources. The adipocyte plays a crucial role in metabolic regulation, serving as a storage depot for fatty acids and as an endocrine cell to manage energy utilization and feeding behavior ,2. The mThe availability of VLDL-derived fatty acids for energy needs and adipocyte storage is dependent upon hydrolytic activity of lipoprotein lipase (LPL) -6, and tLipoprotein particles that are transported out of the vasculature represent a significant source of fatty acids for adipocyte storage. The release of fatty acids from these particles is likely to be dependent on adipocyte-derived LPL activity. One of our recent studies provides evidence that HSPG found on the surface of adipocytes are essential for lipid accumulation in adipocytes . AlthougAn essential element necessary for this mechanism to be effective is adipocyte-derived LPL activity -27. Stud2 and passaged twice weekly. To differentiate 3T3-L1 cells into adipocytes, cells were incubated with 250 nM dexamethasone, 450 \u03bcM 3-isobutyl-1-methylxanthine, and 167 nM insulin for 2 days, followed by 167 nM insulin for an additional 3 days.3T3-L1 cells were obtained from American Type Culture Collection  and grown in Dulbecco's modified Eagle's medium (DMEM)  supplemented with 10% (v/v) fetal calf serum , 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 2 mM L-glutamine, 100 \u03bcg/ml streptomycin sulfate, and 100 units/ml penicillin. Cells were cultured at 37\u00b0C with 10% CO\u00ae pre-designed small interfering RNA (siRNA) directed toward mouse lipoprotein lipase (LPL) was synthesized by Ambion Inc. . The target sequence for the siLPL is on exon 2, with a sense sequence of GCAAAUUUGCCCUAAGGACtt and an antisense sequence of GUCCUUAGGGCAAAUUUGCtt. Cells were transfected with siRNA (100 nM) using DharmaFECT\u2122 3 transfection reagent according to the manufacturer's specific protocol for 3T3-L1 cells . Total RNA was purified from cells using RNeasy  and converted to cDNA using TaqMan Reverse Transcriptase . LPL, leptin, apoCII, apoCIII, and \u03b2-actin expression levels were measured by quantitative Real Time PCR analysis (qRT-PCR) of cDNA samples. Primers specific for LPL [GenBank:NM_008509] were designed to amplify 231 base pairs flanking intron 4. Primer sequences for LPL were: upstream, CTGCTGGCGTAGCAGGAAGT; downstream, GCTGGAAAGTGCCTCCATTG. Primers specific for leptin [GenBank:NM_008493] were designed to amplify 213 base pairs flanking intron 2. Primer sequences for leptin were: upstream, TGACACCAAAACCCTCATCA; downstream, TCATTGGCTATCTGCAGCAC. Primers specific for apoCII [GenBank: NM_009695] were designed to amplify 147 base pairs flanking intron 2. Primer sequences for apoCII were: upstream, GCAGGGCTCCCTCTTAAGTT; downstream, AAAATGCCTGCGTAAGTGCT. Primers specific for apoCIII [GenBank: NM_023114] were designed to amplify 99 base pairs flanking intron 3. Primer sequences for apoCIII were: upstream, GGCTGGATGGACAATCACTT; downstream, TGGTTGGTCCTCAGGGTTAG. Primers specific for \u03b2-actin [GenBank:NM_007393] were designed to amplify 287 base pairs flanking intron 3. Primer sequences for \u03b2-actin were: upstream, CCTGAACCCTAAGGCCAACC; downstream, CAGCTGTGGTGGTGAAGCTG. qRT-PCR was performed using ABsolute QPCR SYBR Green Mix  with the following cycling parameters: 1 cycle, 95\u00b0C, 15 min; 40 cycles, 95\u00b0C, 15 sec, 60\u00b0C, 1 min. \u03b2-actin mRNA levels were measured in parallel with identical cycling conditions and used to normalize values obtained for LPL, leptin, apoCII, and apoCIII expression. Relative quantitation was performed using the comparative CT method. For this analysis, the amount of target message  was normalized to the internal reference (\u03b2-actin) and compared to the calibrator .Purified Silencer\u00ae .For straight RT-PCR reactions of leptin, apoCII, apoCIII and \u03b2-actin, isolated mRNA was reverse transcribed as described above and cDNA amplification was performed using TaKaRa Ex Taq\u2122  with the following cycling parameters: 1 cycle, 95\u00b0C, 2 min; 40 cycles, 95\u00b0C, 30 sec, 60\u00b0C, 30 sec, 72 \u00b0C 1 min. Amplified products were separated on 3% agarose gels and stained with Gel Star-1cm-1.Cells, grown in 6-well plates, were rinsed twice with phosphate buffered saline, pH 7 (PBS), and incubated with 200 \u03bcg/ml heparin  prepared in PBS for 15 min at 25\u00b0C. Following incubation, the heparin solution was centrifuged  to remove cell debris and mixed with an equal volume of 2 mM p-nitrophenyl butyrate (PNPB). Absorbance at 405 nm was recorded following a 10 min incubation using a Genesys UV Spectrophotometer. LPL activity is reported as the amount of p-nitrophenol product formed over the 10 min incubation. The molar extinction coefficient of p-nitrophenol at 405 nm is 11,000 MPalmitate , purified bovine LPL, and fatty acid-free albumin were purchased from Sigma. Palmitate-albumin complexes were prepared as follows. Palmitate was dissolved in 3% albumin (wt/v) to a final concentration of 10 mM in 1X Hank's Balanced Salt Solution. The mixture was slowly heated to 50\u00b0C and stirred overnight. The mixture was then cooled to 37\u00b0C, stirred for an additional 3 hours and sterile filtered through a 0.2 \u03bcm syringe filter. Protein was quantified using the BCA\u2122 Protein Assay Kit .excitation 488 nm; \u03bbemission 585 nm). Nile Red fluorescence was quantitated using a Shimadzu RF-1501 spectrofluorophotometer .Cells were rinsed twice with PBS, pH 7, and trypsinized with phenol red-free 0.05% Trypsin-EDTA  for 5 min at 37\u00b0C. Cells were fixed in suspension with 0.5% paraformaldehyde (v/v) in PBS for 10 min at 25\u00b0C. A stock solution of 1 mg/ml Nile Red  was prepared in acetone and added to the cell preparation to a final concentration of 5 \u03bcg/ml. Cells were incubated at 25\u00b0C for 30 min in the dark. Flow cytometry was performed using a FACScan flow cytometer  LPL mRNA expression changes due to siRNA treatment, 2) the resulting affect on cell surface LPL activity levels, and 3) performed a quantitative evaluation of intracellular lipid accumulation Fig. . SimilarSince siRNA-mediated inhibition of LPL in adipocytes significantly reduced intracellular lipid storage, we reasoned that the exogenous addition of purified LPL (to restore extracellular lipase activity lost due to siRNA treatment) or palmitate (to supply cells with a source of available free fatty acid thus abrogating the need for LPL hydrolysis activity) would be expected to reverse the phenotype seen in siRNA treated cells. To establish control values, adipocytes were treated with or without siRNA for LPL and intracellular lipid accumulation was quantified by Nile Red staining as was done in Figure ApoCII and apoCIII are known to be, respectively, a strong activator and strong inhibitor of LPL ,33. WithSince apoCII and apoCIII have opposite effects on LPL activity, it is generally accepted that the state of LPL activity depends on the ratio of apoCII/apoCIII expression. A high ratio of apoCII/apoCIII promotes LPL activity, whereas a low apoCII/apoCIII ratio inhibits LPL function. Since this ratio can significantly affect extracellular LPL activity and in turn fatty acid uptake and storage by adipocytes, we determined apoCII and apoCIII expression levels in adipocytes treated with or without siRNA for LPL. Although expression of both regulators was largely unaffected by LPL-siRNA treatment, we did find a small but reproducible effect on their expression as a result of diminished LPL expression Fig. . ApoCII The generation of fatty acids from dietary sources and their uptake by cells are essential processes for efficient energy metabolism and storage. A general role for LPL in these processes has been confirmed from LPL gene ablation studies in mice which results in a lethal phenotype . NaturalIt is now well established that LPL requires apoCII as a co-factor for efficient triacylglycerol hydrolysis ,40. ThisThe author(s) declare that they have no competing interests.AMG carried out the experiments in this study and participated in the experimental design. RAO provided the original conceptual framework for the study, assisted with the experimental design and finalized the manuscript for submission. All authors read and approved the final version."}
{"text": "This study investigated the role of a negative FAST in the diagnostic and therapeutic algorithm of multiply injured patients with liver or splenic lesions.A retrospective analysis of 226 multiply injured patients with liver or splenic lesions treated at Bern University Hospital, Switzerland.FAST failed to detect free fluid or organ lesions in 45 of 226 patients with spleen or liver injuries (sensitivity 80.1%). Overall specificity was 99.5%. The positive and negative predictive values were 99.4% and 83.3%. The overall likelihood ratios for a positive and negative FAST were 160.2 and 0.2. Grade III-V organ lesions were detected more frequently than grade I and II lesions. Without the additional diagnostic accuracy of a CT scan, the mean ISS of the FAST-false-negative patients would be significantly underestimated and 7 previously unsuspected intra-abdominal injuries would have been missed.FAST is an expedient tool for the primary assessment of polytraumatized patients to rule out high grade intra-abdominal injuries. However, the low overall diagnostic sensitivity of FAST may lead to underestimated injury patterns and delayed complications may occur. Hence, in hemodynamically stable patients with abdominal trauma, an early CT scan should be considered and one must be aware of the potential shortcomings of a \"negative FAST\". The acr (ATLS\u00ae) . But, th (ATLS\u00ae) -6. Furth (ATLS\u00ae) ,8. This  (ATLS\u00ae) .\u00ae, an abdominal CT scan is indicated in hemodynamic normal trauma patients with impaired sensorium , and equivocal abdominal findings [The computed tomography (CT) scan of the abdomen is currently considered the gold standard for detecting intra- and retroperitoneal lesions in trauma patients -13. Accofindings .However, trauma centers are equipped with dedicated CT scanners to allow fast access to emergency patients, especially those with multiple injuries . ScanninThe aim of the present study was to investigate the role of FAST in the diagnostic algorithm in multiply injured patients in a modern ED with immediate access to a CT scanner. Therefore, we analysed the results of FAST in 226 multiply injured patients with liver or splenic lesions in relationship to the grade of organ injury. Additionally, we characterized the FAST-false-negative patients and determined the clinical consequences of a false-negative FAST.The study was conducted at the Bern University Hospital, Switzerland between January 2001 and July 2006. An average of 286  multiple injured patients are treated in our level I trauma centre during this time each year .\u00ae EUB-6500). In hemodynamically stable patients with the history of a blunt or penetrating abdominal trauma, impaired sensorium, and unclear abdominal clinical findings, a contrast enhanced helical abdominal CT scan (Siemens\u00ae Somatom Sensation 16) is conducted.Immediately after primary assessment of the patient by the attending surgeon, a senior resident in radiology performs bedside the FAST to detect free fluid  a FAST examination on admission, and (2) a spleen or liver lesion documented by (3) an abdominal intravenous contrast enhanced helical CT scan were included in this study. A total of 226 patients fulfilled these three criteria.In the first step, the original radiological reports of the FAST and CT scans, and inpatient records were systematically reviewed. Data concerning the mechanism of injury and accompanying extra- and intra abdominal injuries were collected.The injury severity score (ISS), according to Baker et al., was calculated and the Abbreviated-Injury-Scale (AIS) grading for chest and neurological trauma was used ,19. The Free intra-abdominal fluid or liver and/or spleen lesions detected by FAST were defined as FAST-positive. Free intra-abdominal fluid or organ lesions detected by CT scan, but not by FAST, were defined as FAST-false-negative.The sensitivity and specificity of FAST was then calculated. We further determined the diagnostic accuracy of FAST in relationship to the severity of the organ lesions as depicted by contrast enhanced helical CT scan according to Mirvis et al ,23.p < 0.05 was considered significant.Statistical calculations were performed using SigmaStat 1.0 . Means  were compared using the Mann-Whitney test, and proportions using the Chi-square and Fischer exact test. A value of A total of 164 male and 62 female multiply injured patients with liver or spleen injuries were included in this study. The mean age of the study cohort was 38 years (SD \u00b1 15.0 years). The mean ISS was 17.8 (SD \u00b1 6.9). A splenic lesion was found in 98 patients (44%), a hepatic lesion in 87 patients (38%), and the combination of splenic and hepatic lesions was found in 41 patients (18%).p = n.s.).In 45 of 226 patients with CT-confirmed spleen or liver injuries, the initial FAST failed to detect free fluid or organ lesions (sensitivity 80.1%). FAST showed free fluid without confirmation in the CT examination in one patient with a grade II liver contusion and a subcapsular hematoma (specificity 99.5%). The overall positive and negative predictive values were 99.4% and 83.3%, respectively. The overall likelihood ratios for a positive and negative FAST were 160.2 and 0.2, respectively. Of 41 patients with a combination of hepatic and splenic lesions, FAST was false negative in 7 cases (sensitivity 82.9%). The diagnostic accuracy of FAST was identical for splenic and hepatic injuries . In 21 of 53 patients with grade I hepatic or splenic lesions, FAST could not detect free fluid or any organ lesion (sensitivity 60.4%). In grade II lesions, the sensitivity was 78.6%, and in grade III lesions it was 88.6%. In 32 patients with grade IV and V spleen or liver injuries, FAST could always detect either free fluid or directly demonstrate the organ lesion (sensitivity 100%).Table Of the 7 FAST-false-negative patients with a combination of splenic and hepatic lesions, two had a grade III liver injury in combination with a grade I spleen injury. The five other patients had combinations of grade I and II hepatic and splenic lesions.p = n.s.). There was no difference in the gender ratio between these two groups (Chi-square test: p = n.s.).The mean age of the FAST-false-negative patients was 42 years (SD \u00b1 19.1 years) and 37 years (SD \u00b1 19.0 years) in the FAST-positive group (Mann-Whitney test: Table p = n.s.). The over-all mean ISS of the FAST-false-negative patients was 17.6 (SD \u00b1 10.0). Without the additional diagnostic benefit of a CT scan, the mean ISS of these patients would have been 13.0 (SD \u00b1 10.1), which would significantly underestimate the actual severity of their injuries (Mann-Whitney test: p = 0.0095).The ISS of the FAST-false-negative and FAST-positive patients in relation to the injured organ (spleen or liver) is shown in Table Additional and previously unsuspected intra-abdominal injuries detected by CT scans in the FAST-false-negative patients included: 2 renal contusions (grade II), 1 grade III renal laceration, 2 hemorrhages of the suprarenal gland, 1 colonic perforation, and 1 retroperitoneal hematoma. Of note, surgical intervention was only needed in the patient with colonic perforation. The other incidental findings could be treated conservatively.Further extra-abdominal severe injuries in the 45 FAST-false-negative patients included: 25 (56%) severe thoracic injuries (AIS grade 3 and 4), 8 (18%) severe acute brain injuries , and 5 (11%) unstable pelvic fractures.This clinical study implies that the FAST examination at the primary assessment fails to detect free fluid or organ lesions in 1 of every 5 patients with confirmed spleen or liver injury. On closer examination, it also shows that higher grade lesions were significantly more likely to be identified by FAST than lower grade lesions. This disparity in sensitivity is nicely shown in Table With an exceptional likelihood ratio of a positive result 160.2) FAST is an excellent test when positive. However, the inadequate likelihood ratio of a negative test (0.2) emphasizes the risk to miss intra-abdominal injuries. According to the literature, 11\u201334% of patients with even high grade spleen and liver injury show no evidence of hemoperitoneum and therefore may appear FAST negative . Morbid 60.2 FASTThe mechanism of injury alone doesn't seem to be a predictive factor for a positive abdominal CT scan too ,28. HoweOf note, 2 patients with grade II splenic lesions and negative initial FAST required a haemostatic splenorrhaphy and a splenectomy due to delayed haemorrhage . From the clinical point of view, it is crucial to thoroughly detect all abdominal injuries early. Even low grade lesions can be the source of relevant  bleeding ,30.Currently, the initial CT diagnostic workup is considered the gold-standard for the systematic evaluation of the polytraumatized patient -13. The FAST is an excellent test when positive. However, the inadequate likelihood ratio of a negative test (0.2) emphasizes the risk to miss intra-abdominal injuries, which has led to a significant underestimation of the injury pattern. High grade lesions can be detected reliably by FAST, but only a CT scan can determine the extent and pattern of parenchymal and vascular injury, and therefore allow for individually tailored and often non-operative therapeutic management. Hence, in hemodynamically stable patients with abdominal trauma, an early CT scan should be considered, and one must be aware of the potential shortcomings of a so-called \"negative FAST\".The major limitations of this study are its retrospective design and potential for selection bias. The diagnostic capability of ultrasonography depends on the skill and experience of the examiners. Furthermore, with only a few patients with grade IV and V splenic and liver injuries included in this series, our conclusions are cautious.The authors declare that they have no competing interests.BS coordinated the statistical analysis, interpreted the results and drafted the manuscript. JK collected the radiological data and performed the statistical analysis. DI participated in the interpretation of data and draft of the manuscript. MS collected the clinical data and performed the statistical analysis. RK and ML revised the manuscript critically for radiological and emergency medicine contents. DC gave final approval of the version to be published. AK conceived, designed and coordinated the study. HZ gave final approval of the version to be published.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2342/9/3/prepub"}
{"text": "Staphylococcus aureus, Mycobacterium tuberculosis and Escherichia coli O157:H7 EDL993) were assessed via comparative genomics methods for theirsuitability as antibacterial targets according to a number of criteria, including theessentiality of the protein, its level of sequence conservation, and its distribution inpathogens, bacteria and eukaryotes . Each protein was scored andranked based on weighted variants of these criteria in order to prioritize proteins aspotential novel broad-spectrum targets for antibacterial drugs. A number of proteinsproved to score highly in all three species and were robust to variations in the scoringsystem used. Sensitivity analysis indicated the quantitative contribution of each metricto the overall score. After further analysis of these targets, tRNA methyltransferase(trmD) and translation initiation factor IF-1 (infA) emerged as potential and novelantimicrobial targets very worthy of further investigation. The scoring strategy usedmight be of value in other areas of post-genomic drug discovery.Single and multiple resistance to antibacterial drugs currently in use is spreading,since they act against only a very small number of molecular targets; finding noveltargets for anti-infectives is therefore of great importance. All protein sequences fromthree pathogens ("}
{"text": "In Escherichia coli, two genetically distinct forms of SSADHs had been described that are essential for preventing accumulation of toxic levels of succinic semialdehyde (SSA) in cells.In mammals succinic semialdehyde dehydrogenase (SSADH) plays an essential role in the metabolism of the inhibitory neurotransmitter \u03b3-aminobutyric acid (GABA) to succinic acid (SA). Deficiency of SSADH in humans results in elevated levels of GABA and \u03b3-Hydroxybutyric acid (GHB), which leads to psychomotor retardation, muscular hypotonia, non-progressive ataxia and seizures. E coli gabD gene by X-ray crystallographic studies and compare these data with the structure of human SSADH. In the E. coli SSADH structure, electron density for the complete NADP+ cofactor in the binding sites is clearly evident; these data in particular revealing how the nicotinamide ring of the cofactor is positioned in each active site.Here we structurally characterise SSADH encoded by the E. coli SSADH permits this enzyme to use NADP+, whereas in contrast the human enzyme utilises NAD+. Furthermore, the structure of E. coli SSADH gives additional insight into human mutations that result in disease.Our structural data suggest that a deletion of three amino acids in  The products of the gab operon (which comprises gabT (\u03b3-aminobutyrate transferase), gabD (SSADH), gabP (GABA permease) and gabC (a regulatory gene) sad gene encodes for a NAD+ dependent SSADH (EC 1.2.1.16 and shares 32% identity with gabD) and is an orphan genesad gene is induced by exposure to exogenous SSA and functions primarily to prevent its accumulation in the cell. Furthermore, the sad gene product may also enable growth on putrescine as the nitrogen source In Burkholderia pseudomallei, without a substrate or cofactor (PDB ID: 3ifg and 3ifh), was deposited into the PDB by the Seattle Structural Genomic Centre for Infectious Disease.Recently, the structure of human SSADH has been published gabD gene product (NADP+-dependant) SSADH from E. coliE. coli SSADH is also redox regulated, furthermore it reveals that the bacterial SSADH is structurally suited for NADP+, rather than NAD+ (as utilised by its human counterpart).Despite these recent studies, the structural information of SSADH and its interactions with cofactor remains scarce. Here we report a 2.3 \u00c5 X-ray crystal structure of the E. coli SSADH was purified as a tetrameric molecule  which is in agreement with the previous description in the literature 1H NMR, as shown in mK of the purified enzyme is 16.94\u00b12.2 \u00b5M and maxV is 40.92\u00b11.3 \u00b5M. The enzyme activity measured in the presence of NADP+ is approximately 20-fold higher than that measured in the presence of NAD+ (data not shown) as described previously Recombinant E. coli SSADH reveals four monomers  in the asymmetric unit  and 13 \u03b1 helices (1\u201313). The secondary structure assignments used in this report are as shown in + is bound to the active site giving rise to a binary complex, whereas the structure of the N-terminal His-tag was not resolved.The SSADH monomer  adopts a+ via two tandem Rossmann folds in a (\u03b2\u03b1)4\u03b2 formation. This is a variation of the classic Rossmann fold 2\u03b2 motif (residues 148\u2013208) forms the first \u03b2 strand of the second (\u03b2\u03b1)2\u03b2 motif (residues 205\u2013254). The oligomerisation domain comprises an elongated 3-stranded \u03b2-sheet (the B-sheet), which interacts with two other monomers in the final tetrameric assembly.The catalytic domain consists of a central 7 stranded \u03b2-sheet (the D-sheet) flanked by 2 helices on one side and 3 helices on the other. The catalytic loop (residues 282\u2013290) is located adjacent to the cofactor binding site. The cofactor binding domain interacts with NADP2 buried in the dimer interface  is formed by domain swapping; such that strand s3B of the oligomerisation domain in monomer A forms \u03b2-sheet hydrogen bonding with strand s7D of the catalytic domain in monomer B to make a 10 stranded \u03b2-sheet . The scrnterface .2 buried in the interface and 10 H-bonds  and superposes with a root-mean-square deviation of 0.79 \u00c5 over 472 C\u03b1  and inactive  state has recently been determined  E. coli . These dn of DTT . InteresE. coli SSADH reveals two major regions of structural variation: the first involves the cofactor binding site  resembles the canonical ALDH fold Comparison of human and +  and the active site residues  of human SSADH structures (PDB ID: 2w8o and 2w8q)+ results in formation of the thioacyl enzyme intermediate and NAD(P)H. Lastly, the conserved E254 residue acts as a general base to deprotonate a water molecule prior to its attack on the thioacyl enzyme intermediate resulting in formation of SA and regeneration of the C288 residue. The general base, E254, in all monomers can be modelled in two alternative conformations according to the electron density. It is suggested that the two conformations of E254 is likely to be associated with different stages of the catalytic process, with one conformation \u201ca\u201d tion \u201ca\u201d  being foE. coli SSADH structure, electron density for the cofactor in the binding sites is clearly evident . In human SSADH, 261RKN263  to catalyse the deacylation process.Amongst the well defined cofactor crystal structures, three different conformations of NAD(P)E. coli SSADH numbering in parentheses). The majority (25 mutations) give rise to truncations, deletions, insertions as well as splice site mutants . All these residues superpose well between the human and E. coli structures . The DNA sequence of the PCR product was shown to have a single amino acid change to that of the gabD gene sequence in the database, which is thought to represent a naturally occurring variant in E. coli, the SSADH cDNA was excised from the recombinant pCR\u00ae -Blunt vector using the restriction enzymes EcoRI and HindIII, then ligated into pRSETc/His_TEV plasmid as previously described E. coli BL21(DE3) pLysS cells and the transformant was stored at \u221280\u00b0C. For expression of SSADH recombinant protein, transformed E. coli BL21(DE3) cells were propagated in 2YT growth medium in the presence of 100 \u00b5g/mL ampicillin and 36 \u00b5g/ml chloramphenicol at 37\u00b0C to A600\u200a=\u200a0.6 followed by induction at 16\u00b0C with 0.5 mM IPTG for 18 hours.The cDNA encoding SSADH was isolated from Harvested cells were treated with lysozyme (1 mg/ml) at 4\u00b0C for 30 min and lysed in lysis buffer containing 300 mM NaCl, 10 mM imidazole, 5 mM \u03b2-mercaptoethanol, 0.01% triton X-100, 50 mM Tris (pH 8.0) by sonication on ice. Clarified cell lysate was loaded onto a Nickel Chelating Sepharose Fast Flow column , the His-tagged SSADH protein was eluted in 150 mM NaCl, 250 mM imidazole, 5 mM \u03b2-mercaptoethanol, 50 mM Tris (pH 8.0). Purified His-tagged SSADH were further purified using a S200 16/60 size exclusion column  pre equilibrated with 100 mM NaCl, 10 mM \u03b2-mercaptoethanol, 5% glycerol, 30 mM Tris (pH 7.5) for all experiments described in this paper.+ and SSA 0\u2013400 mM at 30\u00b0C. The rate at which NADP+ was converted to NADPH was monitored fluorometrically (excitation: 355 nm and emission: 460 nm). SSADH oxidative inhibition (H2O2) assays were carried out by incubating various concentrations of H2O2 with SSADH (1 \u00b5g/ml) in a Na phosphate buffer (100 mM pH 8.4), containing 0.75 mM EDTA for 1 hour at room temperature, the reactions were terminated by adding 5.0 mM methionine. To reverse the effect of the H2O2, 10 mM DTT was added to H2O2 treated SSADH and incubated for a further 10 minutes. After the addition of 2.0 mM NADP+ and 0.15 mM SSA, the activity of H2O2 treated SSADH was measured spectrophotomically at 340 nm at 30\u00b0C.Enzyme kinetics were carried out using purified SSADH (2 \u00b5g/ml) in a Na phosphate buffer (100 mM pH 8.0), containing 1.1 mM NADP1H NMR spectroscopic analysis was carried out with a Bruker DPX 400 MHz spectrometer using purified SSADH in the presence of 125 \u00b5M SSA for 240 min as above.Pure SSADH was concentrated to 6 mg/mL and buffer exchanged into 20 mM NaCl, 10 mM \u03b2-mercaptoethanol, 5% glycerol, 1.0 mM NADP, 1.0 mM succinic semialdehyde, 30 mM Tris (pH 7.5) using a 10 KDa molecular weight cut off concentrator (Millipore).Crystals of SSADH were grown using hanging drop vapour diffusion by mixing 2.0 \u00b5L of protein (6 mg/mL) with 1.0 \u00b5L of reservoir solution containing 0.2 M ammonium tartrate, 26\u201331% polyethylene glycol 3350, 10 mM \u03b2-mercaptoethanol and 0.1 M Tris (pH 7.2\u20137.5). Crystals were dehydrated for 48 hours in 0.2 M ammonium tartrate, 32% polyethylene glycol 3350, 10 mM \u03b2-mercaptoethanol and 0.1 M Tris (pH 7.2\u20137.5) after three days. Crystals were soaked in reservoir solution supplemented with 5% 2-methyl-2,4-pentanediol for 5 minutes then soaked for a further 5 minutes in reservoir solution supplemented with 10% 2-methyl-2,4-pentanediol for cryoprotection before freezing in liquid nitrogen for data collection. Data were collected at the Australian Synchrotron High-throughput protein crystallography (PX1) beam.P4212 with unit cell dimensions of a\u200a=\u200a151.88 \u00c5, b\u200a=\u200a151.88 \u00c5, c\u200a=\u200a165.77 \u00c5, \u03b1\u200a=\u200a\u03b2\u200a=\u200a\u03b3\u200a=\u200a90.0\u00b0. These data are consistent with four molecules in the asymmetric unit. These data were merged and scaled using MOSFLM free with neither a sigma nor a low-resolution cut-off applied to the data. Summaries of the statistics are provided in SSADH crystals diffracted to 2.3 \u00c5 resolution and belong to the space group The structure of SSADH was solved using molecular replacement and the program PHASER A \u2018mixed\u2019 model consisting of conserved side chains with all other non-alanine/glycine residues truncated at C\u03b3 atom was then created using the SCRWL server Rfree. Model building and structural validation was performed using COOT Rfree reached 28%. The presence of each water molecule was manually validated. The NADP+ moiety was modelled into the density using PHENIX ligandfit th percentile; Refinement and model building preceded using one molecule (chain A) in the asymmetric unit, with the other chains built using non-crystallographic symmetry operators. Maximum likelihood refinement using REFMACCoordinates and structure factors have been deposited in the Protein Data Bank with accession number 3jz4.http://hdl.handle.net/102.100.100/42) Diffraction image datasets and refinement logs are available online on TARDIS  substrate alone in phosphate buffer which contains succinic semialdehyde (X), 4,4-dihydroxybutanoic acid (Y) and succinic acid (Z). (b) Succinic acid alone with phosphate buffer, showing only the singlet peak of succinic acid (Z). For SSADH enzyme assay, incubation of succinic semialdehyde and SSADH in the presence of NADP+ at 0 min (c) and 240 min (d) showing all substrates  has been converted to succinic acid (Z), NADP+ is marked with W.(0.21 MB TIF)Click here for additional data file.Figure S22-sheet or a cylinder representing an \u00ce\u00b1-helix. The secondary structure elements are coloured according the Alignment of E. coli SSADH with human SSADH. Conserved residues have been highlighted according to the following, polar (green), non-polar (yellow), acidic (red) and basic (blue). The secondary structure (E. coli SSADH above the sequence and human below the sequence) has been marked with either an arrow designating a \u00ce(1.46 MB TIF)Click here for additional data file.Figure S3SSADH activity in an oxidised and reduced environment. The first column shows the untreated activity of SSADH. In the second column the E. coli SSADH enzyme was oxidised by incubating it with 200 \u00ce\u00bcM H2O, which has 11\u201313% of untreated SSADH activity. In the third column the addition of 10 mM DTT to previously oxidised enzyme, which rescued the inhibition to 80% that of the normal activity.(0.16 MB TIF)Click here for additional data file.Figure S4A\u2013F. Human point mutations causing a dramatic loss of acticvity  mapped onto the E. coli SSADH structure. A cartoon representation of E. coli SSADH monomer A  showing the 17 point mutations (magenta spheres) that map to the mature human protein. A small region of monomer B catalytic domain (dark grey) and monomer C oligomerisation domain (light grey) have been included to illustrate the proximity of point mutations with regard to dimer and tetramer interfaces. Labelled, dashed red boxes highlight the area of E. coli SSADH that have been enlarged for analysis. A\u2013F) Show the equivalent E. coli SSADH residues (magenta sticks) to the human point mutants and their interactions (black dashed lines) within their immediate surrounds with other residues (orange sticks). A\u2013B) Mutations in this region would be anticipated to disrupt dimer and tetramerisation, while C) we would anticipate decreased stability in this region due to loss of stabilising interactions with the N255S mutation. D) A loss of NAD/P+ binding efficiency would be expected with the addition of a large negatively charged residue, G268E, into the positively charged adenosine-ribose binding pocket of SSADH. E) We anticipate an overall loss of structural integrity of this loop region from either of the mutations G409D (loss of +/+ backbone conformation) and P382L/Q (disruption of aromatic ring stacking interactions with F419). F) The introduction of a large charged residue (N335K) in a buried surface on the catalytic loop would be anticipated to greatly disrupt the structural integrity and catalytic ability of SSADH.(2.71 MB TIF)Click here for additional data file.Table S1Intermolecular contacts with respect to monomer A.(0.18 MB DOC)Click here for additional data file.Table S2Residues involved in significant NADP+ binding using Molprobity (0.07 MB DOC)Click here for additional data file."}
{"text": "Systematic identification of protein-drug interaction networks is crucial to correlate complex modes of drug action to clinical indications. We introduce a novel computational strategy to identify protein-ligand binding profiles on a genome-wide scale and apply it to elucidating the molecular mechanisms associated with the adverse drug effects of Cholesteryl Ester Transfer Protein (CETP) inhibitors. CETP inhibitors are a new class of preventive therapies for the treatment of cardiovascular disease. However, clinical studies indicated that one CETP inhibitor, Torcetrapib, has deadly off-target effects as a result of hypertension, and hence it has been withdrawn from phase III clinical trials. We have identified a panel of off-targets for Torcetrapib and other CETP inhibitors from the human structural genome and map those targets to biological pathways via the literature. The predicted protein-ligand network is consistent with experimental results from multiple sources and reveals that the side-effect of CETP inhibitors is modulated through the combinatorial control of multiple interconnected pathways. Given that combinatorial control is a common phenomenon observed in many biological processes, our findings suggest that adverse drug effects might be minimized by fine-tuning multiple off-target interactions using single or multiple therapies. This work extends the scope of chemogenomics approaches and exemplifies the role that systems biology has in the future of drug discovery. Both the cost to launch a new drug and the attrition rate during the late stage of the drug discovery and development process are increasing. Torcetrapib is a case in point, having been withdrawn from phase III clinical trials after 15 years of development and an estimated cost of US $800 M. Torcetrapib represents a new class of therapies for the treatment of cardiovascular disease; however, clinical studies indicated that Torcetrapib has deadly side-effects as a result of hypertension. To understand the origins of these adverse drug reactions from Torcetrapib and other related drugs undergoing clinical trials, we introduce a systematic strategy to identify off-targets in the human structural proteome and investigate the roles of these off-targets in impacting human physiology and pathology using biochemical pathway analysis. Our findings suggest that potential side-effects of a new drug can be identified at an early stage of the development cycle and be minimized by fine-tuning multiple off-target interactions. The hope is that this can reduce both the cost of drug development and the mortality rates during clinical trials. These findings suggest that adverse drug reactions might be modulated by the fine-tuning of the off-target binding network and exemplify the role of systems biology in the future of drug discovery.In this paper, we apply this strategy to identify and analyze a panel of unknown off-targets for Cholesteryl Ester Transfer Protein (CETP) inhibitors. CETP inhibitors represent a new preventive therapy for cardiovascular disease through raising HDL cholesterol. However, clinical studies have revealed that one of the CETP inhibitors, Torcetrapib, has deadly off-target effects as a result of hypertension The ligand binding site of CETP (PDB id: 2OBD) is assumed to be a long tunnel interacting with two cholesteryl oleates (2OB) and two 1,2-dioleoyl-Sn-glycero-3-phosphocholines (PCW) molecules in the native state , howeverAlthough only approximately 15% of human proteins have known 3D structures deposited in the Protein Data Bank (PDB) Most of the predicted ligand binding sites of CD1B, LPTP, and FABP have a similar topology to that of CETP. The drug molecule binds to a cavity formed by anti-parallel beta-sheets and capped by other structural components such as a helix. The others, NR, EF, and HEME all have alpha-helical architectures that are completely different from the secondary structure surrounding the binding site of CETP. These differences illustrate the necessity of tools like SMAP that can find local structural similarities even when global similarity is non-existent. From a functional perspective, it is not surprising that lipid binding proteins act as off-targets for CETP inhibitors since they are required to bind similar cognate hydrophobic ligands such as PCW. It is noteworthy that glycolipid transfer protein, one of the lipid binding proteins, has significant structural similarity to nuclear hormone receptors. For example, the FATCAT http://www.ihop-net.org/UniPub/iHOP/in?dbrefs_1=NCBI_LOCUSLINK__ID|1071). Several top-ranked off-targets appear in the same sentences with each other more than 3 times in the literature. They include phospholipid transfer proteins, nuclear receptors, including PPAR, major histocompatibility complex class II that is similar to CD1B, apolipoprotein A-1, and angiotension I converting enzyme.We searched for possible functional correlations between CETP and the putative off-targets using the iHOP http://funsimmat.bioinf.mpi-inf.mpg.de/index.php). From 204 off-targets, 148 structures had annotated GO terms and 94 structures had detectable similarities with a Resnik score The functional similarity between CETP and the off-targets is further quantitatively measured using gene ontology (GO) relationships found with the FunSimMat web server To further support our off-target predictions we conducted docking studies on CETP and the identified off-targets, which also provides insights into the molecular mechanisms of off-target binding. It has been established that the binding affinity calculated from docking programs is not necessarily reliable 3, respectively. As shown in Importantly, the binding profiles for the three CETP inhibitors  are different from each other across the panel of off-targets. JTT-705 is the most promiscuous inhibitor. In contrast, Torcetrapib failed to dock into some of the off-targets, and Anacetrapib is suitable to be docked into the least number of off-targets. The difference between their off-target binding profiles can be partly explained by their different complexity By incorporating the predicted off-targets into biological pathways it is possible for us to correlate the predicted off-target interactions with the observed pleotropic effects of Torcetrapib, Anacetrapib and JTT-705. Among them, the negative effect of Torcetrapib on blood pressure in phase III clinical trials could be deduced. Also deducible was an explanation for the increased death from infection and cancer As shown in According to the normalized docking scores , TorcetrThe effects of CETP inhibitors on inflammation are shown in NF-\u03baB regulates genes involved in cell proliferation and cell survival and hence is an interesting drug target in cancer treatment. Inhibition of NF-\u03baB can potentially halts tumor progression and eliminate tumors oncogenes and participates in cancer development Recent experiments have shown that PPAR\u03b1 and PPAR\u03b3 can induce extracellular signal-regulated kinase (Erk) and/or p38 phosphorylation and then activate the MAPK/Erk signaling pathway Effects of PPAR and RXR are also regulated by fatty acid binding proteins (FABP) Another type of highly ranked off-target, CD1, can also be directly related to the side- effect of infection through its function as an antigen-presenting protein in the immune system. T cells will recognize antigens presented by CD1 proteins and activate a cell-mediated immune response against microbial infections 2+ homeostasis and nitric oxide. It has also been observed that the lack of S100A1 (an EF protein) expression could lead to hypertension 2+ levels but also directly control the transcriptional activity of the tumor suppressor p53 through interactions with its regulatory sequences Other putative off-targets such as ubiquinol-cytochrome-c reductases, globin-like proteins, EF hand-like calcium binding proteins (EFs), and LPTP are also directly or indirectly associated with hypertension, inflammation, and/or cancer. Recent studies suggest that ubiquinol-cytochrome-c reductase expression is indirectly regulated by steroid hormones in response to hypertension In summary, most of the putative off-targets for CETP inhibitors are involved in interconnected lipid metabolism and signaling networks which activate or mediate various biological process such as hypertension, stress regulation In vitro, in vivo and clinical studies indicate that CETP inhibitors exhibit pleotropic effects in humans through the interaction with unknown off-targets. We have identified a panel of proteins that likely bind to CETP inhibitors leading to the observed clinical indications. The putative off-target interactions are consistent with existing experimental data and provide insights into the molecular mechanisms of the side-effect profile of CETP inhibitors. Drug promiscuity depends not only on the similarity of ligand binding pockets in the related proteins but also the complexity of the drug itself in silico simulation of the influence of small molecules on biological systems. In the interim it is noted that the analysis of incomplete networks is still invaluable in making new discoveries in biomedicine as exemplified by several recent studies The chemical systems biology approach developed here is limited by available protein structures that currently only cover approximately 50% of the human proteome, although the structural coverage of the human proteome will steadily increase with progress in structural genomics Besides SMAP used in this study, a number of web servers for ligand binding site search are available, for example, SiteEngine in vitro screening, in vivo screening and clinical trials.Despite the success of ligand binding search algorithms in protein function prediction and drug design Even with the current limited structural coverage of the human proteome, our predications are able to provide a testable hypothesis as to the suitability of a lead compound prior to conducting a clinical trial. Thus our findings have implications for drug discovery and development. In contrast to the conventional drug discovery process in which drug leads are optimized to reduce promiscuous binding, the possible combinatorial control of aldosterone regulation by CETP inhibitors suggests that adverse drug effects can be minimized through fine tuning of multiple off-target interactions. Although it is desirable for a drug to bind the primary target in a highly specific way, this is difficult to achieve considering the inherent similarity among protein binding pockets within and across gene families. Moreover, many biological process involve combinatorial control to provide redundancy and homeostasis N, which is the alignment length between two proteins:5,985 structures or models that cover approximately 57% of the human proteome were searched against CETP (PDB id: 2obd) ligand binding sites using the sequence order independent profile-profile alignment (SOIPPA) algorithm Using this statistical model, 276 off-targets are identified with p-values less than 1.0e-3.The putative 276 off-targets are subject to further investigation using more computationally intensive protein-ligand docking. After removing three structures with the same fold as CETP, JTT-705, the smallest CETP inhibitor, is docked to the remaining 273 structures using two commonly used fast docking programs, Surflex 2.1 An all-against-all global structural similarity analysis between the 204 putative off-targets was computed using CE http://sts-fw.bioengr.uic.edu/castp) with default settings.The volume of the binding pocket is computed using the CASTp server http://zinc.docking.org) Drug-like molecules are downloaded from ZINC .(0.09 MB DOC)Click here for additional data file.Figure S2Structural coverage of the human proteome vs. alignment length between the protein sequence and the structural template.(0.06 MB DOC)Click here for additional data file.Figure S3CE Z-score distributions of putative off-targets.(0.06 MB DOC)Click here for additional data file.Figure S4Structural clusters of helix-like proteins.(0.07 MB DOC)Click here for additional data file.Figure S5Global structure similarity between glycolipid transport protein (PDB: 1tfj) and nuclear hormone receptor ligand binding domain (PDB: 1yow).(0.17 MB DOC)Click here for additional data file.Figure S6Regression curves of eHiTs score for CETP and its off-targets dependent on the number of carbon atoms for a) 2obd, b) 1yow, c) 1y0s, d) 2p54, e) 1zeo, and f) 1ie8.(0.38 MB DOC)Click here for additional data file.Figure S7Correlation of eHiTS score between CETP and its off-targets binding with random ligands with different sizes. a) 1yow; b) 1y0s; c) 2p54; d) 1zeo; e) 1ie8; f) 1tfj.(2.04 MB DOC)Click here for additional data file.Figure S8Correlation of the off-target interaction network of CETP inhibitors with the clinical indication through interconnected biological pathways.(0.23 MB DOC)Click here for additional data file.Figure S9The different regulation effects of Torcetrapib, Anacetrapib and JTT-705 on hypertension, inflammation and cancer through combinational control of other identified off-targets.(0.10 MB DOC)Click here for additional data file.Table S1Putative off-targets of CETP inhibitors across the human structural genome identified from the off-target pipeline SMAP.(0.05 MB DOC)Click here for additional data file.Table S2GO based similarity between CETP and off-targets.(0.03 MB DOC)Click here for additional data file.Table S3Vector distances and Pearson correlations of carbon atom dependent average eHiTS docking scores between binding pockets of CETP and six classes of off-targets.(0.05 MB DOC)Click here for additional data file."}
{"text": "Triceratops and other ceratopsids (horned dinosaurs) are interpreted variously as display structures or as weapons against conspecifics and predators. Lesions  on Triceratops skulls have been used as anecdotal support of intraspecific combat similar to that in modern horned and antlered animals. If ceratopsids with different cranial morphologies used their horns in such combat, this should be reflected in the rates of lesion occurrence across the skull.The horns and frill of G-test of independence to compare incidence rates of lesions in Triceratops  and the related ceratopsid Centrosaurus , for the nasal, jugal, squamosal, and parietal bones of the skull. The two taxa differ significantly in the occurrence of lesions on the squamosal bone of the frill (P\u200a=\u200a0.002), but not in other cranial bones (P>0.20).We used a Triceratops using its horns in combat and the frill being adapted as a protective structure for this taxon. Lower pathology rates in Centrosaurus may indicate visual rather than physical use of cranial ornamentation in this genus, or a form of combat focused on the body rather than the head.This pattern is consistent with  Triceratops battling with conspecifics or the predator Tyrannosaurus have become ingrained in both the scientific and the popular mind. Lesions (wounded or diseased areas) on the horns, frill, and face of Triceratops specimens have been cited as evidence in support of the defensive and offensive nature of the animal's cranial ornamentation Triceratops have been anecdotal, focusing on generating speculative scenarios to explain instances of hypothesized injury Images of the three-horned dinosaur Triceratops and Centrosaurus for bony lesions .A Triceratops and Centrosaurus, because all cranial elements should then show similar rates of incidence. We also rule out predatory attacks as the primary cause of the lesions, because similar large predators (tyrannosaurid theropods) were present in the habitats for both genera, and we would thus expect similar patterns of osteological abnormalities in both. Alternatively, it might be claimed that Triceratops had more frequent occurrence of lesions on the squamosal because this element forms a greater proportion of the frill's exposed area, and was thus more likely to be injured, than in Centrosaurus  caused the differing prevalence of lesions between us e.g., . We testnot be due to combat. We only claim that the overall pattern in all of the specimens is consistent with intraspecific combat in Triceratops.It is important to note that we do not claim to infer a precise cause for individual pathologies on certain specimens , the evolutionary predecessors of ceratopsids, possessed a thin, enlarged frill but lacked elongated brow or nasal horns. Thus, the primitive function of the frill (in addition to a role in jaw muscle attachment) was probably that of display rather than cervical protection Triceratops may have been an exaptation for cervical protection, in addition to a role in display. This suggests interesting possibilities for the factors that drove the evolution of cranial morphology in ceratopsids. Display probably was an important function for the horns and frills in all ceratopsids, but not the only one. Horned combat, and the consequences of injury from this combat, may have been another important selective factor. Recent discoveries strongly suggest that Centrosaurus evolved from an ancestor with a Triceratops-like horn configuration Centrosaurus) lost their long brow horns or changed combat styles as a way to reduce cranial injury. This interpretation also suggests that the frill may not have had a protective function within Centrosaurus , but instead functioned for species recognition and/or other forms of visual display. Centrosaurus and some other ceratopsids may have focused blows on an opponent's torso rather than the skull; this is suggested by the occurrence of fractured ribs in Centrosaurus, Pachyrhinosaurus, and ChasmosaurusTriceratops, as well as rates of cranial bony anomalies in additional taxa, may be informative in further evaluating this hypothesis. Clearly, horned dinosaurs used their cranial ornamentations for a variety of functions.Non-ceratopsid neoceratopsians  is quite similar to other chasmosaurine from these formations (Torosaurus and Diceratus). No distinction was made between Triceratops species, Triceratops horridus and Triceratops prorsus, because of general similarity in horn morphology as well as the difficulty in assessing species for incomplete skulls. A similar approach was used for Centrosaurus. Two species, Centrosaurus apertus and Centrosaurus brinkmani, which differ only in minor details of the horns and frill, were combined in the sample. Additional isolated centrosaurine specimens from the Dinosaur Park Formation of Alberta were also assumed to belong to Centrosaurus.Specimens of Cranial elements chosen for comparison included the nasal , jugal, squamosal, and parietal , and theCentrosaurus, some specimens preserved the midline bar of the frill and only one side. In this case, the elements were scored as belonging to the side that was predominantly preserved, in order to avoid inflating the sample size. Similarly, parietals consisting primarily of the midline bar were also scored only as a single element.Each examined element was coded as \u201cpathological\u201d or \u201cnormal,\u201d and the side of the element (right or left) was also recorded. Because the parietal bone is fused into a single bilaterally symmetric element, right and left sides of the bone were distinguished relative to the midline. In G-test of independence was applied to each 2\u00d72 matrix For each element, the data were assembled into a 2\u00d72 matrix, with rows representing taxon and columns representing pathological state. For associated specimens preserving both right and left elements, each side was counted separately in the matrix. This is appropriate, because the pathologies counted here presumably represented discrete events in the life of the animal instead of systemic conditions Triceratops than in Centrosaurus , we conducted a second analysis looking at the frill as a single element. As before, left and right frills  were counted separately, and disarticulated or isolated frill elements were considered to represent a single \u201cfrill\u201d in order to maximize sample size. This latter assumption was modified for specimens recovered from bonebeds, in order to reduce the possibility that a single individual  would be over counted. Here, the number of squamosals and parietals from each bone bed sample were compared, and the element with the greatest representation was chosen as the N of frills for that locality. For instance, a site with 5 parietals and 8 squamosals would be considered to have 8 individual frills .The squamosal, relative to the parietal, forms a greater proportion of the frill in rosaurus . In ordeTable S1ffracture callus; pperiosteal reactive boneSpecimens included in this study, by element. Each specimen number listed is for a single element. Where numbers are listed twice  or indicated with a parentheses (2), this indicates that two elements from the same individual were included in the sample. Abbreviations: AMNH, American Museum of Natural History, New York, New York; ASU, Appalachian State University, Boone, North Carolina; CCM, Carter County Museum, Ekalaka, Montana; CMN, Canadian Museum of Nature, Ottawa, Ontario; DMNH, Denver Museum of Nature and Science, Colorado; RAM, Raymond M. Alf Museum of Paleontology, Claremont, California; ROM, Royal Ontario Museum, Toronto, Ontario; SDSM, South Dakota School of Mines and Technology Museum of Geology, Rapid City; TLAM, Timber Lake Area Museum, South Dakota; TMP, Royal Tyrrell Museum of Palaeontology, Drumheller, Alberta; UCMP, University of California Museum of Paleontology, Berkeley; USNM, National Museum of Natural History, Washington, D.C.; YPM, Yale Peabody Museum of Natural History, New Haven, Connecticut. (0.02 MB DOC)Click here for additional data file."}
{"text": "Glycyrrhiza glabra) inhibits 11\u03b2-hydroxysteroid dehydrogenase type 1 that catalyzes the activation of glucocorticoids. Thus, oral administration of GA is postulated to ameliorate the MetS.The metabolic syndrome (MetS) is a cluster of metabolic abnormalities comprising visceral obesity, dyslipidaemia and insulin resistance (IR). With the onset of IR, the expression of lipoprotein lipase (LPL), a key regulator of lipoprotein metabolism, is reduced. Increased activation of glucocorticoid receptors results in MetS symptoms and is thus speculated to have a role in the pathophysiology of the MetS. Glycyrrhizic acid (GA), the bioactive constituent of licorice roots (p < 0.05) but non-significant increase in the abdominal muscle, kidney, liver, heart and the subcutaneous and visceral adipose tissues (p > 0.05) of the GA-treated rats compared to the control. Decrease in adipocyte size (p > 0.05) in both the visceral and subcutaneous adipose tissue depots accompanies such selective induction of LPL expression. Consistent improvement in serum lipid parameters was also observed, with decrease in serum free fatty acid, triacylglycerol, total cholesterol and LDL-cholesterol but elevated HDL-cholesterol (p > 0.05). Histological analysis using tissue lipid staining with Oil Red O showed significant decrease in lipid deposition in the abdominal muscle and quadriceps femoris (p < 0.05) but non-significant decrease in the heart, kidney and liver (p > 0.05).In this study, daily oral administration of 50 mg/kg of GA for one week led to significant increase in LPL expression in the quadriceps femoris (Results from this study may imply that GA could counteract the development of visceral obesity and improve dyslipidaemia via selective induction of tissue LPL expression and a positive shift in serum lipid parameters respectively, and retard the development of IR associated with tissue steatosis. Lipoprotein lipase (LPL) is the major enzyme responsible for the hydrolysis of circulating triacylglycerol (TAG) moiety of both classes of TAG-rich lipoproteins; the chylomicrons and very-low-density lipoprotein (VLDL), generating free fatty acids (FFA) that are either oxidized in the muscles or re-esterified in the adipose tissues, and glycerol that is returned to the liver. LPL plays a central role in overall lipoprotein metabolism, where (i) the successive interaction of VLDL with LPL generates the low-density lipoproteins (LDL) that are involved in forward cholesterol transport and (ii) the remnant lipoprotein particles so formed from LPL catalysis contributes to the maturation of high-density lipoprotein (HDL) precursors, the latter of which is then involved in reverse cholesterol transport ,2. PertuThe MetS refers to a constellation of metabolic abnormalities characterized by the co-existence of insulin resistance (IR), visceral obesity, hyperglycaemia, hypertension and dyslipidaemia. The syndrome has become a recognizable clinical cluster of risk factors that are predictive of the progression to cardiovascular disease and type 2 diabetes mellitus (T2DM) . Both viDyslipidaemia, the hallmark of the MetS which is manifested in the more severe form in T2DM, is characterized by (i) increased flux of FFA, (ii) elevated TAG level (hypertriglyceridaemia), (iii) reduced HDL level and (iv) a predominance of small, dense LDL. Elevated plasma FFA is viewed as the primary defect leading to the development of dyslipidaemia ,7 and IRGlycyrrhiza glabra and its pharmacologically active metabolite glycyrrhetic acid (GE) act as potent, non-selective inhibitors of both isoforms of 11\u03b2-HSD  and normalized to the \u03b2-actin (BAC) gene with the forward and reverse primers 5'-GTATGGGTCAGAAGGACTCC-3' and 5'-GTTCAATGGGGTACTTCAGG-3' and the probe 5'-(TET) CCTCTCTTGCTCTGGGC (BHQ1)-3' specific for Rattus norvegicus BAC mRNA [GenBank: BC063166]. The comparison of LPL expression between control and GA-treated rats were performed using the Comparative Ct (\u0394\u0394Ct) Method, with BAC as reference, GA-treated group as target and control group as calibrator. Agarose gel electrophoresis was carried out on amplicons generated from qRT-PCR reaction to ensure primer specificity.The expression of LPL was determined by qRT-PCR using the LPL forward and reverse primers 5'-CAGCAAGGCATACAGGTG-3' and 5'-CGAGTCTTCAGGTACATCTTAC-3' and the probe 5'-(6-FAM) TTCTCTTGGCTCTGACC (BHQ1)-3' that are specific for et al. [et al. [Frozen tissues were cut into small cubes of approximately 5 \u00d7 5 \u00d7 5 mm on and embedded using the Optimal Cutting Temperature (OCT) Compound . Cryosectioning was performed at a temperature of -25\u00b0C where the embedded tissues were sectioned into 5 \u03bcm slices and adhered onto glass slides. Staining with Oil Red O (ORO) was performed in accordance to Koopman et al.  and capt [et al. . Images Eight contiguous views per tissue section were captured and analyzed for the lipid content. The level of lipid deposition of each tissue section was calculated as the average of these eight values.2) per field view per tissue section at 100\u00d7 magnification.Adipose tissues that were fixed in 10% neutral-buffered formalin as aforementioned were processed by a Leica TP 1020 Automatic Tissue Processor and embedded in paraffin. 5 \u03bcm thick tissue sections were then stained with haematoxylin and eosin (H&E) followed by the measurement of the size of 100 adipocytes (\u03bcm\u00a9) MCS Beta 2006 while that of all other parameters was performed using the Statistical Package for the Social Sciences (SPSS) Version 16.0. Data distribution was analyzed using the Kolmogorov-Smirnov test. Parametric data were then analyzed with independent t-test and are presented as mean \u00b1 standard error while non-parametric with Mann-Whitney U-test and are reported as median (minimum \u2013 maximum). In all analyses, a p-value \u2264 0.05 was considered significant.Statistical analysis of LPL expression was performed using the Relative Expression Software Tool (REST11\u03b2-HSD: 11\u03b2-hydroxysteroid dehydrogenase; AM: abdominal muscle; CETP: cholesteryl ester transfer protein; FFA: free fatty acids; GA: glycyrrhizic acid; GE: glycyrrhetic acid; H&E: haematoxylin and eosin; HL: hepatic lipase; HDL: high-density lipoprotein; IR: insulin resistance; LDL: low-density lipoprotein; LPL: lipoprotein lipase; MetS: metabolic syndrome; ORO: Oil Red O; PPAR: peroxisome proliferator-activator receptor; PPRE: peroxisome proliferator response element; QF: quadriceps femoris; SAT: subcutaneous adipose tissue; T2DM: type 2 diabetes mellitus; TAG: triacylglycerol; VAT: visceral adipose tissue; VLDL: very-low-density lipoprotein.The authors declare that they have no competing interests.WYAL was involved in all bench work, data acquisition, analysis and interpretation and manuscript preparation. YYC had part in the optimization of the qRT-PCR conditions and SYL had part in histological work. SHT, KAK and SNASH participated in the coordination of the study and helped in drafting the manuscript. All authors read and approved the final manuscript."}
{"text": "Increased resting heart rate (RHR) may be associated with increased cardiovascular morbidity. Our aim was to explore the possibility that increased RHR is associated with the prevalence of the metabolic syndrome (MetS) in a sample of apparently healthy individuals and those with cardiovascular risk factors.We performed a cross-sectional analysis in a large sample of apparently healthy individuals who attended a general health screening program and agreed to participate in our survey. We analyzed a sample of 7706 individuals (5106 men and 2600 women) with 13.2% of men and 8.9% of the women fulfilling the criteria for the MetS. The participants were divided into quintiles of resting heart rate. Multiple adjusted odds ratio was calculated for having the MetS in each quintile compared to the first.The multi-adjusted odds for the presence of the MetS increased gradually from an arbitrarily defined figure of 1.0 in the lowest RHR quintile (<60 beats per minute (BPM) in men and <64 BPM in women) to 4.1 and 4.2 in men and women respectively in the highest one (\u226580 BPM in men and \u226582 BPM in women).Raised resting heart rate is significantly associated with the presence of MetS in a group of apparently healthy individuals and those with an atherothrombotic risk. The strength of this association supports the potential presence of one or more shared pathophysiological mechanisms for both RHR and the MetS. There are multiple lines of emerging evidence which suggest that resting heart rate (RHR) is associated with the presence and/or the potential to develop cardiovascular disease -4. We haWe have currently analyzed data which has been collected during the last five years from the Tel Aviv Medical Center Inflammation Survey (TAMCIS), a registered data bank of the Israeli Ministry of Justice -13. ThisBaseline RHR was obtained manually at enrolment with one radial pulse measurement over a period of 60 seconds with the patient in a sitting position, after sitting in a quiet room for 5 minutes.The diagnosis of the metabolic syndrome was based on the National Cholesterol Education Program (NCEP) ATP III Criteria  with theBlood was drawn during the morning hours following a fasting period of at least 12 hours using a standard Vacutainer gel tube . Triglycerides, HDL-C and glucose concentration were measured using a Bayer Advia 1650 chemistry analyzer and respective Bayer kits . Blood pressure was obtained on two separate measurements following a five minute resting period.All data was summarized and displayed as mean (Standard deviation (SD)) for the continuous variables and as the number of patients (percentage) in each group for categorical variables.In order to characterize the population we divided the patients of each gender into quintiles of resting heart rate and analyzed all results accordingly. For all categorical variables the Chi-Square test was used for assessing the overall statistical significance between the quintiles, while the One-Way Analysis of Variance was used for all continuous variables as well as for calculating the P value for the linear trend between the quintiles.In order to better evaluate the magnitude of the association between each component of the MetS and the RHR, we calculated the estimated marginal means for the groups with and without each component, adjusting for age, former or never smoking status, alcohol consumption, exercise activity, oral temperature, family history of premature cardiovascular disease (CVD), use of aspirin as well as the presence of all four others components of the MetS, using analysis of covariance (ANCOVA) under a general linear model.Finally, in order to quantify the relative odds of having the MetS as a function of the quintiles of RHR, we arbitrarily defined the lowest quintile as 1.0 and calculated the adjusted odds ratio (OR) for having the MetS for each of the higher quintiles with adjustment for age, former or never smoking status, alcohol consumption, exercise activity, oral temperature, family history of CVD and the use of aspirin, using logistic regression. All above analyses were considered significant at p < 0.05 (two tailed). The SPSS statistical package was used to perform all statistical evaluation .We have currently performed a cross-sectional analysis regarding the presence or absence of the MetS in a sample of 5,106 men and 2,600 women with respective mean (SD) ages of 43 (11) and 44 (11) years. This cohort included a total of 674 males and 231 females defined as having the MetS. The baseline characteristics of both men and women in relation to quintiles of RHR are reported in Tables We have presently documented a relatively strong association between RHR and the presence of the MetS. Such a strong association might suggest that there is a shared pathophysiological pathway which is yet to be revealed. We believe therefore, that RHR is an extremely easy-to-perform and almost costless parameter which may improve the early detection of cardiovascular risk. Of special note might be the fact that even a small increment in RHR (for example from the first to the second quintile) had a clear influence on the odds of having MetS. Moreover, the prevalence of the MetS was three times higher in individuals in the fourth quintile and this was still within the \"normal\" RHR that is - to date - accepted as being between 60 and 80. Again, this might be another observation to support the notion that one should look at RHR as a continuous variable, putting into perspective the currently used normal limits.Sympathetic overactivity or parasympathetic underactivity might underly the aforementioned observation. In fact, sympathetic imbalance has been described for several of the components of the MetS including hypertension , waist cIn a previous study which solely involved men, we addressed the question of the association between RHR and the presence of microinflammatory changes . It is kResting heart rate measurements are known to be influenced by multiple factors. In the current study design, although there were multiple exclusions and statistical adjustments performed, we could not account for every factor. Thus we acknowledge several limitations to the present study. Firstly, the RHR was obtained by single measurements following five minutes of rest and not by repeated measurements. Since all of the analyses were based on this single measurement and since unconditioned individuals might require more time to return to their usual heart rate at rest, it is possible that our results were accordingly influenced. On the other hand, we believe that the large number of individuals analysed dilutes this possible effect and makes it unlikely that repeated measurements or longer resting prior to measurement would influence our results significantly. Secondly, we did not exclude patients with abnormal thyroid function, mainly because the survey does not include those measurements. We did however, exclude all individuals reporting thyroid disease or taking thyroid replacement therapy. Thirdly, we did not measure insulin levels and thus could not calculate the HOMA index. Lacking this objective laboratory parameter, we could only assume that there is a shared pathophysiological pathway and that future studies in this field might reveal what it is. Fourthly, the individuals were not evaluated routinely by echocardiography and thus we were not able to exclude individuals with a cardiomyopathy, including such a cardiomyopathy secondary to tachycardia. Due to the relatively healthy population evaluated and the large number of individuals we believe that the number of individuals with a significant cardiomyopathy included is negligible and would therefore not have influenced the results significantly. Finally, we did not exclude patients regularly performing sport activity, although we did adjust our results to their levels of physical activity. In addition, since our population is mainly referred from places of employment, there exists the possibility of \"healthy worker\" selection bias and thus generalization of the results might be limited.The question of \"normalcy\" for RHR remains. Our study does support, at least in relation to the presence of the MetS, the finding that the lower the RHR is, the lower the dysmetabolic risk. This information might be relevant if new \"normal values\" for RHR are to be determined in the future.The authors declare that they have no competing interests.OR and AS have participated in the design of the study, performed the statistical analyses and drafted the paper. SB and SI conceived the study, participated in its design and coordination and helped to draft and review the manuscript. MC, NS and OKB helped in the data organization and retrieval, English editing and final draft preparation. All of the authors have read and approved the final manuscript."}
{"text": "A decade has passed since metabolic syndrome (MetS) was documented to be highly prevalent in the kingdom of Saudi Arabia. No follow-up epidemiologic study was done. This study aims to fill this gap. In this cross-sectional, observational study, a total of 2850 randomly selected Saudi adults aged 18\u201355 years were recruited. Subjects' information was generated from a database of more than 10,000 Saudi citizens from the existing Biomarkers Screening in Riyadh Program (RIYADH Cohort), Saudi Arabia. Anthropometrics included body mass index (BMI), blood pressure, as well as waist and hip circumferences. Fasting blood glucose and lipid profile were determined using routine laboratory procedures. The definition of ATP-III (NHANES III) was used for the diagnosis of the full MetS. The overall prevalence of complete MetS was 35.3% [Confidence-Interval (CI) 33.5\u201337.01]. Age-adjusted prevalence according to the European standard population is 37.0%. Low HDL-cholesterol was the most prevalent of all MetS risk factors, affecting 88.6% (CI 87.5\u201389.7) and hypertriglyceridemia the second most prevalent, affecting 34% (CI 32.3\u201335.7) of the subjects. The prevalence of the full MetS decreased from previous estimates but remains high, while dyslipidemia remains extremely high, affecting almost 90% of middle-aged Arabs. Screening for dyslipidemia among Saudi adults is warranted, especially among those most at risk. Scientific inquiry into the molecular causes of these manifestations should be pursued as a first step in the discovery of etiologic therapies. Metabolic syndrome (MetS), which is the clinical term used for the co-occurrence of several cardiovascular risk factors, is quite prevalent in many developed nations. Al-Nozha and colleagues previously reported that MetS was almost 40% among adults in a kingdom-wide sample population taken from 1995\u20132000 In this cross-sectional community-based study, a total of 2,850 Saudi adults aged 18\u201355 years were included. Subjects were part of the capital-wide Biomarker Screening in Riyadh (BSR), a collaborative effort between the Biomarkers Research Program (BRP) of King Saud University (KSU) and the Ministry of Health in Riyadh, Kingdom of Saudi Arabia (RIYADH Cohort). Ethical approval was obtained from the College of Medicine Research Center Ethics Committee of KSU, Riyadh, KSA. In brief, BSR was launched to identify and employ novel biomarkers of chronic non-communicable diseases, including diabetes mellitus (DM), cardiovascular diseases (CVD), and obesity, among consenting Saudis. Subjects were recruited randomly from different Primary Health Care Centers (PHCC) across Riyadh. No expatriates were included in the conduct of this study. Each participating subject submitted a signed consent form, a general questionnaire containing demographic, past and present medical history, as well as diet information from the food frequency questionnaire. Subjects' information was taken from the existing database of more than 10,000 subjects (RIYADH Cohort).2).Consenting adults were invited to their respective PHCC after a 10 h overnight fasted state. Anthropometric measurements included height (cm), weight (cm), waist (cm) and hip (cm) circumferences and were taken and noted by trained nurses. Systolic and diastolic blood pressures were taken twice with a 15-minute interval. The average of both readings was recorded. Body mass index (BMI) was calculated as weight (kg) over height . This biochemical analyzer (Konelab) was calibrated routinely prior to the analysis of all serum samples using quality control samples provided . Glucose test method employed glucose oxidase and modified Trinder color reaction catalyzed by the enzyme peroxidase. Triglycerides test method employed hydrolysis, phosphorylation and oxidation leading to the formation of quinoeimine dye which is absorbed at 510 nm. HDL-cholesterol test method employed homogenous enzymatic colorimetric test by cholesterol oxidase coupled with poly(ethylene-glycol) to the amino groups. Measurement ranges were as follows: glucose (0.3\u201320.0 mmol/L); triglycerides (0.05\u201311.0 mmol/L), HDL-cholesterol (0.16\u20132.80 mmol/L). All samples fell within normal detection limits. Standard International Units (mmol/L) were used to record the results. For validation purposes, randomized samples were sent to a reference lab within the kingdom .The definition of MetS used was according to the National Cholesterol Education Program-Third Adult Treatment Panel (NCEP ATP III), three or more of the following criteria must be fulfilled: fasting blood glucose level \u22655.6 mmol/l; blood pressure \u2265130/85 mm Hg; triglycerides \u22651.7 mmol/l; HDL cholesterol <1.03 mmol/l for men and <1.29 mmol/l for women; and waist circumference >102 cm for men and >88 cm for women Statistical analysis was done using the Statistical Package for Social Sciences (SPSS) version 11.5 . Continuous variables are shown as mean \u00b1 standard deviation. Age adjustment was done with a European standard population. Frequencies were presented as percentage . MetS prevalence was presented as overall prevalence, age-adjusted prevalence and prevalence according to age.p-values 0.004, 0.001<0.001 respectively) while females had significantly higher prevalence of abdominal obesity . The over-all prevalence of MetS was 35.3% (CI 33.5\u201337.01), while an age adjusted prevalence was almost 37.0%. Low HDL-cholesterol remains the most common MetS component with almost 9 out of 10 [88.6% (CI 87.5\u201389.7)] of subjects affected followed by hypertriglyceridemia with an over-all prevalence of 34% (CI 32.3\u201335.7) . Males hThere is some improvement in the prevalence of MetS in the kingdom, particularly in Riyadh region where the study was conducted. Prevalence of MetS in urban areas was previously recorded at 44.1% (1) compared to 37.0% in the present study. The prevalence of dyslipidemia as evidenced by low HDL-cholesterol and high triglyceride levels, however, remained alarmingly high, continuing to be the most common cardiovascular risk factor among Saudi adults. High prevalence of low HDL-cholesterol was also noted among the elderly in Spain While the prevalence of MetS in males is higher, it is not significantly different from females. Similar findings were found in a recent study by Lin and colleagues, where even if a higher prevalence of MetS among males was observed, the mortality risk was greater among postmenopausal women In summary, the prevalence of the full MetS among urban Saudi adults remains high, but has considerably decreased. Prevalence of low-HDL cholesterol on the other hand remains extremely prevalent and begs for tougher measures in early intervention and further scientific exploration."}
{"text": "We have recently determined the optimal cut-off of the homeostatic model assessment of insulin resistance for the diagnosis of insulin resistance (IR) and metabolic syndrome (MetS) in non-diabetic residents of Tehran, the capital of Iran. The aim of the present study is to establish the optimal cut-off at the national level in the Iranian population with and without diabetes.Data of the third National Surveillance of Risk Factors of Non-Communicable Diseases, available for 3,071 adult Iranian individuals aging 25-64 years were analyzed. MetS was defined according to the Adult Treatment Panel III (ATPIII) and International Diabetes Federation (IDF) criteria. HOMA-IR cut-offs from the 50th to the 95th percentile were calculated and sensitivity, specificity, and positive likelihood ratio for MetS diagnosis were determined. The receiver operating characteristic (ROC) curves of HOMA-IR for MetS diagnosis were depicted, and the optimal cut-offs were determined by two different methods: Youden index, and the shortest distance from the top left corner of the curve.The area under the curve (AUC) (95%CI) was 0.650 (0.631-0.670) for IDF-defined MetS and 0.683 (0.664-0.703) with the ATPIII definition. The optimal HOMA-IR cut-off for the diagnosis of IDF- and ATPIII-defined MetS in non-diabetic individuals was 1.775 . The optimal cut-offs in diabetic individuals were 3.875  and 4.325  for ATPIII- and IDF-defined MetS, respectively.We determined the optimal HOMA-IR cut-off points for the diagnosis of MetS in the Iranian population with and without diabetes. Insulin resistance, which represents a reduced physiological response of the peripheral tissues to the action of the normal levels of insulin, is amajor finding in several metabolic disorders, including type 2 diabetes and metabolic syndrome (MetS) . TherefoThe homeostasis model assessment of insulin resistance (HOMA-IR), which is developed for application in large epidemiologic investigations , is an aPopulation-based studies for defining cut-off values of insulin resistance for diagnosis of MetS are limited. In this study, we sought, for the first time, to evaluate the distribution and optimal cut-off value of HOMA-IR for identifying MetS in a Middle Eastern population with and without diabetes.The data obtained from the third National Surveillance of Risk Factors of Non-Communicable Diseases in Iran (SuRFNCD-2007)  were anaWeight and height of participants were determined in light clothing and without shoes. Portable calibrated electronic weighing scale and portable measuring inflexible bars were used. Waist circumference was measured using constant tension tape at the end of a normal expiration, with arms relaxed at the sides, at the midpoint between the lower part of the lowest rib and the highest point of the hip on the mid-axillary line. Body mass index (BMI) was calculated as weight (in kilograms) divided by height (in meters) squared. Blood pressure was measured with a calibrated Omron M7 sphygmomanometer (HEM-780-E). The mean value of three measurements, made at intervals of 5 minutes, was used for analysis. Blood samples were collected following 12 h overnight fast. Fasting plasma glucose was measured by the enzymatic colorimetric method using glucose oxidize test . Serum total cholesterol, triglyceride, and high density lipoprotein-cholesterol (HDL-cholesterol) were determined by enzymatic methods . Low density lipoprotein-cholesterol (LDL-cholesterol) was calculated using the formula of Friedewald et al. . When se2 were defined as normal subjects .MetS was defined according to the Adult Treatment Panel III (ATPIII)  and Inte2 + (1 - specificity)2] were calculated ), and the point with shortest distance value form the point  [(1 - sensitivity)lculated . These alculated . We alsoPrimary analyses were performed without covariate adjustment to reflect standard use of blood test results in clinical practice. Subsidiary analyses of surrogate measures considered additional adjustment for age and sex. To control whether this would lead to over-fitting HOMA-IR in statistical models, analyses were repeated with fasting insulin as an alternative to HOMA-IR. For fasting insulin, we also considered additional adjustment for fasting glucose (to assess adjusted discrimination compared with discrimination using HOMA-IR). For each surrogate measure, we compared the ROC of the fuller model with that of the sparser model. P < 0.05 was considered statistically significant.Table S1; Additional file Age and sex distribution of HOMA-IR cut-offs from the 50th to the 95th percentile along with their corresponding sensitivity and specificity for the diagnosis of IDF-MetS in non-diabetic and diabetic individuals are shown in Tables S2 and S3  for ATPIII-defined MetS and 4.325 for IDF-defined MetS .As depicted in Figure ROC analyses showed that the diagnosis of MetS is made more accurately by using HOMA-IR than fasting insulin. Insulin resistance (using any surrogate) or fasting insulin predicts ATPIII-defined MetS more accurately than IDF-defined MetS. For example, the HOMA-IR AUC (95% CI) for IDF-defined MetS was 0.650 (0.631-0.670) compared with 0.683 (0.664-0.703) for ATPIII-defined MetS. One reason that fasting insulin underperformed HOMA-IR is that information about plasma glucose is contained within the latter measure. Additional adjustment for age and sex was performed in subsidiary analyses. This did not influence the accuracy of MetS diagnosis by both definitions, i.e. crude versus age- and sex-adjusted ROCs (for both HOMA-IR and fasting insulin models) had statistically equal performance. Adjustment for fasting glucose decreased the accuracy of MetS diagnosis by both HOMA-IR and fasting insulin (data not shown).We demonstrated that the risk of MetS increased with rising HOMA-IR percentiles. The optimal cut-off point of HOMA-IR for the diagnosis of MetS in our population was estimated to be 1.775 in non-diabetics and around 4 in diabetic patients. In line with previous population-based studies ,31, we fHOMA-IR, developed in 1985 by Matthews and co-workers , was useFor inter-population comparisons, it is necessary to know normal values of HOMA-IR for each population. Although HOMA-IR has been widely used, there is hardly any consensus on the cut-off points for classification of insulin resistance. Some authors have tried to find HOMA-IR cut-offs in subjects who had increased tendencies toward insulin resistance or MetS, but their findings were not consistent -18. TablDifferent cut-off points might be selected to optimize sensitivity versus specificity depending on the purpose. A screening test requires high sensitivity and moderate specificity, whereas a diagnostic test requires a much higher specificity. Although insulin resistance may be at the core of the cluster of metabolic abnormalities that characterizes MetS, our data suggest that MetS, defined by conventional criteria, is not always synonymous with insulin resistance ,38. The The prevalence of MetS in our sample was 33.6% and 34.8% for ATPIII and IDF definitions, respectively. Our results regarding MetS prevalence, insulin levels, and HOMA-IR values suggest that women have a higher propensity to insulin resistance. The available reports on the prevalence of MetS show variable results 23%-40%), depending on ethnicity and the criteria used %, depend, the higIn conclusion, we showed that risk for MetS increases with increasing HOMA-IR percentiles. The optimal cut-off point of HOMA-IR for MetS diagnosis is 1.775 in non-diabetics and approximately 4 in diabetic individuals. Further prospective studies are warranted to elucidate the performance of these cut-offs in predicting incident diabetes or cerebrovascular disease in our country. A fairly large proportion of our participants were excluded because of missing lab results. Although excluded participants were randomly scattered across age, sex, BMI, and residential area categories of SuRFNCD-2007, and their exclusion is thus unlikely to have caused a significant problem in our analysis, this can be considered as a limitation of our study and is to be addressed in future work.The authors declare that they have no competing interests.AE participated in the design of the study and interpreted the results. HA and OK participated in statistical analysis, interpreted the results, and wrote the manuscript. AZ helped with statistical analysis and writing the manuscript. MN and AR interpreted the results and wrote the manuscript. MH and FA participated in the design of the study and conducting it. All authors read and approved the final manuscript.Supplementary Tables 1-4. Table S1 - Clinical and laboratory characteristics of participants, Table S2 - Age and sex distribution of HOMA-IR values in non-diabetic subjects . Table S3 - Age and sex distribution of HOMA-IR values in diabetic subjects (n = 366). Table S4 - Summary of reports (sorted by sample size) on HOMA-IR cut-off in different populations.Click here for file"}
{"text": "COMMUNICATION \u2013 DIALOGUE \u2013 CO-OPERATION \u2013 SOLVING PROBLEMSThese are the words of nowadays Europe. Such approaches should be used in broad spectrum of life as well as in toxicology. It is therefore admirable that EUROTOX commissars, mainly past-president Prof. Liesivuori, invited all heads of European toxicological societies to discuss current issues of toxicology in Europe during IUTOX meeting held in Barcelona in July 2010. Renowned scientists and regulatory officers from Government, Industry and Academia made appearance and talked about contribution of toxicological research to society, importance of communication and education. The strategic meeting was successful. Prof. Liesivuori expressed gratitude to all delegates for the great suggestions and key findings resulting from the brainstorming sessions conducted during the meeting. Majority of delegates agreed that education in toxicology and related fields is the top priority for future. Communication towards society, in the sense of explaining possible risks, should be an important concern as well.I can only hope for success and wish for better and safer future\t\tTaking a good example from EUROTOX, on the verge of summer the Slovak Toxicology Society SETOX organizes meeting of the toxicological societies from the Central Europe, i.e. Slovak, Czech, Polish, Austrian and Hungarian societies of toxicology. First positive step was done by Visegrad Fund and Federation of European Toxicologists & European Societies of Toxicology, which supported this meeting. It is essential for successful co-operation to establish strong connections, which can be further crucial for meaningful and highly profitable information to society."}
{"text": "Metabolic syndrome (MetS) is a cluster of four major obesity-related risk factors for cardiovascular disease (CVD). Russia has one of the highest CVD mortality in the world, but its association with MetS remains unknown. Also little is known about factors associated with MetS and its components in Russia.Data on 3555 adults aged 18-90 years were collected in a cross-sectional study in 2000. MetS was defined by the International Diabetes Federation (IDF) and National Cholesterol Education Program (NCEP) criteria. Sex-specific associations between the IDF-defined MetS, its components, and life-style, socio-economic factors and laboratory indicators, were analysed using multivariable Poisson regression. Vital status of the study participants was identified by July 2009. Sex-specific associations between MetS and stroke, Coronary Heart Disease (CHD), CVD and all-cause death, were studied by Poisson regression adjusted for age, smoking, alcohol and history of CVDs.After adjustment for all studied factors except BMI, age, serum GGT, C-reactive protein and AST-to-ALT ratio were associated with MetS in both genders. Additionally, MetS was associated with sedentary lifestyle in women and with smoking in men. In the same regression model drinking alcohol 2-4 times a month and consumption of five or more alcohol units at one occasion in men, and drinking alcohol 5 times or more a month in women were inversely associated with MetS. After a 9-year follow-up, MetS was associated with higher risk of death from stroke  and from either stroke or myocardial infarction  in men. No associations between MetS and any of the studied causes of death were observed in women.Factors associated with MetS in both genders were age, GGT, C-reactive protein, and AST-to-ALT ratio. Moderate frequency of alcohol consumption and binge drinking in men and higher leisure time physical activity in women, were inversely associated with MetS.Positive associations between MetS and mortality were only observed for deaths from stroke and either stroke or MI in men. The metabolic syndrome (MetS) is a cluster of four major cardiovascular disease (CVD) risk factors; obesity, insulin resistance (hyperglycemia), arterial hypertension and dyslipidemia where obesity and insulin resistance are the core elements . Other iMetS is associated with increased CVD and all-cause mortality ,4. MoreoThe prevalence of MetS is associated with life-style, demographic, socio-economic, and genetic factors. Age, body mass index, postmenopausal status, diet rich in saturated fats, carbohydrates, and smoking have been positively associated with MetS, while inverse associations have been shown for physical activity, education, income, and alcohol intake ,10-12.Cardiovascular mortality in Russia is about four times higher than in Western Europe and the gap is the largest among middle aged men . AlthougDespite the fact that determinants of MetS and its contribution to mortality in Europe and North America receive much attention by the research community, it remains one of the least studied factors in Russia. In an earlier study we showed that while the prevalence of MetS among Russian women in 2000 was comparable with findings from other European countries, among men it was a half of that .The aim of this study was to further explore the data collected in 2000 by studying socio-demographic and lifestyle correlates of MetS and associations between the MetS and CVD-and all-cause mortality after 9 years of follow-up.The data were obtained from a cross-sectional population-based study conducted in 2000 in Arkhangelsk, Northwest Russia. Detailed information on study design, sampling procedure and data collection is presented elsewhere -19. In bData on education, occupational status, use of medications, history of myocardial infarction (MI), diabetes mellitus, and stroke as well as typical patterns of leisure time physical activity, smoking, frequency and amount of alcohol consumption, frequency of fresh fruits and vegetables intake with no specified time-frames were collected using a 6-page comprehensive questionnaire. Blood pressure (BP) was measured three times. The average of the two last readings was used in the study. Waist circumference (WC) was measured at the umbilical level. Weight and height were measured with subjects in light clothing and without shoes. Venous blood samples were drawn and centrifuged within 15-25 min. Most of the participants fasted prior to testing.Enzymatic colorimetric tests were used to measure TC  and TG . HDL-C was measured by a homogenous enzymatic colorimetric test . All biochemical analyses of serum lipids were performed using a Hitachi 737 analyzer. Gamma-glutamyltransferase (GGT) was measured by an enzymatic colorimetric test . Aspartate-aminotransferase (AST) and alanin-aminotransferase (ALT) were measured photometrically by Hitachi 917 analyzer. Serum C-reactive protein (CRP) was measured by particle-enhanced immunoturbidimetric assay in a Roche Modular P analyzer . Glycated hemoglobin (HBA1c), which reflects the mean glucose level over the preceding 2-3 months, was assessed by Bio-Rad Variant II HPLC system with reagents from Bio-Rad Laboratories .The inter-assay and intra-assay coefficients of variation for all laboratory tests were under 3%.MetS was defined according to the International Diabetes Federation (IDF)  and Nati2, respectively. As the distribution of the liver enzymes and CRP was right-skewed, we used logarithmically transformed values in the regression models.Education was divided into 3 categories: low (primary or secondary school), average  and high (complete university education). As income level was difficult to determine due to high inflation and collapsing economy due to the crisis and default in 1998-99, we used data on self-reported occupational status as a \"surrogate\" measure for income. Income level was defined according to official data on average salary levels in different sectors of the economy for year 2000 . Five caAltogether 150 individuals had missing data on one or more variables and were excluded from the analyses. The final sample consisted of 3555 individuals (1918 men and 1637 women) aged 18-90 years or 96% of the initial sample.Differences in the distribution of the studied characteristics between genders were studied by Pearson's chi-squared tests and unpaired t-tests for categorical and continuous data, respectively. Gender-specific associations between MetS defined by the IDF criteria, its individual components and socio-demographic, lifestyle and metabolic factors were calculated using Poisson regression with robust variance estimates as recommended by Barros and Hirakata , and areIn July 2009 we collected data on the vital status of all study participants, using the mortality register of the Arkhangelsk Regional Healthcare Department which is based on data from medical death certificates. Causes of death were coded using the International Classification of Diseases, 10th Revision (ICD-10). The study end-points were: death from coronary heart disease (CHD) (I20-25); death from stroke (I60-64); death from either myocardial infarction (MI) or stroke ; CVD death (I00-99); and all-cause death. By July 2009, 200 subjects of the 3555 participants had died and in 97 of the cases (48%) the diagnosis was verified by autopsy. To study associations between MetS in 2000 and mortality by 2009, we used both IDF and NCEP definitions of MetS to increase comparability of the findings with other studies. Gender-specific risk ratios (RR) were calculated by Poisson regression.All analyses were performed using STATA 10 . The study was approved by the Regional Ethical Committee in Norway.Participants' background characteristics and the prevalence of MetS are presented in Table Among men, MetS was positively associated with age, BMI, sedentary lifestyle, GGT and CRP; and inversely associated with income, smoking, frequency and amount of alcohol intake as well as the AST-to-ALT ratio in the crude analysis. After adjustment for all studied factors except BMI, the associations between MetS and income disappeared. Additional adjustment for BMI attenuated most of the associations except the positive association with age, and inverse associations with the AST-to-ALT ratio, frequency and amount of alcohol consumption Table .In women, MetS was positively associated with BMI, age, very low income, sedentary lifestyle, GGT and CRP, and inversely associated with education, unknown income category, smoking, frequency and amount of alcohol consumption as well as AST-to-ALT ratio in crude analysis. After adjustment for all study factors except BMI, the associations between MetS and income, education, smoking and alcohol disappeared. After further adjustment for BMI, only age, sedentary lifestyle, GGT and CRP remained associated with MetS.In the multivariable analysis of the MetS components Table , frequenSerum levels of GGT and CRP in women were positively related to all five metabolic components Table . High seMetS as defined by the IDF criteria was associated with more than 6 times higher risk of death from stroke among men after 9 years of observation in Table , Model 1The risk of cardiovascular death was almost 2.5 times higher both in men and women with MetS Table , Model 1To the best of our knowledge this is the first study in Russia on determinants of MetS and its association with all-cause and cardiovascular mortality. The main findings suggest that frequency of alcohol consumption and amount of alcohol consumed at one drinking episode are important correlates of MetS in Northwest Russia. Age, sedentary lifestyle and liver enzymes were also associated with MetS independently of all other studied factors. Moreover, MetS was associated with increased risk of death from stroke and either stroke or myocardial infarction among men during the 9-year observation period. The study discloses sex-specific adjusted relationships between frequency and volume of alcohol consumption in Russia , but this association disappeared after adjustment. However, smoking was positively associated with dyslipidemia in both genders and inversely with central adiposity in men. These findings are consistent with previous research suggesting that nicotine increases the energy expenditure, reduces the appetite and stimulates the lipolysis, thus decreasing the risk for obesity . On the Increased serum levels of GGT, CRP and low AST-to-ALT ratio turned out to be independently associated with high metabolic risk, similarly to what has been observed in previous research,24-26. TMetS was associated with an increased risk of stroke-, either stroke or MI-, CVD-and all-cause death during the 9 year follow-up. After adjustment for age and other potential confounders, the risk was still more than 3 times higher for a fatal stroke and more than 2 times higher for death from either stroke or MI among men with MetS. The lack of significant associations between MetS and, CVD-, and, particularly, CHD-death in the adjusted analyses, might be due to heterogeneity of these diagnostic groups. The CHD, for example, included not only diagnoses of fatal myocardial infarction (I21-23) which are clinically well-distinguishable, characterized by progressing atherosclerosis and pathogenetically close to relatively homogenous and clinically well-defined group of cerebral strokes (I60-I64), but also such vaguely defined conditions as \"other forms of acute or sub-acute ischemia\" (I24) and \"chronic ischemic heart disease\" (I25). The latest evidences from Russia suggest that alcohol is an important factor implicated in the pathophysiology of the former two causes of death, and that some deaths within these subgroups are actually caused by acute alcohol intoxication or alcohThus, as a cluster of four major CVD risk predictors, MetS represents one of the factors contributing to the high cardiovascular mortality in Russia, but it is unlikely that it plays a central role at present. Following the improvements of living conditions during the last decade, the latest state's anti-alcohol initiatives launched in 2006, and the recent increase in life-expectancy , the preAge, GGT and C-reactive protein, and AST-to-ALT ratio were associated with MetS in both men and women. High leisure time physical activity in women and moderate frequency of alcohol consumption and binge drinking in men were inversely associated with MetS. Differences between men and women in alcohol consumption may explain gender variation in the MetS prevalence. MetS increased the risk of death from stroke and from either myocardial infarction or stroke during the 9-year follow-up period in men while no associations with mortality were found in women.The authors declare that they have no competing interests.OS and ON planned the study and were responsible for collection of data. OS and AG performed data analysis. OS drafted the manuscript, which was further elaborated by AG and ON. All authors read and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/582/prepub"}
{"text": "The Metabolic syndrome (MetS) is a cardiovascular risk factor of public health significance and of recent has become a topical issue. The prevalence of diabetes mellitus (DM) is on the increase and with this scenario, a possible increase in burden of DM which may be largely attributed to cardiovascular complications is expected. The objective of this report is to determine the prevalence of the MetS and compare gender characteristics in subjects with type 2 DM.Subjects with type 2 DM were recruited from an urban hospital for the study. Clinical data was obtained by interviewing the patients and referring to their Case folders. The anthropometric indices and blood pressure measurements were documented. Laboratory parameters analysed for included total cholesterol, high density and low density cholesterol, triglyceride and glycosylated haemoglobin. Statistical analysis included usage of Student's t test and chi square.963 patients with type 2 DM aged between 35-85 years were recruited for the study. The main outcome measures included the prevalence of the metabolic syndrome and the gender differences of its components. The prevalence of the metabolic syndrome was 86%. The frequency of occurrence of the MetS was similar for men (83%) and women (86%) and increased with age in both sexes. The prevalence of MetS increased from 11% among participants aged 20 through 29 years to 89% in participants aged 70 through 79. In our patients with DM, the commonest occurring and least detected MetS defining parameters are central obesity and elevated triglyceride levels respectively. The components of the MetS that differed significantly in both sexes was HDL-C. The combination of the components of the MetS were comparable in both genders and 5.8% of the subjects with the MetS had all components of the MetS.The prevalence of the MetS in type 2DM is high in both genders and increases with age thus posing a potential high cardiovascular risk in this group of patients. The modifiable risk factors for the MetS should be a focus point in the management of subjects with type 2 DM, The metabolic syndrome (MetS) is a cluster of cardiovascular risk factors that is characterized by obesity, central obesity, insulin resistance, atherogenic dyslipidemia, and hypertension. AlthougThe prevalence of metabolic syndrome increases with increasing glucose intolerance  and withIn Nigeria, DM is an emerging non-communicable health problem as its prevalence is on the increase. The reported prevalence rates of MetS in Nigerians with and without DM are 22% and 59% respectively.Published reports differ in the gender distribution of the MetS. Whilst some researchers report a higher incidence of the MetS in men ,10 than Subjects with type 2 DM were recruited from the General hospital Gbagada and the Lagos state University Teaching hospitals, Lagos for the study. This report is part of a recent study on lipid profile in DM by the author . DetailsLaboratory assessment included obtaining venous blood samples in a fasted state for the determination of components of the lipid panel , blood glucose and glycosylated haemoglobin levels (HBA1c). Serum glucose was measured using glucose-oxidase method and lipid profile by enzymatic-colorimetric method. Ethical approval was obtained from the Ethical committee of both hospitals and informed consent was obtained from the study subjects.The presence of the metabolic syndrome was determined using the new definition. The preA total of 973 patients with diabetes mellitus were recruited for the study. The females and males were 703 and 260 in number respectively.The mean age of the study subjects was 58.6 10.5) years and the female:male ratio was 3:1. Smoking and alcohol histories were documented in 83 (9%) and 208 (21%) of the subjects. Hypertension was a notable feature which was present in 572 (59%) of the subjects. A summary of the clinical parameters of the study subjects is shown in Table 0.5 years2 vs 27 kg/m2 p = 0.0001, 7 vs 6.5, p = 0.03). The mean HBA1c, Low density lipoprotein (LDL-C) and total cholesterol (TCHOL) were also significantly higher in females than males respectively .A comparison of the clinical and biochemical parameters of both sexes showed that the mean BMI and duration of DM of the female subjects were significantly higher than those of the males  were on oral hypoglycaemic agents, 64 (7%) were on insulin and 108 (11%) and 9(1%) respectively were on combination of insulin and OHA and sole dietary management respectively.The total number of the subjects with the metabolic syndrome was 834 thus giving a prevalence rate of 86%. The most prevalent risk factor was abdominal obesity. The proportions of the defining parameters of MetS are shown in Table 2The distribution of the components of the metabolic syndrome is depicted in Figure For two components, the most frequent combinations were central obesity and reduced HDL-C (51.6% in women and 57.5% in men), for three components, the most frequent combinations were central obesity, hypertension and reduced HDL- (42.2% in women and 37.8% in men) and for four components (6.2% in women and 4.5% in men).The proportion of the males with the MetS was comparable to that of the females with the MetS  The mean duration of DM was comparable in both sexes (7.1(6.2) vs 6.5(6.6) p-0.1). The overall prevalence of hypertension was 67% and the proportion of females with it was significantly higher than that of the males. . Smoking and alcohol histories were documented more in males than females and these differences were statistically significant (for smoking 11 (2%) vs 60 (27%) p 0.0000001. alcohol history (71 (12%) vs 105 (47%) p-0.00001)The pattern of lipid abnormalities showed that elevated LDL-C and reduced HDL-C were the commonly documented lipid abnormalities. This is shown in Figure The frequency of occurrence prevalence of the metabolic syndrome increased with age. The proportions of subjects with the metabolic syndrome in each age class is shown in Table 3The age specific distribution of the MetS was comparable in both genders except in ages 70 through 79.9. These results are shown in Figure The proportion of women with the MetS who had elevated blood pressure was significantly higher than men who had same (431 (76% vs 135 (61%), p = 0.01). Females with the metabolic syndrome tended to have higher total cholesterol and LDL-cholesterol than the males with the metabolic syndrome. A comparison of other clinical and biochemical parameters in both genders with the MetS is shown in Table 4The subjects with the metabolic syndrome tended to be older and their mean LDL-C was higher than that of the subjects without the metabolic syndrome. The clinical and biochemical parameters are shown in Table The MetS is a cluster of cardiovascular risk factors including obesity, hypertension and dyslipidaemia that increases the risk of the development of type 2 diabetes mellitus and cardiovascular disease. The risk factors of MetS include obesity, aging, sedentary lifestyle, diabetes mellitus, coronary heart disease and lipodystrophy ,15. It iThere are currently two major definitions for metabolic syndrome and these are provided by the International Diabetes Federation and the The components of the metabolic syndrome vary in their rates of occurrence. The Seychelles study reThe pattern of lipid abnormalities in this study was such that LDL-C although not a component of MetS was the commonest documented lipid abnormality in subjects with the MetS. The occurrence of elevated LDL-C in people with the Mets has been noted to increase the magnitude of the risk for developing coronary artery disease. I reporGender differences were also documented in the occurrence of hypertension in the metabolic syndrome. We report a prevalence rate of hypertension of 67%. This is similar to reports to reports from the Middle East and NigeAlthough each of the components of the metabolic syndrome individually have been identified as risk factors for cardiovascular disease, an individual with three or more components is at particularly high risk. I report a comparable distribution of the components of the MetS in both sexes. A small proportion-5.8% -of our subjects with type 2 DM have all the components of the MetS. This is in contradistinction to the report by Fezeu et al who repoA comparison of biochemical parameters other than those that define the MetS in both sexes showed that subjects with the MetS were significantly older, had higher body mass indices and higher low density cholesterol than those without the MetS.This study has shown the unacceptably high prevalence rate of MetS in both sexes with type 2 DM thus predicting a high disease burden of type 2 DM from possible cardiovascular complications.The authors declare that they have no competing interests.AOO designed the study, participated in data collation, statistical analysis, funding and writing the draft of the manuscript"}
{"text": "Although diabetic patients have an increased rate of cardio-vascular events, there is considerable heterogeneity with respect to cardiovascular risk, requiring new approaches to individual cardiovascular risk factor assessment. In this study we used whole body-MR-angiography (WB-MRA) to assess the degree of atherosclerosis in patients with long-standing diabetes and to determine the association between metabolic syndrome (MetS) and atherosclerotic burden.Long standing (\u226510 years) type 1 and type 2 diabetic patients  were examined by WB-MRA. Based on the findings in each vessel, we developed an overall score representing the patient's vascular atherosclerotic burden (MRI-score). The score's association with components of the MetS was assessed.2 = 0.24, p = 0.038). Finally, using an established risk algorithm, we found a significant association between MRI-score and 10-year risk for CHD, fatal CHD and stroke.The median MRI-score was 1.18 [range: 1.00-2.41] and MetS was present in 58% of the cohort . Age (p = 0.0002), HDL-cholesterol (p = 0.016), hypertension (p = 0.0008), nephropathy (p = 0.0093), CHD (p = 0.001) and MetS (p = 0.0011) were significantly associated with the score. Adjusted for age and sex, the score was significantly (p = 0.02) higher in diabetics with MetS (1.450 [1.328-1.572]) compared to those without MetS (1.108 [0.966-1.50]). The number of MetS components was associated with a linear increase in the MRI-score (increase in score: 0.09/MetS component; rIn this high-risk diabetic population, WB-MRA revealed large heterogeneity in the degree of systemic atherosclerosis. Presence and number of traits of the MetS are associated with the extent of atherosclerotic burden. These results support the perspective that diabetic patients are a heterogeneous population with increased but varying prevalence of atherosclerosis and risk. Today diabetes mellitus is often classified as a coronary heart disease (CHD) equivalent , which hHence the MetS has become the center of an intensive debate due to different and changing definitions, lack of a unifying pathophysiological concept, disputed predictive value regarding CHD and uncertain specific therapeutic consequences ,15,16. WPreviously we have used whole-body magnetic resonance angiography (WB-MRA) in patients with long-standing type 1 or type 2 diabetes to obtain comprehensive vascular imaging (except coronaries) . In our The original study included 65 patients with type 1 (T1DM) or type 2 (T2DM) diabetes of more than 10 years which was published previously . The par2 to avoid nephrogenic systemic fibrosis (NSF) [Inclusion criteria were diagnosis of type 1 or type 2 diabetes mellitus of >10 years duration. Exclusion criteria were pregnancy, allergic reaction to Gadolinium-chelates and a creatinine clearance <30 ml/min per 1.73 mis (NSF) . CreatinAt the time of inclusion, a number of parameters were registered including age, sex, type and duration of diabetes, smoking history, body mass index (BMI), blood pressure, HbA1c, triglycerides, low density lipoprotein (LDL)-cholesterol, high density lipoprotein (HDL)-cholesterol and creatinine. CHD status was assessed, defined as documented history of myocardial infarction, stenosis of >50% on coronary angiogram, coronary intervention or bypass grafting. All patients received the whole body MRI in the Department of Radiology within 3 months after recording the above mentioned parameters.2) was used instead of waist circumference. MetS was diagnosed when in addition to diabetes two or more of these traits were present.The MetS was identified according to the definition of the American Heart Association and the National Heart, Lung, and Blood Institute (AHA/NHBLI) : triglyc\u00ae .MR imaging studies were performed as described previously on a 1.5 T and 3 T whole body MR system  equipped with 32 receiver channels . Twelve First a time-of-flight (TOF)-MR angiogram of the cerebral arteries with a spatial resolution of 0.7 \u00d7 0.5 \u00d7 0.7 mm was acquired. Then 3D-Gd-MR-angiography of the carotids , the abdominal aorta , the thighs , the calves and pedal arteries  was obtained. The same scanning parameters and spatial resolutions were used at 1.5 T and 3 T. A time-resolved CE-sequence of the lower calf and pedal arteries  was performed after repositioning the patient in order to compensate for a shortened range of table movement in the Magnetom Trio and to increase diagnostic accuracy.The MR exams of the diabetic group were evaluated by two experienced radiologists who were blinded to all clinical information, in a consensus reading. The cases were presented in groups of five cases per reading session in randomized order over a time period of four weeks. MRA data sets were evaluated by multiplanar reformats (MPR) and small volume maximum intensity projections (thin MIP) for detection of stenosis as well as volume-rendering (INSPACE) for detection of anatomic variants. There were 22 segments analyzed and all but the abdominal aorta and circle of Willis were bilateral . They inAs previously published we have created a new scoring system for the degree of atherosclerotic disease burden found in the diabetic patients, entitled the \"vessel score\" . The vesContinuous variables were described with mean \u00b1 standard deviation or median and range. Chi-squared tests were used to test for simple associations between dichotomous variables. Correlation between continuous variables was tested with the Spearman rank correlation. Differences between the mean were tested with a t-test. A general linear model (GLM) was used to test for associations between the score and other variables after adjustment for age and sex. A p-value of <0.05 indicated significance. SAS 9.1 was used for statistical evaluation.Fifty nine patients  with long standing  type 1 (n = 19) or type 2 (n = 40) diabetes were examined by MRA .MetS was present in 58% (n = 34) of the patients  with no sex difference. Patients without MetS were considerably younger (56 \u00b1 16 yr vs. 69 \u00b1 8 yr). All patients with the MetS had hypertension or anti-hypertensive medication due to diagnosed hypertension, 26 had high triglycerides, 22 had low HDL-cholesterol and 14 patients had a BMI >30 kg/m2 = 0.24, p = 0.038 adjusted for age and sex, figure Patients with MetS had a higher mean score than those without MetS . This association remained significant (p = 0.02) after adjustment for age and sex. Furthermore, we found a dose-response relationship between the number of MetS components and the MRA-score  risk engine . ConsistDuring the last 10 years the classification of diabetes as a CHD equivalent has helped to improve standards of diabetes care by underlining the importance of cardiovascular risk factor management . HoweverDespite the general high risk of the population with an average diabetes duration of 20.7 years and additional cardiovascular risk factors in many patients, we found very pronounced differences in the degree of atherosclerotic burden. The WB-MRA based score ranged from 1.00 to 2.41 with a median of 1.18. More than one third of the population (n = 22) had a score value of 1.00, indicating that these patients had no atherosclerotic changes or at most wall irregularities in all scanned vessels. In contrast, all patients with a score above 2.0 (n = 5) had at least 3 completely occluded vessels and several other stenotic lesions. These results are in line with the perspective of diabetic patients as a heterogeneous population with increased but variable prevalence of atherosclerosis and cardiovascular events ,26.In our study population a high score was significantly associated with age, HDL-cholesterol, MetS and CHD status. The number of components of the MetS was associated with a linear increase in the MRI-score. Furthermore, consistent with previous reports evaluating MRI-based atherosclerosis scores ,28, a hiDespite significant progress in recent years with respect to risk factor modification particularly through the use of lipid lowering agents and drugs targeting the renin-angiotensin system , severalThere are several limitations to our study. First the prognostic significance of the detected vascular lesions is uncertain, due to the lack of follow up data. The association with the UKPDS risk calculations also must be interpreted with caution since the risk engine is not validated for a diabetes duration of >20 years and has an uncertain validity for patients with established cardiovascular disease, although only patients with acute cardiovascular disease were excluded in the original UPKDS study . FurtherIn conclusion our results contribute further evidence to the perspective of diabetic patients as a heterogeneous population with increased but varying prevalence of cardiovascular disease and risk. In our study, presence of the Metabolic Syndrome and the number of its traits helped to identify those patients with the largest atherosclerotic burden. Further research is needed to improve the characterization of risk in diabetic patients and to adapt the treatment guidelines to different risk classes.The authors declare that they have no competing interests.HMF recruited study participants, collected patient history, performed data analysis, and drafted the manuscript. SW and SOS performed MRA data analysis and participated in designing the study, and critically revising the manuscript. RS performed the statistical analysis. MR participated in designing the study and revising the manuscript. KGP participated in designing the study, data analysis, performing the statistical analysis, and drafting the manuscript. All authors read and approved the final manuscript."}
{"text": "This Finnish population-based study, mean age 46 years, evaluates the association of high-sensitivity C-reactive protein (hs-CRP), interleukin-1 receptor antagonist (IL-1Ra), andadiponectin with the NCEP and IDF definitions of metabolicsyndrome (MetS). Adiponectin levels were higher, hs-CRP and IL-1Ralevels lower in subjects without MetS compared to subjects withMetS. If MetS was present according to both IDF and NCEP criteria,BMI, waist, triglycerides, hs-CRP, and IL-1Ra were significantlyhigher compared to subjects who had MetS according to either onlyIDF or only NCEP criteria. The hs-CRP, IL-1Ra, and adiponectin linearlycorrelated with the number of the components of MetS according toboth definitions. Decreased levels of adiponectin and increasedlevels of hs-CRP and IL-1Ra are tightly associated with thecomponents of MetS. Individuals who had MetS according to bothcriteria had the most adverse changes in cardiovascular riskfactors. Metabolic syndrome (MetS) means a clustering of multiple cardiovascular risk factors in an individual. Several definitions of this syndrome have been presented. The first definition was given by the World Health Organization (WHO) in 1999. Theprimary aim of this definition was to identify individuals with high risk for cardiovascular disease (CVD) [The National Cholesterol Education Program (NCEP) Adult Treatment Panel III introduced a new definition for the MetS in 2001 [ociation . The purociation , 5. It iAdipose tissue has also shown to be an active endocrine organ secreting many hormones and mediators regulating glucose metabolism and the risk of CVD. One of these hormones is adiponectin that has been found to be decreased in individuals with obesity, the MetS, and type-2 diabetes , 7. AdipObesity is an inflammatory condition which may lead to chronic activation of the innate immune system, which in turn could cause a progressive impairment of glucose tolerance and lead to diabetes or CVD , 10. In criteria . Based ocriteria , 20.Interleukin-1 receptorantagonist (IL-1Ra), a naturally occurring antagonist of the proinflammatory cytokines IL- process , and it  process . IL-1Rary state . Thus, lNo previous studies have been published on the role of hs-CRP, IL-1Ra, and adiponectin in relation to different definitions of the MetS in the same population. The aim of the present study was to evaluate the inflammatory differences and associations between the inflammatory markers and adiponectin with the MetS according to the NCEP and the IDF definitions.Thestudy population consisted of middle-aged Caucasian subjects Altogether 923 of 1294 subjects  100 methods . Glucose concentration was measured by automated colorimetric method. Serumcholesterol and triglycerides were measured from fresh serum samples withenzymatic colorimeter methods . Serum HDL cholesterol was measured using the same methods afterthe precipitation of low-density cholesterol and very low-density lipoprotein cholesterol byphosphotungstic acid and magnesium.Serum adiponectin was determinedwith an enzyme immunoassay . Plasma concentration of IL-1Ra was measured withhigh-sensitivity assay kits from R&D Systems. hs-CRP wasmeasured with an Immulite analyzer and a DPC high-sensitivity CRP assay(hs-CRP). Adiponectin, hs-CRP, and IL-1Ra were measured in 2002 at thesame time. Before this measurement, the samples werefrozen andstored atIn this study, we used the quantitative insulin sensitivitycheck index (QUICKI) as a marker of insulin sensitivity. It is an alternativemethod to measure insulin sensitivity in large population studies and wascalculated as follows: QUICKI = 1/(log FPI + log FBG), where FPI = fastingplasma insulin level expressed as mU/l, and FBG = fasting plasma glucose levelexpressed as mg/dL .The results are expressed as meanropriate . Theagrf \u03ba>0.80 .Altogether 923 of 1294 invited subjects  compared to subjects who had the MetS according to only one definition. Furthermore, the only-IDF definition group of the MetS had higher levels of hs-CRP and IL-1Ra compared tothe group with only-NCEP definition, probably due to abdominalobesity as the central criterion for the syndrome. The same strongerrelationship with the IDF definition compared to the NCEP was found in Chinespopulation with hs-CRP . SubjectExcess adipose tissue can contribute to inflammation inseveral ways. First, ectopic fat storage induces lipotoxicity promotingintracellular inflammatory response or altered adipokine production . Second,Our study confirmedthat levels of adiponectin, hs-CRP, and IL-1Ra were similarly and linearlycorrelated with the number of components of the MetS according to the IDF andNCEP definitions in both genders. Similar results have been reported previouslywith respect to levels of hs-CRP ,34, 35 The prevalence of the MetS was  Finland. The preThe strength of our study is that it includes asubstantial number of subjects selected from 5 different age groups without anyexclusion criteria in the same town. Therefore, we could reliably compare thecorrelations of IL-1Ra with hs-CRP and adiponectin in the same studypopulation, which is fairly homogeneous regarding age, BMI, andorigin. We could demonstrate that IL-Ra is correlated with Mets similarly as hs-CRPand adiponectin. The limitation of our study is that we measured totaladiponectin, but not the high molecular weight (HMW) multimer of adiponectin,which has been shown to be a better marker for the MetS than is the totaladiponectin level ,45.Weconclude that decreased levels of adiponectin and increased levels of hs-CRP and IL-1Ra possibly reflect the same phenomenon, and correlate linearly with the number of the components of the MetS according to the IDF and NCEP definitions. The levels of inflammatory markers (hs-CRP and IL-1Ra) are higher among patients with MetS defined only by the IDF definition compared to the only NCEP defined ones. More longitudinal follow-up studies are needed to investigate whether or not these new markers of the MetS increase the predictive power with respect to future risk of type-2diabetes and CVD in different populations."}
{"text": "The metabolic syndrome (MetS) is associated with the presence of low grade inflammation. Our aim was to analyze the inter-relations between each of the components of the metabolic syndrome (MetS) and four inflammatory markers, namely high sensitivity C-reactive protein (hs-CRP), the erythrocyte sedimentation rate, the concentration of fibrinogen and the white blood cell count.We have analyzed data collected between September 2002 and June 2009 in the Tel-Aviv medical center inflammation survey (TAMCIS). We recruited both apparently healthy individuals and individuals presenting with atherothrombotic risk factors. All participants were enrolled during their routine annual health check-up and gave their written informed consent. This is a cross sectional study in which we have fitted linear regression models using inflammatory markers as the dependant variables and adjust them according to the different components of the MetS and multiple other confounders.Included were 12,072 individuals of whom there were 7,760 men at a mean (S.D.) age of 44 (11) years, and 4,312 women aged 44 (11) years. A significant correlation was noted between most components of the MetS and all inflammatory markers, the most significant one being with hs-CRP. In the multi-adjusted regression analysis, waist was the factor that best explained the variability of hs-CRP, in both women and men. It also remained a significant variable for the other inflammatory markers.From amongst the various components of the MetS, waist circumference appears to exert the most influence upon the presence and intensity of the micro-inflammatory response. The metabolic syndrome (MetS) is associated with the presence of a low grade sub-clinical inflammatory process, so called micro-inflammation -7. The rIn order to evaluate the contribution of the MetS components  to the micro-inflammatory process, this cross sectional study has analyzed the strength of the association between each MetS component and four established inflammatory markers. The relative influence of the components of the MetS on these inflammatory markers may be of clinical significance aiding in the establishment of clinical guidelines for health care providers as well to public health policy makers.In the present study we analyzed the data collected at the Tel-Aviv Medical Center Inflammation Survey (TAMCIS), a registered data bank of the Israeli Ministry of Justice -20. ThisBlood samples were drawn in the morning hours, after a 12-h overnight fast. The WBCC and differential were performed using the Coulter STKS  electronic analyzer, while fibrinogen concentrations were determined by the method of Clauss and a SyThe results of the routine health check-up were evaluated by employing certain definitions of the various atherothrombotic risk factors. Diabetes mellitus was defined as a fasting blood glucose level of \u2265 126 mg/dl (7 mmol/L) or treatment with insulin or oral hypoglycemic medications. Hypertension was defined as displaying with blood pressure of \u2265 140/90 mmHg in two separate measurements or the intake of anti-hypertensive medications. Dyslipidemia was defined as the low density lipoprotein cholesterol (LDL-C) or non- high density lipoprotein cholesterol (non-HDL-C) concentrations, for individuals displaying elevated triglyceride concentrations of \u2265 200 mg/dl (2.26 mmol/l) above the recommended levels, according to the risk profile defined by the updated adult treatment panel III (ATP III) recommendations, or the All data was summarized and displayed as mean \u00b1 standard deviation (SD) for the continuous variables and as number of patients plus the percentage in each group for categorical variables. Since hs-CRP, ESR and the triglyceride concentrations display irregular distributions, we used a logarithmic transformation which converted the distributions to normal ones for all statistical procedures. Therefore, all results of hs-CRP, ESR or triglyceride concentrations are expressed as back transformed geometrical means and standard deviations. The One-Way Kolmogorov-Smirnov test was used to assess the distributions. For all categorical variables the Chi-Square statistic was used to assess the statistical significance between the two genders. Pearson partial correlations for confounding variables were used to evaluate the age adjusted association between the various components of the MetS and the inflammatory variables. In order to assess and compare the contribution of the different components of the MetS to the variability of the various inflammatory variables, we used linear regression models. The inflammatory variables were the dependent variables and the different components of the MetS, as well as other potential confounders, were the covariates. The confounders included age, history of proven atherothrombotic disease , smoking status, alcohol consumption, level of physical activity and medication with potential influence on the inflammatory markers and/or the metabolic components such as angiotensin converting enzyme (ACE) inhibitors, angiotensin II receptor blockers, statins, fibrates and aspirin, as well as hormone replacement therapy or oral contraceptives in females. In an attempt to adjust for the association between the inflammatory variables (mainly hs-CRP) and obesity, we repeated the correlations and the linear regression models with additional adjustment for BMI. All above analyses were considered significant at p < 0.05 (two tailed). The statistical package for the Social Sciences (SPSS) was used to perform all statistical evaluation .We have presently analyzed a total of 7,760 men at a mean (S.D.) age of 44 11) years (range 18-83) and 4,312 women aged 44 (11) years (range 18-77). The frequencies of the different components per each participant are described in Table 1 years (The present analysis has shown that amongst the various components of the MetS, waist circumference is the component that most significantly influences the micro-inflammatory response. Invariably, Waist and BMI are used inter-changeably in the definition of the metabolic syndrome and there is in fact a strong association between them. Due to this association, adjusting for waist and BMI together causes problematic co-linearity. However, it must be noted that waist circumference still remained the most significant predictor of the inflammatory response even after additional adjustment for BMI. There is a known association between the MetS and the presence of micro-inflammation -34 but tThe prevalence of the MetS in our cohort was relatively low. In fact only 9.6% of women and 11.7% of men had three MetS components or more. One possible explanation for this is the fact that this study was performed in a group of relatively healthy individuals. However, this population could represent those individuals that are still not affected by the results of long standing atherosclerotic disease and might therefore benefit from preventive interventions. In addition, it should be stressed that we did not limit ourselves to individuals with an established diagnosis of MetS. We wanted to discover the relationship between the presence of micro-inflammation and changes in each individual component of the MetS, even in individuals without defined MetS. Theoretically, our findings can be used to support the recent report by Arnlov et al  that havIn conclusion, a clarification of the relationship between each MetS component and the intensity of the micro-inflammatory response may be of clinical relevance. Such a clarification might help to highlight the importance of targeted interventions such as weight reduction, a measure previously proved to be clearly beneficial ,41.The authors declare that they have no competing interests.OR and AS have participated in the design of the study, performed the statistical analyses and drafted the paper. SB and IS conceived the study, participated in its design and coordination and helped to draft and review the manuscript. TF, TC and OKB helped in the data organization and retrieval, English editing and final draft preparation. All of the authors have read and approved the final manuscript."}
{"text": "To report clinical efficacy and toxicity of fractionated CyberKnife radiosurgery for the treatment of hilar lung tumors.Patients presenting with primary and metastatic hilar lung tumors, treated using the CyberKnife system with Synchrony fiducial tracking technology, were retrospectively reviewed. Hilar location was defined as abutting or invading a mainstem bronchus. Fiducial markers were implanted by conventional bronchoscopy within or adjacent to tumors to serve as targeting references. A prescribed dose of 30 to 40 Gy to the gross tumor volume (GTV) was delivered in 5 fractions. Clinical examination and PET/CT imaging were performed at 3 to 6-month follow-up intervals.Twenty patients were accrued over a 4 year period. Three had primary hilar lung tumors and 17 had hilar lung metastases. The median GTV was 73 cc (range 23-324 cc). The median dose to the GTV was 35 Gy , delivered in 5 fractions over 5 to 8 days . The resulting mean maximum point doses delivered to the esophagus and mainstem bronchus were 25 Gy  and 42 Gy , respectively. Of the 17 evaluable patients with 3 - 6 month follow-up, 4 patients had a partial response and 13 patients had stable disease. AAT t a median follow-up of 10 months, the 1-year Kaplan-Meier local control and overall survival estimates were 63% and 54%, respectively. Toxicities included one patient experiencing grade II radiation esophagitis and one patient experiencing grade III radiation pneumonitis. One patient with gross endobronchial tumor within the mainstem bronchus developed a bronchial fistula and died after receiving a maximum bronchus dose of 49 Gy.CyberKnife radiosurgery is an effective palliative treatment option for hilar lung tumors, but local control is poor at one year. Maximum point doses to critical structures may be used as a guide for limiting toxicities. Preliminary results suggest that dose escalation alone is unlikely to enhance the therapeutic ratio of hilar lung tumors and novel approaches, such as further defining the patient population or employing the use of radiation sensitizers, should be investigated. Patients presenting with inoperable lung tumors are generally treated with conventionally fractionated radiotherapy. To improve local control and survival, researchers in the past decade have explored various means of delivering high doses of radiation in shorter intervals . Lung tu\u00ae System  has been successfully employed at Georgetown University Hospital since early 2002 to treat stationary extracranial tumors [The CyberKnifel tumors . With thl tumors ,20. HereThis retrospective review of an established departmental treatment policy was approved by the Georgetown University institutional review board. Consecutively treated patients between October 2005 and October 2009 with pathologically confirmed inoperable primary hilar lung cancers or hilar lung metastases were reviewed. A tumor was considered a \"hilar lung tumor\" if it abutted or invaded the mainstem bronchus. Baseline studies included PET/CT imaging with iodinated IV contrast as clinically feasible.Tracking based on translational and rotational target information requires the use of a minimum of 3 non-collinear fiducials to be visible on the orthogonal images of the CyberKnife x-ray targeting system. Three to five gold fiducials measuring 0.8-1 mm in diameter by 3-7 mm in length  were placed in or near the tumors via bronchoscopy as previously described .Fine-cut 1.25 mm) treatment planning CT's were obtained following fiducial placement during a full inhalation breath hold with the patient in the supine treatment position. Gross tumor volumes (GTV) were contoured utilizing mediastinal windows. A treatment plan was generated using the TPS 5.2.1 non-isocentric, inverse-planning algorithm with tissue density heterogeneity corrections for lung based on an effective depth correction. The radiation dose was divided into 5 equal fractions of 6 to 8 Gy, prescribed to an isodose line that covered at least 95% of the planning treatment volume (PTV = GTV). Guidelines for dose limits to critical central thoracic structures are provided in Table .25 mm trPatients were treated in the supine position with their arms at their sides. A form-fitting vest containing 3 red light-emitting surface markers was attached to the surface of the patient's anterior torso in the region of maximum chest and upper abdominal respiratory excursion. These markers projected to an adjustable camera array in the treatment room. Precise patient positioning was accomplished utilizing the automated patient positioning system. The internal fiducials were located using orthogonal x-ray images acquired with ceiling-mounted diagnostic x-ray sources and corresponding amorphous silicon image detectors secured to the floor on either side of the patient.Prior to initiating treatment, an adaptive correlation model was created between the fiducial positions as periodically imaged by the x-ray targeting system and the light-emitting markers as continuously imaged by the camera array. During treatment delivery the tumor position was tracked using the live camera array signal and correlation model, and the linear accelerator was moved by the robotic arm in real time to maintain alignment with the tumor. Fiducials were imaged prior to the delivery of every third beam for treatment verification and to update the correlation model.Patients were followed with physical examination and PET/CT imaging at 3 to 6 month intervals. Local tumor recurrence was defined as progression of the treated tumor on PET/CT imaging. Biopsies were obtained when clinically indicated. Early treatment response was defined by the Response Evaluation Criteria in Solid Tumors (RECIST) Committee . ToxicitStatistical analysis was performed with the MedCalc 11.1 statistical package. The follow-up duration was defined as the time from the date of completion of treatment to the last date of follow-up or the date of death. Actuarial local control and overall survival were calculated using the Kaplan-Meier method.Twenty consecutive patients (10 men and 10 women) were treated over a 4-year period Table . Three pTreatment plans were composed of hundreds of pencil beams delivered using a single 20 to 40-mm diameter collimator . Radiation was delivered in 5 equal fractions of 6 to 8 Gy each to a median prescription isodose line of 76% . The median dose delivered to the prescription isodose line over an average of 6 days  was 35 Gy . The resulting mean maximum point doses delivered to the esophagus and mainstem bronchus were 25 Gy  and 42 Gy , respectively.All patients underwent clinical follow-up, and 14 patients reported symptomatic relief within 1 month of treatment and 2 patients reported relief by 4 months. Of the 17 patients with early radiographic follow-up, 4 patients experienced partial responses and 13 patients had stable disease at 3 - 6 months. There was no local disease progression within the 6-month follow-up interval. Furthermore, 13 patients with serial PET/CT imaging exhibited early declines in the maximum standardized uptake values  and a high maximum esophageal point dose approaching the limit of 40 Gy. A second patient with severe COPD and progressing metastatic NSCLC developed dyspnea and an infiltrate on CT corresponding to the high dose treatment volume 8 months following CyberKnife treatment (40 Gy). He required temporary supplemental oxygen and his symptoms resolved with conservative treatment over a 4 day hospital stay. Finally, a patient with advanced mesothelioma developed a mainstem bronchus fistula 7 months following treatment and died  and the mainstem bronchus received a maximum point dose of 49 Gy.Strict maximum point dose constraints were maintained for normal tissues. Immediately following treatment, mild brief fatigue was reported by the majority of patients. Acute Grade II esophagitis, requiring brief hospitalization for IV hydration, was observed in 1 patient with renal cell carcinoma presenting with a relatively large GTV (182 cmd Figure . He was Continuous tracking of respiratory tumor motion and precise beam alignment throughout treatment permits greater dose conformality to the tumor contour and a sharp dose gradient ,24. We oPrior to proceeding with our institutional study of CyberKnife radiosurgery for hilar lung tumors, maturing data of others suggested that critical central thoracic structures tolerate high-dose hypofractionated radiation poorly . In a phDespite the short survival of treated patients and the aggressive radiation doses used, local control at 1 year was a disappointing 63%. However, in light of dose limiting major bronchus, lung, and esophageal toxicity, further dose escalation beyond 40 Gy is not a feasible approach to improve local control in hilar tumors with a significant endobronchial component. Additional clinical trials that exclude patients with gross mainstem endobronchial disease will be necessary to define the appropriate patient characteristics and doses. Alternatively, this study provides support for investigation of novel radiation sensitizers to enhance the therapeutic ratio of hilar lung tumor radiosurgery.Hilar lung tumor patients may be treated with frameless stereotactic radiosurgery, resulting in encouraging early clinical responses, acceptable acute toxicity and reliable palliation. However, local control at 1 year remains poor despite aggressive radiation doses and life threatening late toxicity has been reported, especially for tumors with a significant endobronchial component. We propose additional clinical investigation optimizing patient selection and consideration of novel combination treatments with radiation sensitizing drugs.MAX: maximum standardized uptake value;CT: computed tomography; GTV: gross tumor volume; GY: Gray; NSCLC: non-small cell lung cancer; PET: positron emission tomography; PTV: planning treatment volume; and SUVBC is an Accuray clinical consultant. EA is paid by Accuray to give lectures.KU participated in data collection, data analysis and manuscript drafting and manuscript revision. AJ participated in data collection, data analysis and manuscript revision. EO participated in data collection, data analysis and manuscript revision. SS created tables and figures and participated in data analysis and manuscript revision. XY participated in treatment planning, data collection and data analysis. SV participated in data collection, data analysis and manuscript revision. DS participated in data analysis and manuscript revision. KWH participated in treatment planning, data analysis and manuscript revision. SC prepared the manuscript for submission, participated in treatment planning, data collection, data analysis and manuscript revision. AD participated in data analysis and manuscript revision. EA participated in treatment planning, data collection, data analysis and manuscript revision. BC drafted the manuscript, participated in treatment planning, data collection and data analysis. All authors have read and approved the final manuscript."}
{"text": "With conventional radiation technique alone, it is difficult to deliver radical treatment (\u2265 60 Gy) to gliomas that are close to critical structures without incurring the risk of late radiation induced complications. Temozolomide-related improvements in high-grade glioma survival have placed a higher premium on optimal radiation therapy delivery. We investigated the safety and efficacy of utilizing highly conformal and precise CyberKnife radiotherapy to enhance conventional radiotherapy in the treatment of high grade glioma.\u00ae image-guided radiosurgical system. The majority of patients (88%) received concurrent and/or adjuvant Temozolmide.Between January 2002 and January 2009, 24 patients with good performance status and high-grade gliomas in close proximity to critical structures  were treated with the CyberKnife. All patients received conventional radiation therapy following tumor resection, with a median dose of 50 Gy (range: 40 - 50.4 Gy). Subsequently, an additional dose of 10 Gy was delivered in 5 successive 2 Gy daily fractions utilizing the CyberKnifeDuring CyberKnife treatments, the mean number of radiation beams utilized was 173 and the mean number of verification images was 58. Among the 24 patients, the mean clinical treatment volume was 174 cc, the mean prescription isodose line was 73% and the mean percent target coverage was 94%. At a median follow-up of 23 months for the glioblastoma multiforme cohort, the median survival was 18 months and the two-year survival rate was 37%. At a median follow-up of 63 months for the anaplastic glioma cohort, the median survival has not been reached and the 4-year survival rate was 71%. There have been no severe late complications referable to this radiation regimen in these patients.We utilized fractionated CyberKnife radiotherapy as an adjunct to conventional radiation to improve the targeting accuracy of high-grade glioma radiation treatment. This technique was safe, effective and allowed for optimal dose-delivery in our patients. The value of image-guided radiation therapy for the treatment of high-grade gliomas deserves further study. High-grade gliomas are generally aggressive tumors with poor prognosis . They tePresently, it is our clinical practice to treat high-grade glioma patients with maximum safe surgery followed by 6 weeks of chemoradiation . It has been generally feasible with conventional radiation technique to deliver such \"full dose\" treatment while respecting institutional peritumoral critical structure maximum point dose tolerances Table . However\u00ae, a commercially available frameless image-guided radiosurgery system , was installed at Georgetown University Hospital in late 2001. Standard components include a light weight linear accelerator, a robotic manipulator and an automated x-ray image-guided computer targeting system. Generally, the treatment planning system with input from the user selects hundreds of small non-isocentric circular radiation beams to deliver a highly conformal radiation treatment with steep dose gradients to a defined target in order to spare normal tissues [The CyberKnife tissues ,18. SubsPatients with newly diagnosed resected unifocal high-grade gliomas (WHO Grade III and VI) in close proximity (<1 cm) to critical structures Table  were evaThe extent of surgical resection was documented as total tumor resection or subtotal tumor resection following review of operative reports and post operative MRI imaging Table . SalvagePatients were placed in the supine treatment position with their heads resting on a standard support. A custom thermoplastic mask was crafted. Thin-sliced (1.25 mm) high-resolution CT images were obtained through the cranium for conventional and CyberKnife treatment planning. Treatment planning MRI imaging was completed selectively to enhance target and critical structure delineation when clinically indicated. Target volumes and critical structures were contoured by team neurosurgeons. Treatment volumes were generous including the contrast enhancing tumor volume when present and the surgical defect with a 3 cm margin. Critical structures in close proximity to the target volume were not excluded from the treatment volume during conventional radiation treatment. Forty to 50.4 Gy was delivered in 1.8 to 2.0 Gy fractions 5 days a week for a total of 4 to 5 1/2 weeks. Treatment was delivered using linear accelerators with nominal energies \u2265 6 MV. Intensity modulated radiation therapy (IMRT) technique was not permitted.\u00ae radiosurgical system for cranial tumors have been described in detail [\u00ae radiosurgical system. An inverse planning method with non-isocenteric technique was used. The treating physician and physicist input the specific treatment criteria, limiting the maximum dose to critical structures  describes the uniformity of dose within a treated target volume, and is directly calculated from the prescription isodose line chosen to cover the margin of the tumor:HI = Maximum dose/prescription doseThe new conformity index (NCI) as formulated by Paddick , and modPTC = The percentage of the target volume covered by the prescription isodose line.Image-guided radiosurgery was employed to eliminate the need for stereotactic frame fixation. Using computed tomography planning, target volume locations were related to cranial landmarks. With the assumption that the target position is fixed within the cranium, cranial tracking allows for anatomy based tracking relatively independent of patient's daily setup. Position verification was validated every third beam during treatment using paired, orthogonal, x-ray images ,24.Patients received concurrent and/or adjuvant chemotherapy at the discretion of their medical oncologist. Typically, patients were administered Temozolomide with concurrent radiation at a dose of 75 mg/m2/d, given 7 d/wk from the first day of conventional irradiation until the last day of CyberKnife treatment. After a 4-week break, patients generally received 6 cycles or more of adjuvant Temozolomide on a 5-day schedule of 150 to 200 mg per square meter every 28 days.Clinical evaluation and MRI imaging were performed at 3-6 month intervals following CyberKnife treatment for 5 years. Evaluation frequency beyond 5 years was determined by the medical oncologist. Throughout the follow-up period, a multidisciplinary team of neurosurgeons, radiation oncologists, medical oncologist and radiologists reviewed outcomes at a weekly central nervous system tumor board. Toxicity was scored according to the National Cancer Institute Common Terminology Criteria for Adverse Events, Version 3.0 The follow-up duration was defined as the time from the date of surgery to the last date of follow-up for surviving patients or to the date of death. Actuarial survival and local control was calculated using the Kaplan-Meier method.Twenty four consecutive eligible patients were treated over a seven year period extending from January 2002 to January 2009 . Upon completion of conventional treatment, an additional dose of 10 Gy was delivered in five successive 2 Gy daily fractions utilizing the CyberKnifeThe median follow-up was 23 months  for glioblastoma multiforme patients and 63 months  for anaplastic glioma patients Table . No patiUltimately, 16 patients experienced local progression during follow-up Table . SalvageHigh grade gliomas adjacent to critical structures are difficult to treat with conventional radiation therapy technique alone . When ir\u00ae radiosurgical system has several advantages over conventional radiation delivery systems. Since hundreds of non-isocentric treatment beams are available, the CyberKnife is capable of delivering a highly conformal treatment [In this study, we utilized the highly conformal and accurate fractionated CyberKnife radiotherapy to enhance conventional radiotherapy and investigated the safety and efficacy of this technique. The CyberKnifereatment ,18. Cranreatment -31. FurtThis is the first study to evaluates CyberKnife enhanced conventionally fractionated radiation therapy and chemotherapy for high-grade gliomas. Twenty-four patients were treated with encouraging 2 year and 4 year overall survival rates of 37% and 71% for the glioblastoma multiforme and anaplastic glioma cohorts, respectively. There were no severe late toxicities attributed to this technique using conventional total radiation doses of approximately 60 Gy. Our results demonstrate the feasibility, tolerability and efficacy of delivering CyberKnife enhanced conventionally fractionated radiation therapy and chemotherapy. Unfortunately, local progression remains the predominant pattern of failure for these patients despite optimal radiation treatment and chemotherapy Figure . NonetheBC is an Accuray clinical consultant.EO participated in data collection, data analysis and manuscript preparation. BC participated in drafting the manuscript, treatment planning, data collection and data analysis. KE participated in data collection, data analysis and manuscript revision. XY participated in treatment planning, data collection and data analysis. SL participated in treatment planning, data collection and data analysis. SS created tables and figures and participated in data analysis and manuscript revision. HH participated in data collection, data analysis and manuscript revision. JK participated in data collection, data analysis and manuscript revision. HP created tables and figures and participated in data analysis and manuscript revision. AE participated in data collection, data analysis and manuscript revision. CK participated in treatment planning, data analysis and manuscript revision. KM participated in treatment planning, data analysis and manuscript revision. DS participated in data analysis and manuscript revision. WJ participated in treatment planning, data analysis and manuscript revision. SC participated in drafting the manuscript, treatment planning, data collection and data analysis. All authors have read and approved the final manuscript."}
{"text": "The C\u2014S\u2014N\u2014C torsion angle is \u221280.6\u2005(6)\u00b0. The chloro\u00adbenzoyl ring is disordered and was refined using a split model [occupancy ratio 0.537\u2005(3):0.463\u2005(3)]. In the crystal, mol\u00adecules are linked by pairs of N\u2014H\u22efO(S) hydrogen bonds, forming inversion dimers.In the title compound, C N-(ar\u00adyl)-amides, see: Gowda et al. (2000N-(substitutedbenzo\u00adyl)-aryl\u00adsulfonamides, see: Gowda et al.  \u00c5b = 8.1963 (7) \u00c5c = 18.397 (3) \u00c5\u03b2 = 131.77 (1)\u00b0V = 2820.4 (7) \u00c53Z = 8K\u03b1 radiationMo \u22121\u03bc = 0.42 mmT = 293 K0.48 \u00d7 0.20 \u00d7 0.16 mmOxford Diffraction Xcalibur diffractometer with a Sapphire CCD detectorCrysAlis RED; Oxford Diffraction, 2009Tmin = 0.822, Tmax = 0.935Absorption correction: multi-scan (5253 measured reflections2432 independent reflectionsI > 2\u03c3(I)1623 reflections with Rint = 0.033R[F2 > 2\u03c3(F2)] = 0.071wR(F2) = 0.115S = 1.162432 reflections216 parameters15 restraintsH-atom parameters constrainedmax = 0.30 e \u00c5\u22123\u0394\u03c1min = \u22120.31 e \u00c5\u22123\u0394\u03c1CrysAlis CCD  used to solve structure: SHELXS97  I, global. DOI: 10.1107/S1600536812015681/nc2273Isup2.hklStructure factors: contains datablock(s) I. DOI: 10.1107/S1600536812015681/nc2273Isup3.cmlSupplementary material file. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
{"text": "Rapid scientific and technological advances have allowed for a more detailed understanding of the relevance of intestinal microbiota, and the entire body-wide microbiome, to human health and well-being. Rodent studies have provided suggestive evidence that probiotics (e.g. lactobacillus and bifidobacteria) can influence behavior. More importantly, emerging clinical studies indicate that the administration of beneficial microbes, via supplementation and/or fecal microbial transplant (FMT), can influence end-points related to mood state , brain function , and mental outlook . However, despite the advances in the area of gastro-biological psychiatry, it becomes clear that there remains an urgent need to explore the value of beneficial microbes in controlled clinical investigations. With the history explored in this series, it is fair to ask if we are now on the cusp of major clinical breakthroughs, or are we merely in the quicksand of Autointoxication II? Though the first two parts of this series, we have attempted to provide a historical and contextual approach to the more direct lines of contemporary evidence as it relates to gut microbiota, its intentional manipulation, and mental health. Here in part III we will discuss more specific research related to the direct experimental and clinical effects of probiotics in the context of stress, neurophysiology, behavior and mental outlook. The emerging studies clearly show that we are in the midst of a very exciting time within gastro-biological psychiatry. Still, as we conclude our series, it becomes evident that there many unanswered questions and an urgent need for expanded clinical investigations.More clinically relevant information related to behavior is provided by animal studies involving interactions between stress, dietary habits and alterations to the normal homeostasis of gut microbiota (i.e. dysbiosis rather than germ-free). The term dysbiosis is often erroneously attributed to Metchnikoff, however, both eubiosis  and dysbiosis  were already in popular use decades before Metchnikoff gained fame. Physician Elliot E. Furney used the terms together in his 1890 book related to plant, animal and human resiliency . In animBifidobacterium longum NCC3001  prevented the anxiety-like behavior associated with gut inflammation in animals with an intact vagus nerve, but it did not have this anxiolytic effect if the vagotomy was performed after chronic low-grade inflammation. Remarkably, the reduction in anxiety-like behavior after probiotic administration was not associated with any detectable reduction in gut inflammation per se[Lactobacillus rhamnosus also showed that administration to healthy animals in stressful situations reduced anxiety and depression-like behaviors in the elevated plus maze (EPM) and forced swim tests. These behavioral changes were linked to alterations in the gamma-aminobutyric acid (GABA) system of the brain in the probiotic group, yet the changes in behavior and brain chemistry were largely extinguished with vagotomy [More directly, however, the anxious-like behavior of dysbiosis invoked by small amounts of gut pathogens is associated with increased markers of activation within limbic structures of the brain  . Intestion per se. In othevagotomy .Lactobacillus hilgardii fermentation has been shown to have clinical value in anxiety reduction [Bifidobacterium longum normalized anxiety-like behavior and hippocampal BDNF levels among animals when the parasite Trichuris muris was introduced orally \u2013 the behavioral benefits were once again independent of inflammatory cytokines [As we argued almost a decade ago regarding depression and the gut-brain axis, some species of intestinal microbes can make significant contributions to the prodcution of GABA and other neurotransmitters in vivo . The exteduction . As for eduction . This suytokines .Salmonella enteritides exposure vs. other natural foods. In particular, a switch from the standard chow to banana powder decreased mortality from 96% to 6% over one month post-infection [As described in Part I, Lloyd Arnold reported in the 1920-30s that dietary context can influence intestinal-pathogen-induced symptoms and mortality. Remarkably, he found that the standard stock rodent chow, one that they had been using for years in his lab to raise mice, was associated with the highest mortality in mice upon nfection . For Arnnfection . When confection . From thbenefit to the host. The same is true of antimicrobial administration \u2013 clearly, antimicrobial agents can cause massive shifts in gut microbiota, yet here again the oral administration of these agents to mice (anxious BALB/c strain) caused a decrease in anxiety-like behavior. Such was not the case when the antimicrobial agents were delivered by injection, nor were there any behavioral changes when the agents were delivered orally to germ-free mice [Of course, this research also exposes the short-comings of the term dysbiosis, in that a shift from \u2018normal\u2019 homeostasis of intestinal microbiota  might actually confer ree mice . As mentree mice .E. coli Nissle 1917) is more effective at reducing experimental intestinal inflammation and markers of intestinal permeability vs. either one alone. In particular, this combination of probiotic and antibiotic significantly reduced the expression of matrix metalloproteinase 9 (MMP-9) [It is unlikely that antibiotics are a long-term solution to depression; however, the recently reported success of minocycline in depression  can no l (MMP-9) , a salie (MMP-9) , meanwhi (MMP-9) ,26, and  (MMP-9) -29. Sinc (MMP-9) , researc (MMP-9) .Lactobacillus reuteri vs. control) prior to experimental colorectal distension in rats. Remarkably, live probiotic prevented the physiological signs of visceral pain (marked bradycardia) that was otherwise evident in the control group. The researchers found the same effect whether or not the L. reuteri was alive, heat or radiation-killed, indicating that even structural components of probiotics can play a role in visceral sensitivity. This reduction in cardio-autonomic response in the animals was noted even at the highest level of distention pressure (80mm Hg), and the resiliency was accompanied by an inhibitory effect on discharge of colonic afferent nerve fibers in the probiotic groups [Bifidobacterium infantis 35624 can reduce visceral pain behaviors in both normosensitive and hypersensitive-anxious rat strains during colorectal distention [Bifidobacterium infantis can normalize sensitivity to colorectal distention in a rat model of post-inflammatory colonic hypersensitivity [Bifidobacterium lactis CNCM I-2494 in a fermented dairy matrix has been shown to reduce visceral hypersensitivity when colorectal distention occurred in the context of psychological stress. This study also showed that the probiotic reduced intestinal permeability and blood endotoxin levels. It is noteworthy that the antinociceptive effect of the fermented dairy product (inclusive of the aforementioned bifidobacterium strain plus Lactococcus lactis and two yogurt starters L. bulgaricus and S. thermophilus) was more effective than an equivalent dose of Bifidobacterium lactis CNCM I-2494 alone [Some of the more intriguing animal studies in recent years have involved the efficacy of probiotics in the reduction of visceral pain, including that related to colorectal distention. One study involved 9 days of probiotic supplementation  by colorectal distention \u2013 however, L. farciminis administration significantly reduced Fos expression in these areas during colorectal distention [Lactobacillus paracasei NCC2461 prevented this antibiotic-induced visceral sensitivity [L. paracasei did not restore normal lactobacilli levels overall, indicating that a major influence on gut microbial genera is not required for therapeutic efficacy via probiotics.stention . Finallysitivity . Importain sensitive people the brain is profoundly influenced by afferent impulses coming from a distended, underactive or unduly active bowel\u2019 \u2013 certainly modern day interoseptive sensitivity in anxiety and pain-related conditions would support this notion [Although these are preliminary animal studies, one cannot help but to reconsider the influential voice of intestinal toxemia\u2019s most vehement critic. Recall from Part I that Alvarez, who focused his attention on Freudian-inspired conditions - \u2018hysterical\u2019 bloating and \u2018neurosis of the abdominal wall\u2019 as he called them - claimed that personal  sensitivity to distention was at the heart of the gastrointestinal complaints in many of those with neurasthenia. Alvarez turned out to be correct in proposing a psycho-mechanical theory, his 1919 assertion  that \u2018ins notion ,40. HoweConsider the separate research on methane producing microbes within the intestines; these microbes have been consistently linked to constipation -43, and A primary focus among the scientists and clinicians of the autointoxication era was on gut-derived putrefactive chemicals and their burden on the brain and elsewhere. As autointoxication faded away, Alvarez and others dismissed the notion that, except under rare circumstances, these chemicals could be absorbed and/or retained at any appreciable levels such that they could influence health. Although the modern gut-to-brain scientific focus has shifted to LPS and inflammatory cytokines, even the classic putrefactive chemicals  and some of the gut-derived and liver metabolized/conjugated structures  continue to be linked to systemic cellular damage and neuropsychiatric disorders -52. In pAlthough the association between cardiovascular disease and kidney disease is clearly significant, uremic toxins are presenting themselves as independent predictors of CVD risk, even at surprisingly mild levels of kidney disease. Recent studies show that even mild increases in serum p-cresylsulfate (0.7mg/L) are associated with coronary artery disease , and expIn animals, uremic chemicals can influence neurotransmitter levels in the brain, and emerging studies suggest they may have divergent effects on behavior depending on the level of production \u2013 in other words, too little or too much of these gut-derived chemicals may influence behavior . Isatin,Lactobacillus plantarum C29, isolated from the traditional Asian food kimchi, can increase hippocampal brain derived neurotrophic factor (BDNF) [L. acidophilus (vs. placebo) reduced immobility and observations of post-swim fatigue \u2013 these effects of L. acidophilus were in tandem with reductions in brain measurements of oxidative stress and serum measurements of the inflammatory cytokine TNF\u03b1 [Bifidobacterium animalis 01, isolated from centarians, decreased oxidative stress burden and brain monoamine oxidase activity, thereby potentially increasing neurotransmitter levels between synapses [Meanwhile, other lines of experimental research continue to highlight the utility of probiotics in the prevention of intestinal permeability , reductir (BDNF) . Numerour (BDNF) . In exper (BDNF) ,76,77. Iine TNF\u03b1 . Recentlsynapses .The influence of probiotics as a means to attenuate substance P release may also play a relevant role within the gut-brain connection. Experimental alterations to the normal gut microbiota can increase substance P release in the nervous system and promote behaviors reflective of anxiety . Indeed,Lactobacillus plantarum has been shown to secrete bioactive extracellular proteins capable of interacting with and modulating dendritic cells [C. jejuni as previously described) continue to be demoinstrated [Researchers have begun to explore the crosstalk biomarkers through which microbiota and host communicate. For example, ic cells . The secnstrated . As resenstrated , it is bnstrated . The rolnstrated .Bifidobacterium animalis subsp. lactis 420 to these animals reversed the bacterial translocation, its associated adipose tissue inflammation and metabolic disturbances indicative of diabetes [L. farciminis can reduce the effects of this vicious cycle in an animal model of acute stress [In a study which takes us back to the previously described work of Fenton Turck in 1916 , a Frencdiabetes . Of coure stress . Specifie stress . The resMycobacterium vaccae took note of its unexpected improvement in quality of life scores. Although it did not alter cancer survival times, benefits in favor of M. vaccae injections included aspects of cognition, vitality, and emotional health. [M. vaccae is widely distributed in nature, including soil and water, and it begs the question to what extent is the withdrawal from contact with nature and its non-pathogenic microbes a factor in mental health? As mentioned, it has been recognized for over a century that lactobacilli can be found in garden soil and on plant foods [M. vaccae can beneficially influence brain serotonergic activity under stress, and live M. vaccae added to the mice diet improves behavioral displays of anxiety and cognitive functioning [Recently there has been, once again, a suggestion that it might be possible to vaccinate against depression . Specifi health.  Of cours health. . It is nnt foods . Recent nt foods . Very prctioning . These sL. rhamnosus IMC 501 and L. paracasei IMC 502 minimized the systemic oxidative stress, lipid peroxidation in particular, associated with intense physical activity [L. casei, L. plantarum, B. brevis) in the treatment of SIBO, indeed the pilot study (n\u2009=\u200950) showed a more favorable response to probiotic treatment vs. the metronidazol control [Human research continues to accumulate in the area of probiotics and oxidative stress. A 6-week study involving patients with type 2 diabetes showed that probiotic yogurt administration improved fasting blood glucose as well as systemic antioxidant enzyme activity and total antioxidant status . In a onactivity . Given tactivity , the res control .Bifidobacterium lactis CNCM I-2494, L. bulgaricus and L. lactis) vs. non-fermented dairy vs. no beverage for one month. The fMRI was conducted during an emotional reactivity task . Based on blood flow assessments during the task, the probiotic group showed diminished activity in the mid/posterior insula vs. the control groups [There has also been intriguing preliminary research involving probiotic administration and changes in the brain activity as measured via functional magnetic resonance imaging (fMRI). In a double-blind, controlled study, 45 healthy women (age 18\u201350) consumed either a probiotic yogurt , should they confer benefit, could be considered a probiotic blend of sorts. Infusion of fecal microbiota from healthy donors has recently been reported to improve insulin sensitivity in individuals with metabolic syndrome, [Enterobacter cloacae B29 was eradicated from an obese adult, and remarkably, the induction of obesity, inflammation and serum endotoxemia when that same strain was introduced to gnotobiotic mice [L. reuteri ATCC55730 showed that the strain reduced mucosal inflammatory cytokine production after it was administered as a rectal enema for 8 weeks [Finally, although not probiotics yndrome,  and neuryndrome, . Workingtic mice . The enc 8 weeks .While some researchers continue to search for specific probiotic strains as transfer candidates, others are examining the use of cocktails of pathogen-free microbes derived from the entire commensal range . ExperimLactobacillus casei fermented beverage compared to the placebo group [Lactobacillus casei probiotic vs. placebo. At the conclusion of the 8-week study, depression scores remained unchanged between the groups, however there were significant improvements in anxiety as measured via the Beck Anxiety Inventory vs. placebo [The first formal investigation of the potential psychological benefits of strictly defined probiotic supplementation in humans involved 132 otherwise healthy adults; those who had more depressive symptoms at baseline had significant improvement in mood scores after taking a probiotic bo group . A separ placebo .Lactobacillus helveticus and Bifidobacterium longum combination probiotic which was orally administered for one month in a placebo-controlled study. Using a variety of validated anxiety, stress, and depression scales, researchers reported significant improvements in day-to-day depression, anger, anxiety, as well as lower levels of the stress hormone cortisol among otherwise healthy adults taking a daily probiotic supplement vs. placebo. In addition, an experimental arm of this study also confirmed that the probiotic added to the chow of rats did indeed decrease behaviors indicative of anxiety [Lactobacillus helveticus and Bifidobacterium longum vs. controls , and among this low cortisol sub-group the overall benefits in anxiety and depression were pronounced over time [bifidobacteria levels [Even more recently, French researchers evaluated a  anxiety . Moreovever time . Finallya levels .The essential deficiencies in academic medical history derive from its commitment to the \u201cgreat man, great discoveries\u201d view of medical history and of medical progress\u2026those who labour long at such gathering are prone to mistake their miscellany of accumulations for real knowledge and deep understanding\u2019 [may play a role in mental health \u2013 was correct.Looking back at the first three decades of the 20th century is an experience, for the modern scientist interested in the gut-microbiome-brain connection, akin to an anthropological archeologist discovering an ancient civilization. Superficially, the historical markings are dominated, as they often are in medicine, by the myopic and biased view toward the so-called \u2018great/infamous men, great/infamous discoveries and claims\u2019. Medical historians focus on heroes and anti-heroes in the fights against ignorance and disease. Yet the complete chronicles are never as simple as Lane vs. Alvarez. Psychiatrist and medical historian Iago Galdston warned against losing context and understanding with such chronicles - \u2018tanding\u2019 . Siftinga triumph of ignorance over science\u2019. Yet, as the French physiologist Claude Bernard wrote, \u201cThat which we know is a great hindrance to our learning that which is yet unknown to us\u201d. By the year 2000 we \u201cknew\u201d intestinal toxemia and friendly microbes for mental health to be exclusively a medical folly, one associated with charlatans and so-called colon cleansers.Related concerns of intestinal permeability, SIBO, hypochlorhydria, carbohydrate intolerance, endotoxins, modernity and dietary matters, gut microbe vaccines, the oral administration of lactic acid bacteria, colonic microbiota transfer, and qualitative/quantitative changes to the intestinal microbiota were all discussed as being relevant to mental health and cognition. For a variety of reasons, not the least of which included lack of human evidence and broad claims that autointoxication was the exclusive root of all neuropsychiatric disorders, these discussions disappeared from mental health publications. One cannot say that the disappearance of autointoxication was driven exclusively by the emergence of evidence-based medicine because in many cases it would be supplanted by unverifiable Freudian psychoanalytic viewpoints. Still, clinicians pleaded for more than studies in rodents, rabbits and monkeys \u2013 they needed convincing human research so that medicine could be practiced not by hypothesis - and yet none would be forthcoming. Unwarranted colectomies and unfounded marketing promissory notes for good health via friendly microbes would obscure legitimate research pathways that might have otherwise been followed with vigor. They also created a superficial and simplified medical history based on great or infamous men. Over time, autointoxication would become known only for these surgical and marketing extremes, ultimately becoming a medical outcast \u2013 or, as it was written just prior to our hypotheses papers, \u2018L. bulgaricus as a fountain of youth, or colon cleansers as a solution to all the potential ills of what may indeed be a type of intestinal \u2018toxemia\u2019. However, modern historical reviews that stick exclusively to the redundant and superficial narrative of \u201cautointoxication was the arena of charlatans, it was wrong and disproven by Alvarez\u201d contribute little, and indeed provide a disservice to the medical minds that were on a rational path. Of course, reminders of the dangers of practicing medicine by hypothesis alone have their place. However, it may be time to re-write some of the history books or at least qualify them; the legacy of Lane and Cotton should not negate that of those who found that a high fat diet and stress increased intestinal permeability and bacterial translocation, or those who reported successful outcomes with simple fecal transplantation. Why should the legacy of those who instilled fears into healthy adults regarding autointoxication, as a means to sell pseudoscientific contraptions, obscure that of rational physicians who saw some legitimacy to intestinal toxemia as relevant to unhealthy populations? It is fairly obvious many of those physicians rationally discussing intestinal toxemia a century ago were confronted with unhealthy patients  that would today be classified with elaborate diagnostic criteria and codes.All of this contemporary work, as described above, forces us to have a fresh look at the inner dialogue within the historical intestinal toxemia publications. Obviously the modern advances are not a validation of colectomy, These results suggest that neuroticism is involved in the pathophysiology of IBS\u2019 [we will learn to understand the experiences of man in terms of multidirectional relations, and with a simultaneity that is free of the naivet\u00e9 and artificiality of straight line sequential causality\u2026when we have come to such an understanding, psychosomatic medicine will be truly holistic. But then, may I whisper it softly, it will no longer be psychosomatic medicine. It will be medicine such as Hippocrates could comprehend, and Paracelsus might celebrate \u2013 a keen reflection on the interrelations of Microcosm and Macrocosm\u2019 [Top-down, psychosomatic-oriented theorists  continue of IBS\u2019 . These scrocosm\u2019 .human GABA system, are not synthetic benzodiazepines; as discussed throughout this paper, orally administered microbes are much more likely to converge with lifestyle variables within the gut lumen.With all our modern advances, we once again arrive at a place of theory, albeit slightly more sound in its support. In order to truly advance from the days of Metchnikoff we must expand the bench and rodent work and bring it into the clinical investigative setting, and not to do so, of course, for the purpose of yet more anecdote. The undoing of intestinal toxemia and the idea of probiotics for brain health was not Alvarez, it wasn\u2019t the charlatans and the high colonics, nor was it for the want of more rodent and laboratory studies - its undoing was the lack of convincing controlled clinical work. It seems remarkable, given the supporting scientific rationale, that there has been so little in the way of clinical research. At this point, as highlighted throughout this series, we already have extensive experimental research from which to guide probiotic strain selection for clinical experimentation \u2013 e.g. strains that can lower LPS burden; strains that lower oxidative stress, and systemic inflammatory cytokines; strains that have a beneficial influence on stress resiliency; strains that can influence neurotransmitter precursor levels via amino acids and neuronal membrane structure via fatty acids; strains that can attenuate intestinal permeability; strains that can lower uremic toxin burden. It may take decades to further elucidate the divergent ways in which these and other specific probiotic strains may interact, alone and in combination with each other, to influence markers relevant to animal models of depression and/or anxiety. This critical work should, of course, continue. However, the mouse models will always be lacking the clinically-relevant context of mood-related diet, physical activity, environmental toxin exposure and other variables within lifestyle medicine. Probiotics, even if they do influence the human mood, cognition and fatigue. The results from these early studies, in concert with what is now a fairly robust body of experimental research, would suggest that we have now passed the time in which clinical investigations should be approached with vigor. Moreover, the work of Micha\u00ebl Messaoudi [This presents a quandary for experimental researchers examining the use of probiotics in the behavior of animals as a means to inform clinical utility. Since environmental enrichment factors are known to interact with psychological stress and diet, both of which interact with gut microbiota, a near-endless combination of animal housing and dietary variables related to microbes must be investigated - from running wheels, tunnel positioning, wood, plastic and soil materials -123. To essaoudi ,114 and M. vaccae added to the dietary of animals \u2013 as a soil-derived organism, M. vaccae can easily find its way onto plant foods. It seems the links between traditional dietary patterns, mental health and microbiota, are far more complex than generally appreciated. We simply cannot view the gut-brain-microbiota axis as isolated from diet, the context of its macro and micronutrient as well as phytochemical composition. This fact underscores the potential futility of probiotic administration to a sedentary individual with depression that may be co-consuming a fast-food style diet with the addition of pharmaceuticals and/or dietary chemicals  that are otherwise capable of altering the intestinal microbiota [The strain specific focus is clearly justifiable in the scientific examination of a particular probiotic preparation or commercial \u2018functional food\u2019 for mental health. Research not only shows that heat-killed bacteria may have strain-specific benefit, the research also indicates that there are broad and divergent effects of lactic acid bacteria in their interaction with the immune system . If we icrobiota . These aIn the real-world of mental healthcare provider and patient, one that occurs in a holistic setting involving lifestyle factors, the odds of a single strain of probiotic bacterium providing clinically meaningful and long-lasting benefit, not simply statistically significant differences vs. placebo, could not be estimated to be high. Yet, probiotic experiments with rodents, just as they did in the day of Metchnikoff  , generatPLoS One, Japanese researchers showed that a strain of Bifidobacterium animalis can increase longevity in mice via its influence on gut polyamine production [emerge from phase I of translational medicine? Will all of this work become another clinically meaningless forgotten city in the future, one destined to once again be explained away by conflicts over toilet training? If there is a future role of probiotics in cognitive and mental health, one relevant for clinicians, and one that can only be proven or disproven by human intervention studies, it is almost certainly as our group hypothesized it to be \u2013 an adjuvant to well-established first-line care.Today, in the new era of Autointoxication II, what is old is new again \u2013 preliminary non-clinical research efforts, based on metagenomics and microbiome projects, are commercially co-opted to support a financially lucrative probiotic business wherein unsubstantiated claims abound . Metchnioduction . In 2012oduction ; meanwhioduction . It seemACB and EMS have no competing interests. ACL has received consulting fees from Genuine Health, Toronto, Canada.ACB, ACL and EMS contributed equal time and effort in the investigation, research and drafting of this manuscript. All authors read and approved the final manuscript."}
{"text": "Male moths aiming to locate pheromone-releasing females rely on stimulus-adapted search maneuvers complicated by a discontinuous distribution of pheromone patches. They alternate sequences of upwind surge when perceiving the pheromone and cross- or downwind casting when the odor is lost. We compare four search strategies: three reactive versus one cognitive. The former consist of pre-programmed movement sequences triggered by pheromone detections while the latter uses Bayesian inference to build spatial probability maps. Based on the analysis of triphasic responses of antennal lobe neurons , we propose three reactive strategies. One combines upwind surge (representing the On response to a pheromone detection) and spiral casting, only. The other two additionally include crosswind (zigzag) casting representing the Off phase. As cognitive strategy we use the infotaxis algorithm which was developed for searching in a turbulent medium. Detection events in the electroantennogram of a moth attached to a robot indirectly control this cyborg, depending on the strategy in use. The recorded trajectories are analyzed with regard to success rates, efficiency, and other features. In addition, we qualitatively compare our robotic trajectories to behavioral search paths. Reactive searching is more efficient (yielding shorter trajectories) for higher pheromone doses whereas cognitive searching works better for lower doses. With respect to our experimental conditions (2 m from starting position to pheromone source), reactive searching with crosswind zigzag yields the shortest trajectories (for comparable success rates). Assuming that the neuronal Off response represents a short-term memory, zigzagging is an efficient movement to relocate a recently lost pheromone plume. Accordingly, such reactive strategies offer an interesting alternative to complex cognitive searching. The moth mating race is a suitable model case for studying the efficiency of various search strategies and to compare them to real-world behavior. All there is to guide olfactory navigation are simple sporadic clues, i.e., single pheromone detections. Thus, a pheromone seeking male relies on a specifically adapted behavior where action selection is triggered by simple perceptional events. They switch between stereotypical movement sequences, as, for example, upwind surge and crosswind casting. This behavior can be either a consequence of cognitive processing or a reactive reflex of fixed action patterns. Suggesting a direct relationship between neuronal central activity and such action patterns, we combine and implement them as reactive strategies. We also employ infotaxis, an artificial intelligence algorithm specifically developed for searching in turbulent odor plumes. Using these strategies in cyborg experiments, we obtain and compare the resulting search trajectories. Our results indicate that complex, computationally expensive search strategies like infotaxis are not necessarily better than simple reactive ones. With respect to our set-up, reactive searching yields the shortest trajectories if and only if it includes a crosswind zigzagging phase that represents a short-term memory. Thus, already a minimal bit of simplistic memory can produce very efficient goal-directed behavior. The efficiency of male moths searching for females is astonishing. In spite of serious difficulties, as, for example, large distances, sharp time constraints, and sparse discontinuous clues, their olfactory pheromone system usually guarantees a successful encounter This mating race is not only fascinating in itself but also particularly convenient to study the chain linking perception to action, and for the investigation of search tasks in general. The advantages are the rich adaptive behavioral repertoire of insects generated by a relatively simple neuronal system reactive search strategies have been suggested and modified An important factor is the olfactory stimulus cognitive strategies, e.g. A powerful alternative to reactive searching is the more sophisticated and computationally rather expensive approach of using Such experimental tests of theoretical models are particularly important for applied research as they point out real-world issues and limitations that mere simulations cannot account for. This is true for both studies involving reactive Agrotis ipsilon mounted on a mobile robot sp) combines surge and arithmetic spiral casting, (za) and (ze) combine surge and a two-step casting sequence composed of crosswind casting, i.e., zigzagging followed by arithmetic or exponential spiraling, respectively. The single movement sequences are motivated by biological findings on behavioral insect data: straight upwind surge Using such an approach, we compare the strategies detailed above: reactive versus cognitive searching in dependence of the stimulation strength for a turbulent air flow. Our cyborg, a male moth We consider in this article the following questions: is complex cognitive searching superior to using simple reactive strategies? What is the influence of the stimulus strength? How can the resulting search trajectories be characterized and compared? Do they show common features and how do they relate to behavioral data? We expected a clear and overall predominance of infotaxis since the algorithm involves memory and learning, and it has been proven to be very successful in computer simulations We first present the biological motivation of the implemented reactive search strategies. We then detail the results of using these strategies, as well as the infotaxis algorithm, in cyborg experiments. On the one hand, we focus on basic features as success rate and efficiency, expressed by the corresponding trajectory lengths. On the other hand, we also aim at a more detailed characterization of these search paths, including a qualitative comparison to behavioral data We first detail the analysis of the neuronal MGC recordings. Subsequently, we relate the different regimes therein to the reactive search strategies used in the cyborg experiments. After a brief introduction of the infotaxis strategy, we present the results of comparing various search strategies in cyborg experiments. Finally, we relate and compare patterns occurring in our cyborg trajectories to those of walking moths published in We consider the electrophysiological MGC recordings of 8 multiphasic neurons and 6 monophasic neurons , part 1,For comparison, we also analyze monophasic MGC responses to pheromone stimulation, shown in sp strategy neglects the Off while the other two strategies (za and ze) comprise a zigzag casting sequence representing the Off in our multiphasic neurons . Note that the cyborg stops zigzagging after a fixed period of 19 s (if there is no further detection): as we record from the antenna and not from the MGC, we do not have access to the length of the Off. Our za and ze strategies combine zigzagging with either arithmetic or exponential spirals As initial movement, we choose arithmetic or exponential spiraling which represents baseline firing. We assume that each detection event initiates a straight upwind surge representing the On. If there is no subsequent detection, the movement changes either into Off zigzagging followed by baseline spiraling, or it directly switches back to baseline spiraling  and exploration . The exploration mode predominates if there is nearly no information available. Long periods of time with no odor encounter broaden the posterior distribution and compel the agent to explore the environment in large patterns. On the contrary, if many detections indicate that the source is close, the exploitation mode triggers more localized movements. Starting from a prior probability distribution for the location of the source, the agent accumulates information while exploring its environment. Both odor detections and non-detections contribute to the ongoing update of the estimated spatial probability distribution. Infotaxis has been shown to function very well in computer simulations , 85% (za), and 84% (ze), averaged across different doses. Cognitive searching yields a sightly higher success rate of 93% (it) trials without stimulation is 73%. These are not called false positives, since infotaxis is supposed to be successful even without stimulation . More details are given in ze path lengths obtained for varying doses, as well as between sp, za and ze path lengths obtained for the maximum dose are particularly small because these trajectories are close to the minimum length.A global ANOVA yields a statistically significant difference for both strategy and dose  together with particularly long trajectories.mal path  coincidemal path . For cogsp histogram shows one single peak representing the upwind surge associated with the On response while the za histogram exhibits two additional peaks at approximately za and ze histograms . In terms of reactive trajectories, however, the number of turns slightly decreases with increasing dose . Otherwise, in case of stimulated trials, the path length increases with the pheromone doses due to the high number of turns which are related to the exceptionally high number of detections (see subsection Infotaxis) \u2014 while the horizontal spread decreases.One might wonder about the low success rate for reactive trials with no stimulation  as the cBombyx mori) walking in a wind tunnel tries to locate a pheromone source (relatively high pheromone concentration) located 60 cm away from the starting position za and ze strategies za and ze trajectories (With ectories .sp), and two more complex strategies including an additional Off zigzag phase following the surge sequence . We applied these reactive strategies, as well as the cognitive infotaxis algorithm, in robotic experiments enabling our cyborg to locate a pheromone source. Reactive searching with Off zigzagging yielded the shortest trajectories, independent of the pheromone dose : (Z)-7-dodecenyl acetate, (Z)-9-tetradecenyl acetate and (Z)-11-hexadecenyl acetate. The stimulation lasted 200 ms. There are 4 to 10 trials for each neuron. Extracellular recordings were performed by inserting two glass electrodes filled with Tucson ringer into the MGC. After amplification the signal was band-pass filtered (0.3 to 5 kHz) and sampled at 16 kHz. Spike sorting (R-package SpikeOMatic) yielded single neuron signals. For more details see Neurons from the macroglomerular complex (MGC) were recorded from male We here analyzed the responses of 8 neurons that exhibited clear multiphasic responses : an exciThe Off occurrence is usually based on an increased firing compared to baseline activity , see 2, 1 CaCl2, 12 NaCl. A silver wire inside the glass pipette served as recording electrode while another wire, the reference electrode, was inserted into the neck. The sensor was approximately 16 cm above the ground. An EAG acquisition board was embedded on the robot. The EAG signal was transmitted wireless via WIFI to a remote computer in order to be used as input for a MGC neuron model. This neuron simulation was performed in real-time (time steps \u200a=\u200a0.01 ms) using SIRENE, a C-based neural simulator (http://sirene.gforge.inria.fr). Neuron simulation, pheromone detection and robot control were performed in separate threads. A graphical user interface (written in Qt/C++) visualized both EAG input and neuron output. For more details see Tethered moths  \u00b5l of pheromone solution dropped on its tip, located approximately 16 cm above the ground. We used three different doses: minimum \u200a=\u200a0.1 \u00b5g/\u00b5l, medium \u200a=\u200a0.3 \u00b5g/\u00b5l and maximum \u200a=\u200a1 \u00b5g/\u00b5l of main pheromone component ((Z)-7-dodecenyl acetate). The plume contour (indicated by black dashed lines in http://en.wikibooks.org/wiki/Category:Khepera_III_Toolbox).Our cyborg  had to locate the pheromone source in an arena of 4 m length and 2.5 m width, see We employed three reactive search strategies and one cognitive strategy, namely infotaxis sp strategy) or by crosswind zigzagging (za and ze strategy) as illustrated in za) was generated by ze) results from After each detection, the cyborg received a surge command leading to a straight upwind movement (approximately 5 cm). This was either followed by spiral casting . Track-angle histograms  show the distribution of track-angles, i.e., movement directions: 0 means straight upwind, In total, we performed 428 successful trials using reactive search strategies and 85 successful trials using infotaxis . Ideallyirection  and 5B."}
{"text": "Background: The National Dietary Survey on the Child and Adolescent Population in Spain (ENALIA) provides data to assess the usual micronutrient intake among Spanish infants, children, and adolescents. Methods: Cross-sectional survey (November 2012\u2013July 2014) of a representative sample of Spanish children and adolescents (six months\u201317 years) (n = 1862). Dietary information was collected using two non-consecutive one-day food diaries (six months\u201310 years old) or two 24 h dietary recalls (11 years and older) separated by at least 14 days. Estimates were calculated using the Iowa State University method and PC-SIDE software  to account for within- and between-person variation. Results: Usual intake of vitamin D was insufficient in practically all individuals. Vitamin E, folate, and calcium were insufficient, especially from nine years of age, and magnesium and iodine from 14 years of age. The percentage of subjects with insufficient intakes was higher among females. Sodium intake was excessive in a considerable percentage of the population, especially in males, and it increased with age. Finally, over half of children under four years of age had zinc usual intakes that exceeded the Tolerable Upper Level. Conclusion: Vitamin and mineral intake in Spain should be improved, especially in late childhood and adolescence. Nutritional intervention and educational strategies are needed to promote healthy eating habits and correct micronutrient inadequacies in Spanish children and adolescents. Early childhood is the most rapid period of development and following a balanced diet in these stages is essential to ensure optimal growth and development . AdolescDietary surveys provide insight into dietary habits and food intake and help estimate the adequacy of the nutrient intake of different groups in a population, monitor their changes and develop nutritional interventions. One of the challenges in dietary surveys is the assessment of usual intakes, i.e., the long-term dietary information. Single or repeated 24 h dietary recalls or food records are used for dietary assessment in large epidemiological studies  because Until now the reference study on children and young people in Spain was the enKid study. It was conducted between 1998 and 2000 on 2855 Spanish children and adolescents aged between two and 24 years . DietaryThe ENALIA study  is a cross-sectional survey that was carried out in Spain and sought to collect accurate food consumption data in children and adolescents in a way that is consistent with other European countries ,14,15. TThe ENALIA study was a cross-sectional survey conducted in Spain on a national sample of children and adolescents (six months\u201318 years old). The design, protocol, and methodology of the ENALIA study have been already described elsewhere ,17 and fThe study was conducted according to the guidelines laid down in the Declaration of Helsinki. Depending on the age of participants, information was given to parents, tutors, or other legal representatives, and consent and assent from each participant were obtained before proceeding with the study interviews. The Spanish Agency of Consumption, Food Security, and Nutrition (AECOSAN), belonging to the Spanish Ministry of Health, Social Services and Equality, approved the study. In accordance with the Spanish Ethical Review System, ethical approval was exempt from ethical review because this is a population-based survey, no intervention were done, no human biological samples were collected, and all data from the study were anonymized and de-identified.The target population was people under 18 years old living in households in Spain. The ENALIA study began in November 2012 and ended in July 2014. Institutionalized populations were excluded. Recruitment was done via home visits and for children under four years of age, also in kindergartens, since in Spain they are only for the day care of the children. Subjects were randomly chosen from all 17 autonomous regions in Spain, according to a random multistage sampling procedure, considering census section and municipality, population size , age, and sex. To capture the inter-seasonal variability in consumption patterns, subjects were uniformly distributed over the four different seasons, and the schedule was organized to capture an adequate proportion of weekdays and weekend days at the population group level. The sample was also distributed uniformly over the weeks in a month. The recruitment process included five contacts: an initial contact with household by phone or at nurseries/kindergarten (for children under three years of age), a second contact by letter , two more contacts by phone , and a fifth final contact with a household visit .The ENALIA final sample included 1862 children aged six months to 17.9 years. The participation rate was 68.9%. Dietary information was collected using two different methodologies depending on the child\u2019s age: two non-consecutive one-day food diaries separated by at least 14 days, for children from six months to 10 years of age or two 24 h dietary recalls, separated by at least 14 days, for adolescents (11 years old and over). In younger groups of children (under 11 years old), parents and caregivers were responsible for completing the food diaries and the other questionnaires, and requested collaboration and/or information from other proxy persons about the child\u2019s out-of-home diet. The recalls were conducted using specific software (ENIA-Soft)  in computer-assisted interviews by trained interviewers and nutritionists/dieticians. Food diaries were also recorded using this software, since guided the interviewer during data collection, facilitating the homogenous collection of information. The software included a database with coded foods, a database with standard recipes, a database with weights and household measurements, and a database with pictures and portion weights from a validated photographic food atlas for Spanish children and adolescents . The picNutrient intake was calculated from dietary records/recalls using the Spanish Food Composition Tables  completeA general questionnaire asked about sociodemographic data, such as the birth date of the participant, place/country of origin of the participant and his/her parents, academic level and profession of parents, and about the health status of the participant .Anthropometric data of the participant were measured at the interviewee\u2019s home by trained interviewers and following standardized procedures . A stadiSample weight factors for each participant were calculated to account for nonresponses and to weight the sample to known population demographic characteristics. Since the average intake of a small number of days of dietary record/recall (observed intakes) does not adequately reflect the usual intake, it is necessary to statistically model the dietary data to eliminate day-to-day variation in food consumption . We usedTo assess vitamin and mineral adequacy, the Estimated Average Requirement (EAR) cut-off point method was used . We usedThe plausibility of energy intakes was assessed using the Goldberg\u2019s cut-off method  updated p value < 0.05 indicated statistical significance. The normality of the distribution of age, anthropometric and EI/BMR data was checked using the Kolmogorov\u2013Smirnov test. Differences between males and females were examined with the Student\u2019s t test or the Mann-Whitney U test, depending on whether or not the data were normally distributed. Categorical variables were compared using the \u03c72 test. Dietary intakes of the participants were expressed as the means and standard deviations, medians, and 5th and 95th percentiles.Statistical analyses were performed using the statistical software package SPSS version 20.0 for Windows. A Characteristics of the studied sample are shown in The percentage of under-reporters ranged from 0.6% (children aged six to 12 months) to 19.8% (adolescents aged 14\u201317 years). On the other hand, overestimation was higher in younger children (16%) and lower in adolescents (0.4%). The data presented in the rest of this report have not been adjusted for under-reporting.The usual intakes (from food and beverage sources only) of vitamins and minerals are presented in Regarding the usual intake of minerals, the prevalence of inadequate intakes in children below four years of age was low (<5%), except for iron in children between six and 12 months and for iodine in children between one and three years, where a subset of infants (10.9%\u201314.2% for iron and 11.0%\u20137.8% for iodine, The usual intake of minerals exceeded the ULs for sodium in a high percentage of children and adolescents, and the prevalence of higher usual intakes increased with age . In addiThis paper provides recent estimates of the vitamin, mineral, and trace element intake distributions, from food and beverage sources only, in a representative sample of Spanish infants, toddlers, children, and adolescents. The usual micronutrient intakes in the ENALIA study meet or exceed their requirements, except for those of vitamin D, which was practically insufficient in all individuals, and vitamin E, folate, calcium, magnesium, and iodine, especially in adolescents and females. Sodium intake is excessive in a considerable percentage of the population, especially in males, and increases with age. Finally, the usual intake of zinc exceeds the UL in children less than four years of age.Data on intake distributions in children, corrected for the day-to-day variation, are very scarce in Europe . As for Both food diaries and dietary recalls are prone to under-/over-reporting, and there is debate about whether or not to eliminate misreporters in dietary studies, since the exclusion of potential misreporters may create a biased sample. The exclusion of under-/over-reporters might have induced selection bias since the misreporters might have a special food choice or eating behavior. In addition, under-reporting includes both under-recording and under-eating, and some over-reporters could eat much more than usual during the period of study as well. It has also been suggested that low energy reporting may be just as common among plausible energy reporters as among those defined as under-reporters , so thatThis study highlights the very low intake of vitamin D, which is insufficient in all age groups and sexes, and the fact that almost all individuals have intakes that are at risk. Vitamin D deficiency is a worldwide health problem, and similar data have been described in infants in the Netherlands , FinlandThe usual mean vitamin E intakes were less than the EARs in some subgroups of children, especially those over nine years of age, similar to what was observed in other toddlers and preschoolers  and in aFolate intake is inadequate in a high proportion of children and adolescents over nine years of age . The risRegarding minerals, the risk of inadequate calcium intake is especially high in children over nine years of age and is even higher in females . DiethelAs for iron intake, the EARs are exceeded in almost all subgroups, except for a small but important subset of six- to 12-month-old infants whose usual intakes were below the EAR (10.9% in males, 14.2% in females, On the other hand, the percentage of adolescent girls with inadequate iron intake is low relative to other studies, although differences may be due not only to different eating patterns of children and adolescents within Europe , but alsThe usual intake of sodium exceeds the UL in a considerable percentage of children in all age and sex groups, although the prevalence of excessive intakes is higher in males . SimilarThe usual magnesium intake is insufficient in 63.5% of adolescent males and 81.8% of females . The medSome small but important subsets of children have a high risk of inadequate intake of iodine, and the risk is highest in adolescent females over 14 years . Other sFinally, the usual zinc intake exceeds the UL in children up to four years of age, although there was a group of girls over nine years old with intakes at risk of deficiency (9.2% and 6.3% in girls between nine and 13 years and over 14 years, respectively, Our study has some limitations and strengths. First, the food composition tables may not accurately reflect the nutrient composition of the food. It is appreciated that there is variability in the composition of foods, likely due to differences in season, cultivar, or variety. On the other hand, the Spanish Food Composition Tables used included enriched/fortified foods commonly available in Spain, and additional composition data for specific brands were taken into account. Fortification values can differ between countries, so data from food composition tables from other countries might not be adequate. Our study did not account for the use of supplements of vitamins and minerals, so the results of this study are limited to the dietary intake of micronutrients. Although parents may be reliable reporters of their children\u2019s food intake at home, meals out of parental control are prone to being misreported, as are the estimation of their portion sizes . FinallyThis paper provides recent data on the dietary vitamin and mineral intake from food and beverage sources of Spanish children. Public health initiatives should ensure that children and adolescents follow an adequate, balanced diet because the health behaviors adopted during the early years of life and adolescence can be maintained in adulthood, and improving them would help prevent many chronic diseases related to diet. Such initiatives should include the promotion of a Mediterranean Diet style, including more fish, eggs, cereals, and dairy products which are source of vitamin D, and lowering the consumption of processed foods which are sources of sodium. Additionally, the collaboration between the administration and the industry aiming to reduce more of the sodium content of processed foods is also desirable. Clinical and biological assessment of the nutritional status of a representative sample of Spanish children and adolescents focusing on the micronutrients of concern would seem advisable."}
{"text": "Malignant airway obstruction is a feared complication and will most probably occur more frequently in the future because of increasing cancer incidence and increased life expectancy in cancer patients. Minimal invasive treatment using airway stents represents a meaningful and life-saving palliation. We present a new removable airway stent for improved individualised treatment.in vivo model using two anaesthetised and spontaneously breathing pigs, we deployed and subsequently removed the stents by unravelling the device. The procedures were executed by flexible bronchoscopy in an acute and a chronic setting \u2013 a \u2018proof-of-principle\u2019 study.To our knowledge, the new airway stent is the world's first knitted and uncovered self-expanding metal stent, which can unravel and be completely removed. In an The new stent was easily and accurately deployed in the central airways, and it remained fixed in its original position. It was easy to unravel and completely remove from the airways without clinically significant complications. During the presence of the stent in the chronic study, granulation tissue was induced. This tissue disappeared spontaneously with the removal.The new removable stent functioned according to its purpose and unravelled easily, and it was completely removed without significant technical or medical complications. Induced granulation tissue disappeared spontaneously. Further studies on animals and humans are needed to define its optimal indications and future use. Benign and malignant airway obstruction (MAO) may affect individuals at all ages. The physicians must think and act differently in each case, depending on the cause, the characteristics of the airway obstruction, and the individual patient. The treatment options are numerous, including interventional bronchoscopy, systemic treatment, and endobronchial and extrathoracic irradiation. The need for optimal individualised treatment is a fact \u20133.Benign airway obstruction comprises fibrous membrane stenosis, post-infectious granulomas and strictures, tracheobronchomalacia, foreign bodies, and severe haemoptysis. MAO is more frequent in the adult population, expressed either as intrabronchial tumour growth or external tumour compression, not seldom complicated with trachea-esophageal fistulas and airway stenosis . Figure Thermal ablation  or brachytherapy applied with bronchoscopy is often used to treat MAO. Thermal ablation is contraindicated in stenosis caused by pure external tumour compression, often leaving stent therapy as the best choice. There are different types of stents available on the market. Some silicone stents are radiopaque and some are not; deployment needs rigid bronchoscopy and general anaesthesia, but these stents can be removed. Self-expanding metal stents (SEMS) are visible by X-ray; deployment can be performed with flexible bronchoscopy using conscious sedation combined with local anaesthetics. Uncovered SEMS can be difficult to remove because of epithelisation, ingrowth of tumour and granulomatous tissue. This drawback is less pronounced in first weeks after deployment and less a problem in covered stents. Uncovered SEMS are avoided in benign airway disorders and in patients with MAO who have a longer life expectancy. Complications to airway stents are migration within the airways, granuloma formation, mucostasis and pneumonia, mucosal ischaemia and fistulas. This is because of the radial pressure on neighbouring tissue induced by the stent. Complications may also be associated with the underlying condition or comorbidity , 14, 15.Lacking the possibility of removing uncovered SEMS, especially after 6\u20138 weeks, is a clinically important limitation of the functionality of the stent. Covered SEMS are often used in patients with MAO and short lifetime expectancy \u201319. FirsThe removable stent used in the two current experiments represents a new type of uncovered self-expanding metal stent made by the memory alloy nitinol . The stein vitro for its mechanical properties and as vascular stent in iliac arteries in sheep in acute and chronic studies, with successful unravelling. The stent is ordered and produced online based on specifications of needs for a specific person and condition. It is produced at GraftCraft AB, Bor\u00e5s, Sweden. The stent is not approved for medical use in humans, but based on this and further studies, this is the plan.The stent is knitted from a nitinol thread. Nitinol is a memory alloy, and the stent thereby belongs to the group of SEMS. There is usually no need for any balloon dilatation after deployment of the stent. The mechanical impact and radial force can be predefined and specified according to the individual needs, which increases the possibilities for successful individualised treatment. Before this study, the new removable stent has been thoroughly tested, in vivo animal study with two spontaneously breathing pigs \u2013 \u2018A proof-of-principle study\u2019. The procedure was first tested in a phantom model and subsequently in the animal model , safety (adverse events) and the ability to be removed (unravelling characteristics). The study was performed in an acute and a chronic setting using an al model .in vivo animal model with spontaneous breathing anaesthetised pigs. The pigs were acclimatised for 1 week before the studies in the animal research department and fasted overnight before each experiment. Subcutaneous premedication was given (azaperon 16 mg/kg body weight (mg/kg bw), diazepam 0.25 mg/kg bw, ketamine 3 mg/kg bw and 1 mg atropinsulphate). Anaesthesia was given through a venous catheter in a marginal ear vein. Induction consisted of ketamine 3\u20134 mg/kg bw and sodium pentothal 2\u20133 mg/kg bw. The pig received a temporary or orotracheal tube for transportation between buildings. Maintenance anaesthesia was given as a continuous intravenous infusion of ketamine, midazolam and fentanyl.We established a novel 2 supply on a nasal tube with an inner diameter of 4.0 mm. Complementary ketamine, midazolam and fentanyl were given when the respiratory rate increased, respiration deepened and/or the eyelash reflex was elicited by finger stroke. Heart rate was kept between 60 and 100 beats/min and blood pressure was kept within 100\u2013120/60\u201380 mmHg.The orotracheal tube was removed right before the start of the stenting procedure. To achieve spontaneous breathing and open airways, the jaws and tongue were fixed with smooth textile bonds. Adequate oxygenation (oxygen saturation 96\u2013100%) was maintained by 10 l/min OWe used a flexible bronchoscope  for inspection, deployment, unravelling and removal of the stents. The operating theatre was located at the Operating Room of the Future (ORF), which is dedicated to research and development activities. Deployment was facilitated by using a guide wire and an in-house-built introducer. The deployment and removal procedure was documented and guided through bronchoscopy videos and images, X-ray (fluoroscopy) and cone beam CT acquisition.Deployment and accurate placement, subsequent unravelling and complete removal of differently sized stents in differently sized airways in both lungs were performed with a flexible bronchoscope . During Day 1: Deployment and accurate placement of stents, leaving one peripheral (8\u00d720 mm) and one more proximal stent (11\u00d720 mm) in the right (main) bronchus . ThereafDay 14: Bronchoscopy during which the operator grabbed the proximal end of the thread with the forceps, pulled carefully and unravelled the proximal stent as one single thread in one sequence, as described above in the acute study. The distal stent was left behind. The animal was observed in the ACF for another 4 days.Day 18: Bronchoscopy was performed to study the conditions and healing of the proximal right main bronchus after removal of the proximal stent and control of the position and bronchial condition of the residual distal stent.In the acute and at all stages of the chronic study, acquisition of bronchoscopy images and videos were collected, together with X-ray (fluoroscopy) and cone beam CT images. During anaesthesia, the pig showed no spontaneous movement, but showed normal cardio-pulmonary functions and breathed spontaneously during the whole experiment.The Local Ethics Committee of the Norwegian Experimental Animal Board approved the experiments in accordance with the Helsinki Convention for the use and care of animals.The two stents (size 11\u00d720 mm and 14\u00d720 mm) were successfully deployed and accurately placed in the central airways, using a flexible bronchoscope and an in-house-built introducer and guide wire. The stents remained in their fixed positions before they were successfully unravelled and completely removed from the airways, carefully, in one sequence as a single thread . The steDay 1: The two stents were successfully deployed and accurately placed in the right bronchial tree, one in distal position, lobe bronchus (8\u00d720 mm stent), and the other in a more proximal position, main bronchus (11\u00d720 mm stent), using the same instruments and technique as described in the Acute study section.Day 14: The extended thread was immediately found using the bronchoscope, it was grasped with a forceps and the stent was easy to unravel and completely remove from the airways, with the technique described in the Methods section. The stent was carefully pulled out as a single thread in one sequence. The procedure was effective and safe, and was performed without technical or medical complications . The vidDay 18: We observed the same phenomenon in the residual distal stent with occurrence of mucus retention and granulation tissue. At this time, the proximal main bronchus from where the proximal stent had been removed was almost free from mucosal inflammation and granulation tissue. The bronchial wall had recovered almost completely 4 days after removal of the stent  \u2013 Day 18The new removable SEMS was successfully deployed and accurately placed in the airways; it expanded in accordance with its purpose and remained in a fixed position, both in peripheral and more proximal parts of the right bronchial tree. It was easy to unravel and completely remove without significant medical or technical complications, regarding both the acute and chronic study. The stent was removed carefully as one single metal thread in one sequence. In this \u2018proof-of-principle study\u2019, the stent fulfilled its expected efficacy, safety and feasibility. No other studies with predesigned unravelling, removable and uncovered SEMS are known to date. Inflammatory adverse events and granulation tissue, associated with present available uncovered SEMS, also occurred using the new removable stent. To our experience, this phenomenon was shown to be of the same quality and extent as we have seen with ordinary uncovered stents. We emphasise that after the stent removal, the inflammation and granulation tissue had almost disappeared within 4 days, leaving the bronchial wall in a good recovery state.The current feasibility study was a preclinical proof-of-principle study in presumptively healthy pigs. The results should therefore be interpreted with caution before extended to the treatment of MAO in human beings. The relevance of the animal model for the present hypothesis may therefore be questioned. With respect to the difference between healthy airways of pigs versus MAO in human beings, the findings cannot directly be transferred. Apart from that, the choice of species can be fairly well argued for the main purpose of this initial feasibility study. First, porcine models have been established as reliable animal models for a variety of human lung-related conditions, regarding anatomy and size to genetic and translational medicine, including our own experience \u201324. TestRemoval of ordinary uncovered SEMS may cause harm to the bronchus and promote bleeding, especially 6\u20138 weeks after deployment. Covered SEMS can be removed, but also these stents may cause complications due to inflammation, granulation tissue and ingrowth \u2013 especially at the proximal and distal ends. In this study, a superficial bleeding occurred after unravelling the stent in the chronic study, which was easily and quickly cleaned by suction and ceased.To sum up, the pros are 1) easy and accurate deployment with the possibility to change stents during the procedure, 2) stents remained in fixed positions in the airways over 18 days , 3) easy unravelling and complete removal of the stent without significant technical or medical complications and 4) pronounced and fast mucosal recovery after removal of the stent. Cons are 1) the occurrence of some mucosal retention and 2) inflammatory granulation tissue, as expected in all commercially available stents to date. The new stent functioned according to its purpose and it seems promising for human use.Area of utilisation may be wide and appropriate. First, uncovered SEMS may maintain airway branch ventilation better than covered or silicon stents, and the new stent may cover all established indications of ordinary SEMS. Second, removable stents may be favourable as short-term or temporary use after interventional bronchoscopy, subsequent extra thoracic radiation or brachytherapy and thereby minimise development of stenosis formation and complicating atelectasis or obstructive pneumonia. The removal of the stent has the potential to further reduce the degree of granulation tissue, thereby achieving an even larger bronchus diameter. Third, the physician would appreciate the opportunity to remove the stent at any time, also during the deployment to guarantee optimal individualised treatment.There may be some additional advantages: one can order the right size, shape and radial force and vary the thread dimensions and characteristics, and knitting characters. The final stent placement and function has a high potential to be optimal because the stent can be changed at any time. In summary, it may lead to an improved individualised endoscopic therapy. Results from human studies are necessary for final conclusions, but the results from the present proof-of-principle study seem promising for human use.The new removable and uncovered self-expanding metal stent was successfully deployed in the central airways of pigs, using a flexible bronchoscope and spontaneously breathing animals. The stents remained fixed in their original positions and were easy to unravel and completely remove from the airways after 14 days, without any clinically significant complications. The removal imposed an almost complete recovery of the inflammatory responses within 4 days. Further studies on animals and humans are needed to evaluate the efficacy, safety and optimal use of the new removable stent in human beings."}
{"text": "Trichoderma. In general, almost half of the variations of transcriptome and protein level are due to translational control. Thus, studies are required to integrate raw information from different \u201comics\u201d approaches for accurate depiction of translational response of BCAs in interaction with plants and plant pathogens. The studies on translational status of only active mRNAs bridging with proteome data will help in accurate characterization of only a subset of mRNAs actively engaged in translation. This review highlights the associated bottlenecks and use of state-of-the-art procedures in addressing the gap to accelerate future accomplishment of biocontrol mechanisms.Genome-wide studies of transcripts expression help in systematic monitoring of genes and allow targeting of candidate genes for future research. In contrast to relatively stable genomic data, the expression of genes is dynamic and regulated both at time and space level at different level in. The variation in the rate of translation is specific for each protein. Both the inherent nature of an mRNA molecule to be translated and the external environmental stimuli can affect the efficiency of the translation process. In biocontrol agents (BCAs), the molecular response at translational level may represents noise-like response of absolute transcript level and an adaptive response to physiological and pathological situations representing subset of mRNAs population actively translated in a cell. The molecular responses of biocontrol are complex and involve multistage regulation of number of genes. The use of high-throughput techniques has led to rapid increase in volume of transcriptomics data of  Trichoderma is a cosmopolitan and cardinal representative soil microflora of various climatic conditions . Genome sequencing and its annotation in mycoparasitic species have depicted genome sizes of 38.8 and 36.1 Mb for T. viride and of T. atroviride for biocontrol strains, respectively, compared to 34 Mb of T. reesei an industrial strain. Annotation of complete genome depicted a gene pool of 11,800 genes for T. atroviride and 12,400 genes for T. viride, compared to 9,143 genes in saprophytic strain T. reesei. The abundance of gene pool in mycoparasitic strains of Trichoderma genome . Recent studies showed that the gene expression of mycoparasitic T. harzianum and T. atroviride strains changes not only to plant-pathogenic fungi . The interaction of Trichoderma with host plants reprograms not only the gene expression of biocontrol strains but also of its associated host plant . For example, strains of Trichoderma are explored for growth promotion and boosting immune responses, root development, and activation of seed germination or amelioration of abiotic stresses  transcripts were found significantly differentially expressed in mycoparasitic interactions. The differentially expressed transcripts were also investigated during pathogenic attack on Phytophthora capsici, Botrytis cinerea, and R. solani . A comparative account of genome revealed presence of seven chromosomes in industrial strain T. reesei  during the early interaction of T. atroviride with B. cinerea and R. solani were identified .Studies involving translational regulation of gene expression are emerging as a prominent tool for the understanding the regulation of protein abundance in adaptive responses of the host . In the Figure 3). Polysomal profiling discovered in 1960s involves the separation of actively translated mRNAs bound by several ribosomes from free RNA by sucrose gradient centrifugation and then mRNAs can be coupled to northern blot or RT-qPCR or cDNA microarrays, or RNA-seq on a global level  polysomal profiling, (b) ribosomal profiling, and (c) ribosome affinity purification (RAP) .The post-transcriptional events such as translation regulation and protein stability are the principle causes of weak correlations and variations in proteomic, transcriptomic, and genomic data. The associated errors in transcriptome analysis are subjected to arise from the suppression by microarrays which can further impede the identification of active candidate transcripts. On the other side, methods opted for protein staining, limitations associated in visualizing low-abundant and co-migrating proteins seriously hampers proteomic based study. The recent developments in proteomics methods such as use of mass spectrometric (MS) and liquid chromatography (LC) techniques have made quantitative proteomic profiling, currently a driving force for identification of proteins. The highly stable and reproducible performance of mass spectrometers such as Q Exactive hybrid quadrupole-Orbitrap mass spectrometer MS and Triple TOF 5600 MS is capable of identification of both proteomics  and charTrichoderma spp. has accelerated our research on understanding of the behavior of different species of this genus and how the information on their gene pool determines their capabilities and limitations. The genomes of Trichoderma which is known to contain thousands of genes encoding different glycosyl hydrolases, secondary metabolites, antibiotics, lectins with insecticidal properties, and transporters with potential in bioremediation involved in antibiotics biosynthesis, and several other candidate genes , translatome level (ribosome loaded mRNAs) and the proteome is experimentally feasible in a high-throughput way, the integration of these omic technologies is still far away. Systematic global analyses aims at integrating transcriptome, translatome, and proteome level can provide accurate view of widespread adaptive mechanisms of interaction between Trichoderma\u2013plant\u2013pathogen.The genomic comparison of mycoparasitic species of Trichoderma arsenal involved in its success as BCAs as well as industrial sectors. In such instances, the integration of the translatome using ribosomal profiling and coupling it with proteomic approaches such as liquid chromatography-tandem mass spectrometry (LC-MS/MS) for both extracellular and intracellular proteins offers a lot of scope for accurate characterization of active molecular components involved in biocontrol and then subsequently their utilization of various applications.In future, integrated efforts will help us to better understand, identify, and then explore the molecular behavior of Trichoderma\u2013plant\u2013plant pathogens in three way interaction will play vital role in accurate characterization of transcripts responsible for cosmopolitan nature of Trichoderma and then targeting the promising one for agricultural based applications. The latest advancements and complete genome sequencing have already provided a platform of gene pool. Further integration with latest functional techniques such as translatome will lead another step close to identification of targets in the form of active transcripts involved in a complex interaction of plant\u2013BCA\u2013plant pathogens.A comparative multiomic coupled insights of VS and RS prepared the manuscript. PS and AG edited the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "There are limited longitudinal data regarding nutritional intake and status, and physical function in community-dwelling ethnically diverse older adults. This study explored these variables and their relationship at baseline (n=100) and after 8-months (n=81) among community-dwelling ethnically diverse older adults (\u226560 years) in Birmingham, United Kingdom. Multiple pass 24-hour dietary recalls and the Mini Nutritional Assessment-Short Form assessed nutritional intake and status, respectively. The Short Physical Performance Battery(SPPB) and handgrip strength measured physical function. Linear and multinomial regression analyses were used to predict the relationship between nutritional intake, status and physical function. Mean(SD) age was 70(8.1) years , with 62% of the sample being obese. Significant decreases in intakes of vitamin B6; vitamin B1; iron; folate; and magnesium occurred over time. At both timepoints, across sexes, daily intakes of all micronutrients except vitamin B12, phosphorus and manganese were below the Recommended Nutrient Intakes. There were significant declines in SPPB scores and nutritional status over time. At baseline, younger age, better nutritional status, and higher vitamin D and fibre intakes were associated with higher SPPB scores. At follow-up, higher baseline SPPB scores  were associated with reduced decline in nutritional status. The observed declines in nutritional status and physical function, and the inadequate nutrient intakes in the absence of weight loss within eight months pose serious challenges to healthy ageing. There is an urgent need to re-evaluate and tailor appropriate dietary advice for this population to support them to age healthily."}
{"text": "Subgroup analysis and meta-regression were used to explore heterogeneity. A total of 65 eligible studies reported one-year prevalence estimates for 61,800 health care professionals from 30 countries. The pooled one-year prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors was 19.33% : 16.49\u201322.53%) and the overall heterogeneity was high across studies. We noted geographic and staff categories variations for prevalence estimates through subgroup analysis. The meta-regression showed that sample size, type of health care setting, and quality score were significant moderators for heterogeneity. One in five health care professionals experienced workplace physical violence perpetrated by patients or visitors worldwide annually. Practical intervention was needed to ensure safety of health care professionals.Workplace physical violence against health care professionals perpetrated by patients and visitors has been a persistent problem worldwide. Prevalence estimates varied vastly across studies and there was a lack of quantitative syntheses of prevalence studies. This review aimed to quantify pooled one-year prevalence estimates at the global and regional levels. A systematic literature search was performed in the databases of PubMed, PsycINFO, Web of Science, and Embase between 1 January 2000 and 8 October 2018. Studies providing information about one-year prevalence of self-reported workplace physical violence against health care professionals perpetrated by patients or visitors were included. Heterogeneity between studies was evaluated using Cochran\u2019s chi-squared test (Cochran\u2019s Q) and I Workplace physical violence against health care professionals has been a persistent problem of health care environment worldwide ,2. HealtThe WHO had classified workplace violence into physical violence and psychological violence. Physical violence was defined as physical force  against a person or groups that results in physical, sexual, or psychological harm . PhysicaIn order to obtain relatively reliable pooled prevalence estimates, the research included in meta-analysis should be relatively consistent in definition. The definition of workplace physical violence was more consistent across studies ,14,15. ETo address the need for global estimates of prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors, we did a meta-analysis of relevant studies around the world. We also aimed to understand how the methodological characteristics  and contextual factors  influenced the variations in prevalence estimates. A systematic literature search was performed. Possible relevant studies were screened based on strict eligibility criteria. Quality of eligible studies was assessed. Quantitative synthesized one-year prevalence of workplace physical violence against health care professionals perpetrated by patients and visitors was obtained by the meta-analysis.This meta-analysis was performed according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines see . The folStudies were independently screened by two reviewers (Y.-L.L. and R.-Q.L.) using the eligibility criteria described below. Studies were included if they meet the following criteria: (i) provided one-year prevalence of self-reported workplace physical violence against health care professionals perpetrated by patients or visitors; or (ii) reported definition and measurement of workplace physical violence. We excluded studies if they met the following criteria: (i) included medical student, cleaning staff, clerk, security, or administrative staff as participants; (ii) did not report perpetrators of the workplace physical violence; (iii) reported response rate <20%, or no response rate was reported; or (iv) was conference abstract, report, review, meta-analysis, letters, pilot study, protocol, or qualitative study. Workplace physical violence against health care professionals included beating, kicking, slapping, stabbing, shooting, pushing, biting, and pinching against health care professionals in their workplace . We inclTwo researchers (Y.-L.L. and R.-Q.L.) independently extracted relevant data from eligible studies and a third researcher (D.Q.) cross checked for accuracy. The following data were extracted: author, year of publication, country of study, sample size, categories of health care professionals, sampling method, method of data collection, response rate, type of health care setting, region of health care setting, and one-year prevalence estimates of workplace physical violence perpetrated by patients or visitors.The methodological quality was assessed using the eight-item Loney criteria see . Studies2 values. The significant heterogeneity between studies was assumed when p < 0.1 or I2 > 50% [Statistical analyses were performed using the \u201cmeta\u201d and \u201cmetafor\u201d package of R version 3\u00b75\u00b72 . Firstly, a normality test for the original study rates was performed to decide whether to transform the original rates. According to the normality testing results, a logit transformation method was used in this meta-analysis. Heterogeneity between studies was evaluated using Cochran\u2019s chi-squared test (Cochran\u2019s Q) and II2 > 50% . A randop < 0.05) in the regression model based on the result of the univariate analysis.To further explore the relevant factors influencing prevalence estimates, univariate meta-regression analysis was conducted including the following covariates: year of publication, income classification, sample size, response rate, method of data collection, professional group, region of health care setting, type of health care setting, and quality score. The multivariate meta-regression analysis included only significant variables ; reviews and conference abstracts (n = 136); used qualitative method only (n = 14); did not report definition or measurement (n = 26); had a response rate <20% or did not report response rate (n = 16); did not provide workplace physical violence prevalence data (n = 84); did not reported perpetrators (n = 89); including medical student, cleaning staff, clerk, security, and administrative staff (n = 38); and no reported and/or not one-year prevalence period (n = 71). Finally, 65 eligible studies were included for the meta-analysis .A total of 65 studies reported one-year prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors, with prevalence estimates ranging from 2.75% to 88.31%. The lowest one-year prevalence was found among nurses in Thailand  and the For the regional level, pooled one-year prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors was 26.38% (95% CI: 18.42\u201336.25%) in the European region, 23.61% (95% CI: 15.25\u201334.67%) in the Americas region, 20.71% (95% CI: 8.59\u201342.07%) in the African region, 17.07% (95% CI: 13.15\u201321.86%) in the eastern Mediterranean region, 14.53% (95% CI: 10.05\u201320.54%) in the Western Pacific region, and 5.62% (95% CI: 1.38\u201320.14%) in the Southeast Asia region. The pooled one-year prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors in high-income, upper-middle-income, lower-middle-income, and low-income countries was 21.66% (95% CI: 17.49\u201326.51%), 19.98% (95% CI: 14.61\u201326.69%), 13.75% (95% CI: 9.49\u201319.50%), and 13.14% (95% CI: 9.62\u2013%17.70%), respectively.Q = 4.38, p = 0.0364). Studies conducted in rural and township areas had significantly lower prevalence estimates than urban areas . The pooled one-year prevalence of workplace physical violence against male health care professionals perpetrated by patients or visitors was similar to that against female health care professionals .Prevalence estimates varied by health care facilities and staff categories. The pooled one-year prevalence estimates in tertiary hospital, secondary hospital, primary care facilities, and nursing home were 22.48% (95% CI: 15.35\u201331.69%), 18.83% (95% CI: 9.94\u201332.77%), 6.51% (95% CI: 4.36\u20139.64%), and 30.33% (95% CI: 22.32\u201339.75%), respectively. The pooled one-year prevalence of workplace physical violence against nurses perpetrated by patients or visitors was significantly higher than that against physicians . When compared studies with response rate >50%, studies with response rate \u226450% had higher prevalence estimates . Subgroup analysis showed the sampling method, year of publication, and method for data collection were not statistically associated with prevalence estimates. All details about the subgroup analysis are provided in Some methodological characteristics also influenced prevalence estimates across studies. When compared studies with sample size >500, studies with sample sizes \u2264500 had higher prevalence estimates , in tertiary hospital , and lower quality score . Specifically, sample size accounted for 8.72% of the heterogeneity, type of the health care setting accounted for 14.20% of the heterogeneity, and quality score accounted for 5\u00b741% of the heterogeneity across studies. Finally, sample size, type of health care setting, and quality score were entered into multivariate meta-regression model. Of the multivariate model, type of health care setting  and quality score  remained significant and accounted for 24.87% of the heterogeneity  to 19.77% (95% CI: 16.87\u201323.03%), and the Ig 0.1012 .Using meta-analytical methods, we pooled the one-year prevalence estimates of workplace physical violence against health care professionals perpetrated by patients or visitors reported in 65 studies published between 2000 and 2018. Eligible studies included 61,800 health care professionals from 30 countries. The one-year prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors was 19.33% (95% CI: 16.49\u201322.53%) worldwide, or about one in five health care professionals annually. To the best of our knowledge, this study provided the first quantitative estimate of the prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors worldwide.Few review articles specifically focused on the prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors. A systematic review conducted in 2008 found that, on average, 25% of health care professionals have experienced workplace physical violence perpetrated by patients or visitors in general hospital . AnotherAmong eligible studies, more than half of the studies were published after 2010. We found that the year of publication was not associated with the prevalence estimates. Administrative strategies, preventive interventions, and policy against workplace violence have been advocated in health sectors over the decade ,84. A suThe results revealed that studies with sample sizes \u2264 500 and studies with low response rate had significantly higher one-year prevalence estimates. The studies\u2019 characteristics obviously influenced prevalence estimates of workplace physical. Studies with fewer participants generally yielded more extreme prevalence estimates , which mThe result of the subgroup analysis suggested that nurses experienced more workplace physical violence perpetrated by patients or visitors than physicians. This phenomenon was supported by numerous epidemiological studies ,69,87,88Gender difference was not observed in this meta-analysis. In a systematic review emphasizing gender difference of physical violence, the researcher found that numerous studies showed male health care professionals experienced more workplace physical violence than females . This sySubgroup analyses revealed that health care professionals working in nursing homes experienced more physical violence from patients or visitors than those in other health care settings. Patients with dementia or disability in nursing homes might present more aggressive behavior and physical violence against health care professionals than general patients . Except Health care professionals working in rural or township areas experienced less workplace physical violence perpetrated by patients or visitors than those in urban areas. Few studies had emphasized the disparity between urban and rural areas . PatientThere were several limitations in the present study. First, although our study included relevant studies across 30 countries, half of the eligible studies were from high-income countries. Prevalence studies were scarce for many countries, especially for lower-middle-income and low-income countries. Considering the inconsistency of the health care environment and working conditions across the world, more prevalence studies in low-income and lower-middle-income countries are needed to understand the panorama of workplace physical violence against health care professionals. Second, the ability to compare findings and understand the magnitude of pooled prevalence was severely hampered by inconsistent methodology between studies, including inconsistent definitions, response rate, and methods of data collection. Although we have excluded those studies without description of definition and measurement, inconsistency was still inescapable. Numerous studies adopted self-designed and self-administrated questionnaire to measure workplace physical violence. It is hard to compare findings without a standard assessment tool. Thus, future research should develop a standard and comprehensive used assessment tool to measure workplace physical violence.The pooled one-year prevalence of workplace physical violence against health care professionals perpetrated by patients or visitors was 19.33% (95% CI: 16.49\u201322.53%). About one in five health care professionals experienced workplace physical violence perpetrated by patients or visitors annually. One-year prevalence estimates varied significantly regarding the country of study, sample size, response rate, professional group, region of health care setting, and type of health care setting. Significant moderators for heterogeneity included sample size, type of health care setting, and quality score. Future research can benefit from exploring gender differences, occupational differences, and time trends in workplace physical violence against health care professionals. More practical intervention and policy defensed workplace physical violence were needed to ensure the safety of health care professionals."}
{"text": "Understanding how engagement in mobile health  weight loss interventions relates to weight change may help develop effective intervention strategies.This study aims to examine the (1) patterns of participant engagement overall and with key intervention components within each intervention arm in the Cell Phone Intervention For You (CITY) trial; (2) associations of engagement with weight change; and (3) participant characteristics related to engagement.The CITY trial tested two 24-month weight loss interventions. One was delivered with a smartphone app (cell phone) containing 24 components  and included prompting by the app in predetermined frequency and forms. The other was delivered by a coach via monthly calls  supplemented with limited app components  and without any prompting by the app. Engagement was assessed by calculating the percentage of days each app component was used and the frequency of use. Engagement was also examined across 4 weight change categories: gained (\u22652%), stable (\u00b12%), mild loss (\u22652% to <5%), and greater loss (\u22655%).r=\u2212.213; personal coaching: r=\u2212.319), number of apps use per day , and percentage of days self-weighed . None of the characteristics examined, including age, gender, race, education, income, energy expenditure, diet quality, and hypertension status, appeared to be related to engagement.Data from 122 cell phone and 120 personal coaching participants were analyzed. Use of the app was the highest during month 1 for both arms; thereafter, use dropped substantially and continuously until the study end. During the first 6 months, the mean percentage of days that any app component was used was higher for the cell phone arm  than for the personal coaching arm . The cell phone arm used the apps an average of 5.3 times/day (SD 3.1), whereas the personal coaching participants used them 1.7 times/day (SD 1.2). Similarly, the former self-weighed more than the latter . Furthermore, the percentage of days any app component was used, number of app uses per day, and percentage of days self-weighed all showed significant differences across the 4 weight categories for both arms. Pearson correlation showed a negative association between weight change and the percentage of days any app component was used  Mobile health  technology provides innovative ways to create interventions that may help people lose weight and sustain weight loss -3. mHealThe effectiveness of behavioral weight loss studies that are delivered in person is known to be moderated by dose . AlthougIn this report, we defined engagement specifically as interaction with components of the intervention and then assessed various types of engagement to understand how and whether engagement relates to weight management. Specifically, we defined engagement as the frequency of use of various intervention components of the cell phone app and the attendance of the in-person group sessions and phone counseling calls. We theorized that a higher engagement may reflect individual motivation and lead to a greater commitment for behavioral change and, thus, a higher intervention efficacy in the Cell Phone Intervention For You (CITY) clinical trial.P<.01). There was also a large variability in weight loss within each arm\u2014some participants lost a substantial amount of weight, whereas others did not. The CITY intervention provides an opportunity to examine engagement because it incorporated various strategies for delivering intervention components, such as using sensor technology for capturing data from a wireless scale, providing tailored feedback, and using prompting as a reminder strategy. In addition, detailed and careful collection of both engagement data and weight data allows for examination of the association between engagement and weight and for examination of factors that may influence engagement. Thus, this work examines (1) the patterns of participant engagement overall, and with key intervention components within each intervention arm, in the CITY trial; (2) the associations of engagement patterns with weight change; and (3) the participant characteristics related to intervention engagement.In the CITY trial, we compared 2 behavioral interventions for weight loss: the cell phone (CP) intervention arm and the personal coaching (PC) arm . Even thThe CITY study was 1 of the 7 trials in the Early Adult Reduction of weight through LifestYle Intervention consortium, sponsored by National Heart Lung and Blood Institute  . Th. Th10]. use of each app component to be achieved when a participant completed an important, but also measurable, interaction with that component. In other words, looking at a screen that asks a participant to take a weight reading does not count as use, but entering a weight value when asked to do so does count as use. Engagement data were summarized for each participant for each app component for each day; then, the participant-level data were averaged for the CP and PC arms (separately and combined) over time by month and by 3 specific intervention periods: from baseline to 6 months, 7 to 12 months, and 13 to 24 months. These periods correspond to distinct phases of the intervention with regard to availability and frequency of different app components.Recognizing that engagement with different components of the intervention demands different amounts of time and effort , we evaluated all components of engagement combined and separately for specific app components. For this manuscript, we considered a discrete instance of We also examined the relationship between categories of weight change and engagement during the 3 study periods. Weight change was grouped into 4 categories: gained (\u22652%), stable (\u00b12%), mild loss (lost \u22652% to <5%), and greater loss (lost \u22655%). These categories were chosen to reflect current guidelines that support 2% to 5% weight loss as clinically meaningful and stable weight as within \u00b12% of weight gain or loss . One-wayP value of <.05 was considered statistically significant. All analyses were conducted using SAS 9.4 .To understand whether baseline characteristics were associated with higher levels of engagement during the first 6 months of the intervention, we examined the distribution of selected baseline characteristics across quartiles of the mean number of times any app component was used per day (including self-weighing) for the PC and CP arms separately. Baseline characteristics such as age, gender, race, ethnicity, education, income, weight, BMI, energy expenditure, healthy eating index score, and hypertension status were examined. All statistical tests were two-sided, and a 2 (SD 7.9). Approximately 69.8% (169/242) of these participants were female and 37.1% (90/242) were black.Similarly, during the first 6 months, the CP arm had a higher mean percentage of days self-weighed compared with the PC arm . Within the PC arm, engagement in the face-to-face group coaching sessions was high during the first 6 months , as was engagement with monthly calls and group sessions combined .The pattern of early reduction in engagement is also observed when we examined the engagement pattern for each of the app components by intervention arm and over time. Overall, not counting the use of the CITY home screen component, the CP arm used the app components about 3.24 times a day during the first 6 months, whereas the PC arm used components about 1.08 times a day during the same timeframe (data not shown). Right Now in CITY.The second most used app component was the detailed food tracker, with a median daily mean use of 0.46 and 0.35 times per day during the first 6 months in the CP and PC arms, respectively, which is approximately every 2 to 3 days. The detailed food tracker use decreased by more than half during months 7 to 12 and further reduced to about once every 1 to 3 months during the last 12 months in both arms (months 13-24). In the CP arm, where participants were prompted daily to self-weigh, use of the self-weighing component was about every other day during months 1 to 6, which decreased slightly during months 7 to 12 and further reduced to about once every 4 to 5 days during months 13 to 24. For the PC arm participants who did not receive prompting from the smartphone but were encouraged by their coach during monthly calls, the self-weighing component was used about once every 4 days during months 1 to 6 and dropped to about once every 8 days during months 7 to 12 and once every 12 days during months 13 to 24. The CP participants used other components of the app every 2 to 20 days during months 1 to 6, and the use reduced to almost none for the rest of the study. These other components consisted of the sugar-sweetened beverage tracker, physical activity tracker, veggie tracker, meat tracker, goal setter, fruit tracker, and a screen with updates titled Other than the detailed food tracker and self-weighing, the PC participants rarely used any of the rest of the app components that were available to them during the entire study.r=\u2212.213, PC: r=\u2212.319), the mean number of times app was used per day , or the mean percentage of days participants self-weighed  were each correlated with weight change during the first 6 months.We also examined selected baseline characteristics of mean number of times the app was used per day during the first 6 months in CP and PC arms separately, across the 4 quartiles. None of the characteristics examined appeared to be related to the varying engagement patterns of the participants see  and 3.Our results demonstrate that engagement in mHealth delivery of a behavioral weight loss intervention was associated with weight loss. Our findings suggest that the more the participants used the smartphone app or self-weighed, the more weight loss was observed during the first 6 months of the study for both intervention arms. This association continued to be true for the PC arm into months 7 to 12, but not for the CP arm. Despite the fundamental differences in the time and effort needed in using various components of the smartphone app or in completing personal contacts , the finding is consistent\u2014engagement with the intervention is associated with weight loss. It is unclear, however, what level of engagement is required for effective weight loss, and if a different level of engagement is effective for weight loss maintenance.Our findings are consistent with previous research showing that greater engagement with an intervention was associated with greater weight loss, even with different types of engagement measures -19. For Unlike self-weighing, other components of self-monitoring components such as dietary tracking were only used during the first month and almost never used beyond the first month. This low engagement in dietary tracking may result from low motivation ,26 or diIndeed, ours and other studies have shown that the engagement dropped drastically, even after the first month, and declined continuously over time ,28-30. IIn a 12-month behavioral weight loss study, the self-monitoring pattern of 148 participants also varied and declined over time . Indeed,Although traditional personal contact has been perceived as the ideal mode of intervention delivery, in this study, completion of the group sessions alone or combined with monthly calls in the PC arm was not significantly associated with weight change. However, engagement as assessed by overall app use or self-weighing was significantly associated with weight loss, even for the PC arm that received regular and sustained personal support. This finding suggests that mHealth for behavioral interventions could supplement and even enhance interventions based on personal contact, even in the setting of a reduced engagement pattern. Combining mHealth intervention with human support may be more efficient than using either of them alone. This is consistent with a recent study that randomized 102 participants into 3 weight loss intervention arms versus control for 12 weeks: a personal contact arm, an mHealth app-only arm, and a combined arm with personal contact and an mHealth app. The authors reported that the combined personal contact and mHealth app arm was as effective as the personal contact arm and tended to be more effective than the mHealth app arm . Thus, fOur data suggest that prompting may be helpful to generate engagement to some degree because the CP arm that received prompting regularly used the smartphone app components more than the PC arm did across all measures of engagement. A meta-analysis of 14 studies with varying designs showed that technology-based prompting had a small to moderate effect on engagement as compared with no-strategy . ParticiThis study has several strengths. The engagement data reported here were collected objectively with a smartphone app, and the main outcome of weight was reliably measured at each of the study visits in the clinic and does not rely on self-reporting. Furthermore, this study generated a relatively large amount of engagement data of young adults (n=242) for an extended period (24 months). Another strength of this study is the ability to collect engagement data with each of the cell phone app\u2019s components and with the personal interactions, where the design of the intervention components was based on behavioral theories and prior research evidence.The study has several limitations that must be considered when interpreting data. Regardless of the reason for joining the CITY study, the varying motivation for weight loss among the participants may have contributed to the varying level of engagement in the intervention arms. Increasing motivation may increase engagement and subsequent weight loss; however, identifying effective level of engagement may also be important for all weight loss studies and programs. Another weakness of the study is that limited study resources prevented development of an intervention app as attractive, polished, and robust as some commercial apps, which could have an impact on engagement. Unfortunately, it was beyond the scope of this study to tease apart whether the reduction in engagement over time may have been due to lack of motivation or challenges with the app design and other technical reasons. Our study compensation for smartphone data coverage, which was offered to both the PC and CP arms, may have incentivized participants to stay in the study but would not contribute to the differences in engagement between the 2 arms. This compensation would not be available to app users if the app were widely deployed. Our compensation, however, did not require any substantial level of engagement or use of app components, and so, participants with low motivation who may have otherwise dropped out of the study may have continued until the end. The overall engagement was lower than expected and desired, but the pattern was consistent with other studies. Messages and tips to encourage healthy lifestyle and weight loss management were delivered through the app home screen, but the smartphone\u2019s operating system prevented the measurement of whether participants covered them up with other app icons or even turned off the messages altogether; this behavior would affect engagement. The fact that engagement dropped substantially early suggests that a more effective intervention that automatically adapts to behavior and self-measured engagement, such as using just-in-time adaptive design, may be needed ,36. AnotIn this study, engagement assessed using different measures was associated with weight loss. Nevertheless, engagement declined over time at varying rates for different intervention engagement components. This study suggests that a variety of strategies may be needed during different stages of an intervention to increase and sustain engagement required for intervention effectiveness. Self-weighing was associated with weight loss regardless of the baseline characteristics of the participants, suggesting that an effective weight loss program may not need to include multiple behavioral strategies. Focusing on a single effective strategy in conjunction with prompting may be better than offering more components that most participants may not use. Future studies should clarify the definition of effective engagement. In addition, future studies should explore the motivations for participant engagement and nonengagement to design effective strategies for addressing those specific challenges."}
{"text": "The aim of physiology is to elucidate the factors that maintain homeostasis, and therapeutics aim to correct abnormal factor functions. The homeostasis paradigm does not formally recognize influences outside its controlled experimental frames and it is variable in its modeling of neural contributions. The paradigm of allostatic orchestration (PAO) extends the principle of allostasis (\u201cstability through change\u201d) as originally put forth by Peter Sterling. The PAO originates from an evolutionary perspective and recognizes that biological set points change in anticipation of changing environments. The brain is the organ of central command, orchestrating cross-system operations to support optimal behavior at the level of the whole organism. Alternative views of blood pressure regulation and posttraumatic stress disorder (PTSD) illustrate differences between the paradigms. For the PAO, complexities of top-down neural effects and environmental context are foundational (not to be \u201cfactored out\u201d), and anticipatory regulation is the principle of their interface. The allostatic state represents the integrated totality of brain-body interactions. Health itself is an allostatic state of optimal anticipatory oscillation, hypothesized to relate to the state of criticality, a mathematical point of poise between phases, on the border between order and disorder (or the \u201cedge of chaos\u201d). Diseases are allostatic states of impaired anticipatory oscillations, demonstrated as rigidifications of set points across the brain and body (disease comorbidity). Conciliation of the paradigms is possible, with \u201creactive homeostasis\u201d resolved as an illusion stemming from the anticipation of environmental monotony. Considerations are presented with respect to implications of the two paradigms for brain-focused intervention or advancement; the hypothesis that the state of criticality is a vehicle for evolutionary processes; concordance with a philosophy of freedom based on ethical individualism as well as self-creativity, non-obsolescence, empowerment, and citizenship; and concluding reflections on the science and ethics of the placebo, and the potential for virtuous cycles of brain-Anthropocene interactions.There are two main paradigms for brain-related science, with different implications for brain-focused intervention or advancement. The paradigm of homeostasis , originating from laboratory-based experimental physiology pioneered by Claude Bernard, shows that living systems tend to maintain system functionality in the direction of  The human brain is the most precious resource on our planet. Excitement about the brain takes many forms, and actions on behalf of the brain go in many different directions. It may be valuable to articulate and clarify whether there are particular approaches to the brain that favor the recognition of particular categories of data, and whether they lead to different goals and strategies for intervention. Such an exercise may help visualize alternative trajectories for brain-related advancement at the level of \u201cbroad brush strokes.\u201dThis essay contends that there are two main paradigms Kuhn,  for braiallostasis , to point toward his original ideas and to extend them.Over the course of three decades, a series of brain-centric, evolution-inspired insights have been articulated with increasing refinement, as principles of The essay reviews the origins and principles of homeostasis and allostasis and illustrates their differences by considering how they approach the phenomena of blood pressure regulation and posttraumatic stress disorder (PTSD). It contends that the Sterling principle of allostasis is sufficiently different that it warrants characterization as a new paradigm\u2014the PAO\u2014which is articulated as a set of propositions, and it also contends that the two paradigms can be conciliated. Selected considerations are presented pertaining to their different interventional implications; a falsifiable model regarding the vehicle or mechanism of evolutionary processes; the alignment of the PAO with a philosophy of freedom; and the proposed utility of allostatic planning and action in the context of the Anthropocene epoch.milieu interieur :Potentially, it may have been his studies of sugar mobilization in the setting of insulin-induced hypoglycemia, that may have spurred his attention to the organizing principle of In an open system such as our bodies represent, compounded of unstable material and subjected continually to disturbing conditions, constancy is in itself evidence that agencies are acting, or ready to act, to maintain this constancy.If a state remains steady it does so because any tendency towards change is automatically met by increased effectiveness of the factor or factors which resist the change.Any factor which operates to maintain a steady state by action in one direction does not also act at the same point in the opposite direction.Homeostatic agents, antagonistic in one region of the body, may be cooperative in another region.The regulating system which determines a homeostatic state may comprise a number of cooperating factors brought into action at the same time or successively.When a factor is known which can shift a homeostatic state in one direction, it is reasonable to look for automatic control of that factor or for an opposite factor or factors having an opposite effect.factors which move system parameters in one direction or another.In concordance with these postulates, laboratory physiological research from the early twentieth century and beyond has made tremendous progress in the understanding of normal level of blood pressure.Blood pressure regulation is a phenomenon exhaustively studied under the homeostatic paradigm. The main actors for blood pressure maintenance include the heart, which acts as a pump; the vessels, which constrict and relax as they transport blood throughout the body; and the kidneys, which manage blood volume by filtering fluid and conserving sodium to preserve osmotic pressures. Exhaustive search for the factors of blood pressure regulation and their sites of production or action has led to recognition that the adrenal glands, lungs, and liver also play roles. The main \u201cequation\u201d renders blood pressure to be a function of cardiac output and total vascular resistance, analogous to Ohm\u2019s law in physics where the voltage in an electrical circuit is calculated as the product of current and resistance. Cardiac output is itself a product of heart rate and stroke volume, with stroke volume, in turn, being influenced by blood volume (\u201cpreload\u201d), the pressure against which the heart must contract (\u201cafterload\u201d), and the strength of each contraction (contractility). If sensors in the carotid artery or kidney detect a decrease in blood pressure, there will be a cascade of factor actions that alter volume, vascular resistance, and cardiac output, to increase it. If they detect a rise in blood pressure, there will be cascades in the opposite direction. Life itself\u2014through the capacity for homeostasis\u2014is given the credit for checks and balances that preserve the When the system fails to maintain its normal state\u2014for example hypertension, the state of persistent blood pressure elevation\u2014then causes are sought in the various factors which would otherwise return the blood pressure to \u201cnormal.\u201d Yet though there are certain well-characterized abnormalities of homeostatic mechanisms, that are correctable causes of hypertension\u2014for example renal artery stenosis or endocrine tumors\u2014many anomalies arise when explaining blood pressure regulation as the steady state of local tissue factors. Ninty-five percentage of individuals with hypertension are deemed to have a type that has no identifiable local factor as the cause . Thus, studies which aim to explore physical changes in PTSD are themselves conducted in some defiance of reductive explanation based on physical factors alone. Nonetheless, stimuli can be carefully designed with the intention of producing controlled forms of trauma within a laboratory setting, and the brain can be taken to be the organ of behavior . By refining such frameworks for experimentation, specific physical factors for PTSD have been sought in cellular failures to extinguish associative conditioning between environmental cues and fear learning mechanisms , the naturalist Alfred Russel Wallace wrote a letter to Charles Darwin in which he proposed that species may change through the pressures of scarcity generated by nature itself, which would lead to the differential reproductive success of some variants over others. Subsequently, Darwin  publisheallostasis, beginning with a personal appreciation for the influence of environmental context on biological regulation. In the 1960s, Sterling was working as both a neuroscientist and a social activist, and while canvassing in African-American communities he noticed that many individuals had limps or facial droops indicative of a history of stroke, as a consequence of the high prevalence of hypertension. Over the next two decades, Sterling integrated his naturalistic observation, which was being confirmed in epidemiological studies of the links between social disruption and chronic disease, with other growing bodies of knowledge. There were electron microscopic findings of the ubiquity of nerve fibers on blood vessels, endocrine cells, and elsewhere, suggesting that \u201cthe brain has close access to essentially every somatic cell,\u201d and also primate studies showing that demands for sustained attention caused elevations of blood pressure and release of catabolic hormones.The neuroscientist Peter Sterling has given the following account (2004) of the origins of allostasis (1988), which states that \u201can organism must vary all the parameters of its internal milieu and match them appropriately to environmental demands.\u201d If an individual is exposed to an environmental condition presenting potential danger and high need for vigilance, the brain orchestrates systems on an anticipatory basis, toward a physiological arousal state that is a match for those demands  homeostatic schematics of blood pressure regulation do highlight the brainstem centers of the autonomic nervous system; direct neural control and afferent signaling between the brain, heart and blood vessels; and neural ganglia at the kidneys. Nonetheless, the role of neocortical influences on the brainstem and autonomic signaling has yet to be understood in depth, and the full significance of these pathways for neural influence has yet to be appreciated across physiological subspecialties, clinical medicine or public health.For example, there is now an expansive corpus of studies that have provided an increasingly granular appreciation for the environmental factors associated with blood pressure, including an early report from Bevan et al. . In grouThe brain-centric allostatic perspective in conjunction with the polyvagal theory Porges,  can alsoToo, the Sterling principle of allostasis may shed light on the controversy around the role of salt consumption as a factor in hypertension. The allostasis perspective is consistent with the idea that dietary salt may be not a culprit but rather an \u201cinnocent bystander\u201d , Sterling articulated allostasis as the following set of principles: (1) organisms are designed for efficiency; (2) efficiency requires reciprocal trade-offs (managed by the brain); (3) efficiency requires predicting (by the brain) what will be needed; (4) prediction requires each sensor to adapt its sensitivity to the expected range of input; (5) prediction requires each effector to adapt its output to the expected range of demand; and (6) predictive regulation depends on behavior whose neural mechanisms also adapt.An objective of the present essay, addressed in greater depth in Section \u201cConciliation of the Two Paradigms,\u201d is to help resolve questions and occasional debate as to whether the concepts or principles of allostasis merit the cognitive costs that come with the introduction of new language. Post-Sterling, many have used the allostasis concept to refer to the general phenomenon that biological set points become temporarily altered under the condition of acute environmental stress . Yet Cannon himself recognized that systems do not maintain absolute constancy in their set points, and he was careful to note that he had chosen the prefix \u201chomeo\u201d (similar) rather than \u201chomo\u201d (same) when coining the term homeostasis (1929). It seems likely that the answer to the question, whether or not allostasis is simply homeostasis in \u201cnew clothes,\u201d lies mainly in Sterling\u2019s heightened appreciation for the brain. Sterling\u2019s recognition that the brain is necessary as a dedicated organ for higher-order processing, for management of trade-offs or anticipatory orchestration among actors, is in some respects the same conclusion reached by Bernard more than 100 years earlier.between the brain and all organ systems , which can replace the idea that health is a capacity for reactive (or corrective) feedback. Optimal anticipatory oscillation builds on appreciation of the brain as a \u201cprediction machine\u201d  is the rule among individuals with chronic diseases  that is most conducive to the generation of rapid and context-sensitive variations in its activity. A given brain activity pattern can only be characterized as \u201coptimal\u201d for a given environmental condition; it is the pluripotent capacity to express a range of activity patterns, that should be the most optimal pattern of all. An \u201cempty\u201d state of latent potentiality may have great import for anticipatory regulation, when external circumstances entail unpredictable and last-moment changes  are themselves secondary phenomena, which invoke the need for investigation of primary causes. Tendency to maintain the state of criticality  is hypothesized to explain the likelihood to express optimal anticipatory oscillations.As noted in Section \u201cAllostasis\u2014From Principles to Paradigm,\u201d the current presentation aims to help resolve the question of whether allostasis (to include the PAO) is genuinely different from homeostasis. Attention to this question entails empirical, analytical, inferential, interventional, and ethical considerations, some of which are further explored in Section \u201cSelected Considerations and Summary.\u201d Clarification of terminology shared by the two paradigms, as put forth by different authors, is presented in replace the concept of homeostasis, which is itself flawed. In this view, homeostasis erroneously perceives that biological parameters maintain a categorically constant set point (they do not), and erroneously explains that these set points are maintained through corrective or reactive feedback (which is inconsistent with the ubiquity of anticipatory regulatory behaviors demonstrated throughout nature). It is the brain that acts as a data-integrating prediction-machine, to orchestrate operational set points and anticipatory behaviors in ways that support whole-organism health (with implications for species evolution). In the main, critics of Sterling\u2019s original allostasis concept have focused on his point against biological constancy, and dismissed it as a mischaracterization of the thinking of Bernard and Cannon, who both recognized variability of biological functions. Consequently, there have been doubts as to whether the allostasis concept adds meaning beyond homeostasis  of physiological research post-Cannon. Though Cannon made many statements which can be selectively highlighted to give the appearance that Sterling has misunderstood him (and Bernard\u2019s appreciation for the brain has been unrecognized by many), a bird\u2019s-eye view of homeostatic science makes clear that it is generally designed for the isolation of local factors, in hopes for discovery of \u201csilver bullets\u201d\u2014with sparse attention to complex environments which will favor anticipatory variations in functional set points, or to the integrative and top-down role of the brain. The only way to validate the existence and efficacy of such bullets is to \u201cfactor out\u201d the contributions of top-down neural regulation  and environmental variations. Sterling can be forgiven for using Bernard and Cannon as straw-men in order to make a set of crucial points that have still yet to reach biomedical researchers as a community. There are vacuities in research which proceeds without a view informed by evolutionary processes , and that processes which support homeostasis can simply be labeled as \u201chomeostatic mechanisms\u201d  arises because data collection and causal inference in biology are substantially still driven by a methodology that systematically limits or ignores parameter alteration or variability that may be decisively influenced by factors from complex environments, as well as neural complexity including top-down efficacy for regulation of whole-body physiology . Adequate updating of the classical view of homeostasis would entail the need for three formal revisions. Again, there would be a need for formal recognition of anticipatory behaviors . Second, there is a need for formal attention to top-down neural effects and their complexity . Third, there is a need for an expansion in formal modeling of the complexity of the natural environment.Nonetheless and conceivably, if the sciences which explore homeostasis\u2014the collective methodologies essential to the maintenance and utility of a Kuhnian paradigm\u2014were sufficiently broadened or revised, there would be no need to burden biological researchers with the additional concept of allostasis. appears to be a reactive (or \u201ccorrective\u201d) process may be parsimoniously understood as another form of anticipatory behavior, if the complex environment has been \u201ccontrolled\u201d to appear monotonous and unchanging, and especially if neural regulation is relatively limited in its own complexity or criticality. An additional implication of conciliation is to offer lines of exploratory investigation for any given phenomenon that appears to be homeostatic. The PAO predicts that relative constancy in any biological parameter will yield to findings of increased variability if there are systematic alterations in either the complexity of neural dynamics , environmental complexity, or both. A straightforward illustration is to consider a subject who provides continuous daytime blood pressure readings for 10 consecutive days. He or she may show maintenance of an average  blood pressure in the vicinity of 120/80 for each day, irrespective of occasional changes from being seated to standing, or whether they read the morning newspaper or receive an animated neighbor as a guest. Consistency of the mean value at roughly 120/80 for each of those 10 days can be taken as empirical evidence for homeostasis. However if 10 days of readings were then to be collected from the same subject after they had begun a new role associated with high job strain , whereas while the PAO would also be sensitive to genetic substrates, it would search for differences in environmental and top-down neural regulatory influences.Thus, the PAO begins with two critical complexities that are foundations, not after-thoughts, and that are themselves interfaced through anticipatory regulation; and it avoids the possible introduction of \u201ckludges\u201d to rescue homeostasis. The PAO\u2019s potential to resolve \u201creactive vs. predictive homeostasis\u201d may be one illustration of its economy, in that it identifies \u201creactive homeostasis\u201d as a kind of illusion. What Following is a more provocative example of how homeostatic phenomena can be viewed as the special case of allostatic orchestrations that arise when a product of neural and environmental complexities is minimized. The constancy of core body temperature in homeotherms, despite major changes in seasonal weather, seems to give evidence for the McEwen-Wingfield formulation that homeostasis is the rule for a few fundamental parameters. Yet perhaps the narrow range is only a demonstration of relatively limited critical capacity for top-down neural regulation of temperature. Many mammal species reduce their core temperatures markedly during winter , at a time when their foraging opportunities are limited. Interestingly the evolutionary origins of hibernation are not genetically defined ; or \u201cAlteration in pre-prandial glucose allostasis through a comprehensive lifestyle intervention\u201d (attention to anticipatory regulation and whole-person behavior); or \u201cAllostatic intervention for critical brain dynamics in diabetics results in tighter glucose control without increasing episodes of hypoglycemia\u201d . At this juncture it may also be helpful to identify socio-cultural and ethical currents as well as a key lacuna of scientific understanding\u2014the physics of consciousness itself\u2014which have likely contributed to the value and durability of the homeostatic paradigm, and may be presumed to associate with any application of the PAO . Theological dictums have influenced progress in biology  no less than they have in physics. Separately yet relatedly, physicians and healers judiciously rely on the biological value of their patients\u2019 subjective confidence. Bernard and Cannon formalized an experimental method explicitly designed to ascertain material causes and effects in living systems, without adducing idiosyncratic or sometimes exploitative ideas and practices of theologians, vitalists, physicians, or faith healers. These two giants of physiology are in a lineage that extends the legacy of the American polymath Benjamin Franklin one century and more before them, with respect to Franklin\u2019s participation in a commission that falsified the \u201cmagnetism\u201d claims of Franz Mesmer. It seems possible that Cannon\u2019s own relative neglect of the brain\u2019s top-down influences may have been partly motivated by his own principled ethical secularism . Ethical secularism remains alive and well, easily recognizable in the commitments to liberal political philosophy dating back to the Western Enlightenment  which are central to modern biomedical ethics. Stated otherwise, modern biomedicine at its best may shun the benefits of the placebo response not out of antipathy to human self-empowerment, rather because it greater disdains the sense of charlatanism  that can sometimes be associated with its efficacious induction, and the distaste is exacerbated by the lack of a hold on the essential biology of subjective intentionality. The objectivity of the laboratory has not only identified the fine mediators of biological operations, it has also been constitutive for the needful expunging of \u201csin\u201d in particular as an etiological construct in the understanding of health and disease.Nonetheless and with appreciation for the weight of the aforementioned considerations, including the cost of progress and the work still undone, the thrust of the PAO is that the present need for advancements in neuroscience, healthcare, and beyond, points us to cease clinging to an era where the significance of subjectivity, or consciousness itself, is ignored in neural research or excluded with scrupulosity from the healthcare toolkit. To be clear, the PAO makes no call for a return to vitalistic reasoning, disease as \u201cpunishment,\u201d or the methods of Mesmer. As the PAO admits consciousness and all its qualities, the \u201cold\u201d scientific conundrums and ethical dilemmas will not disappear; they will require advanced forms of conceptualization and engagement.Innovation is needed in the field of brain functional enhancement or advancement, that begins and ends with a homeostatic perspective. For example, a neuroprosthetic is a miracle if it permits recovery of homeostatic capacities for an individual with gross brain damage. Nonetheless even the most successful homeostatic interventions may entail systematic under-recognition of unintended consequences, because such effects may not be easily visible in the controlled context of early laboratory investigations. In contrast, the PAO perspective may be well suited to inform brain advancement objectives on larger scales, with heterogeneous populations, for objectives that may be less \u201ccontrolling\u201d yet potentially more ambitious. To clarify the differences entailed by homeostatic and PAO approaches to brain advancement, this section begins by considering how homeostasis and the PAO are associated with different approaches to \u201cbrain normality\u201d and therapeutics in general.or time.Homeostasis begins with the (often unstated) presumption that there do exist \u201ctruly normal\u201d forms of biological phenomena including brain functionality; that \u201ctrue and discrete abnormalities\u201d can be identified; and that the goal of therapeutics including brain-focused interventions is to \u201crestore the state of normality.\u201d While scientists acknowledge that the parameter estimates associated with these assumptions may be frail, there is little argument about the biological validity of the constructs themselves , and indeed without them, it is not clear how knowledge can be gained, or interventions can be devised. In contrast, the PAO definition of health as an active state of anticipatory behaviors with respect to the changing environment is not consistent with the identification of a single biological state that is objectively \u201cnormal.\u201d An \u201caverage\u201d specimen may be the one that is obliterated, in the next new environment; it may be the highly \u201cunusual\u201d individual that becomes the \u201cnext new normal\u201d Taleb, , 2012. Mper se, to include its association with whole-organism behaviors in context, that is central to the Sterling principle of allostasis or the PAO. For example, many pharmacological strategies that are designed to clamp set points for neurotransmission, even if they \u201ctarget allostatic load,\u201d are still likely to entail the complications and limitations associated with homeostatic therapeutics , or to support the brain to move toward a pluripotent and flexible capacity for meeting the needs of changing situations. Allostatic intervention may still include the goal of \u201cimprovement\u201d for a given output parameter, yet strictly speaking, such a change should be modeled as a secondary outcome (given its contingency on assumptions about the \u201cbetter\u201d which may or may not be durable). Whereas a homeostatic medication for sleep promotion may also cause lethargy that impairs attention, in contrast an allostatic intervention should support a state of \u201cwholeness\u201d that can be expressed as relaxation or concentration, depending on the contextual need. Moreover, robust allostatic interventions should have effects on bodily facets of the allostatic state, not only on cognitions, emotions or behaviors.natural selection are tautological\u2014we know that some variants are more fit because they have survived; what permits some variants to survive, is being more fit. The PAO theorizes that the critical state of the brain , demonstrated behaviorally as optimality of anticipatory oscillation  variation, \u201cfield-tested\u201d over repeated reproductive cycles that \u201cjudge\u201d its fitness for a given environment  to have been desirable, it does not necessarily follow that struggle should be the guiding principle for producing new outcomes in the future. Consequences of the naturalistic fallacy are shown in darker chapters of modern history, post-Origin. Repressive movements such as eugenics, along with ideologies that informed twentieth-century fascism, for example, were products of misconceived justifications based on \u201csurvival of the fittest.\u201dOne error perpetuated by some evolutionists is the naturalistic fallacy Moore, . For preallostatic neuro-education can present many advantages for learners, especially by better preparing them for the rapidly changing environment of the twenty-first century \u201d there are anomalies that block the advance of understanding or practice with respect to PTSD, and many of them can be attributed to competition between foundational definitions held by different societal stakeholders including afflicted individuals and their loved ones, clinicians and healthcare advocates, military culture-bearers, clinical researchers, laboratory scientists, epidemiologists, and others. Whether these definitions are constructed upon, or against, the homeostatic paradigm (and either implicitly or explicitly), in either case, the persistence of homeostatic conceptualizations as our dominant \u201cmental furniture\u201d does not leave researchers or anyone else with much room for innovation at a fundamental level. Until there is a viable and attractive framework for biological research other than homeostasis, in some ways the limitations in scientific and societal progress around PTSD are predictable. If it has merit, the PAO should help to honor and integrate the most valuable elements of different perspectives that pertain to traumatic stress-related phenomenology, in a way that goes beyond the political brokering of ontological consensus, toward the construction of genuine and \u201cneedle-moving\u201d solutions.healthy strategies for their prevention or management.In the first place, a strong application of the PAO points us to dispense with the notion that the clinical construct of PTSD is a tenable way to distinguish between \u201chealthy\u201d and \u201cdiseased\u201d individuals. As discussed in Section \u201cImplications of the Two Paradigms for Intervention on the Brain,\u201d it is problematic to define \u201cnormal\u201d biology in any absolute sense, including for the state of the brain, and a visceral consciousness of this truth is appreciated greatly in, for example, communities of special operations military service members. To these individuals on mission, who have been trained to maintain extraordinary levels of alertness and sleep deprivation, it is counter-contextual to state that certain \u201csymptom criteria\u201d\u2014including hypervigilance and sleep disturbance, core features of the clinical PTSD definition\u2014can be used as indicators of their \u201cabnormality.\u201d Yet in a different setting, neither is it acceptable to suggest that these traits should have no negative impact on a service member\u2019s ability to interact with civilians in a non-combat environment, or that service members should not receive tailored forms of healthcare or support from the governing agencies that trained them to develop their characteristics. If the \u201cPTSD\u201d concept must persist in order to serve civilian life, then perhaps it is a label that should simply be carried in a graded form by everyone, anywhere  more endemic to modern life than homeostatic thinking might point us to consider Selye, , the PAOmoonshot to prevent and eliminate the negative effects of stress, for example, are likely to be unacceptably fragile or absent. Not only is the homeostatic evidence for subtle yet chronic stress effects inadequate for the kinds of conceptualizations entailed by the PAO, also the scientific appreciation for neural complexity is still only elementary (including the girders or limits of free will), and there is a need for advanced allostatic interventional strategy. Yet we should not be lulled into complacency excused by the lack of sufficient data collected from existing paradigms. Homo sapiens currently seem to be on path for exacerbations (or compounding) of stress effects that are already impairing our lives in joy and functionality  management and prevention, including allostatic interventional strategies described in Section \u201cImplications of the Two Paradigms for Intervention on the Brain.\u201d Given the complexities alluded to in PTS(D) ontology, pathogenesis, and comorbidity, it is unsurprising that there is no consensus regarding what to do about PTS(D) on a population basis, whether it can be prevented and if so then how, and whether efforts toward such challenges are worth the resources they might require. Though studies have been conducted on these questions (e.g., Cohen et al.,  Harari, . For reaThe reflections below aim to further exemplify the potential usefulness of the PAO with respect to the science of consciousness, as it pertains to the \u201cplacebo phenomenon,\u201d and the science of human interactions with the global environment, in the present temporal context. Other implications of ongoing development and application of the two paradigms and their interaction with one another are beyond the scope of this essay.There are data to indicate that effects from placebo interventions in clinical trials are increasing over time (e.g., Rief et al., Homo sapiens are now the single largest influence on the natural environment as a complex whole, then it is no small matter to state that the essential function of the brain is to generate optimal anticipatory behaviors with respect to that self-same environment. The PAO predicts that if human brains can be successfully supported to be in allostatic states of criticality, with increased sensitivity to the environment and human impacts upon it, then they should demonstrate behaviors that anticipate the value of re-creating those environments so as to be recursively supportive of their allostatic criticality, the theorized bedrock of health itself. Allostatic agendas for brain advancement\u2014to include both an allostatic perspective on the brain, as well as allostatic interventions\u2014have the potential to generate virtuous cycles that leverage the inextricability of humans and their environments.Geological data suggest that the earth is now in an Anthropocene epoch, characterized by human factor influences more than any other and that in recent decades we are experiencing a \u201cGreat Acceleration\u201d (Lewis and Maslin, allostasis, here expanded upon as the PAO, which posits that neurally directed anticipatory behavior\u2014not corrective feedback\u2014is the general principle of biological regulation. The PAO\u2019s construct of the allostatic state serves to represent the integrated totality of brain-body interactions, and optimal anticipatory oscillation, potentially a function of the mathematically-defined state of criticality, is intended to spur the scientific imagination toward advancements in models, data, and interventions for positive health. As an evolutionary approach to brain advancement and in its alignment with a philosophy of freedom, the PAO aims to inspire new forms of allostatic thinking, research and action, including new attention toward currently under-attended classes of biological phenomena.In the late nineteenth century, Claude Bernard laid the foundation for the homeostatic paradigm by showing that biological systems tend to maintain constancy, and Walter Cannon later used this idea to lead a long prolific run. As Bernard was concluding that the brain has a privileged position in its relationship to other organs, Charles Darwin brought forth a context-sensitive, evolutionary perspective to life on earth as a whole. Beginning 100 years later, Peter Sterling and Joseph Eyer re-realized the importance of environmental context; and they re-realized, with Bernard, that the brain is the upstream regulator of other organs. To synthesize those insights, Sterling and Eyer introduced the principle of SL is responsible for the ideas presented in this manuscript, and was the sole writer.The author was formerly an employee at Brain State Technologies LLC, a company that has developed an allostatic neurotechnology, and he retains stock options with the company."}
{"text": "It was the main goal of this study to investigate performance on the mental rotation test (MRT) in Brazilian and German adolescents. Mental rotation is the ability to mentally transform a three-dimensional stimulus in mind and relates to science education. 60\u00a0German and 60 Brazilian adolescents  completed the Mental Rotation Test, a physical activity and media use questionnaire and a Number Connection Test. The result showed no difference between Brazilian and German adolescents in the cognitive processing speed measurement. German adolescents are more active and show a less media use compared to the Brazilian adolescents. Furthermore, German adolescents demonstrate a better MRT performance than Brazilian ones, as well as boys show a better performance than girls do. A multiple regression analysis indicated that the MRT performance could be predicted by nationality, sex, and cognitive processing speed. Since cognitive processing speed did not differ between Brazilian and German adolescents, the worse MRT performance of the Brazilian adolescents could be explained by different educational systems. Further studies have to follow which investigate the reasons for the different nations in more detail. Mental rotation is defined as the ability of mental transform of how an object appears if it is rotated from its original position . This spDifferences in spatial abilities between males and females favoring males are clearly established findings, with MRT performance producing the largest effects  and beinStudies that investigated the effects of long-term physical activity on MRT performance found better MRT performance for students of sports sciences compared to students of educational sciences . Also moThere are only a few studies investigating cultural differences regarding Mental Rotation Test performance: Omani students show a worse MRT performance compared to German students , and chiWith regard to cross-cultural cognitive differences between German and Brazilian children, German children scored higher than Brazilian children in intellectual and emotional autonomy in a self-rated survey by school teachers and students , and theThus, the objective of this study is to investigate whether there are performance differences in solving the MRT between Brazilian and German boys and girls and the contributing factors of cognitive processing speed, physical activity, and media usage. According to the literature presented above, we hypothesize (1) that the MRT performance should be better in German than Brazilian adolescents and (2) that the sex differences should be smaller in the Brazilian than German sample. Furthermore, we explore the possible role of nationality, age, sex, cognitive processing speed, sports practice, and media usage in predicting the MRT performance.M\u00a0=\u00a013.42\u00a0years, SD\u00a0=\u00a01.80), half German , half Brazilian  participated in the current study. Regarding age and sex, the Brazilian children were matched to the German sample.Around 120 children aged between 11 and 17\u00a0years . The study was conducted according to the guidelines of the declaration of Helsinki.Demographic data of the participants concerning sex, age, and time spent practicing sport were recorded with a self-generated questionnaire. Hours of practice and use of electronic devices were registered by the questionnaire used in the health behavior in school-aged children (HBSC) study protocol  includinThe number connection test (ZVT)  was admiThe mental rotation test (MRT-A) test is a speeded mental rotation test and appropriate to use for children and adolescents older than 10\u00a0years of age . The tesThe pupils were tested in each country in group sessions, in the following order: (1) demographic questionnaire; (2) physical activity and sedentary behavior questionnaires; (3) cognitive processing speed test; (4) mental rotation test.To investigate if there are differences in the physical activity (hours per week) and media behavior (hours per week), two analyses of variance with the dependent variables (1) \u201chours of sports practice per week\u201d and (2) \u201chours of media behavior per week\u201d were conducted, with the independent factors \u201cnationality\u201d (German and Brazilian) and \u201csex\u201d . For the media behavior, the use of electronic devices, TV, video and computer games, chatting, emailing etc., were meant.Two univariate analyses of variance were conducted for the dependent variables (1) \u201ccognitive processing speed,\u201d and (2) \u201cnumber of correctly solved items in the MRT,\u201d with the independent factors \u201cnationality\u201d (German and Brazilian) and \u201csex\u201d . Furthermore, a multiple regression on MRT performance with the predictors\u2019 nationality, age, sex, cognitive processing speed, hours of sports practice per week, and hours of media used per week was conducted to investigate the relevant predictors for MRT performance.F\u00a0=\u00a038.92, p\u00a0<\u00a00.001, partial \u03b72\u00a0=\u00a00.25 , as well as in use of electronic devices likewise for \u201cnationality\u201d F\u00a0=\u00a033.22, p\u00a0<\u00a00.001, partial \u03b72\u00a0=\u00a00.22 . Both analyses revealed neither an effect for sex, physical activity: F\u00a0=\u00a02.92, p\u00a0=\u00a00.09, partial \u03b72\u00a0=\u00a00.02, media behavior: F\u00a0=\u00a00.39, p\u00a0=\u00a00.53, partial \u03b72\u00a0<\u00a00.01, nor an interaction for \u201cnationality\u201d and \u201csex,\u201d physical activity F\u00a0=\u00a01.65, p\u00a0=\u00a00.2, partial \u03b72\u00a0=\u00a00.01; media behavior: F\u00a0=\u00a00.57, p\u00a0=\u00a00.45, partial \u03b72\u00a0<\u00a00.01.The analysis regarding physical activity revealed a significant main effect for the factor \u201cnationality,\u201d F\u00a0=\u00a01.085, p\u00a0=\u00a00.300, partial \u03b72\u00a0=\u00a00.009 nor for the factor \u201cnationality,\u201d F\u00a0=\u00a00.73, p\u00a0=\u00a00.394, partial \u03b72\u00a0<\u00a00.006 and neither a significant interaction between both factors, F\u00a0=\u00a00.17, p\u00a0=\u00a00.681, partial \u03b72\u00a0=\u00a00.001. The ZVT values for the German girls  and boys  did not differ. There was also no difference between the Brazilian girls  and boys .A univariate analysis of variance with the dependent variable \u201ccognitive processing speed\u201d showed no significant differences for the factor \u201csex,\u201d F\u00a0=\u00a07.38, p\u00a0=\u00a00.008, partial \u03b72\u00a0=\u00a00.06. Adolescents from Brazil  performed significantly worse than the ones from Germany . There was also a significant effect of the factor \u201csex,\u201d F\u00a0=\u00a012.61, p\u00a0=\u00a00.001, partial \u03b72\u00a0=\u00a00.01, but no significant interaction between \u201cnationality\u201d and \u201csex,\u201d F\u00a0=\u00a00.503, p\u00a0=\u00a00.480, partial \u03b72\u00a0=\u00a00.004. Boys  showed a better performance than girls , see In the analysis of the standard performance measurement with the MRT, our results show that there was a significant effect of the factor \u201cnationality,\u201d 2R\u00a0=\u00a019.7%) was explained by the predictors \u201ccognitive processing speed,\u201d \u201cnationality,\u201d and \u201csex,\u201d F\u00a0=\u00a05.951, p < 0.001, see The multiple regression with including all variables results on MRT performance with the predictors nationality, age, sex, cognitive processing speed, hours of sports practice per week, and hours of media used per week showed that 23.8% of the variance . According to this, the quasi-experimental study was conducted according to the guidelines of the declaration of Helsinki.PJ designed the study, analyzed the data, and wrote the first draft of the paper. SH helped to design the study, organized the data acquisition, and discussed the first draft of the paper. FP and SM acquired the data and discussed the first draft of the paper.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "One of the most common complications following autologous cranioplasty is bone flap resorption (BFR). Severe BFR can lead to revision surgery with implantation of synthetic bone flap and also necessarily lead to higher hospital expenses. This study aims to perform a meta-analysis to summarize available evidence regarding risk factors of BFR requiring a second surgery in patients with autologous cranioplasty.Cohort, case-control, and cross-sectional studies that report the incidence and risk factors of BFR among patients with autologous cranioplasty, published in English, will be considered for selection. Three databases from inception to May 2020 will be searched. The process of data selection, quality assessment, and data extraction will be assessed by 2 authors independently. The study quality will be assessed by Newcastle-Ottawa Scale (NOS) and Agency for Healthcare Research and Quality checklist.The statistical analysis of this meta-analysis will be calculated by Review manager version 5.3.The results of this systematic review and meta-analysis will be disseminated through academic conferences and expected to publish in a peer-reviewed journalThis study will offer high-quality evidence about risk factors for BFR after autologous cranioplasty.INPLASY202050063. The reported prevalence of BFR with autologous cranioplasty was varied significantly, up to 50% in previous studies.,12 BFR can lead to weakening, loosening and significant disintegration of the implanted autologous bone, which eventually results in loss of the bone coverage. Revision surgery with replacement of synthetic material is necessary in severe cases of BFR and second surgery could be associated with higher expenses and poor clinical outcomes.,15 It would be reasonable to identify high-risk group that might suffer BFR and take preventive measures or choose alloplastic material cranioplasty for those patients.Despite the advantages and simple technique, cranioplasty can carry high rates of complication.,16\u201318 Other potential risk factors, such as bone flap size, preservation of bone flap, and time interval between DC and cranioplasty,17,19,20 need to be assessed in a systematic approach. Therefore, we will undertake a systematic review and meta-analysis of studies presented data on risk factors for BFR requiring a second surgery after autologous cranioplasty.The risk factors of BFR, however, remains unclear, and the data is not comprehensive and no systematic review with respect to the prevalence rates and risk factors of BFR has been implemented. Previous reports have found that younger age, bone flap fragmentations, and hydrocephalus shunt implantation to be associated with higher incidence of BFR.22.1https://inplasy.com/inplasy-2020-5-0063/) and the study registration number is INPLASY202050063. It is reported to be in line with the meta-analysis of observational studies in epidemiology (MOOSE) guidelines and the Preferred Reporting Items for Systematic Reviews and Meta-analysis Protocol.,22 If adjustments are needed throughout the study, we will update the details in the final version.This systematic review protocol has been registered on the INPLASY website  and cross-sectional studies will also be included. The language of literature will be limited in English, but there will be no restriction on publication data. Case report, letters, conference abstracts, reviews, non-clinical research, technical note will be excluded.2.3.2In study group, any patients should be diagnosed with BFR requiring a second surgery after autologous cranioplasty with no restrictions on ethnicity, sex, or nation. People in control group should be patients without BFR or those patients with BFR but not requiring a revision surgery with implantation of synthetic materials. The diagnosis of BFR will be based on valid clinical and radiographic findings.2.3.3The outcomes should be explicitly reported as the followings:1.Incidence of BFR;2.Study reported at least 1 risk factor for BFR requiring a second surgery;3.Study reported findings in terms of risk estimate  or provided sufficient data to calculate. Those studies that risk estimates cannot be directly extracted or obtained will be excluded.2.4A systematic and comprehensive search will be carried out in 3 databases, including PubMed, Embase, Cochrane Library database, from the inception to May 1, 2020. Detailed search strategy of PubMed will be ((((cranioplasty[Title/Abstract]) OR post-cranioplasty[Title/Abstract])) AND (((((autologous[Title/Abstract]) OR bone[Title/Abstract]) OR autologous bone[Title/Abstract]) OR autogenous[Title/Abstract]) OR autograft[Title/Abstract])) AND ((((resorption[Title/Abstract]) OR necrosis[Title/Abstract]) OR bone resorption[Title/Abstract]) OR bone necrosis) The search strategies for other electronic databases will be modified appropriately.2.5Two independent members in our group will select all of the studies and import them into Endnote version X8 software to manage. First, the duplicated studies will be removed. Then, the 2 authors will independently screen all potentially qualified studies by reading titles and abstracts. Studies will be excluded if they do not meet inclusion criteria. Finally, the 2 authors will screen the full text and determine the final qualified articles that in line with the inclusion and exclusion criteria. The 2 reviewers will crosscheck the included studies, disagreements in the process will be resolved after mutual discussion. If no agreement is reached, the third author will individually evaluate the matter. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses Flowchart Fig.  will be 2.6For eligible studies, data were independently extracted into Microsoft Excel by 2 authors. The following information were collected: name of the first author, study period, preservation of the bone flap, where the study was conducted, study design, sample size, mean (median) age of participants, the rate of bone flap resorption. We will extract the risk factors if they reach statistical significance of 5% in univariate and multivariate analyses. The risk estimates with a 95% confidence interval (CI) were extracted for each risk factor or the absolute number of case and control for each risk factor were available. If data is missing, we will email the corresponding author to ask for assistance.2.7 which contains 3 categories: 4 items for patients selection, 1 item for study comparability and 3 items for outcomes assessment. The score is classified into 3 scales: 7-9 defined as good, 5-6 is fair quality, and 0-4 is poor quality.All included studies will be cohort, case-control and cross-sectional studies. The quality of included studies will be independently assessed by 2 authors and possible discrepancies will be adjusted by a third author. Quality assessment will be conducted according to guidance of Newcastle-Ottawa Scale (NOS),2.82.8.1Meta-analysis will be performed using Review manager version 5.3. The outcome measures for the meta-analysis will be risk factors associated with BFR requiring revision surgery. If relevant risk factors are reported in 2 or more studies, the pooled odds ratio with 95% confidence intervals will be calculated. If the risk factors could not be included in this meta or reported only once, the results will be presented separately or in discussion part.2.8.2I2 index. When P value <.10 or the value of I2 < 50%, studies will not be considered heterogeneous and a fixed effect model will be adopted in the meta-analysis; otherwise, a random effects model will be applied. In the case of heterogeneity, the quantitative synthesis is not appropriate, the results will be presented in tables or charts.Heterogeneity of the studies will be assessed using Cochrane Q test and 2.8.3If the results of meta analyses are heterogenous, we will perform a subgroup analysis based on several aspects, such as race, study country, study year, different bone flap preservation, and study quality.2.8.4The sensitivity analysis is used to evaluate the robustness and stability of conclusions. It will be conducted by removing low-level quality study one by one and then merges the data to probe the sample size, study quality, and missing data on results of the study.3BFR is one of the most common complication following autologous cranioplasty, which could lead to prolonged hospital stay and neurological deterioration and economic burden. Recently, there has been a growing number of studies about identification of risk factors and potential strategies for lowering BFR rates, avoiding a second surgery. The results are different and no studies have summarized the existing evidence. Therefore, the purpose of this systematic review and meta-analysis is to summarize the evidence from previous researches and investigate potential risk factors for BFR. For those patients with risk factors, prevention strategies or implantation with alloplastic material are necessary.There are strengths in this study. This is the first meta-analysis to summarize findings about risk factors for BFR, which could provide clear evidence for clinical work and improve clinical outcomes. However, there may be some limitations in our meta-analysis. First, we only search 3 international database that may lead to selection bias. Second, the included types of studies are varied, for example RCTs, case control studies and cohort studies, this may cause substantial heterogeneity. Third, the methods of bone flap preservation are different, this may also be a source of heterogeneity.In conclusion, this study will help to identify risk factors for BFR after autologous cranioplasty. We hope this systematic review and meta-analysis can provide a high evidence for predictions for BFR and guide future clinical works.Conceptualization: Jingguo Yang, Junwen Guan.Data curation: Jingguo Yang, Yikai Yuan, Yicheng Zhou.Methodology: Tong Sun.Project administration: Xuepei Li.Writing \u2013 original draft: Jingguo Yang.Writing \u2013 review & editing: Junwen Guan."}
{"text": "The Kessler Foundation Neglect Assessment Process (KF-NAP) is an assessment tool for unilateral spatial neglect (USN), which is the scoring method for the Catherine Bergego Scale (CBS) based on detailed instructions. This study is aimed at determining the reliability and validity of the Japanese version of the KF-NAP (KF-NAP-J), evaluating the improvement of neglect assessment with KF-NAP-J, and comparing it with the original CBS for subacute stroke patients. We assessed subacute stroke patients admitted to our intensive rehabilitation hospital. Two KF-NAP-trained occupational therapists (OTs) assessed 22 patients. Before implementing the KF-NAP at the hospital, two other OTs assessed the other 23 patients using the CBS. We evaluated the interrater reliability of the KF-NAP and CBS using intraclass correlation coefficients (ICC) for the total scores, weighted kappa statistics for each subscale, and internal consistency using Cronbach's alpha. We assessed the validity of the KF-NAP against the Behavioral Inattention Test (BIT) and Functional Independence Measure (FIM) using Spearman's correlation coefficient. The reliability of both the KF-NAP and CBS was excellent. The weighted kappa results demonstrated that each subscale was in better agreement with the KF-NAP than with the CBS. In the KF-NAP, all eight subscales in which weighted kappa could be calculated were in significant agreement, and two were almost in perfect agreement. The KF-NAP moderately correlated with the subscales of BIT and FIM representing USN and activities of daily living. The USN detection rates of KF-NAP and BIT in the KF-NAP group were 63.6% and 22.7%, respectively. These results suggest that the KF-NAP, as well as the CBS, is useful to assess USN, which strongly impacts the rehabilitation outcomes in subacute stroke patients. Unilateral spatial neglect (USN) is defined as a failure to report, respond, or orient to novel or meaningful stimuli presented to the side opposite a brain lesion, when this failure cannot be attributed to either sensory or motor defects . This diChen et al. proposed the Kessler Foundation Neglect Assessment Process (KF-NAP) , 14, whiOur hospital is a rehabilitation hospital in Japan that provides intensive rehabilitation for subacute stroke patients hospitalized within 2 months after onset. In this phase, most patients are in the process of functional recovery, and improvement of USN strongly affects rehabilitation outcomes . Therefok = 2) assessment, 95% confidence interval (CI), and CI width 0.4; we calculated the minimum sample size as n = 20. We determined that 20 or more participants were required.We recruited participants from patients with cerebral stroke who were admitted to Saiseikai Higashi-Kanagawa Rehabilitation Hospital from July 2018 to June 2019, before implementing KF-NAP-J at our hospital, for the CBS group, and from July 2019 to August 2020 for the KF-NAP group. A chief occupational therapist, who did not participate in this study, randomly assigned patients for screening. We included participants admitted within 2 months after the onset of stroke and who could follow the examiner's instructions. We excluded participants whose behavior could not be assessed with the CBS or the KF-NAP-J due to severe aphasia, severe cognitive impairment, severe deafness, or blindness. For the CBS group, we screened 25 stroke patients, and 23 patients fulfilled the inclusion criteria. For the KF-NAP group, of the 39 patients who were screened, 26 fulfilled the inclusion criteria. Four patients were excluded: three had severe aphasia, and one was severely deaf. Therefore, we eventually recruited 23 participants in the CBS group and 22 in the KF-NAP group. We calculated the sample size according to the study by Doros . We assuExperiments were performed according to the Declaration of Helsinki and were approved by the Saiseikai Higashi-Kanawa Rehabilitation Hospital Research Ethics Committee . All participants provided written informed consent.The KF-NAP was translated into Japanese (forward translation) by a professional life science translator. The comparison and panel discussion led to the primary Japanese version. The translators translated the Japanese form back to English (backward translation), and this was checked and verified by members of the Kessler Foundation who developed the KF-NAP. Finally, the committee comprised two physiatrists and two occupational therapists, who compared the original English form and the obtained form to produce the final Japanese version (KF-NAP-J).The CBS  was baseThe KF-NAP , 14 was The BIT is a standard test used to assess USN and consists of conventional and behavioral tests. The conventional test consists of six subscales , with a score ranging between 0 and 146; a higher score indicates a better spatial awareness. In the original version, the cut-off score is 129 , whereasThe functional independence measure (FIM), which was developed to ensure uniformity in assessing the ADLs, includes motor and cognitive subscales and is subdivided into 18 items . For eacThe Mini-Mental State Examination (MMSE) is a simple examination used to evaluate the decline in cognitive function  and is conducted using a verbal questionnaire . It is cTwo OTs (who had not participated in translating the KF-NAP) assessed participants using the CBS (CBS group). Two other OTs who were members of the KF-NAP-J translation team and trained in KF-NAP assessment assessed participants using the KF-NAP-J (KF-NAP group). The raters of both the CBS and the KF-NAP-J possessed similar clinical experience and skills. The ADLs in both groups were assessed using the FIM. The USN of the KF-NAP group was assessed using the conventional BIT.t-test , and FIM) and chi-squared test . The level of statistical significance for the variables was set at 0.05.The two groups were compared by performing the unpaired Interrater reliability was calculated employing intraclass correlation coefficients (ICC) for total scores and weighted kappa coefficients for each subscale. Internal consistency was calculated using Cronbach's alpha. The level of statistical significance for the variables was set at 0.05.The KF-NAP was evaluated for convergence and discriminative validity of Rater 1. Convergence validity was obtained using the Spearman correlation coefficient of the KF-NAP against conventional BIT and FIM. The level of statistical significance for the variables was set at 0.05.In the KF-NAP group, we calculated and compared the percentage of patients detected with USN symptoms by KF-NAP and the percentage of patients who were below the cut-off point with the BIT conventional test by Rater 1. In addition, we calculated the detection rates of the injured side in the participants assessed using the KF-NAP and BIT.Data analysis was performed using IBM SPSS Statistics for Mac, Version 23 .P > 0.05). The CBS group had more patients with left hemisphere damage and lower MMSE scores than the KF-NAP group. Four participants in the CBS group could not participate in MMSE assessment due to motor aphasia. However, CBS assessment in these participants could be performed because they could understand and follow the instructions.The demographic data of all participants are presented in The ICC and Cronbach's alpha of the two groups are shown in The weighted kappa coefficients of each subscale of the KF-NAP and CBS are shown in The order of the CBS was changed to correspond with that of KF-NAP.The correlation between the KF-NAP and conventional BIT is shown in The correlation between the KF-NAP and FIM is shown in 1The correlation between the KF-NAP and FIM is shown in The USN detection rates of KF-NAP and BIT in the KF-NAP group are shown in We evaluated USN using the KF-NAP in subacute stroke patients during rehabilitation in Japan. In the Japanese healthcare system, stroke patients are transferred to a rehabilitation hospital within 60 days, and the time between stroke onset and admission to rehabilitation hospitals is generally 3 to 5 weeks. Subsequently, patients receive intensive rehabilitation treatment for several months.In this study, both interrater reliability and internal consistency were slightly better in the KF-NAP group than in the CBS group. Each subscale was generally in better agreement in the KF-NAP group than in the CBS group. Previous studies reported that both CBS , 10 and In this study, weighted kappa coefficients of two subscales (auditory attention and navigation) could not be calculated because one rater assigned the same score (zero) on the subscales for all the participants. However, the other rater also scored zero for all except two participants on the auditory attention (scored 1) and except for one (scored 1) on the navigation. Therefore, even these two subscales were in good agreement between the raters. Although most subscales of KF-NAP were in moderate or better agreement, only the personal belonging subscale remained fair even with KF-NAP, possibly due to the assessment method and the space constraints in the Japanese hospital room setting. We assessed the personal belonging subscale from 3 to 6 based on the patients' daily use of personal belongings placed in the room and assessed their behavior. It is difficult to evenly position personal belongings around a patient on the left and right because of limited personal space in the hospital rooms in Japan. Therefore, it is challenging to appropriately arrange the room for the assessment. The interrater reliability of the subscales was less consistent than in previous reports both in the KF-NAP and the CBS. The possible reasons are as follows: (1) the participants were in the subacute intensive rehabilitation ward, and most of the patients experience improvement in their function and abilities day by day, and the symptoms of USN fluctuated. Therefore, we expect that the scores would be significantly different between raters compared with those of patients during the acute phase, as reported in previous studies. (2) Most participants with USN had mild to moderate symptoms. Potentially, in these patients, USN symptoms would have been impacted by intensive rehabilitation more rapidly than in patients with more severe USN, and (3) the raters were not adequately trained, which could be improved by thorough education.In our study, KF-NAP-J was correlated with the line cancellation test, star cancellation test, and figure and shape copying of BIT. Azouvi et al.  reportedKF-NAP-J was also correlated with motor and total FIM but not with cognitive FIM. Chen et al.  showed tThe USN detection rate of the KF-NAP was higher than that of the BIT. Subacute patients receiving rehabilitation treatment may learn to compensate for USN symptoms in the visual search task. In addition, paper-and-pencil tests tend to improve when the tests are repeated regardless of improvement of USN . TherefoIn patients with left hemisphere damage, the USN detection rate of KF-NAP was considerably higher than that of BIT. No USN patients were detected using BIT, whereas 60% were diagnosed with USN by KF-NAP. It is difficult to evaluate USN using paper-and-pencil tests if the patients have aphasia and/or severe dominant hand paresis. However, right-sided USN of patients with left hemisphere damage equally predicts poor functional outcomes as left-sided USN , 4. TherUSN is a strong negative predictor of poor rehabilitation outcomes , 6, 24, One of the main limitations of this study is the small sample size. There were only 22 participants in the KF-NAP group and 25 participants in the CBS group. Therefore, we could not match the lesion side and distribution of severity between the two groups. Future studies with a large number and a wide spectrum of participants are required to ascertain the reliability and validity of the method. In addition, we assigned the participants and the raters to either the CBS group or the KF-NAP group. Ideally, to effectively compare the reliability between the CBS and KF-NAP is to assess the same participants by two KF-NAP trained raters and two other raters trained with the original CBS but not KF-NAP trained. However, it is also difficult to retain blindness and independence among raters if many raters assess the same participants in a small hospital. Therefore, we initially separated the raters for the two groups, and two raters assessed participants in the CBS group, whereas the other two raters were involved in translating and KF-NAP training. Owing to these limitations in the study design, we cannot confirm the validity and reliability based on the results of this study only. Despite these limitations, the investigators believe that the KF-NAP-J is useful for assessing CBS in stroke patients undergoing subacute rehabilitation.In this study, the KF-NAP exhibited good interrater reliability and correlated with the subscales of BIT and FIM, which represent USN and ADLs in subacute stroke patients. Unilateral spatial neglect strongly impacts rehabilitation training and its outcomes, therefore requiring accurate assessment of USN. In addition, behavioral testing is even more important in patients with left hemisphere damage because it facilitates assessment even if the patients experience aphasia and paralysis of the right hand. These results suggest that KF-NAP and CBS are useful in assessing USN in subacute stroke patients."}
{"text": "Ovis aries) from Qinghai-Tibetan Plateau. Bacteroidetes and Spirochaetae were enriched in sub-adult sheep, while Firmicutes and Tenericutes were more abundant in young individuals. The sub-adult individuals had higher alpha diversity values than those in young sheep. Metabolomics analysis showed that the content of essential amino acids and related gene functional pathways in rumen were different between the lambs and sub-adult population. L-Leucine that participates in valine, leucine and isoleucine biosynthesis was more abundant in the lambs, while phenylethylamine that takes part in phenylalanine metabolism was more enriched in the sub-adults. Both rumen microbial community structures and metabolite profiles were impacted by age, but rumen SCFA concentration was relatively stable between different age stages. Some specific microbes  were positively associated with L-Leucine but negatively correlated with phenylethylamine, implying that rumen microbes may play different roles for metabolite production at different ages. Mantel test analysis showed that rumen microbiota was significantly correlated with metabolomics and SCFA profiles. Our results indicates the close relationship between microbial composition and metabolites, and also reveal different nutritional requirement for different ages in ruminants, thus having important significance for regulating animal nutrition and metabolism by microbiome intervention.The rumen microbiota plays an important role in animal functional attributes. These microbes are indispensable for the normal physiological development of the rumen, and may also convert the plant polysaccharides from grass into available milk and meat, making it highly valuable to humans. Exploring the microbial composition and metabolites of rumen across developmental stages is important for understanding ruminant nutrition and metabolism. However, relatively few reports have investigated the microbiome and metabolites across developmental stages in ruminants. Using 16S rRNA gene sequnecing, metabolomics and high-performance liquid chromatography techniques, we compared the rumen microbiota, metabolites and short chain fatty acids (SCFAs) between lambs and sub-adult Tibetan sheep ( Ruminants have a close relationship with their symbiotic microorganisms in the digestive tract. These microbes include bacteria, archaea, fungi, viruses, and protozoa , which pRuminococcus and Fibrobacter) in the bovine had a low abundance in the newborn (1\u20133 days) individuals, while had higher abundance in the adult sheep and maintained a relatively constant level , which can extract many metabolites from samples and uncover the metabolic phenotypes in humans , animalsOvis aries) are one of the most widely distributed and numerous livestock on the Qinghai-Tibetan Plateau, as their population size reaches more than 50 million  and 6-month-old Tibetan sheep  in the same cohort. Three portions (~5 g per portion) of the contents from the anterior, middle and posterior parts of the rumen were taken and mixed well-before sample collection. These Tibetan sheep were all males. The sub-adult individuals were grazed on pasture  on the Qinghai-Tibet Plateau, and supplied commercial feed#8876  at dusk. The main nutritional components of this commercial feed include crude protein \u2265 16%, crude fat \u2265 3%, crude fiber \u2264 8.0%, and crude ash \u2264 9.0%. The daily feed intake of sub-adult individuals was 4.75 \u00b1 0.32 kg. The lamb individuals were mainly fed milk, and also ate a small amount of the grass (~0.72 \u00b1 0.0.07 kg) and commercial feed (~0.54 \u00b1 0.0.12 kg) mentioned above. Drinking water was freely available to these Tibetan sheep. The body weight of lamb and sub-adult groups was 15.75 \u00b1 5.90 and 26.35 \u00b1 4.01 kg, respectively. After collection, the ruminal contents were immediately divided into three parts on ice for the following microbiome, metabolome and short chain fatty acid (SCFA) analysis, and were temporarily kept in \u221220\u00b0C portable refrigerator in field. Finally, all samples were transferred to our lab within 24 h and stored at \u221240\u00b0C refrigerator.Rumen contents were collected between February and July from the Haibei Demonstration Zone of Plateau Modern Ecological Animal Husbandry . After the sheep were anesthetized using diethylether and dissected, we obtained a total of 12 rumen samples from 1-month-old  was applied to extract total microbial DNA from the ruminal contents according to the product manual. Thereafter, Qubit 2.0 Fluorometer  was used to detect the concentration of DNA samples. The V3-V4 regions of 16S rRNA gene were amplified using the primer pairs 341F(CCTACGGRRBGCASCAGKVRVGAAT) and 806R (GGACTACNVGGGTWTCTAATCC) . PCR amphttp://qiime.org/scripts/index.html) from our Microbiome and Bioinformatics Platform in School of Public Health, Lanzhou University. The detailed analysis methods and procedures were described in our previous reports with slight modification , were calculated using QIIME Pipeline. Unweighted UniFrac distance matrice is based on the absence or presence of OTUs, while weighted UniFrac is dependent on the relative abundance of OTUs . Princip2O (4\u00b0C) were added into the tubes. The mixture was thoroughly vortex-mixed for 60 s. Thereafter, 1,000 ul of methanol (pre-cooled at \u221220\u00b0C) was added into the samples, and the mixed liquids were shaken for 30 s. Thereafter, we further placed the tubes into an ultrasound machine at room temperature for 10 min, and then stew for 30 min on the ice. The samples were centrifuged for 10 min at 14, 000 rpm 4\u00b0C, and then 1.2 mL supernatant was transferred into a new centrifuge tube. Samples were further blow-dried by vacuum concentration. Thereafter, samples were dissolved using 400 \u03bcl methanol aqueous solution , and underwent 0.22 \u03bcm membrane for filtration. For the quality control (QC) samples, 20 \u03bcL of prepared samples were extracted and mixed. These QC samples were used to monitor deviations of the analytical results from these pool mixtures. Finally, samples were ready for LC - MS  detection. More detailed methods for LC-MS procedures have been described in the previous report . Then the metabolomic data underwent peaks identification, filtration and alignment using the XCMS package in R (v3.3.2). In order to compare data of different magnitude, peak area was normalized for further statistical analysis .Short chain fatty acid (SCFA) profiles of ruminal content samples were measured using an Agilent 1100 series high-performance liquid chromatography (HPLC) system . We measured the concentration of acetate, propionate, butyrate, isobutyrate, valerate, isovalerate, and hexanoate using an Alltech IOA-2000 organic acid column. The detailed procedures for measuring SCFAs have been described previously .U-tests were used. Permutational multivariate analysis of variance (PERMANOVA) analysis based on the unweighted and weighted UniFrac distance matrices was used to evaluate whether the community structures were significantly distinct between groups using the procedure \u201cAdonis\u201d in the R \u201cvegan\u201d package. In order to identify significant taxonomic differences of rumen microbiota between groups, we used LEfSe analysis at phylum, genus and OTU level. This method considers both biological and statistical significance of data. Linear discriminant analysis (LDA) effect size (LDA > 2) was applied to assess the magnitude scale of the effect of differentially abundant taxa. This analysis was performed at Galaxy module of LEfSe .To test the differences of the alpha diversity indices (phylogenetic diversity and observed OTUs) of ruminal microbiomes, Mann\u2013Whitney P < 0.05) between the groups ES and SS. The identification of these compounds was based on their MS/MS spectra, online databases and literature. Subsequently, the related metabolic pathways of the above different metabolites were analyzed based on Hypergeometric test using the online software MetaboAnalyst . The impacting factor plots of KEEG (Kyoto Encyclopedia of Genes and Genomes) based on those different metabolites were visualized.For metabolomic data, the detailed analysis methods were described in Li et al. . Brieflypost-hoc test in SPSS13.0 was used to analyze the differences of SCFA concentration of sheep ruminal contents between young and sub-adult groups. The spearman correlation analysis between rumen bacterial genera and SCFAs, differential metabolites was also performed using SPSS13.0. Heatmap2 was used to visualize the correlation results. In addition, mantel test was used to detect the relationship between rumen microbiota and metabolic profile or SCFAs using the \u201cmantel\u201d procedure in the R vegan package.One-way analysis of variance (one-way ANOVA) with Tukey's PRJEB36249 (http://www.ebi.ac.uk/ena/data/view/PRJEB36249).All the original 16S rRNA gene data in this study were submitted to the European Nucleotide Archive, and were available by accession NO. Ruminococcaceae_UCG-005 (10.22%), Bacteroides (8.18%), Rikenellaceae_RC9_gut_group (7.58%), two unknown genus from Lachnospiraceae (7.42%) and Ruminococcaceae_UCG-010 (5.77%). The rumen microbial composition of each sample was visualized in We obtained 698,333 original paired-end reads across all samples  from MiSeq sequencer. A total of 800 unique OTUs were detected in the Tibetan sheep rumen across all samples using VSEARCH clustering. By taxonomic classification, we found that the rumen microbiota was dominated by Firmicutes (mean relative abundance = 56.57%), Bacteroidetes (39.46%), Proteobacteria (1.88%) and Verrucomicrobia (1.24%), followed by other rare phyla (mean relative abundance <1%), such as Spirochaetae, Actinobacteria, Tenericutes and Saccharibacteria. At genus level, five most abundant genera were Clostridium_sensu_stricto_1, Turicibacter and Ruminococcaceae_UCG_010. The SS (or sub-adult) group was enriched by 22 genera, including Escherichia_Shigella, Prevotellaceae_UCG_001, Succinivibrio and Treponema_2. At OTU level, a total of 27 OTUs were more abundant in the ES group, these OTUs were mainly affiliated with Clostridium_sensu_stricto_1, Ruminococcaceae, Barnesiella, Akkermansia and Eubacterium. In contrast, 26 OTUs showed a higher abundance in the SS group, these OTUs mainly belonged to Lachnospiraceae, Succinivibrio, Rikenellaceae_RC9_gut_group, Ruminococcaceae, Eubacterium and Bacteroidales. In addition, we compared the alpha diversity values between the ES and SS groups. The rumen microbiota of sub-adult sheep had higher phylogenetic diversity and observed OTUs .Using LefSe analysis, we compared the significant different bacteria taxa between developmental stages of Tibetan sheep at phylum, genus and OTU level . We founMetabolic biomarker can reveal the significantly different metabolites between young and sub-adult Tibetan sheep. A total of 32 biomarkers were identified between the two groups . Among tAccording to the PCA or PLS-DA plots, we found that the young sheep had significantly different metabolomic profiles with sub-adult individuals regardless of ion mode -Hexenal, 3-Hydroxy-3-Methylglutaric acid, glycochenodeoxycholic acid, 5,6-Dihydrouracil, 9(S)-HpOTrE, barceloneic acid A, galactitol, and L-Leucine, while this genus showed negative correlations with 16 metabolites .Some rumen microbes were associated with metabolites . For exar = 0.296, P = 0.028; negative ion mode, r = 0.343, P = 0.019). In addition, SCFA profiles also showed significant associations with rumen microbiota .Mantel test was also used to detect the relationship between rumen microbiota (using weighted UniFrac distance) and metabolomic or SCFA profiles. We found that rumen microbial communities were significantly correlated with metabolomic profiles (positive ion mode, Most of previous reports on ruminants only focused on rumen microbiome, but lacked functional and metabolic information. Here, we investigated the relationship among age, rumen microbiome, metabolomics and SCFA profiles. Our data indicate that age significantly influence the rumen microbiome and metabolomic profiles, but had no impacts on SCFA concentrations. In addition, we found that rumen microbial communities were significantly correlated with metabolomic profiles and SCFAs. These results have important significance for understanding nutrition and metabolism of ruminants on the Qinghai Tibetan Plateau.The rumen microbial diversity in the sub-adult Tibetan sheep was more diverse than that in the young individuals. This finding is consistent with those of previous studies , 26, whiIn addition, the community structures of rumen microbiota were also significantly divergent between the young and sub-adult Tibetan sheep. These results were consistent with those in previous studies , 26, whiTreponema, Ruminococcus and several unknown genera from Ruminococcaceae and Spirochaetaceae were enriched in the sub-adult Tibetan sheep. Some members of these bacterial taxa were involved in the degradation of plant cellulose, hemicellulose, and chitin (Barnesiella, Akkermansia and Eubacterium were enriched in the young sheep. Some members of Barnesiella have also been isolated from human feces (Barnesiella intestinihominis may activate anti-cancer immune response of spleen T cell, and thus inhibit tumor growth and improve chemotherapy effect (Eubacterium, especially Eubacterium hallii, may increase fecal butyrate concentrations and modify bile acid metabolism. More importantly, it can improve the insulin sensitivity in diabetic mice, thus contributing potential benefits to animal health (Akkermansia is mucin-degrading bacteria, and may protect hosts against pathogen invasion. The abundance of this genus in gut microbiome is positively correlated with health and metabolic ability of hosts (Our data showed that Bacteroidetes were more enriched in the sub-adult individuals, while Firmicutes were more abundant in the young sheep. This finding was partly consistent with that in Jami et al. , who foud chitin . At OTU an feces , and arey effect . Eubactel health . Akkermaof hosts , 35, thuOur data showed that the metabolomics profiles were significantly different between the young and sub-adult Tibetan sheep based on PCA or PLS-DA analysis, indicating that age is likely to influence the metabolic profiles of animals. These results were consistent with those in Li et al. , who alsSeveral organic acid were more abundant in the young sheep, such as barceloneic acid A, terephthalic acid, 3-Hydroxy-3-Methylglutaric acid, fumaric acid, and glycochenodeoxycholic acid. These organic acids probably play important roles in host development and metabolism. For example, it has been reported that terephthalic acid was tightly correlated with the ruminal development of lambs . Glycochin vivo. For instance, acetate can been transported to peripheral tissues, and then to liver for participating in cholesterol synthesis (Staphylococcus aureus internalization into bovine mammary epithelial cells and regulate antimicrobial peptide gene expression (SCFAs are the end metabolic products of plant cellulose and other dietary polysaccharides via rumen microbial fermentation. These metabolites contributes to energy and nutrition of ruminants. For example, butyrate can supply ~60\u201370% energy for normal epithelial cells . Besidesynthesis . Propionynthesis . In addipression , 49. OurOur results showed that rumen microbiota structure was associated with metabolic profiles. This result was congruent with that in goat , fish 5, human , gorillaIn conclusion, we found that both rumen microbial community structures and metabolite profiles of Tibetan sheep were distinct at different ages, but rumen SCFA concentration was relatively stable between the two age stages. Notably, metabolomics analysis showed that the nutritional requirement of essential amino acids in rumen were different between the lambs and sub-adult Tibetan sheep. We found L-Leucine that participates in valine, leucine and isoleucine biosynthesis was more abundant in the lambs, while phenylethylamine that takes part in phenylalanine metabolism was enriched in the sub-adults. In addition, rumen microbita was associated with metabolomics and SCFAs, indicating the close relationship between microbial composition and metabolites. These results have important significance for regulating animal nutrition and health by microbiome intervention.PRJEB36249.All the original 16S rRNA gene data in this study were submitted to the European Nucleotide Archive, and were available by accession no. Animal ethics approval for the present project was obtained from the Animal Ethics Committee of Lanzhou University.HL and JQ designed this study. JQ carried out the animal experiments and sample collection. HL was responsible for the molecular experiments, data analysis, and wrote the original manuscript. All authors revised and edited the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The ILD-model showed a significantly higher Dice score , and IoU-score  compared to the DeepLab V3 model, and a significantly lower average false positive rate of 3.6/patient vs. 7.0/patient (p\u2009<\u20090.001) using a 10 mm3 lesion-size limit. The ILD-model, trained on all possible combinations of four MRI sequences, may facilitate accurate detection and segmentation of brain metastases on a multicenter basis, even when the test cohort is missing input MRI sequences.The purpose of this study was to assess the clinical value of a deep learning (DL) model for automatic detection and segmentation of brain metastases, in which a neural network is trained on four distinct MRI sequences using an input-level dropout layer, thus simulating the scenario of missing MRI sequences by training on the full set and all possible subsets of the input data. This retrospective, multicenter study, evaluated 165 patients with brain metastases. The proposed input-level dropout (ILD) model was trained on multisequence MRI from 100 patients and validated/tested on 10/55 patients, in which the test set was missing one of the four MRI sequences used for training. The segmentation results were compared with the performance of a state-of-the-art DeepLab V3 model. The MR sequences in the training set included pre-gadolinium and post-gadolinium (Gd) T1-weighted 3D fast spin echo, post-Gd T1-weighted inversion recovery (IR) prepped fast spoiled gradient echo, and 3D fluid attenuated inversion recovery (FLAIR), whereas the test set did not include the IR prepped image-series. The ground truth segmentations were established by experienced neuroradiologists. The results were evaluated using precision, recall, Intersection over union (IoU)-score and Dice score, and receiver operating characteristics (ROC) curve statistics, while the Wilcoxon rank sum test was used to compare the performance of the two neural networks. The area under the ROC curve (AUC), averaged across all test cases, was 0.989\u2009\u00b1\u20090.029 for the ILD-model and 0.989\u2009\u00b1\u20090.023 for the DeepLab V3 model ( In recent years, there has been significant effort in utilizing the next-generation AI technology, coined deep learning, to learn from labeled magnetic resonance imaging (MRI) data7. One key advantage of AI-based radiology is the automatization and standardization of tedious and time-consuming tasks, most clearly exemplified in the tasks surrounding detection and segmentation10. Several deep learning approaches have successfully been developed and tested for automatic segmentation of gliomas13, thanks in part to the publicly available brain tumor segmentation (BraTS) dataset14. In recent years, studies have also shown the potential of AI-based segmentation in patient cohorts comprising tumor subtypes, such as brain metastases, which may pose a greater challenge in terms of segmentation performance given their wide range of sizes and multiplicity16. Delineation of initial metastatic lesion size and changes related to disease progression or response are key neuroradiology tasks17. Traditionally, the metrics used for assessing brain metastases are based on unidimensional measurements, and although the value of using volumetric measurements has been increasingly discussed, expert groups remain reluctant to endorse a universal requirement of volumetric criteria for assessing brain metastases. One concern often raised is that volumetric analysis, as performed manually by radiologist, adds cost and complexity, and is not available at all centers. Consequently, there has been a strong need to develop an accurate pipeline capable of automatic detection and segmentation of brain metastases. In a recent study, we trained a fully convolution neural network (CNN) for automatic detection and segmentation of brain metastases using multisequence MRI18. While our DL-approach showed high performance, the robustness and clinical utility needs to be challenged in order to fully understand its strengths and limitations. In fact, many AI-based segmentation studies are limited in terms of generalizability in that the algorithms are trained and tested on single-center patient cohorts. In some studies, the training-sets and test-sets are even limited to a single magnetic field strength, a single vendor, and/or a single scanner for data acquisition. A key step towards understanding the generalizability and clinical value of any deep neural network is by training and testing using real-world multicenter data. Another limitation of these AI-based segmentation networks is that they are trained on a distinct set of MRI contrasts, which limits the use of the networks to sites acquiring the same sequences. However, deep neural networks should be able to handle missing model inputs. To this end, this work tested an AI-based segmentation model, called input-level dropout (ILD), in which a neural network with an input dropout layer is trained on the full set of four distinct MRI sequences, as well as every possible subset of the MRI sequences. Hence, our proposed model can improve the generalizability of deep learning segmentation models by enabling inference at imaging sites missing MRI sequences used for training. This proposition was investigated by testing the trained ILD-model on a patient cohort acquired at a different site and missing one of the four MRI sequences used for training. To evaluate this network\u2019s performance, a second neural network was trained and tested using state-of-the-art architecture without applying the input-level dropout strategy, i.e., only trained on the limited sequences corresponding to those in the test set. We hypothesize that the ILD-model will yield segmentation performance comparable to that of a state-of-the-art segmentation network, while at the same time being robust towards missing input data and allow it to generalize to multicenter MRI data.Advances in artificial intelligence (AI) are suggesting the possibility of new paradigms in healthcare and are particularly well-suited to be adopted by radiologistsThe total time used for training was approximately 20\u2009h for both the ILD-model and the DeepLab V3 network. For processing a test case using the ILD-model, the forward pass on a system with two NVIDIA GTX 1080Ti GPUs took approximately 250\u2009ms per slice.p\u2009=\u20090.620), respectively , and IoU-score , compared to the DeepLab V3 network . By applying a lesion-size limit of 10\u2009mm3, the ILD-model demonstrated an average FP of 3.6/patient, also significantly lower that the DeepLab V3   regardless of missing input MRI sequences. The accuracy of the ILD-model in detecting metastatic voxels in the brain, as measured by the AUC, is equivalent to that of the state-of-the-art DeepLab V3 neural network trained on the specific subset of sequences in our test set. However, our results indicate that the proposed model is superior to the DeepLab V3 in terms of segmentation performance, as measured by the Dice score and IoU, while at the same time returning significantly fewer FP. Nevertheless, the number of FP reported by the ILD-model remains a challenge that needs to be addressedThe neural networks used in this study were based on the DeepLab V3 architecture, which is considered as one of the most robust neural networks for image-based semantic segmentation. The key difference of the DeepLab V3 compared with other relevant networks is its reliance on atrous (or dilated) convolutions. By using atrous convolutional layers, our network has a large receptive field, thereby incorporating greater spatial context. This approach may be key to enabling the network to identify local features as well as global contexts, i.e., identifying brain regions, which could enhance the network\u2019s decision-making process on similar local features.18. No previous studies have evaluated the deep learning for brain metastasis detection using multicenter data. Other single-center studies, such as Liu et al.15 and Charron et al.16, have recently shown that deep neural networks can detect and segment brain metastases with high performance, reporting results comparable to that of the current study. The latter study also demonstrated that a deep neural network trained on multisequence MRI data outperformed single contrast networks.In our study, the networks\u2019 performance was tested on multicenter data, representing an essential step towards understanding the generalizability and clinical value of the proposed neural network. In this sense, it represents a logical extension of our prior single-center study on this topic20 and can be acquired by fast spin-echo or gradient-echo techniques. The 3D T1-weighted gradient-echo sequences  are broadly used because they create isotropic T1-weighted images with excellent gray-white matter differentiation, but are limited by lower contrast conspicuity and a lack of blood vessel suppression. The 3D fast spin-echo techniques  are relatively newer techniques optimized for isotropic high-resolution 3D imaging of T1-weighted, T2-weighted, or FLAIR images, and have the advantage of blood vessel suppression. For this study, post-Gd T1-weighted 3D fast spin-echo, pre-Gd and post-Gd T1-weighted 3D axial IR-FSPGR, and 3D FLAIR sequences were used as input to train the neural network. While these sequences are widely used for imaging brain metastases, they are not compulsory. Variations in sequences and acquisition parameters among different institutions frequently are present. For instance, 2D FLAIR (with thicker slice and non-isotropic voxels) may be acquired instead of 3D FLAIR. In clinical practice, it is also not unusual to omit sequences owing to patients\u2019 safety or comfort. Therefore, it is imperative to design a robust and versatile neural network that can accommodate missing sequences while maintaining good performance. To this end, the goal of this study was to develop a deep learning model that is able to detect and segment brain metastasis with high accuracy, equivalent to that of the state-of-the-art DeepLab V3 model, even when the clinical end-user does not have access to all MRI data on which the model was trained. This is a major improvement for the generalizability of deep learning segmentation tools since many clinical sites do not the time or hardware to perform all four MRI scans.In general, the two most used MRI sequences for assessing brain metastases are post-Gd T1-weighted and T2-weighted FLAIR. The post-Gd 3D T1-weighted, high-resolution isotropic sequence is most crucial18. However, a total of nine patients in the current test set presented with >3 small metastases, for which the ILD-model still demonstrated a high accuracy and performance, equivalent to the average metrics for all lesions.While this study shows a high accuracy using the ILD-model for detecting and segmenting brain metastases, the results should be interpreted in light of the limited sample size and the homogeneity of the test cohort. Patients included in the test set were all scheduled for SRS, which generally presents with fewer and larger metastases, which in turn may be easier for the network to predict. This hypothesis is supported by observations made in our previous study, in which the tested neural network showed higher accuracy in patients with three or less metastases compared to patients with >3 metastasesIn conclusion, this study demonstrates that the ILD-model, utilizing a pulse sequence level dropout layer, thus being trained on all possible combinations of multiple MRI sequences, can detect and segment brain metastases with high accuracy, even when the test cohort is missing MRI data. This is likely of value for generalizing deep learning models for use in multiple different imaging sites.This retrospective, multicenter study was approved by the Oslo University Hospital and Stanford Review Board. The patient cohort consisted of a total of 165 patients with brain metastases, enrolled from two different hospitals, hereinafter referred to as \u201cHospital A\u201d and \u201cHospital B\u201d. From Hospital A, MRI data from a total of 100 patients were acquired and used for neural network training. These patients received their scans for clinical purposes, and our Review Board waived the requirement for informed consent. Further, a total of 65 patients from Hospital B were used for validation and testing, and written informed consent was obtained from all the patients.Inclusion criteria for the training data included the presence of known or possible metastatic disease , no prior surgical or radiation therapy, and the availability of all required MR imaging sequences (see below). Only patients with \u22651 metastatic lesion were included. Mild patient motion was not an exclusion criterion. For the validation and test data, we used MRI data from an ongoing clinical study (NCT03458455) conducted at Hospital B. To be eligible for inclusion, patients had to receive stereotactic radiosurgery (SRS) for at least one brain metastasis measured at a minimum of 5\u2009mm in one direction, be untreated or progressive after systemic or local therapy, have confirmed non-small-cell lung cancer (NSCLC) or malignant melanoma, be \u226518 years of age; have an Eastern Cooperative Oncology Group performance status score \u22641, and have a life expectancy >6 weeks. Details on the patient cohorts are shown in Table n\u2009=\u20097; TwinSpeed and SIGNA Explorer, GE Healthcare, Chicago, USA) and 3\u2009T  scanners. The training set included four MRI sequences; post-Gd T1-weighted 3D axial inversion recovery prepped fast spoiled gradient-echo (IR-FSPGR) (BRAVO/MPRAGE), pre- and post-Gd T1-weighted 3D fast spin echo (CUBE/SPACE), and 3D CUBE/SPACE fluid-attenuated inversion recovery (FLAIR). A dose of 0.1\u2009mmol/kg body weight of gadobenate dimeglumine  was intravenously injected for Gd-enhancement. For the test set (n\u2009=\u200965), imaging was performed on a 3\u2009T Skyra scanner , and included three MRI sequences; pre-Gd and post-Gd T1-weighted 3D fast spin echo (SPACE) and 3D T2-weighted FLAIR. Note that the 3D T1 BRAVO sequence is missing from the test set. All sequences with key imaging parameters are summarized in Table MRI training data was acquired on both 1.5\u2009T  over each image slice where a lesion was visible on the Gd-enhanced IR-FSPGR sequence. The combined ROIs for a specific lesion comprised the volume of interest (VOI). In a separate session one week later, the second neuroradiologist with 9 years of experience confirmed (and modified as appropriate) final VOI placement for each lesion. All lesions were outlined using the OsiriX MD software package .For the test data, ground truth segmentations of Gd-enhancing metastatic lesions were manually drawn on post-Gd 3D T1-weighted spin echo data by two radiologists with 14 and 5 years of relevant experience. Delineations were performed using the nordicICE software package .All image-series were co-registered to a common anatomical space. For the training data, pre-Gd and post-Gd 3D T1-weighted spin echo data and FLAIR were co-registered to the post-Gd 3D T1-weighted IR-FSPGR, whereas for the test data, the post-Gd 3D T1-weighted spin echo images was used as reference for the pre-Gd 3D T1-weighted spin echo data and FLAIR. Prior to network training, a defacing procedure was applied to anonymize all imaging data using an in-house algorithm .21, and the modifications and training strategies are detailed in a recent work22. This study utilized and trained a \u201cinput-level integration dropout\u201d network, referred to as the ILD-model .All patients from Hospital A were used for training, while the patients from Hospital B were divided into validation-sets and test-sets, giving a final breakdown of 100 training cases, 10 validation cases, and 55 test cases. All training was done on a system with two NVIDIA GTX 1080Ti GPUs.3 (roughly 2\u2009mm in linear dimension) as a detected lesion.In this study, we perform statistical analysis on a voxel-by-voxel and lesion-by-lesion basis. The voxel-based approach allows investigation of differences in the probability maps at the smallest volume-level of the MR image-series. ROC curve statistics was used to evaluate the networks\u2019 ability to differentiate between healthy and metastatic tissue on a voxel-by-voxel basis. For each patient in the test set, the area under the ROC curve (AUC) was measured. Further, the optimal probability threshold for including a voxel within the metastatic lesion was determined using the Youden index from the ROC statistics on the validation set. Using this threshold, the networks segmentation performance was further evaluated by estimating the precision-values and recall-values, false positive rate (FPR), as well as the IoU and Dice similarity score. The networks\u2019 performance was also evaluated on a per-lesion basis by calculating the number of false positive (FP) per case. This metric was determined by multiplying the ground truth maps and the thresholded probability maps and counting the number of overlapping objects in the resulting binary image. By using a connecting component approach, voxels were considered connected if their edges or corner touch. The number of FP was determined both without any size criterion, as well as only considering objects \u226510 mmp-value of 5% or lower was considered to be statistically significant. All Statistical analyses were performed using MATLAB R2017a version 9.2.0 .Finally, the performance of the ILD-model and the DeepLab V3 network was compared using the Wilcoxon rank sum test. A Further information on research design is available in the Reporting Summary"}
{"text": "The diagnosis of abusive head trauma (AHT) is complex and neuroimaging plays a crucial role. Our goal was to determine whether non-neuroradiologists with standard neuroradiology knowledge perform as well as neuroradiologists with experience in pediatric neuroimaging in interpreting MRI in cases of presumptive AHT (pAHT).blindly, i.e., no clinical history was given to the 3 non-neuroradiologists and 3 neuroradiologists from 2 different institutions.Twenty children were retrospectively evaluated. Patients had been diagnosed with pAHT (6 patients), non-abusive head trauma-NAHT (5 patients), metabolic diseases (3 patients), and benign enlargement of the subarachnoid spaces (BESS) (6 patients). The MRI was assessed Blindly, neuroradiologists demonstrated higher levels of sensitivity and positive predictive value in the diagnosis of pAHT (89%) than non-neuroradiologists (50%). Neuroradiologists chose correctly pAHT as the most probable diagnosis 16 out of 18 times; in contrast, non-neuroradiologists only chose 9 out of 18 times. In our series, the foremost important misdiagnosis for pAHT was NAHT (neuroradiologists twice and non-neuroradiologists 5 times). Only victims of motor vehicle accidents were blindly misdiagnosed as pAHT. No usual household NAHT was not misdiagnosed as pAHT. Neuroradiologists correctly ruled out pAHT in all cases of metabolic diseases and BESS.MRI in cases of suspected AHT should be evaluated by neuroradiologists with experience in pediatric neuroimaging. Neuroradiologists looked beyond the subdural hemorrhage (SDH) and were more precise in the assessment of pAHT and its differential diagnosis than non-neuroradiologists were. It seems that non-neuroradiologists mainly assess whether or not a pAHT is present depending on the presence or absence of SDH. The published review of the literature on \u201cabusive head trauma\u201d (AHT) in infants by the Swedish Agency for Health Technology and Assessment of Social Services (SBU)  triggereclinical experience, after an extensive multidisciplinary workup, suggests that when a young infant presents with hypoxic brain injury (HBI), SDH, and retinal hemorrhage, AHT is the most likely cause. Nevertheless, an experienced pediatric neuroradiologist will not only evaluate the triad but also other findings, such as the presence of ruptured and thrombosed cortical veins, ligamental injuries, myelination, or specifically the location and timing of the SDHs, as well as the age of the different brain injuries.The diagnosis of presumed AHT (pAHT) is complex and should always be the result of an extensive multidisciplinary approach. Nonetheless, neuroimaging plays a crucial role. Even though there are controversies; the main way for a radiologist to blindly assess pAHT is to evaluate the presence of the classical \u201ctriad\u201d on magnetic resonance imaging (MRI): SDH, retinal hemorrhage (if possible), and parenchymal injuries. Enormous amounts of It is important for non-neuroradiologists and neuroradiologists to know that shaking is a contributor to AHT and that the old terminology \u201cshaken baby syndrome\u201d is a subset of AHT, i.e., AHT without impact. AHT is a well-recognized brain injury caused by the directed application of force to an infant or young child , 4. CaseThis retrospective study was approved by the ethics committee of Frankfurt University Hospital. \u201cConsent\u201d for the study was waived by the INSTITUTIONAL REVIEW BOARD/INDEPENDENT ETHICS COMMITTEE (IRB/IEC) of the Frankfurt University.The patient data relate to a 10-year period, from January 2008 to December 2017. Cases were selected, rather than from random search, by the neuro-pediatrician who heads the task force for child abuse cases. The minimum interval between imaging and reassessment of a case in the study was more than 1 year. Thereby, we avoided that the neuroradiologists initially involved in the clinical diagnosis could remember the case and thus be influenced in their decisions. In addition, non-neuroradiologists and neuroradiologists from 2 institutions evaluated the MRI images.Following pre-established inclusion and exclusion criteria  were included. Patients had been diagnosed with pAHT (6 patients), non-abusive head trauma (NAHT) (5 patients), metabolic diseases , and benign enlargement of the subarachnoid spaces (BESS) (6 patients).The general mean age was 7.7 months (newborn to 36 months) with an age-appropriate grouping and an equivalent mean age of 7.7 months in the group of pAHT. At 12.7 months, the mean age of NAHT was higher than that of pAHT, but the difference between these two groups was not significant. The mean age of the other groups was also comparable at 6.3 and 4.4 months.Cases were selected by the neuro-pediatrician who is responsible for child abuse cases. All cases were discussed in a multidisciplinary team consisting at least of a neuro-pediatrician, a neuroradiologist, a pediatric radiologist, a pediatric ophthalmologist, a metabolic, and a forensic doctor. After analyzing all clinical findings, performing the recommended procedures according to the current S3 AWMF*-Guideline of 2019  and ruliInfants with pAHT presented with symptoms of their injury and the clinical history were incomplete, inconsistent, or incorrect. The following presentations were observed: 3 cases of a fall from a low height (\u2264 0.5 m); 1 child in good general health with associated progressive macrocephaly; 1 with hydrocephalus; and 1 who presented at the emergency room without previous trauma.An obligatory inclusion criterion was the presence of retinal bleeding. These had to be diagnosed by the ophthalmologist, be present on both sides, and affect several layers of the retina. Retinal hemorrhage was a crucial criterion that was collected independently of neuroradiological imaging.MRI positive concomitant brain and/or ophthalmological injuries, such as SDH(s), parenchymal injuries, cerebral edema, avulsed and thrombosed cortical veins, and retinal hemorrhages.In addition to retinal hemorrhage and inadequate or missing clinical history, patients had Metabolic diseases were ruled out.In addition, spinal, skin, and skeletal injuries were evaluated but not shown to radiologists.The goal was to include various severe degrees of pAHT. Clinically, patients presented from no symptoms to coma requiring resuscitation. One case of pAHT with impact was also included in the study. Cases were diagnosed as pAHT according to the following criteria:To note for all cases of pAHT, we used blinded data, detailed reporting on the exclusion of differential diagnoses  . We consAHT with impact (1 patient).The pAHT cases (6 patients) were sub-classified as follows: (A) pAHT without impact with bilateral SDHs (3 patients)\u2014MRI showed avulsed/thrombosed cortical veins and possible retinal hemorrhage; (B) massive pAHT without impact with cerebral edema (2 patients)\u2014MRI showed diffusion-weighted image (DWI) lesions, avulsed and thrombosed cortical veins , parenchymal hemorrhage, and possible retinal hemorrhage in MRI (1 patient); and (C) pThe main criterion for inclusion was an intracranial hemorrhage (SDH and/or subarachnoid hemorrhage (SAH)), which, together with all other clinical abnormalities, was compatible with the details of the described accident  spaces and a disorder of myelination. One patient had glutaric aciduria, type 1; his/her MRI showed atrophy of the frontotemporal regions with enlarged subarachnoid spaces and delayed myelination. One had a cobalamin defect and one methylmalonic aciduria, both with an enlargement of the external CSF spaces and borderline delayed myelination.In addition to the neuroradiological evidence of dilation of the external CSF, it was important from an inclusion perspective that the patients had no neurological symptoms and that the enlargement of the subarachnoid space and the head circumference receded in the follow-up. In addition, myelination was correct for age. Six patient cases were included in this group. One of these had, in addition to the enlargement of the external CSF space, a unilateral, homogeneous, subacute subdural hematoma, which was most likely based on a minor trauma after the exclusion of coagulation disorders and metabolic disorders. There were no indications of a pAHT. The neuroradiological examination was initiated in this case to clarify macrocephaly.The evaluation was performed within 2 university hospitals and included 6 examiners from 2 centers. 3 senior neuroradiologists -2 with additional pediatric neuroradiology experience, one with over 10 and the other 20 years of neuroradiology expertise; 1 pediatric neuroradiologist with over 20 years of neuroradiology expertise. 3 non-neuroradiologists with basic neuroradiology knowledge  axial, T1- and T2-weighted axial images, DWI/apparent diffusion coefficient (ADC) maps, axial and coronal, and T2 sequence of a multi-echo gradient recalled echo (GRE) in the axial plane. All MRIs were performed a 1.5 T MRI. The age of the patients at the time of the examination was indicated. Specifying the age was important to assess myelination. The radiologists were not made aware of the follow-up, other imaging studies, or their results.Evaluation of the MRI was performed in two rounds. In the first, the radiologist had to give a definitive yes/no answer to pAHT or select \u201cpAHT could not be excluded.\u201d In the case of a \u201cno to pAHT\u201d or \u201cpAHT could not be excluded,\u201d they should decide what other diagnoses  they would consider. For the first evaluation round, investigators had to review the cases without the help of a questionnaire or clinical history.For the second, detailed guidance of possible MRI findings in pAHT was included to help guide diagnosis, and the physician was then allowed to reconsider the original diagnosis. Again, clinical history was omitted.Only the results of the first round are provided in this study, in which the investigators judged the cases alone, according to their knowledge. Our goal was to avoid the influence of specific questions . In contrast, the second round was added to specifically evaluate if guidance would help.The statistical evaluation of the collected data was carried out with the help of \u201cMicrosoft Excel\u201d and the university\u2019s own statistics program \u201cBias.\u201d We were supported by the Institute for Biostatistics and Mathematical Modelling of Frankfurt University Hospital.To determine the role of an MRI examination in cases of pAHT, the sensitivities and positive predictive value were determined individually for each examiner and the respective mean values for the groups of examiners. The results were then compared. The basis for the calculation was the answers from the first assessment round. To determine whether the results improved by presenting a structured answer sheet, we compared the sensitivities and positive predictive values of the first and second assessments.We determined the consistency of the assessment within the two groups of examiners by determining Fleiss\u2019 kappa coefficient for both groups of examiners. Here, the answers of the first assessment were relevant, in which the investigators judged the cases alone and had to determine the most probable diagnosis.We also assessed patients individually and described specifically which cases misjudgments most commonly occurred.One hundred twenty questionnaires were evaluated in both the first and second rounds.Neuroradiologists showed a strong agreement in their case assessments Graphic  and moreThe 3 neuroradiologists chose correctly pAHT as the most probable diagnosis in 16 out of 18 times. One case of pAHT with impact . Results deteriorated even further after detailed guidance of possible MRI findings was provided. Presumed AHT was assessed as NAHT seven times and twice as a metabolic disease.Overall, neuroradiologists were blindly able to determine whether a pAHT was present or if it could be excluded Graphics  and 2 moThe sensitivity in the diagnosis of pAHT, i.e., correctly choosing pAHT as the most probable diagnosis, was 89% for neuroradiologists and 50% for non-neuroradiologists. Results for positive predictive value, i.e., the probability of patients who have a positive MRI result actually fitting the hypothesis pAHT, were identical to the results for sensitivity.It was more difficult for non-neuroradiologists to diagnosis pAHT in children who presented with SDH but no parenchymal injury. In comparison, neuroradiologists reliably chose correctly pAHT as the most probable diagnosis in patients with SDH but without parenchymal injury; they correctly recognized the retinal bleeding and detected bridging vein injury associated with the SDH. None of the non-neuroradiologists recognized or suspected retinal bleeding.In two cases, pAHT presented with brain edema. These cases were more often misdiagnosed. One case  pAHT.In 3 patients  and one who suffered a fall from a low height (NAHT5), pAHT was ruled out by all investigators.In all cases of metabolic diseases, the 3 neuroradiologists were able to correctly rule out pAHT. The non-neuroradiologists correctly ruled out pAHT in 8 out of 9 case assessments. In 1 case , pAHT was wrongly assumed to be the most probable diagnosis. All other investigators were able to assign this case to a metabolic genesis.All neuroradiologists assessed myelination as delayed in patients with metabolic diseases. Remarkably, the 2 non-neuroradiologists who correctly suspected metabolic disease did not detect any disturbance of myelination.Neuroradiologists correctly ruled out pAHT in all cases of BESS. Non-neuroradiologists ruled out pAHT correctly in 14 out of 18 evaluations. In 3 case assessments, pAHT was wrongly assumed to be the most probable diagnosis and in 1 evaluation pAHT could not be ruled out. One case with a widening of the external cerebrospinal fluid spaces and associated unilateral SDH proved to be, as expected, difficult for non-neuroradiologists Fig. .Legal cases of AHT have become more complex during the last 20 years . GuideliThe radiologist who analyzes the brain MRI performed after pAHT plays a key role in its diagnosis and differential diagnosis. Neuroradiologists, who are routinely exposed to pediatric cases, have learned after years of training to analyze the pediatric brain MR images systematically and to interpret all findings. This perception is different in a non-neuroradiologist without advanced neuroradiology training.Our series showed that, blindly, it was only possible to distinguish pAHT from other differential diagnoses with high confidence (sensitivity of 88.89%) if the assessment of brain MRI images was carried out by a neuroradiologist with experience in neuropediatrics. This result is of particular interest in cases of unwitnessed abuse, where the brain MRI can provide crucial information with which to initiate further diagnostics. In this study, we deliberately avoided providing information about the clinical situation of the patients to the evaluator.The level of experience of radiologists plays an especially important role when pAHT does not present itself with bilateral SDH, which is the most frequent intracranial lesion in patients with AHT . Non-neuWhen compared with non-neuroradiologists, neuroradiologists based their decisions on different imaging aspects and not only on the presence or absence of SDH. They were therefore able to differentiate the cases more precisely. Even if SDHs were present, a pAHT could be excluded.The presence of parenchymal brain injury in patients with AHT is the most significant cause of morbidity and mortality . ContusiRetinal bleeding is classically associated with AHT, but also it has other causes, such as accidental trauma. In cases of NAHT, the retina shows fewer bleeding (except in cases of severe trauma), which is usually limited to the posterior pole . It is eIn our data, severe NAHT was more likely to be mistaken for pAHT. It is important to emphasize that only the cases of severe MVA with bilateral SDHs , which is the common misleading history provided by caregivers.Neuroradiologists blindly detected 16 out of 18 evaluations of pAHT, and all cases of pAHT were correctly detected blindly by at least 2 of the 3 neuroradiologists. Furthermore, the neuroradiologists also succeeded in identifying cases of pAHT in which no or only minor SDHs were present. They were able to detect retinal bleeding more precisely in the MRI and interpret it correctly.In contrast, non-neuroradiologists chose correctly pAHT as the most probable diagnosis only in 50% of the pAHT case assessments correctly . In 7 evaluations, pAHT was interpreted as NAHT and twice as a metabolic disease. The second round, where we tried to improve the results with specific questions such as asking about retinal bleeding, resulted in even worse results for the non-neuroradiologist group. This could be explained by the fact that compared with neuroradiologists, non-neuroradiologists are rarely exposed to such specific images, and combining specific findings into a coherent, organized way of diagnosing pAHT, is difficult.In cases of pAHT, neuroradiologists more often suspected or detected retinal bleeding. This shows that a higher degree of experience is required to detect retinal bleeding in MRI. Teixeira et al.  showed tCerebral edema can result from abusive and non-abusive trauma or from other nontraumatic causes such as meningitis or encephalitis (infections were not included). Specifically, due to the limited cerebral autoregulation, AHT is often associated with hypoxia and brain edema . This is in agreement with the previous literature , 19\u201325. In our sample, as to be expected under blind conditions, the correct recognition of a brain fracture misled the diagnosis. One patient . In these cases, the injuries and MRI findings are proportional to the height. Couches, for example, have been blamed for injuries. The reality is that children almost never die in falls from low heights and they rarely even suffer serious injuries. The specific case of a fall from a height of 0.5 m (case \u201cNAHT5\u201d) was identified as NAHT by all examiners, who recognized the presence of soft tissue swelling and assigned the case as accidental injury.In an extensive review of the literature, Choudhary et al.  showed tAnother important differential diagnosis is birth traumatic injury (\u201cNAHT4\u201d). In this case, all neuroradiologists and non-neuroradiologists were able to rule out the possibility of a pAHT and correctly assumed an accidental genesis. Hemorrhage can occur after vaginal delivery or cesarean and presents as an asymptomatic thin subdural or intradural collection (< 3 mm) located posteriorly. It resolves within a month to 6 weeks and does not appear to rebleed . The SDHIt is important to emphasize the radiological distinction between pAHT and NAHT. The accidental trauma presents with extra-axial hemorrhages close to the site of injury with soft tissue swelling. An epidural hematoma happens more often in cases of NAHT, but it does not rule out pAHT; in children, it is often caused by a direct traumatic violent effect. In contrast to adults, epidural hemorrhage in children is predominantly of venous origin, mostly due to injury of the sinus or the diploic veins in children with skull fractures , 28. In In contrast, SDH in children with AHT is usually multifocal, typically along the posterior interhemispheric fissure, close to the vertex, due to the rupture of the bridging veins Fig.  and 4.FiSubarachnoid, intraparenchymal, and intraventricular hemorrhage are non-specific and occur equally in AHT and NAHT , 22\u201325.The presence of ruptured bridging veins is not pathognomonic for AHT, but its presence supports a traumatic cause for the SDH . TypicalThe second most common misdiagnosis within the pAHT group was a metabolic disease (2 out 18 case assessments of pAHT in the first round by non-neuroradiologists but none by neuroradiologists).Our raters had no access to clinical information or to the head circumference, both of which play an important role in the differential diagnosis . An acutThe neuroradiologists paid attention to the myelination stage, while none of the non-neuroradiologists did. In addition, the neuroradiologists were aware that infants with metabolic disease, such as glutaric aciduria type I (GA1), are predisposed to develop SDH. The relatively high estimated incidence of SDH (20\u201330%)  in childThe evaluation of normal myelination is important. In this pilot project, no metabolic disease or BESS was misdiagnosed as pAHT by neuroradiologists. BESS is a common finding in imaging studies indicated by macrocephaly in infancy and the recognition thereof is important. No misdiagnosis was made by neuroradiologists. In comparison, non-neuroradiologists had difficulties in correctly ruling out pAHT in cases of BESS, especially when it was associated with SDH.Differentiating between SDHs and enlargement of the subarachnoid spaces is one of the most important responsibilities when interpreting brain imaging in infants. The distinguishing feature by which BESS and SDH can be differentiated is the location of the bridge veins Fig.  9]. In . In 9]. It is questionable if BESS predisposes SDH. According to a recent review , only arIt appears that non-neuroradiologists assess whether or not a pAHT is present mostly depending on \u201cthe presence of subdural hematomas.\u201d The presence or suspicion of retinal bleeding played a minor or no role in the evaluation of the non-neuroradiologists.Neuroradiologists as a rule looked beyond SDH and were consequently more precise in assessing pAHT and its differential diagnosis than non-neuroradiologists. Basically, neuroradiologists with pediatric expertise make the diagnosis of pAHT not only based on the \u201ctriad\u201d  but also on other findings, such as ruptured and thrombosed cortical veins, the presence of SDHs in different locations, and age and/or parenchymal injuries with different ages. In addition, they routinely evaluate myelination. All neuroradiologists were able to rule out all cases of birth trauma, a fall from a low height, BESS, and metabolic diseases.In cases of traffic accidents and NAHT, the differential diagnosis with pAHT was, blindly, particularly difficult, even for neuroradiologists, due to the differential diagnosis with pAHT associated with impact. But after a MVA, medical history would not give any room for such misdiagnosis.Despite extensive literature in neuroimaging of AHT, the early presumption of AHT remains a challenge not only for non-neuroradiologists but also for neuroradiologists. The final diagnosis of presumptive AHT can never be based only on radiological findings and should never be based on a single injury. Presumptive AHT should be viewed as a combination of all imaging findings, including extracranial injuries, in the overall clinical context. Other diseases which cause similar brain MRI findings should be ruled out. In addition, the diagnosis should be made inter-disciplinary, based on medical, forensic, and social investigation.The results of our study should be viewed critically due to the large confidence intervals. It was a pilot project and can be used as the basis for future data collection in a multicenter prospective study."}
{"text": "Silver-Russell syndrome (SRS) is a representative ID in SGA-SS and has heterogenous (epi)genetic causes.To clarify the contribution of IDs to SGA-SS and the molecular and phenotypic spectrum of SRS, we recruited 269 patients with SGA-SS, consisting of 103 and 166 patients referred to us for genetic testing for SGA-SS and SRS, respectively. After excluding 20 patients with structural abnormalities detected by comparative genomic hybridization analysis using catalog array, 249 patients were classified into 3 subgroups based on the Netchine-Harbison clinical scoring system (NH-CSS), SRS diagnostic criteria. We screened various IDs by methylation analysis for differentially methylated regions (DMRs) related to known IDs. We also performed clinical analysis.H19/IGF2:intergenic-DMR and uniparental disomy chromosome 7, being major genetic causes of SRS, was detected in 30.4% of patients in the \u201cSRS-compatible group\u201d and in 13.8% of patients in the \u201cnon-SRS group.\u201dThese 249 patients with SGA-SS were classified into the \u201cSRS-compatible group\u201d (n = 148), the \u201cnon-SRS with normocephaly or relative macrocephaly at birth group\u201d (non-SRS group) (n = 94), or the \u201cnon-SRS with relative microcephaly at birth group\u201d  (n = 7). The 44.6% of patients in the \u201cSRS-compatible group,\u201d 21.3% of patients in the \u201cnon-SRS group,\u201d and 14.3% in the \u201cnon-SRS with microcephaly group\u201d had various IDs. Loss of methylation of the We clarified the contribution of IDs as (epi)genetic causes of SGA-SS and the molecular and phenotypic spectrum of SRS. Various IDs constitute underlying factors for SGA-SS, including SRS. Approximately 10% of babies born small-for-gestational-age (SGA), a condition for babies with birth weight (BW) and/or birth length (BL) less than those expected for the gestational age and sex, do not have catch-up growth until 2 years of age . The cau(Epi)genetic disorders causing SGA-SS include genetic syndromes caused by defects in genes associated with human growth, imprinting disorders (IDs), and pathogenic copy number variants (PCNVs). Among them, IDs are caused by abnormal gene expression of the imprinted genes. Imprinted genes are expressed in a parental-origin-specific manner and are associated with fetal and placental growth . ParentaH19/IGF2:intergenic (IG)-DMR (H19LOM) and maternal uniparental disomy chromosome 7 (UPD(7)mat) (H19LOM and UPD(7)mat did not satisfy NH-CSS criteria, and were diagnosed as SGA-SS (H19LOM and UPD(7)mat met NH-CSS criteria and were diagnosed as SRS  is the clinical diagnostic criteria for SRS having the most sensitive and the highest negative predictive value . A conseD(7)mat) ; howevers SGA-SS . Moreoved as SRS , 14.Previous work has examined the contribution of IDs to SGA-SS; however, the number of patients involved was not so large, and clinical assessment using clinical diagnostic criteria for SRS was not performed . To clarThis study was approved by the Institutional Review Board Committee at the National Center for Child Health and Development and performed after obtaining written informed consent from patients or patients\u2019 parents to participate in this study and for publication of the clinical and molecular information.From 2002 to 2019 we recruited 220 patients referred to us for investigation for SGA-SS and 431 patients referred to us for genetic testing for SRS . Among thttp://dgv.tcag.ca/dgv/app/home) and previous reports. Eventually, when CNVs were detected in our study involved in the regions causing known microdeletion or microduplication syndromes, we defined those CNVs as PCNVs. Next, to detect IDs, we performed methylation analysis with pyrosequencing for 9 DMRs related to known IDs, namely, the H19/IGF2:IG-DMR on chromosome 11, PEG10:transcription start site (TSS)-DMR and MEST:alt-TSS-DMR on chromosome 7, PLAGL1:alt-TSS-DMR on chromosome 6, KCNQ1OT1:TSS-DMR chromosome 11, MEG3/DLK1:IG-DMR and MEG3:TSS-DMR on chromosome 14, SNURF:TSS-DMR on chromosome 15, and GNAS-A/B:TSS-DMR on chromosome 20, as previously reported mat (H19LOM and UPD(7)mat, such as TS14, PWS, UPD(6)mat, UPD(16)mat, and UPD(20)mat, we conducted structural analysis to detect micro-deletions and/or duplications involving the imprinted regions. For structural analysis, we used methylation-specific multiplex ligation-dependent probe amplification  analysis for each imprinted region  and/or aCGH analysis using custom built array  and/or genome-wide comparative genomic hybridization and single-nucleotide polymorphism array , according to the manufacturer\u2019s instructions. For patients with abnormal methylation levels of the DMRs related to known IDs other than H19LOM and UPD(7)mat, but not structural abnormalities, we carried out microsatellite analysis for chromosomes 6  to detect PCNVs. To access the PCNVs, we found copy number variants (CNV) that had 3 or more continuous probes with aberrant signals. Then we evaluated whether these CNVs were pathogenic or not by referring to the Database of Genomic Variants http://dgH19LOM and UPD(7)mat, which are major genetic causes of SRS, were detected in 58 patients (23.3%), and IDs other than H19LOM and UPD(7)mat were in 29 patients (11.6%). Twenty patients with IDs other than H19LOM and UPD(7)mat were previously reported (see H19LOM and UPD(7)mat were identified in 30.4%, 13.8%, and none of patients in the SRS-compatible group, the non-SRS group, and the non-SRS with microcephaly group, respectively. IDs other than H19LOM and UPD(7)mat were identified in 14.2% of patients in the SRS-compatible group, in 7.4% of patients in the non-SRS group, and in 14.3% of patients in the non-SRS with microcephaly group. Particularly, 8 patients with TS14 were included in the SRS-compatible group. The non-SRS with microcephaly group had the lowest detection rate (14.3%) for IDs in patients.The results of molecular analyses are summarized in rted see   showed mild hypomethylation of the MEG3/DLK1:IG-DMR and MEG3:TSS-DMR besides H19LOM. Patient 2 with MLID (MLID 2) showed mild hypomethylation of the GNAS-A/B:TSS-DMR besides H19LOM. Patient 3 with MLID (MLID 3) showed mild H19LOM besides hypomethylation of the MEG3:TSS-DMR, as previously reported (Three patients (3.4%) of 87 patients with various IDs had MLID. Two patients showed obvious reported . A singlH19LOM, UPD(7)mat, IDs other than H19LOM and UPD(7)mat, and unknown etiology are summarized in H19LOM and UPD(7)mat, and 20 patients with IDs other than H19LOM and UPD(7)mat had clinically suspected SRS. Clinical manifestations in patients with each etiology are summarized in H19LOM and UPD(7)mat showed that patients with H19LOM had typical SRS phenotypes, such as severe prenatal and postnatal growth failure and higher frequency of the remaining clinical features in NH-CSS. BOFC of patients with H19LOM were more preserved than those of patients with other etiologies. Patients with UPD(7)mat showed less serious prenatal growth failure compared to patients with H19LOM, showed severe postnatal growth failure similar to patients with H19LOM, and had a high frequency of relative macrocephaly at birth (H19LOM and UPD(7)mat showed feeding difficulties and/or low BMI in over 70%. Of clinical features frequently observed in SRS patients, triangular face was observed in approximately 90% of patients with H19LOM and in 70% of patients with UPD(7)mat. Fifth finger clinodactyly was detected in more than 70% of patients with H19LOM and in about 45% of patients with IDs other than H19LOM and UPD(7)mat. Muscular hypotonia was observed at relatively high frequency in patients with IDs other than H19LOM and UPD(7)mat, compared to those with other etiologies. Speech delay was detected in 40% and 58.6% of patients with UPD(7)mat and IDs other than H19LOM and UPD(7)mat, respectively. Congenital heart diseases (CHDs) were observed in 16% of patients with IDs other than H19LOM and UPD(7)mat. Genitourinary anomalies were observed in approximately 30% of patients with H19LOM.Clinical data for each subgroup in patients with at birth . PatientAll 3 patients with MLID were classified into the SRS-compatible group. Thus, the frequency of MLID was 2.0% of patients in the SRS-compatible group and 4.5% of patients with various IDs in the SRS-compatible group. MLID 1 had 5 NH-CSS items other than body asymmetry, and also showed triangular face, fifth finger clinodactyly, cryptorchidism, hypospadias, and pelvic bone defect. His BW, BL, and present height were \u22124.2, \u22123.8, and \u22125.8 SDS, respectively. MLID 2 had 5 NH-CSS items other than feeding difficulties together with fifth finger clinodactyly. Her BW, BL, and present height were \u22123.5, \u22123.4, and \u22123.3 SDS, respectively. Clinical features of MLID 3 have been reported previously . In brieH19LOM and UPD(7)mat in H19LOM and UPD(7)mat, was diagnosed in 6 patients with maternal uniparental disomy chromosome 14 and 5 patients with epimutation at the 14q32.2 imprinted region. Eight patients with TS14 were classified into the SRS-compatible group. The etiology with the second largest number of patients was UPD(20)mat. All patients with UPD(20)mat were classified into the SRS-compatible group and the non-SRS group. UPD(6)mat, PWS, and UPD(16)mat were detected in several patients. In addition to chromosomal abnormalities involving the imprinted region, parthenogenesis was identified in a single patient. Muscular hypotonia was observed in all patients with PWS, and about half of patients with TS14, UPD(20)mat, 11p15 maternal duplication, and UPD(16)mat. Speech delay was observed in all patients with PWS and 11p15 maternal duplication, and in about half of patients with TS14, UPD(20)mat, and UPD(16)mat. Genitourinary anomalies were frequently identified in UPD(6)mat, PWS, and UPD(16)mat.We summarized clinical features of 29 patients with IDs other than H19LOM and UPD(7)mat. These results suggest that H19LOM and UPD(7)mat do not contribute to the development of SGA-SS with relative microcephaly. The frequency of H19LOM and UPD(7)mat in the SRS-compatible group in our study was lower than those (76.7%) in a previous study, which examined 60 patients with 4 or more NH-CSS items (H19LOM and UPD(7)mat were detected in 14.2% of patients in the SRS-compatible group, in 7.4% of patients in the non-SRS group, and 14.3% of patients in the non-SRS with microcephaly group. Particularly, TS14 and UPD(20)mat were detected in at least 5 patients. A previous study reported the results of methylation analysis for 11 imprinted loci  in 79 patients with growth restriction who were classified into 4 clinical referral categories, namely, SRS, intrauterine growth restriction (IUGR), short stature (SS), and IUGR and SS mat, IDs other than H19LOM and UPD(7)mat, and unknown etiology produced several notable clinical findings. First, 21 patients satisfying NH-CSS had etiologies other than H19LOM and UPD(7)mat, and meanwhile, 13 patients with H19LOM and UPD(7)mat did not satisfy NH-CSS. Consistent with this, Azzi et al reported a single patient with UPD(7)mat who did not satisfy NH-CSS (H19LOM and UPD(7)mat carriers do not always show the unambiguous SRS phenotype (H19LOM and UPD(7)mat having SGA-SS without typical SRS phenotype, some other factors such as environmental, maternal, paternal, placental, and other genetic factors may affect their phenotypes. Second, most patients with H19LOM, two-thirds of patients with UPD(7)mat, and two-thirds of patients patients with IDs other than H19LOM and UPD(7)mat satisfied NH-CSS. Patients with H19LOM showed the most severe prenatal and postnatal growth failure. In addition, relative macrocephaly, protruding forehead, and body asymmetry were frequently detected in patients with H19LOM. Patients with UPD(7)mat had heavier BW and taller BL than patients with H19LOM; however, patients with UPD(7)mat showed severe postnatal growth failure as well as those with H19LOM. Furthermore, 90% of patients with UPD(7)mat had relative macrocephaly, whereas only 9% had body asymmetry. These results indicate the differences in clinical features related to NH-CSS between patients with H19LOM and patients with UPD(7)mat, as previously reported (H19LOM and UPD(7)mat. This is probably because patients with TS14 and PWS, who have muscular hypotonia with high frequency (H19LOM and UPD(7)mat. Speech delay was observed in higher frequency in patients with UPD(7)mat, and those with IDs other than H19LOM and UPD(7)mat, than in those with H19LOM. In this regard, abnormal gene expression of FOXP2 on chromosome 7 associated with language development and dysfunction of the genes related to language development caused by IDs may lead to speech delay (H19LOM and UPD(7)mat. Previous studies also showed that some DNA methylation abnormalities were associated with CHD (H19LOM and UPD(7)mat. Genitourinary anomalies were observed in about 30% of patients with H19LOM. Several studies have reported that male genitourinary anomalies were frequently identified in SRS . IUGR has been reported as one of the most common features of UPD(6)mat; however, it is unknown whether SS and the remaining NH-CSS items are common features or not due to lack of clinical information about patients with UPD(6)mat mat mosaic or 11p15 maternal duplication showed SRS phenotype as well as previous reports . UPD(11)feration , 33, andwith SRS . Over 70with SRS . On the PD(6)mat . In our PD(6)mat , 38. FurIn our study, the frequency of MLID was 3.4% in the patients with various IDs, and 4.5% in patients with various IDs classified into the SRS-compatible group. Recently, Eggermann et al reported that the frequency of MLID was 3.6% in SRS patients with aberrant findings . These fThis study has some limitations. First, because our laboratory is one of the largest facilities that can perform genetic analyses of SRS in Japan, some selection bias for recruiting patients may occur, that is, patients with SGA-SS clinically diagnosed by attending physicians have some aspect of SRS phenotype. Second, many patients included in our study were preschool children under 3 years old. It is possible that developmental delay and characteristic features of each etiology were unclear at the time of examination. Lastly, we did not perform mutation screening of genes that cause genetic syndromes leading to SGA-SS. Patients with unknown etiology in our study may have had gene mutations of genetic syndromes resulting in SGA-SS.In conclusion, we clarified the contribution of IDs to SGA-SS. This study also showed broad molecular and phenotypic spectrums of SRS. Various IDs constitute underlying factors for SGA-SS, including SRS."}
{"text": "In recent years, several trials of breast cancer treatment have failed to demonstrate a survival benefit for some previously routine surgical therapies in selected patient groups. As each of these therapeutic approaches has been deemed of low value deimplementation has varied significantly. This demonstrates that effective de-escalation in breast cancer surgery relies on more than the availability of data from randomized controlled trials and other high-quality evidence, but is also influenced by various stakeholders, social expectations, and environmental contexts. Current national recommendations for surgical de-escalation in breast cancer care include the avoidance of completion axillary lymph node dissection (ALND) in patients with micrometastases or macrometastases in 1 or 2 sentinel nodes, re-excisions for close but negative surgical margins after partial mastectomy, contralateral prophylactic mastectomy in women with average-risk unilateral breast cancer, and sentinel lymph node biopsy (SLNB) in patients aged >70 years with early-stage hormone receptor\u2013positive (HR\u2009+\u2009) cancer  after neoadjuvant chemotherapy, and areas under study such as the omission of surgery altogether in selected women with DCIS or in women with clinical complete responses to chemotherapy. As each of these therapeutic approaches can be considered low value , their effective deimplementation remains influenced by various stakeholders, social expectations, and environmental contexts. By examining these deimplementation processes, we can identify factors contributing to the persistent use of low-value services and can leverage this knowledge to design strategies to reduce or eliminate them.Over last 20 years, a growing number of trials of breast cancer treatment demonstrate equivalent survival outcomes when some previously routine therapies, such as axillary dissection and radiotherapy, are omitted in selected patient groups. These findings have led to recommendations for surgical de-escalation by various multidisciplinary oncology groups5.Surgical procedures incurring costs and possible harms for patients without contributing to improved oncologic or survival outcomes are designated as low value. Harms extend beyond potential short-term surgical complications from the intervention itself to include potential downstream dangerous care cascades , increased travel burdens for patients and their families, financial toxicity through direct costs and patient-time costs to undergo treatments rather than earn income, and excess health care utilization and spending that may be more appropriately reallocated to high-value services6. Third, breast cancer care is largely decentralized from academic medical centers and is provided in the community, requiring systematic and complete dissemination of de-escalation recommendations. Finally, as breast cancer treatment is inherently multidisciplinary, effective de-escalation of low-value surgery requires the support and coordination of the entire treatment team.The management of early-stage breast cancer is ideal for understanding and improving efforts to de-escalate low-value treatments. First, breast cancer is common and well-studied, with many high-quality randomized controlled trials supporting guidelines for de-escalation. Second, broad uptake of screening mammography has resulted in a large cohort of patients with early-stage, highly curable disease who are at risk for overtreatmenthttps://www.choosingwisely.org). Choosing Wisely is an international campaign, initiated by the American Board of Internal Medicine Foundation, that has engaged more than 80 specialty organizations to issue 550-plus recommendations to avoid certain low-value tests or treatments. These guidelines are intended to inform consultations between physicians and patients to facilitate delivery of care that is supported by evidence and is both essential and appropriate. Prominent breast surgical oncology groups, including the Society of Surgical Oncology (SSO), the American Society of Breast Surgeons, and the American College of Surgeons, participate in the campaign and have identified numerous low-value practices. The recommendations specific to low-value breast surgical practices were first issued in 2016 and were updated in 2020; the trials that supported de-escalation and resulted in some practice changes preceded these dates.The most broadly disseminated form of value assessment in breast cancer surgery has come from the Choosing Wisely campaign  in women with average-risk unilateral breast cancer and SLNB in women aged >70 years with HR\u2009+\u2009, HER2-negative early-stage breast cancer20. Despite publication of these findings in 2013 and the subsequent recommendation in 2016 to avoid SLNB in patients aged >70 years with HR\u2009+\u2009breast cancer, the rate of use of this low-value procedure has remained relatively stable: 88% in 2013 and 87% in 20167. Qualitative evaluation of patients and providers revealed skepticism regarding supporting data, uncertainty about broad application of age-specific cutoffs, and perceptions that SLNB results in minimal morbidity as justifications for the continued use of SLNB. For example, patients and providers often dispute set age cutoffs in favor of assessment of an individual patient\u2019s physiology. Finally, similar to the reasons underlying the continued use of CPM, the continued use of SLNB has been justified in terms of promoting patient peace of mind and allowing the determination of nodal involvement to confirm cancer staging21.A similar pattern has been observed for SLNB in older women with early-stage HR\u2009+\u2009cancer. Among patients in CALGB 9343, which randomized women aged >70 years with HR\u2009+\u2009clinical stage I breast cancer to tamoxifen plus radiation therapy or tamoxifen alone after lumpectomy, radiation therapy conferred a small benefit in the rate of locoregional recurrence but did not result in longer overall survival. Furthermore, there was no difference in survival was identified in patients who did and did not undergo axillary evaluation at the time of surgical excision. In long term follow up of the CALGB 9343 cohort, a 3% increase in axillary recurrence was noted in those who did not undergo radiation therapy or SLNB. Importantly, the result of SLNB in this cohort is unlikely to impact systemic therapy choice22. This has allowed for omission of ALND in node positive patients who downstage after neoadjuvant chemotherapy. Additionally, in node positive patients undergoing neoadjuvant chemotherapy, the clipping of positive nodes to allow for their removal at the time of surgery when they are not sentinel nodes has been demonstrated to further reduce the false negative rate in retrospective studies23. These approaches allow avoidance of ALND in 50\u201380% of node positive patients with triple negative and HER2 positive cancers24.In addition to the guideline alterations and shifts in practice described above, there are other emerging areas of surgical de-escalation that have impacted the surgical care of patients with breast cancer. For example, in node positive patients undergoing neoadjuvant chemotherapy, sentinel lymph node biopsy had been demonstrated to be a reliable method of assessment of axillary disease burden when dual tracer was utilized and three or more sentinel nodes are identified, with a false negative rate of <10%25. To uniformly and sustainably reduce the use of low-value practices, avoid overtreatment, and deliver the highest-quality evidence-driven care, deimplementation in breast cancer surgery will require strategies specifically targeted at the patient, physician, and society levels. These strategies may differ from those commonly used to reduce the use of low-value diagnostic testing or medications, such as ordering or formulary restrictions or market withdrawal.The differing outcomes among deimplementation efforts across four low-value breast surgical practices is a clear demonstration that effective de-escalation in breast cancer surgery relies on more than the availability of data from randomized controlled trials and other high-quality evidence. With substantial differences in the contexts of breast cancer care delivery and the strong emphasis on patient autonomy in decision-making, breast cancer surgery practices remain influenced by social, economic, and other factors that may affect deimplementation initiatives26. Additionally, even when patients report being aware of a lack of survival advantage in opting for more invasive surgery, patients still cite desire to extend their life as key to their decision making27.Deimplementation in breast cancer surgery should account for patients\u2019 fears and, often, misperceptions of the risks of cancer recurrence, which can lead to patients being inclined to undergo more-invasive surgical interventions. For example, patients and their advocates may have concerns other than overall survival, such as fear of local recurrence or the desire to have peace of mind with their surgical decision. In these scenarios, patients may opt for treatments that do not necessarily convey a survival advantage but rather lead to reduced rates of local recurrence or contralateral breast cancer29. Patients considering more invasive surgical options may be best served by the use of patient education tools that emphasize communication of risks and introduce literature reporting on long term quality of life when comparing surgical interventions with comparable oncologic outcome. These efforts may help patients balance their desire for an overall excellent prognosis and low risk of recurrence with the potential costs and harms of overtreatment.Initial surgical treatment decisions may not fully consider the long-term harms or be able to anticipate potential decisional regret of choosing more invasive surgical treatment for breast cancer. For example, in consideration of contralateral prophylactic mastectomy in patients with nonhereditary breast cancer, patients often aim to reduce anxiety of recurrence through more invasive surgery, but may not actually benefit from reduced recurrence fear and may experience worse body image and quality of life following surgery21. Such clinicians may benefit from exposure to data, beyond the results of randomized controlled trials, focusing on the interaction of patient satisfaction and psychological outcomes after surgery. In addition to educational interventions, clinician-level strategies  may play a role in future deimplementation efforts in breast cancer surgery. On a broader scale, payment reform or a transition to value-based insurance may further influence decision-making in breast cancer surgery and promote the deimplementation of low-value practices. For example, payers may opt to incentivize facilities with high levels of appropriateness per current recommendations or implement value-based payment designs where low-value treatments may incur greater out of pocket costs to patients. Additionally, accreditation measures may have greater emphasis on appropriateness of care with collecting and reporting of data related to low-value practices.Clinicians often overestimate the benefits of procedures, underestimate the potential harms or costs of unnecessary intervention, and do not consider or misinterpret their patients\u2019 values or desiresImportantly, de-escalation of breast cancer surgery must be conducted and monitored in the context of multidisciplinary care. As surgical practices are de-implemented, there may be a tendency toward escalation of adjuvant therapies. Specifically, in cases of uncertain nodal involvement when criteria for omission of SLNB was met, radiation may be more frequently offered or genomic assays more often used. These challenges in coordination between multidisciplinary care team members will be inherent in the changing landscape of breast cancer care and collaboration essential in order to resist unnecessary and potentially harmful care.32. However, the criteria for omission of surgery will likely spare only a minority of patients from undergoing excision, and the additional cost in terms of biopsies and surveillance and potentially increased anxiety may counteract any potential benefits of surgical de-escalation33. The presence of nonoperative trials signals that breast surgical oncologists will continue to be challenged to respond to the growing body of data, which may result in recommendations for even less surgery for patients with breast cancer.As the trend for less-intensive surgical interventions for breast cancer continues, the need for deimplementation will persist. Investigators are currently evaluating the safety of omitting surgery in the context of a complete clinical response to neoadjuvant therapy for invasive cancer, as well as the safety of omitting surgery from the management of patients with ductal carcinoma in situ34.Beyond interpreting the evidence from trials, the ability to successfully deimplement low-value breast cancer surgery will require an ability to adapt to new evidence, understand what is meaningful value for patients, and consider the interests and needs of all stakeholdersFurther information on research design is available in the Reporting Summary Checklist"}
{"text": "Xenopus and mouse embryos, we establish molecular links between Tbx5 and retinoic acid (RA) signaling in the mesoderm and between RA signaling and sonic hedgehog expression in the endoderm to unveil a conserved RA-Hedgehog-Wnt signaling cascade coordinating cardiopulmonary (CP) development. We demonstrate that Tbx5 directly maintains expression of aldh1a2, the RA-synthesizing enzyme, in the foregut lateral plate mesoderm via an evolutionarily conserved intronic enhancer. Tbx5 promotes posterior second heart field identity in a positive feedback loop with RA, antagonizing a Fgf8-Cyp regulatory module to restrict FGF activity to the anterior. We find that Tbx5/Aldh1a2-dependent RA signaling directly activates shh transcription in the adjacent foregut endoderm through a conserved MACS1 enhancer. Hedgehog signaling coordinates with Tbx5 in the mesoderm to activate expression of wnt2/2b, which induces pulmonary fate in the foregut endoderm. These results provide mechanistic insight into the interrelationship between heart and lung development informing CP evolution and birth defects.The gene regulatory networks that coordinate the development of the cardiac and pulmonary systems are essential for terrestrial life but poorly understood. The T-box transcription factor Tbx5 is critical for both pulmonary specification and heart development, but how these activities are mechanistically integrated remains unclear. Here using  Proper integration of the cardiac and pulmonary systems begins during early embryogenesis and is essential for terrestrial life. A key feature of cardiopulmonary (CP) development is evolutionarily conserved bi-directional paracrine signaling between the foregut endoderm, which gives rise to pulmonary epithelium, and the cardiogenic mesoderm . The intFgf8, Fgf10, and Tbx1 and generates the right ventricle, portions of the outflow tract, and pharyngeal mesoderm  that give rise to lung mesenchyme, pulmonary vasculature, and myocardium of the inflow tract , termed the first and second heart fields, respectively  signaling is a strong candidate for the Tbx5-dependent signal that activates endodermal  foregut  and mani foregut . RA, a d foregut . Aldh1a2SHF fate . How theShh expression. We further define the molecular basis by which Tbx5 drives RA signaling and by which RA signaling drives Shh expression. Specifically, Tbx5 directly maintains expression of Aldh1a2 in pSHF via an evolutionarily conserved intronic enhancer, and Tbx5/Aldh1a2-dependent RA signaling directly activates Shh transcription in the foregut endoderm via an evolutionarily conserved MACS1 endoderm enhancer. We conclude that Tbx5 coordinates CP development by controlling expression of the RA-producing enzyme Aldh1a2, and that this RA signal initiates a mesenchyme-epithelial signaling cascade that controls both Hh/Wnt-dependent lung induction and SHF patterning. Hh/Gli and Tbx5 then cooperate to promote Wnt2/2b expression and lung induction. This work unifies previously unconnected observations to resolve the molecular basis of a mesoderm-endoderm-mesoderm signaling network that coordinates pulmonary induction and SHF cardiac patterning.In this study, we demonstrate that RA signaling is the link between mesodermal Tbx5 activity and endodermal \u2212/Tbx5\u2212 mouse embryos at E9.5 (Tbx5 (\u22651.5 fold change and 5% FDR) , Hh-targets (Hhip and Gli1), the lung-inducing Wnt2/2b ligands, and pulmonary progenitor marker Nkx2-1, indicated a loss of pulmonary fate in \u2212/Tbx5\u2212 mutant CPP tissue    micro-dissected from wild-type (WT) and  at E9.5 . Differe 5% FDR) . ReducedP tissue . We examor cells . We founst, HGT) . On the 01, HGT) . The aSHnd Dusp6 . Gene seP tissue . Thus, T reports .\u2212/Tbx5\u2212 CP tissue, including Aldh1a2, Crabp2, which promotes nuclear shuttling of RA, and Rbp1, a cytosolic chaperone of the RA precursor retinol  in Xenopus, either by CRISPR/CAS9-mediated mutation or morpholino (MO) knockdown, phenocopies the mouse \u2212/Tbx5\u2212 phenotype with severe cardiac hypoplasia, a failure to induce Nkx2-1+ lung progenitors and the foregut tube fails to separate into distinct trachea and esophagus  (Tg(WntRE:dGFP)   . Quantifse E9.5) . AnalysiRE:dGFP) , confirmRE:dGFP) . Importaelopment . A time s (NF15) . These r\u2212/Tbx5\u2212 CP tissue were also misregulated in Xenopus  into cardiac fate  inducible iac fate  was suff0 levels . Howeveraldh1a2 transcription in Xenopus. We injected RNA encoding a dexamethasone (DEX) inducible Glucocorticoid receptor (GR)-Tbx5 fusion protein  to block secondary protein synthesis  and 60% reduction (p=0.0031) of the mouse and frog reporter activity in the foregut respectively, and also significantly blunted their response to ectopic Tbx5 in the hindgut (Aldh1a2 expression via multiple T-box motifs found in an evolutionarily conserved first intron enhancer.We next tested Tbx5 regulation of the enh1 enhancer by combining reporter assays with LOF or gain-of-function (GOF) experiments. Tbx5-MO knockdown resulted in a dramatic reduction of the mouse and TBX5 RNA . Moreoveous tbx5 . Mutatio hindgut . Mutatio hindgut  largely  hindgut . We concfgf8 and fgf10, we tested if a temporal FGF GOF would phenocopy Tbx5 LOF  and pulmonary endoderm genes (shh and nkx2-1), whilst decreasing aSHF markers   , similarnd tbx1) . Moreovend tbx1) . Interesuires RA . Combineshh and dhh transcription in Xenopus foregut endoderm explants where the tbx5/aldh1a2+ lpm, the source of endogenous RA, had been removed , which is located more than 800 kb from Shh, within an intron of the Rnf32 gene  in part by RA treatment  Tbx5-RA and FGF-Cyp form mutually antagonistic modules, with the Tbx5-RA loop promoting pSHF/CPP identity and suppressing aSHF fate, and Cyp-mediated RA degradation refining the spatial domain of RA activity; and (3) Direct RXR/RAR activation of the MACS1 enhancer at the shh locus, which provides a mechanism underlying the cell-non-autonomous activation of endodermal Hh ligand expression by Tbx5/Aldh1a2-dependent RA signaling in the pSHF. Reception of Hh signaling in the pSHF mesoderm activates Gli TFs, which cooperate with Tbx5 to directly activate wnt2/2b transcription; Wnt2/2b then induce pulmonary fate in the foregut endoderm  and in mice . Adult transgenic X. laevis and X. tropicalis Wnt/B-catenin reporter (VlemxXla.Tg(WntREs:dEGFP), NXR_0064; and VlemxXtr.Tg(WntREs:dEGFP), NXR_1094), and adult transgenic X. laevis nkx2-5:GFP (MohuXla.Tg.(nkx2-5:GFP), NXR_0030) frogs were purchased from the National Xenopus Resource (RRID:SCR_013713). Ovulation, in-vitro fertilization and natural mating, embryo de-jellying, and microinjection were performed as described (Xenopus GR-Tbx5 (Addgene 117248), Xenopus Tbx5 (Addgene 117247) (Xenopus dominant-negative RARa (TBX5 (Horizon Discovery OHS5894-202500411) was gateway sub-cloned from its entry vector pENTR223 into the expression vector pCSf107mT-Gateway-3\u2032myc (Addgene 67617) using clonase (ThermoFisher 11791020) according to manufacturer\u2019s instructions. Linearized plasmid templates were used to make mRNA for injection using the Ambion mMessage mMachine SP6 RNA Synthesis Kit (ThermoFisher AM1340). Total amounts of injected mRNA were as follows: GR-Tbx5 RNA, 125 pg; dN-RARa, 200 pg; and human TBX5-myc, 100 pg. Previously validated translation-blocking MOs against Tbx5 . MOs were purchased from GeneTools  and were as follows: Tbx5-MO1: 5\u2032-TTA GGA AAG TGT CTC TGG TGT TGC C-3\u2032; a negative control Tbx5 mismatch MO1 with three nucleotides mutated: 5\u2032-TCA GTA AAG TAT CTC TGG TGT TGC C-3\u2032; Tbx5-MO2: 5\u2032-CAT AAG CCT CCT CTG TGT CCG CCA T-3\u2032; Tbx5 3 bp mismatch MO2: 5\u2032-TAT CAG ACT CCT CTG TGT CCG CCA T-3\u2032 ; Aldh1a2-MO: 5\u2032-GCA TCT CTA TTT TAC TGG AAG TCAT-3\u2032; Cyp26a1 MO: 5\u2032-TAG TGA GCA GAG TAT ACA GAT CCA T-3\u2032; and Cyp26c1 MO: 5\u2032-TAC AAG ATG TTC CTC CTT GAG ATC A-3\u2032.WT adult escribed . Plasmid 117247) , and Xenive RARa  were prenst Tbx5 , Aldh1a2nst Tbx5 , Cyp26a1nst Tbx5 , and Cypnst Tbx5  were injX. trop tbx5 exon 5 (DNA-binding domain) that causes frameshift mutations was synthesized in-vitro as previously described . In all experiments, corresponding amounts of vehicle controls (DMSO or 0.2% fatty-acid free BSA) were used.For Gastrula or CP-foregut explants (containing both endoderm and lpm) were micro-dissected in 1\u00d7 MBS +50 \u03bcg/ml gentamycin sulfate \u00b110 U/ml dispase  and were cultured in 0.5\u00d7 MBS +0.2% fatty acid free BSA (Fisher BP9704)+50 \u03bcg/ml gent with the following concentrations of factors: 1 \u03bcM dexamethasone ; 1 \u03bcM cycloheximide ; 25 nM all-trans RA (Sigma R2625); 100 ng/ml WNT2B (R&D Systems 3900-WN-025); 1 \u03bcM DEAB (Sigma D86256); 100 ng/ml FGF8b (R&D Systems 423-F8-025); and 0.5 \u03bcM ketoconazole (Tocris 1103). In CHX experiments, explants were treated for 2 hr in CHX prior to DEX+CHX treatment for 6 hr.Xenopus RT-qPCR primer sequences are listed in odc, was determined using the 2\u2212\u0394\u0394Ct method. Graphs display the average 2\u2212\u0394\u0394Ct value \u00b1 standard deviation. Statistical significance (p<0.05) was determined using parametric two-tailed paired t-test, relative to uninjected, untreated explants. Each black dot in the RT-qPCR graphs represents an independent biological replicate containing four explants. Heat map of Xenopus RT-qPCR gene expression was generated using Morpheus software (https://software.broadinstitute.org/morpheus/) and shows the average 2\u2212\u0394\u0394Ct value from three biological replicates for each condition.Xenopus explants were dissected from embryos of 2\u20133 separate fertilization/injection experiments, frozen on dry ice in 200 \u03bcl of TRIzol (ThermoFisher 15596018), and stored at \u201380\u00b0C. RNA was extracted using TRIzol and purified using the Direct-zol RNA miniprep plus kit (ZymoResearch R2070); 500 ng RNA was used in cDNA synthesis reactions using Superscript Vilo Mastermix (ThermoFisher 11755050), all according to the manufacturer\u2019s instructions. qPCR reactions were carried out using PowerUp Mastermix (ThermoFisher A25742) on ABI StepOnePlus or QuantStudio3 machines. Xenopus embryos was performed as described (In-situ hybridization of escribed  with minEmbryos were fixed in 100 mM HEPES (pH 7.5), 100 mM NaCl, 2.7% methanol-free formaldehyde for 2 hr at room temperature, dehydrated directly into Dent\u2019s post-fixative (80% Methanol/20% DMSO), washed five times in Dent\u2019s, and stored in Dent\u2019s at \u221220\u00b0C for at least 48 hr. Embryos were serially rehydrated  into PBS +0.1% TritonX-100 (PBSTr). Embryos were then cut in a transverse plane through the pharynx and posterior to the liver to create a foregut sample using a fine razor blade on a 2% agarose-coated dish in PBSTr. Foreguts were subjected to antigen retrieval in 1\u00d7 R-universal epitope recovery buffer (Electron Microscopy Sciences 62719-10) for 1 hr at 60\u201365\u00b0C, washed 2\u00d7 10 min in PBSTr, blocked for 1\u20132 hr in PBSTr +10% normal donkey serum (Jackson ImmunoResearch 017-000-001) + 11% DMSO at room temperature, and incubated overnight at 4\u00b0C in this blocking solution+primary antibodies: chicken anti-GFP , mouse anti-Sox2 , rabbit anti-Aldh1a2 , and goat anti-Tbx5 . Secondary antibodies were donkey anti-chicken 488, donkey anti-rabbit Cy3, and donkey anti-mouse Cy5, donkey anti-goat 405 . After extensive washing in PBSTr, samples were incubated overnight at 4\u00b0C in PBSTr +0.2% DMSO+secondary antibodies. Samples were again extensively washed in PBSTr, dehydrated into 100% methanol, washed five times in 100% methanol, cleared, and imaged in Murray\u2019s Clear  on a metal slide with glass coverslip bottom using a Nikon A1R confocal microscope to obtain optical sections.Xenopus tropicalis v9.1 genome on Xenbase.org; RRID:SCR_003280 , X. trop aldh1a2 enh1 , X.trop shh MACS1, and human SHH MACS1  enhancers, as well as their respective mutant forms, were commercially synthesized  and cloned into the pGL4.23 firefly luc2/miniP vector (Promega E8411). For enh1 enhancer assays, embryos were co-injected with 5 pg of pRL-TK:renilla luciferase plasmid (Promega E2241) + 50 pg of the pGL4.23 luc2/miniP enhancer:luciferase plasmid and the following amounts of MOs or mRNAs into each dorsal marginal zone (dmz) region of 4\u20138 cell embryos: 3.5 ng of tbx5-MO or 3 bp mismatch-MO; 62.5 pg GR-Tbx5 RNA; 50 pg Xenopus Tbx5 RNA; 50 pg human TBX5-myc RNA. For hindgut mesendoderm injections, the luciferase reporters were injected into the ventral-posterior marginal zone at the 4\u20138 cell stage\u00b1Tbx5 RNA. For analysis of Shh MACS1 enhancer activity in endoderm, C1 (foregut) or C4 (hindgut) blastomeres were injected at the 16- or 32-cell stage with 5 pg pRL-TK+50 pg MACS1:luc\u00b1100 pg dnRARa RNA.The R_003280  was usedg and then 25 \u00b5l of the clear supernatant lysate was used separately in firefly (Biotium #30085-1) and renilla (Biotium 300821) luciferase assays according to the manufacturer\u2019s instructions. Relative luciferase activity was determined by normalizing firefly to renilla levels for each sample. Graph show the average relative luciferase activity \u00b1 standard deviation with dots showing values of biological replicates. Statistical significance was determined by parametric two-tailed paired t-test, *p<0.05.Each biological replicate contained a pool of five embryos, obtained from 2 to 3 separate fertilization/injection experiments which were frozen on dry ice in a minimal volume of 0.1\u00d7 MBS and stored at \u201380\u00b0C. To assay luciferase activity samples were lysed in 100 \u00b5l of 100 mM TRIS-Cl pH 7.5, centrifuged for 10 min at ~13,000\u00d7Xenopus transgenic plasmids were constructed using the pI-SceI-d2EGFP plasmid backbone (Addgene 32674). First, a fragment containing the mouse or X. trop enh1 enhancers upstream of a minimal TATA box promoter . Columns in the +/+Tbx5 WT N=5, \u2212/Tbx5\u2212 N=2), and each column replicate contained n=4 pooled CP dissected regions.RNA-seq of the micro-dissected E9.5 WT and Gapdh and RT-qPCR primers are listed in Shh probe was provided by Elizabeth Grove (University of Chicago). Immunofluorescence of WT CD-1 (Charles River) or Shh:GFP (B6.129\u00d71(Cg)-Shhtm6Amc/J; Jax Labs Stock Number #008466) mouse embryos was performed as described  mouse E9.5 pSHF/CPP regions was performed as described , cDNA geescribed  using mohttp://www.adobe.com) and reconstructed with AMIRA . Manual review of each image in the stack was performed and corrections were made when necessary. LabelFields for gene expression and tissue were generated from the same series of sections using separate CastField and LabelVoxel modules. The SurfaceGen module was used to generate surfaces from these LabelFields. Gene expression models for two different genes were initially aligned using the Landmark (two sets) module, and a minimum of three landmarks were used to align the separate models. These landmarks were located using the pharyngeal endoderm and ventral edge of the SHF. Final alignments were fine-tuned manually using the Transform editor.Reconstructions of whole-mount in-situ hybridizations were generated using previously published methods . In brieAldh1a2, Tbx1, Tbx5, and Shh was generated using the single cells Spatial Mouse Atlas . Images are centered around the cardiothoracic region with cardiomyocytes highlighted.Digital in-situ hybridization for Tbx5OE-mESC line was previously generated , .RNA-seq of the micro-dissected E9.5 WT and ogists), . Differe\u2212/Tbx5\u2212 embryos compared to the single-cell data sets by GSEA  feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.Our editorial process produces two outputs: (i) Acceptance summary:Your study provides critical data on the early events regulated by mesoderm-endoderm signaling required for lung development. These studies are important for assessment of early foregut development and help to define causal cell types in genetic diseases of lung formation.Decision letter after peer review:eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Edward Morrisey as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Tien Peng (Reviewer #1).Thank you for submitting your article \"TBX5 drives Aldh1a2 expression to regulate a RA-Hedgehog-Wnt gene regulatory network coordinating cardiopulmonary development\" for consideration by The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.Essential revisions:1) Please address the issues raised by the reviewers on the specificity of the pharmacological inhibitors through the use of more specific techniques such as morpholinos. Also clearly state the limitations of such pharmacological inhibitors.2) Address the requests of additional histological and gene expression analysis with new data where noted by the reviewers.3) The manuscript needs to be revised to better link the current studies with previous work and to highlight to the uninitiated the importance of your study.4) The manuscript also needs additional revision to temper some of the claims as mentioned by the reviewers.Reviewer #1 (Recommendations for the authors):1. In Figure 1H,I, labeling of major anatomic landmarks would be helpful to delineate the domain of Aldh1a2 expression. Furthermore, it would be nice to highlight the relationship of the Shh expression domain alongside Aldh1a2 in Figure 1I as their complement anatomic relationship sets up the hypothesis studied in this manuscript.2. In Figure 2a-c, it is clear that while there are some overlaps between Tbx5 and Aldh1a2, there are clearly domains of Aldh1a2 expression that are Tbx5-negative. It would be easier to visualize the overlap of the two domains in Figure 2b by coloring Tbx5 and Aldh1a2 green and red respectively with some quantification of the overlap. Furthermore, it is not clear how the reduction in Aldh1a2 is quantified. Finally, some discussion on what is driving Aldh1a2 expression in cells that are not Tbx5+.3. In Figure 3A, a set of data shows that RA inhibition by DEAB can phenocopy RNA targeting of Tbx5, however, this is not really specific to the expression of Aldh1a2 per say. What is the phenotype of using MO to target Aldh1a2 in these set of experiments?4. In Figure 4G, it would be nice to colocalize the expression of the GFP with in situ of Adh1a2 to see where the enhancer-driven GFP overlap with actual gene expression.5. In Figure 5, I would raise a similar point as Comment 3, which is that the use of ketoconazole as a Cyp inhibitor is not as specific as MO targeting Cyp26a1. Would targeting of Cyp26a1 block the effect of FGF8 directly. This would provide stronger mechanistic proof for the model described.6. In Figure 6E, can RA administration directly increase the reporter activity driven by the MACS1 enhancer? This would better link the Shh enhancer described to an RA response.Reviewer #2 (Recommendations for the authors):Prior to publication, a few points need to be considered.1. Figure 1H. It will be nice to zoom in the foregut region in addition to showing the whole embryo. Although it is not necessary, it will be informative if the authors can show the in situ hybridization of Fgf10, Shh in TBX5 mutants using the similar projection method.2. Fgf10 is known  to be localized in the future lung budding sites. In between the budding sites Fgf10 is not expressed. Is Tbx5 expressed in this region? It will be informative if authors can also show the projection image of Tbx5 as other genes in H.3. Figure 1I, Can the authors label the projection images, e.g. heart field, lung budding site.4. Does TBX5 deletion/kd induce stronger foregut phenotypes in frog than mouse? It appears that trachea-esophageal separation is abnormal in frog models . Can the authors provide more details?5. Does addition of exogenous Tbx5 RNA or RA in the rescue experiments affect the development of other organs? The presence of any phenotypes can further confirm that the extra Tbx5 or RA works in addition to the qPCR data.Reviewer #3 (Recommendations for the authors):Phrasing throughout the manuscript should be cautious. For example, differentially expressed genes are not necessarily Tbx5-dependent as worded on page 8 second paragraph.Listing Tbx5 regulation of shh signaling as a key finding is an overstatement.Can the authors demonstrate loss of Aldh1a2 expression in Tbx5null embryos?The authors should mention the role of Aldh2a2 in retinoic acid processing so that the reader can understand how it functions to regulate RA signaling. The only description present is RA-producing enzyme.The Wnt GFP reporter data in figure 2 B and C could be moved to supplemental data as it is more distracting than informative.A co-stain for lateral plate mesoderm would be beneficial in figure 2 B and C.For comparison purposes and because the readout is qualitative Figure 3 should be organized in a manner such that DEAB is next to tbx5 MO and 25 nM RA is next to mismatch MO. TBX5 RNA could go to the far right.Limitation of drug inhibition should be stated. There are likely many more developmental processes disrupted by addition of RA inhibitor at the NF20 stage.Authors might consider highlighting what new data they have added to the illustration in figure 7.Figure legend 3 should be revised to reflect the panels in the figure.Several of the effects observed in Figure 3 A-J appear to span beyond the cardiopulmonary region of the embryo. The author should recognized this in the interpretation of their data.The diagram in 3L is based primarily on one time point examination. It may be prudent to remove this figure.Wording in figure 4A legend has mixed verb tenses.The statement that Tbx5 activates and represses certain genes goes beyond the data demonstrated in Figure 4A.The authors should try to separate the description of the results from their discussion of the results. For example, p 12 the entire first full paragraph is more discussion than results. Essential revisions:1) Please address the issues raised by the reviewers on the specificity of the pharmacological inhibitors through the use of more specific techniques such as morpholinos. Also clearly state the limitations of such pharmacological inhibitors.We have repeated the Aldh1a2 and Cyp loss of function experiments with morpholinos that completely support the inhibitor studies. This data is presented in new Figure 3\u2014figure supplement 1 and Figure 5\u2014figure supplement 1. We have also clearly stated the limitations and advantages of pharmacological inhibitors.2) Address the requests of additional histological and gene expression analysis with new data where noted by the reviewers.We have added new analysis gene expression analysis in both sections and wholemount as requested and better annotated the anatomical structures in the images. These new data are presented in a revised Figure 1 D-F and in a revised Figure 1\u2014figure supplement 1F-H.2) The manuscript needs to be revised to better link the current studies with previous work and to highlight to the uninitiated the importance of your study.We have revised the introduction and discussion to better link our results to previous work and to better highlight the importance of the work and the significance of the advance.3) The manuscript also needs additional revision to temper some of the claims as mentioned by the reviewers.We have revised the text to temper some of the claims as suggested by the reviewers.Reviewer #1 (Recommendations for the authors):1. In Figure 1H,I, labeling of major anatomic landmarks would be helpful to delineate the domain of Aldh1a2 expression. Furthermore, it would be nice to highlight the relationship of the Shh expression domain alongside Aldh1a2 in Figure 1I as their complement anatomic relationship sets up the hypothesis studied in this manuscript.Aldh1a2 and Tbx5 in the pSHF, Tbx1 in the aSHF and endodermal Shh . We also added better labels of anatomical structures on the 3D in situ reconstructions as requested. Finally, we also present 3D maximum projections of confocal images showing the co-expression domain Tbx5-Ald1ha2 in the Xenopus pSHF/foregut lpm .In retrospect, we agree that the relative expression domains were not as clear as they should have been. While the each of these gene expression patterns has been documented before in previous publications, their direct comparison is key for our hypothesis. Therefore, we performed additional 3D whole mount confocal imaging of the E9.5 mouse embryo simultaneously staining Tbx5, Aldh1a2, Shh-GFP and Nkx2-1 , which clearly shows the co-expression of Tbx5 and Aldh1a2 in the pSHF adjacent to the Shh/Nk2-1 expressing pulmonary endoderm. In addition, we used anew online single cells expression resource from the Marioni lab , to generate a \u201cdigital\u201d in situs hybridization of sagittal section through the cardiothoracic region of a E9.5 mouse showing the overlapping expression domains of 2. In Figure 2a-c, it is clear that while there are some overlaps between Tbx5 and Aldh1a2, there are clearly domains of Aldh1a2 expression that are Tbx5-negative. It would be easier to visualize the overlap of the two domains in Figure 2b by coloring Tbx5 and Aldh1a2 green and red respectively with some quantification of the overlap. Furthermore, it is not clear how the reduction in Aldh1a2 is quantified. Finally, some discussion on what is driving Aldh1a2 expression in cells that are not Tbx5+.As requested, we revised the immunostaining in Figure 2B with Tbx5 in green and Aldh1a2 in red. This better shows the overlapping expression domains in yellow, which we quantified by generating a 3D volume with Imaris imaging software . We also quantified the reduction in Aldh1a2 protein levels based on the average immunostaining pixel intensity in the lpm in both the Tbx5-MO and tbx5-CRISPR mutants .Yes there are some Aldh1a2 expression domains that do not overlap with Tbx5 including the somite and kidney mesenchyme (figures ??), which must be regulated by different enhancers independent of Tbx5. While studying these other enhancers and expression domains is interesting, this are not really relevant to the present and so we only briefly mention this in the revised discussion.3. In Figure 3A, an set of data shows that RA inhibition by DEAB can phenocopy RNA targeting of Tbx5, however, this is not really specific to the expression of Aldh1a2 per say. What is the phenotype of using MO to target Aldh1a2 in these set of experiments?We agree that this is an important point given the potential off target effects of inhibitors. As requested, we performed Aldh1a2-MO knockdowns with targeted microinjection to the foregut lpm. Immunostaining confirmed loss of Aldh1a2 protein, and resulted in gene expression changes largely identical to the DEAB treatment. Moreover, addition of exogenous RA rescued the Aldh1a2-MO phenotype. Since Aldh1a2 has earlier functions in the paraxial mesoderm, if the targeting was not efficient the embryos can have other defects, which is why we initially used the DEAB where we can control the timing of RA inhibition. We address the limitations and advantages of inhibitors in the revised manuscript. This new data presented in Figure 3\u2014figure supplement 1A-E further strengthens our conclusions.4. In Figure 4G, it would be nice to colocalize the expression of the GFP with in situ of Adh1a2 to see where the enhancer-driven GFP overlap with actual gene expression.As requested, we performed co-staining of the enh1-GFP transgenes with endogenous Aldh1a2, which shows a specific overlap in the Tbx5+ foregut lpm, but not in the somites . Again this is consistent with other Tbx5-independent enhancers regulating Aldh1a2 in other tissues.5. In Figure 5, I would raise a similar point as Comment 3, which is that the use of ketoconazole as a Cyp inhibitor is not as specific as MO targeting Cyp26a1. Would targeting of Cyp26a1 block the effect of FGF8 directly. This would provide stronger mechanistic proof for the model described.shh, tbx5, wnt2b and nkx2-1 expression and elevating their expression levels in untreated foregut explants . This new data provides a stronger mechanistic proof that FGF8 restricts RA-dependent cardiopulmonary development in the anterior foregut domain by regulating expression of Cyp26 RA-degrading enzymes. We thank the reviewer for the suggestion.To address this, we performed MO knockdown of redundant Cyp26a1 and Cyp26a1, both of which are direct FGF targets. RT-PCR analysis of dissected foregut tissue shows that the cyp261a/c-MO phenocopies the Cyp-inhibitors ketoconazole, rescuing FGF8\u2019s inhibition of 6. In Figure 6E, can RA administration directly increase the reporter activity driven by the MACS1 enhancer? This would better link the Shh enhancer described to an RA response.Xenopus MACS1 enhancers can be activate by RA in isolated foregut endoderm and that this activation is dependent on RXR/RAR DNA-binding sites .We have added new luciferase assay data that demonstrate that both the human and Reviewer #2 (Recommendations for the authors):Prior to publication, a few points need to be considered.1. Figure 1H. It will be nice to zoom in the foregut region in addition to showing the whole embryo. Although it is not necessary, it will be informative if the authors can show the in situ hybridization of Fgf10, Shh in TBX5 mutants using the similar projection method.Aldh1a2 and Tbx5 in the pSHF, Tbx1 in the aSHF and endodermal Shh . We focused on Tbx5, Aldh1a2 and Shh rather than Fgf10 since these are the main focus of the work. As the mouse RNA-seq and RT-PCR as well as the Xenopus data show reduced Fgf10 and Shh expression of in Tbx5 mutants we did not repeat this by in situ in mice, given our time constraints.As suggested, we have improved the imaging of the cardiopulmonary region with additional high magnification 3D whole mount confocal imaging of the E9.5 mouse embryo simultaneously staining Tbx5, Aldh1a2, Shh-GFP and Nkx2-1 , which clearly shows the co-expression of Tbx5 and Aldh1a2 in the pSHF adjacent to the Shh/Nk2-1 expressing pulmonary endoderm. In addition, we used a new online single cells expression resource from the Marioni lab , to generate a \u201cdigital\u201d in situs hybridization in sagittal section of the E9.5 mouse cardiothoracic region showing the overlapping expression domains of 2. Fgf10 is known  to be localized in the future lung budding sites. In between the budding sites Fgf10 is not expressed. Is Tbx5 expressed in this region? It will be informative if authors can also show the projection image of Tbx5 as other genes in H.Fgf10, Wnt2, as well as branching morphogenesis. It is unclear whether RA is involved in this role, but we have mentioned the similarity in the discussion.Arora et al., PLOS Genetics, 2012, have already published a description of Tbx5 and Tbx4 expression in the fetal mouse lung, including the distal mesenchyme where they regulate expression of 3. Figure 1I, Can the authors label the projection images, e.g. heart field, lung budding site.In addition to providing better analysis of the gene expression, we have labeled the anatomy on the 3D in situ reconstruction.4. Does TBX5 deletion/kd induce stronger foregut phenotypes in frog than mouse? It appears that trachea-esophageal separation is abnormal in frog models . Can the authors provide more details?Xenopus Tbx5 null mutant phenotypes are very similar. As previously described, both have major defects in cardiac morphogenesis and fail to specify respiratory fate in the ventral foregut . Tbx5-/- null mice die between E9.5 and E10.5 due to cardiac defects, before trachea-esophageal separation at E11.5. Xenopus tadpoles on the other hand are well known to survive for many days with severe heart defects as they can absorb oxygen from the water, which is one reason that we used Xenopus for this study. We now make this clearer in the manuscript and show data on the late tbx5-MO phenotype confirming the previously published hypoplastic atria and vertical lacking trabeculae as well as the failed trachea-esophageal separation .The mouse and 5. Does addition of exogenous Tbx5 RNA or RA in the rescue experiments affect the development of other organs? The presence of any phenotypes can further confirm that the extra Tbx5 or RA works in addition to the qPCR data.We did not look at other organs, but focused our analysis on early heart and lung specification, which is the theme of the paper. We show that addition of Tbx5 or RA can rescue cardiopulmonary development as assessed by immunostaining, in situ hybridization and RT-qPCR. There are publications suggesting that Tbx5 and RA may also interact in other tissue such as the limb, but the logic of the regulatory networks appears to be somewhat different. We address this in the discussion. While beyond the scope of this work, in the future it would be interesting to compare the different developmental contexts.Reviewer #3 (Recommendations for the authors):Phrasing throughout the manuscript should be cautious. For example, differentially expressed genes are not necessarily Tbx5-dependent as worded on page 8 second paragraph.We have revised the phasing to be more accurate and cautious as requested.Listing Tbx5 regulation of shh signaling as a key finding is an overstatement.shh expression via RA is a major finding and one of the key mechanisms linking mesoderm and endoderm development. We have revised how we describe this to be clear that Tbx5 regulates shh expression.We are not sure what the reviewer means here. In our view the finding that Tbx5 indirectly regulates Can the authors demonstrate loss of Aldh1a2 expression in Tbx5null embryos?Xenopus. Give the time constraints, and the other revisions requested did not repeat this experiment with immunostaining or in situ.The RNA-seq and RT-PCR of the Tbx5-null mouse foregut do clearly demonstrate the loss of Aldh1a2, as does the many experiments in The authors should mention the role of Aldh2a2 in retinoic acid processing so that the reader can understand how it functions to regulate RA signaling. The only description present is RA-producing enzyme.Yes, we agree that this would be helpful, and we have added this. Thank you for the suggestion.The Wnt GFP reporter data in figure 2 B and C could be moved to supplemental data as it is more distracting than informative.A co-stain for lateral plate mesoderm would be beneficial in figure 2 B and C.We understand the reviewer perspective, but we have shown the figure to a number of colleagues take a different view and find the Wnt-GFP reporter helpful as this shows the respiratory progenitors. Having said that we take the reviewers point and simplified the description of these data. We also show the panels without the GFP for those readers who find it distracting. To better show the Tbx5-Aldh1a2 co-staining in lateral plate mesoderm we have new immunostaining  showing the overlap in the ventral-lateral foregut lateral plate mesoderm.For comparison purposes and because the readout is qualitative Figure 3 should be organized in a manner such that DEAB is next to tbx5 MO and 25 nM RA is next to mismatch MO. TBX5 RNA could go to the far right.We respectfully prefer to keep the original organization of the columns.Limitation of drug inhibition should be stated. There are likely many more developmental processes disrupted by addition of RA inhibitor at the NF20 stage.We have now clearly stated the limitation of the inhibitor experiments. In addition, we have added new Aldh1a2-MO and Cyp261a/c-MO experiments to complement the DEAB and ketoconazole experiments, which support our model. We also acknowledge that these inhibitors can affect other organ system notably the kidney where RA is known to play a role as published by others. While these to not change the interpretation in the cardiopulmonary tissue we agree that it is important to state this.Authors might consider highlighting what new data they have added to the illustration in figure 7.Thank you for this suggestion we agree that is helpful.Figure legend 3 should be revised to reflect the panels in the figure.Done. Thank you for pointing out this error.Several of the effects observed in Figure 3 A-J appear to span beyond the cardiopulmonary region of the embryo. The author should recognized this in the interpretation of their data.We agree that the Tbx5 depleted embryos have non-cell autonomous defects in other tissues including the kidney primordia, pharynx, head and ectoderm. We interpret this to be due to the disrupted RA and FGF signaling that we have documented. We have modified the text to explain this.The diagram in 3L is based primarily on one time point examination. It may be prudent to remove this figure.We have revised the figure legend of the model to make it clear that we are refereeing to a specific time point. We agree that this is important since Tbx5-RA interactions may be different at different times.Wording in figure 4A legend has mixed verb tenses.Thank you we have corrected this.The statement that Tbx5 activates and represses certain genes goes beyond the data demonstrated in Figure 4A.We have revise language to state that expression levels increase and decreases in Tbx5 GOF.The authors should try to separate the description of the results from their discussion of the results. For example, p 12 the entire first full paragraph is more discussion than results.We have done this, although we kept some description of previous work where is provides a rational for the experiments."}
{"text": "Network analysis of large-scale neuroimaging data is a particularly challenging computational problem. Here, we adapt a novel analytical tool, the community dynamic inference method (CommDy), for brain imaging data from young and aged mice. CommDy, which was inspired by social network theory, has been successfully used in other domains in biology; this report represents its first use in neuroscience. We used CommDy to investigate aging-related changes in network metrics in the auditory and motor cortices by using flavoprotein autofluorescence imaging in brain slices and in vivo. We observed that auditory cortical networks in slices taken from aged brains were highly fragmented compared to networks observed in young animals. CommDy network metrics were then used to build a random-forests classifier based on NMDA receptor blockade data, which successfully reproduced the aging findings, suggesting that the excitatory cortical connections may be altered during aging. A similar aging-related decline in network connectivity was also observed in spontaneous activity in the awake motor cortex, suggesting that the findings in the auditory cortex reflect general mechanisms during aging. These data suggest that CommDy provides a new dynamic network analytical tool to study the brain and that aging is associated with fragmentation of intracortical networks. In this work, we introduce a novel technique  which is based on social network theory, to analyze neural data. We use CommDy to analyze imaging data from the cerebral cortex of awake mice and mouse brain slices. In each case, data were obtained from young and aged mice. Using CommDy, we found that in both types of data, aging is associated with a fragmentation of cortical circuitry. Specifically, the strength of intracortical connectivity diminishes with aging, leaving fragmented cortical networks. Thus, CommDy is a novel tool now available to the neuroscience community, and has revealed aging-related pathology of cortical networks. Normal aging is associated with a gradual loss of cognitive function . The mecNetwork analysis tools are emerging approaches to understand functional connectivity of the brain . UnfortuPrevious investigators have suggested that complex dynamic networks, be they populations of neurons, large ecosystems, or social networks, share common underlying organizational motifs . TherefoIn the current report, we adapt CommDy for the analysis of Two datasets were examined in this study: brain slice imaging data from the auditory cortex during Prior to applying the CommDy technique, there are several data preprocessing steps required to transform raw brain imaging data into CommDy input, including using the time series of each pixel to construct a simple network representation, and then static community detection in each time step. After that, CommDy was applied to infer dynamic communities. \u201cStatic\u201d networks refer to temporal networks with multiple snapshots, and \u201cdynamic\u201d networks refer to those networks linked over time. To create the network representation, pixels were used as nodes and a weighted, thresholded network of pixel value correlations across an empirically determined number of time steps (the \u201cwindow size\u201d) was then generated. The correlation threshold was determined empirically, and correlation values above the threshold were used to build the correlation matrix.To determine the appropriate time window and correlation thresholds for CommDy analysis applied to flavoprotein autofluorescence imaging data for slice data, the analysis window size was systematically changed from 25 frames (352 ms) to 200 frames  and the resulting spatial distributions of the average By sliding the correlation window one step or frame each time following each correlation extraction, and doing this over the entire time line, a time series of correlation networks was obtained. CommDy can take the resulting dynamic network as the input directly or, for more efficient processing, it takes any grouping of the time steps as input. In each time step of these time series, we applied the Louvain static community inference method  to find \u22123, which is lower than previous reports  change over time, we use the CommDy method . In CommCommDy can be used to quantitatively describe network activity in terms of the node and structural network metrics based on network theory . These mSD] edges per active node, mean in aged animals = 149.1 \u00b1 162.4 [SD] edges per active node, p = 0.005, Mann\u2013Whitney). These data suggest that the average connectivity between nodes is higher in younger animals than in aging animals and cannot be accounted for by any differences in the magnitude in the response of the young versus aged animals.Paroxysmal depolarizations were imaged in brain slices taken from five young  and five aged  animals . Initially, static analysis was performed on auditory cortical networks in young and aging mice. To do this, the average degree of each node was computed for each pixel as the average number of edges at each node during the 100-frame window surrounding the peak of the paroxysmal depolarization. These values were then averaged across paroxysmal depolarizations within each animal, normalized to the overall magnitude of the response, and the resulting grand average for each group of animals is shown in Average degree of each node does not provide insights into the changing associations between nodes. We therefore performed dynamic analysis using CommDy, which is built upon static communities detected by the Louvain algorithm independently in each time step. Dynamic analysis of paroxysmal depolarizations in young and aged animals using CommDy revealed that network activity differed between these two groups. Young animals showed distinct patterns of activity across the auditory cortex during paroxysmal depolarizations. See SD] for young vs. 0.058 \u00b1 0.046 [SD] for aged; p = 0.0001) and normalized community size . The differences in homing, a measure of network cohesion, trended toward significance but did not survive correction for multiple comparisons . See CommDy network metrics were compared between young and aged mice. To ensure that differences in network measures were not due to changes in the absolute magnitude of activation, individual group and community sizes were normalized by the total number of nodes in each activation. Using a mixed-effects model, age was found to be a significant predictor for both normalized group size  and compared to those with low ABR thresholds . Similar to separation of groups based on age (n = 5 per group), using a mixed-effects model, normalized group size, and normalized community size were both larger in the better hearing animals. The values for normalized group size = 0.189 \u00b1 0.070 (SD) for low ABR threshold versus 0.120 \u00b1 0.052 (SD) for high ABR threshold,  for young vs. 0.146 \u00b1 0.052 (SD) for aged , whereas for group size, cortical thickness was the only significant predictor , as has been seen previously . These data suggest that spontaneous flavoprotein autofluorescence signals track with more commonly measured indicators of spontaneous activity, such as Nine young  and nine aged  mice were used for these experiments. Because flavoprotein autofluorescence has not been used previously to measure spontaneous neural activity in vivo, we initially characterized the properties of the signals. It was observed that the majority of the power is in the delta range (approximately 3 Hz) in both young and aged animals . To valieviously , with nop = 0.3, . To deteSD] edges/node vs. 257 \u00b1 476 [SD] edges/node, p = 0.03, Mann\u2013Whitney; To compare the overall degree of connectedness between nodes in aged versus young animals, the degree of each node was computed in young and aged animals. Similar to the findings in brain slices from the auditory cortex, the degree of connectivity, as measured by average number of edges per node, was significantly decreased in the aged compared to the young animals , switching , and normalized community size , visiting , and average stay ; but these did not survive multiple comparisons correction. To determine if the drop in community size with aging is related to diminished intracortical connectivity, analogous to that seen in vitro . Slices containing the auditory cortex were cut using a modification of the method developed by Cruikshank et al.  and incubated at 32\u00b0C for 1 hr prior to experimentation. The ACSF used for the experiments use equimolar MgCl2 and CaCl2 and contained 1 \u03bcM of the GABAA antagonist The CBA/CaJ strain was used because of its gradual aging-related hearing loss . Five yok et al. , modifiek et al. , see FigAn initial stereotactic surgery under ketamine/xylazine  was done to glue a threaded headbolt onto the skull using OptiBond XTR kit  cement. After at least 3 days to recover, mice were gradually acclimated to an imaging chamber within a soundproof booth. Their headbolts were affixed to a holder, and the body was suspended while under isoflurane (4%) anesthesia. The mice were then allowed to emerge from anesthesia, initially for 5 min, and gradually up to 15\u201320 min. Awake data were obtained once isoflurane was removed for at least 10 min. Once awake data were obtained, the animal was reanesthetized with ketamine/xylazine  for additional imaging.For the slice work, flavoprotein autofluorescence imaging was done with a fluorescence illuminator (Prior Lumen 200) and a UMNIB Olympus filter cube , Award ID: 1515587. Daniel Adolfo Llano, National Institutes of Health (https://dx.doi.org/10.13039/100000002), Award ID: DC012125. Daniel Adolfo Llano, National Institutes of Health (https://dx.doi.org/10.13039/100000002), Award ID: AG059103. Daniel Adolfo Llano, American Federation for Aging Research (https://dx.doi.org/10.13039/100000965), Award ID: 2011-03147. Daniel Adolfo Llano, Alzheimer's Association (https://dx.doi.org/10.13039/100000957), Award ID: NIRG-12-242848. Daniel Adolfo Llano, Kiwanis Neuroscience Research Foundation.Daniel Adolfo Llano, National Science Foundation (Click here for additional data file.Click here for additional data file.Click here for additional data file."}
{"text": "Knowledge translation (KT) is an important means of improving the health service quality. Most research on the effectiveness of KT strategies has focused on individual strategies, i.e., those directly targeting the modification of allied health professionals\u2019 knowledge, attitudes, and behaviors, for example. In general, these strategies are moderately effective in changing practices (maximum 10% change). Effecting change in organizational contexts  is part of a promising new avenue to service quality improvement through the implementation of evidence-based practices. The objective of this study will be to identify why, how, and under what conditions organizational KT strategies have been shown to be effective or ineffective in changing the (a) knowledge, (b) attitudes, and (c) clinical behaviors of allied health professionals in traumatology settings.This is a realist review protocol involving four iterative steps: (1) Initial theory formulation, (2) search for Evidence search, (3) knowledge extraction and synthesis, and (4) recommendations. We will search electronic databases such as PubMed, Embase, CINHAL, Cochrane Library, and Conference Proceedings Citation Index - Science. The studies included will be those relating to the use of organizational KT strategies\u00a0in trauma settings, regardless of\u00a0study designs, published between January 1990 and October 2020, and presenting objective measures that demonstrate change in allied health professionals\u2019 knowledge, attitudes, and clinical behaviors. Two independent reviewers will select, screen, and extract the data related to all relevant sources\u00a0in order to refine or refute the context-mechanism-outcome (CMO) configurations developed in the initial theory and identify new CMO configurations.Using a systematic and rigorous method, this review will help guide decision-makers and researchers in choosing the best organizational strategies to optimize the implementation of evidence-based practices.PROSPERO CRD42020216105The online version contains supplementary material available at 10.1186/s13643-021-01793-4. Knowledge translation (KT)  is an imA promising new avenue for supporting service quality improvement through the translation of evidence-based practices targets changes in organizational contexts  \u201311. IncrA realist review is required to assess the different action mechanisms of organizational KT strategies  and to facilitate the choice of effective strategies that will enable effective and sustainable implementation of evidence-based practice for allied health professionals in traumatology settings. Realist synthesis (or review) is a scientific literature review approach that provides an explanatory analysis of how theories work (or fail to work) in different contexts . It is uWe will conduct a realist review . We repoThe research team consists of seven co-investigators: three academic researchers , two knowledge users , one research coordinator (JD), and one postdoctoral fellow (KL). The project involves a multidisciplinary team of experts in knowledge synthesis (AL), neurotrauma rehabilitation (MEL), management in traumatology settings , and KT . Knowledge users are decision-makers representing health and social services settings in Quebec City. The postdoctoral fellow is working on developing expertise in knowledge synthesis and KT. All team members will contribute to the different stages of this project through document revision, reflection, and decision-making with regard to the methodological approach and the various analyses. Monthly written follow-up is planned, as well as two face-to-face meetings at the beginning of the project and one at the end of the project. Other meetings (by telephone or in-person) may be convened as needed in the course of the project.The realist review consists of four main stages: (1) formulation of initial theories, (2) search for evidence, (3) knowledge extraction and synthesis, and (4) recommendations .In terms specific to the realist review, we will put forward initial theories to explain the context-mechanism-outcome (CMO) system. From a methodological point of view, researchers begin by extracting from the literature the main ideas that relate to a class of interventions . These initial theories explain how and why a class of interventions  work and generate the outcome(s) of interest .We will use the Consolidated Framework for Implementation Research (CFIR)  to guideBased on CFIR and team members\u2019 own clinical and organizational experience, we will develop initial theories explaining why, how, and in what context organizational KT strategies can work. Specifically, we will hold a 1.5-h, audio-recorded, group discussion to develop a first draft theory answering the following question: how (context and mechanism) an organizational KT strategy (intervention) has been shown to be effective or ineffective in changing the (a) knowledge, (b) attitudes, and (c) clinical behaviors of allied health professionals (outcomes). We will make an initial schematic representation based on the discussion and refine it through revision of the audio-recorded material. This representation will then be tested against data from studies included in the review.The search will be conducted in the MEDLINE, CINAHL, Embase, Cochrane, Ergonomic Abstracts, and Web of Science Core Collection databases and may be extended to other databases of a more social or sociological nature as required (planned date coverage between January 1990 and October 2020). It should be noted that, depending on the realist review methodology, subsequent iterative research may be conducted to generate additional data on a particular aspect of the research question.Two knowledge management specialists will perform the primary article search in the various databases. Subsequently, the research team will use three different mechanisms: (1) the list of cited references will be reviewed to extract articles of interest, 2) the \u201cfind similar articles\u201d function of the databases will be used to check if other articles of interest are related to the primary articles, and (3) the authors who have published more than two articles deemed relevant will be contacted by e-mail to request a list of relevant references, published or not, on our subject. All articles found during the secondary search will in turn be put through the three secondary search mechanisms to complete the search. Finally, Grey Matters, a practical tool for searching health-related grey literature , will be the \u201cfinhttps://cihr-irsc.gc.ca/e/29529.html):We will consider French- and English-language studies relating to organizational KT strategies published. The definition of KT used for the purpose of article selection\u00a0 is the one provided by the Canadian Institutes of Health Research  in traumatology settings. For the outcomes, we will include all objective measures that demonstrate a change in the clinical knowledge, attitudes, and behaviors of allied health professionals.First (by title and abstract) and second (full-text review) screenings will be carried out independently by two reviewers  using Covidence . We willStudy characteristics: title, first author, publication year, country, participants , study objectives, trauma setting , and outcomes (what specific changes have been measured in the (a) knowledge, (b) attitudes, and (c) clinical behaviors)Intervention: type of organizational KT strategiesProgram theory: refined or refuted CMO configurations developed in the initial theory and new CMO configurationsMethodology: data collection method and type of analysisWe will carry out a thorough reading of the selected articles followed by the extraction of relevant data. The extraction will be also performed in parallel by two research team members  using a standard Covidence \u00a0extractiThe extraction form will be piloted with five studies. Here again, data extraction can lead to questions about the focus of the synthesis and, consequently, to iterative reflection on the research question and selection of articles. These questions and reflections will also be referred to the research team.Two independent analysts will examine the selected articles and indicate to what extent they correspond to each CMO configurations developed in the original theory. They will also identify any new CMOs that may emerge from the studies. Results will then\u00a0be compare in a cross-tabulation matrix. A consensus will have to be reached before results\u00a0are presented to the rest of the team. Data synthesis will take into account the circumstances in which these organizational KT strategies were used, including the characteristics of the targeted evidence-based practices, as well as internal, external, and personal contexts of individuals involved, in addition to any other information that supports the understanding of the context. Based on the emerging results of the studies, the research team will be able to validate (confirm or refute) the initial theories on the effectiveness of organizational KT strategies through group discussion. The team will perform a comparative analysis between the initial theories and the emerging results of the review as well as a search for both contradictory and consensual results , 26. SpeUsing a systematic and rigorous method, this review will help guide decision-makers and researchers in choosing the best organizational strategies to optimize the implementation of evidence-based practices in the trauma field.Researchers have explained some of the challenges that are specific to realist reviews. Among other things, making the distinction between mechanism and context can be difficult \u201334. RobeAdditional file 1. PRISMA-P populated checklist.Additional file 2. Draft search strategy for MEDLINE."}
{"text": "The Covid-19 pandemic is affecting the entire world population. During the first spread, most governments have implemented quarantine and strict social distancing procedures. Similar measures during recent pandemics resulted in an increase in post-traumatic stress, anxiety and depression symptoms. The development of novel interventions to mitigate the mental health burden are of utmost importance.In this rapid review, we aimed to provide a systematic overview of the literature with regard to associations between physical activity (PA) and depression and anxiety during the COVID-19 pandemic.We searched major databases  and preprint servers , for relevant papers up to 25/07/2020.We included observational studies with cross-sectional and longitudinal designs. To qualify for inclusion in the review, studies must have tested the association of PA with depression or anxiety, using linear or logistic regressions. Depression and anxiety must have been assessed using validated rating scales.Effect sizes were represented by fully adjusted standardized betas and odds ratios (OR) alongside 95% confidence intervals (CI). In case standardized effects could not be obtained, unstandardized effects were presented and indicated.We identified a total of 21 observational studies , including information of 42,293  participants from five continents. The early evidence suggests that people who performed PA on a regular basis with higher volume and frequency and kept the PA routines stable, showed less symptoms of depression and anxiety. For instance, those reporting a higher total time spent in moderate to vigorous PA had 12\u201332% lower chances of presenting depressive symptoms and 15\u201334% of presenting anxiety.Performing PA during Covid-19 is associated with less depression and anxiety. To maintain PA routines during Covid-19, specific volitional and motivational skills might be paramount to overcome Covid-19 specific barriers. Particularly, web-based technologies could be an accessible way to increase motivation and volition for PA and maintain daily PA routines. With 106,125,682 confirmed cases all over the world , COVID-19 is a global public health emergency. COVID-19 is characterized by a fast human-to-human transmission through droplet or close contact. Given the lack of appropriate treatments and vaccines during the early stage of the pandemic, many countries implemented procedures recommended by the World Health Organization (WHO) .Quarantine and social distancing measures had already been successfully enforced during earlier pandemics, such as the 2003 outbreak of SARS and the 2014 outbreak of Ebola , 6. ThesNotably psychiatric disorders result in a considerable burden of disease, accounting for 6.7% of overall disability-adjusted life years  and beinIn this rapid review, we sought for observational studies examining the associations of PA and depression and anxiety during the COVID-19 pandemic. Inclusion criteria were: (1) observational studies in any population, including cross-sectional and longitudinal designs. Longitudinal studies could be either prospective or retrospective; (2) studies have tested the association of PA with depression or anxiety, using linear or logistic regressions; (3) depression and anxiety were assessed using validated screening or diagnostic tools. We excluded opinion pieces, systematic reviews, and studies addressing other viruses.We searched the electronic databases PubMed, EMBASE, SPORTDiscus, and Web of Science using the following strategy:  AND (coronavirus OR sars-cov-2 OR COVID* OR severe acute respiratory syndrome OR pandemic) AND . Preprints were searched in MedRxiv, SportRxiv, and SciELO Preprints using the following strategy: \u201c AND (coronavirus OR sars-cov-2 OR COVID* OR severe acute respiratory syndrome OR pandemic)\u201d. Additional hand searches were performed on COVID-19 online repositories on ResearchGate and Google Scholar. Searches were made by an experienced reviewer (FS) on 29th July, 2020. Study selection was conducted in three steps: (1) duplicates removal; (2) screening at the title and abstract level; and (3) assessment based on full-text. The selection was made by one reviewer (FS). Data extraction of selected studies was then performed by three researchers . Data extracted were: author and year, country of the included sample, study design, sample size, age group of the sample included, when possible, mean or range of age sample, % of women, instrument/question used to assess PA levels, instruments used to assess depression and anxiety, publication type and statistical outcomes (regression standardized beta coefficients and odd\u2019s ratios). If they were indicated in the report, fully adjusted coefficients and odd\u2019s ratios were extracted. As studies included in this review used very heterogeneous statistical approaches, a meta-analysis could not be conducted. Instead, we summarized the evidence and presented effect sizes [betas and odds ratios (OR)] with confidence intervals and indicated significant associations between PA and depression or anxiety, separately  were peer-reviewed, seven studies were published as preprints. A summary of studies is provided in Table Data form a total of 42,293 (median\u2009=\u200968% of women) participants were included. Only 1 study was exclusively composed by older adults (over 50\u00a0years), 4 were in children, adolescents, or young adults, while 13 studies were in adults (over 18). Only 7 studies used validated measures to assess PA levels. A wide range of scales to measure depression or anxiety were used, the most used scales being the Beck Depression and Anxiety inventory and the DASS-21. Most studies (Results are summarized and presented in Table The risk of bias of individual studies is presented in Table The present study is, to the best of our knowledge, the first study to summarize the evidence on the associations of PA with depression and anxiety during the COVID-19 pandemic. The majority of studies included in the present review showed that those who performed PA on a regular basis with higher volume and frequency and kept the PA routines stable, showed less symptoms of depression and anxiety. There was consistent evidence that those who could not keep their PA routine stable during the pandemic showed more depression and anxiety symptoms , 41\u201343. Indeed, the observed reduction in PA behavior during COVID-19 specific conditions is highly expected. For example, due to social distancing, exercising in a group setting was limited or completely prohibited. However, high social support is associated with more engagement in PA . Indeed,A web-based tool, e.g., a smartphone application could be a low-threshold and cost-effective option to train, supervise, apply, and adopt such BCTs, especially in terms of COVID-19. First empirical evidence showed preliminary efficacy of apps in promoting PA. Users of such apps are more likely to meet recommendations on PA than non-users \u201359. HoweMost of the studies included in this review used cross-sectional research designs. A causal nature of these associations, therefore, remains unclear. There are notably differences in effect sizes which point at a high heterogeneity of the effects. Several studies further showed methodological shortcomings, e.g., not reporting the participation rate, including less than 50% of eligible participants, no validated tools to assess PA and failure to report standardized coefficients. Heterogeneity in research designs and statistical analyses hindered meta-analytic approaches, which would have provided a more sophisticated overall effect estimate. Finally, several included studies were published as preprints and are currently in review processes for final publications. It is, therefore, planned to update this review in the future.This rapid review shows promising evidence that higher volume and frequency of PA and the keeping of regular PA habits during the Covid-19 pandemic are associated with less symptoms of depression and anxiety. For instance, those reporting a higher total time spent in moderate to vigorous PA had 12\u201332% lower chances of presenting depressive symptoms and 15\u201334% of presenting anxiety. Thus, the promotion of PA habits and routines might be a cost-effective and comprehensive worldwide applicable strategy to overcome the severe gap between people in need and people receiving mental health care, especially in low-income countries with even non-existing mental health supplies. Particularly, web-based technologies, could be an easily accessible way to increase motivation and volition for PA and maintain daily PA routines even under pandemic-specific barriers. However, only very few apps or websites have been tested in RCTs with high methodological standards , 61. Thu"}
{"text": "Pituitary metastases are rare, often deriving from lung or breast cancer owing to the upper vena cava proximity. Pituitary metastases can manifest with signs and symptoms of pituitary tumors, consequent to mass effect  and/or hormonal alterations . Immune checkpoint inhibitors burst immunity against tumors, significantly increasing patients\u2019 survival, but their autoimmune side effects frequently involve the skin, the gastrointestinal tract, and the endocrine glands .A 77-year-old Caucasian man had undergone trans-nasal sphenoidal surgery for a nonsecreting pituitary macroadenoma in 2001, without remnant or endocrine deficits. In 2016, he was operated for a shoulder melanoma. In February 2018, imaging evaluation demonstrated metastases in lung, liver, and femur. Therefore, treatment with pembrolizumab (anti-programmed death 1) was scheduled in May 2018, but, before starting this therapy, a brain computed tomography performed for a sudden loss of consciousness detected a sellar mass of 17\u00a0\u00d7\u00a012\u00a0mm, which extended to the pituitary stalk and compressed the optic chiasma. Focused magnetic resonance imaging confirmed the size and characteristics of the lesion, while emergency evaluation of the hormonal profile demonstrated an impairment of adrenal and thyroid function. The pituitary lesion demonstrated a remarkable shrinkage (8\u00a0\u00d7\u00a06\u00a0mm), which was confirmed by subsequent imaging evaluations.This is the first case reporting on effectiveness of immune checkpoint inhibitors in a patient with pituitary metastasis from a melanoma. Pituitary metastases (PMs) are rare, accounting for 1% of all pituitary tumors and 0.4% of all intracranial metastatic tumors, respectively . They moClinically, PMs present with signs/symptoms in about 20% of patients only, occurring in end-stage disease . The mosRegarding PM treatment, surgery by trans-nasal sphenoidal (TNS) approach is often the first-line therapy, mainly considered for the relief of symptoms rather than for survival improvement that otherwise depends on the primary tumor . RadiothImmune checkpoint inhibitors (ICIs) are novel drugs targeting the molecular regulators of immune response to boost it against tumor tissue: anti-cytotoxic T-lymphocyte antigen 4 (CTLA4), programmed death 1 (PD-1), and its ligand (PD-1L) , 13. So Herein, we describe one case of PM that benefited greatly from treatment with an anti-PD1 (pembrolizumab) for advanced melanoma.A 77-year-old Caucasian male was referred to our endocrine unit in June 2018, for evaluation of a suspected PM from melanoma.In 2001, the patient had been diagnosed with a nonsecreting pituitary macroadenoma of 25\u00a0mm in maximum diameter with suprasellar extension. He had been treated with TNS surgery in another center, and follow-up MRI studies did not demonstrate any residual tissue, up to 5\u00a0years after intervention, and pituitary function was preserved. Unfortunately, these images from the previous patient\u2019s history are not available since he moved from another town.In 2016, he had undergone surgical resection of a melanoma of the right shoulder, and then he was regularly followed up by an oncologist in another hospital, reporting no relapse after surgery.Keytruda, MSD), 2\u00a0mg/kg in cycles of four intravenous infusions each with a 3-week interval, was scheduled. Nevertheless, at the beginning of May 2018 before starting this treatment, a sudden onset of nausea and dizziness followed by loss of consciousness required an emergency brain computed tomography (CT) evaluation, which revealed the appearance a sellar mass of about 17\u00a0\u00d7\u00a012\u00a0mm. A focused sellar MRI confirmed the presence of this lesion, isointense with the surrounding parenchyma in T1-weighted sequences and extending from the anterior pituitary towards the peduncle and the optical chiasma , normal heart rate at 72\u00a0beats per minute, and slightly high blood pressure (145/95\u00a0mmHg). Endocrine evaluation showed mild hyperprolactinemia (prolactin (PRL) 482\u00a0\u00b5IU/ml, normal range 86\u2013324\u00a0\u00b5IU/ml) and panhypopituitarism, with an insufficient dose of thyroid hormone and an excess of urinary free cortisol (UFC) indicating corticosteroid overtreatment  and CT scans performed in August 2018 after one cycle of pembrolizumab infusions revealed reduced metabolic activity and morphovolumetric stability of the other known secondary lesions. The head-MRI study performed in September 2018 demonstrated a significant volume decrease (47%) of the pituitary lesion, thus confirming its secondary nature. In fact, only a paramedian left 8\u00a0\u00d7\u00a06\u00a0\u00d7\u00a06\u00a0mm remnant was described, without alterations in the surrounding structures , hypoadrenalism , sexual dysfunction , or headache or visual field impairment in a patient with neoplasia. DI is a frequent manifestation of PMs (about 50% of cases) since the posterior pituitary is directly perfused by the inferior hypophyseal arteries, lacking a portal system like the anterior lobe and thus being more susceptible to hematogenous spread. On the contrary, anterior pituitary deficiency is reported in 25\u201345% of cases, mainly manifesting itself with central hypothyroidism and secondary adrenal insufficiency , 5. Howeet\u00a0al. reporting two cases from the authors\u2019 practice, the lesions were characterized by similar histopathological features, appearing hemorrhagic with an Mib1 proliferation index of 15\u201320%, and one of them also presented with scattered deposits of melanin and BRAFV600E mutation positivity [There are few reports in the literature regarding pituitary metastases from melanoma. In a recent paper by Mattogno sitivity . PMs frositivity . The tensitivity , 19.plus anti-PD1/PD1L inhibitors) [ICIs are successfully prolonging patients\u2019 survival in the context of advanced solid tumors, but their use is often accompanied with autoimmune endocrine adverse events that are more frequent with the \u201coldest\u201d anti-CTLA4  than with the newest anti-PD1 and anti-PD1L , with the latter potentially causing more toxicity at the thyroid level . The patibitors) .The case we present is paradigmatic for several reasons. First, the patient had already been treated for a pituitary macroadenoma almost a decade before, with neither evidence of remnant tissue nor hormone deficits for several years post-surgery. Second, the patient had demonstrated signs of pituitary dysfunction  before starting pembrolizumab, consistently with the mass effect exerted by the pituitary lesion. Third, pembrolizumab treatment dramatically led to pituitary mass shrinkage, confirming its secondary nature without any significant endocrine or metabolic side effect.Some evidence of the efficacy exerted by novel anticancer treatments at the pituitary/central nervous system level is emerging in the literature, such as a recent report describing the responsiveness to ICIs by a pituitary adrenocorticotropic hormone (ACTH)-secreting carcinoma . In thisplus pembrolizumab) [V600E, an intriguing therapeutical perspective is represented by BRAF inhibitors  that could add another pharmacological approach to these lesions [PMs can be included in the broader category of brain metastases (BMs), which complicate neoplastic diseases in 8\u201310% of cases, with the highest cumulative incidence in melanoma . In theslizumab) , 28. Thelizumab) . Besideslizumab) . An emerlizumab) . A recenlizumab) . Of notelizumab) . However lesions .In conclusion, this clinical case reminds us of the possibility of PMs originating not only from breast or lung cancer as in most cases, but also from other tumors like melanoma, thus highlighting the importance of accurate follow-up of cancer patients to identify potential pituitary involvement. It generally occurs at an advanced stage, and the onset is often sudden and dramatic, due to hormonal dysfunction and/or mass effect. Finally, this report, for the first time, sheds light on the role of ICIs in the management of PMs from \u201cICI-sensitive\u201d malignancies, considering that often surgery is not feasible in such patients. In these cases, targeting the immune checkpoints could significantly prolong the OS rate. Larger studies comparing the role of ICIs, alone or combined with each other or with RT in PMs from \u201cICI-sensitive\u201d cancers, should be carried on to extend their use in these rare and complicated clinical settings."}
{"text": "Deanship of Scientific Research of King Abdul-Aziz University, D-1025-253-1443, was not included.In the original publication , the funResults section, Paragraph Number 8, where the word \u201cpositive\u201d has been corrected to \u201cnegative\u201d:A correction has also been made to the The general arithmetic mean value for the axis of negative attitudes was 3.43 out of 5.0, which means that the average was located in the fourth category of the Likert scale. Thus, the respondents mostly selected \u201cagree.\u201d The arithmetic mean value of the degrees of approval ranged between 2.76 and 3.91, which means that the averages were between \u201cagree\u201d and \u201cuncertain\u201d.Paragraph Number 2 from the Results section, where duplicated paragraph was removed:Another correction has also been made to Knowledge assessment was divided into four main sections: nutrition and diabetes; nutrition and obesity; nutrition and heart diseases; and nutrition and other diseases. The study participants\u2019 responses to the questions on the nutrition and diabetes axis showed that correct answers accounted for 55.6% of the questions, and wrong answers accounted for 44.4%, which illustrated the difference in their knowledge about this subject. The question that most of the participants answered correctly (81.0%) was about the complication of prednisone therapy that requires nutritional intervention. Most of the students (76.0%) did not know the correct answer to the question on how many grams of carbohydrate are contained in one serving unit.The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated."}
{"text": "This paper presents a Brix sensor based on the differential pressure measurement principle. Two piezoresistive silicon pressure sensors were applied to measure the specific gravity of the liquid, which was used to calculate the Brix level. The pressure sensors were mounted inside custom-built water-tight housings connected together by fixed length metallic tubes containing the power and signal cables. Two designs of the sensor were prepared; one for the basic laboratory testing and validation of the proposed system and the other for a fermentation experiment. For lab tests, a sugar solution with different Brix levels was used and readings from the proposed sensor were compared with a commercially available hydrometer called Tilt. During the fermentation experiments, fermentation was carried out in a 1000 L tank over 7 days and data was recorded and analysed. In the lab experiments, a good linear relationship between the sugar content and the corresponding Brix levels was observed. In the fermentation experiment, the sensor performed as expected but some problems such as residue build up were encountered. Overall, the proposed sensing solution carries a great potential for continuous monitoring of the Brix level in liquids. Due to the usage of low-cost pressure sensors and the interface electronics, the cost of the system is considered suitable for large scale deployment at wineries or juice processing industries. In many industries, such as distillery, juice processing, maple and corn syrup production, the outcome always relies on a solution with sugar  as the major solute. Similarly, in brewing and wine making, the final fermented product is dependent on the starting sugar content of the must and the way it changes during fermentation. Therefore, it is essential to monitor the sugar content in these industries, preferably in a continuous manner . DissolvHydrometer is the most commonly used, hand-held, and economical device to measure SG. However, it includes a manual measurement process that can cause an incorrect reading of the meniscus. In addition, temperature compensation is required in the final reading as its operation is temperature dependent ,12,13. TSeveral in-line or continuous monitoring Brix sensors have also been developed. Among them, vis/NIR spectroscopy is a widely used method, especially in wineries, as it can allow the additional benefit of composition analysis ,18. It iThere are commercially available in-line measurement sensors, such as Liquiphant M vibrating fork, Fermetrol probe, Micro-LDS, and Tilt hydrometer . LiquiphIn this paper, we present a low-cost liquid Brix measurement sensor based on the differential pressure measurement principle. The sensor is intended for continuous measurement of Brix to monitor processes such as wine fermentation, brewing, etc. The use of differential pressure for level  and densP is the pressure, g is the acceleration of gravity with a value of 9.8 m/s2, and h is is the level of the liquid in the container. Equation \u2218Bx=Pressure sensor selection is the most important step when designing the proposed Brix sensor. The major criteria considered while selecting the pressure sensor are the pressure range, measurement resolution, output interface, and packaging type. The pressure range is dependent upon the depth at which the sensors are immersed in the testing tank. In the process industry, tank height can vary from 1 m up to 5 m. Hence, a pressure sensor with a range of 0 to 25 psi is desired if the sensors are immersed in the tank for the full depth. However, this is not required for Brix measurement as the sugar content is uniform in the whole tank and measurements at any depth are representative of the solution\u2019s Brix value. This means a pressure sensor with a smaller range can be used in the proposed method of measurement.\u22122. However, at 0.1 \u00b0Bx the density changes to 1000.39 g/L, producing a pressure of 2.8458 psi. The difference of pressures (2.8458\u20132.8447) is 0.0011.To obtain the accuracy of \u00b1 0.1 \u00b0Bx, the preferred resolution of the pressure sensor needs to be 0.001 psi. This is determined by calculating the pressure at a fixed depth for 0 \u00b0Bx and 0.1 \u00b0Bx. For example, at 2 m depth, the pressure is 2.8447 psi at 0 \u00b0B if the density of the liquid is 1000 g/L and the acceleration of gravity is 9.80665 msThe output interface and packaging type of the pressure sensor are important as they relate to how the sensors are interfaced with the measurement electronics and mounted inside the housing. Sensors with analogue or digital interfaces are available and can be used; however, an analogue sensor requires analogue to digital conversion (ADC) and other signal conditioning for interfacing with a microcontroller. The packaging type can be flush mount or port type, but flush mount is preferred as it is less susceptible to residue build up and clogging. Furthermore, the sensor should be suitable for liquid media and temperature-compensated, with an operating temperature range up to 80 \u00b0C. Sensor MPRLS0025PA00001A is a port type sensor with digital output. In real life application, residues/ material can be stuck in the port, which can cause fouling of the sensor, and cleaning of the sensor will become challenging. Some additional packaging may be required to avoid this problem. Hence, preference is given to the TE connectivity sensors. The output of the sensor 86-015G-C is analogue voltage, which requires additional signal conditioning circuitry . On the other hand, 86BSD015PG provides digital output directly in response to the applied pressure. Due to the digital signal output, flush mount, and lower cost compared to 86-015G-C, 86BSD015PG is selected.2C port is directly connected to the I2C bus of the Arduino board. The SD card is used to store the sensor\u2019s output and it is connected to the SPI bus of the Arduino board. The block diagram of the measuring circuit is shown in The pressure read from the sensors is processed in the microcontroller to calculate the density and Brix value of the liquid. The data is stored on the SD card in the CSV format. The flow chart in In general, pressure sensors measure stress over a surface area (diaphragm) that is not totally uniform over the measurement range of the sensors and leads to non-linear output. Therefore, least squares regression is selected and implemented in the embedded algorithm to improve the linearity.y represents the theoretical value of the sensor, x is the actual value of the sensor, a is the gradient, and b is an intercept of the linear polynomial.To obtain the best fit of the line, the following linear polynomial is usedThe least squares regression minimizes the error between the each theoretical data and calibration data. Therefore, the partial derivatives of a and b are zero and are expressed as (9)a=N\u03a3xN is the number of points,From the sensors\u2019 actual values, the sensors\u2019 linear polynomials are calculated, as shown in Initially, all six pressure sensors were calibrated against the standard pressure. The results of the calibrations are shown in The experiment was performed under the atmospheric pressure condition. The Brix sensor a was immA commercially available hydrometer Tilt  was alsoAs mentioned earlier, the SG values of the proposed sensor were evaluated with the commercially available Tilt hydrometer\u2019s output. After achieving satisfactory results in the sugar monitoring experiments, fermentation monitoring was performed to observe the sensor functionality. Fermentation was performed in a tank using a sugar solution and yeast. For this purpose, a 1000 L sugar solution was prepared by mixing 200 kg sugar into 1000 L of water. The mixture was circulated overnight with the help of a pump to dissolve sugar. The following morning specific gravity of the solution was measured with the help of a traditional hydrometer, which was 1.0848. The yeast was activated using lukewarm water and added to the sugar solution to start the process of fermentation. The proposed sensor illustrated in During fermentation, the sugar present in the solution was transformed into ethanol due to the presence of yeasts. The process released carbon dioxide as a by-product. The sugar content started to decrease as fermentation progressed. The decrease in sugar level was continuously recorded in terms of the SG level by the proposed sensor. Additionally, every morning the SG of the solution was measured using a hydrometer, a Tilt hydrometer, and the proposed sensor  for compThe curves in During fermentation monitoring, four sensors were used. Each of the sensors were connected 250 mm apart from each other. This allowed us to observe the effect of increasing the distance between two sensors on the Brix measurement. It is clear from Continuous in-line Brix monitoring is important in many industries, but a suitable and low-cost method does not exist. The available sample-based methods for measuring the liquid Brix value are manual, time-consuming, and most importantly cannot be the solution for continuous monitoring. On the other hand, existing in-line measurement methods are expensive or too cumbersome to use.The Brix sensor we have presented is based on the measurement of differential pressure in the liquid. The sensor is fully automatic due to the use of an embedded microcontroller. The Brix sensor uses two pressure sensors for differential pressure measurement. Hence, the key element of the Brix sensor is the linearity and accuracy of the pressure sensors. The least-squares regression model is used to provide the linear compensation of the proposed Brix sensor. The experimental results suggest that the SG and Brix measurement in an open tank is feasible and accurate. It is independent of the liquid level in the tank. The linearization caused an improvement in the accuracy of the SG value. The results of the proposed sensor in sugar monitoring experiment are compared with a commercially available Tilt hydrometer. The proposed sensor shows the SG value more accurately than the Tilt hydrometer. The Brix value of the sensor shows some offset that exists due to the offset present in the pressure sensors.To show the industrial application of the proposed Brix sensor, it was tested in a real fermentation experiment. The sensor successfully monitored the changing levels of Brix over a period of seven days. Multiple pressure sensors were mounted on the mounting rod to study the effect of the distance between the sensors on the resulting Brix values. It was found that the measurements were independent of the distance between the sensors used for the differential pressure calculation.This is significantly important as it allows the proposed sensor to be used as long as it is fully immersed in the liquid.Problems such as residue build up and sensor failure due to liquid ingress were found and need to be remedied for application of the proposed sensor in actual industrial applications. Nevertheless, the sensor has proven to be a successful design and a low-cost method of monitoring Brix in liquid solutions. We assumed a homogeneous temperature in the experimental tank due to its small size. However, in future, we aim to include the temperature compensation and focus on removing the offset with the help of software algorithms. Additionally, the interface electronics will be modified to include IoT features in the sensor."}
{"text": "Basal lipid and gene expression profiles, measured by LC/MS-MS-based targeted lipidomics and qPCR transcriptomics, respectively, highlighted a differentially altered intestinal eCBome and oxylipin tone, possibly linked to increased mRNA levels of inflammatory markers in db/db mice. In particular, the duodenal levels of several 2-monoacylglycerols and N-acylethanolamines were increased and decreased, respectively, in db/db mice, which displayed more pronounced intestinal inflammation. To a little extent, these differences were explained by changes in the expression of the corresponding metabolic enzymes. Correlation analyses suggested possible interactions between eCBome/oxylipin mediators, cytokines, and bacterial components and bacterial taxa closely related to intestinal inflammation. Collectively, this study reveals that db/db mice present a higher inflammatory state in the intestine as compared to ob/ob mice, and that this difference is associated with profound and potentially adaptive or maladaptive, and partly intestinal segment-specific alterations in eCBome and oxylipin signaling. This study opens the way to future investigations on the biological role of several poorly investigated eCBome mediators and oxylipins in the context of obesity and diabetes-induced gut dysbiosis and inflammation.Obesity is associated with a cluster of metabolic disorders, chronic low-grade inflammation, altered gut microbiota, increased intestinal permeability, and alterations of the lipid mediators of the expanded endocannabinoid (eCB) signaling system, or endocannabinoidome (eCBome). In the present study, we characterized the profile of the eCBome and related oxylipins in the small and large intestines of genetically obese ( Overweight and obesity have reached epidemic proportions globally and are one of the leading public health issues of the 21st century ,4. In faN-arachidonoyl-ethanolamine, AEA, and 2-arachidonoylglycerol, 2-AG), their congeners , and other eCB-like bioactive lipid mediators, their receptors, and metabolic enzymes [N-acylphosphatidylethanolamine phospholipase D, Napepld, in white adipocytes or intestinal epithelial cells, induces a shift in gut microbiota composition and related dysmetabolism [N-acylserotonins, were modified in the small intestine [Among the different systems implicated in regulating the intestinal barrier alongside the gut microbiota and bacterial metabolites is the expanded endocannabinoid (eCB) system\u2014also known as the endocannabinoidome (eCBome)\u2014which includes the eCBs  and diabetic (db/db) mice, despite exhibiting the same body weight and fat mass, are characterized by a divergent eCBome signaling in two different sites  that could be related to the etiology or consequences of the different inflammatory tone observed in the two mutant strains [db/db mice reflect an increased intestinal permeability [ob/ob and db/db mice using targeted LC/MS-MS-based lipidomics and qPCR array-based transcriptomics. Additionally, by performing correlative analyses, we sought to determine to what extent specific bacterial components and bacterial taxa could be related to either inflammatory markers or eCBome components. Deciphering the role that the lipidome targeted here plays in intestinal inflammation, per se or in relation to gut microbiota composition, might open up new possibilities for the treatment of metabolic diseases.In the context of obesity, type 2 diabetes (T2D), and inflammation we have previously shown that genetically obese  and db/db mice (BKS-Lepr/db/db/JOrlRj) and their respective control lean littermates  were used and followed for seven weeks. All mouse experiments were approved by and performed in accordance with the guideline of the local ethics committee . Housing conditions were specified by the Belgian Law of 29 May 2013, regarding the protection of laboratory animals (agreement number LA1230314).As previously described , six-weeThe duodenum, jejunum, ileum and distal colon used in this study to explore the eCBome tone originated from the same mice extensively phenotyped in Suriano et al., . BrieflyLipids were extracted from tissue samples according to the Bligh and Dyer method , as prevThe quantification of eCBome-related mediators , was car\u2212\u0394\u0394Ct method and are represented as fold change with respect to baseline within each tissue. Rps13 was used as a reference gene for the eCBome-related receptors and metabolic enzymes, whereas Rpl19 was chosen as the housekeeping gene for the intestinal inflammatory markers. cDNA was prepared by reverse transcription of 1 \u00b5g total RNA using the Goscript RT Mix OligoDT kit  as previously described [Total RNA and cDNA were obtained, and their quantity and quality were assessed as previously described . Sixty-fAs previously described , a correob/ob and db/db mice were reported. The differences between experimental groups were considered statistically significant with a p \u2264 0.05 and were represented as follows: * p \u2264 0.05, ** p \u2264 0.01, *** p \u2264 0.005, **** p \u2264 0.001. Data were analyzed using GraphPad Prism version 8.00 for Windows . The presence of outliers was assessed using the Grubbs test.Data are presented as the mean \u00b1 standard error of the mean (S.E.M), as specified in the individual tables and figures. The differences between the groups were determined using a One-Way ANOVA followed by Tukey\u2019s post hoc test on \u0394\u0394Ct and on fmol/mg tissue for gene expression levels and mediator levels, respectively. Only statistically significant differences between db/db mice had a significant increase in the full intestinal length as compared to ob/ob mice  in three segments of the small intestine  and in one segment of the large intestine . Although no significant changes were observed in the mRNA expression of Il6, Il1b, Tnfa (data not shown) in any gut segments, a common signature was found in the duodenum, jejunum, ileum, and distal colon of db/db mice as compared to ob/ob mice, which were characterized by a significant increase of the expression of Rorgt2, a transcription factor that directs the differentiation of inflammatory T helper (Th)17 cells [Il17a , one of the major pro-inflammatory cytokines secreted by the Th17 cells, was also observed in the db/db mice , 2-linoleoylglycerol (2-LG), 2-arachidonoylglycerol (2-AG), 2-eicosapentaenoylglycerol (2-EPG), 2-docosapentaenoylglycerol (2-DPG) and 2-docosahexaenoylglycerol (2-DHG). The levels of docosapentaenoic acid (DPA), an omega-3 fatty acid which is the precursor of 2-DPG, were also augmented. Conversely, as shown in , N-oleoylethanolamine (OEA), N-linoleylethanolamine (LEA) and anandamide (AEA). The levels of an endogenous putative metabolite of AEA, N-arachidonoyl glycine (NAGly), were also significantly decreased in the db/db group  did not differ between the ob/ob and db/db groups (data not shown), the levels of their bioactive derivatives 13(S)-HOTre, 12- and 15-HEPE, and 14 and 17-HDHA, respectively, were significantly higher in db/db than ob/ob mice , the same trend was observed for Trpa1, a proposed target for the eCB, AEA. Differences in gene expression were also observed at the level of eCBome-related metabolic enzymes  and Pla1a, and for the catabolic Abhd16a (p = 0.06) and Ces1d whose transcripts were less expressed in db/db compared with ob/ob mice. The transcript levels of Dgke, which is an intracellular lipid kinase that phosphorylates diacylglycerol (DAG) to phosphatidic acid, were also decreased in db/db mice. Concerning NAE metabolic enzymes, there were decreases, in db/db compared to ob/ob mice, of the transcript levels of NAE biosynthetic enzymes Gde1 and Napepld, the latter showing only a trend (p = 0.06) toward reduction, which could explain the decreased levels of several NAEs, as described above. However, an increased expression was observed for the anabolic Pla2g5. With regard to NAE hydrolyzing enzymes, the expression of Faah was reduced in db/db compared to ob/ob mice. We also observed an increase in the transcript levels of the lipoxygenase Alox15 and a decrease of Ptgs2 (Cox2) in the db/db mice. The reduction of the expression of Ptgs2, which is the rate-limiting enzyme primarily responsible for the conversion of cell membrane-derived arachidonic acid into prostaglandins, could explain the decrease of PGF2\u03b1 and PGD2 levels, but also the increase of 2-AG, which is a good substrate for this enzyme.Specifically, for the 2-monoacylglycerol metabolic enzymes, the most relevant results were found for the biosynthetic db/db as compared to ob/ob mice. Accordingly, the levels of DPA were also augmented in the db/db group. As for the NAEs, only the eCB and AEA, showed a decreasing trend (p = 0.09). Modifications were also observed for the omega 3 derivative molecules; particularly 15-HEPE, 17-HDHA, and 13(S)-HOTre, which are the metabolites of EPA, DHA and ALA, respectively, which were increased in the db/db compared to the ob/ob group, although no changes were observed in the free omega 3 fatty acid levels. Regarding the eCBome receptors, we observed, a significant increase in the gene expression of Cacna1b and Cacna1h, Gpr18, and Trpv4 in db/db mice  and eCBome mediator tissue concentrations or metabolic enzyme and receptor mRNA expression levels of the respective two gut segments. An analysis of the Pearson\u2019s rank correlation matrix confirmed the existence of potential links between certain eCBome lipids and genes and either inflammatory markers or bacterial metabolites. In detail, we found that the Gram-negative bacterial component LPS was significantly correlated with the duodenal levels of the PPAR\u03b1 agonist, and hence the anti-lipogenic and anti-inflammatory mediator, 2-PG (Abhd16a (Rorgt2 and Il17a) were positively correlated with 13S-HoTre and the mRNA expression levels of Trpv4, Mgll, Abhd16a, Inpp5d, and Alox 15 17 cells [Il17a , one of the major pro-inflammatory cytokines secreted by Th17 cells. This observation confirms a previous finding of ours [Il6, Il1b and Tnfa, did not differ between the two mice strains, suggesting a selectively impaired Th17 cell balance and a greater inflammatory tone in the intestine of db/db mice. Moreover, the increase in the total intestinal length observed in db/db mice might reflect impaired intestinal epithelial proliferation, apoptosis, and mucosal hyperplasia, as previously described in db/db mice with the same body weight as ob/ob mice [The eCBome modulates several physiological functions, including GI tract function and energy metabolism . It is a/ob mice . The fir17 cells , and, ac of ours  that the/ob mice . db/db mice was accompanied by significant alterations of eCBome mediators and receptors, as well as of other oxylipins and eicosanoids, as compared to ob/ob mice. Common to all intestinal segments were the increases of 2-DPG and 13-HOTrE, which, given their biosynthetic origin from omega-3 fatty acids, are expected to have anti-inflammatory properties. These changes could represent protective responses to inflammation, but studies on the pharmacological activity of these compounds are needed to substantiate this hypothesis. Indeed, pro-inflammatory prostaglandins were, instead, decreased in both the duodenum and ileum and/or jejunum of db/db mice, and so was the potentially pro-inflammatory oxylipin, 11-HETE. On the other hand, the levels of the TRPV1 agonist, 13-HODE-G [db/db as compared to ob/ob mice. These observations, also substantiated by several other, more segment-specific differences in the levels of other eCBome mediators and oxylipins with proposed opposing functions in inflammation, suggest that the observed increased intestinal inflammatory state of db/db mice engenders a series of adaptive and maladaptive responses at the level of these lipid signals, whose effects might also depend on the concomitant, and again segment-dependent, changes of their receptors. In support of this hypothesis are two other novel findings of the present study: (1) the levels of two well established anti-inflammatory mediators, PEA [db/db compared to ob/ob mice, and (2) while no alteration in the expression of the proposed receptors of the former compound  was detected, two of the proposed targets of NAGly, the anti-inflammatory Gpr18 and the pro-inflammatory Cana1h, for which this mediator is an agonist and an inhibitor, respectively [Trpv4, another emerging pro-inflammatory receptor [db/db and ob/ob mice in the levels of the lipid mediators investigated here and the expression of their several known receptors, the assessment of the significance of each of these changes in determining the increased intestinal inflammatory state of diabetic mice will require several further investigations.More relevant to the aims of this study, we observed that the increased inflammatory response in the intestine of 3-HODE-G , were elors, PEA  and NAGlors, PEA , were siectively ,28, alsoreceptor , which hreceptor , was insdb/db and ob/ob mice could explain, at least in part, the different levels of the mediators. In the duodenum, the main enzymes for both the biosynthesis and inactivation of both 2-MAGs and NAEs were less expressed in db/db compared with ob/ob mice, offering no explanation as to why the levels of the former mediators were mostly increased, whereas those of the NAEs were mostly decreased. This discrepancy was even stronger in the distal colon (and jejunum), where the expression levels of the catabolic enzymes for 2-MAGs, but not those of their anabolic enzymes, were increased, and yet the concentrations of 2-DPG were also counterintuitively increased. The effect of the availability of the ultimate biosynthetic precursors for these fatty acid derivatives may in part have prevailed on the expression of metabolic enzymes, since we found that in all intestinal segments the levels of DPA, but not those of other measured fatty acids, were increased in db/db compared with ob/ob mice, thus reflecting the increased concentrations of 2-DPG. On the other hand, the relative levels of expression, between db/db and ob/ob mice, of Alox15 and Ptgs2 (respectively increased and decreased in the former genotype) in the duodenum, and of the former enzyme also in the jejunum and distal colon (again increased in the former genotype in both segments), explained the increased and decreased levels of several 15-LO and COX-2 derivatives in intestinal sections of db/db mice. The increased levels of some 15-LO derivatives of linoleic acid were also possibly sustained by the observed concomitant increase of this fatty acid precursor, at least in the jejunum and ileum.We also studied the segment-specific mRNA expression of enzymes catalyzing the biosynthesis and degradation of the lipid mediators analyzed here to gain a preliminary understanding as to whether or not putative differences between db/db mice. In particular, the pro-inflammatory bacterial component LPS was significantly correlated with the duodenal levels of 2-PG, a PPAR\u03b1 agonist with likely anti-inflammatory action, whereas, in the distal colon, the two inflammation markers found to be up-regulated in db/db mice, i.e., Rorgt2 and Il17a, were positively correlated with the potentially anti-inflammatory mediator, 13S-HoTre, and with the mRNA expression levels, respectively, of the pro-inflammatory channel Trpv4, and of the inactivating enzymes of mostly anti-inflammatory 2-MAGs, i.e. Mgll and Abhd16a, as well with Alox 15, which produces both pro-and anti-inflammatory mediators. These correlations suggest that alterations in the signaling of eCBome mediators and oxylipins may depict segment-specific adaptive or maladaptive responses to the increased intestinal inflammation observed in db/db mice. Likewise, the correlations observed between the absolute abundance of fecal bacterial taxa involved in gut inflammation [Clostridium_sensu_stricto_1, Dubosiella, Bacteroides and Turicibacter, with both duodenal and colonic concentrations of several 15-LO derivatives and Alox15 and Gpr18 expression levels, reinforced this hypothesis. This is also supported by the fact that the quantity of these bacterial taxa, which was significantly, or tended to be, affected by either the ob/ob or the db/db genotype or both, was also either positively or negatively correlated with several metabolic and inflammatory markers in other body sites  [Finally, the observed correlations among eCBome and other lipid mediators and the levels of inflammatory markers or the relative abundance of some gut microbiota taxa reinforce the hypothesis that alterations in the intestinal tone of the eCBome and oxylipin signaling are related to higher inflammation and dysbiosis in ammation ,32,33,34 tissue) , furtherdb/db mice display a higher inflammatory state in the intestine when compared to ob/ob mice. This difference is associated with profound and potentially adaptive or maladaptive, and partly intestinal segment-specific, alterations in eCBome and oxylipin signaling. These alterations: (1) are only to a minor extent explained by changes in the expression of the corresponding metabolic enzymes, and (2) correlate with both inflammatory markers and fecal microbiota taxa that have been previously found to be altered during conditions of intestinal inflammation in mice, or following the correction thereof. This study opens the way to future investigations on the biological role of several poorly investigated eCBome mediators and oxylipins in the context of obesity and T2D-induced gut dysbiosis and inflammation.In summary, we discovered that"}
{"text": "E-cigarette use among middle and high school youth increased from 2. 5 million in 2014 to 9.2 million in 2019, becoming the most common tobacco product used among youth. Hispanic youth, the largest ethnic minority in the United States, have higher rates of tobacco use, including e-cigarettes, than non-Hispanics. Identifying factors that put youth at risk for future e-cigarette use is vital to focusing prevention efforts. Informed by social cognitive theory, this study identifies predictors of e-cigarette uptake among e-cigarette na\u00efve youth in a predominantly low-income Hispanic community.n = 862). Outcome measures were e-cigarette initiation and current use at follow-up. Logistic regression models tested six hypotheses about predictors of e-cigarette initiation and current use: (1) intention, (2) outcome expectations, (3) knowledge, (4) friendship network exposure, (5) normative beliefs, and (6) social acceptability.1,249 students (6\u20138th grades) from two middle schools in El Paso, Texas consented to participate in this longitudinal survey during the 2016\u20132017 school year. The study sample for analysis was restricted to e-cigarette na\u00efve students (n = 71) reported initiation at follow-up; of these, 3% (n = 23) reported current use. Significant predictors of initiation were intention , outcome expectations , friendship network exposure , normative beliefs , and social acceptability . Significant predictors of current use were intention  and friendship network exposure .Among e-cigarette na\u00efve students at baseline, 8% (With the increasing popularity of e-cigarettes, age appropriate and culturally sensitive prevention strategies tailored at altering these predictive factors are essential in preventing future e-cigarette use. Use of electronic cigarettes (e-cigarettes) among middle and high school youth increased from 2.5 million in 2014 to 9.2 million in 2019 . Much isExamining the beliefs that underlie e-cigarette use behavior among adolescents will be beneficial to address this health problem and successfully guide prevention efforts. Thus, this study is informed by social cognitive theory (SCT), which posits that learning occurs in a social context with a three-way reciprocal interaction of the individual, social environment, and behavior and has previously been used to study tobacco use among adolescents , 7. GrowIf I were to use an e-cigarette, I would enjoy it\u2014are important determinants of tobacco initiation and subsequent steady use  and their impact on youth tobacco use , 21. ButHispanic youth report greater intention to use tobacco and e-cigarettes compared to non-Hispanic peers  and greaThe purpose of this study is to examine SCT-based predictors of e-cigarette initiation and current use among 6, 7, and 8th grade youth who had never tried e-cigarettes at baseline in a low-income Hispanic community. We hypothesized that significant predictors of e-cigarette initiation and current use at the individual level were (1) intention, (2) outcome expectations, and (3) knowledge; and at the social environmental level, (4) friendship network exposure, (5) normative beliefs, and (6) social acceptability. We examined the hypothesized predictors to identify their unique influence beyond demographic characteristics  identified as factors related to e-cigarette use among youth , 11, as To identify predictors of e-cigarette initiation and current use over time, we analyzed data collected at baseline and again at follow-up during the 2016\u20132017 school year as part of an evaluation of Teens Against Tobacco Use (TATU), a school-based peer-led tobacco prevention intervention . Two TitAmong the 1,695 eligible students, 1,249 (73.7%) returned signed parental consent forms; 1,166 (93.3%) of these students completed surveys at baseline and follow-up. The sample for this analysis, however, was limited to e-cigarette naive students at baseline, defined as never tried an e-cigarette at the time of the baseline survey, with 862 (73.9%) students included in the final sample.The anonymous survey consisted of Likert scale questions drawn primarily from the Pierce et al. measure of smoking susceptibility  and the Have you ever tried or experimented with electronic cigarettes, even one or two puffs?\u201d .E-cigarette initiation was assessed by asking \u201c puffs?\u201d . StudentPredictors of e-cigarette initiation and current use were assessed at baseline through a composite of SCT constructs of intention, outcome expectations, and knowledge in the individual domain; and friendship network exposure, normative beliefs, and social acceptability in the social environmental domain.r = 0.61), e.g. Do you think you will use any kind of tobacco product or electronic cigarette in the next year?; outcome expectations through five items (\u03b1 = 0.61), e.g. Do you think you might enjoy smoking an electronic or regular cigarette?; knowledge through three items (\u03b1 = 0.56), e.g. Do you think electronic cigarettes contain harmful chemicals?; normative beliefs through three items (\u03b1 = 0.42), e.g. Do you think smoking looks cool?; and social acceptability of tobacco use among peers through three items (\u03b1 = 0.91) asking \u201cDo you think it is okay for people your age to: Smoke cigarettes? Use e-cigarettes? Smoke hookah?\u201d. Response options ranged from 1 = \u201cDefinitely NOT!\u201d, 2 = \u201cProbably not\u201d, 3 = \u201cNeutral\u201d, 4 = \u201cProbably yes\u201d, and 5 = \u201cDefinitely YES!\u201d. Responses for two items under outcome expectations  and one item under normative beliefs (Smoking cigarettes or e-cigarettes is a good way to make friends.) were on a different 5-point scale, where 1 = \u201cStrongly disagree\u201d, 2 = \u201cDisagree\u201d, 3 = \u201cNeutral\u201d, 4 = \u201cAgree\u201d, and 5 = \u201cStrongly agree\u201d. Friendship network exposure was measured with three items (\u03b1 = 0.87) asking \u201cHow many of your friends: Smoke cigarettes? Use e-cigarettes? Smoke hookah?\u201d with response options ranging from 1 = \u201cnone\u201d to 5 = \u201call\u201d.We assessed each construct on a 5-point Likert scale using multiple questions and calculated the scale mean to create a continuous variable. Intention was assessed through two items , school performance , and school . For thep < 0.05) to assess their combined influence on e-cigarette initiation at follow-up. We replicated these models with current use of e-cigarettes at follow-up as the dependent variable, rather than initiation. The amount of missing data was minimal, ranging from 0.006 to 3.5%; therefore, we used listwise deletion, with sample sizes differing minimally across models. We analyzed the data using STATA version 15.1 statistical software.Descriptive statistics characterized non-initiators and initiators. Sampling was not classroom dependent and we therefore did not apply multilevel modeling at the classroom level. We instead used logistic regression to test the relation between each hypothesized predictor and e-cigarette initiation at follow-up, controlling for gender, ethnicity, grade, school performance, and school. It should be noted that initial testing for multicollinearity did not produce problematic results. We then fit an additional model with the significant independent predictors (n = 71) reported e-cigarette initiation at follow-up (n = 23) reported current use. E-cigarette initiation was made up of slightly more females  than males . Grade was the only covariate that significantly differed across participants (p < 0.05). Initiation was reported by more 8th grade students  than 7th  and 6th grade students . Most non-initiators  and initiators  reported school performance of mostly A's, mostly B's, and mostly C's. The number of initiators was slightly higher at middle school 2  versus middle school 1 .Among the 862 e-cigarette na\u00efve respondents at baseline, 8.2% . A one unit increase in baseline scores for outcome expectations\u2014e.g., from Agree to Strongly Agree\u2014predicted 1.73 times higher odds of initiation at follow-up . Knowledge was not a significant predictor of initiation .Logistic regression models separately examined the hypothesized predictor of e-cigarette initiation at follow-up , controlAOR = 1.53; 95% CI = 1.11\u20132.11; p = 0.01). Students with higher baseline scores on normative beliefs had 2.12 times higher odds of initiating e-cigarettes at follow-up . Those with higher social acceptability of e-cigarette use at baseline had 1.91 times greater odds of initiation at follow-up .In the social environmental domain, normative beliefs, friendship network exposure, and social acceptability were significant predictors of initiation . RespondAOR = 1.86; 95% CI = 1.13\u20133.07; p = 0.02). Likewise, a one unit increase in friendship network exposure scores\u2014e.g., from Some to Most\u2014predicted 1.52 times increased odds of initiation . McFadden's R2 ranged from 0.03 to 0.06 in the separate models. When we entered the significant predictors into a combined model, McFadden's R2 was 0.08.When entering only the significant predictors of e-cigarette initiation from the separate models into a combined model , intentiAOR = 1.98; 95% CI = 1.07\u20133.69; p = 0.03). Outcome expectations at baseline were not a significant predictor of current use at follow-up , nor was knowledge .Following the same analytic process used to predict initiation, we entered the hypothesized predictors into separate logistic regression models to predict e-cigarette current use at follow-up , with geAOR = 1.69; 95% CI = 1.06\u20132.70; p = 0.03). Normative beliefs at baseline were not a significant predictor of current use at follow-up , nor was social acceptability .In the social environmental domain, friendship network exposure was a significant predictor of e-cigarette current use at follow-up. Students with higher baseline friendship network exposure to tobacco products had 1.69 times increased odds of current use at the end of the school year . Intentions remained associated with a higher risk of current use in the multivariate model (p > 0.05). McFadden's R2 ranged from 0.02 to 0.03 in the separate models and was 0.05 in the combined model.Upon entering only the significant predictors from the separate models into a combined model, friendship network exposure significantly predicted e-cigarette current use. A one unit increase in baseline friendship network exposure scores predicted 1.68 times higher odds of current use at follow-up .The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Screening tests for body posture defects and abnormalities conducted over the past several decades have revealed a significant and constantly increasing problem of health risks in children. A sedentary lifestyle, which is considered to be the primary cause, can result in proprioceptive disorders leading to postural instability. The aim of the study was to find the correlation between the level of proprioceptive control and the number of postural disorders. The study involved a representative group of 1090 children aged 8\u201310 years, from randomly selected primary schools. Subjects who scored from 1 to 5 points in a prior postural screening test were qualified for the examination of the postural control system. The examination of the postural control system was carried out using an electronic station enabling assessment of postural stability and proprioception. A single leg stance test showed that the number of postural disorders does not significantly impact proprioceptive control. Proprioceptive control was found to significantly increase with the age of the children, and girls presented significantly better proprioceptive control in relation to the boys in each age group. The process of posturogenesis is accompanied by a continuous, conditioned, and encoded development of postural reflex and locomotion. A normal process of body posture development depends on numerous exogenous and endogenous factors . DecreasScreening tests designed to detect postural defects and abnormalities, conducted over the past several decades, have shown there is a significant and constantly growing problem of health risks in children ,4,5,6. EA group of 1090 individuals, 564 girls and 526 boys aged 8\u201310 years from selected primary schools of the city and municipality of Zielona G\u00f3ra, were enrolled in the study. The examinations were carried out between 2009 and 2010 as a part of a program entitled \u201cProsto do zdrowia\u201d, focusing on postural defects prevention, as well as diagnostics, and aimed toward prophylaxis and therapy of postural defects, and at improving the overall level of health and physical fitness in children and adolescents. The specific objective of the program was to also shift the emphasis from treatment to prevention in accordance with current guidelines for health care development. The characteristics of the study group are presented in Individuals were assessed for the presence of body posture defects. The individuals who were diagnosed with at least one postural defect were qualified for the specialist examination performed using a Delos Postural System Professional 4.0 device . The tests were carried out by a specialist in physiotherapy with a doctoral degree in medical sciences.Disturbed alignment of the spine in the frontal plane;Disturbed alignment of the spine in the sagittal plane;Scoliosis (positive result in the Adam\u2019s test);Knee malalignment ;Foot malalignment .Points were awarded depending on the occurrence of:One posture defect scored one point. Thus, the respondents could obtain a result from 0 (no posture defect) to 5 points .The inclusion criteria were obtaining from 1 to 5 points in the body posture examination by visual assessment and Adam\u2019s test.-physical disability;-mental disability;-developmental anomalies of the feet;-true shortening of a lower limb;-sensory integration disorders;-neurological conditions;-nystagmus;-attention deficit disorder;-feeling unwell on the day of the examination.The exclusion criteria were as follows:Parents/legal guardians of the subjects expressed their written consent for the examination.The use of the research for this paper was approved by the Independent Bioethics Committee of the Medical University of Gda\u0144sk, dated 19 September 2011, resolution number: NKEBN/359/2011, and accepted in writing by the coordinator of \u201cProsto do zdrowia\u201d program.The test was performed under similar lighting and time conditions by the same person.The stability test was performed by means of electronic postural proprioceptive station (DPPS). The station, connected to a personal computer with specific software DPPS 4.0), consisted of an electronic postural reader, an infrared sensor bar, and a display . In case.0, consiThe data from the postural reader were a stream of acceleration samples taken by converting the sensor outputs into the digital domain at a rate of 100 Hz. These raw data were initially averaged with a 4-tap sliding window; therefore, the 3 dB bandwidth was narrowed to approximately 11 Hz. Scaling with the calibration data of the instruments was then performed to convert the raw data into angles. The equations involved in the management of data from the postural reader have been described in a previous article [The stability index with closed eyes, SI CE (%), was used to assess proprioceptive control. This index allows researchers to grade all tests and to compare individuals with high stability scores obtained during the test  and those with a lower level of stability (very low autonomy of the system) .Static Riva Test was used to assess the functional status of the postural control system. It was performed on an electronic station for postural stability and proprioception tests, Delos Postural System Professional 4.0.Static Riva Test was performed using Delos Vertical Controller (DVC), which was attached to the subject\u2019s sternum, and Delos Postural Assistant (DPA), which the subjects were asked to use as hand support in case of imbalance. The DPA was adjusted to each person\u2019s height to provide adequate support. The device was connected to a computer with specialized software (PSM 4.0) designed to receive and analyze information from the specific parts of the device.Static Riva Test consisted of 20 s trial of one-leg stance on the left leg with eyes open, then 20 s on the right leg with eyes open, followed by the same amount of time on the left leg with eyes closed, and on the right leg with eyes closed. Every 20 s trial was followed by a 15 s interval.All calculations were performed using Microsoft Excel version 2007 and Statistica version 8.5 statistical package. In the statistical description of the quantitative data, classic position measurements were used, such as arithmetic mean, median, and mode, as well as the standard deviation and the definition of minima and maxima as general measures of variation.p < 0.05 was assumed as the level of statistical significance of differences.When comparing two groups for quantitative and stepwise data, the Mann-Whitney U test (comparison of two groups) was used, and the Wilcoxon test (comparison of two measurements with the same people). In the comparative analysis of a larger number of nonparametric data groups, the Kruskal-Wallis test was used together with the post hoc multiple test (Dunn test) as a non-parametric equivalent of ANOVA, the parametrically evaluated method of analysis of variance (ANOVA) using the Fischer test, and the post hoc tests Scheffegi and RIR Tukey. In order to assess the strength, direction, and significance of linking variables, Pearson\u2019s linear correlation coefficient was used. In all statistical tests, Statistical analysis was carried out in cooperation with the School of Medical Informatics and Biostatics at the Medical Faculty of the Medical University of Gda\u0144sk.The influence of the number of postural disorders on the level of proprioceptive control index in the children aged 8 years.p = 1)  . The Mann-Whitney U test showed that the level of stability index of the girls was significantly higher than the level of stability index of the boys .The influence of the number of postural disorders on the level of proprioceptive control in the children aged 9 years.p = 0.4)  . p < 0.0001). The level of the stability index for the girls was significantly higher than the level of the stability index for the boys   . p < 0.0001). The Mann-Whitney U test showed that the level of the stability index for the girls was significantly higher than the level of the stability index for the boys representing this age group . A multiple comparison test was performed to identify the age group with the highest differences. The test showed that all the age groups differed from one another in a statistically significant manner, and the level of the stability index with closed eyes visibly increased with age. The relationships are shown in detail in The Kruskal-Wallis test showed statistically significant differences between the level of the stability index with closed eyes and the age of the subjects (According to Riva, decreased physical activity results in reduced proprioceptive information supplied, which consequently leads to poorer neuromuscular control causing functional instability of the joints and decreased balance capacity, which may eventually lead to postural instability ,5. DynamThe current study showed significant age-related differences in the scores identified during one leg stance trials. Posture stability level constantly increased from 8 to 10 years of age. This is consistent with results reported by Morioka, who believed that the ability to maintain a standing position on one leg with eyes open rapidly improves from late pre-school to early school age, and then slows down during later school age. Statistically significant differences were also observed between girls and boys. The results indicate that girls have a better ability to maintain a stable posture in a one leg stance, compared to boys in every group from 8 to 10 years of age.On the other hand, the present study has shown that the number of postural defects does not significantly impair posture stability in any of the age groups from 8 to 10 years. In some age groups it is possible to only observe a tendency towards a decrease in the stability index associated with a larger number of postural defects. In the 8-year-old group, the downward trend was observed only if there were more than two defects in body posture. In the group of children aged 9 years, a similar tendency was observed in cases with up to three postural defects. In 10-year-olds, poorer results were observed only in the group of children with three defects in comparison to the children with two defects. The lack of a downward trend in the stability index in the groups with more than three disorders in body posture may be linked to the small size of the groups with four or five defects, which is reflected by a relatively large range of standard error. It should also be considered that postural defects were not rated by the authors for the quality of the disorder, but only in terms of their presence. Further research should also consider the degree of the disorder, as it is possible that the stability index will deteriorate with increasing defects. Studies by Herdea et al. have shown that some cases of idiopathic scoliosis occur and progress due to insufficient levels of vitamin D, calcium, and melatonin . TherefoProprioceptive control significantly increases with age in children with diagnosed postural defects.Girls aged 8 to 10 years had statistically significantly better results in proprioceptive control compared to boys, in all age groups.The number of postural defects does not significantly impair posture stability in any of the age groups from 8 to 10 years.The number of postural defects has no significant effect on proprioceptive control."}
{"text": "A cohort study was conducted to examine the association of an increased body mass index (BMI) with late adverse outcomes after a carotid endarterectomy (CEA). It comprised 1597 CEAs, performed in 1533 patients at the Vascular Surgery Clinic in Belgrade, from 1 January 2012 to 31 December 2017. The follow-up lasted four years after CEA. Data for late myocardial infarction and stroke were available for 1223 CEAs, data for death for 1305 CEAs, and data for restenosis for 1162 CEAs. Logistic and Cox regressions were used in the analysis. The CEAs in patients who were overweight and obese were separately compared with the CEAs in patients with a normal weight. Out of 1223 CEAs, 413 (33.8%) were performed in patients with a normal weight, 583 (47.7%) in patients who were overweight, and 220 (18.0%) in patients who were obese. According to the logistic regression analysis, the compared groups did not significantly differ in the frequency of myocardial infarction, stroke, and death, as late major adverse outcomes (MAOs), or in the frequency of restenosis. According to the Cox and logistic regression analyses, BMI was neither a predictor for late MAOs, analyzed separately or all together, nor for restenosis. In conclusion, being overweight and being obese were not related to the occurrence of late adverse outcomes after a carotid endarterectomy. According to the World Health Organization (WHO), in 2016, almost 60% of adults in the WHO European Region were overweight and obese ,4,5,6. TExtracranial carotid disease accounts for approximately 18\u201325% of ischemic strokes ,12. CaroData on the association between obesity and CEA adverse outcomes are inconsistent. In some of the investigations ,14, therThe aim of the present study was to examine the association of increased BMI (overweight and obesity) with late adverse outcomes after CEA.As previously described in detail , this co2. For the purpose of the present study, patients were categorized into four categories: underweight (<18.5), normal weight (BMI = 18.5\u201324.9), overweight (BMI = 25.0\u201329.9), and obese (BMI \u2265 30) . Moreover, there was no significant correlation between the independent variables included in the study. None of the correlation coefficients was higher than 0.75, taken as the limit value significant for multicollinearity. The follow-up data concerning stroke, myocardial infarction, and death, separately and together, did not show any difference between those with a normal weight, those who were overweight, and those with obesity, analyzed by the Kaplan\u2013Meier test. The curves almost overlapped with p values ranging from 0.973 to 0.764.  had significantly higher perioperative cardiac complications, while bleeding was significantly more frequent in patients who were underweight; however, neither of these two BMI groups was analyzed separately in our study. However, while we did not find an association between being overweight and having obesity with any of the late adverse outcomes, Volkers et al. [2 was one of the predictors of five-year mortality after CEA for asymptomatic carotid stenosis. In the present investigation, we analyzed symptomatic and asymptomatic patients together, and we did not include patients who were underweight in the analysis due to the very small number. Jeong et al. [The literature data on the association of BMI with late adverse outcomes after CEA are scarce. In fact, we found only a few articles ,20,21,22s et al.  found ths et al. , also prs et al. . In the Although being overweight and having obesity were not significantly related to late complications after CEA, they were, significantly and independently of other variables, associated with some factors found to be predictors of late adverse outcomes, such as non-insulin-dependent diabetes mellitus ,26,27,28In the present study, non-insulin-dependent diabetes mellitus was significantly more frequent in both patients who were overweight and patients with obesity, compared to those with a normal weight. It is well known that an increased BMI is strongly correlated with type 2 diabetes mellitus (T2DM) ,34. AccoBoth obesity and atherosclerosis are lipid storage disorders, with triglyceride accumulation in the fat tissue and cholesterol esters in atherosclerotic plaques . In our It is also known that obesity contributes directly to incident cardiovascular risk factors, including dyslipidemia, type 2 diabetes, hypertension, and sleep disorders, but it can lead to the development of some cardiovascular diseases and cardiovascular disease mortality, independent from other risk factors ,44. The There were some limitations to our investigation. Due to the small numbers, patients who were underweight were not included in the present study. Moreover, class II and III obesity were put together with class I obesity, and all these BMI subgroups could be, according to the results of other investigations, associated with complications after CEA. There is also the question of whether BMI is the best measure of adiposity, or whether it would be better to use measures such as the waist circumference, waist-to-height ratio, waist-to-thigh ratio, or the InBody Test ,47,48,49Compared to the patients with a normal weight, the patients who were overweight were significantly more frequently males, with non-insulin-dependent diabetes mellitus, and a more frequent use of ACEI in hospital discharge therapy. The patients with obesity were significantly younger, with myocardial infarction and non-insulin-dependent diabetes mellitus in their personal history, with more frequently increased triglyceride levels, more frequent usage of OAC in the therapy before the operation, and a shorter clump duration.However, being overweight or having obesity was not significantly associated with the occurrence of myocardial infarction, stroke, death, and restenosis, as the late adverse outcomes after a carotid endarterectomy."}
{"text": "Mycobacterium smegmatis mc2155. McGee has a genome 156,008\u2009bp long, containing 237 protein-coding genes, 31 tRNA genes, and 1 transfer-messenger RNA (tmRNA) gene. McGee shares high gene content similarity to phages in actinobacteriophage cluster C1.Mycobacteriophage McGee is a myovirus isolated from a wet soil sample collected at Manassas, VA, using  Mycobacterium smegmatis mc2 155 have been isolated and characterized, providing important insights into viral diversity and population structure . The soil sample was washed with 7H9 liquid medium, the wash filtered , and the filtrate plated in soft agar overlay containing Mycobacterium smegmatis mc2 155. McGee was purified with multiple rounds of plating. Negative-stain transmission electron microscopy revealed McGee to possess a Myoviridae morphology , and sequenced on an Illumina MiSeq instrument v3 reagents), resulting in 77,248 single-end 150-bp reads providing 73\u00d7 coverage. The raw reads were assembled and assessed using the programs Newbler v2.9 ( reagentshttp://cobamide2.bio.pitt.edu/) (http://phages.wustl.edu/starterator), whereas gene functional assignments were determined using BLASTp searches against the NCBI nonredundant v2.13.0 (13Genes were identified and annotated using DNA Master v5.23.6 (tt.edu/) , GLIMMER v2.13.0  and acti v2.13.0 , HHpred  v2.13.0 , and Pha v2.13.0 . Aragorn v2.13.0  and tRNA v2.13.0  were use2.13.0 1315 and TM2.13.0 13, 17. AllA total of 269 putative genes were identified in McGee, including 237 protein-coding genes, 31 tRNAs, and 1 tmRNA. Among those that could be assigned a function, the virion structure and assembly genes include a major capsid protein (gp101), capsid decoration protein , tail sheath protein (gp129), tail assembly chaperones , tape measure protein (gp134), minor tail proteins , and baseplate wedge protein . The genes involved in McGee\u2019s DNA metabolism include DNA helicase (gp188), thymidylate kinase (gp197), DnaC-like helicase loader (gp201), DnaB-like double-stranded DNA (dsDNA) helicase (gp202), DNA primase (gp204), DnaJ-like chaperonin (gp206), single-stranded DNA (ssDNA) binding protein (gp207), DnaE-like DNA polymerase III \u03b1 (gp208), RF-1 peptide chain release factor (gp209), RecA-like DNA recombinase (gp210), Holliday junction resolvase (gp210), RusA-like resolvase (gp214), Ro-like RNA binding protein (gp233), and multiple proteins with a helix-turn-helix DNA binding domain . Genes involved in lysis, lysin A, holin, and lysin B are encoded by gp252, gp253, and gp254, respectively. The largest gene in McGee is a hypothetical protein gp98  and the smallest gp64 (75\u2009bp long).https://phagesdb.org/), McGee was assigned to phage cluster C1 (Based on its gene content similarity (GCS) of at least 35% to phages in the Actinobacteriophage database (uster C1 , 18, 19.ON637764, while its raw reads have been deposited under Sequence Read Archive accession number SRX14483217.The complete genome sequence for McGee can be found at GenBank under accession number"}
{"text": "The application of different approaches calculating the anthropogenic carbon net flux from land, leads to estimates that vary considerably. One reason for these variations is the extent to which approaches consider forest land to be \u201cmanaged\u201d by humans, and thus contributing to the net anthropogenic flux. Global Earth Observation (EO) datasets characterising spatio-temporal changes in land cover and carbon stocks provide an independent and consistent approach to estimate forest carbon fluxes. These can be compared against results reported in National Greenhouse Gas Inventories (NGHGIs) to support accurate and timely measuring, reporting and verification (MRV). Using Brazil as a primary case study, with additional analysis in Indonesia and Malaysia, we compare a Global EO-based dataset of forest carbon fluxes to results reported in NGHGIs.2yr\u22121), while Brazil\u2019s NGHGI reported a net carbon source (+\u20090.8 GtCO2yr\u22121). After adjusting the EO estimate to use the Brazilian NGHGI definition of managed forest and other assumptions used in the inventory\u2019s methodology, the EO net flux became a source of +\u20090.6 GtCO2yr\u22121, comparable to the NGHGI. Remaining discrepancies are due largely to differing carbon removal factors and forest types applied in the two datasets. In Indonesia, the EO and NGHGI net flux estimates were similar (+\u20090.6 GtCO2 yr\u22121), but in Malaysia, they differed in both magnitude and sign . Spatially explicit datasets on forest types were not publicly available for analysis from either NGHGI, limiting the possibility of detailed adjustments.Between 2001 and 2020, the EO-derived estimates of all forest-related emissions and removals indicate that Brazil was a net sink of carbon (\u2212\u20090.2 GtCOBy adjusting the EO dataset to improve comparability with carbon fluxes estimated for managed forests in the Brazilian NGHGI, initially diverging estimates were largely reconciled and remaining differences can be explained. Despite limited spatial data available for Indonesia and Malaysia, our comparison indicated specific aspects where differing approaches may explain divergence, including uncertainties and inaccuracies. Our study highlights the importance of enhanced transparency, as set out by the Paris Agreement, to enable alignment between different approaches for independent measuring and verification.The online version contains supplementary material available at 10.1186/s13021-023-00240-2. The intde Table  35, 54], 54\u22121) a2) in 2019 [The large difference between the gross emissions in Malaysia may be linked to the fact that most reported emissions and area change (>\u200999%) in the Malaysian NGHGI are associated with \u201cforest land converted to settlement\u201d  had limited capacity and (b) had less historical responsibility in terms of emissions contribution. Under the Enhanced Transparency Framework, there is now greater requirement for transparency and all countries will be required to provide a Biennial Transparency Report (BTR) from 2024  to improTransparent methods used in each of Brazil\u2019s datasets made it possible to distinguish and quantify methodological and definitional differences such as forest categories. This transparent information enabled adjustments to be made to improve comparability and thus credibility of the estimates. Unfortunately, such a geospatial analysis was not possible in other countries, such as Indonesia and Malaysia, where digitised versions of the LULC maps were unavailable for open-access\u00a0analysis. While it may not always be possible to fully reconcile differences between datasets as each has their own motivations and assumptions, the differences should be traceable so they can be understood. For greater transparency, countries could consider clearly documenting the emissions and removal factors used in their submissions to the UNFCCC, as was demonstrated in the Malaysian BUR4.All the NGHGIs considered in our study clearly stated that tree crops such as palm oil and rubber are classified as perennial agricultural crops. Associated emissions and removals are, therefore, not necessarily forest-related Tables , 2. The Variations in definitions are not limited to our analysis and vary between global models and other internationally applied flux datasets such as the FAO , emphasiFor completeness, there is a need to consider all forest types, which might be GHG sources or sinks. EO data can help capture spatial and temporal heterogeneity of forest types and associated fluxes, to improve accuracy.Our analysis has shown spatial differences in the forest cover between the Brazilian NGHGI and Global EO approach, especially outside the Amazonia biome, with divergences in the savannah and dry forest biomes Fig.\u00a0. These dAcross the Brazilian biomes, fire and logging disturbances can cause forest degradation that often occurs at smaller-scales, and thus goes undetected by moderate resolution (>\u200930\u00a0m) remote sensing products . Due to Our analysis highlighted the differences in the removal factors used by different datasets as an important discrepancy, demonstrating the ongoing uncertainty with regards to applying removal factors for different forest types. Per unit area, the difference was particularly evident in young secondary forests in Brazil (\u201cother land converted to secondary forests\u201d) Table . HoweverAs many countries and organisations aim to reduce their net carbon emissions through forest conservation and restoration, accurate and representative removal factors for all forest types , 45, 56 In this study, we highlighted the differences between the flux datasets regarding the forest classification assigned to a given pixel in space and time, which has implications for the emission/removal factor applied . The impIndependent data, such as that from the Global EO model included here, have the potential to provide key sources of information for the MRV of NGHGIs . Convers2\u00a0yr\u22121) and the NGHGI flux (0.8\u00a0GtCO2\u00a0yr\u22121) from 2001 to 2020 was 1.0\u00a0GtCO2\u00a0yr\u22121 and estimates were opposite in sign. Adjusting the Global EO flux by applying the Brazilian NGHGI definition of managed forest area and only considering the assumptions in their inventory (in terms of land transition and flux categories) resulted in the adjusted Global EO net flux to be 0.6\u00a0GtCO2\u00a0yr\u22121, now just 0.2\u00a0GtCO2\u00a0yr\u22121 lower compared to the NGHGI. The various adjustments also highlight the impact of considering all land as managed versus different applications of the managed land proxy. The analysis was made possible due to the availability of the geospatial data and transparency in methodologies from all flux datasets.Using Brazil as a primary case study, we could reconcile the difference between GHG fluxes from a Global EO dataset and the NGHGI. With no adjustment to the Global EO dataset, considering all forest fluxes in the country boundary, the difference between the Global EO flux -country scales. For completeness and information purposes, NGHGIs could voluntarily consider providing fluxes associated to unmanaged land or consider all land to be managed.Full transparency is crucial for understanding differences and making effective comparisons between datasets. This includes ensuring transparency in the methodology and open access to the data used by all approaches.Further disaggregation in the forest types and associated fluxes in all datasets will facilitate greater comparability and completeness. Independent datasets could disaggregate the fluxes by the land use categories and forest types\u00a0used in NGHGIs, to allow greater comparability. All flux datasets could explicitly consider disturbance type and intensity, and associated recovery.The adjustments outlined in this study can also be used to aid comparisons with and benchmarking of other approaches, such as global models or in other regions. Below we outline some key lessons learned in this study:As more information and datasets become available, including EO, countries\u2019 requirements and capacity to report is expected to increase in transparency, comparability, consistency, completeness, and accuracy. Additionally, region specific information compiled for use in NGHGIs can also be used to improve local applicability of Global EO assessments. Given the approval of Article 6.4 of the Paris Agreement, and the numerous pledges and commitments that have been made by business organisations, cities, nations, and international agreements to protect and restore forests, the need to measure, report and especially verify estimates becomes increasingly important. If this is not achieved in accurate and credible ways, we risk mis-representing the carbon fluxes of the world\u2019s forests, one of our most important allies on land, to tackle the climate emergency.Additional file 1: Figure S1. Comparison of the area of Primary and non-Primaryforest land according to the Global EO  in the year 2000, for which they used dataset byTurubanova et al. (2018)and the Unmanaged forest land and Managed forest land according to the NGHGI in 1994 and 2002. Figure S2. Percentage contribution of different plantation types to the total plantation area in different biomes of Brazil. Colouring denotes if the plantation is a forest plantation (shades of blue) or a Tree crop plantation (yellow-oranges). Theareas considered for analysis only included those that were also classified as plantation area in the National Greenhouse gas inventory of Brazil in 2016. Figure S3. Bar graphs representing the area contribution of different forest and non-forest cover types that make up the six biomes of Brazil according to three different approachesfor the year 2020. The three approachesare the Global Earth Observation (EO), the National Greenhouse Gas Inventory (NGHGI) and the independent estimate (SEEG). As the NGHGI is only available up to 2016, area numbersfor theNGHGIhave been adjusted by multiplying by the fractional difference in the area of each forest type in 2016 and 2020 according to SEEG (Mapbiomas).Note differences in the Y axis scale. Figure S4. Bar graphs representing theaveragegross removals contribution of different forest types within the six biomes of Brazil according to three different approachesover the period 2001 to 2020.The three approachesare the Global Earth Observation (EO), the National Greenhouse Gas Inventory (NGHGI) and the independent estimate (SEEG). As the NGHGI is only available up to 2016, numbersfor the NGHGI have been adjusted by multiplying by the fractional difference in the removalsof each forest type in 2016 and 2020 according to SEEG.Note differences in the Y axis scale. Table S1. Summary of the key United Nations Framework Convention on Climate Change (UNFCCC) principles as outlined in the 5th Conference of the Parties (COP5) in 1999. Table S2. Modifications made to the NGHGI of Brazil to account for the shorter time-period available. The fractional difference of the average fluxes were calculated for the period 2002 to 2016 (period of the NGHGI) and for 2001 to 2020 . Table S3. The total number of pixels per biome which are considered as non-primary forests in the Global Earth Observation dataset and overlap pixels classified as Managed forests  pixels in the National Greenhouse Gas Inventory (NGHGI) of Brazil. Table S4. The categories of forest-based transitions used within this study and how they are referred to in the National Greenhouse Gas Inventory (NGHGI) of the case study countries Indonesia and Malaysia."}
{"text": "Schizophrenia is a chronic neuropsychiatric syndrome that significantly impacts daily function and quality of life. All of the available guidelines suggest a combined treatment approach with pharmacologic agents and psychological interventions. However, one in three patients is a non-responder, the effect on negative and cognitive symptoms is limited, and many drug-related adverse effects complicate clinical management. As a result, discovering novel drugs for schizophrenia presents a significant challenge for psychopharmacology. This selective review of the literature aims to outline the current knowledge on the aetiopathogenesis of schizophrenia and to present the recently approved and newly discovered pharmacological substances in treating schizophrenia. We discuss ten novel drugs, three of which have been approved by the FDA . The rest are under clinical trial investigation . However, additional basic and clinical research is required not only to improve our understanding of the neurobiology and the potential novel targets in the treatment of schizophrenia, but also to establish more effective therapeutical interventions for the syndrome, including the attenuation of negative and cognitive symptoms and avoiding dopamine blockade-related adverse effects. Schizophrenia is a neuropsychiatric disorder, most likely due to neurodevelopmental reasons arising from abnormalities in different circuits and neurotransmitter systems. This developmental process includes uncontrolled synaptic pruning, deriving from gene\u2013environment interaction . NumerouThe dopamine (DA) hypothesis of psychosis is one of the most enduring ideas in psychopharmacology. Undeniably, one central dysfunction stems from dopaminergic abnormalities, but in a different way than initially thought  . MoreoveIncreasing evidence implicates glutamate, cholinergic, and serotonin neuronal networks, trace amines, and their TAAR receptors. Focusing on these alternative neurotransmitters/receptors is critical to fully understand the underlying pathophysiology of the psychoses, in addition to developing drugs with novel mechanisms of action other than DA receptor antagonism; the latter results from the necessity for safer, more tolerable, and more effective medications . ImproveIn this review, we aim to present an update on the current understanding of the aetiopathogenesis of schizophrenia, along with the most promising novel agents in the treatment of this disorder, namely olanzapine/samidorphan, lumateperone, brilaroxazine, xanomeline/trospium, emraclidine, ulotaront, pimavanserin, sodium benzoate, other DAAO inhibitors, D-serine, and iclepertin.www.clinicaltrials.gov database. We considered all clinical trials evaluating patients strictly with schizophrenia-type psychosis. We also checked the references in publications found to acquire any additional data, as well as the official sites of the pharmaceutical companies developing the novel compounds in question.MEDLINE was searched for articles written in the English language from inception to 31/7/23 that matched any combination of the following keywords: ((olanzapine/samidorphan[tiab] OR lumateperone[tiab] OR (RP5063[tiab] OR brilaroxazine[tiab]) OR (xanomeline[tiab] OR Kar-XT[tiab]) OR (emraclidine[tiab] OR CVL-231[tiab]) OR (ulotaront[tiab] OR SEP363856[tiab]) OR pimavanserin[tiab] OR sodium benzoate[MeSH] OR DAAO inhibitor*[tiab] OR D-serine[tiab] OR (iclepertin[tiab] OR OR voltage-gated sodium channel blocker[tiab]) AND (schizophr*[MeSH] OR schiz*[tiab]) AND ). Using the same keywords, the search was repeated for each drug separately in the www.clinicaltrials.gov search yielded ongoing trials for each compound under investigation  articles on the olanzapine/samidorphan combination, eight (8) on lumateperone, one (1) on brilaroxazine (RP5063), six (6) on xanomeline/tropsium, one (1) on emraclidine, four (4) on ulotaront, four (4) on pimavanserin, nine (9) on sodium benzoate, one (1) on the DAAO inhibitor luvadaxistat, and fifteen (15) on D-serine. Our tigation . The eliThe classic concept of striatal functioning proposes that the dorsal striatum regulates motor movement, and the ventral striatum regulates emotions via the nigrostriatal and the mesolimbic pathway, respectively . HoweverAccording to the dopamine synthesizing capacity (DSC) theory, dopaminergic dysfunction predates the subsequent onset of frank psychotic illness in people with symptoms that are truly prodromal to a psychotic disorder . In refrAt present, it is widely accepted that the DA receptors in the prefrontal cortex (PFC) maintain a balance of excitation/inhibition (E/I) by modulating glutamate neurotransmission and GABAergic interneuron function . In schiThe neurodevelopmental theory of schizophrenia suggests that DA has pruning properties, mostly notable during the early stages of neuronal development. Excessive pruning is considered the cause of decreased brain volume, which is the most consistent brain abnormality in schizophrenia. Evidence indicates that DA induces a decrease in neurite extensions, mainly via the activation of D1 receptors , and neuHallucinogens, including the naturally occurring mescaline and psilocybin and the synthetic lysergic acid diethylamide (LSD), act via the serotonin 5-HT2A receptors (5-HT2AR) and enhance glutamatergic transmission to induce their profound changes in human consciousness, emotions, and cognition. In the prefrontal cortex, 5-HT2AR stimulation increases the release of glutamate . The serAntagonism of the 5-HT2AR receptors on glutamatergic neurons is a common feature of second-generation, or atypical, antipsychotics. 5-HT2ARs are excitatory, leading to excitatory glutamate release at downstream targets, and thus to the hyperactivation of the mesostriatal pathway and hypoactivation of the mesocortical pathway. The serotonin hyperfunction hypothesis of psychosis suggests that psychosis may be caused by an imbalance in excitatory 5-HT2A receptor stimulation on the glutamate pyramidal neurons, which directly innervate mesostriatal DA neurons and visual cortex neurons, inducing delusions and hallucinations. This theory explains the psychotic symptoms in PD dementia and the psychotic effect of 5-HT2A agonists such as psilocybin and LSD. Moreover, it indicates the promising role of pure 5-HT2A antagonists in psychosis .The inhibitory 5-HT1A receptors are located on the glutamate neurons projecting to the VTA or the substantia nigra (SN). When activated by serotonin or a 5-HT1A agonist, they inhibit glutamatergic neurons to enhance mesocortical and nigrostriatal DA pathway neurotransmission . The 5-HBeyond the 5-HT1A and 5HT2A receptors, other serotonin receptors, including the 5-HT2C, 5-HT3, 5-HT6, and 5-HT7 receptors, continue to represent promising drug targets for the discovery of novel multi-receptor antipsychotic agents aiming to address cognitive and negative symptoms .Moreover, serotonin antagonists improve the extrapyramidal side-effects of antipsychotics ,28, and Glutamate is the main and most common excitatory neurotransmitter in the mammalian brain . DysfuncDisturbances in glutamatergic neurotransmission may influence synaptic plasticity and cortical microcircuitry, especially NMDA receptor functioning . NMDA reThe key NMDA receptors are in the indirect cortico-cortical glutamate pathways . ThroughDisturbances in glutamate signaling may be an attractive drug target for schizophrenia due to its key role in the aetiopathogenesis of the disorder regarding cognitive impairment and negative symptoms . AntipsyHowever, classical agonists at the NMDA did not prove to be useful as the excessive stimulation of NMDA receptors results in excitotoxicity and neuron damage. The glycine modulatory binding site on the NMDA receptor is considered a more promising target, and direct or indirect glycine modulatory site modulators, including glycine, D-cycloserine, D-serine, glycine transporter 1 (GlyT1) inhibitors, and D-amino acid oxidase (DAAO) inhibitors, have been actively researched in clinical trials and, as discussed in more detail below, show promise in the treatment of schizophrenia following the glutamatergic hypothesis of schizophrenia .We have now discussed the dopaminergic, serotoninergic, and glutamatergic hypotheses of schizophrenia. There is also growing evidence that inhibitory GABA signaling is dysregulated in schizophrenia, particularly in the cortex. Dopaminergic, GABAergic, and glutamatergic signaling are all modulated by the cholinergic system; therefore, the modulation of ACh receptors represents an exciting new target. Muscarinic ACh receptors (mAChR) appear to be suitable for interventions. The M1, M4, and M5 mAChR subtypes can all modulate schizophrenia-related circuitry and are intriguing targets for novel schizophrenia treatments .Using traditional therapies that lack specificity among mAChR subtypes requires drug tailoring to hit a therapeutic window between beneficial effects  and classical cholinergic side-effects. These side-effects are mediated by peripherally expressed M2 and M3 receptors, making the selective targeting of M1, M4, and M5 therapeutically desirable. ACh binds on the mAChRs\u2019 orthosteric binding pocket, which is a specific area on each subtype of mAChR, making it challenging to create molecules that specifically target this site with high subtype selectivity. However, some agonists have been developed that, while lacking complete subtype-selectivity, exhibit preferential activation for certain subtypes over others. Allosteric agents have proved easier in targeting binding pockets outside the orthosteric binding pocket binding ACh. In particular, selective positive allosteric modulators (PAMs) have significantly advanced subtype-selectivity .Substantial evidence supports that the cholinergic system robustly modulates striatal DA signaling through the activation of both mAChRs and nicotinic ACh receptors (nAChRs) via cholinergic projections from the brainstem to the midbrain, where they stimulate DA neurons in SN and the VTA .The M4 receptor is among the best-studied muscarinic targets for psychosis. In the striatum, the M4 subtype is primarily expressed postsynaptically on direct pathway spiny projection neurons , on cholinergic interneurons, where it acts as an autoreceptor, and on glutamatergic inputs, where it acts as a heteroreceptor .The M4 receptors on cholinergic interneurons and spiny projection neurons modulate DA signaling through different mechanisms. The activation of M4 autoreceptors on cholinergic interneurons reduces ACh release. Typically, ACh induces striatal DA release by activating nAchR on the DA axonal projection, arriving from the VTA/SN complex. Consequently, an M4-mediated decrease in ACh secretion leads to a reduction in DA output. Furthermore, the activation of the M4 receptors on spiny projection neurons leads to an endocannabinoid-dependent blockade of DA release independent of nAChRs. Beyond its role at the striatum, the M4 receptor regulates the hippocampal circuitry involved in cognitive processes. Recent findings suggest that M4 activation (by PAMs) alleviates cognitive deficits and positive symptom reduction .The M1 receptor is another well-studied muscarinic receptor. There is robust evidence that M1 activation leads to pro-cognitive effects and alleviates negative-type symptoms . This efMoreover, deficits in M1 receptor expression are brain region-specific. In schizophrenia, M1 receptor-expressing neurons are reduced in the cortex but not the thalamus or the hippocampus. As for the M1-selective compounds, pure PAMs seem superior in their pro-cognitive efficacy and exhibit fewer adverse side effects. Although M1 is primarily considered a target for enhancing cognition, there are indications that M1 activation is associated with an antipsychotic effect. Such implications derive from animal studies where M1 PAMs have demonstrated efficacy in positive symptoms . The norThe M5 receptors need to be better studied, and data are scarce. However, they modulate DA signaling via actions at the DA terminals and DA cell bodies, making them an interesting target for the future . The advTrace amines are endogenous substances found in trace levels in the body. They are formed from amino acids inside CNS during the synthesis of monoamines when certain enzymatic steps are omitted. They are commonly found in foodstuffs and can be produced and degraded by microbiota. These molecules do not act as typical neurotransmitters; namely, they are not released upon nerve firing. There are five main human trace amines: \u03b2-Phenylethylamine, p-Tyramine, Tryptamine, p-Octopamine, and p-Synephrine .Trace amine-associated receptors (TAARs) are G-protein receptors. There are six isoforms in humans, and TAAR1 is the most studied. Except for TAAR1, all other TAAR subtypes are expressed only in olfactory neurons. TAAR1 are present in multiple CNS areas, including several monoamine brainstem centers and projection areas. They are also expressed in the periphery, where they may have a role in nutrient-induced hormone secretion . Cross-tTAAR1 are predominantly located intracellularly. The putative mechanism of DA rheostasis is the following. When the TAARs are occupied by an endogenous or an exogenous agonist, the derivative complex is translocated to the cell surface, where it couples with D2. This heterodimerization directs the second-messenger pathway to move preferentially towards the inhibitory G (Gi) protein signal transduction cascade, inhibiting the synthesis and release of DA, rather than towards the \u03b2-arrestin-2 excitatory pathway (production of GSK-3 and overstimulation). Presynaptically, the amplification of the Gi pathway leads to the inhibition of DA release, while postsynaptically, the amplification of the Gi pathway can lead to the reduced production of GSK-3 and, therefore, to less stimulation. Consequently, drugs that target TAAR1 constitute a promising field of indirect dopamine modulation ,61.\u03bc-opioid receptor.The Olanzapine/Samidorphan (OLZ/SAM) combination was approved by the FDA for the treatment of adults with schizophrenia or bipolar disorder type I in June 2021. Strictly speaking, this is a novel combination of a well-established antipsychotic, olanzapine, with samidorphan. This treatment can be used for maintenance monotherapy or the acute treatment of psychotic, manic, or mixed episodes. Olanzapine, acting primarily via the DA and 5-HT receptors, is a second-generation  antipsychotic (SGA) approved for treating schizophrenia and bipolar disorder type I. Samidorphan is a 3-carboxamido-4-hydroxynaltrexone, acting as an opioid antagonist, preferentially on the Enlighten-1 was a 4-week, phase III, randomized, double-blind, placebo- and olanzapine-controlled study conducted in patients with schizophrenia in acute exacerbation . It aimep = 0.003). The combination was well-tolerated, with the most common adverse events being weight gain, somnolence, and dry mouth.Enlighten-2 evaluated the weight gain profile of OLZ/SAM versus olanzapine over 6 months in 561 patients with stable schizophrenia . CompareA systematic review of the literature in 2022  highlighLumateperone is a butyrophenone atypical antipsychotic approved by the FDA in 2019 for the treatment of schizophrenia. It is a potent antagonist at 5-HT2A, a presynaptic partial agonist and a postsynaptic antagonist at the dopamine D2 receptors, and a dopamine receptor phosphoprotein modulator. It is also a D1 receptor-dependent indirect modulator of glutamatergic \u03b1-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid and N-methyl-D-aspartate (NMDA) GluN2B receptors and a blocker of the serotonin transporter (SERT) . Thus, lLumateperone is thus claimed to be an effective antipsychotic agent, appropriate as a first-line treatment for patients with schizophrenia, claiming a possible long-term positive impact on cognitive and negative symptoms . MoreoveBrilaroxazine is an antipsychotic agent under development with a unique binding profile ,76. It aIn 2018, Cantillon and colleagues  publisheA phase II, 4-week, double-blind, placebo- and aripiprazole-controlled clinical trial evaluated the safety and efficacy of brilaroxazine  in 234 patients with schizophrenia or schizoaffective disorder in acute episodes. It demonstrated that brilaroxazine at 15 mg and 50 mg significantly improved the PANSS total score compared to the placebo . The mosXanomeline is a muscarinic ACh receptor agonist with reasonable selectivity for the M1 and M4 subtypes and an M5 receptor antagonist studied for the treatment of both Alzheimer\u2019s disease and schizophrenia, particularly for the cognitive and negative symptoms ,80,81,82post-hoc analysis of the EMERGENT-1 study, KarXT was associated with a low overall adverse event burden [A recent phase II, 5-week, double-blind, randomized, placebo-controlled clinical trial evaluated the combination of xanomeline/trospium in 182 patients with schizophrenia in acute episodes . The xant burden . The majp < 0.0001). In the xanomeline/trospium group, the improvement in negative symptoms was slight but significant. Xanomeline/trospium was well-tolerated, with the most prevalent side-effects being cholinergic. There were no reports of any side-effects commonly associated with atypical antipsychotics. Furthermore, using the PANSS to assess the effectiveness, response was demonstrated as early as 2 weeks relative to the placebo. KarXT demonstrated improvements vs. the placebo in all five PANSS factors  [The results of a phase III, randomized, double-blind, placebo-controlled clinical trial in 252 in-patients with schizophrenia have been presented as a poster ,88. Patiression) . There aEmraclidine is an M4-selective positive allosteric modulator (PAM) currently in development as a novel antipsychotic drug for the treatment of schizophrenia . PAMs inp = 0.023; emraclidine 20 mg bid, p = 0.047). At present, three phase II clinical trials are ongoing to confirm the efficacy, safety, and tolerability of emraclidine . Furthermore, it showed a favorable safety and tolerability profile. A six-month extension study followed up the recruited patients who completed the initial study to evaluate the safety and efficacy of long-term ulotaront treatment. Ulotaront use was associated with continued improvement in the PANSS total and BNSS total scores [The results of a phase II, 4-week, randomized, double-blind, flexible-dose (50 mg/day or 75 mg/day) aimed to evaluate the efficacy and safety of SEP 363,856 in adults with schizophrenia in acute relapse were published in 2020 . Ulotarol scores . The mosl scores .A population analysis  of the pUlotaront is in phase III clinical development for further evaluation of the efficacy, safety, and tolerability . Two mulPimavanserin primarily functions as an inverse agonist and a partial inverse agonist at the 5-HT2A receptors. It spares the dopamine post-synaptic receptors, including the D2. Pimavanserin binds with high affinity to 5-HT2A, with lower affinity to 5-HT2C, and demonstrates negligible binding at the 5-HT2B, dopaminergic (D3), muscarinic (M5), and opioid (sigma 1) receptors . PimavanADVANCE-II, a phase II, 26-week, randomized, double-blind, placebo-controlled, multi-center, international study, assessed the efficacy and safety of pimavanserin in 403 stable patients with predominantly negative symptoms of schizophrenia while being on stable antipsychotic therapy . PimavanENHANCE-III, a phase III, 6-week, randomized, double-blind, placebo-controlled clinical trial, assessed pimavanserin as an adjunctive treatment in resistant-to-treatment out-patients with schizophrenia . The stuIn the brain, D-amino acid oxidase (DAAO) is a peroxisomal flavoenzyme. Through oxidative deamination by DAAO, D-serine\u2014the main co-agonist of synaptic N-methyl-D-aspartate (NMDA) receptors (NMDARs) \u2014is degraIt has been hypothesized that excessive DAAO activity may cause reduced D-serine levels, possibly contributing to the NMDAR hypofunction in schizophrenia . DAAO isSodium benzoate , an accessible food preservative, is a D-amino acid oxidase (DAAO) inhibitor, initially shown to increase synaptic D-serine levels . Howeverp < 0.001 for all; ES\u2009 = \u20091.16\u20131.69). Additionally, a neurocognitive assessment revealed the superiority of the sodium benzoate treatment compared to the placebo, especially in terms of processing speed and visual memory. Sodium benzoate exhibited a good safety profile without significant adverse effects.In 2013, Lane and colleagues presented the results of a 6-week, randomized, double-blind, placebo-controlled trial that examined the efficacy and safety of adjunctive sodium benzoate at 1 g/day, in 52 patients with stable schizophrenia for at least three months . The stuIn a 6-week , double-In contrast, a 12-week, double-masked, placebo-controlled, randomized clinical trial from Australia  examininA recent meta-analysis from India  evaluateAs the hypofunction of the NMDA receptor is implicated in the pathophysiology, particularly cognitive impairment, of schizophrenia, in a randomized, double-blind, placebo-controlled trial in patients with chronic schizophrenia, add-on sodium benzoate was given in combination with sarcosine, a glycine transporter I (GlyT-1) inhibitor, to enhance NMDA receptor-mediated neurotransmission (see below). The investigators concluded that the combination of these two NMDA-enhancing agents, but not sarcosine alone, can improve cognitive function, despite the non-improvement in the clinical symptoms of patients with chronic schizophrenia .\u00ae as an add-on treatment for schizophrenia, one in adolescents and one in adults  failed to address the negative symptoms of schizophrenia but resulted in cognitive symptom enhancement , and a pCurrently, the most reliable way to assess NMDAR-related function in humans is through mismatch negativity (MMN), which relies on the NMDAR\u2019s dual voltage- and ligand-sensitivity. MMN is an event-related brain potential that is sensitive to stimulus deviation from a repetitive pattern, thought to reflect the activity of sensory memory, with, at most, moderate influences of higher-level cognitive processes, such as attention . MMN is An early meta-analysis including 29 trials and a total of 1253 cases aiming to evaluate the potential of NMDA receptor modulators as adjunctive therapy for schizophrenia found D-serine, N-acetyl-cysteine (NAC), and sarcosine to have therapeutic benefit in the treatment of total and negative symptoms as adjuncts to non-clozapine antipsychotics. However, while glycine improved the positive and total symptoms as an adjuvant to non-clozapine antipsychotics, it worsened them when added to clozapine . A more In addition to its powerful role as an inhibitory neurotransmitter through its binding to the Glycine Receptor (GlyR) in the spinal cord and the brainstem, glycine, a non-essential amino acid, is an important co-agonist of the NMDAR in excitatory glutamatergic transmission . VariousIn the synaptic cleft, glycine\u2019s reuptake is regulated by glycine transporters, namely type I (GlyT1) and type II (GlyT2). GlyT1 is considered a highly potential target for psychosis therapy. A phase II study conducted on bitopertin, a selective and non-competitive GlyT1 inhibitor, demonstrated benefits for negative symptoms in a per-protocol population . HoweverIclepertin  is a potent and selective GlyT1 that showed significant (d\u2009 = \u20090.34) improvements in cognition over 12 weeks of treatment in patients with schizophrenia during a phase II study . AnotherVoltage-gated sodium channel blockers, in particular the antiepileptic drugs carbamazepine, oxcarbazepine, phenytoin, and lamotrigine, increase the motor threshold, and the corticospinal system becomes less excitable . HoweverEvenamide  is a voltage-gated sodium channel blocker and inhibits the synaptic release of glutamate. It thus reduces hyperexcitability in the PFC and the hippocampus. Unlike other antipsychotics, it does not interact with other neurotransmitter systems , acts preferentially on sodium channels, and modulates glutamate release. It was shown to reverse the NMDR antagonist ketamine- and phencyclidine-induced reduction in prepulse inhibition  and has Indeed, the results from a pilot, 6-week, randomized, open-label, rater-blinded study with a 46-week extension indicate very good tolerability with an exceptional, clinically important, increase in the efficacy of evenamide  as an add-on treatment to antipsychotics in treatment-resistant schizophrenia patients .p = 0.023), but there were no significant differences in the negative symptoms between groups. In conclusion, it has been suggested that a dosage of 800 mg of L-Carnosine was promising for improving executive functions in schizophrenia [L-Carnosine is an antioxidant reported to improve negative and cognitive symptoms in schizophrenia . A randoophrenia . The treatment of schizophrenia remains a significant challenge in clinical practice, despite the enormous progress in psychopharmacological research. The complexity of its aetiopathogenesis leads to high variability in the medication response across patients with schizophrenia and schizoaffective disorder. While several psychotropic drugs are currently available, one out of three patients remains a non-responder , the effNovel compounds in the pipeline for use in schizophrenia appear to work beyond the dopamine system .Future drug discovery should focus on the optimal implementation of the available treatments, emphasizing improvements in medication adherence due to improved side-effect profiles, and hence adherence. Long-acting or dual preparations are a good example of such strategies. Most importantly, based on novel mechanisms of action, prospective medications should address the debilitating negative and cognitive symptoms, in addition to treating the positive symptoms, whilst avoiding the burden of post-synaptic DA blockade-induced side-effects."}
{"text": "Pseudomonas syringae pv. actinidiae (Psa) causes bacterial canker of kiwifruit with heavy economic losses. However, little is known about the pathogenic genes of Psa. CRISPR /Cas-mediated genome editing technology has dramatically facilitated the characterization of gene function in various organisms. However, CRISPR genome editing could not be efficiently employed in Psa due to lacking homologous recombination repair. The base editor (BE) system, which depends on CRISPR/Cas, directly induces single nucleoside C to T without homology recombination repair. Here, we used dCas9-BE3 and dCas12a-BE3 systems to create substitutions of C to T and to convert CAG/CAA/CGA codons to stop codons (TAG/TAA/TGA) in Psa. The dCas9-BE3 system-induced single C-to-T conversion frequency of 3 to 10 base positions ranged from 0% to 100%, with a mean of 77%. The dCas12a-BE3 system-induced single C-to-T conversion frequency of 8 to 14 base positions in the spacer region ranged from 0% to 100%, with a mean of 76%. In addition, a relatively saturated Psa gene knockout system covering more than 95% of genes was developed based on dCas9-BE3 and dCas12a-BE3, which could knock out two or three genes at the same time in the Psa genome. We also found that hopF2 and hopAO2 were involved in the Psa virulence of kiwifruit. The HopF2 effector can potentially interact with proteins such as RIN, MKK5, and BAK1, while the HopAO2 effector can potentially interact with the EFR protein to reduce the host\u2019s immune response. In conclusion, for the first time, we established a PSA.AH.01 gene knockout library that may promote research on elucidating the gene function and pathogenesis of Psa. CRISPR /Cas proteins constitute a prokaryotic immune surveillance system in bacteria and archaea to defend against the infection of phages ,2,3. RecBase editing is a new powerful technology that enables the programmable conversion of single nucleosides in the eukaryote and prokaryote genomes . Base edPseudomonas syringae pv. actinidiae (Psa) is the causal agent of bacterial canker, primarily infecting commercial cultivars of Actinidia deliciosa and A. chinensis [Psa infects the kiwifruit plant through stomata, stylar, and wounds [Psa-infected plant displays only minor symptoms in summer, while in winter, with humid conditions, Psa colonizes various kiwifruit tissues and rapidly becomes systemic, leading to the death of the host plant [Psa is a very aggressive pathogen to kiwifruit worldwide, we know little about its pathogenic mechanism. The type III secretion system (T3SS) has been shown to be closely associated with the pathogenicity of bacteria [Pseudomonas syringae pv. tomato DC3000, which is used as a model organism for studying plant pathogenicity, has already investigated the function of some effector proteins secreted by the T3SS, such as HopF2Pto and HopAO1Pto [Psa has high homology with the DC3000 effector protein, we can refer to the study of DC3000 effector proteins to explore the pathogenic mechanism of Psa.Bacterial canker severely threatens kiwifruit cultivation worldwide . Pseudomhinensis . Psa infd wounds . Psa-infst plant . Althougbacteria . PseudomopAO1Pto ,20. SincPsa strains is homologous recombination (HR) [Psa is that they are cumbersome. In addition, they are challenging to use for knockout multi-site or high-throughput gene mutation experiments.The currently used method for constructing mutations in ion (HR) ,22,23. Sion (HR) . The RecPsa genome [Psa might depend on NHEJ without donor DNA. The applicability of this method may be limited because it generates large fragment deletions, and deletion sites are uncontrollable [Recently, the genome editing tool CRISPR/Cas9 system has been used to create large fragment deletions  in the a genome . Generala genome . Howeverrollable .Psa. We showed that BE3 achieved accurate and effective base conversion in Psa. We also demonstrated that BE3 could target multi-site base conversion by a single plasmid. Our purpose is to provide a new, simple, and high-throughput tool to investigate the function of Psa genes.Base editing has been demonstrated as a powerful tool with high mutation frequencies in bacteria ,27,28. IThe genomic DNAs of strain PSA.AH.01 (PRJNA923731), isolated from Sichuan Province in China, were sequenced by Oxford Nanopore Platform . A circular chromosome and a circular plasmid were obtained by genome de novo assembly. The length of the chromosome was 6,529,123 bp, and the length of the plasmid was 77,260 bp, for a total of 6,606,383 bp. The GC content of the chromosome was 58.42%, and the plasmid was 56.00%. The assembled data of PSA.AH.01 were subjected to Glimmer, version 3.02, and 6079 protein-coding sequences (CDSs). Furthermore, 65 tRNA genes, 16 rRNA genes, and 43 sRNA genes were identified. Subsequently, PSA.AH.01 was annotated using the Bacterial Virulence Factor Database [Psa, we constructed a dCas9-BE3-fliC plasmid vector that harbors gRNA to target the flagellin (fliC) gene in Psa. The sgRNAs were designed between the 382 bp and 401 bp of the fliC open reading frame to truncate the protein  or CGA (Arg) codons into respective TAG/TAA/TGA premature Stop codons. To test the efficiency of the dCas9-BE3 system in  protein A. The dCost 100% B. Scannidetected C,D. The Psa, we tested dCas9-BE3 at twelve target gene sites with the NGG PAM sequence  in hopAI1 and the 177th amino acid Gln (CAG) in hopI1 were successfully mutated to stop codons (TAG). The sequencing of avrE1 and hopR1 in positive colonies showed that the CAG or CAA (Gln) codons were successfully converted to a TAG or TAA stop codon . The number of plasmid DNAs was approximately 1657 times of library size. All clones were harvested and combined to prepare the plasmid DNAs constituting the sgRNA library. The primers BE3F/R were used to amplify the plasmid DNA library and PCR products were deeply sequenced by Next-generation sequencing (HiSeq 2500). The sequence data showed that 9464 of the 9467 sgRNAs were represented by at least one read (99.97%), and these 9464 sgRNAs covered 5725 genes (99.9%). Moreover, 90% of the sgRNAs had approximately 1721 reads, and 10% of the sgRNAs had less than 460 reads. We randomly selected 365 clones and sequenced them. The results showed that 307 of the 365 clones harbored the correct sgRNA target sequences (84.1%), 55 of the 365 clones had mutated sgRNA target sequences (15.1%), and three clones did not harbor the target sequence (0.8%) . In total, 9467 target sites were identified and located in 5728 genes. The two 25-bp homologous arms derived from the dCas9-BE3 were added to the two ends of the 20-bp guide sequences. Furthermore, 9467 oligonucleotides were synthesized by array-based oligo-pool synthesis. Then the oligonucleotides were amplified, purified, and ligated into the pBmBE3 vector. The recombinant plasmids were transformed into e (0.8%) . Those rPsa mutant strains constructed by BE3 systems, \u2018Hongyang\u2019 tissue culture plantlets were incubated with \u0394hrcC, \u0394hopR1, \u0394hopF2, and \u0394hopAO2 mutant strains. After 20 days, \u2018Hongyang\u2019 plantlets inoculated with Psa3 developed leaf yellowing and browning. The plantlets inoculated with the \u0394hrcC mutant (the type III secretion system) appeared healthy and asymptomatic  with the previous studies of dCas9-BE3 and dCas12a-BE3 in Psa. The results showed that the proportions of genes with dCas9-BE3 knockout targets in the Psa genomes were 94.23%, 95.85%, 96.68%, 96.44%, and 96.36%, respectively, with a mean of 95.91%. The proportions of genes with dCas12a-BE3 knockout targets in the Psa genome were 54.07%, 55.35%, 56.92%, 57.57%, and 58.17%, with a mean of 56.42%  PAM, we thought that the dCas9-BE3, which recognized GC-rich (NGG) PAM, was more suitable for gene knockout in Psa genome sequencing, the challenge in the post-genome era is to study the function of the Psa genes systematically. Gene knockout is the most common and effective way to achieve this goal. Generating large-scale mutants is of great value for studying Psa functional genes. Traditional methods for producing large-scale mutations include physical, chemical, and biological methods. The biological methods include transposon insertion and homologous recombination. The transposon insertion method is random and inserts only 47% of chromosomal genes into Psa [E. coli were deleted [Psa genome to a base T, so the CGA/CAA/CAG of the target gene was mutated to a stop codon and finally generated a mutation. It is because of the convenience that it has been successfully applied to eukaryotic and prokaryotic cells. However, the construction of large-scale mutant libraries of Psa is rarely reported. Therefore, we constructed a high-throughput Psa mutant library based on the BE3 system to provide an experimental basis for studying gene function. Since there is an almost one-to-one relationship between sgRNA and target genes in these BE3 mutants, the disease-associated genes can easily identify with observed phenotypes.With the into Psa . The hom deleted . The CRIPto in Pseudomonas syringae pv. tomato DC3000 can bind to the RIN protein of Arabidopsis and not trigger the plant\u2019s ETI response, thereby promoting the growth of DC3000 within the plant [Pto can also interact with and inactivate the Arabidopsis MKK5 protein, reducing the plant\u2019s defense ability [Pto can interact with BAK1, inhibiting the phosphorylation of the BIK1 protein in Arabidopsis and reducing the non-host immunity of plants [Pto in tomato requires its myristoylation site and the catalytic residue of ADP-RT, with the 71st arginine (Arg71) and the 175th aspartic acid (Asp175) of HopF2Pto being particularly important [Pto revealed that it has a protein sequence of 204 amino acids, while HopF2Psa in PSA.AH.01 has 205 amino acids with a homology of 57%. The 72nd amino acid of HopF2Psa is also Arg72, and the 174th amino acid is Asp174, indicating that HopF2Psa may also interact with proteins such as RIN, MKK5, and BAK1 in kiwifruit (The study found that HopF2he plant . HopF2Pt ability . Additiof plants . The virmportant . Furtheriwifruit .Pto is similar to protein tyrosine phosphatases (PTPs) and has PTP activity, which requires a conserved catalytic cysteine residue (Cys378) [Pto can inhibit the HR response of tobacco, but when Cys378 is changed to Ser, this inhibition disappears, highlighting the importance of Cys378 in the role of HopAO1Pto [Pto acts on the tyrosine 836 site of the Arabidopsis EFR protein, reducing its phosphorylation and preventing the downstream immune response [Pseudomonas syringae, with DC3000 possessing only HopAO1 and PSA.AH.01 having only HopAO2. HopAO2 has phosphatase activity and can inhibit early defense responses in tobacco, reduce reactive oxygen species, and reduce callose deposition [Pto in DC3000 is VHC378NGGRGR384T, and the conserved domain of HopAO2Psa in PSA.AH.01 is IHC243GVGQGR249T  . HopAO1PopAO1Pto . The stu8 . HopAOposition . The conposition , the actGQGR249T . Based of DC3000 . Jayaram results . HoweverPsa strain (PSA.AH.01) isolated in China (Sichuan province) from a leaf spot lesion of A. deliciosa cv. Hayward was routinely grown in King\u2019s B medium (KB) at 25 \u00b0C. The Escherichia coli strain (Trans T1)  was cultivated at 37 \u00b0C in Luria\u2013Bertani (LB) or on LB agar plates. Antibiotics and additives were used at the following final concentrations (\u03bcg/mL) unless otherwise noted: Gentamicin (Gm), 50; rifampicin (Rf), 50; theory Isopropyl \u03b2-d-1-thiogalactopyranoside .The The genome of PSA.AH.01 was sequenced by the DNBSEQ platform and Nanopore platform . Sequence data were assembled using Falcon, version 0.3.0, and Celera Assembler, version 8.3, and analyzed using Glimmer, version 3.02. Then the protein sequence of the genome was blasted with the VFDB for gene annotation to find the potential virulence factors.PstI restriction sites were removed using the Fast Mutagenesis System . The crRNA-BsaI sequences were synthesized and inserted into the site between BsaI and PstI by T4 DNA Ligase , resulting in pdCas12a-BE  or CGA (Arg) codons were located at 20 bases upstream of the PAM site, then this region would be suitable as a target. For the dCas12a-BE system, finding the TTTN structure in half of the target gene CDS is necessary. If the CAG/CAA (Gln) or CGA (Arg) codons were located at 20 bases downstream of the TTTN structure, this region could be designed as a target site.pBmBE3 or pdCas12a-BE vectors.For a single-site knockout, the target region\u2019s sense and anti-sense strands were synthesized and annealed to form a dimer. For two-site knockout, the \u2018Target1-sgRNA-Trc-Target2\u2019 was assembled by overlapping PCR. Then the fragment was ligated into BsaI-digested Psa, we used Python to screen out one or two suitable targets for each gene in the PSA.AH.01 genome. Twenty-five base pairs were added at the 5\u2032 end of the target, which identifies with upstream BsaI in pBmBE3.For the dCas9-BE3 system, the 12-bp seed sequence of the sgRNA should only match with one site in the target genome, so the possibility of off-target editing is very low. If the CAG/CAA (Gln) or CGA (Arg) codons were located at 20 bases upstream of the PAM site, then this region would be suitable as a target. Hence, to generate loss-of-function mutations efficiently, sgRNA target sites were designed in the first half of the open reading frame, as close as possible to the start codons. According to those editing rules of Cas9-cytidine deaminase fusion in BsaI in pBmBE3. The oligonucleotides (each oligonucleotide was 70 bp) were synthesized by array-based oligonucleotide pool synthesis. Then all oligonucleotides were amplified by PCR. The PCR products were purified and ligated into the BsaI-digested pBmBE3 vector by Gibson ligation, and the successfully ligated plasmids were transformed into Psa or E. coli DH5\u03b1 chemically competent cells  or CGA (Arg) codons were located at 20 bases downstream of the TTTN structure, this region could be designed as a target site.Psa strain was taken from an ultra-cold storage freezer (\u221280 \u00b0C) and cultured on King\u2019s B medium (containing 50 \u03bcg mL\u22121 Rifampicin) at 25 \u00b0C for 48 h before usage. A single colony was inoculated in 5 mL of liquid KB and shaken at 200 rpm min\u22121 overnight at 25 \u00b0C. The bacterial culture (2 mL) was transferred to 50 mL of liquid KB and incubated in the same conditions until the OD600 reached 0.5. Cells were collected by centrifuging at 4 \u00b0C for 10 min at 10,000\u00d7 g and resuspended with a 5 mL cold CaCl2 solution (20 mM). The supernatant was discarded, and the bacterial cells were resuspended with the buffer (0.7 mL of 20 mM CaCl2 and 0.3 mL of 50% glycerol) and then dispensed into each centrifuge tube with 100 \u03bcL. The competent cells were immediately frozen in liquid nitrogen for 5 min and stored at \u221280 \u00b0C (Supplementary Notes 2 and Psa cells were added to 0.5 mL of liquid KB (0.6 mM IPTG) and cultured at 25 \u00b0C for 2 h at 180 rpm. Cells were inculcated on the KB solid medium (containing 50 \u03bcg/mL gentamicin and 0.6 mM IPTG) for 2 days at 28 \u00b0C. A single colony was selected, and the target gene was amplified and sequenced to identify the mutation events.The Psa infection assays were based on previous procedures [A. chinensis var. chinensis \u2018Hongyang\u2019 tissue culture plantlets were cut and grown on Murashige and Skoog rooting medium without antibiotics in plates. Plantlets were grown in a plant growth chamber with a temperature of 24 \u00b1 1 \u00b0C and a photoperiod of 16 h light/8 h dark. Kiwifruit plantlets (4 weeks old) were infected using a plant flooding method [Psa (containing empty vector) and mutants were grown in liquid LB (containing 50 \u03bcg/mL gentamicin) followed by overnight shaking and washing, and the cell density was adjusted to 1 \u00d7 107 CFU/mL. Silwet L-77  as a surfactant was added to the Psa suspension at 0.0025% (vol/vol). Kiwifruit plantlets were fully submerged in Psa suspension for 5 min and grown in a plant growth chamber with a temperature of 16 \u00b0C with 16 h/light and 10 \u00b0C with an 8 h/dark cycle. Leaves were collected at 20 days postinoculation (dpi). Leaf samples were washed with ddH2O three times and ground with 1 mL of sterile 10 mM MgSO4. The leaf homogenate was stored at 4 \u00b0C overnight, and the supernatant was diluted 10-fold and plated as 10 \u03bcL droplets on the LB medium with 50 \u03bcg/mL Gm. After 2 days of incubation at 25 \u00b0C, the CFU per cm2 leaf was ascertained from dilutions.ocedures . The axig method . Psa (coPsa pathogenic genes focused on the effector proteins of the T3SS in the sequenced strain PSA.AH.01. We referred to relevant literature regarding DC3000 and selected 10 effectors, namely, HopAO2, HopR1, HopAI1, AvrE1, HopM1, HopI1, AvrB4, HopQ1, HopZ3, and HopF2, which have been reported in the literature [In this paper, the screening of terature ,47,48,49"}
{"text": "Background: The locoregional recurrence of breast cancer has been reduced due to the multidisciplinary approach of breast surgery, systemic therapy and radiation. Early detection and better surgical techniques contribute to an improvement in breast cancer outcomes. Purpose of Review: The purpose of this review is to have an overview and summary of the current evidence behind the current approaches to the locoregional treatment of breast cancer and to discuss its future direction. Summary: With improved surgical techniques and the use of a more effective neoadjuvant systemic therapy, including checkpoint inhibitors and dual HER2-directed therapies that lead to a higher frequency of pathologic complete responses and advances in adjuvant radiation therapy, breast cancer patients are experiencing better locoregional control and reduced local and systemic recurrence. De-escalation in surgery has not only improved the quality of life in the majority of breast cancer patients, but also maintained the low risk of recurrence. There are ongoing clinical trials to optimize radiation therapy in breast cancer. More modern radiation technologies are evolving to improve the patient outcome and reduce radiation toxicities. Due to the multidisciplinary approach to locoregional disease in breast cancer, the local recurrence and long-term outcome of breast cancer have improved. The decline in ipsilateral breast cancer recurrence is due to multiple factors including early detection, better surgical techniques, an effective neoadjuvant and adjuvant systemic therapy and adjuvant radiation. The improvement in local recurrence and long-term outcome has shifted the treatment toward an improvement in quality of life and decreased morbidities, such as lymphedema, which is achievable with de-escalation. There are ongoing clinical trials to de-escalate local therapy while omitting surgery and/or radiation in ductal carcinoma in situ and early-stage hormone-positive breast cancer in older adults ,2. In thTo understand where we are with treatment, we must review the past. The surgical treatment of breast cancer has evolved drastically since the Halsted radical mastectomy was established as the operation for breast cancer for most of the 20th century. The radical mastectomy included the breast, pectoralis major muscle and a level 1\u20133 axillary lymphadenectomy. Patients and surgeons began to voice dissatisfaction for this procedure in the mid1960s , compariThe evolution of a radical mastectomy to less surgery was the first step toward improvements in the morbidity from lymphedema, pain, decreased range of motion and function. With the knowledge gained in the NSABP B-04 trial and womenThere has been much debate on the adequate margin needed at the time of surgical resection for breast cancer. This has ranged greatly in the literature from no ink on tumor to margins > 1 cm. There has also been debate between invasive and non-invasive breast cancer. In 2014, a consensus statement was issued after a systematic review and meta-analysis across all subspecialties including surgical oncologists, medical oncologists, radiation oncologists and breast pathologists. The consensus is that no ink on tumor minimizes the risk of invasive breast cancer recurrence and a 2 mm margin is required for pure ductal carcinoma in situ (DCIS) ,10. The Through the twentieth century, we moved further from the radical mastectomy to partial mastectomy for early-stage breast cancer. Women were able to have outpatient surgery with minimal morbidity, although the standard was to perform a level 1 and 2 ALND for patients with invasive breast cancer. Moving from an ALND to a sentinel lymph node (SLN) biopsy to surgically stage the axilla in clinically node negative patients was another major step in the de-escalation of breast cancer surgical treatment. SLN biopsy was shown repeatedly to be safe in patients who had a negative SLN ,12,13. BThe results of the ACOSOG Z0011 trial have been widely adopted for patients undergoing a partial mastectomy with a clinically negative axilla and are considered a standard of care in the NCCN guidelines version 4.2023 for invasive breast cancer. Patients have greatly benefited from this shift in treatment. In a retrospective chart review conducted at the Memorial Sloan Kettering Cancer Center, they looked at how many axillary lymph node dissections were avoided based on the Z0011 criteria. Out of 793 patients, 84% underwent SLND alone while the remainder underwent ALND based on \u22653 SLN-positive, extra capsular extension and/or surgeon choice . Upon fuThe question of the surgical treatment of the axilla in patients who are undergoing a mastectomy is still ongoing. Patients included in the Z0011 trial all underwent breast conservation with adjuvant breast irradiation. The tangential fields of radiation treated level 1 of the axilla and part of level 2. Due to this, there was concern that those patients undergoing a mastectomy who may not qualify for post mastectomy radiation therapy would have their axilla undertreated if any disease was noted in their pathology. The AMAROS trial  8] comp comp8] cThere has been a conundrum for patients who undergo a mastectomy and are found to have axillary metastasis through H&E in their SLN. A multidisciplinary conversation is necessary to discuss the patient\u2019s clinical scenario and the necessity of completion ALND versus axillary radiation versus both ALND and radiation therapy. There remain clinical scenarios where an ALND remains the standard of care. These include patients who present with a clinically positive axilla and do not undergo neoadjuvant systemic therapy, those with a failed SLN mapping, those with sentinel or axillary lymph nodes that remain positive after neoadjuvant chemotherapy, those with an axillary recurrence following previous breast cancer treatment, those with matted lymph nodes or gross disease at the time of SLNB, those with occult breast cancer only presenting with axillary metastasis, SLN-positive patients who fall out of the Z0011 criteria and those with inflammatory breast cancer (ASBrS consensus statement). Lymphedema is a concern for all patients undergoing a lymphadenectomy. This known morbidity has been reported through all clinical trials including this treatment of the axilla. In the AMAROS trial, although there was no difference in survival, there was a significant difference in morbidity for the patient in terms of lymphedema with the axillary radiotherapy having 11% lymphedema noted at 5 years compared to 23% in the ALND group. Singhal et al. reported on the use of a prophylactic lymphovenous bypass at the time of ALND for breast cancer. This showed a decrease in lymphedema from at least 20% to 3.1% in the patient population treated . FurtherThe evolution of breast surgery has not occurred in a silo. The majority of the credit has to be given to the quickly changing and improving systemic therapy that we have available to our patients. From the trials discussed above one can see that more surgery does not equate to a better OS or DFS. Improved systemic therapy is what has improved survival in the treatment of breast cancer. As we better understand the biology of individual breast cancers and can personalize treatment, pathologic complete responses (pCR) have become more common especially with utilizing dual HER2-directed therapy in HER2-positive breast cancer patients and the use of pembrolizumab, an immune checkpoint inhibitor in triple-negative breast cancer patients in a neoadjuvant setting ,19. The This cohort of patients was excluded from trials such as AMAROS and Z0011 as there was concern over the false negative rate of sentinel lymph node biopsy after neoadjuvant chemotherapy. The ACOSOG Z1071 trial set to evaluate the false negative rate of sentinel lymph node biopsy after neoadjuvant chemotherapy ,24. ThisACOSOG 71071 and multiple other trials  have shown similar results. Patients who are converted to a clinically negative axilla with neoadjuvant systemic therapy can undergo a Targeted Lymph node Dissection (TLND) at the time of surgery. If there is any residual cancer noted in the lymph nodes that are removed, a completion ALND is recommended. Using systemic therapy to de-escalate axillary surgery will save many patients the morbidity of an ALND. The alliance A11202 study compares patients who undergo neoadjuvant chemotherapy and have a positive SLN. Patients are randomized to either ALND with chest wall and local lymph node radiation or to radiation alone regardless of surgery. Johnson et al. recently reported the results of a feasibility study by the Exceptional Responders Clinical Trials Group to eliminate surgery. Thirteen patients with triple-negative or HER2-positive breast cancer who received neoadjuvant systemic treatment underwent a vacuum-assisted core biopsy post systemic therapy. Those with pCR  did not have any surgery, but they received whole breast radiation therapy. The median follow-up of 44.3 months did not reveal any ipsilateral breast tumor recurrence. The expansion phase of this study is ongoing ,26.p = 0.279), but radiation therapy did reduce recurrence  [The de-escalation of surgery in the axilla has been very important in reducing the morbidity of surgery. SLN biopsy is performed in all patients who present with a clinically negative axilla. In 2013, Hughes et al. published their results of the CALGB 9343 trial that looked at lumpectomy plus tamoxifen with or without irradiation in women aged 70 or older with early-stage breast cancer . They fo= 0.002) . The omiAlthough surgical techniques have changed drastically, there continues to be some morbidity that is unavoidable after surgery. Omitting surgery all together in some settings would be beneficial to patients if oncologically safe. Multiple retrospective trials ,31,32,33More recently, multiple prospective studies have utilized an image-guided core needle biopsy to evaluate for pCR using ultrasound and mammography ,36,37. Tp < 0.0003). Both hormone-receptor-positive and negative DCIS patients were enrolled in this study. There was no benefit from adding tamoxifen for hormone receptor-negative patients. At a 10-year follow-up, patients maintained low LRR [Multiple studies have shown the benefit of systemic therapy in reducing the locoregional recurrence (LRR) of breast cancer. NSABP B-24 was one of the first studies that was conducted and that showed a reduction in the rate of LRR with tamoxifen in patients with DCIS. Patients with DCIS were randomized to receive tamoxifen in an adjuvant setting after surgical resection and radiation therapy. At a 7-year follow-up, patients who received tamoxifen showed a 39% relative risk reduction of ipsilateral and contralateral breast cancer; both stage 0 and invasive cancer were reduced from 16% in the placebo group to 10% in the tamoxifen group  that randomized early-stage, node-negative breast cancer patients to lumpectomy and whole breast irradiation with or without systemic therapy showed lower LRR in patients who received systemic therapy. Of the patients who did not receive any systemic therapy, 12.3% had a 12-year incidence of ipsilateral recurrence compared to patients assigned to tamoxifen alone, chemotherapy alone, and tamoxifen plus chemotherapy of which 6.7%, 6.4%, and 6.8% had ipsilateral recurrences, respectively ,46. The secondary analysis of the TAILORx randomized clinical trial that was reported by Sparano et al. showed that patients with a high Oncotype DX recurrence score of 26 to 100 who received adjuvant chemotherapy did extremely well and 91% had a 5-year freedom of breast cancer distant or locoregional recurrence .Adjuvant radiation has been an integral component of breast conservation for several decades. In 2011, the Early Breast Cancer Trialist\u2019 Collaborative Group (EBCTCG) meta-analysis showed that for node-negative patients, radiation reduced the risk of local recurrence from 31.0% to 15.6% at 10-years and reduced the 15-year risk of breast cancer death from 20.5% to 17.2% . For nodRegional nodal irradiation (RNI) is the radiation of the draining lymph nodes of the breast, which often includes the axilla (levels I\u2013III), supraclavicular lymph nodes (SCL) and internal mammary lymph nodes (IMN), after either a mastectomy or breast conserving surgery. In the late 1990s, multiple trials established RNI after a mastectomy as the standard of care for women with node-positive or high-risk breast cancer ,50,51. IThe treatment of the regional nodes in women with 1\u20133 positive lymph nodes had been a source of controversy for several years. In 2011, the EBCTCG sought to end the debate with a meta-analysis that showed that the radiation after BCS reduced any first recurrence from 58.2% to 38.3%, for an absolute 10-year gain of 19.9% . In 2014Neoadjuvant chemotherapy (NAC) is increasingly being used in the treatment of breast cancer. NAC can not only downstage tumors, making them more amenable to breast-conserving surgery (BCS), but also a tumor\u2019s response to NAC can give insight into the tumor biology and prognosis ,55. It iTwo large, randomized trials are currently investigating the role of radiation therapy after NAC in patients with a clinically node-positive disease. The NSABP B-51/RTOG 1304 trial  is evaluFollowing the practice changing TAILORX trial, molecular assays are increasingly being used to guide and individualize breast cancer treatment . PatientTwo randomized trials have been initiated that aim to use genetic biomarkers to guide the adjuvant radiation. NRG-BR007 , also knConventional whole breast radiation therapy is delivered in 25 fractions over 5 weeks. However, there is a growing interest in the use of non-standard radiation fractionations, such as hypofractionated whole breast radiation (HBRT) and ultra-hypofractionated whole breast radiation (UHBRT) to make radiation treatment more convenient for patients. The FAST-FORWARD trial compared HBRT (1 week) to conventional whole breast radiation (3 weeks) in patients with early-stage breast cancer. The trial found that HBRT was non-inferior to conventional whole breast radiation in terms of local control and toxicity . The NRGRadiation oncology is also moving towards more individualized treatments that maximize the cancer outcomes and minimize the treatment-related toxicity. Modern radiation techniques such as intensity-modulated radiation therapy (IMRT), prone positioning and proton therapy have reduced the dose to normal tissues such as the heart and lung, thereby minimizing any potential radiation-related cardiac or pulmonary toxicities. Smaller target volumes seen in partial breast irradiation further minimize the dose to normal tissues for lower-risk patients. Through appropriately de-escalating RNI in those patients who do not derive benefit, by omitting radiation in select lower-risk patients, modifying radiation targets to account for smaller surgeries and utilizing modern radiation treatment planning, radiation oncology is adapting and evolving to improve breast cancer treatment for all patients. In the future, more modern radiation technologies, such as FLASH radiotherapy, may be able to spare normal tissue while maintaining the anti-tumor effectiveness. Due to an improvement in surgical techniques, a neoadjuvant systemic therapy that includes checkpoint inhibitors in triple-negative breast cancer patients and dual HER2-directed therapy in HER2-positive breast cancer patients leads to an improved pCR plus advances in radiation therapy which have changed the outcome of breast cancer patients. With the increased use of neoadjuvant systemic therapy, breast cancer patients are having less aggressive surgeries. The management of axilla has changed tremendously. We can downstage the axilla and reduce the number of axillary node dissections even if the patient had clinically positive lymph nodes before starting the neoadjuvant chemotherapy, which turned into negative axilla post neoadjuvant chemotherapy. We are escalating neoadjuvant therapy by adding a checkpoint inhibitor (pembrolizumab) and dual HER2-directed therapy to neoadjuvant chemotherapy in triple-negative and HER2-positive breast cancer patients even though some studies have shown a de-escalation from the chemo portion of neoadjuvant systemic therapy in selected HER2-positive patients can maintain the high pCR rate, which is translated into an improvement in DFS and OS and a decrease in treatment-associated toxicities . Breast cancer patients are experiencing less locoregional and systemic recurrences and an improvement in DFS and OS. Early-stage breast cancer patients with proper surgery, adjuvant systemic therapy and radiation have a 0.5% risk of local recurrence per year, which previously was reported as 1% . The useThere will always be a role for breast surgery in the treatment of breast cancer, but we have shown repeatedly that less surgery is equivalent in regard to disease free and disease specific overall survival. The de-escalation of surgery has been made possible with the improvement of systemic therapy in a neoadjuvant setting. Adjuvant systemic therapy also plays an important role in reducing both the systemic and local recurrence of breast cancer. There are a number of controversies surrounding the use of radiation therapy in breast cancer. These controversies are being investigated in a number of clinical trials. Multiple ongoing studies are investigating how to utilize and validate biomarkers in the adjuvant radiation therapy of breast cancer patients. The results of these trials will help to inform the optimal use of radiation therapy in breast cancer. More modern radiation technologies are evolving to improve the patient outcome and reduce the radiation toxicities.The evolution for the loco-regional treatment of breast cancer has de-escalated in a short amount of time as systemic therapy has improved. This allows us to give patients more options and personalize their care. A robotic-assisted nipple sparing mastectomy and sensation sparing mastectomy are two new additions to our surgical arsenal to improve patients\u2019 quality of life. In addition to omitting surgery all together, further studies are continuing to look at percutaneous treatment including cryoablation and radiofrequency ablation. We predict that the de-escalation/omission of radiation therapy in low-risk breast cancer patients will be on the horizon."}
{"text": "Introduction: Inosine monophosphate dehydrogenase 1 (IMPDH1) is a critical enzyme in the retina, essential for the correct functioning of photoreceptor cells. Mutations in IMPDH1 have been linked to autosomal dominant retinitis pigmentosa subtype 10 (adRP-10), a genetic eye disorder. Some of these mutations such as the Asp226Asn (D226N) lead to the assembly of large filamentous structures termed cytoophidia. D226N also gives IMPDH1 resistance to feedback inhibition by GDP/GTP. This study aims to emulate the adRP-10 condition with a long-term expression of IMPDH1-D226N in vitro and explore cytoophidium assembly and cell survival. We also assessed whether the introduction of an additional mutation (Y12C) to disrupt the cytoophidium has an attenuating effect on the toxicity caused by the D226N mutation.Results: Expression of IMPDH1-D226N in HEp-2 cells resulted in cytoophidium assembly in \u223c70% of the cells, but the presence of the Y12C mutation disrupted the filaments. Long-term cell survival was significantly affected by the presence of the D226N mutation, with a decrease of \u223c40% in the cells expressing IMPDH1-D226N when compared to IMPDH1-WT; however, survival was significantly recovered in IMPDH1-Y12C/D226N, with only a \u223c10% decrease when compared to IMPDH1-WT. On the other hand, the IMPDH1 expression level in the D226N-positive cells was <30% of that of the IMPDH1-WT-positive cells and only slightly higher in the Y12C/D226N, suggesting that although cell survival in Y12C/D226N was recovered, higher expression levels of the mutated IMPDH1 were not tolerated by the cells in the long term.Conclusion: The IMPDH1-D226N effect on photoreceptor cell survival may be the result of a sum of problems: nucleotide unbalance plus a toxic long-life cytoophidium, supported by the observation that by introducing Y12C in IMPDH1 the cytoophidium was disrupted and cell survival significantly recovered, but not the sensibility to GDP/GTP regulation since higher expression levels of IMPDH1-D226N were not tolerated. Inosine monophosphate dehydrogenase 1 (IMPDH1) is a crucial enzyme in the retina that plays a critical role in the survival and function of photoreceptor cells, as the demand of cGMP for the phototransduction process is very high. These cells are responsible for converting light into electrical signals, and any dysfunction or loss of these cells can lead to severe vision impairments. In photoreceptor cells, the isoform 1 of IMPDH is predominant , probablin vivo to adjust GTP synthesis to different lighting conditions , a genetic eye disorder that affects approximately 1 in 4000 people . The adRin vivo adRP-10 patient condition with a long-term expression of IMPDH1-D226N in vitro and explore cytoophidium assembly and cell survival. We will also evaluate if by disrupting the cytoophidium with another mutation in residue Tyr12 , results in \u201cpermanent\u201d cytoophidium assembly that cannot be disrupted by guanosine supplementation , meaningue Tyr12 , or by tue Tyr12 , toxicit\u00df isoform (NCBI Reference Sequence: NM_000883.4) was PCR-amplified from a human cell line cDNA (HEp-2), with the following primers: F: atg\u200bgcg\u200bgac\u200btac\u200bctg\u200batc\u200bagc; R: gta\u200bcag\u200bccg\u200bctt\u200bttc\u200bgta\u200baga\u200bgtg, and the GMPR (NCBI Reference Sequence: NM_006877.4), with the following primers: F: atg\u200bccc\u200bcgc\u200bata\u200bgat\u200bgcg\u200bgac\u200bc; R: tta\u200bgct\u200bgaa\u200bcac\u200bggt\u200bgtt\u200bgtg. The genes were inserted into the linearized pCMV3 vector  that contains piggyBac inverted repeats for the transposon system, by using ClonExpress UItra One Step Cloning Kit  according to the manufacturer\u2019s protocol. To the IMPDH1 gene, a myc tag was fused at the C\u2032 terminus and a dark red fluorescent molecule  at the N\u2032 terminus, interleaved by a P2A sequence. To the GMPR gene, a blue fluorescent protein BFP  was added at the N\u2032 terminus, interleaved by a P2A sequence. The final IMPDH1 construct was pCMV_iRFP670_P2A_IMPDH1-Myc. The final GMPR construct was pCMV_BFP_P2A_GMPR.The IMPDH1 coding sequence for the canonical 514aa Site-directed mutagenesis was carried out by linearizing target constructs with primers containing individual point mutations, followed by recirculation of the plasmid with the Gibson assembly system and NEBuilder HiFi Master Mix Kit . Gene size, sequence, and point mutations were confirmed by agarose gel and Sanger sequencing.\u00df were replaced by the 38aa fragment  were grown to confluence with the culture medium DMEM supplemented with 2\u00a0mM L-glutamine and 1% antibiotic\u2013antimycotic (Thermo Fisher Scientific), plus 10% fetal bovine serum . The cells were cultured in a 37\u00b0C humid incubator with 5% COAll transfections were carried out with TurboFect or Lipofectamine 3000 transfection reagents  diluted in Opti-MEM I Reduced Serum Medium , according to instructions provided by the manufacturer.For transient overexpression, plasmids were transfected alone or mixed (as indicated in the Results) and the cells analyzed 24\u201348\u00a0h after transfection. For generation of cell lines with stable overexpression of the proteins, plasmids were transfected together with a transposase vector , and after 48\u00a0h, the cells were selected with 100\u00a0\u03bcg/mL of hygromycin B for 2\u20133\u00a0weeks  before aFor preparation of the IMPDH inhibitor drugs, ribavirin 250\u00a0mg pills  were diluted in water and filtered (0.22\u00a0\u00b5m) for a 100\u00a0mM stock solution. For MPA, mycophenolate sodium 360\u00a0mg pills  were diluted in PBS and filtered to obtain a 100\u00a0mM stock solution. Drugs were added to the cells 4\u00a0h before fixation in a 1/1000 final dilution, or otherwise as indicated in the Results.For analysis of cytoophidium, the cells grown in 13-mm round coverslips were fixed with 4% paraformaldehyde and probed with antibodies in an indirect immunofluorescence assay, as previously described .Primary antibodies used: rabbit polyclonal anti-IMPDH2 antibody , mouse anti-Myc monoclonal antibody 9E10 , and mouse anti-Flag monoclonal antibody clone M2 . Secondary antibodies used: Cy3-conjugated donkey anti-mouse IgG  and Alexa Fluor 488-conjugated donkey anti-rabbit IgG . After immunofluorescence labeling, the cells were covered with VECTASHIELD containing DAPI , and the images were captured either by a fluorescence microscope with 200 \u00d7 or 400 \u00d7 magnification  or by a confocal microscope .Cytometry analysis of the reporter genes (iRFP670 and BFP) was performed as previously described . BrieflyTwo methods were applied for analyzing apoptosis. First, the cells were labeled with Annexin V conjugated to Alexa Fluor 488 and propidium iodide , following the manufacturer`s protocol.Apoptosis was also measured by transfecting the cells 24\u00a0h before analysis with a plasmid containing a caspase-3 cleavage sequence, named FlipGFP, as detailed elsewhere . After cAs a positive control, the cells were treated with 0.5\u00a0\u00b5M of staurosporine for 4\u00a0h before analysis. In addition, another positive control was induction of apoptosis by exposing the bare cells to UV light for 1\u00a0min, followed by analysis 24\u00a0h later.Images captured using the microscope were analyzed using ImageJ 1.53 software. The proportion of cells presenting a given characteristic, such as cytoophidium, was obtained by quantification of at least two randomly captured images (>100 cells) in each of at least two independent experiments.All cytometry data were analyzed with CytExpert v2.3 software. Plasmid construction was designed, and DNA sequencing results were analyzed with SnapGene v3.2.1 software.t-test with Welch`s correction was applied. If the data require sample pairing, first the repeated measures one-way ANOVA (RM-ANOVA) was applied to assess if the difference among the groups was significant. If it was, comparisons among two groups were made by a two-tailed paired t-test  or Wilcoxon matched-pairs signed rank test . Normal distribution was evaluated by the D'Agostino and Pearson normality test.The data are presented as mean plus error bars indicating standard deviation (S.D.) or standard error of the mean (S.E.M.) as described in the figure legends. For statistical comparisons, if the data did not require sample pairing, an unpaired two-tailed p \u2264 0.05 was considered statistically significant. All statistical analyses were performed with GraphPad Prism v7.0 software.Comparisons among each condition and the reference (IMPDH1-WT) are shown above each data-bar, as indicated by the red arrows in the graphs . Other cTo better understand the cytoophidium assembly behavior of IMPDH1-D226N, as well as the potential of replacing Tyr12 for another residue , in thisOverexpression of IMPDH1-D226N mutation induces cytoophidium in \u223c70% of transfected cells, significantly higher than that of IMPDH1-wt overexpression. Curiously, under ribavirin or MPA treatment, the cytoophidium turns into large clumps in \u223c50% of the cells , as shown in Since the reporter gene was fused to the IMPDH1 interleaved by a P2A sequence, by analyzing the iRFP670 mean fluorescence intensity (MFI) in the positive cells, we could estimate the expression level of IMPDH1, estimating the amount of protein that was not toxic enough to prevent long-term cell survival. The average MFI in the D226N-positive cells was <30% of that of the IMPDH1-WT-positive cells . AltogetWe then evaluated if the presence of Y12C mutation that disrupts cytoophidium  could deHowever, when we analyzed the MFI and the percent of high iRFP670, there was only a slight although significant increase in the Y12C/D226N compared with the D226N alone , with vaWe hypothesized that the improved cell survival in Y12C/D226N when compared with the D226N alone could be, in part, credited to the presence of the cytoophidium-disrupting Y12C since in all analyses of percent of iRFP670 and MFI, the cells expressing IMPDH1-Y12C tolerate slightly increased expression levels of protein when compared with IMPDH1-WT .One of the hypotheses for the toxic effect of D226N mutation on IMPDH1 is that it may disrupt feedback inhibition of IMPDH1 by GDP/GTP , which iIn the long-term cell-lines, percent of D226N-expressing cells among the GMPR-WT positive cells was 42.5% ; this reSimilar to when expressing mutated IMPDH1 alone, in the presence of GMPR, percent of high iRFP670 presented a slight although significant increase for Y12C/D226N, but still significantly lower than that of IMPDH1-WT + GMPR-WT . In addiEither an accumulation of protein aggregates or an unbalanced pool of nucleotides would result in cell damage and death by apoptosis. To evaluate the dynamics of cell death induced by the presence of D226N without the effect of hygromycin B treatment, the percent of iRFP670-expressing cells was analyzed 24\u00a0h after transfection (T1) and within 3-day intervals (time-points) up to 2\u00a0weeks . Within To measure apoptosis, we used a plasmid containing a caspase-3 cleavage sequence, named FlipGFP, as detailed elsewhere . The gatIn the cells with stable expression of IMPDH1-WT or D226N, apoptosis was labeled for phosphatidylserine translocation with Annexin V . In all Altogether, the presence of IMPDH1-D226N results in a \u223c20\u201330% increase in the apoptosis rate, with a cumulative effect, meaning within 1 week, the percent of iRFP670-positive cells will reach the \u223c40\u201350% decrease observed in the D226N\u00a0cell lines when compared with IMPDH1-WT.\u00df isoform, with 514aa. However, in human retinal photoreceptor cells, an alternative splicing isoform \u03b1 is the predominant IMPDH1 isoform expressed   without hygromycin selection . A total (day 7) . In addionical \u00df .Altogether, these data show that cell survival was slightly lower in the presence of IMPDH1-\u03b1(546aa) when compared with the canonical IMPDH1-\u03b2(514aa), a \u223c10% decrease, but the intensity of damage is much less severe than that of IMPDH1-D226N. However, since \u03b1(546aa) is the major isoform in the human retina, in adRP-10 patients that carry the IMPDH1-D226N mutation, the effect would add up and damage photoreceptor cells even further.in vivo side effect of this mutation in retinal photoreceptor cells. We were also able to significantly recover cell survival by introducing another mutation in IMPDH1, the Y12C, which disrupts the filaments.Our data show that the adRP-10-related IMPDH1 missense mutation D226N induces formation of large cytoophidium, and the replacement of tyrosine at position 12 disrupts those cytoophidia, as previously demonstrated elsewhere . The lonThe impact of the exogenous IMPDH1-Y12C on the polymerization of endogenous IMPDH2 and the assembly of the cytoophidium, which is known as a large bundle of IMPDH polymers, can be attributed to the fundamental understanding that IMPDH polymers are composed of octamers . Given tin vivo model that faithfully replicates adRP-10-related IMPDH1 mutations poses significant challenges due to the difficulty of introducing mutations in animals and waiting for the disease phenotype to manifest. In vitro, the complex metabolism within photoreceptor cells is also a challenge, as well as retinal cell lines such as the retinal pigment epithelial cell (RPE1) or the 661W cone photoreceptor cell line which grow at a much slower rate than other more traditional tumor-derived cells, such as HeLa and HEK293-T. In our model, we used HEp-2 cells, initially thought to be a lineage of laryngeal carcinoma, but recent evidence suggests that it is derived from a HeLa contamination (\u03b1 is the predominant IMPDH1 isoform, with 546aa. IMPDH1-\u03b1 has decreased sensitivity to GTP feedback inhibition when compared with the canonical 514aa IMPDH1-\u03b2 (Creating an accurate mination . In any mination . HoweverIMPDH1-\u03b2 . Our resBy utilizing this model, we could emulate the long-term expression of IMPDH1-D226N and evaluate cytoophidium assembly, cell tolerance, and survival. However, there are at least 12 mutations in IMPDH1 that are associated to adRP in humans . From thIn retinal cells, the presence of cytoophidium is tightly regulated by light conditions, as demonstrated in previous studies . This rein vivo. The D226N-induced \u201ctoxic long-life cytoophidium\u201d hypothesis would be in addition to losing its sensibility to GDP/GTP inhibition (in vivo using an adRP-10 animal model.In conclusion, we hypothesize that since cytoophidium increases protein half-life by making it difficult to be degraded , this cohibition , which rhibition . Indeed,hibition , as well"}