{"text": "Drosophila \u201cphotoshop\u201d mutations, which increase expression of green fluorescent protein and other transgenes. Mapping and molecular analyses show that photoshop mutations are loss-of-function mutations in the Drosophila homologs of NMD genes Upf1, Upf2, and Smg1. We find that Upf1 and Upf2 are broadly active during development, and they are required for NMD as well as for proper expression of dozens of wild-type genes during development and for larval viability. Genetic mosaic analysis shows that Upf1 and Upf2 are required for growth and/or survival of imaginal cell clones, but this defect can be overcome if surrounding wild-type cells are eliminated. By contrast, we find that the PI3K-related kinase Smg1 potentiates but is not required for NMD or for viability, implying that the Upf1 phosphorylation cycle that is required for mammalian and Caenorhabditis elegans NMD has a more limited role during Drosophila development. Finally, we show that the SV40 3\u2032 UTR, present in many Drosophila transgenes, targets the transgenes for regulation by the NMD pathway. The results establish that the Drosophila NMD pathway is broadly active and essential for development, and one critical function of the pathway is to endow proliferating imaginal cells with a competitive growth advantage that prevents them from being overtaken by other proliferating cells.Nonsense-mediated mRNA decay (NMD) is a cellular surveillance mechanism that degrades transcripts containing premature translation termination codons, and it also influences expression of certain wild-type transcripts. Although the biochemical mechanisms of NMD have been studied intensively, its developmental functions and importance are less clear. Here, we describe the isolation and characterization of  Drosophila, the authors identified a set of mutations they call \u201cphotoshop\u201d mutations because they increase expression of green fluorescent protein transgenes such that cells expressing green fluorescent protein are more easily visualized. They found that the photoshop mutations are mutations in three different genes implicated in NMD. Using these mutations, they show that the NMD pathway not only degrades mutant mRNAs but also influences expression of many transgenes and dozens of endogenous genes during development and is essential for development beyond the larval stage. One important function of the pathway is to provide proliferating cells with a competitive growth advantage that prevents them from being overtaken by other proliferating cells during development. Thus, the Drosophila NMD pathway has critical cellular and developmental roles beyond the classical surveillance function of eliminating mutant transcripts.Cells possess a variety of surveillance mechanisms that detect and dispose of defective gene products. One such system is the nonsense-mediated mRNA decay (NMD) pathway, which degrades aberrant mRNAs containing nonsense mutations or other premature translation stop signals. In a genetic screen in  Drosophila mutants that affect NMD.Nonsense-mediated mRNA decay (NMD) is a cellular surveillance pathway in eukaryotes that recognizes and degrades transcripts with premature termination codons (PTCs). Such transcripts arise as a consequence of genomic mutation, as in numerous human genetic diseases ,2, and fup-frameshift suppressor [Upf] genes;  genes; ), and th] genes;  and cultla cells \u201310. Theriewed in ). Upf1 iP bodies . Upf1 isUpf1 undergoes a phosphorylation cycle  containing Smg5, Smg6, and/or Smg7, three similar proteins that are thought to recruit the phosphatase PPA2. The Upf1 phosphorylation cycle is apparently necessary for Upf1 and NMD activity at least in some organisms, because NMD function is abrogated when Smg1, Smg5, Smg6, or Smg7 activity is reduced  and PBac{WH}CG3044[f02328] as described in Thibault et al. [http://www.flybase.org. Flies were reared at 25 \u00b0C on cornmeal/dextrose medium.S system  drivers btl-GAL4 , e22c-GA22c-GAL4 , ppk-GALppk-GAL4 , and da-[da-GAL4 . GFP andt et al. . Marker 19Ay w FRT chromosome [19A/FMy w * FRT7 females to 19A, hsFLP122/Y; btl-GAL4, UAS-GFPgal80 FRT males. After a 45-min heat shock at 38 \u00b0C to induce FLP expression, embryos were returned to 25 \u00b0C to continue development. L3 larvae of genotype 19A/gal80 FRT19A, hsFLP122; btl-GAL4, UAS-GFP/+y w * FRT were identified by GFP mosaicism within the tracheal system and scored for the photoshop phenotype.The photoshop mutations were obtained by mutagenesis of an isogenized romosome  with 25 romosome  in a tra32APSmg1 chromosome (designated 32AP\u2020) carried lethal mutations not associated with the photoshop phenotype. Lethals were removed by crossing 32AP\u2020/19Ay w FRT females to w/Y; btl-GAL4, UAS-GFP males and identifying L3 larvae with enhanced GFP throughout their tracheal systems. These 32AP/Y; btl-GAL4, UAS-GFP/+Smg1 larvae developed into viable adult males. We also found a viable wing morphology mutation on 32AP\u2020 that is allelic to wavy. Existing wavy alleles do not show a photoshop phenotype, and the wing phenotype is separable from the photoshop phenotype, so wavy does not seem to contribute to the photoshop phenotype.The original 29AAUpf2 chromosome carries a linked lethal mutation. When recombined away from 29AA,Upf2 the mutation had no effect on tracheal development or reporter expression. However, we have not obtained a recombinant containing 29AAUpf2 without the extraneous mutation.The Upf2, we used genomic rescue transgenes located on the autosomes to generate males of genotype 14J v g f FRT19Ay w Upf2/+, Upf2+}/+Y; P{w and crossed these to 19A/FM7cy w * FRT females, where the asterisk indicates the tested mutation. Absence of Bar+, white-eyed female progeny indicated failure to complement. For complementation tests of Upf1, we used the Y-linked duplication +DpBSC1, y, which covers the Upf1 locus. Males of genotype 13DUpf1/+DpBSC1, y were crossed to 26AUpf1/FM7c females, and the absence of female Bar+ progeny indicated a failure to complement.For complementation tests of 19Ay w * FRT/19Asc cv ct v g f FRT females  to FM7c/Y males and scoring the viable male progeny for the visible markers to determine the lethal interval. To refine the map position, we collected male progeny in which a recombination event had occurred within the mapped interval and scored them for SNPs. For each mutation we typically scored 300\u2013400 males for SNPs. For 26AUpf1 and 13D,Upf1 which map between v and g, we crossed the 19Ay w * FRT/19Asc cv ct v g f FRT females to males of genotype 1 sd1/Dpw+Df(1)64c18, g to distinguish + w cv+ ct+ v+ g fy sc recombinants, which we could not otherwise identify because of epistasis of w over v and g. We also crossed the 19Ay w * FRT/19Asc cv ct v g f FRT females to 19A/Ysc cv ct v g f FRT males to identify recombinant females, which were then tested for the photoshop phenotype in genetic mosaics to confirm that the lethality and photoshop phenotype mapped to the same interval. For the viable mutation 32AP, we followed a similar strategy as for the lethals, except we scored recombinant males for the presence or absence of 32AP by testing the enhancement of GFP in btl-GAL4, UAS-GFP transgenic animals.Identification of SNPs, construction of the SNP map of the X chromosome, and details of their use in mapping X chromosome mutations will be described elsewhere. Briefly, the location of the lethality associated with a photoshop mutation was mapped by crossing Upf2 genomic rescue construct, Drosophila BAC 24A2 [Upf2, was transformed into Escherichia coli strain EL250, which harbors heat-shock-inducible homologous recombination machinery [Upf2 coding sequence and UTRs based on the cDNA RE04053  tandemly into the Drosophila transformation vector pCaSpeR4 [Upf2 into pMM#200. The resultant plasmids were analyzed by restriction digestion, and one with the expected pattern (pMM#201) was used to establish transgenic lines on the second and third chromosomes by P-element transformation. Six lines were tested and all six rescued hemizygous male 14JUpf2 mutants to viability. The degree of rescue varied based on insertion site, but for the strongest lines +, Upf2+}11A(P{w and 24) rescued animals appeared indistinguishable from +Upf2 animals and were readily maintained as stocks of genotype 25G; P{w+, Upf2+}11AUpf2 or 24/+ or 14J; P{w+, Upf2+}11AUpf2 or 24/+.For the BAC 24A2 , which cachinery . We thenGFP reporter constructs, coding sequence of eGFP  was amplified by PCR using KpnI linker primers Kpn5GFP and Kpn3GFP  or pUAST-eGFP+I (to make pUAST.h-eGFP+I).The intron in the SV40 3\u2032 UTR of om pGATB . The PCRDrosophila using standard microinjection techniques using the \u03942\u20133 helper plasmid as the transposase source.Constructs made using PCR were sequenced to confirm that mutations had not been introduced. Constructs were transformed into http://www.ambion.com). RNA concentration was determined spectrophotometrically and normalized before reverse transcription with MuMLV reverse transcriptase . Real-time quantitative PCR was done with a thermocycler (iCycler) and real-time PCR mix . Primers used in the qRT-PCR experiments were designed to amplify 60- to 100-bp fragments within single exons; amplification of Drosophila genomic DNA containing a UAS-GFP transgene showed that primers gave a linear amplification response at concentrations ranging over four orders magnitude. Control reactions performed on RNA without reverse transcription or with primers against nontranscribed regions of genomic DNA gave negligible signals compared to experimental reactions. Experimental reactions were carried out in duplicate (except EK161155 was done once) on two RNA samples that were derived independently from the RNA used for microarray analysis. Results were normalized to results with rp18LA transcript, a gene that is not developmentally regulated [L3 larvae of the appropriate genotype were identified by enhancement of GFP for mutant alleles or by sexing using gonad morphology for wild-type controls. Total larval RNA was prepared using Trizol reagent , and genomic DNA contamination was eliminated with DNAse  or AdhR2Fam (for capillary electrophoresis). PCR products were sequenced directly or digested with PvuII to distinguish the Adh+ and n4Adh alleles. Capillary electrophoresis was performed on an ABI 3730x1  and analyzed using GeneMapper v3.0 software (Applied Biosystems).For analysis of 25G/Y; btl-GAL4, UAS-GFP/+Upf2 and 19A/Y; btl-GAL4, UAS-GFP/+y w FRT L3 larvae using Trizol as described above. cDNA labeled with Cy3 or Cy5 was prepared from each RNA sample and hybridized to microarrays containing ~14,000 gene probes [http://genome-www5.stanford.edu). During analysis we noted that the 25GUpf2 mutants were delayed in development. To avoid confounding effects of changes in gene expression that result from developmental regulation rather than more direct effects of Upf2 loss of function, we used the available wild-type developmental gene expression time course [Upf2 allele, and thus provides only a lower estimate of genes regulated by NMD.RNA was isolated from e probes ,53. Hybre course  to filteTable S1(22 KB DOC)Click here for additional data file.Table S2(36 KB DOC)Click here for additional data file.Table S3(31 KB DOC)Click here for additional data file.http://flybase.net)/Entrez Gene (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene) accession numbers for the genes described in the text are Adh (CG3481/Gene I.D. 3771877), oda (CG16747), Smg1 (CG32743/Gene I.D. 31625), Upf1 (CG1559/Gene I.D. 32153), and Upf2 (CG2253/Gene I.D. 31724). Microarray data have been deposited in the National Center for Biotechnology Information Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) and are accessible through accession number GSE5585.The FlyBase ("}
{"text": "Drosophila, their expression is dependent on HBP/SLBP that binds to the RNA hairpin element. We showed previously that these cis and trans acting regulators of histone gene expression are conserved in C. elegans. Here we report the results of an investigation of the histone mRNA 3' end structure and of histone gene expression during C. elegans development.Histone protein synthesis is essential for cell proliferation and required for the packaging of DNA into chromatin. In animals, histone proteins are provided by the expression of multicopy replication-dependent histone genes. Histone mRNAs that are processed by a histone-specific mechanism to end after a highly conserved RNA hairpin element, and lack a poly(A) tail. In vertebrates and C. elegans histone mRNA 3' end formation occurs at this polyadenylation signal and results in polyadenylated histone mRNA, we investigated the mRNA 3' end structure of histone mRNA. Using poly(A) selection, RNAse protection and sequencing of histone mRNA ends, we determined that a majority of C. elegans histone mRNAs lack a poly(A) tail and end three to six nucleotides after the hairpin structure, after an A or a U, and have a 3' OH group. RNAi knock down of CDL-1, the C. elegans HBP/SLBP, does not significantly affect histone mRNA levels but severely depletes histone protein levels. Histone gene expression varies during development and is reduced in L3 animals compared to L1 animals and adults. In adults, histone gene expression is restricted to the germ line, where cell division occurs.Sequence analysis of replication-dependent histone genes revealed the presence of several highly conserved sequence elements in the 3' untranslated region of histone pre-mRNAs, including an RNA hairpin element and a polyadenylation signal. To determine whether in C. elegans histone genes is subject to control mechanisms similar to the ones in other animals: the structure of C. elegans histone mRNA 3' ends is compatible with histone-specific mRNA 3' end processing; CDL-1 functions in post-transcriptional control of histone gene expression; and C. elegans histone mRNA levels are elevated at periods of active cell division, indicating that histone gene expression is linked to DNA replication.Our findings indicate that the expression of  Packaging of DNA into macromolecular nucleoprotein complexes is essential for cell division and the control of gene expression. In eukaryotes, histone proteins associate with DNA to form chromatin. Chromatin formation occurs during S phase and is dependent on the coordination of histone and DNA synthesis. In animals, replication-dependent histone genes are expressed during S phase and provide the protein building blocks for chromatin. They are the only genes known to produce mRNAs that lack polyadenylated (poly (A)) tails, and instead end with a highly conserved hairpin structure. Specialised histones, termed replacement variant histones, define specialised chromatin domains and are independently integrated into chromatin. The expression of replacement variant histone genes is not linked to DNA synthesis, and their mRNAs, which normally lack the hairpin element, are polyadenylated.Drosophila dSLBP is essential and is required for histone-specific mRNA 3' end processing [In animals, the four core histone proteins H2A, H2B, H3 and H4 and the linker histone H1 are normally encoded by multi copy replication-dependent histone genes (hereafter simply referred to as histone genes). These genes are clustered and have conserved histone specific elements in the 3' untranslated region (3'UTR), including the hairpin RNA element. The RNA binding protein termed hairpin-binding, or stem-loop binding protein (HBP/SLBP) specifically binds the RNA hairpin and is a key regulator of histone gene expression -7. An adocessing ,11. In docessing . HoweverC. elegans has multicopy H2A, H2B, H3 and H4 histone genes that have hallmarks of replication-dependent histone genes: they are clustered and have a conserved hairpin structure in the 3'UTR [C. elegans histone H1 genes are similar to replacement variant histone genes and do not have the conserved 3'UTR sequence elements [C. elegans HBP/SLBP CDL-1 [C. elegans hairpin RNA element [cdl-1 is essential and required for histone synthesis [he 3'UTR . This elhe 3'UTR , and theelements . We prevBP CDL-1 , and sho element . cdl-1 iynthesis ,17.C. elegans histone genes during development and elucidate the structure of C. elegans histone mRNA 3' ends. We observed that, as is the case in other metazoans, histone mRNAs end after the hairpin structure and not after the conserved polyadenylation signal, compatible with histone mRNA 3' end formation by histone-specific processing. We demonstrate that knockdown of cdl-1 severely inhibits histone gene expression, but does not have a significant effect on histone mRNA steady state levels, compatible with a role for cdl-1 in post-transcriptional control of histone mRNA. Finally we report that histone gene expression in C. elegans correlates with the presence of actively dividing cells, consistent with a need to generate histones during cell division.Here we investigate the expression of C. elegans histone gene 3'UTRs and flanking regions revealed that the conserved 16 nucleotide hairpin sequence, the core element of the binding site for CDL-1 [Drosophila, histone genes are organised in tandem repeats with intergenic regions that contain polyadenylation signals at various distances from the hairpin, and these signals are used for mRNA 3' end processing in a dSLBP mutant background [Drosophila histone mRNAs end shortly after the hairpin, similar to vertebrate histone mRNA [A survey of or CDL-1 . Thus, cckground . In the one mRNA -21.C. elegans GAPDH mRNA were enriched, indicating that the selection procedures were successful. As expected, human histone mRNAs, which are known to lack a poly(A) tail [C. elegans histone mRNAs were similarly lost during the procedure, indicating that the structure of C. elegans histone mRNA 3' ends is similar to human histone mRNA ends. An exception was the enrichment of a low mobility C. elegans histone H3 mRNA species that may represent polyadenylated transcripts of C. elegans replacement variant histone H3 genes [We wished to determine whether histone mRNA 3' end processing would result in mRNAs ending after the hairpin as in other metazoans, or whether 3' end formation would normally occur by cleavage and polyadenylation using the conserved polyadenylation signal, and result in polyadenylated mRNA. First, we exploited the fact that polyadenylated histone mRNA is enriched by selection with oligo-dT coupled to cellulose ,23. Tota(A) tail ,25 and d(A) tail ,27, wereH3 genes .his-62 and the histone H3 genes his-9, his-13 and his-42 ending after the polyadenylation signal or after the hairpin structure, respectively. The 3'UTR and 3' flanking regions of the his-62 H2B gene contains the highly conserved 32 nucleotide element encompassing the hairpin element, and AATCC and AATAAA elements, but differs in the non-conserved regions from other H2B genes. RNase protection with the his-62 probe revealed a series of protected fragments. Using a combination of DNA marker and single-nucleotide ladder produced by KOH treatment of 5' end labelled probe RNA to estimate the length of the protected fragments, we found that the longest protected fragment was ~50 nucleotides long. This is compatible with protection of the probe by hybridisation with his-62 mRNA ending after the hairpin. Shorter protected fragments were most likely due to partial protection of the probe by hybridisation to other histone transcripts. Fragments of ~32 to ~36 nucleotides length can be accounted for by hybridisation to the region containing the hairpin element conserved in the other H2B mRNAs and also in mRNAs from other histone gene types .Next, we performed RNase protection assays to further characterise the ends of selected histone mRNA species Fig. . Probes his-9 gene is identical to the 3'UTRs of the his-13 and his-42 genes, which are therefore also detected in RNase protection assays with the probe designed to determine the his-9 mRNA 3' end. RNase protection with total RNA prepared from N2 adults and the his-9 probe revealed protected histone mRNA fragments of ~81 nucleotides in length, indicating that the majority of transcripts from the his-9, his-13 and his-42 genes lacked the polyadenylation signal and ended after the hairpin. Thus, the findings obtained with two experimental approaches described \u2013 poly(A) selection and RNase protection \u2013 are compatible with the majority of C. elegans histone mRNAs ending after the hairpin structure and lacking a poly(A) tail.The 3'UTR of the C. elegans histone mRNA 3' ends. We exploited the fact that yeast poly(A) polymerase will add non-template encoded nucleotides to the 3' end of RNA molecules with a 3'OH group [Drosophila histone mRNAs that normally end a few nucleotides after the hairpin, 3' of an A and also have a 3'OH group [C. elegans histone mRNA ends \u2013 represented by sequences where inosine was inserted into a poly(A) tail \u2013 have poly(A) tails added after the hairpin structure in vivo that were then extended during the experiment by incorporation of first inosine and then adenosine. Polyadenylated histone mRNAs with a short poly(A) tail added immediately after the hairpin have been detected in Xenopus oocytes [C. elegans histone mRNA do not extend past the polyadenylation signal but end three to six nucleotides after the hairpin structure. This is compatible with histone mRNA 3' ends being formed by histone mRNA cleavage after the hairpin, as in other animals [To independently confirm this we decided to determine the sequence of OH group . We firsOH group . In concOH group ,20,29. W oocytes . The tai oocytes . However animals -21,29.C. elegans HBP/SLBP CDL-1 and reported that it is essential for histone gene expression and cell division [cdl-1(RNAi) and RNAi targeting histone H3 and H4 genes resulted both in sterility and early embryonic arrest, linked to defects on chromatin structure [cdl-1(RNAi) treated animals was linked to a reduction in steady state histone mRNA levels. Animals were subjected to cdl-1(RNAi) by feeding. Untreated animals and gfp(RNAi) animals were used as controls. As reported previously, depletion of cdl-1 expression using the same RNAi-by-feeding regime resulted in a protruding vulva (Pvl) phenotype [cdl-1(RNAi) animals, but not in gfp(RNAi) animals which were wild type in appearance  animals compared to N2 and gfp(RNAi) animals, as determined by semi-quantitative RT-PCR  and gfp(RNAi) on histone H2B and H3 gene expression. We expect, given the similarities of histone genes and examples from other species, that findings are transferable to the other replication-dependent histone genes. Histone H2B and H3 mRNA levels were not significantly different in animals subjected to the two RNAi treatments, and were similar to levels in untreated animals  treatment caused RNA 3' end formation to occur more frequently at polyadenylation signals, we compared the structure of his-62 mRNA in RNA prepared from N2 animals and from cdl-1(RNAi) animals  animals. Analysis of histone protein levels by Western blotting revealed that histone H2B and H3 levels were broadly similar in untreated and gfp(RNAi) N2 animals  and untreated N2 animals. However this effect is minor compared to the severe depletion of histone proteins in cdl-1(RNAi) animals. This effect of cdl-1(RNAi) on histone protein synthesis indicates that cdl-1, as is the case for its homologues in other animals, is mainly required for post-transcriptional control of histone gene expression.We then examined the effect of als Fig. . For comals Fig. . RelativC. elegans development. We examined the level of histone transcripts from wild-type (N2) and glp-4(bn2) hermaphrodites by Northern Blotting. Hermaphrodites homozygous for the temperature-sensitive glp-4(bn2) mutation almost completely lack germ line proliferation when grown at the restrictive temperature of 25\u00b0C [glp-4(bn2) adult hermaphrodites grown at the restrictive temperature  and Bristol (N2) worms at the first and third larval stages and in adults  at the permissive (16\u00b0C) and non-permissive (25\u00b0C) temperatures  worms grown at the permissive temperature did not differ from wild-type in their levels of histone gene expression  and wild type larvae grown at the restrictive temperature, consistent with the fact that most of the dividing cells in these developmental stages are somatic cells. In agreement with the results seen in Figure glp-4(bn2) adult worms raised at the restrictive temperature is negligible  mRNA using oligo-dT cellulose, similar to HeLa cell histone mRNA known to end after the hairpin and to lack a poly(A) tail  end after the hairpin signal. Finally, cloning and sequencing of synthetically poly(I/A) tailed histone mRNAs showed that none of the mRNAs included the putative HDE element or polyadenylation signal  results in the inhibition of histone synthesis [cdl-1(RNAi) does not significantly affect histone mRNA levels, but, as shown previously, severely inhibits histone protein expression  adult animals grown at 25 \u00b0C, which essentially lack germ line proliferation when grown at the restrictive temperature, shows that in adults most, if not all histone gene expression is confined to the germ line. Thus our findings indicate that the link between DNA synthesis and histone gene expression observed in mammals and Drosophila is also the case for C. elegans.We have shown that during ues Fig. . Thus, aC. elegans is a well established animal model to study development. In contrast, comparatively little is known about the control of gene expression in this animal. Here we show that histone gene expression is linked to cell proliferation, and is subject to similar post-transcriptional controls as histone gene expression in other animal species. Thus C. elegans will be an ideal model to investigate the regulation of histone gene expression during animal development.Histone gene 3'UTR sequences were downloaded from the Wormbase database  and aligC. elegans culturing techniques were used [glp-4 temperature sensitive (ts) mutant [Caenorhabditis Genetics Center. Strains were grown at 16\u00b0C and 25\u00b0C as indicated in the text.Standard ere used . N2 (Bri) mutant , which icdl-1(RNAi) construct was described earlier [RNAi by feeding was carried out as described previously . The cdl earlier . GFP RNA earlier , Addgenecdl-1 and act-1 RT-PCR was performed using primers CGTAAAGCACCACGAGGCCGTC and GACGACATCTTGGAGAAGTCAGTTG, and CGTGGTTACTCTTTCACCACCACCGCT and GGACTCGTCGTATTCTTGCTTGGAGAT respectively. 21, 22 and 23 PCR cycles were performed using an annealing temperature of 55\u00b0C, and extension time of 1 minute for all reactions. Products were analysed by agarose gel electrophoresis, visualised by staining with ethidium bromide and quantitated using a Molecular Imager Gel Doc XR System (Biorad) and analysed using AIDA Image Analyzer Software (Raytest). To determine the efficiency of cdl-1 knockdown we standardised the cdl-1signal with respect to the corresponding actin signal. The average of the measurements with N2 RNA was defined as 100%. The standard deviations were calculated from the measurements made for RNA from N2, gfp(RNAi) and cdl-1(RNAi) animals, respectively.To confirm gene knockdown by RT-PCR, 1 \u03bcg of total RNA was reverse transcribed using random primers  and subsequent PCR was performed using Taq DNA polymerase (Promega). glp-4(bn2) embryos were obtained from bleaching gravid adult hermaphrodites, aliquoted onto NGM-OP50 plates and incubated at 16\u00b0C or 25\u00b0C. Worms were harvested from plates by gentle washing with sterile M9 salts. L1 larvae were harvested after 15 hours and 30 hours at 25\u00b0C and 16\u00b0C, respectively; L3 larvae were harvested following 36 hours and 72 hours at 25\u00b0C and 16\u00b0C, respectively; and adult animals were harvested after 72 hours and 144 hours at 25\u00b0C and 16\u00b0C, respectively.N2 and 260 nm corresponds to 40 \u03bcg RNA.Pelleted worms were snap-frozen in 250 \u03bcl Trizol reagent (Invitrogen) in liquid nitrogen, thawed at 42\u00b0C and vortexed for 30 seconds. Following five cycles of freeze-thawing, 50 \u03bcl chloroform was added and mixture incubated at room temperature for 3 minutes, spun at 4\u00b0C for 20 minutes at 13200 rpm in a table top centrifuge and clear phase containing RNA removed. Total RNA was isopropanol precipitated and stored in 75% ethanol (nuclease free) until required. RNA concentration was determined using a 1 cm cuvette assuming 1 ODC.elegans or HeLa cells was subjected to poly(A) selection with oligo-dT cellulose (Poly(A)Purist, Ambion) as per manufacturer's instructions. Half of the poly(A) enriched fraction was subjected to a second round of selection. Poly(A) selected RNA was precipitated with ethanol and resuspended in 10 \u03bcl DEPC treated water.200 \u03bcg total RNA from EcoRI. The C. elegans histone H4 probe was prepared by PCR using a cloned his-10 gene as template and spans nucleotides 9 \u2013 312 of the his-10 ORF. The C. elegans histone H3 probe was prepared by PCR using a cloned his-9 gene as template and spans nucleotides 1 \u2013 398 of the his-9 ORF. Probes detecting histone H2A (his-30) and H2B (his-62) and actin (act-1) mRNA were prepared by RT-PCR from Bristol (N2) RNA and span nucleotides 1 \u2013 372, 9 \u2013 366 and 589\u20131096 of the respective open reading frames. The probe detecting C. elegans GAPDH (gdp-1) mRNA was amplified from genomic DNA and spans nucleotides 19\u2013995 of the gpd-1 open reading frame. This probe has high sequence identity to GAPDH gpd-2,gpd-3 and gpd-4 genes and cannot distinguish between transcripts from these genes. Probes were labelled with 32P-dCTP using a random prime labelling kit (Roche). C. elegans 18S rRNA was detected using the oligonucleotide ACGTATCTAATCGCCTTCGTTCC 32P end labelled using T4 polynucleotide kinase and \u03b3-32PATP. Data was analysed by autoradiography and using a Fuji Phosphoimager and AIDA Image Analyzer Software (Raytest).RNA was fractionated on 1.2 % or 1.5 % agarose gels and transferred to Hybond N membranes as described . Probes his-62 gene spans nucleotides 3 \u2013 145 of the his-62 3' UTR. The template for transcription was amplified from genomic DNA using primers CATTGGCTGAAAACTAACC and TAATACGACTCACTATAGGGGAATCCAACGTTTCAAGAAAAGAC. This produced a template for T7 RNA polymerase transcription containing the T7 RNA polymerase promoter followed by 10 non-histone specific bases prior to sequence complementary to his-62 mRNA. The probe to detect his-9 mRNA spans from nucleotide 400 in the his-9 ORF to nucleotide 205 of the 3' UTR. The template for transcription was amplified from genomic DNA using the primers AGCGTGCTTAAATGCCTTCC and TAATACGACTCACTATAGGGCGAATCGTACGCTGATAGCTTATGTTCAAAAACTGAGTA, resulting in a product containing T7 RNA polymerase promoter followed by 20 non-histone specific nucleotides and 216 nucleotides his-9 sequence. The PCR product was inserted into pGEM-T easy and sequenced . For RNA synthesis, the fragment was re-amplified using the same primers and transcribed using the T7 RNA polymerase to produce a probe complementary to his-9 mRNA. Uniformly labelled RNA was prepared by in vitro transcription using T7 RNA polymerase and \u03b132P-UTP. RNase protection assays were normally done with 12.5 \u03bcg RNA using RNases A and T1 . 32P-labelled pBR322 DNA/MspI marker was prepared by endlabelling using a 32P-dCTP and Klenow fragment. 5'32P-labelled his-62 probe RNA was prepared by treating non-labelled RNA with alkaline phosphatase, followed by end-labelling with T4 polynucleotide kinase and \u03b3-32PATP. The KOH ladder was produced using 5' 32P end-labelled probe as described [The probe to detect the escribed . ReactioRNA tailing with yeast poly(A) polymerase was done essentially as described . 10 \u03bcg tRK carried out the sequencing of histone mRNA ends, the RNAi experiments and helped draft the manuscript. SW carried out sequence alignments, poly(A) selection and RNAse mapping of histone mRNA 3' ends. Both SW and RK carried out experiments analysing histone gene expression during development. JP participated in the conception and design of the study and helped draft the manuscript. BM conceived of the study, and participated in its design and coordination and drafted the manuscript. All authors read and approved the final manuscript.C. elegans histone mRNA 3'UTR sequences. Sequence alignments used to identify consensus 3'UTR elements of histone mRNAs shown in Figure Alignment of Click here for filecdl-1(RNAi) treatment on the 3' end of his-62 mRNAEffect of . Internally 32P labelled his-62 probe was hybridised with either total RNA from adult N2 animals, or total RNA from cdl-1(RNAi) adults, or yeast RNA and subjected to treatment with RNase A/T1 as described. Samples were analysed by denaturing PAGE and visualised by autoradiography. The asterisk marks probe protected by hybridisation to template DNA. Note that the protection patterns obtained with N2 and cdl-1(RNAi) treatment are identical and that cdl-1(RNAi) does not result in longer protected fragments diagnostic for end-formation using the polyadenylation signal.Click here for file"}
{"text": "Drosophila model of HD. This high-content validation assay showed that 27 of 60 orthologs tested were high-confidence genetic modifiers, as modification was observed with more than one allele. The 45% hit rate for genetic modifiers seen among the interactors is an order of magnitude higher than the 1%\u20134% typically observed in unbiased genetic screens. Genetic modifiers were similarly represented among proteins discovered using yeast two-hybrid and pull-down/mass spectrometry methods, supporting the notion that these complementary technologies are equally useful in identifying biologically relevant proteins. Interacting proteins confirmed as modifiers of the neurodegeneration phenotype represent a diverse array of biological functions, including synaptic transmission, cytoskeletal organization, signal transduction, and transcription. Among the modifiers were 17 loss-of-function suppressors of neurodegeneration, which can be considered potential targets for therapeutic intervention. Finally, we show that seven interacting proteins from among 11 tested were able to co-immunoprecipitate with full-length Htt from mouse brain. These studies demonstrate that high-throughput screening for protein interactions combined with genetic validation in a model organism is a powerful approach for identifying novel candidate modifiers of polyglutamine toxicity.Huntington's disease (HD) is a fatal neurodegenerative condition caused by expansion of the polyglutamine tract in the huntingtin (Htt) protein. Neuronal toxicity in HD is thought to be, at least in part, a consequence of protein interactions involving mutant Htt. We therefore hypothesized that genetic modifiers of HD neurodegeneration should be enriched among Htt protein interactors. To test this idea, we identified a comprehensive set of Htt interactors using two complementary approaches: high-throughput yeast two-hybrid screening and affinity pull down followed by mass spectrometry. This effort led to the identification of 234 high-confidence Htt-associated proteins, 104 of which were found with the yeast method and 130 with the pull downs. We then tested an arbitrary set of 60 genes encoding interacting proteins for their ability to behave as genetic modifiers of neurodegeneration in a  Huntington's Disease (HD) is a fatal inherited neurodegenerative disease, which typically begins in middle age and progresses with symptoms of severe uncontrolled movements and cognitive dysfunction. HD is uniformly fatal with death occurring ten to 15 years after onset of symptoms. There is currently no effective treatment for HD. The genetic mutation underlying HD causes a protein called huntingtin (Htt) to contain an abnormally long tract of the amino acid glutamine. This extended span of glutamines changes the shape of the Htt protein, which can cause it to interact in abnormal ways with other cellular proteins. In this study, we have identified a large number of new proteins that bind to normal and mutant forms of the Htt protein. To establish a potential role for these interacting proteins in HD, we show that changing the expression of many of these proteins can modulate the pathological effects of mutant Htt on fly neurons that deteriorate when they express mutant Htt. Identifying cellular proteins that bind to Htt and modulate its pathological activity may facilitate the discovery of an effective treatment for HD. Huntington's Disease (HD) is a member of a family of dominantly inherited neurodegenerative diseases caused by expansion in a glutamine-encoding CAG tract. HD occurs when the polyglutamine (polyQ) tract in huntingtin (Htt) expands beyond ~35 glutamine (Q) repeats and manifests with movement disorder, psychological disturbances, and cognitive dysfunction progressing over a period of about ten to 15 years until death. Currently there is no effective treatment or cure for HD.Caenorhabditis elegans, Drosophila, and mouse y were crossed to males from the mutant strains. In cases where the mutation was on the X chromosome, the cross was reversed. Crosses were incubated at 27 \u00b0C and 29 \u00b0C to provide two different phenotypic readouts. Strains modifying the eye phenotype were recrossed to verify the modification. Only genes that consistently showed modification at different temperatures or using different alleles were further analyzed. Potential modifiers behaving as enhancers were tested for possible nonspecific eye phenotypes by crossing them to control females of the genotype 1w118; GMR-GAL4/CyO.yFor the modifier screen, females of the genotype For scanning electron microscopy (SEM) images, flies were crossed at 29 \u00b0C and newly eclosed adults were aged for five days. Whole flies were dehydrated in ethanol, critical-point dried, and analyzed with a JEOL JSM 6100 microscope. For paraffin sections of enhancers, flies were crossed at 25 \u00b0C and adults were aged for five days . Adult heads and torsos were fixed in 4% formaldehyde/85% ethanol/5% acetic acid, dehydrated, embedded in paraffin for vertical semi-thin sections, and then stained with Hemathox.For the climbing and survival assays, females of the genotype Elav-GAL4; UAS:128QHtt[F27B] were crossed to males of the mutant strains. Climbing assays were performed on 30 age-matched adult virgin female flies raised at 27 \u00b0C as described . The flihttp://www.roche.com). Protein determination was carried out with the BCA method . Lysate  were precleared with mouse IgG beads  and immunoprecipitated with monoclonal Htt antibody  by incubating overnight at 4 \u00b0C and then with protein G . Beads were washed 5\u00d7 with TBS/0.05% Tween, sample was eluted with 1\u00d7 sample buffer  and then resolved using 4%\u201312% Bis-Tris precast gels (Invitrogen). Western blot was preformed, and blots were probed with rabbit antibody to USP9X , Cullin 2 , CACNA2D1 , Htt BKP1 (1:500), PARP , mouse monoclonal GAPDH , STX1A , SNAP25 , goat antibody PKM2 , and PSMC2 .Whole brains from wild-type or YAC128 mice were lysed in T-PER (Pierce) with protease inhibitors  and silver stained. The presence of glutathione S-transferase (GST) and Htt in the bands was confirmed by matrix-assisted laser desorption/ionisation-time of flight MS and Western blotting (not shown). The predicted size of the GST-Htt fusion product is 53 kDa. We were unable to determine the difference in the two GST-Htt bands by MS; they may represent expanded (48 Q) and wild-type (22 Q) Htt fragments. The band at 28 kDa represents GST and likely occurs from cleavage of the fusion product between the GST and the bait as we saw a band of this size with numerous heterologous purified baits.(575 KB PDF)Click here for additional data file.Figure S2Only searches with N-terminal baits  that gave at least one positive were included in the analysis. The x-axis indicates numbers of screens performed. The y-axis shows the novel discovery index for prey proteins . A peak near 525 searches corresponds to introduction of new prey libraries.(529 KB PDF)Click here for additional data file.Figure S3 (B) show a severe degenerative phenotype when compared to (A) GMR-GAL4 controls of the same age and cultured at the same temperature. The phenotype consists of a shortening (see arrow) and detachment of the retina, as well as the presence of vacuoles in the retina. The Htt-induced phenotype can be suppressed by (C) reduced levels of armadillo G0234; GMR-GAL4/+; UAS:128Qhtt[M64(P{lacW}arm]/+), (D) reduced levels of hu li tai shao k06121; UAS:128Qhtt[M64]/+),(GMR-GAL4/P{lacW}hts (E) reduced levels of M6 BG00390), reduced levels of kinesin heavy chain 1pr1Khc8;(GMR-GAL4/b UAS:128Qhtt[M64]/+), (G) reduced levels of peanut KG00478; UAS:128Qhtt[M64]/+),(GMR-GAL4/P{SUP pr P-}pnut (H) reduced levels of 14-3-3e j2b10), reduced levels of G protein I a-subunit 65A KG01907ry506), reduced levels of Itp-r83A 05616ry506), over-expression of Src oncogene at 42A EY08937; UAS:128Qhtt[M64]/+),(GMR- GAL4/P{EPgy2}Src42A (L) reduced levels of clathrin heavy chain 4/+ GMR-GAL4/+; UAS:128Qhtt[M64]/+),(Chc (M) reduced levels of soluble N-ethylmaleimide-sensitive factor attachment protein M4), reduced levels of STX1A 506P{PZ}Syx1A06737), reduced levels of Rpt1 05643cn1; UAS:128Qhtt[M64]/+),(GMR-GAL4/P{PZ}Rpt1 (P) reduced levels of Eip75B 07041), reduced levels of myocyte enhancing factor 2 X1; UAS:128Qhtt[M64]/+),(GMR-GAL4/Df(2R)X1,Mef2 (R) reduced levels of crooked legs (GMR-GAL4/P{EPgy2}crolEY08953), (S) reduced levels of Glycerol 3 phosphate dehydrogenase 1Gpdhn1\u20134; UAS:128Qhtt[M64]/+),(GMR-GAL4/Al (T) reduced levels of Pdsw k10101; UAS:128Qhtt[M64]/+),(GMR-GAL4/P{PlacZ}Pdsw and (U) reduced levels of porin k05123; UAS:128Qhtt[M64]/+).Click here for additional data file.Figure S4(GMR-GAL4/+).(A) Age-matched controls cultured at the same temperature  cultured at 25 \u00b0C show a degenerative phenotype. The phenotype consists of a shortening (arrow), vacuolization, and detachment of the retina. This phenotype can be enhanced by (C) reduced levels of KG00083; UAS:128Qhtt[M64]/+),CAP (GMR-GAL4/P{SUPor-P}CAP (D) reduced levels of KG06490; UAS:128Qhtt[M64]/+),CLIP-190 (GMR-GAL4/P{SUPor-P}CLIP-190 (E) reduced levels of G00158; UAS:128Qhtt[M64]/+),LaminC (GMR-GAL4/P{PTTor-GB}LamC (F) overexpression of EY07032),M6  reduced levels of 02957; UAS:128Qhtt[M64]/+),zipper (GMR-GAL4/P{PZ}zip (H) reduced levels of hs)}G13 shot3; UAS:128Qhtt[M64]/+),short stop (GMR-GAL4/P{FRT(w (I) overexpression of  Scer\\UASc.Ca),14-3-3\u025b  overexpression of EY03325; UAS:128Qhtt[M64]/+),14-3-3\u03c2 (GMR-GAL4/ P{EPgy2}14-3-3\u03c2 (K) overexpression of EY10355),G-i\u03b165A  overexpression of EY02522),Itp-r83A  reduced levels of G00044Lachesin , (N) reduced levels of k10108Src oncogene at 42A , (O) overexpression of soluble NSF-attachment protein , (P) overexpression of Syntaxin1A ,P{EP}Syx1A (Q) reduced levels of KG09881Aspartyl \u03b2-hydroxylase , (R) reduced levels of Dynein heavy chain 64C ,P{SUPor-P}Dhc64C (S) reduced levels of fat facets ,faf (T) overexpression of EP2153Rpt1 , (U) reduced levels of 04418; UAS:128Qhtt[M64]crooked legs (GMR-GAL4/P{PZ}crol/+), (V) reduced levels of nNC1; UAS:128Qhtt[M64]Phosphogluconate isomerase (GMR-GAL4/Pgi/+), (W) reduced levels of RhoGAP92B , (X) reduced levels of G0423a; GMR-GAL4/+; UAS:128Qhtt[M64]Unc-76 (P{lacW}Unc-76/+), and (Y) overexpression of EY09750; UAS:128Qhtt[M64]CG12455 (GMR-GAL4/P{EPgy2}CG12455/+). These mutations do not cause an abnormal eye phenotype in control flies carrying the GMR-GAL4 driver without the UAS:128Qhtt[M64] transgene (unpublished data). However, when combined with 128-Q htt, they lead to further decrease in retinal thickness and in some cases increased retinal detachment and vacuolization.(B) Retinal sections of day 5 flies expressing N-terminal 128-Q htt (2.8 MB PDF)Click here for additional data file.Table S1Y indicates peptides that were manually validated and confirmed by inspection of the MS spectra; A refers to ambiguous peptides that could not be conclusively identified by manual validation of the MS spectra.(3.4 MB XLS)Click here for additional data file.Table S2http://www.prolexys.com).*The total number of unique interacting proteins refers to the number of unique gene sequences identified in a database of positives from nearly >250,000 high-throughput random Y2H searches performed at Prolexys Pharmaceuticals ((580 KB DOC)Click here for additional data file.Table S3http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene). E_VALUE_EXP is the negative log of the E value produced by the highest scoring BLAST hit and has a maximum of 180 . Amino acid coordinates of HD baits are indicated relative to NP_002102. Q-length repeats are shown in parentheses. HD bait sequences may be represented multiple times if more than one search generated positives. High-throughput sequencing was performed unidirectionally for identification purposes and does not necessarily represent the entirety of the clone. *Search ID 14291 (HD bait 1116\u20131196) was identified in a search using a complex bait library rather than individual bait clone.Search ID is an identifier given each Y2H mating event see . Positiv(3.2 MB XLS)Click here for additional data file.Table S4(98 KB DOC)Click here for additional data file.Table S5Drosophila prior to statistical filtering; E, Enhancer; S, Suppressor*Genes tested in (73 KB DOC)Click here for additional data file.http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Protein) accession numbers for MS studies (RefSeq) are: NP_000302.1, NP_000382.3, NP_000524.3, NP_000602.1, NP_000708.1, NP_001019645, NP_001367.2, NP_001377.1, NP_001419.1, NP_001753.1, NP_001779.2, NP_001834.2, NP_001853.2, NP_001854.1, NP_001907.2, NP_001914.2, NP_001951.2, NP_001990.1, NP_002046.1, NP_002064.1, NP_002065.1, NP_002102.4, NP_002329.2, NP_002536.1, NP_003033.2, NP_003124.1, NP_003156.1, NP_003170.1, NP_003356.2, NP_003357.2, NP_003365.1, NP_003366.2, NP_003696.2, NP_004246.1, NP_004309.2, NP_004364.2, NP_004365.1, NP_004484.1, NP_004491.1, NP_004539.1, NP_004542.1, NP_004543.1, NP_004594.1, NP_004850.1, NP_004993.1, NP_004996.1, NP_004997.4, NP_005156.1, NP_005264.2, NP_005268.1, NP_005653.3, NP_005736.3, NP_005995.1, NP_006046.1, NP_006279.2, NP_006308.3, NP_006576.2, NP_006810.1, NP_006830.1, NP_008839.2, NP_009034.2, NP_009204.1, NP_031407.2, NP_031457.1, NP_031464.1, NP_031669.2, NP_031736.1, NP_031773.1, NP_031887.2, NP_031959.1, NP_032246.2, NP_032518.1, NP_032644.2, NP_033012.1, NP_033033.1, NP_033321.1, NP_033332.1, NP_033333.2, NP_033441.1, NP_033805.1, NP_033851.1, NP_033914.1, NP_034053.1, NP_034078.1, NP_034438.1, NP_034442.1, NP_034715.1, NP_034829.1, NP_034944.1, NP_035229.2, NP_035253.1, NP_035523.1, NP_035558.1, NP_035824.1, NP_035825.1, NP_036288.2, NP_036560.1, NP_036611.2, NP_038709.1, NP_057049.3, NP_057223.1, NP_057606.1, NP_058084.2, NP_060064.2, NP_061359.2, NP_062681.1, NP_065593.1, NP_066268.1, NP_067541.1, NP_075553.1, NP_077128.2, NP_077173.1, NP_077725.1, NP_077745.2, NP_079589.1, NP_079612.1, NP_079634.1, NP_079683.2, NP_080175.1, NP_080720.1, NP_080971.2, NP_080979.1, NP_084501.1, NP_114080.2, NP_149124.2, NP_443106.1, NP_444427.1, NP_536846.1, NP_536849.1, NP_542970.1, NP_570824.1, NP_598429.1, NP_613063.1, NP_619621.1, NP_659409.2, NP_663493.1, NP_663589.2, NP_766024.1, NP_776169.2, NP_796376.2, NP_849209.1, NP_976218.1, XP_128725.4, XP_131103.3, XP_203393.2, and XP_622887.1.The National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene) accession numbers for Y2H studies are: 120, 161, 323, 1315, 1387, 1499, 1759, 1778, 1785, 2597, 3064, 3092, 3093, 3275, 3329, 3338, 3839, 4209, 4361, 4790, 5033, 5295, 5296, 5315, 5468, 5493, 5710, 5753, 6670, 6721, 6829, 6867, 7430, 7529, 7644, 7692, 7704, 7802, 8065, 8239, 8453, 8462, 8503, 8539, 9093, 9330, 9611, 9638, 9810, 9818, 9901, 9938, 10010, 10133, 10422, 10456, 10458, 10464, 10540, 10580, 10906, 10915, 11177, 11193, 23116, 23328, 23332, 23348, 23360, 23380, 23609, 23613, 23641, 25764, 26578, 27068, 28969, 29062, 29072, 29993, 51061, 51322, 51586, 51593, 51667, 55219, 55660, 55704, 55735, 56254, 57489, 57509, 57522, 57616, 63908, 79027, 79813, 80254, 83478, 84936, 128866, 134218, 139818, 152789, and 171392.The NCBI (GeneID) ("}
{"text": "The crystal structure is stabilized by inter\u00admolecular N\u2014H\u22efO hydrogen bonds. An intra\u00admolecular O\u2014H\u22efN hydrogen bond is also present.In the title compound, C \u00c5                           b = 10.3967 (4) \u00c5                           c = 14.2938 (6) \u00c5                           V = 1922.86 (13) \u00c53                                                   Z = 8                           K\u03b1 radiationMo \u22121                        \u03bc = 0.30 mmT = 173 K                           0.48 \u00d7 0.42 \u00d7 0.39 mm                                 Bruker SMART 1000 CCD diffractometerSADABS; Sheldrick, 2004T                           min = 0.869, T                           max = 0.891Absorption correction: multi-scan (11037 measured reflections1881 independent reflectionsI > 2\u03c3(I)1706 reflections with R                           int = 0.027                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.054                           wR(F                           2) = 0.150                           S = 0.98                           1881 reflections129 parametersH-atom parameters constrainedmax = 1.20 e \u00c5\u22123                        \u0394\u03c1min = \u22120.33 e \u00c5\u22123                        \u0394\u03c1                                 SMART  used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S160053680903164X/xu2563sup1.cif            Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053680903164X/xu2563Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "Its structure contains a 1.8797\u2005(13)\u2005\u00c5 P\u2014C bond and two inter\u00admolecular N\u2014H\u22efO=P hydrogen bonds, resulting in centrosymmetric dimers. An intra\u00admolecular N\u2014H\u22efO=P hydrogen bond is also present.The title compound, C \u00c5                           b = 10.1375 (13) \u00c5                           c = 15.5955 (19) \u00c5                           \u03b2 = 93.264 (2)\u00b0V = 1845.4 (4) \u00c53                                                   Z = 4                           K\u03b1 radiationMo \u22121                        \u03bc = 0.34 mmT = 113 (2) K                           0.60 \u00d7 0.42 \u00d7 0.40 mm                                 Bruker SMART CCD area-detector diffractometerSADABS; Sheldrick, 2003T                           min = 0.820, T                           max = 0.874Absorption correction: multi-scan (20001 measured reflections4568 independent reflectionsI > 2\u03c3(I)4027 reflections with R                           int = 0.022                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.029                           wR(F                           2) = 0.082                           S = 1.03                           4568 reflections246 parametersH-atom parameters constrainedmax = 0.34 e \u00c5\u22123                        \u0394\u03c1min = \u22120.33 e \u00c5\u22123                        \u0394\u03c1                                 SMART  used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S1600536808020175/si2094sup1.cif            Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808020175/si2094Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "The oxadiazole ring makes dihedral angles of 82.82\u2005(7) and 9.92\u2005(7)\u00b0 with the 3,4-dichloro\u00adbenzene and the 3,4,5-trimethoxy\u00adbenzene ring planes, respectively. The crystal structure is stabilized by inter\u00admolecular C\u2014H\u22ef O and C\u2014H\u22ef N hydrogen bonds. Intra\u00admolecular C\u2014H\u22efO and C\u2014H\u22efN hydrogen bonds are also present.The title compound, C \u00c5                           b = 15.9516 (8) \u00c5                           c = 15.7483 (8) \u00c5                           \u03b2 = 90.8940 (10)\u00b0V = 1927.63 (17) \u00c53                                                   Z = 4                           K\u03b1 radiationMo \u22121                        \u03bc = 0.37 mmT = 173 (2) K                           0.47 \u00d7 0.39 \u00d7 0.32 mm                                 Bruker SMART 1000 CCD diffractometerSADABS; Sheldrick, 2003T                           min = 0.845, T                           max = 0.890Absorption correction: multi-scan (10032 measured reflections4159 independent reflectionsI > 2\u03c3(I)3238 reflections with R                           int = 0.025                                                            R[F                           2 > 2\u03c3(F                           2)] = 0.041                           wR(F                           2) = 0.125                           S = 1.04                           4159 reflections257 parametersH-atom parameters constrainedmax = 0.34 e \u00c5\u22123                        \u0394\u03c1min = \u22120.31 e \u00c5\u22123                        \u0394\u03c1                                 SMART  used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S1600536808020771/wn2269sup1.cif            Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808020771/wn2269Isup2.hkl            Structure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF report            Additional supplementary materials:"}
{"text": "Autosomal dominant polycystic kidney disease (ADPKD) is responsible for 10% of cases of the end stage renal disease. Early diagnosis, especially of potential fast progressors would be of benefit for efficient planning of therapy. Urine excreted proteome has become a promising field of the search for marker patterns of renal diseases including ADPKD. Up to now however, only the low molecular weight fraction of ADPKD proteomic fingerprint was studied. The aim of our study was to characterize the higher molecular weight fraction of urinary proteome of ADPKD population in comparison to healthy controls as a part of a general effort aiming at exhaustive characterization of human urine proteome in health and disease, preceding establishment of clinically useful disease marker panel.We have analyzed the protein composition of urine retentate (>10\u2009kDa cutoff) from 30 ADPKD patients and an appropriate healthy control group by means of a gel-free relative quantitation of a set of more than 1400 proteins. We have identified an ADPKD-characteristic footprint of 155 proteins significantly up- or downrepresented in the urine of ADPKD patients. We have found changes in proteins of complement system, apolipoproteins, serpins, several growth factors in addition to known collagens and extracellular matrix components. For a subset of these proteins we have confirmed the results using an alternative analytical technique.Obtained results provide basis for further characterization of pathomechanism underlying the observed differences and establishing the proteomic prognostic marker panel. Autosomal dominant polycystic kidney disease (ADPKD) is an inherited disorder affecting 1 in 1000 people and responsible for 10% of cases of the end stage renal disease (ESRD). Apart from renal manifestations, changes in other organs may be present, including a.o. liver cysts and intracranial aneurysms. The disease is divided into 2 types based on mutated gene . The type of the mutation has prognostic significance, as the average age of ESRD depends on the type of the disease and amounts to 53\u2009years in type 1, and 69\u2009years in type 2. The solution was applied to 18\u2009cm IPG strip with 3\u201311 NL pH gradients  for isoelectrofocusing (IEF): 340\u2009\u03bcl of sample/strip, corresponding to 400\u2009\u03bcg protein. The IPG strip was rehydrated overnight in an IPG box . The next day, the strips were isoelectrofocused using a Ettan IPGphor 3 electrophoresis system  as follows. Two steps of electrophoresis were used. The first step consisted of a 5\u2009h pre-run at 500\u2009V. During this step, the conductivity decreases, and salts and other highly conductive compounds move towards the electrode (anode). Second, a long gradient focusing program was used: 1\u2009h at 500\u2009V, 9\u2009h at 1000\u2009V and 30\u2009h at 8000\u2009V .After focusing, the strip was removed from the tray and the overlay oil was blotted with a paper tissue. Strip was wrapped in a parafilm and stored at \u221280\u00b0C. The strip was placed on a tray cooled with dry ice and cut into sections of ca. 7\u2009mm. The sections were transferred into individual 1.5-ml siliconized Eppendorf tubes. In all, the 18-cm long gel strips were sliced into 26 sections. Peptides were extracted from gel sections by two cycles of adding 60\u2009\u03bcl 0.1%TFA, 2% acetonitrile and vortexing the tubes for 40\u2009minutes at room temperature. Aliquots with extracted peptides were stored at \u221280\u00b0C for LC-MS/MS analysis.The peptide mixture (20\u2009\u03bcl) was applied to the nanoACQUITY UPLC Trapping Column (Waters) using water containing 0.1% formic acid as the mobile phase and then transferred to the nanoACQUITY UPLC BEH C18 Column  using an acetonitrile gradient (3\u201333% acetonitrile over 150\u2009minutes) in the presence of 0.1% formic acid with a flow rate of 250\u2009nl/min. The column outlet was directly coupled to the electrospray ion source of the LTQ-Orbitrap Velos mass spectrometer (Thermo Scientific) working in the regime of data-dependent MS to MS/MS switch. HCD fragmentation was used. Other Orbitrap parameters were as follows: one MS scan was followed by max. 5 MS/MS scans, capillary voltage was 1,5\u2009kV, data were acquired in positive polarity mode.q-value estimates for each peptide spectrum match (PSM) in the dataset. All PSMs with q-values\u2009>\u20090.01 were removed from further analysis. A protein was regarded as confidently identified if at least two peptides of this protein were found. Proteins identified by a subset of peptides from another protein were excluded from analysis. Proteins that exactly matched the same set of peptides were clustered into one group/cluster. MS/MS spectra of peptides meeting the above acceptance criteria were subjected to quantitative analysis step to obtain a list  of proteins differentially populated between a set of three CPS\u2019s and three DPS\u2019s.The acquired MS/MS data were pre-processed with Mascot Distiller . The database search of the data using MASCOT search engine was carried out in a three-step procedure  were included. In the first step, using MascotDistiller program iTRAQ reporter ion peaks were detected in the preprocessed MS/MS spectra; next, their intensities were corrected for isotope impurity using the information provided by the reagent manufacturer. For each spectrum a geometric mean of two reporter ion intensities belonging to one study group (CPS or DPS) were separately calculated. A ratio of these mean values (CPS mean divided by DPS mean) was reported as peptide ratio. If more than one spectrum was obtained for a peptide in a single LC-MS/MS experiment, median peptide ratio value from all spectra was used. Prior to the protein ratio calculations, peptide ratios were median-normalized to remove systematic bias. Proteins ratios were calculated as the median ratio of their peptide\u2019s ratios. The statistical significance of a single protein ratio was assessed by an in house program Diffprot. In thisWe have selected a subset of proteins from the Differential Protein List shown in Table\u2009Finally a set of peptides, corresponding to nine proteins, used for further MRM analysis of individual ADPKD and control samples, consisted of 14 peptides:1. Antithrombin-III \u2013 peptide: TSDQIHFFFAK, peptide: FATTFYQHLADSK2. Cystatin-M - peptide: DLSPDDPQVQK, peptide: AQSQLVAGIK3. Transthyretin \u2013 peptide: AADDTWEPFASGK4. Retinol-binding protein 4 \u2013 peptide: YWGVASFLQK, peptide: DPNGLPPEAQK5. Proactivator polypeptide \u2013 peptide: EIVDSYLPVILDIIK, peptide: LVGYLDR6. Apolipoprotein A-IV \u2013 peptide: SELTQQLNALFQDK, peptide: LLPHANEVSQK7. Complement C3 \u2013 peptide:TIYTPGSTVLYR8. Histidine-rich glycoprotein \u2013 peptide: DGYLFQLLR9. Myocilin \u2013 peptide: YELNTETVKhttp://www.peptideatlas.org/, Institute for Systems Biology, Seattle, WA), and on specific criteria required in SIS peptides such as length and lack of amino acid modifications[13C615\u2009N2-Lys (98% isotopic enrichment) or 13C615\u2009N4-Arg (98% isotopic enrichment). MRM analysis was performed using a Waters Xevo TQ mass spectrometer  coupled to a Waters nanoAcquity UPLC via a Zspray Nanoflow source with a 10\u2009\u03bcm SilicaTip PicoTip emitter . Mobile phase A was 0.1% formic acid (Sigma-Aldrich) in LC-MS grade water , and mobile phase B was LC-MS grade acetonitrile (J.T.Baker) with 0.1% formic acid. Peptides were loaded onto a Waters Symmetry C18 pre-column  and separated using a 40\u2009min LC run, with a 27\u2009min gradient of mobile phase B changing from 1 to 45% on a Waters nanoAcquity UPLC BEH130 C18 Column . Other MS instrument parameters included a capillary voltage of 3.1\u2009kV, a purge gas flow of 100\u2009L/h, cone gas flow of 5\u2009L/h, NanoFlow gas set at 1.0 Bar, and a source temperature of 150\u00b0C. MRM parameters were empirically optimized using pure SIS peptides to generate the highest possible signal for each individual peptide and resulting ion fragments. The optimal charge state and optimal cone voltage were determined for each SIS peptide by injecting 1 pmol (in 0.1% formic acid) on-column and ramping the cone voltage from 20 to 70\u2009V in 5\u2009V steps while gating all the possible parent ion charge states  using the selected ion recording (SIR) function controlled by the Waters MassLynx V4.1 software. The daughter ions generating the highest possible signal and their individual, optimal collision energy (CE) voltages were determined empirically by injecting 1 pmol (in 0.1% formic acid) of SIS peptide on-column and ramping the CE voltage up and down five 2\u2009V steps from that suggested by the Skyline Ver. 1.3 software  for the Waters Xevo instrument. All possible b- and y-series fragment ions for both 2+ and 3+ precursor ion charge states spanning a m/z range from 300 to 1500 were tested. MRM scans for optimization of MRM Q1/Q3 ion pairs were conducted with the optimized cone voltages with the Span setting set to 0 and with dwell times of 10 milliseconds for each transition. From this data, using the Skyline Ver. 1.3 software, the 5 transitions that produced the strongest signals were selected on a per-peptide basis, with a preference toward higher-mass y series ions if the abundances were similar. These top 5 transitions were then checked for signal interferences when present in a sample-digest background. The SIS peptide mix was analyzed by LC-MRM/MS using transitions for heavy (SIS) and natural (endogenous) peptides, both in buffer and in a sample digest. Identical MRM acquisition parameters were used for the heavy and natural forms of each peptide, while taking into account the Q1/Q3 mass differences due to the stable-isotope label. The transitions that maintained the same relative intensities in both the buffer and sample were considered as interference free. This analysis is also used to determine the retention time as well as confirm the identity of the ion signals observed for natural and heavy peptides, thus verifying the identity of the natural peptides which co-elute with the corresponding SIS peptides.Specific tryptic peptide sequences, to be used for SIS peptide synthesis, were selected for the nine proteins based on the number of observations in the PeptideAtlas MS/MS database , with an injection volume of 4\u2009\u03bcl resulting in 2\u2009\u03bcg of protein digest on-column. Samples were prepared basically as for iTRAQ pooling analysis, see Sample filtration section. First, from each sample, an aliquot of protein fraction containing 10\u2009\u03bcg of total protein was transferred to silanized vials. Then the volume of each sample was brought to 30\u2009\u03bcl using 100\u2009mM solution of NH4HCO3. 100\u2009mM DTT (Sigma Cat no D8161-5\u2009G) was added to the samples to the final concentration of 10\u2009mM and incubated at 56\u00b0C for 40\u2009min. To block reduced cysteines 0.5\u2009M iodoacetamide (Sigma Cat no I1149-5\u2009G) to the final concentration of 50\u2009mM was used and the sample was incubated at room temperature for 30\u2009minutes in darkness. Trypsin (Promega cat. no V511A) was added to samples in 1:20 vol./vol. ratio and incubated at 37\u00b0C overnight. Finally, trifluoroacetic acid was added to digested protein samples to reduce pH to 2 and inactivate trypsin.MRM analysis was performed on a new set of 52 samples  peak to the integrated area of the corresponding standard (SIS) peptide.ADPKD: Autosomal Dominant Polycystic Kidney Disease; ESRD: End Stage Renal Disease; DPS: Disease Pooled Samples; CPS: Control Pooled Samples; DPL: Differential Protein List; SIS peptides: stable-isotope-labeled internal standard peptides.Magda Bakun and Mariusz Niemczyk contributed equally to this workThe authors declare that they have no competing interest.M.B. \u2013 optimized peptide IEF, carried out LC-MS experiments, analyzed LC-MS data. M.N. \u2013 did patients selection, characterization, enrollment to the study, sample collection, wrote the manuscript. S.N. - did patients selection, characterization, enrollment to the study. A.F. \u2013 optimized sample prep protocol, carried out LC-MS experiments, M.K. \u2013 provided statistical analysis of the data. D.D., R.J. \u2013 designed MRM experiments, selected peptides, optimized MRM conditions. A.P., A.B. \u2013 carried out MRM experiments, analyzed data. M.D. - designed the study, wrote manuscript. L.P. - designed the study, established exclusion/inclusion criteria, wrote manuscript. All authors read and approved the final manuscript.List of 1 700 proteins identified by at least two peptides.Click here for fileMass measurement error correction and identification estimation q-value.Click here for file"}
{"text": "Lactococcus lactis, ssp lactis is reported in which emission intensities are used to follow and define metabolic activity during growth in nutrient broths. Optical density (OD) data were also acquired during L. lactis growth at 32\u00b0C and provided insight into the timing of the AE signals relative to the lag, logarithmic, and stationary growth phases of the bacteria. The inclusion of a metabolic inhibitor, NaN3, into the nutrient broth eliminated bacteria metabolic activity according to the OD data, the absence of which was confirmed using AE data acquisition. The OD and AE data were also acquired before and after the addition of Bacteriophage c2 in L. lactis containing nutrient broths during the early or middle logarithmic phase; c2 phage m.o.i. (Multiplicity of infection) was varied to help differentiate whether the detected AE was from bacteria cells during lysis or from the c2 phage during genome injection into the cells. It is proposed that AE measurements using piezoelectric sensors are sensitive enough to detect bacteria at the amount near 104\u2009cfu/mL, to provide real time data on bacteria metabolic activity and to dynamically monitor phage infection of cells.The detection of acoustic emission (AE) from  Saccharomyces cerevisiae yeast cell walls was observed using atomic force microscopy (AFM) , , and  minutes after inoculation. Although the groups near 180 and 250 minutes could be associated with bacterial activity, because L. lactis under \u201cnormal\u201d growth produced AE peaks as great as 278 minutes after inoculation  values of all AE peaks with timings after phage addition were small (~1.6 minutes). Their analyses required careful attention to avoid their removal by signal averaging when periods of three minutes or greater were used. In contrast, AE peaks associated with bacteria activity displayed in Figures L. lactis cell infection would be near 30 minutes [Durations of overall phage replication cycles are affected by four dependent variables: nutrient concentration; free or un-infected bacterial cell amount; free phage amount; and infected bacterial cell amount . For a p minutes . This vaThe presence in Furthermore, virus burst sizes are also known to affect the rate of cell lysis and phage-to-bacteria amount ratios \u201327. InteThe data presented herein were analyzed after completion of each test. However, the detection of phage genome injection into bacterial cells using AE techniques has the potential to be accomplished in real-time. This capacity would expand overall applicability of the AE technique for probing virus-cell interaction dynamics and for shedding insight into the prevention of viral infections. Additionally, the technique will serve as a novel way to study and analyze the critical steps of pathogenic life cycle in general, including the molecular basis of infection, the defensive mechanism by the host cell as well as host-pathogen interaction. Also, improved or new sensor-cell attachment mechanisms that optimize contact between the surfaces or immerse the sensor within nutrient media would help circumvent the AE transmittance losses at interfaces; for example, the loss of AE signal intensity at the broth-glass interface combined with at the glass-stainless steel sensor interface eliminated more than 75% of the intensity from the source of the acoustic wave. Nevertheless, the data presented herein show that AE signals from bacteria metabolic activity and phage genome injection were measurable and distinguishable, and the creation of a metabolically quiescent culture caused elimination of AE from the bacteria.Lactococcus lactis ssp. lactis C2 could be detected by measuring acoustic signals from cultures using piezoelectric sensing elements attached to the outside of bacteria growth flasks. The bacteria-related AE signals were evident when the bacterial amount attained \u2265104\u2009cfu/mL levels and only occurred during early or late periods of the logarithmic growth phase; these timings suggested a relationship between cell division and measurable acoustic emission, consistent with the higher metabolic activities during the steps of bacterial life cycle. It was also discovered that Bacteriophage c2 infection of L. lactis could be detected, and the origin of the ensuing AE signals was proposed to be a result of phage genome injection into the bacteria cells. This data has an important biological significance in terms of the real time study of phage mediated infection cycle and its consequences in the phage as well as host bacterium, at both molecular and cellular level. The multiplicity of the AE signals detected over ~250 minutes after phage addition to the bacteria culture contained timings that were in agreement with previous published c2 data during the infection of L. lactis and with the dynamics expected from virus-microbe assemblages under rapidly changing amounts. This multiplicity also suggested-extensive coordination of the timings of phage genome injection into bacteria cells. The acoustic detection of microbes could serve as a potentially valuable and real-time approach to address numerous basic and applied biological and/or clinical issues related to pathogenic microbial infections.It was discovered that the presence or absence of metabolic activity by bacteria"}
{"text": "GJB2 may lead to various degrees of sensorineural hearing impairment and/or hyperproliferative epidermal disorders. So far studies of dominant GJB2 mutations were mostly limited to case reports of individual patients and families. In this study, we identified 7 families, 11 subjects with dominant GJB2 mutations by sequencing of GJB2 in 2168 Chinese Han probands with sensorineural hearing impairment and characterized the associated spectrum, de novo rate and genotype-phenotype correlation. We identified p.R75Q, p.R75W and p.R184Q as the most frequent dominant GJB2 mutations among Chinese Hans, which had a very high de novo rate (71% of probands). A majority (10/11) of subjects carrying dominant GJB2 mutations exhibited palmoplantar keratoderma in addition to hearing impairment. In two families segregated with additional c.235delC or p.V37I mutations of GJB2, family members with the compound heterozygous mutations exhibited more severe phenotype than those with single dominant GJB2 mutation. Our study suggested that the high de novo mutation rate gives rise to a significant portion of dominant GJB2 mutations. The severity of the hearing and epidermal phenotypes associated with dominant GJB2 mutations may be modified by additional recessive mutations of GJB2.Dominant mutations in  Numerous gap junction proteins, termed as connexins (Cx), are expressed in inner ear and epidermis. Formed by hexameric connexin hemichannels (connexon) between adjacent cells, those gap junctions play an important role in the potassium homeostasis of the inner ear as well as in the keratinocyte growth and differentiation of the epidermis GJB2 gene, encoding the gap-junction protein connexin 26 (Cx26), may lead to sensorineural hearing loss (HL) and hyperproliferative epidermal disorder. Recessive GJB2 mutations are predominantly associated with non-syndromic HL  and are the most common cause of hereditary HL GJB2 mutations may cause both non-syndromic  and syndromic HL GJB2 mutations includes keratitis-ichthyosis-deafness  syndrome, hystrix-like ichthyosis with deafness , palmoplantar keratoderma  with deafness, Vohwinkel syndrome (MIM124500) and Bart-Pumphrey syndrome (MIM149200). Major epidermal phenotypes associated with dominant GJB2 mutations include ichthyosis, pseudoainhum, palmoplantar hyperkeratosis, knuckle pads and nail abnormalities Mutations in the De novo mutation occurs in the germline during early embryogenesis or somatically in some overgrowth syndromes de novo mutations have nevertheless been reported in some disorders with lesser impact on fitness, including a number of de novo GJB2 mutations detected in sporadic patients with sensorineural HL and hyperproliferative epidermal disorder GJB2 mutations, for which the mutation spectrum and the genotype-phenotype correlation have been well characterized, previous studies of dominant GJB2 mutations were mostly limited to case reports of individual patients and families. In the present study, we aimed to systematically characterize the spectrum, de novo rate and genotype-phenotype correlation of dominant GJB2 mutations in Chinese Han patients with syndromic or non-syndromic HL.Unlike recessive GJB2 mutations. All subjects or their parents gave written, informed consent to participate in this study. This study was approved by the Ethics Committee of Xinhua Hospital, Shanghai Jiao tong University School of Medicine.A total of 2168 Chinese Han probands with sensorineural HL were recruited from patients seeking genetic testing and counseling in Department of Otolaryngology - Head and Neck Surgery, Xinhua Hospital, Shanghai, China. Among them, 1904 (87.8%) probands had severe or profound HL, while the rest 264 (12.2%) had mild or moderate HL. Additional family members were recruited for those carrying known dominant GJB2 was performed by PCR amplification and bidirectional sequencing as previously described Genomic DNA was extracted from the whole blood samples using the Blood DNA kit . Mutation screening of all exons and flanking splicing sites of GJB2 mutations, physical examination was performed with special attention to hearing and epidermal abnormalities. Comprehensive auditory evaluations were performed including otoscope examination, tympanometry and pure-tone audiometry (PTA). Hearing threshold was calculated as the average of the hearing levels at 0.5, 1.0, 2.0, 4.0 KHz for the better ear. The severity of hearing impairment was defined as mild (20\u201340 dB), moderate (41\u201370 dB), severe (71\u201395 dB) and profound (>95 dB). Histological examination was performed in skin biopsies of patient C209-1.For subjects and family members carrying known dominant de novo mutations of GJB2, short tandem repeat (STR) analysis was performed in the affected individuals and their unaffected parents to confirm the parenthood using informative STRs D5S435, D5S629, D5S610, D5S351, D6S1714, D6S1573, D6S1344, D6S469, D3S1597, D3S3611, D3S3601 and D3S3589.For subjects carrying potential GJB2 in 2168 Chinese Han probands with sensorineural HL, we identified 7 (0.32%) probands carrying known dominant GJB2 mutations p.R75Q (n\u200a=\u200a3), p.R75W (n\u200a=\u200a2) and p.R184Q (n\u200a=\u200a2). Four additional family members carrying p.R75Q (n\u200a=\u200a2) and p.R75W (n\u200a=\u200a2) mutations were also recruited in this study. All other GJB2 variants detected in this study were either previously reported recessive mutations or non-pathogenic polymorphisms. None of the three dominant mutations in GJB2 was seen in 100 ethnically-matched normal hearing controls.By mutation screening of GJB2 mutations. Except for subject D439-2, who had mild HL with delayed-onset, the majority of the subjects (10/11) had congenital, severe-to-profound HL. Ten of the 11 subjects had additional PPK-associated epidermal abnormalities in their hands and feet, including thickening and peeling of the skin, keratoderma, erythema, callus, deep fissures, brittle, thickened or spoon nails, knuckle pads and circular keratotic constriction bands (on bands .All subjects with the p.R75Q (n\u200a=\u200a5) and p.R75W (n\u200a=\u200a4) mutations had syndromic HL with PPK. C209-1 and D40-1, two subjects with the p.R184Q mutations, had syndromic and non-syndromic HL, respectively. Since the p.R184Q mutation has not been reported to be associated with epidermal abnormalities previously , we furtGJB2 mutations, the probands  and/or their first-degree relatives (D441-2 and D493-2) had unaffected parents. STR analysis of the trios confirmed the true parenthood (data not shown). Parental genotyping showed that the dominant GJB2 mutations detected in those 7 subjects were de novo  and Family D441 (D441-1 and D441-2), respectively. Interestingly, intrafamilial variations of the degree of HL and PPK were observed in both families and the severity of phenotype was apparently modified by the presence of additional GJB2, while the proband's half-sibling D439-2 had the p.R75Q heterozygous mutation only  was detected with known dominant GJB2 mutations. Though not as common as its recessive counterpart, dominant mutations in GJB2 still represent one of the most frequent causes for dominantly inherited HL. To date, more than 20 dominant mutations of GJB2 has been reported worldwide . The mutation spectrum revealed by the current study of Chinese Hans, however, evolved only three of them: p.R75Q (n\u200a=\u200a3), p.R75W (n\u200a=\u200a2) and p.R184Q (n\u200a=\u200a2). Considering that all these three mutations have also been reported in sporadic cases with HL in Taiwan or mainland China  of the probands and two additional family members with the p.R75Q (n\u200a=\u200a2), p.R75W (n\u200a=\u200a3) and p.R184Q (n\u200a=\u200a2) mutations (de novo mutations constitute transitions (purine\u2194purine or pyrimidine\u2194pyrimidine) rather than transversions (purine\u2194pyrimidine), and the mutation rate can be elevated at the CpG-rich region GG>CAG), p.R75W (CGG>TGG) and p.R184Q (CGG>CAG) mutations all fit in with this characteristics of de novo mutations, which may partly explain the relatively high frequency of these three dominant GJB2 mutations in Chinese Hans.One of the most interesting findings of our study was the very high utations . It has GJB2 mutations, family members with both mutations exhibited more severe HL and PPK phenotypes than those with the dominant GJB2 mutation only Click here for additional data file.Table S1Genotype-phenotype correlation of the p.R75Q, p.R75W and p.R184Q mutation in previous reports and the current study.(DOC)Click here for additional data file."}
{"text": "Samples were tested from 67 patients in the derivation cohort, 10 (15%) of whom had confirmed VAP. Using cycles to cross threshold (Ct) values as the result of the 16S PCR test, the area under the receiver operating characteristic (ROC) curve (AUROC) was 0.94 . Samples from 92 patients were available from the confirmation cohort, 26 (28%) of whom had confirmed VAP. The AUROC for Ct in this cohort was 0.89 . This study has derived and assessed the diagnostic accuracy of a novel application for 16S PCR. This suggests that 16S PCR in BAL could be used as a rapid test in suspected VAP and may allow better stewardship of antibiotics.Ventilator-associated pneumonia (VAP) remains a challenge to intensive care units, with secure diagnosis relying on microbiological cultures that take up to 72 hours to provide a result. We sought to derive and validate a novel, real-time 16S rRNA gene PCR for rapid exclusion of VAP. Bronchoalveolar lavage (BAL) was obtained from two independent cohorts of patients with suspected VAP. Patients were recruited in a 2-centre derivation cohort and a 12-centre confirmation cohort. Confirmed VAP was defined as growth of >10VAPRAPID trial ref NCT01972425. Ventilator-associated pneumonia (VAP) remains a significant problem in intensive care units (ICUs)The ubiquitous presence of a 16S ribosomal RNA gene in bacteria offers the possibility of detecting a wide range of bacteria in a single PCR.9/L; or mucopurulent sputum. In the derivation cohort patients were excluded if they had received new antibiotics within the 3\u2005days prior to recruitment;4 colony forming units/mL (CFU/mL) of BAL fluid being defined as \u2018VAP positive\u2019 and growth <104 CFU/mL as \u2018VAP negative\u2019, these cut-offs being in line with established standards.Samples from two previously describedFull details of sample processing are described in the online 10.1136/thoraxjnl-2016-209065.supp1supplementary data2, 0.2\u2005mM deoxynucleotide mix (dNTP), 0.25\u2005\u00b5M primer 27-F, 0.75\u2005\u00b5M primer 16S 1RR-B, 0.3\u2005\u00b5M probe 514-S, nuclease-free water  and 10\u2005\u00b5L nucleic acid extract to a final volume of 25\u2005\u00b5L. Real-time PCR was carried out on the ABI 7500 instrument . This assay was used for samples from the derivation cohort, to establish proof in principle of the diagnostic utility of this approach, and was also used for samples from the confirmation cohort.The primer and probe sequences targeting the16S rRNA gene have been described previously.The primer and hybridisation probe sequences targeting the 16S rRNA gene have been described previously.2, 0.4\u2005\u00b5M forward and reverse primers, 0.1\u2005\u00b5M hybridisation probe, nuclease-free water  and 2\u2005\u00b5L of target template for a final reaction volume of 10\u2005\u00b5L. Real-time qPCR was carried out on a Light Cycler 480 instrument . This assay was used on samples from the confirmation cohort only.The final 16S PCR reaction mix contained 1X Platinum uracil DNA glycosylase Mastermix , 0.2\u2005\u00b5M bovine serum albumin , a total of 4\u2005mmol/L MgClt) as a measure of 16\u2005s rRNA gene load and hence bacterial burden. A higher bacterial load will result in a lower time to cross threshold, that is, a lower Ct value. Details of statistical analyses used can be found in the online For the purposes of analysis, the metric was cycles to cross threshold  had \u2018microbiologically confirmed VAP\u2019. In the \u2018confirmation\u2019 cohort samples from 92 patients were available for analysis; 26 (28%) met the culture criteria for \u2018microbiologically confirmed VAP\u2019. The demographic details and organisms cultured are shown in the online t value, than those without VAP  and a \u2018negative\u2019 result would be a value above this cut-off .Samples from the confirmation cohort were also tested using 16S assay 2. As seen in analysis . Using tt values  patients were receiving antibiotics on the day of recruitment. In the confirmation cohort, 69 (75%) were receiving antibiotics and 14 (15%) had undergone a change of antibiotics within the past 3\u2005days. Receipt of antibiotics and recent change in antibiotics were not associated with changes in 16S CFigure S2 shows the relationship between Ct values for the two 16S assays, demonstrating a non-linear association.To our knowledge, this is the first report of the use of real-time 16S PCR for diagnosing VAP. Although 16S rRNA gene sequencing has been used to explore the microbiome of ventilated patients, data on its diagnostic potential have been absent. In deriving and confirming a test, with a high agreement in test performance between the two cohorts, we demonstrate clear potential for the clinical utility of this test. Turnaround time is 4\u20136\u2005hours; therefore, this test could impact on antibiotic use, which may otherwise only be rationalised following the results of conventional cultures at 48\u201372\u2005hours.This study has a number of strengths. First, we were able to perform derivation and confirmation in two distinct cohorts, with confirmation in a cohort recruited from a diverse group of 12 ICUs. The results are therefore likely to be widely applicable; indeed, the microbiological spectrum found is similar to reports from other countries.A disadvantage of this study is that samples were obtained bronchoscopically, requiring resource and exposing patients to a small but definite risk, and the applicability of this test to other sample types cannot be inferred. The assays we describe here are also limited to bacterial detection. The differences between the two assays tested, and the use of stored samples, highlight the need for external prospective validation before this measure could be implemented in routine clinical practice. Further refinements of assays may also improve diagnostic performance. The reference standard of growth of organisms on conventional culture, remains imperfect, and indeed may well be influenced by intercurrent antibiotics generally, and recent changes in antibiotics specifically.In conclusion, we have derived and confirmed the diagnostic utility of a rapid laboratory test for VAP in a multicentre setting. We propose that this test has the potential to permit rapid decisions to direct antimicrobial therapy in patients with suspected VAP thus improving stewardship of antibiotics in the ICU."}
{"text": "Amongst women without GDM, first-trimester mono-(2-ethylhexyl) phthalate and mono(carboxyisooctyl) phthalate levels were positively associated with 120-min plasma glucose  in mid-pregnancy. No other monotonic associations were detected between phthalate or phenol levels and fasting or stimulated plasma glucose, \u03b2-cell function, insulin resistance, or 60-min disposition index. Our results support a glycaemia-raising effect of phthalates during pregnancy, consistent with findings in non-pregnant populations and suggest a possible protective effect of exposure to TCS against GDM.Certain phthalates and bisphenol A (BPA) have been associated with insulin resistance and type 2 diabetes in non-pregnant adults, but studies of gestational diabetes mellitus (GDM) have reported conflicting results for phthalates and no associations with BPA. Our aim was to investigate the relationship between maternal serum levels of phthalate metabolites and phenols at 10\u201317\u2009weeks of gestation and glucose homeostasis at 28\u2009weeks of gestation. 232 women aged \u226516\u2009years without type 1 or 2 diabetes with singleton male pregnancies were recruited from a single UK maternity centre between 2001 and 2009 as part of a prospective observational study (Cambridge Baby Growth Study). Serum levels of 16 phthalate metabolites and 9 phenols (including BPA) were measured using liquid chromatography/tandem mass spectrometry. Oral glucose tolerance tests were performed at 28\u2009weeks. 47/232 (20.3%) women had GDM. First-trimester triclosan (TCS) was inversely associated with incident GDM (adjusted odds ratio per log increase in concentration 0.54, 95% confidence interval 0.34\u20130.86,  Late pregnancy is characterised by peripheral insulin resistance with a compensatory increase in insulin secretion and \u03b2-cell mass. Inadequacy of this response leads to gestational diabetes mellitus (GDM), which is associated with both perinatal and long-term adverse outcomes . The incIn vitro, phthalates activate peroxisome proliferator-activated receptors, which regulate cellular lipid and glucose metabolism (n\u2009=\u2009350), second-trimester urinary monoethyl phthalate (MEP) was positively associated with impaired glucose tolerance (IGT), whereas di-(2-ethylhexyl) phthalate (DEHP) metabolites were associated with lower odds of IGT  observed no significant associations between first-trimester urinary phthalate metabolites and incident IGT/GDM  reported a positive association between second-trimester (but not first-trimester) urinary BPA levels and stimulated blood glucose levels (but not incident GDM) at 24\u201328\u2009weeks of gestation , first-trimester urinary BPA was not significantly associated with incident IGT/GDM (n\u2009=\u200994), second-trimester urinary BPA was not associated with GDM or fasting blood glucose levels amongst controls , and triclosan (TCS)] have not been associated with T2DM or fasting serum glucose in humans .Our objective was to investigate the prospective relationships between maternal serum levels of phthalate metabolites, BPA, and other phenols at 10\u201317\u2009weeks of gestation and glucose homeostasis at 28\u2009weeks of gestation in a UK setting.n\u2009=\u20092,229) were recruited to the Cambridge Baby Growth Study (CBGS), a large prospective cohort study, from routine antenatal clinics at 10\u201317\u2009weeks of gestation at the Rosie Maternity Unit, Cambridge, between April 2001 and March 2009. Characteristics of CBGS participants have previously been described (Pregnant women aged \u226516\u2009years (escribed . Writtenp\u2009>\u20090.2).A subcohort of 330 mothers of 334 male infants was selected for a nested case-control study of EDCs and cryptorchidism . Of these, women were retrospectively included in the present study if they had a singleton pregnancy, no pre-existing diagnosis of type 1 or 2 diabetes mellitus or GDM, and undertook an oral glucose tolerance test (OGTT) at 28\u2009weeks of gestation. This subset of 232 women was representative of the whole cohort with regard to age, ethnicity, pre-pregnancy body mass index (BMI), and deprivation index  as these women did not differ from others with regard to age, pre-pregnancy BMI, ethnicity, smoking status, parity, or prevalence of GDM .A questionnaire administered at ~36\u2009weeks of gestation collected demographic information, including history of diabetes mellitus, ethnicity, smoking, and parity. The Index of Multiple Deprivation 2007 (IMD), which measures various economic, social, and housing parameters, was derived from residential postcodes . The samp\u2009>\u20090.1). Insulin and C-peptide levels were measured at 0 and 60\u2009min in 158/232 (68.1%) women. Women with missing insulin and C-peptide levels did not differ from others with regard to age, BMI, IMD, ethnicity, smoking status, parity, or prevalence of GDM . Glycated haemoglobin levels were not measured.At 28\u2009weeks of gestation, a 75-g OGTT was performed following an overnight fast. Venous whole blood glucose levels were measured at 0 and 60\u2009min, and capillary blood glucose levels were measured at 0, 60, and 120\u2009min. From May 2007 onwards, venous whole blood glucose levels were also measured at 120\u2009min . Women completing OGTTs before May 2007 did not differ from those completing OGTTs during/after May 2007 with regard to age, BMI, IMD, ethnicity, smoking status, parity, or prevalence of GDM . Fasting and stimulated insulin and C-peptide levels were measured by enzyme-linked immunosorbent assay using commercial kits .n\u2009=\u2009232), with the first quartile used as the referent category.Analyses of associations with parameters of blood glucose homeostasis included only those chemicals measured above the LOD in >60% of samples. Concentrations below the LOD were assigned a value equal to LOD/2 if the data were highly skewed or LOD/\u221a2 if not . These sR2\u2009=\u20090.790, F\u2009=\u20092,889.3, p\u2009=\u20092\u2009\u00d7\u200910\u2212262]. A linear regression model assessing the ability of fasting capillary blood glucose to predict fasting venous plasma glucose gave a different result: venous plasma glucose\u2009=\u20090.826\u2009\u00d7\u2009capillary blood glucose\u2009+\u20090.996 ; however, we justified using the first equation to estimate the missing 120-min venous plasma glucose levels as across the entire CBGS cohort the mean 60-min venous plasma glucose (7.4\u2009mmol/l) was closer to the mean 120-min venous plasma glucose (6.9\u2009mmol/l) than the mean fasting venous plasma glucose (4.7\u2009mmol/l) The updated homeostasis model assessment (HOMA2) was used to estimate steady-state \u03b2-cell function  and insulin resistance  . To estimate insulin secretion independent of insulin sensitivity, we calculated the disposition index as the 60-min insulinogenic index [(insulin 60\u2009\u2212\u2009insulin 0)/(venous glucose 60\u2009\u2212\u2009venous glucose 0)] divided by HOMA2-IR  ; softwarHOMA2-IR . HOMA2-BFor primary analyses, women were diagnosed with GDM if they met one or more of the following criteria: fasting plasma glucose \u22655.1\u2009mmol/l, 60-min plasma glucose \u226510.0\u2009mmol/l, or 120-min plasma glucose \u22658.5\u2009mmol/l , 32. ForNewborns were examined by research nurses, as far as possible in the first 2\u2009weeks of life, either in hospital or at home visits. They were then re-examined during clinic visits at 3, 12, and 24\u2009months of age. Birth weight as measured at delivery by midwives was taken from health records. Cryptorchidism was defined as one or more testes not present in the inferior half of the scrotum for at least a few moments after manipulation.The study was approved by Cambridge Local Research Ethics Committee and adhered to the Declaration of Helsinki.t-test and Mann\u2013Whitney U-test for continuous variables, and chi-square test for categorical variables.Distribution percentiles of phthalate and phenol concentrations were calculated for women with and without GDM, and differences in patient characteristics were assessed using the per se may cause insulin resistance and \u03b2-cell dysfunction (phet) and linear trend (ptrend) in outcome value across serum phthalate/phenol concentration quartiles were performed. Because numerous chemicals were significantly correlated and several have been previously associated with dysglycaemia  and a possible association between GDM and congenital cryptorchidism , we addip-values were two-sided and p\u2009<\u20090.05 was considered statistically significant. Data were analysed using SPSS, version 22.0 .All 232 women participated in the study, of whom 47 (20.3%) met one or more criteria for GDM , and several of the other chemicals were weakly correlated .Six phthalate metabolites  and three phenols  were detectable in >60% of samples (Table p\u2009=\u20090.010] (Table p\u2009=\u20090.028), third , and fourth  quartiles for triclosan, compared to the first quartile . Inspection of the data did not reveal evidence for a threshold or non-linear relationship. Conversely, women with MiBP levels in the second  and fourth  quartiles, but not in the third quartile, had higher odds of GDM .In continuous models, of these nine chemicals, only triclosan was associated with incident GDM [adjusted OR (aOR) per log increase in concentration 0.54, 95% CI 0.34\u20130.86, p\u2009=\u20090.005) and the categorical analysis . However, there was no significant association between MiBP levels and incident GDM (data not shown).To explore the robustness of our results, and in view of the high incidence of GDM in our sample compared to previous studies , we repen\u2009=\u2009185), MEHP was positively associated with 120-min plasma glucose , explaining 6.9% of the variation in 120-min glucose . MCiOP was also positively associated with 120-min glucose , explaining 3.4% of the variation in 120-min glucose. Other phthalate metabolites (including MiBP) and all phenols were not significantly associated with fasting/stimulated glucose levels, HOMA2-B, HOMA2-IR, or disposition index .Among women without GDM at 28\u2009weeks of gestation (p\u2009=\u20090.00008), explaining 7.6% of the variation in 120-min glucose, but not any other indices of glucose homeostasis.Experimental studies suggest that MEHP, the primary metabolite of DEHP, may have greater endocrine disrupting activity that is secondary metabolites, such as MECPP . We, thep\u2009=\u20090.12) nor MCiOP  was associated with incident GDM; and MCiOP was not associated with GDM in the categorical analysis . However, women with MEHP levels in the second  and fourth  quartiles, but not in the third quartile , had significantly increased odds of GDM .We hypothesised that the lack of association of MEHP and MCiOP with GDM, despite their positive associations with 120-min plasma glucose, may reflect the relatively small proportion of cases in our sample with abnormal 120-min glucose levels, owing to the use of a higher diagnostic threshold (\u22658.5\u2009mmol/l) , 32 thanp\u2009=\u20090.58) or fasting/stimulated glucose levels, HOMA2-B, HOMA2-IR, or disposition index (data not shown). When we remodelled the of odds of GDM in relation to serum phthalate/phenol concentrations in the 216 mothers whose sons did not have cryptorchidism at birth, our results were not substantially different from the primary analyses: triclosan was associated with incident GDM in both the continuous analysis  and categorical analysis , and women with MiBP levels in the second  and fourth  quartiles, but not in the third quartile, had higher odds of GDM  (other data not shown).Of the 232 male infants born to the women in our study, 16 (6.9%) had cryptorchidism at birth  phthalate and MCiOP were positively associated with 120-min plasma glucose. These findings are consistent with the thalates  and rodethalates . Two epithalates , 9\u2014althothalates , 8, and thalates . The lacOur phthalate results do not corroborate with three other recent prospective studies of GDM, which variously reported inverse associations of MiBP and MBzP with 60-min glucose , a positThe prevalence of GDM in our subcohort 20.3%) was several-fold higher than the reported prevalence for England and Wales (~3.5%) . This ma0.3% was We did not have data for all possible confounders: for example, education, income, activity levels, diet, subfertility, family history of diabetes, and other EDCs , 18. ThiSerum phthalate metabolite levels in our study were of a similar order of magnitude to those reported in other cohorts of pregnant or postpartum women , 49. SerStrengths of our study include its prospective design; use of laboratory criteria to diagnose GDM; sample collection and storage in glass tubes ; use of a highly sensitive technique for measuring the chemicals; and our ability to account for a number of potential confounding variables. This is also the first study to examine the association between phthalate metabolites and phenols and markers of insulin resistance and \u03b2-cell function in pregnant women.p values were\u2009\u2264\u20090.01, making a type-1 error unlikely.Our study has several limitations. First, the sample size was relatively small, which will have limited precision and statistical power, although it was larger than two of the five previously published studies of phthalates/BPA and GDM , 19. SecIn conclusion, our study provides a novel and interesting demonstration of inverse association between maternal serum triclosan levels at 10\u201317\u2009weeks of gestation and incident GDM, in addition to biologically plausible associations between MEHP, MCiOP, and the MEHP/MECPP ratio and stimulated blood glucose levels. However, these findings need to be confirmed by further carefully designed prospective studies in other settings, that use a variety of specimen types (including urine) and assess exposure levels at multiple time points. More evidence is required before specific recommendations can be made with regards to clinical practice in diabetes or public health policy.This study was carried out in accordance with the recommendations of Cambridge Local Research Ethics Committee with written informed consent from all subjects. All subjects gave written informed consent in accordance with the Declaration of Helsinki. The protocol was approved by Cambridge Local Research Ethics Committee.BF, AT, and CA contributed to the conception and design of the study; BF, HF, A-MA, AJ, and AT performed the data analysis; KO provided statistical expertise; BF wrote the first draft of the manuscript; AT, IH, DD, KO, and CA contributed to the design of the CBGS; and HF, A-MA, AJ, IH, DD, KO, and CA contributed to data collection. All authors contributed to the interpretation of the results and revision of the manuscript for important intellectual content, and approved the final version of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Optimization of outcomes of extra-abdominal STS is not clearly understood. We sought to determine whether hospital surgical volume and adherence to NCCN guidelines, or both, are associated with outcomes in the treatment of extra-abdominal soft tissue sarcoma (STS).  The National Cancer Database (NCDB) was queried for patients undergoing surgery for extra-abdominal STS diagnosed from 2003 to 2007. Mean annual hospital volume for STS surgery was divided into volume terciles . Adherence to NCCN guidelines was determined. Primary outcome was overall survival. p \u2264 0.001) than 1T hospitals. On multivariable analysis, adherence to NCCN guidelines was associated with improved survival , but hospital volume was not . Five-year overall survival was comparable for compliant groups at 1T, 2T, and 3T hospitals . 3T hospitals were not associated with a lower risk of 30-day mortality  compared to 1T hospitals but did have a higher R0 resection rate .  Our study population consisted of 13,684 patients with a median age of 56 years. 3T hospitals were more likely to adhere to NCCN guidelines for stage III patients (63% versus 47%;  Adherence to NCCN guidelines, irrespective of hospital volume, is associated with improved overall survival for patients with extra-abdominal STS. High-volume hospitals more often adhere to guidelines, but low-volume hospitals that follow national guidelines may achieve comparable outcomes. One of the challenges in managing complex cancers is identifying health care processes and structural measures that optimize outcomes. Hospital volume is a well-known measure that correlates with improved clinical outcomes for several cancer types . AlthougSoft tissue sarcoma (STS) is a group of over 50 rare mesenchymal malignancies that accounts for less than 1% of all new cancers. Optimal treatment of STS is based on an institution's experience and resources to provide a multidisciplinary effort to treat such a rare and complex malignancy. Although a volume-outcome relationship has been demonstrated for STS, optimizing cancer outcomes likely also depends on the appropriate use and expertise of a multimodality team that includes pathologists, radiation oncologists, medical oncologists, and surgeons , 11. HowConsequently, the purpose of this study was to analyze the impact of hospital surgical volume and adherence to NCCN guidelines on outcomes for extra-abdominal STS patients. We hypothesize that increased adherence to NCCN guidelines is associated with higher overall survival (long-term outcomes) and that high hospital surgical volume is associated with improved 30-day mortality and R0 resection rates (short-term outcomes).Data from the National Cancer Database (NCDB) was used to conduct this study. The NCDB, a joint program of the Commission on Cancer (CoC) of the American College of Surgeons (ACoS) and the American Cancer Society (ACS), is a nationwide oncology outcomes database for more than 1,500 commission-accredited cancer programs in the United States and Puerto Rico. Approximately 70% of all newly diagnosed cases of cancer in the United States are captured at the institutional level and reported to the NCDB. Variables in the database cover demographics, socioeconomic status, tumor stage, treatment received, and hospital characteristics. NCDB data contain no protected health information; hence, this study was exempt from formal IRB review.http://www.nccn.org). For this study, we utilized NCCN guidelines on the use of radiation therapy for these tumors with regard to margin status and tumor stage to divide patients into compliant and noncompliant groups . This time period was chosen to ensure up to date coding in the NCDB for the variables of interest for this study and to provide at least 5 years of follow-up for survival analyses. Histologies included were liposarcoma, fibrosarcoma, leiomyosarcoma, malignant fibrous histiocytoma, myxofibrosarcoma, malignant peripheral nerve sheath tumor, and not otherwise specified (NOS). Patients with stage I, II, and III were included, and patients with stage IV were excluded. Only patients who underwent curative intent surgery were included in the study cohort. NCDB surgical codes distinguish between curative intent surgery and procedures such as open biopsies. Patients undergoing palliative surgery were excluded. In order to provide valid volume-outcome comparisons, only patients who had all treatment at the reporting hospital were included in the study cohort.The exposure variables were hospital volume status and adherence to NCCN guidelines as outlined in a priori and before any analysis of the data was performed. Using this technique, the cutoff identified for high volume  was \u226511 cases per year.We adapted the methods from Birkmeyer et al. to compute the hospital volume . The nump value of <0.05 was set as our threshold for statistical significance. The analysis was performed using SAS 9.4 and R 3.1.3.Bivariate analyses were initially performed to identify demographic, tumor, and treatment differences between different terciles of volume using the chi-square test or analysis of variance. Logistic regression analyses were used to model the margin negative resection and 30-day mortality following surgery, and adjusted odds ratios (OR) and 95% confidence intervals (CIs) were reported. We excluded patients who underwent amputation from the margin status analysis. Overall survival was estimated by the Kaplan\u2013Meier method, and the comparison in the survival curves between different surgical volumes and compliance to NCCN guidelines was assessed by the log rank test. Cox regression analyses were used to model overall survival, and adjusted hazard ratios (HRs) and 95% CIs were reported. For the multivariable logistic regressions and Cox regression, we included demographic and clinical characteristics that were considered as variables influencing 30-day mortality and margin status. A Our study population consisted of 13,684 patients who underwent surgical resection for extra-abdominal STS . The medN=7373). 3T centers were also more likely to see tumors that were >10\u2009cm in size and hence had a higher proportion of patients with stage III tumors than 1T facilities . The use of chemotherapy and radiation therapy was also higher in 3T facilities. Statistically significant differences in socioeconomic characteristics were seen between the volume terciles. Finally, patients treated at 3T centers were more likely to receive care in accordance to NCCN guidelines in the use of radiation therapy than at 1T centers . Though this finding is likely not clinically meaningful, these differences were most pronounced for stage III patients between 3T and 1T centers . There was no difference in guideline compliance between 1T, 2T, and 3T centers in the management of stage I patients , or stage II patients .Following the division of the study cohort by volume terciles, some noticeable differences between groups emerged . Overallp=0.003) was seen from 1T to 3T centers. p < 0.001), respectively. The 5-year overall survival rates for NCCN guideline compliant and noncompliant patients were 72.4% and 67.2% (p < 0.001), respectively.A monotonic decrease in unadjusted overall mortality from 35.8% to 32.4% (p < 0.001). In contrast, hospital surgical volume was no longer associated with improved overall survival . As expected, larger tumor size, higher grade, and positive margins were all associated with a higher risk of overall mortality.p \u2264 0.001). A similar association was seen for 2T hospitals, with improved 5-year overall survival for the compliant group compared to the noncompliant group . There was no difference in 5-year overall survival for patients treated at 3T hospitals who received compliant care compared to those who received noncompliant care . It is important to note that 5-year overall survival for patients treated at 1T, 2T, and 3T hospitals was similar when treated in compliance with guidelines .p < 0.001)  . However< 0.001) , the 30-p < 0.001). After adjustment of variables, The overall rate of margin negative resection was higher at 3T versus 1T centers , yet the baseline overall rate remains low (0.9%). This is consistent with other published reports of low postoperative mortality following extra-abdominal STS surgery . ConsequOne advantage of the NCDB over other registry data is the inclusion of margin status. It can be reported as either (a) margin negative or margin positive or (b) margin negative (R0), microscopic positive (R1), and macroscopic positive (R2). For the sake of simplicity, we used the R classification system and found that the margin negative rate (R0) of a 1T center was lower than that of a 3T center (83% versus 90%). This association persisted following adjustment for other variables related to margin status, such as tumor location and size, with 3T centers 77% more likely to achieve negative margins as 1T centers. Related to this, we also noted that 3T centers were more likely to treat more advanced cancers and perform amputation. It is possible that the higher margin positive rate noted for 1T centers may be secondary to their reluctance to perform an amputation. Whether such cases would have been better treated with amputation is not known. Also, it is possible that hospitals planned for positive margins for those cases where the tumor is in close proximity to vital neurovascular structures, a strategy that one would expect to be more common at high-volume centers in the context of a multidisciplinary approach. Although we are unable to quantify the rate of planned positive margins using the NCDB, we expect that inclusion of these cases would artificially inflate the margin positive rate at 3T centers and bias our results towards no difference between 1T and 3T centers. In reality, the true negative margin rate may be even higher at 3T centers than reported in this analysis.Our study has limitations typical of large database studies. Incomplete clinical data as well as lack of granularity can bias our results. The NCDB does not report the cause of death; hence, our endpoint for survival analysis was overall survival and not the oncologically more relevant disease-specific survival. We are also unable to study local recurrence rates and correlate these with margin status or overall survival as recurrence information is not available in the database. Moreover, other measures highly relevant to extra-abdominal STS care such as limb function and treatment-related morbidity are not captured by the NCDB. It is quite possible that 3T centers would have improved local control, limb salvage, limb function, and treatment-related morbidity outcomes compared to 1T centers. The distribution of socioeconomic variables was significantly different between volume terciles. Although these variables were not significant predictors of overall survival, the fact that they were not balanced between groups may have introduced unknown bias. Also, we rely on data abstractors to determine whether surgery was performed for curative intent, and therefore it is not known if R2 resected tumors were for curative or palliative intent. Histologic subtype has been shown to have a significant change in 16% of cases referred to a sarcoma center, suggesting that the histologic subtypes reported by 1T centers may be unreliable in sarcoma cases . To addrSo what do we take from this data? First, the inclusion of guideline compliance is important to disentangle the true significance of hospital volume. A prior sarcoma study showed an association between hospital surgical volume and long-term outcomes . When guHigh-volume hospitals more often adhere to guidelines. Low-volume hospitals that follow national guidelines appear to achieve comparable survival, but data regarding the association between hospital volume and important outcomes such as local control, limb salvage, limb function, and treatment of related morbidities are lacking. This may help inform the debate on regionalization of sarcoma care. Rather than a focus on volume, centers should encourage expert multidisciplinary consultation and guideline-based treatment for extra-abdominal STS. Currently, adherence to guidelines for all volume terciles remains moderate at best, suggesting a potential avenue to improve outcomes across the board."}
{"text": "P\u00a0<\u00a00.05; 95% CI, 2.3\u20102.9 and 1.4\u20101.8). The higher PPT1 enzymatic levels in FEP schizophrenia patients were positively associated with larger PANSS scaling scores . Higher enzymatic PPT1 in FEP schizophrenia patients is significantly associated with increased PANSS scaling values, indicating more serious rates of developing psychosis. Enzymatic activity of PPT1 may provide an important new view for schizophrenia disorders.Genome\u2010wide association studies have confirmed that schizophrenia is an inheritable multiple\u2010gene mental disorder. Longitudinal studies about depression, first episode psychosis (FEP) and acute psychotic relapse have mostly searched for brain imaging biomarkers and inflammatory markers from the blood. However, to the best of our knowledge, the association between enzymatic activities with diagnosis or prediction of treatment response in people with schizophrenia has barely been validated. Under the Longitudinal Study of National Mental Health Work Plan (2015\u20102020), we have studied a subsample of approximately 36 individuals from the cohort with data on palmitoyl\u2010protein thioesterase\u20101 enzymatic activity from FEP and performed a bivariate correlation analysis with psychiatric assessment scores. After adjusting for sex, age, body mass index (BMI) and total serum protein, our data demonstrated that PPT1 enzymatic activity is significantly associated with schizophrenia and its Positive and Negative Syndrome Scale (PANSS) scores. This longitudinal study compared the PPT1 enzymatic activity in FEP schizophrenia patients and healthy volunteers, and the former exhibited a significant 1.5\u2010fold increase in PPT1 enzymatic levels (1.79\u00a0mmol/L/h/mL, and 1.18\u00a0mmol/L/h/mL;  After centrifuging at 1000\u00a0rpm for 10\u00a0minutes, the plasma was stored at \u221280\u00b0C for later use.Before electrophoresis or ELISA assays, each serum sample was treated with a Qproteome Albumin/IgG Depletion Kit . For western blotting, primary antibodies were as followed: rabbit anti\u2010PPT1 ; rabbit anti\u2010transferrin . The secondary antibody was goat anti\u2010rabbit IgG . The PPT1 enzymatic assay  was performed after 8 months with no freeze\u2010thaw cycles during storage. All intra\u2010assay coefficiency of variations was less than 5%. Please also see in supplemental materials.2.3Details of the clinical evaluation in the schizophrenia patients have been published elsewhere.2.4t test was used to compare two groups to continuous variables. Chi\u2010square test was used to compare two groups in binary variables. PANSS scales  and S\u2010scales were regressed on age, sex, BMI, serum total protein levels. The resulting residuals were ranked and inverse normalized. The multiple linear regressions in SAS 9.14 were used for analyses of the transformed PANSS scales. The logistic regression model was used for the binary variable of FEP status with covariates of sex, age, BMI and serum total protein level. The Pearson correlation coefficient scores were calculated among PPT1, sex, age, BMI and serum total protein, regressed, ranked and inverse normalized PNASS scales. Receiver operator characteristic (ROC) curves analysis in R (pROC) was performed to evaluate if PPT1 activity was a predictor of SCZ. The data set was randomly divided into train (60%) and test (40%) sets. Parameters were estimated in a train set with covariant of sex, age, BMI and serum total protein, and the parameters were evaluated in test set. ROC and AUC (area under a curve) scores were calculated based on the predicted probabilities within a test set. P<\u00a00.05 was considered statistically significant.The PANSS 3P\u00a0<\u00a00.01.Demographic and clinical details of the samples are presented in Table 3.1Palmitoyl\u2010protein thioesterase 1 was weakly correlated with functional magnetic resonance imaging in specific brain regions,3.2From the current subsample of the longitudinal study, the distributions of age and sex were not different between the SCZ patients and matched healthy volunteer subjects as a study designed. Basic study information is presented in Table P\u00a0<\u00a00.01 .Body mass index, total serum protein and PPT1 enzymatic value in the SCZ patients were significantly higher than those in the matched controls  and 9.51  for with and without adjustment of total serum protein levels respectively  scores for PPT1 enzymatic activity only , negative scaling scores , general scaling scores  and PNASS\u2010S scaling scores .Our findings demonstrated, in a longitudinal cohort study, that PPT1 enzymatic activity levels associated with FEP schizophrenia clinical assessment scores. This association persisted after adjusting for several potential confounders, including sex, age, BMI and total serum protein levels. Higher PPT1 enzymatic activity levels were extremely positively correlated with FEP schizophrenia with higher PANSS\u2010positive scaling scores . These confronted results of serum factors in oxidative and immune profiles will limit their value to determine whether oxidative and inflammatory markers as good candidates for diagnosing or indicating treatment responses. However, the enzymatic activity of PPT1 in the current study provides a potentially novel path for seeking diagnostic serum biomarkers of schizophrenia.To the best of our knowledge, this is the first longitudinal study of enzymatic activity levels on blood\u2010based assay in first episode patients of schizophrenia. We applied restricted categories of psychotic measurements to assess each FEP patient and the degree of severity according to the latest version of the PANSS scaling system.Schizophrenia alters basic brain processes of perception, emotion and judgement to cause hallucinations, delusions, thought disorder and cognitive deficits.Of all these related genes, PPT1 is one of the responsive genes that encode critical proteins for neural development, synaptic transmission and plasticity that are widely improperly expressed in the SCZ brain.The limitations of our present study are that these FEP patients are still enrolled in longitudinal treatment studies and that the 90% dropout rate makes the follow\u2010up evaluation of serum levels of PPT1 enzymatic activity unavailable in the current study. However, associations between PPT1 enzymatic activity and psychotic assessment scores are consistent with the clinical and genetic studies from Ibrahim's group that 33 genes, including PPT1, as the potential blood\u2010based markers that are related to clinical fMRI changes in left hippocampal ventricle integrity. This view of the association of PPT1 enzymatic activity with severity PANSS scores provides a novel scope to the diagnosis or prediction of prognosis outcomes of schizophrenia in clinics.5The strong association between the systemic enzymatic levels of palmitoyl\u2010protein thioesterase\u20101 in FEP schizophrenia patients and the psychotic assessment PANSS values could be used for diagnosing or predicting the severity of schizophrenia. Further study of PPT1 enzymatic activity in schizophrenia patients may provide crucial new intervention and prevention targets for schizophrenia disorders.Uses of all human samples and blood tissues in this study complied with safety guidelines and regulations of the National Institute of Health (NIH). All experiments on human samples were approved by Xinxiang Medical University (XXMU) Ethics Committee.Authors of this paper claimed no potential financial and nonfinancial competing interest.\u00a0Click here for additional data file."}
{"text": "Since the inception of psychology as an academic discipline, scholars have made extensive use of first-person (or introspective) enquiry: it is applied during theory-development and hypothesis-formulation; it permeates the data-collection stage; and it impacts on the process of data-interpretation and theory-development. In all these cases, the scientists' expertise, understanding, perspective, or expectations inform their scholarly practice. Sometimes this is the case in more explicit ways; sometimes, however, it can also occur in more implicit forms\u2014and in turn it can color and even bias the research process.This universally applied impromptu or na\u00efve form of introspection can thus be a burden to the research process and we hence considered it important to raise this issue more broadly. We were not only seeking to draw attention to the widely practiced, often unreflected and hence problematic form of first-person enquiry; rather, we were also hoping to advance methods that could systematically develop and advance this practice so that it can become a form of enquiry that may complement other, third-person forms of research. This was the methodological aim of our Research Topic.The other, theoretical aim was to explore more subtle facets of psychological phenomena that are difficult to access from a third-person point of view. Many such phenomena have first-person characteristics or are even of a primary first-person nature to begin with  and it appears inadequate to try and explore these topics while bypassing what a first-person exploration can uncover. First- and third-person research should not be seen as competing approaches but as providing complementary access routes in a pluralistic research culture.To bring together the available expertise and to explore current approaches on what is admittedly still a niche-theme\u2014often even marred with notorious skepticism and apodictic rejection\u2014we compiled the current Research Topic. From a competitive selection of contributions, six were successful in the review process and in what follows we provide a brief overview to orient the reader through these articles.Is there a problem in the laboratory?Wendt voices reservations against the common practice of reducing problem-solving research to laboratory settings, as this does not give justice to the experiential facets of many real-life problem-solving situations. Wendt proposes a phenomenologically oriented understanding and definition of what a problem is and proposes a set of empirical strategies that a revised approach should consider. These include the use of less intrusive methods of enquiry; and the inclusion of \u201catmospheric\u201d characteristics of the experimental setup, for instance via the consideration of artwork.In his paper The Phenomenology of Habits: Integrating First-Person and Neuropsychological Studies of Memory, Tewes explores the possibility to integrate first-person research on embodied memory capacities with third-person research methods as commonly used in neuropsychology. Starting with the concept of habits, he analyzes phenomenological and embodied work of habitual memory capacities in order to show that next to rigid and stereotypical habits there are also flexible and adaptive ones, which are open to attentional control and accessible from the first-person perspective. In the last part of the paper he outlines how the method of front-loaded phenomenology\u2014developed by Shaun Gallagher\u2014could contribute to exploring this type of habitual body memory also with neurophysiological methods.In his contribution The relevance of explanatory first-person approaches for understanding psychopathological phenomena. The Role of Phenomenology, Schmidt draws on the Husserlian concept of genetic phenomenology to illuminate different psychopathological phenomena. He points to the importance of complementing biological/reductionist accounts of psychiatric conditions with phenomenological ones, as many experiential facets of psychiatric disorders have correlate symptoms that cannot be immediately traced back to the primary physiological deficiency. He points out how phenomenological research needs to be used to systematize psychopathological experiences rather than understand them via the detour of physiology.In his article Husserlian phenomenology as a kind of introspection, Gutland introduces phenomenology as a form of introspection and gives an overview over Husserl's phenomenological approach. He reviews the challenges of introspective enquiry and points to safeguards that Husserl introduced to shield phenomenological introspection against these challenges. One is the systematic scrutiny and reduction of accounts to those aspects that are fully compatible with what one experiences. The other is the exploration of different (imaginary) instantiations of a phenomenon and the attempt to identify patterns of lawfulness that permeate these\u2014an approach Husserl termed eidetic variations. Gutland discusses the implications of these aspects and also places Husserl's account in the wider philosophical context.In his article The confluence of perceiving and thinking in consciousness phenomenology, Wagemann focuses on the phenomenon that similar dynamic patterns of separation and integration appear in the history of human consciousness as well as in elementary mental processes. Against this background\u2014and substantiated with representative examples\u2014he complements the standard approach to perception and thought as externally measurable processes with systematic first-person observations inspired by Steiner's and Witzenmann's Structure Phenomenology. In the context of voluntary perceptual reversals, this allows the author to trace back perceiving and thinking action to a diachronic structure of separating and integrating mental micro-gestures and to relate this to the historical development of psychology.In his article Pristine inner experience and descriptive experience sampling: Implications for psychology, Lesley-Carr and Heavey define pristine inner experience as experiences that is spontaneous and not yet colored by interpretation. Such experiences are theoretically important as they allow for an unobtrusive assessment of a momentary psychological state. The authors introduce descriptive experience sampling as a method to enquire into these spontaneously available states and illuminate how this method can help uncover facets of psychological functioning that are difficult to access with other methods.In their article Taken together, the Research Topic has implications for basic research as well as applied  practice and will equip the reader with an overview over the challenges and opportunities of introspection\u2014and how these can be addressed and/or made use of.All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The health and gender of older adults can elicit differing attitudes and emotions within young and middle-aged adults ; one\u2019s own gender may also influence these differences . In this study, 287 participants , aged 19-55 years (M=32.8), were randomly assigned to read one description of an older adult that varied cognitive health status  and gender . Factorial MANOVAs examined differences by gender, health, and participant gender for participants\u2019 (a) emotions about the older adult  and (b) negative perceptions about aging (ageist attitudes and aging anxiety). The first MANOVA found a significant main effect for health status; participants expressed more compassion (p=.013) and less emotional distance (p<.001) for the older adult with Alzheimer\u2019s than for the healthy older adult. Also, the Target Gender X Participant Gender interaction was significant for emotional distance (p=.032), but not for compassion (p=.616); men reported more emotional distance than women for the female older adult, regardless of target health status, but men and women\u2019s emotional distance were very similar for the male older adult. The second MANOVA showed only a significant health status main effect; ageist attitudes (p=.021), but not aging anxiety (p=.062), differed by health status of the older adult, with more ageist attitudes expressed for the healthy older adult than the older adult with Alzheimer\u2019s. Overall, these results show that individual factors can influence young and middle-aged adults\u2019 negative attitudes and emotions towards older adults. Implications will be discussed."}
{"text": "SMAD4 gene significantly contributed to the increased risk and might participated the pathological progression of TAAD. This investigation aims to test (1) the associations between rs12455792 and M\u00d8 recruitment, inflammatory response in aggressiveness of TAAD, and (2) the molecular mechanism accounting for their effects. In TGF-\u03b2 signaling molecular detection, rs12455792 C>T variant activated the canonical and non-canonical TGF-\u03b2 mediators. It also increased the secretion of chemotactic factors of HASMCs. To confirm the impact of this change, we detected M\u00d8 recruitment and infiltration in HASMCs and aortic tissues of TAAD patients. We found that M\u00d8 recruitment in cells and tissues with rs12455792 variant genotypes was increased than that in wild type groups. Moreover, rs12455792 variant increased M1 type inflammatory response, which might contribute much to TAAD progression. To mimic the SMAD4 suppression effect of rs12455792 in vivo, we constructed the SMAD4 KD mouse. After induction with Ang II for 4w, the thoracic aorta dilatation and vascular remodeling were more serious than that of wild type group. In conclusion, rs12455792 increased M\u00d8 recruitment, M1 type inflammatory response via activated TGF-\u03b2 signaling, and further promoted vascular remodeling and pathological progress of TAAD.Thoracic aortic aneurysm and dissection (TAAD) is the most fatal macro vascular disease. The mortality of 48h after diagnosis of dissection is up to approximately 50-68%. However, the genetic factors and potential mechanism underlying sporadic TAAD remain largely unknown. Our previous study suggested rs12455792 variant of  Aortic aneurysm and dissection is the most fatal macro vascular disease, accounting for over 152,000 new deaths in the United States per annum . IncreasSMAD4, also known as DPC4 , is located at 18q21.1 [SMAD4 mutations were proven causing thoracic aortopathy and vascular malformation [SMAD4 haploinsufficiency resulted in aortic aneurysm exacerbation in a MFS mouse model [SMAD4 deficiency elevated M\u00d8 infiltration and initiated thoracic aortic aneurysm and dissection formation in mouse model [SMAD4 in the pathogenesis of human thoracic aortic disorders is largely unknown. 18q21.1 . It enco 18q21.1 . TGF-\u03b2/S 18q21.1 . Generou 18q21.1 . SMAD4 mormation -13 sinceormation . Furtherse model . Zhang ese model . HoweverSMAD4) C>T variant significantly increased TAAD risk and correlated with increased aortic diameter. We further detected the impact of other 4 SMAD4 SNPs on TAAD risk, and the potential impact of rs12455792 on SMAD4 expression and cell function [At first, we screened 20 SNPs  using recent Genome-wide associated studies (GWAS) based TAAD reports -18 and Ofunction . But theSMAD4 low expression generally, we constructed the SMAD4 KD mouse and detected the associated pathological progress of thoracic aortic aneurysm and dissection. Our study elucidated the potential mechanism for differences in susceptibility and prognosis of TAAD between patients with CC, CT or TT genotypes. These novel findings may shed light on the role of rs12455792 and SMAD4 in pathogenesis of TAAD and provide a predictive marker for optimizing clinical trial design and individualizing therapeutic plans.Here we identified 5 significant SNPs on the basis of GWAS-based TAAD reports. Among them, rs12455792 was correlated with aortic diameter of patients. We further explored whether rs12455792 contributed to the M\u00d8 recruitment, vascular remodeling and TAAD progression. To mimic the impact of rs12455792 - The demographic characteristics and clinical features of the study participants in screening and validation cohort were listed in P>0.05). Of the 20 SNPs, rs12913975, rs10757278, rs10770612, rs10733710 and rs12455792 were significantly associated with increased TAAD susceptibility, with ORs of 1.489 (P=0.012), 2.006 (P=0.005), 1.767 (P=0.003), 1.412 (P=0.005), 1.585 (P=0.011) adjusting for age and gender, respectively. Among them, the functional SNP rs12455792 C>T variant was correlated with increased aortic diameter of TAAD patients , yielding the most significant results  flag and piggyBac (PB) transposon in exon 8 of SMAD4   . Moreovew to 4w) . As the modeling . Notablyltration .SMAD6), rs10757278 (CDKN2B-AS1), rs10770612 (LINC02398), rs10733710 (TGFBR1) and rs12455792 (SMAD4). Among them, rs12455792 was most associated with thoracic aorta dilatation and was chosen for further analysis. Functional experiments demonstrated that rs12455792 C>T polymorphism activated TGF-\u03b2 signaling, enhanced M\u00d8 recruitment and M1 type inflammatory response, thus facilitated vascular remodeling and pathological progress of TAAD. To the best of our knowledge, this is the first study to demonstrate potential impact of rs12455792 on TGF-\u03b2 signalling, M\u00d8 infiltration and pathogenesis of TAAD.In the present study, we investigated the effects of 20 TAAD risk- related polymorphisms screened by GWAS and OMIM database. There was 5 significant SNP were identified using MALDI-TOF MS in 202 patients and 400 controls, rs12913975  of rs12455792 in  of TAAD . In bioipression . Numerourtopathy -13,15. SSMAD4 low-expression or rs12455792 variant groups. Activation of TGF-\u03b2 signaling always contribute to uncontrolled cell growth and inflammatory response, leading to vascular disorders such as aneurysm [In detection for TGF-\u03b2 signaling molecules, there was an enhanced canonical and non-canonical signaling activation in aneurysm . The reganeurysm ,22. TGF-aneurysm . Of noteSMAD4 low-expression , the first affiliated hospital of Soochow University (Jan. 2010 - Dec. 2016). All subjects were chosen from Han Chinese population of eastern China. 202 cases of screening cohort, 227 cases of validation cohort and 400 healthy controls were included in this study. They have signed the informed consent. The inclusion criteria of sporadic TAAD patients was described in previous report . Controlhttp://www.omim.org/) and Han Chinese data from 1000 Genome Project resources (http://www.1000genomes.org). Among them, 10 SNPs were difficult to detected using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) and excluded, by virtue of homologous interference, hairpin structure, short intervals and so on. All the candidate SNPs meet the following criteria: (1) the minor allele frequency (MAF)>0.05; (2) r2>0.80 for each paired SNPs. Functinal SNPs were bioinformatical analyzed using online tools- rsnp (http://rsnp.psych.ac.cn/) and snpinfo (http://snpinfo.niehs.nih.gov/cgi-bin/snpinfo/snpfunc.cgi).We selected 30 SNPs essential in pathogenesis of TAAD by analyzing GWAS-based TAAD reports -18, OMIMCandidate SNPs were genotyped using MALDI-TOF MS as previously described . BrieflySMAD4 knock-down (KD) mouse were designed and constructed by Biogle . All mice were maintained with C57BL/6J genetic background. Experiments regarding to animal model were performed according to institutional guidelines for laboratory animals. To induce aneurysm formation of TAA model, we chose 10-12w old mice and intraperitoneal injected with Angiotensin II (Ang II)  . All experiments were conducted using both male and female mice. Controls were sex-matched littermates. Four weeks later, mice were sacrificed, and thoracic aortas were histochemistry stained and evaluated.The Mice were anesthetized with 5% isoflurane by Small Animal Anesthesia Ventilator System . The thoracic aortic diameter was evaluated using a Vevo2100 cardiovascular ultrasound system with MS400 (30mHz) microprobe . Echocardiographic detection was performed in B mode. Each experiment was repeated at three times from 10 mice per group.2 pieces, then cultured in 10cm dishes with human SMC medium . Three days after primary culture, HASMCs were spread out from aortic tissues. With growth to 80% confluence, cells were digested by 0.25% trypsin-EDTA and passaged. In the experiments, HASMCs were used in passage 3-8 with at least 95% purity.Primary patients human aortic smooth muscle cells (HASMCs) were isolated from thoracic aorta of TAAD patients who received Bentall procedures. Normal HASMCs was obtained from aorta from patients during aortic valve replacement. In brief, the media of fresh thoracic aortas were tore off and cut into 1mmReal-time PCR was performed on an ABI StepOnePlus\u2122 Real-Time PCR System . The primers used for amplification of chemotactic factors and TGF-\u03b2 molecules were listed in 3) in 100 \u03bcl medium was added into each upper insert, and HASMCs in different group (5\u00d7104) in 500 \u03bcl medium were added into lower chamber. The plate were incubated at 37 \u00b0C, 5% CO2 for 24h. To examine M\u00d8 chemotaxic-migrating to lower chamber, cells was fixed by methanol for 10 minutes, washed, and stained with DAPI. Finally, the images of chmotaxic-migrated M\u00d8 were captured with an inversion fluorescence microscope . M\u00d8 was quantified by counting 10 independent visual fields per group via Image Pro Plus 6.0 software . Each assay was performed in triplicate.M\u00d8 was derived from THP-1 monocytes with 100ng/ml PMA induction for 48h. Cell chemotaxis were measured using 24-well Transwell\u00ae units . One hour before experiment, M\u00d8 was stained with Dil , a bioactive fluorescence probe. HASMCs were stained with Dio . Then, M\u00d8 .To evaluate the pathological performances of TAAD, murine aortas were separated and fixed in the 4% paraformaldehyde after 4w of treatment. Serial paraffin cross section (5 \u03bcm) of murine thoracic aortas were prepared for histological analysis. Aorta sections were stained with eosin and hematoxylin for morphological assessment. Immunostaining of CD86 and polarization markers   was performed to detect M\u00d8 infiltration in frozen sections of human thoracic aortas. The images of immunofluorescence were digitally captured on a Carl Zeiss LSM880 laser scanning confocal microscope . CD68+ Cell numbers or average integral optical density of CD206 and TNF-\u03b1 in the aortic wall were quantitative analyzed from 10 samples per group using Image Pro Plus 6.0 software .t test (for continuous variables) or Chi-square test . The comparisons of cell numbers, mean intergral optical density, lesion areas and so on were using Student's t test (between 2 groups) or One way ANOVA (between more than 2 groups). Hardy\u2013Weinberg equilibrium (HWE) was evaluated using online analytical tools. For analyzing main effect of candidate SNPs, univariate or multivariate logistic regression models were performed to generate ORs and corresponding 95%CIs with adjustment by possible confounders. All statistical tests were two tailed and conducted using Statistical Program for Social Sciences  or R software(http://www.r-project.org/). P value <0.05 was considered statistically significant.Differences of the demographic and clinical features, and frequencies of genotypes in case-control study were tested by Student's Supplementary FiguresSupplementary Tables"}
{"text": "Thiodictyon syntrophicum\u201d strain Cad16T, belonging to the Chromatiaceae, fixes around 26% of all bulk inorganic carbon in the chemocline, both during day and night. With this study, we elucidated for the first time the mode of carbon fixation of str. Cad16T under micro-oxic conditions with a combination of long-term monitoring of key physicochemical parameters with CTD, 14C-incorporation experiments and quantitative proteomics using in-situ dialysis bag incubations of str. Cad16T cultures. Regular vertical CTD profiling during the study period in summer 2017 revealed that the chemocline sank from 12 to 14 m which was accompanied by a bloom of cyanobacteria and the subsequent oxygenation of the deeper water column. Sampling was performed both day and night. CO2 assimilation rates were higher during the light period compared to those in the dark, both in the chemocline population and in the incubated cultures. The relative change in the proteome between day and night (663 quantified proteins) comprised only 1% of all proteins encoded in str. Cad16T. Oxidative respiration pathways were upregulated at light, whereas stress-related mechanisms prevailed during the night. These results indicate that low light availability and the co-occurring oxygenation of the chemocline induced mixotrophic growth in str. Cad16T. Our study thereby helps to further understand the consequences micro-oxic conditions for phototrophic sulfur oxidizing bacteria. The complete proteome data have been deposited to the ProteomeXchange database with identifier PXD010641.The microbial ecosystem of the meromictic Lake Cadagno  has been studied intensively in order to understand structure and functioning of the anoxygenic phototrophic sulfur bacteria community living in the chemocline. It has been found that the purple sulfur bacterium \u201c As an aThiocapsa roseopersicina istrain BBS  and Beggiatoaceae spp.  -hydroxyalkanoicacid synthase subunit PhaE and the phasin PhaP involved in the synthesis of PHB were found. In contrast, among the 17 proteins overexpressed under dark conditions, three enzymes of the dicarboxylate/4-hydroxybutyrate (DC/HB) cycle were detected. However, the absence of the complete set of DC/HB cycle genes in the genome of str. Cad16T indicates that these enzymes are rather involved in the reverse tricarboxylic acid cycle and the last step of the beta-oxidation of fatty acid and PHB granules  reaction center, the membrane-bound protein cascade of cyclic electron transport to generate ATP and reverse electron transport to produce NAD(P)H, and also contains a cbb3 type cytochrome c. The latter may enable microaerobic growth and Fe(III) oxidation of str. Cad16T  to study differences between day and night in the metabolism of PSB str. Cad16T incubated in situ at 12 m in the chemocline of Lake Cadagno and (ii) to monitor the environmental factors longitudinally that could influence the metabolic activity of the chemocline community. In order to quantify differences in metabolic activity, we used a combination of CO2 assimilation analysis using radioactive isotope 14C and label-free quantitation tandem mass spectrometry (LFQ-MS2) based proteomics. Relative light intensity and temperature at the depth of the chemocline were measured constantly and several physicochemical profiles were taken during the period of incubation. The unique micro-oxic in situ conditions measured in summer 2017 were reflected in the carbon assimilation rates and protein profiles obtained and revealed mixotrophy in str. Cad16T.With this study, we aimed at elucidating the microaerobic metabolic mechanisms of PSB in the presence and absence of light, using str. Cad16in situ incubations were performed in Lake Cadagno between 13 July 2017 to 12 September 2017 with dialysis bags attached to a mooring   equipped with temperature, salinity, oxygen and turbidity sensors was used to measure physicochemical profiles from a working platform at the anchor site of the mooring. Profiles from 13 July 2017 were taken as an estimate of chemocline depth (\u22122 s\u22121) were used for the surface and below the water, respectively as in Thimijan and Heins (The th 18 m) . From 13ne depth . HOBO UAne depth . Empiricnd Heins . The HOBWe additionally had access to CTD data from a parallel project from Oscar Sep\u00falveda Steiner and colleagues from EAWAG  where two CTD profiles were taken daily.\u22121.The analysis was performed with the BD Accuri C6 Plus software . Two lasers (488 and 680 nm), two scatter detectors, and two fluorescence detectors (FL3 = 670 nm and FL4 = 670) were used. To exclude abiotic particles a forward scatter threshold of FSC-H 10,000 was applied. A red fluorescent (FL3) threshold above 1,100 was applied to select for cells emitting autofluorescence due to Chl and BChl.Flow-cytometry (FCM) based cell counting was performed as in Danza et al. . In shorC. okenii and GSB C. clathratiforme to be 70 and 15% of the total daily CO2 photo-assimilation, respectively . Cells were grown up to a concentration of around 3 \u00d7 106 cells mL\u22121. Cell concentrations repeatedly were measured by flow cytometry.Str. Cad162CO3 (40 g L\u22121) and 0.01 M EDTA at 60\u00b0C while stirring. The bags were cleaned with ddH2O, cut into 0.6 m long pieces, closed by a knot on one end and autoclaved for 20 min at 121\u00b0C. On site, about 80 mL of bacteria culture (3 \u00d7 106 cells mL\u22121) were filled randomly in each bag, which was closed, attached to a rig and installed in the chemocline within 30 min  were rinsed for 1.5 h in Nan 30 min . In tota14C-radioisotope uptake experiment was performed as in Storelli et al.  were added and thereof, six technical replicates were transferred to 50 mL translucent Duran glass bottles . The bottles were then incubated at a depth of 14 m in a mesh basket on the rig for 4 h during day (1:00\u20134:00 p.m.) and night (9:00 p.m.\u221212:00 a.m.), respectively. Chemocline background fixation rates were determined in 50 mL chemocline samples. Filtered chemocline lake water (0.45 \u03bcm) was used as negative control. Upon retrieval, the amount of \u03b2-activity (14C) assimilated by microbes during the incubation time was measured in the laboratory following standard method that included acidification and bubbling of the samples  running with the WinSpectral v.1.40 software. Raw data was statistically analyzed using t-tests in Excel .Scintillation was done on a 3Merck Spectroquant kit No. 1.01758.0001 and the Merck spectroquant Pharo 100 photospectrometer . Samples were taken at 14 m depth, filtered with 0.45 \u03bcm filters, pH was tested with indicator paper  to lie within 6.8\u20137.0 and triplicate samples were measured.The inorganic dissolved carbon concentration was determined with the CaCOv/v; Thermo Fisher Scientific, Reinach, Switzerland) and frozen at \u221220\u00b0C until further processing.Equal volumes of subsamples were transferred to 50 mL tubes upon retrieval and stored at 4\u00b0C in the dark. They were then brought to the lab within 30 min and centrifuged 10,000 g at 4\u00b0C for 10 min. The supernatant was discarded and the pellets were re-suspended in 1\u00d7 PBS pH 7.0 and 1% EDTA-free Protease Inhibitor Cocktail  and sonicated for 15 min at 200 W at 10\u00b0C with a Bioruptor ultrasonicator . Samples were then shipped to the Functional Genomic Center Zurich (FGCZ) on dry ice for further processing. Protein concentration was estimated using the Qubit Protein Assay Kit . The samples were then prepared using a commercial iST Kit [PreOmics, Germany -analysis.The cells were thawed, lysed in 5% sodium-deoxycholate (w/w) in 100 mM ammonium-bicarbonate buffer containing 1% EDTA-free Protease Inhibitor Cocktail . Initial solvent composition was 0.1% formic acid for channel A and 0.1% formic acid, 99.9% acetonitrile for channel B, respectively. For each sample 4 \u03bcL of peptides were loaded on a commercial Acclaim PepMap Trap Column  followed by a PepMap RSLC C18 Snail Column . The peptides were eluted at a flow rate of 300 nL min\u22121 by a gradient from 5 to 22% B in 79 min, 32% B in 11 min, and 95% B in 10 min. Samples were acquired in a randomized order. The mass spectrometer was operated in data-dependent mode (DDA), acquiring a full-scan MS spectra  at a resolution of 70,000 at 200 m/z after accumulation to a target value of 3,000,000, followed by HCD (higher-energy collision dissociation) fragmentation on the twelve most intense signals per cycle. HCD spectra were acquired at a resolution of 35,000, using a normalized collision energy of 25 a. u. and a maximum injection time of 120 ms. The automatic gain control (AGC) was set to 50,000 ions. Charge state screening was enabled and singly and unassigned charge states were rejected. Only precursors with intensity above 8,300 were selected for MS2 (2% underfill ratio). Precursor masses previously selected for MS2 measurement were excluded from further selection for 30 s, and the exclusion window was set at 10 ppm. The samples were acquired using internal lock mass calibration on m/z 371.101 and 445.120.MS2 data were processed by MaxQuant v.1.4.1.2 (RRID:SCR_014485), followed by protein identification using the integrated Andromeda search engine. Each file was kept separate in the experimental design to obtain individual quantitative values. Spectra were searched against a forward str. Cad16T database , concatenated to a reversed decoyed fasta database and common protein contaminants . Carbamidomethylation of cysteine was set as fixed modification, while methionine oxidation and N-terminal protein acetylation were set as variable. Enzyme specificity was set to trypsin/P allowing a minimal peptide length of 7 amino acids and a maximum of two missed-cleavages. Precursor and fragment tolerance was set to 10 ppm and 0.05 Da for the initial search, respectively. The maximum false discovery rate (FDR) was set to 0.01 for peptides and 0.05 for proteins. Label free quantification was enabled and for the quantification across multiple run-files the \u201cmatch between runs\u201d option with a retention time window of 2 min was enabled. The re-quantify option was selected. For protein abundance, the intensity (Intensity) as expressed in the protein groups file was used, corresponding to the sum of the precursor intensities of all identified peptides for the respective protein group. Only quantifiable proteins (defined as protein groups showing two or more razor peptides) were considered for subsequent analyses. Protein expression data were transformed (hyperbolic arcsine transformation) and missing values (zeros) were imputed using the missForest R-package v.1.4  was used to validate MS2 based peptide and protein identifications. Peptide identifications were accepted if they could be established at >42.0% probability to achieve an FDR <0.1% by the Peptide Prophet algorithm with Scaffold  t-test on transformed protein intensities (hyperbolic arcsine transformation). Proteins were called significantly differentially expressed if linear fold-change exceeded Two-fold and the q-value from the t-test was below 0.01.Scaffold v.4.8.4  and eggNOG v.4.5.1  were used to classify the proteins into functional categories. The complete KEGG-dataset for str. Cad16T can be found under KEGG PATHWAYThiodictyon syntrophicum).BlastKOALA v.2.1  was measured. At 12.4 m depth, a mean of 1.3 \u03bcmol quanta m\u22122 s\u22121 (0.04\u20137.8) was registered (a profiles in the daily CTD profiles indicated that the chemocline had been sinking from 12 to 13\u201314.5 m depth (\u22122 s\u22121 (0.2\u20134.0) was measured at 14 m depth from 24 August to 13 September 2017, and no light was measured at 14.4 m depth after 23 August 2017. Temperature was stable around 5\u00b0C (4.6\u20136.1) at both incubation depths with a positive trend over the months (Fluctuations in the relative light intensity were positively correlated with the measured surface radiation and negatively associated with cloud cover . Daily rgistered . Within  m depth . To ensue months .\u22121 (265.6 \u03bcM) throughout the mixolimnion. From 7 to 9.5 m depth, DO-concentrations steadily declined to 6 mg L\u22121, and then more rapidly to 2 mg L\u22121 at 10.5 m depth, at both time points measured. At 14 m depth, 0.4 mg L\u22121 (12.5 \u03bcM) and 0.3 mg L\u22121 (9.4 \u03bcM) dissolved oxygen were measured during day and night, respectively. Conductivity increased along the profile from 0.13 in the mixolimnion to 0.22 mS cm\u22121 hypolimnion, both at day and night. In contrast, a pronounced turbidity peak (28 FTU) was observed at a depth of 13 m at 1:30 p.m. whereas a broader distribution of the FTU values (6\u201316 FTU) from 13 to 14 m depth, with a maximal peak of 18 FTU at 13 m, was observed at 9:00 p.m. Water samples taken at 1:30 p.m. and 9:00 p.m. from 14 m depth showed a milky and pink coloration, characteristic for a concentrated PSB at high FTU values. The total inorganic dissolved carbon concentrations measured at 14 m depth were 1.26 mM at 1:30 p.m. and 1.46 mM 9:00 p.m.Physicochemical measurements and endpoint-sampling was done on the 12 and 13 September 2017. The weather was cloudless with weak wind. Two CTD profiles at 1:30 p.m. and 9:00 p.m. showed a comparable situation for temperature, dissolved oxygen and conductivity . Water tT cell concentrations were on average 3.1 \u00d7 106 cells mL\u22121 in July, as measured by flow cytometry. The rigged cultures were checked on 23 August 2017 and all dialysis bags were found intact and cells were judged healthy due to the turbid-pinkish appearance. When retrieved for sampling on 12 September 2017, all dialysis bags were still intact, the population was uniformly distributed within the dialysis bags and the cells grew to a mean concentration of 9.3 \u00d7 106 cells mL\u22121. In total, the number of str. Cad16T cells increased three-fold from July to September.Initial str. Cad165 cells mL\u22121 at 1:30 p.m., whereas it was 2.73 \u00d7 105 cells mL\u22121 at 9:00 p.m., corresponding to 33.4 and 23.5% of the total events count by FCM, respectively. Moreover, FCM revealed that the phototrophic microbial community at 1:30 p.m. consists mainly of C. okenii, Chlorobium sp., and cyanobacteria spp. with 1.31 \u00d7 105, 1.49 \u00d7 105, and 1.57 \u00d7 105 cells mL\u22121, representing 10.3, 11.8, and 12.4% of the total cell counts, respectively. At 9:00 p.m. the population at 14 m was found to consist of 5.37 \u00d7 104 cells mL\u22121C. okenii, 9.82 \u00d7 104 cells mL\u22121Chlorobium sp. and 1.03 \u00d7 105 cells mL\u22121 with 4.6, 8.5, and 8.9% of all phototrophic cells, respectively. Together C. okenii and Chlorobium sp. corresponded to the 66.1 and 55.7% of the total anoxygenic phototrophic sulfur bacteria cells, during the day and at night, respectively. No significant difference in total cell concentration and internal complexity was measured between the two sampling groups (P = 0.74).The average concentration of phototrophic cells in the lake sample taken at 14 m (12 September 2017) was 4.23 \u00d7 10\u22121, respectively  during the day, and 834 amol C cell\u22121 h\u22121  during the night  and Cad16T_dia_12 (\u201cdark\u201d) were identified as outliers in cluster analysis and were excluded from further data analysis. Therefore, the data analysis was made with four samples of the category \u201clight\u201d and five samples of the category \u201cdark.\u201d Overall a total of 1,333 proteins\u201421% of the total protein coding sequences\u2014with at least two peptides were identified.A total of 11 samples, five samples for light period and six samples for the dark period, were processed for quantitative bottom-up proteomics and protein quantification was performed using the MaxQuant package. We used corrected Peptide identifications were accepted if they could be established at >42.0% probability to achieve a false discovery rate (FDR) <0.1% with Scaffold delta-mass correction, resulting in 12,576 spectra included. Protein identifications were accepted if they could be established at >54.0% probability to achieve a FDR <1.0% and contained at least two identified peptides. The number of quantified proteins per condition was similar, with an average of 374 for the day and 354 for night period, respectively. Between 102 and 663 proteins were quantified in each biological replicate . Consequently, 684 proteins were quantified over all samples. Thereof, 21 contaminants were excluded. The remaining 663 proteins were classified with blastKOALA and EggNOG, with 627 annotated proteins for (99%) COG and 460 annotated proteins (69.4%) for blastKOALA, respectively.0F1 ATPase subunits  and chaperons . Since cell growth depends on protein synthesis, we found 36 ribosomal subunits as well as elongation factor Tu (AUB80476.1) to be equally abundant. The cells always contained the established components of the dissimilatory sulfide oxidation pathway such as ATP-sulfurylase Sat (AUB82369.1), the adenylylsulfate reductase AprAB , and the dissimilatory sulfite reductase (Dsr) complex (AUB83448.1\u2013AUB83455.1). A Sqr sulfide:quinone reductase and a glutathione amide reductase GarA homolog to A. vinosum putatively involved in intracellular sulfur shuttling  and PuhA (AUB85431.1) subunits forming the reaction center II and six different PufAB antenna proteins  were expressed.As expected, many of the proteins with unchanged abundance belonged to the functional categories energy conversion, genetic information processing, carbohydrate and amino metabolism and protein modification . Among tcbb3 cytochrome c oxidase subunits. PSB use the ATP and NAD(P)H derived from photosynthesis to fix CO2 through the CBB cycle. For str. Cad16T a complete CBB cycle with the key enzymes CbbM/RbcL RuBisCO form II (AUB81831.1) and phosphoribulokinase PrkB (AUB79979.1) were present. The fixed carbon enters the central carbon metabolism as 3-phospho-D-glycerate. In both growth conditions, str. Cad16T contains enzymes for glycolysis and gluconeogenesis, as well as pyruvate oxidation, the glyoxylate cycle and the citrate cycle (TCA) in unvaried abundance. Additionally, the presence of malic enzyme  may allow the entry of malate into the central carbon pathway via pyruvate, as shown for A. vinosum. In both conditions examined, the PHB synthase subunits PhaC and PhaE are expressed (AUB80707.1 and AUB84676.1). Also enzymes necessary for amino acid biosynthesis and Co-factor and vitamin synthesis were expressed under both groups analyzed.Additionally we found enzymes for BChl synthesis, terpenoid backbone biosynthesis, and carotenoid synthesis. Noteworthy, elements of the reduction pathways driven by photosynthesis are shared with oxidative phosphorylation in PSB. We found in total 23 protein subunits involved in substrate respiration including the NADH dehydrogenase subunits NuoCDEFG and HoxFU, the cytochrome reductase CytB and Cyt1, seven F-type ATPase subunits and two t-test on transformed protein intensities (q.mod <0.01). The expression dataset was alternatively analyzed using correlation-adjusted t-scores (CAT scores) in order to additionally address the correlative structure of the dataset as only 4.5% of the proteins are differentially expressed. Sixty proteins were found differentially expressed  at a local false discovery rate of lfdr <0.05  corrected dr <0.05 , 3.T. Thereof, all protein-coding sequences were annotated with eggNOG . Additionally, chaperone-type proteins DnaJ and proteolytic ClpX were also over-expressed. During the night period 39 proteins were shown to be more abundant and thereof 35 entries (89%) were successfully annotated to COG categories with eggNOG (T further expressed proteins associated to cell division (FtsZ), cell wall formation CpxP, Lysine and branched amino acid synthesis and nucleotide metabolism . Elements of two secretion pathways were identified, a putative polar amino acid transport system and type II general secretion system. Additional three proteins detected to be more abundant in the dark are involved in stress response. The BolA-family transcriptional regulators, is a general stress-responsive regulator. Rubrerythrin may provide oxidative stress protection via catalytic reduction of intracellular hydrogen peroxide and a ATP-dependent serine protease mediates the degradation of proteins and transitory regulatory proteins, and ensures cell homeostasis.During the day period 21 proteins were found relatively more abundant for str. Cad16h eggNOG . In presh eggNOG . Analysih eggNOG . Str. CaT through a combination of longitudinal monitoring of physicochemical conditions, FCM counts of the microbial population, 14C-radioisotope uptake and quantitative proteomics of cultures incubated in situ in the Lake Cadagno chemocline.We compared light to dark carbon fixation metabolism under micro-oxic conditions of PSB str. Cad162 L\u22121 (19 \u03bcM) below a depth of 12 m. The chemocline also retained some of the produced oxygen through the night  sunk from around 12\u201314 m depth. Taken together, a dense microbial population inflicted increased self-shading below a depth of around 14 m. For this reason, we decided to lower the dialysis bags from 12 to 14 m at the 23 August 2017. Subsequently, the average light availability measured at the chemocline was 10\u00d7 lower than previously recorded at 12 m  and at night  previously obtained for Lake Cadagno, respectively    and was as such 8\u00d7 longer than observed in vitro at room temperature  seems to be the main carbon storage regulator where it was detected under both conditions. Glycolysis under mixotrophic conditions might thereby be regulated through mRNA transcription and stability as in A. vinosum  and CysP (AUB80377.1) and oxidation to sulfite via the intermediate S-sulfocysteine by cysteine synthase B CysM (AUB82938.1) and possibly monothiol glutaredoxin of the Grx4 family (AUB83488.1) as suggested by Dahl (Additionally, str. Cad16 by Dahl . HoweverT is metabolically flexible in situ and growths phototrophically as well as chemotrophically in the light as shown in this study. In dark conditions, low levels of oxygen may enable respiration of different small organic molecules. In summary, the 60 proteins found differentially expressed between night and day period represent only about 1% of all protein coding sequences and about 5% of the identified proteins. Therefore, their impact on metabolic pathways of str. Cad16T is unclear and has to be further examined. In wider perspective, the role of PSBs in large water bodies has to be studied in more detail as we demonstrated that that low levels of oxygen can be used for respiration. As for other stratified lakes it was found that after a bloom of PSB anoxia can prevail (Bush et al., T to mixotrophy.PSB str. Cad16SL, NS, FD, JP, and MT conceived the study. SL, NS, FD, and SR installed the mooring and performed field measurement and sampling. NS and FD prepared scintillation samples. FD and NS did flow cytometry cell enumeration. SL extracted total protein and performed scintillation measurements. SL, MW, JP, and MT analyzed physicochemical, proteomic, and scintillation data. SL, NS, FD, and MT prepared the manuscript. All authors contributed to writing and agreed on the manuscript before review.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "The objective of this study was to evaluate the effects of glycolic acid (GA) (with pH 1.2 and 5) and ethylenediaminetetraacetic acid (EDTA) on the chemical and mechanical properties of dentin to investigate the potential use of GA as final irrigant in the root canal therapy. Specifically, changes in microhardness, smear layer removal, erosion, mineral content distribution, apatite/collagen ratio and flexural strength of mineralized dentin treated with GA were assessed. Saline solution was used as a negative control. Knoop microhardness (KHN) was measured on the root canal lumen of root segments. Dentin beams were used for 3-point flexural strength (\u03c3) test. Scanning electron microscopy (SEM) images of root sections were obtained for evaluation of smear layer removal and dentin erosion on root segments and energy dispersive X-ray spectroscopy (EDS) was used for mineral content distribution. The apatite/collagen ratio (A/C) in dentin powder were examined by Fourier transform infrared (FTIR) spectroscopy. KHN, \u03c3 and A/C results were statistically analyzed with ANOVA and Tukey tests (\u03b1\u2009=\u20090.05). Smear layer and dentin erosion scores were analyzed with Kruskal-Wallis and Dunn tests (\u03b1\u2009=\u20090.05). Root dentin treated with EDTA and GA presented similar KHN regardless of the pH (p\u2009>\u20090.05). However, KHN was significantly reduced in EDTA and GA groups when compared to control group (p<0.001). GA showed the same ability to remove the smear layer and to cause dentin erosion as EDTA. EDS results showed that the GA and EDTA solutions did not alter the dentin mineral content distribution. The apatite/collagen ratio reduced with all irrigant solution and was the lowest with GA pH 5 (p<0.001), while \u03c3 was not significantly affected by the experimental solutions (p\u2009=\u20090.559). It can be concluded that GA has similar ability to remove the smear layer than EDTA. GA does not affect negatively the chemical/mechanical properties and it does not increase dentin erosion. The use of GA with low pH seems to promote less change in collagen/apatite ratio, but further studies are needed to establish an ideal clinical protocol. Therefore, this study supports the potential use of GA as an alternative final irrigation solution for root canal preparation. However, this step results in the deposition of a smear layer on the root canal walls. The presence of the smear layer keeps bacteria and their byproducts in the root dentin, hinders the penetration of intracanal disinfectants and cements into the dentinal tubules, and decreases the sealing capacity of root canal sealers2. Therefore, smear layer removal during chemical and mechanical preparation of root canals has been proposed by the use of final irrigants. Different final irrigant solutions such as citric acid, MTAD , etidronate and ethylenediaminetetraacetic acid (EDTA) are used for removal of the smear layer, being the EDTA still the most widely well-known in endodontics3.The main purpose of the root canal preparation is cleaning and disinfection by using endodontic files and root canal irrigants3, it has unfavorable features such as denaturation of collagen fibrils4 and peritubular and intertubular dentin erosion when used for more than three minutes3. These mineral changes in root canal dentin could have an effect on the adhesive properties of the dentin surface and reduce root canal sealing5. Furthermore, extrusion of EDTA solution beyond the apical foramen should be avoided because of its cytotoxicity6. Another important factor is that EDTA is produced on an industrial scale from ethylenediamine, formaldehyde, and sodium cyanide leading to the formation of contaminants that are considered some of the important pollutants dispensed in water7. Thus, EDTA plays a part in aquatic toxicity and may cause chronic effects, including the disequilibrium of body calcium in other organisms8. The investigation of alternative final irrigants that are biocompatible, effective in removing the smear layer without causing damage to the root dentin structure and properties is needed to ensure success of the root canal therapy.However, an effective final irrigant solution must act only on superficial dentin removing the smear layer without causing damage to the internal portion of the root dentin. Although EDTA has good capacity of smear layer removal9. GA is found in concentrations of 2 to 10% in dermocosmetics and used in higher concentrations for chemical peeling (from 20 to 70%)10. In dentistry, recent studies showed GA to be suitable for enamel and dentin etching in restorative procedures and as efficient as EDTA in removing smear layer from root canals walls12. In addition, cytotoxic results indicated that GA has less toxic effects on fibroblasts when compared to EDTA13. Furthermore, GA showed pH stability for 90 days when stored at 4, 25 and 37\u2009\u00b0C, which may facilitate its clinical use in endodontics, and did not promote alterations in dentin flexural strength14. Due to its positive characteristics, and considering the need for biologically compatible endodontic materials and substances, GA may be a suitable agent to remove the smear layer from the root canal walls with minimal negative biological effects.The glycolic acid (GA) is an alpha hydroxy acid (AHA) extracted from sugar cane and other sweet vegetables. It is uncolored, odorless, has only two carbons in its molecular structure, and can be easily dissolved in water. GA is commonly used in dermatology for applications that range from skin moisturizing to deep chemical peeling, a common esthetic procedure. As the smallest AHA, GA has great penetration potential and its absorption on skin and mineral surfaces is faster than other AHA14. However, its application in endodontics relies on the establishment of a clinical protocol that details the concentration, pH, and irrigation time. The objective of the present in vitro study was to evaluate the effects of irrigation with 17% GA used with different pH (1.2 or 5.0) compared to 17% EDTA  on their capacity of smear layer removal from the root canals, changes in erosion, microhardness, mineral content distribution, apatite/collagen ratio and flexural strength of mineralized dentin. The tested null hypotheses were: (1) the 17% EDTA and 17% GA have similar capacity to remove the smear layer in all root canal thirds, regardless of the pH values of GA (1.2 or 5.0); and (2) there is no significant change on chemical and mechanical properties of root dentin when using 17% EDTA or 17% GA, regardless of the pH values.Previously published studies from our research group suggest the use of GA as a final irrigant in the root canal therapy, since it demonstrated ability to remove the smear layer without negatively affecting the dentin properties when used at low pH (around 2)Tables\u00a0The mean and standard deviation of the KHN values, flexural strength and apatite/collagen ratio of the experimental groups are presented in Table\u00a0Figure\u00a0Table\u00a0The erosion scores for the experimental groups are summarized in Table\u00a0Figure\u00a0In order to evaluate whether the irrigation with GA at acidic or neutral pH is effective in removing the smear layer and its potential effects on dentin surface integrity and chemical/mechanical properties when compared to EDTA, the pH values of 1.2 and 5.0 for GA were tested in the present study. The ability to remove the smear layer of EDTA was similar to GA at both pH values in each root third evaluated, so the first null hypothesis was accepted. Considering the chemical and mechanical properties evaluated in the present study, EDTA and GA irrigants caused significant reduction on the dentin microhardness, showed similar potential to promote erosion of root dentin walls, and no clear differences were noted in mineral composition on dentin surface. However, when comparing the collagen/apatite ratio, the most significant change was observed for GA at pH 5. Therefore, the second null hypothesis was rejected.15. EDTA has the ability to combine with calcified components of dentin through a chelating mechanism resulting in demineralization and softening of tissue15. GA also showed significant reduction in microhardness than the control group, with similar changes regardless of the solution pH. GA has shown potential to demineralize dentin and remove smear layer in previous studies. When used as an etchant for smear layer removal prior to application of etch-and-rinse adhesive system, GA showed decrease of dentin microhardness comparable to phosphoric acid and ability to promote adequate bond strength11. In the same previously published study, GA was less aggressive in promoting enamel demineralization than PA11. Overall, irrigant solutions that present ability to remove the smear layer facilitate the access and action of endodontic instruments until the apical foramen, which is critical in narrow and calcified root canals15, but may cause reduction of dentin microhardness. Nevertheless, this reduction caused by the final irrigants does not seem to be detrimental to the fracture resistance of endodontically treated teeth16 when these solutions are used for a short period inside the root canal. For example, the resistance to fracture of endodontically treated roots significantly decreased when 17% EDTA persisted for 10\u2009minutes or more inside the root canal17. Different irrigation time with GA should be explored in future studies and its clinical application should consider short irrigation time as proposed for EDTA.The decrease of dentin microhardness values promoted by EDTA compared to control  is in agreement with other studieset al.14. On the other hand, when comparing EDTA and GA with saline solution (control group), there were significant changes in the apatite/collagen ratio. These findings are agreement with others and support the hypothesis that the use of NaOCl prior EDTA and GA may promote collagen degradation and/or extraction and lower the apatite/collagen ratio18. Although is expected that this collagen degradation would also affect the mechanical property, the low concentration of NaOCl used in the present study (2.5%) might have resulted in less collagen breakdown, not enough to significantly reduce the flexural strength when compared to the control group, as previously suggested19. When comparing the FTIR spectra among the groups, the most significant changes are observed for the GA pH 5  and teeth collection were performed in accordance with relevant guidelines and regulations as per the ethical and research board committee instructions. All teeth were obtained from the teeth biorepository of the School of Dentistry of the University of Passo Fundo under informed consent of the patients. After the extraction, the teeth were stored at 4\u2009\u00b0C in 0.9% NaCl solution and were used within 1-month period.For the treatment of dentin samples, the GA  was used at pH 1.2 and pH 5.0. To obtain GA solution at higher pH (5.0), a neutralizing agent, aminomethyl propanol, was used. As a positive control, 17% EDTA  was selected as the conventional final endodontic irrigant. Saline solution was used to treat samples in the negative control group.The dentin surface demineralization was indirectly assessed by the microhardness test. The smear layer removal capacity and dentin erosion were evaluated by analyzing images obtained with Scanning Electron Microscopy (SEM). The analysis of mineral dentin distribution was assessed using Energy-Dispersive X-ray Spectroscopy (EDS). The apatite/collagen ratio and flexural strength of mineralized dentin were evaluated by Fourier-transform infrared spectroscopy (FTIR) and flexural strength test, respectively.Twenty canine human teeth were sectioned transversely below the cementum-enamel junction producing 15-mm-long root segments. Thereafter, the roots were sectioned longitudinally in two, creating 40 specimens from the buccal and lingual segments. Each root specimen was embedded in self-curing acrylic resin, leaving the root canal dentin exposed on the surface. The dentin surfaces were then flattened using silicon carbide paper  under constant water irrigation, and polished using a suspension of 0.1-mm alumina on a rotating felt disc.In the negative control group (10 root segments), dentin surfaces were irrigated only with a saline solution. Dentin specimens in the other three groups (30 root segments) were irrigated with 2\u2009ml of 2.5% sodium hypochlorite (NaOCl) for 1\u2009min, followed by irrigation with 5\u2009ml of saline solution and randomly divided according to the final irrigant (n\u2009=\u200910): 17% EDTA, 17% GA at pH 1.2, and 17% GA at pH 5. All final irrigations were performed with 2\u2009ml of solution for 1\u2009min. Finally, all samples were rinsed with 5\u2009ml of saline solution.15. The values were averaged to generate one hardness value per specimen. Microhardness data showed normal distribution using the Shapiro-Wilk Normality and Equal Variance tests . Data were statistically analyzed using one-way analysis of variance (ANOVA) and Tukey\u2019s post-hoc test for multiple comparison (\u03b1\u2009=\u20090.05).Dentin microhardness was measured using a Knoop indenter with 40\u00d7 magnification  under a 25-g load and a dwell time of 15\u2009s. Three indentations were performed on each specimen along lines parallel to the edge of the root canal in the apical direction. The first indentation was performed at 1.000\u2009\u00b5m distance from the entrance of the root canal, and the other two indentations were performed at a distance of 200\u2009\u00b5m from each other21.The chemical-mechanical preparation of 40 mandibular first premolar roots was performed using nickel-titanium rotatory instruments  following the manufacturer\u2019s recommendations. The sequence of files used was X1, X2, and X3 at a speed of 300\u2009rpm and torque of 2\u2009N until the working length was achieved. At each change of instruments, the root canal was irrigated with 2\u2009ml of 2.5% NaOCl. Thereafter, the 40 roots were randomly divided into four groups and the final irrigation was performed with 2\u2009ml of the experimental solutions as previously mentioned. The solutions were applied inside the root canal as follows: 29-gauge needles  were inserted up to 3-mm short of the working length and the test solution was introduced until it fully filled the root canal. The test solution was inserted using up-down movement and remained within the root canal for one minute. Final irrigation was made with 5\u2009ml of saline solution, and the canals were dried using absorbent paper cones21. Two blinded independent investigators analyzed the presence or absence of the smear layer and verified root dentin erosion on the respective areas. The Kappa coefficient test showed a high agreement between the investigators regarding the interpretation of erosion scores (k = 0.876).Thereafter, the 40 roots were divided into two halves resulting in 80 halves (20 in each group). The specimens were dehydrated using increasing concentrations of ethanol . Each half root was mounted on metal stumps, covered with palladium gold , and examined using SEM . Images were obtained to observe the morphology of the surface of the canal wall at 2000\u00d7 magnification and 20\u2009kV along the coronal (10\u201312\u2009mm from the apex), middle (6\u20137\u2009mm from the apex), and apical (1\u20132\u2009mm apex) thirds of each specimen27: Score 1: no smear layer, dentinal tubules wide open; Score 2: small quantity of smear layer, some dentinal tubules open; Score 3: homogenous smear layer covering the root canal wall, only few dentinal tubules open; Score 4: entire root canal wall covered by a homogenous smear layer, no open dentinal tubules; and Score 5: heavy, non-homogenous smear layer covering completely the root canal wall. The images were classified according to the following specification for dentin erosion23: Score 0, smear layer covering almost all dentin surface, with few or no open tubules; Score 1, no erosion: all tubules without alteration in appearance and dimension; Score 2, moderate erosion: the peritubular dentin was eroded; and Score 3, strong erosion, the intertubular dentin was destroyed and the tubules were connected to each other.For the smear layer analysis the following criteria was usedSmear layer and dentin erosion data were determined to be non-parametric based on the Shapiro-Wilk Normality test (p<0.001). Therefore, data were analyzed with Kruskal-Wallis test and Dunn\u00b4s Method (\u03b1\u2009=\u20090.05), and results were presented using medians and quartiles (to represent data dispersion).The same specimens prepared in the previous test  were used for the evaluation of surface mineral content. The entire area of the dentin matrix was visualized using SEM at a standard magnification of 200\u00d7 (650\u00d7420\u2009\u00b5m), and analyzed using EDS to determine the atomic ratio (at. %) of calcium (Ca), phosphorus (P), sodium (Na), chlorine (Cl), and magnesium (Mg). Changes in the mineral levels were recorded and differences among the groups were qualitatively analyzed.13.Twenty non-carious extracted human mandibular third molar teeth were selected for this test. Enamel and cementum were removed from the teeth using a diamond bur #2215 in a high-speed handpiece under refrigeration. Dentin powder (90\u2009\u00b5m) was obtained with a high-speed handpiece and diamond bur #3145\u2009F without refrigeration. The powder went through a 90\u2009\u00b5m sieve, so the dentin grains were equal to or smaller than this size. The dentin powder was divided in four groups of 9\u2009mg each. One group remained untreated (NT), and the other three groups were rinsed with the GA and EDTA solutions. For irrigation, dentin powder was placed over a filter paper and fixed on a glass Becker. Irrigation was performed with 5\u2009ml of the experimental solutions using a 25\u00d74\u2009mm needle for 1\u2009min. After irrigation, the powder was washed three times with 5\u2009ml of deionized water to remove residue of the experimental solutions and air-dried at 37\u2009\u00b0C\u22121 resolution, using 48 scans . The IR spectrum is produced as a result of the absorption of electromagnetic radiation at frequencies that correlate to the vibration of chemical bonds within a molecule. Thereby, when IR radiation is absorbed by an organic molecule, it is converted into molecular vibration energy, and the spectrum portray the vibrational motion and usually appears in the form of bands28. The range for the characterization of organic compounds is mid-IR (4000 to 400\u2009cm\u22121)29.FTIR spectra of the dentin powder were collected for each group (n\u2009=\u20093). Spectra were obtained between 650 and 4000\u2009cmApatite/collagen ratios derived from FTIR spectroscopy showed normal distribution using the Shapiro-Wilk Normality test (p\u2009=\u20090.882) and Equal Variance test (p\u2009=\u20090.419). Data were statistically analyzed using one-way ANOVA and Tukey\u2019s post-hoc test for multiple comparison (\u03b1\u2009=\u20090.05).13. Two beams were obtained from each tooth, totaling 40 beams, which were randomly divided into four groups (n\u2009=\u200910) following the same irrigation protocols previously mentioned.Twenty human mandibular third molars were used for the flexural strength test. Mid-coronal dentin disks were cut perpendicular to the longitudinal axis of each tooth with a slow-speed diamond saw under constant water-cooling. The disks were trimmed to a final rectangular-shaped beam 2, where P\u2009=\u2009load at fracture (N), L\u2009=\u2009length of support span (mm), b = beam width (mm)13.Flexural tests were conducted using a three-point flexure device with a 3-mm support span. The specimens were tested at a crosshead speed of 0.5\u2009mm/min using a universal testing machine . Flexural strength (in MPa) was calculated using the following equation: 3PL/2bdFlexural strength data was normally distributed as observed in the Shapiro-Wilk Normality test (p\u2009=\u20090.05) and Equal Variance test (p\u2009=\u20090.405). Data were statistically analyzed using one-way ANOVA and Tukey\u2019s post-hoc test for multiple comparison (\u03b1\u2009=\u20090.05)."}
{"text": "N-acetyl-para-amino phenol , which is commonly used for its analgesic and antipyretic properties may lead to hepatotoxicity and acute liver damage in case of overdoses. Released cytokines and oxidative stress following acute liver damage may affect other organs\u2019 function notably the diaphragm, which is particularly sensitive to oxidative stress and circulating cytokines. We addressed this issue in a mouse model of acute liver injury induced by administration of APAP. C57BL/6J mice (each n\u2009=\u20098) were treated with N-acetyl-para-amino phenol (APAP) to induce acute drug caused liver injury and sacrificed 12 or 24\u00a0h afterwards. An untreated group served as controls. Key markers of inflammation, proteolysis, autophagy and oxidative stress were measured in diaphragm samples. In APAP treated animals, liver damage was proven by the enhanced serum levels of alanine aminotransferase and aspartate aminotransferase. In the diaphragm, besides a significant increase in IL 6 and lipid peroxidation, no changes were observed in key markers of the proteolytic, and autophagy signaling pathways, other inflammatory markers and fiber dimensions. The first 24\u00a0h of acute liver damage did not impair diaphragm atrophic pathways although it slightly enhanced IL-6 and lipid peroxidation. Whether longer exposure might affect the diaphragm needs to be addressed in future experiments. APAP is highly used due to its analgesic and antipyretic properties and while safe and effective at therapeutic doses, its overdose may lead to hepatotoxicity and acute liver damage. At therapeutic doses, most of APAP is metabolized by phase II conjugating enzymes and excreted as a non-toxic compound. The remaining APAP is degraded via the cytochrome p-450 system into a more toxic substance, N-acetyl-p-benzoquinone imine, whose toxic action can be prevented by glutathione2. In APAP overdose, glutathione scavenger reserves fade and, once depleted, the toxic metabolite damages liver cells, especially mitochondria where it leads to mitochondrial membrane permeabilization and dysfunction3.Drug-induced liver injury represents a serious problem growing in prevalence and importance. Acute liver damage is induced by several toxic agents, of which N-acetyl-para-amino phenol  is the most common drug responsible for toxic liver injury5. In acute damage, the liver releases cytokines into the circulation5 and secondarily may influence other organs\u2019 function and biology.Hence, acute liver injury can end as a systemic disease with decreasing liver synthesis and detoxification function and increasing cytokine production. Several authors pointed to the fact that acute liver injury is probably not an entity that remains limited to the liver7 and diaphragm weakness with muscle atrophy through activation of several proteolytic pathways and autophagy has been reported in situations associated with enhanced circulating cytokines and/or oxidative stress9.The diaphragm is particularly sensitive to oxidative stress and circulating cytokinesWe therefore hypothesized that acute liver injury may affect the diaphragm and induce atrophic signaling via protease-based proteolysis and autophagy. This issue was addressed in a mouse model of acute liver injury induced by administration of APAP.The study was approved by the appropriate governmental institution  which granted the ethical approval for this study. The study was conducted in accordance with the principles for care and use of animals based on the Helsinki Declaration and the ARRIVE criteria.11. Briefly, after a fasting period of 12\u00a0h, the animals received 250\u00a0mg/kg of APAP  by a single i.v. injection into a tail vein. After sacrifice, diaphragm was removed quickly and further processed (see below). Alanine aminotransferase (ALT) and aspartate aminotransferase activity (UV test at 37\u00a0\u00b0C) was measured in serum .C57BL/6J mice were housed under specific pathogen free conditions  and were divided into 3 groups (each n\u2009=\u20098): (1) acute liver injury sacrified at 12\u00a0h (APAP12), (2) acute liver injury sacrified at 24\u00a0h (APAP24), (3) an untreated control group (CTRL). Acute liver injury was induced as described in detail beforeDiaphragm strips were longitudinally embedded in formalin and cut in 10\u00a0\u00b5m thin slides. Staining was performed using hematoxylin and eosin as routine laboratory staining. Around 50 fibers of 3 animals of each group were used for assessment of cross-sectional areas using Image J software .\u22121) in 5\u00a0mmol Tris\u00b7HCl and 5\u00a0mmol EDTA buffer (pH at 7.5) containing a protease inhibitor cocktail  and centrifuged at 1500\u00d7g for 10\u00a0min at 4\u00a0\u00b0C. After collection of the resulting supernatant, diaphragmatic protein content was assessed by the method of Bradford12, . Proteins were detected with Chemiluminescent Peroxidase Substrate , imaged with the Proxima 2850T imaging system  and analyzed using the TotalLab 1D software .Diaphragm tissue samples were homogenized 1:10 (weight volumeAutophagosome formation was assessed by measuring the conversion of LC3B-I to LC3B-II via immunoblotting. Proteins were separated on a 12% polyacrylamide gel and transferred onto a polyvinylidene fluoride (PVDF) membrane. Blots were incubated overnight at 4\u00a0\u00b0C with the primary antibody  and subsequently with the appropriate secondary antibody  for 1\u00a0h at room temperature. Data were expressed as LC3B-II/LC3B-I ratio.Upstream signaling via Phosphatidyl-inositol-Kinase-3 (Pi3K) and Protein kinase B (AKT) was also measured by detecting the phosphorylated and non-phosphorylated form of Pi3K  and of Protein kinase B . Data were expressed as ratio between phosphorylated to total (non-phosphorylated) protein.13. The cleavage product of intact \u03b1II-spectrin by calpain gives a band at 150\u00a0kDa and a band at 120\u00a0kDa when cleaved by caspase-3 while intact \u03b1II-spectrin is detected at 260\u00a0kDa14. Active Caspase 3 was measured with their cleaved forms .In vivo calpain-1 and caspase-3 activities were indirectly assessed, by measuring cleavage of \u03b1II-spectrin, a specific substrate for both calpain-1 and caspase-3. After separation of the proteins on a 10% polyacrylamide gel and transfer to PVDF membrane, the blot was incubated with the primary antibody against \u03b1II-spectrin  and the suitable secondary antibody . Activities of calpain and caspase-3 were measured as the ratio between the densitometric values of their breakdown products to intact \u03b1II-spectrinThe activation of E3 ligases Atrogin and MURF-1 as markers of the ubiquitin\u2013proteasome pathway was investigated by Western blotting using the antibodies: .15.Diaphragmatic 4-hydroxynonenal (4-HNE) was used as a marker of lipid peroxidation. After electrophoresis (7.5% polyacrylamide gel and blotting) polyclonal anti-4-HNE antibody  was used as primary antibody and a polyclonal rabbit anti-mouse  as secondary antibody. Data were expressed as a ratio between densitometric values of 4-HNE and VinculinThe p50 and p 65 subunits of NFkB were assessed by Western blotting using P50/P65: #4764 and phospho-P65: #3031, Cell-Signaling, Danvers, MA, USA.T method. The following primers were used . qPCR was run on a StepOne Plus instrument (LifeTechnologies) using Power SYBR Green Master Mix (Applied Biosystem #4368706). For messenger RNA (mRNA) analysis, inflammatory and proteolytic marker expression was normalized with ribosomal protein S7. RNA expression was analyzed by the \u0394\u0394 CPopulation distribution was assessed with the Kolmogorov\u2013Smirnov test. If this test showed normal distribution of data, comparisons between groups for each dependent variable were made by ANOVA, if normal distribution was not present, by a Kruskall Wallis test. If the group effect was significant, a Dunn\u2019s multiple comparisons test was used for pairwise comparisons between all groups. Data are shown as means\u2009\u00b1\u2009standard deviation (SD). All statistical tests are two-tailed, significance was established at p\u2009<\u20090.05 .Serum levels of ALT increased significantly and similarly 12 and 24\u00a0h after APAP administration compared to control  while serum levels of AST increased significantly but only 24\u00a0h after APAP administration (ctrl vs APAP 24 p\u2009<\u20090.001) .Caspase 3 and calpain-1 protein (measured as the amount of the specific breakdown products of \u03b1-II spectrin) were significantly decreased after 24 h after APAP intoxication vs ctrl  see Fig. .Downstream levels of Ubiquitin E3 ligases Atrogin and MURF did not differ between ctrl and the APAP treated animals , while this increase failed to reach statistical significance after 24\u00a0h see Fig.\u00a0. The bloThis study showed that in mice, during the acute phase of liver injury, no activation of the proteolytic or autophagic pathways and no atrophy occurred in the diaphragm while lipid peroxidation was elevated and IL-6 was the only inflammatory marker to be upregulated inside the diaphragm. The effects on the diaphragm are discussed in detail below.10. Hepatocyte necroses are induced directly by the toxic metabolite NAPQI. Otherwise, severity of the liver injury and dimension of necrosis are affected by a massive immune cell infiltration into the liver caused by the initial damage3. Until know it is still ambiguous which part of the immune response and which immune cells respectively aggravate or attenuate liver injury at the different stages of the disease16.The APAP model to induce acute liver failure is a well-established model. In previous studies, we have proven that induction of necrosis in hepatocytes after administration of APAP leads to consistent results within groups. Analysis of immune cells and their modulation showed that the model induces \u201ctwo hits\u201d during acute liver injury generated by APAP4. Summarily, acute liver failure results in multi-organ failure (Acute liver failure)17, although depending on etiology and duration course of illness is variable. In APAP and ischemia induced ALF the acute phase will be measured in hours and we expect systemic effects during the experimental time chosen in our model.We detected significant changes of liver enzymes\u2019 serum levels and necrotic areas inside liver tissue, pointing to a profound damage of hepatocytes. Central clinical signs of the acute liver failure are prolonged prothrombin time/INR, declined mental function, vasodilation and a systemic inflammatory response syndrome due to the high immunological impact of the liver18. Blazka and colleagues revealed an immediate response of TNF\u03b1 and IL1\u03b2 after APAP induced liver injury induction with systemic response19. IL-6 can even more act in several different ways in muscle and is produced during exercise20 or diaphragm overload21. Moreover, Janssen et al. demonstrated severe muscle atrophy in the diaphragm after IL-6 administration into the circulation. However, in diaphragm the influence of inflammation on its function has been under discussion: Blocking of toll-like receptor-4 in mice in a disuse model could decrease the amount of autophagic activation and IL-6 production and ameliorate the reduction of myosin heavy chain protein22. Possibly, the animals had an increase in the work of breathing due to metabolic disturbances after liver injury, which might explain this increase in IL-6 in a quasi-physiologic response to overload.Inflammatory response to acute liver injury has been described in humans and several cytokines in drug induced liver injury were elevated in serumSummarily, we could not detect a profound secondary response inside the diaphragm in the following 12\u00a0h or 24\u00a0h after liver injury induction except for enhanced levels of IL-6 that were not associated with changes in NF\u03baB subunits or other inflammatory cytokines.5 with mitochondria and to a smaller extent oxidases functioning as major sources of ROS25. In diaphragm, the increase of ROS interacts with the activity of main proteolytic pathways caspase 3 and calpain-1 as well as the autophagic system, so that blocking ROS results in an amelioration of atrophy via autophagic and proteolytic pathways27. In our model, we could detect a significant transient increase in the formation of lipid peroxidation (4 HNE) after 12\u00a0h of APAP induced liver injury. This increase abandoned in the 24\u00a0h APAP group, which could indicate a quick removal of oxygenated structures, as we have detected in a former experiment28. In our actual study, we did not distinguish further which source (mitochondria and/or oxidases) was responsible for the increase in oxidation. Importantly, we did not found a link between this increase in lipid peroxiadation and atrophy inducing pathways, although in disuse or sepsis this has been proven27. Possibly the amount of oxidative stress did not reach the level to induce proteolytic Ca-dependent proteases or autophagy.Oxidative stress is a key factor in the pathogenesis of ICU-acquired diaphragmatic weakness31. Caspase 3 acts a key protease, in conjunction with calpain 1, to break up the sarcomeric structures and allow downstream proteasome to further degrade the proteins33. Neither mRNA levels nor protein expression of key calcium-dependent proteases were enhanced in the diaphragm despite the presence of clear liver injury. Even more, the downstream ligases MURF and MAFbx remained unaltered in the interventional groups, although these ligases are involved in the further degradation of muscle protein after break-up by caspases31 and are usually activated during muscle atrophy, inflammation or oxidative stress30. In summary, proteolytic activation in the diaphragm by acute liver injury does not seem to be present in our model.In several diseases, proteolysis is activated inside the diaphragm and modulated by different pathways: Calcium dependent protease-based proteolysis via caspase 3 and calpain 1 have been described during sepsis, disuse (VIDD) and in chronic lung disease34. Upstream, Protein kinase B (AKT) and PI3K regulate via the Forkhead-Box-O1 transcription factor the formation of autophagosome building proteins, like LC3B.Autophagy is an important proteolytic pathway targeting cellular components associated with muscular atrophy via autophagosomes, which form double layer structures of which LC3 is a core molecule35. Transformation from LCB3BI into LC3B-II indicates the activation of autophagosomes30 and Hussain and colleagues described this pathway as one major diaphragmatic pathway in disuse36 which is also active in sepsis and linked to oxidative stress30. In addition, the autophagy pathway can modulate protein synthesis through the mammalian target of rapamycin (mTOR) and serves therefore as a switch between anabolic and catabolic states37.The diaphragm is susceptible to slightest disturbances in the ratio of protein synthesis and proteolysis, so that even 12\u00a0h of disuse affect this balanceDuring liver injury as in our model, autophagy assessed by the ratio of LC3BII/LC3BI and by the upstream molecules was not activated in the diaphragm.38. Those were in this study beyond the scope.This study has, however, some limitations that should be taken into account. According to the goal of the study, 12 and 24\u00a0h were specifically chosen as time point measures after liver injury in order to address the early phase effects of liver injury on the diaphragm. We, however, acknowledge that later time point measures may be relevant to address the secondary complications reported to arise days after acute liver injury in humans. Further studies are needed to address the influence of acetaminophen induced liver injury on diaphragm dysfunction at later time points and whether known effects on lung function  may add to these changesIn contrast to our hypothesis, acute liver injury induced by APAP in mouse did not induce atrophy or activate proteolysis via calcium dependent proteases or via ubiquitin proteasome pathway, neither it did stimulate autophagy. However, it resulted in enhanced diaphragm lipid peroxidation and upregulation of IL-6 which, on long-term, might be detrimental for the diaphragm. Future research might focus on long term models of liver injury to see whether the diaphragm would be affected.Supplementary Information 1.Supplementary Information 2."}
{"text": "IntroductionCoronary artery bypass graft (CABG) is the most potent of surgical procedures; in this procedure, the narrowing of the coronary artery due to atherosclerotic plaque is bypassed by forming an alternate route for blood flow to the heart. There are various risk factors associated with the procedure. The aim of this study was to observe if postoperative outcomes are affected by preoperative hematocrit (hct) levels in patients.Methods\u00a0This longitudinal study was conducted from April 2019 to December 2019. Eighty-two (82) participants who were to undergo CABG surgery were divided into two groups based on their preoperative hct levels. Group 1 had 42 participants with lower levels of hct (less than 35.5% for women and 38.3% for men), whereas group 2 consisted of 40 participants with normal hct levels (greater than 35.5% for women and 38.3% for men).ResultsThe results showed that participants undergoing CABG with lower than normal hct levels\u00a0had increased blood loss through drainage as compared to participants who had normal hct levels . Group 1 participants also had an increased need for blood and blood product\u00a0transfusion as compared to group 2 . Furthermore, the participants in group 1 had longer stays in the ICU\u00a0relative to the other group .ConclusionBased on our findings, patients who undergo CABG surgery with\u00a0lower than normal hct levels are at increased risk of certain complications, including\u00a0excessive blood loss, need for transfusion, and increased duration of ICU stay. Therefore, preoperative hct levels should be routinely checked in patients undergoing CABG to prevent these complications. Coronary artery bypass graft (CABG) is a revascularization procedure that is used to treat coronary artery disease (CAD), which is the narrowing of the arteries supplying oxygen and nutrients to the myocardium by atherosclerotic plaques . ConsideVarious studies have been conducted in the past to determine the surgical risk factors of CABG, and it has been found that the success of the procedure depends on the improvement or elimination of these risk factors, making preoperative risk-factor assessment important in patients undergoing CABG -5. TheseThere is very limited data available on the preoperative assessment of patients undergoing CABG in the local setting. In this study, we aimed to analyze the effect of hct levels on early postoperative outcomes in patients undergoing CABG.https://clincalc.com/stats/samplesize.aspx) based on results from Pala et al. [This longitudinal study was conducted in the cardiovascular unit of a tertiary care hospital\u00a0in Pakistan from April 2019 to December 2019. The sample size was calculated using an online calculator, ClinCalc . Continuous variables were presented as means and standard deviations. Binary outcomes were expressed as frequencies and percentages. The student's t-test and Pearson's chi-squared test\u00a0were employed to compare the two groups. A p-value of less than 0.05 indicated that there was a significant difference between the groups and the null hypothesis was not valid.After enrollment in the study, all patients underwent phlebotomy before any intervention was given, and blood samples were sent to the laboratory to determine the hct levels. Forty-two (51.3%) patients undergoing CABG had\u00a0lower levels of preoperative hct (less than 35.5% for women and 38.3% for men) and were placed in one group (group 1), and the other 40 (58.7%) participants with normal hct levels (greater than 35.5% for women and 38.3% for men) were placed in another group (group 2).Age, gender distribution, comorbidities (hypertension and type 2 diabetes) and ejection fraction were comparable between both groups. Hemoglobin (Hb) and hct were significantly lower in group 1 compared to group 2 . Group 1 participants also had an increased need for blood and blood product\u00a0transfusion as compared to group 2 . Furthermore, the participants in group 1 had longer stays in the ICU\u00a0relative to the other group  (Table Patient optimization prior to CABG is essential for better outcomes and early recovery. Hematocrit is a well-recognized factor with respect to pre and postoperative complications of cardiac surgery. The present study was conducted to assess the effect of hct levels on early adverse postoperative outcomes in patients undergoing CABG. In our study, postoperative drainage, the need for blood and blood product transfusion, and length of ICU stay were found to be statistically higher in patients in the low-hct group.Despite the advances in cardiovascular medicine and cardiac surgery operating techniques, morbidity and mortality are still a problem after CABG . With inMultiple studies have been conducted about this topic, and they have investigated the association of\u00a0blood and blood product transfusions with outcomes in CABG patients. In a study by Surgenor et al., 36% of patients received one to two units of packed cell transfusion; among them, 43% were transfused intraoperatively, and the rest were postoperatively transfused, and the mortality rate was found to be 16% higher in patients receiving transfusion compared to those who did not receive it . A studyA low preoperative hct level is an independent risk factor for the need for a transfusion, and the mortality rate among patients is directly proportional to the need for a transfusion . SimilarIn the current study, the mortality rate was higher in group 1 compared to group 2, although the difference was statistically insignificant. Low preoperative hct levels have a negative impact on postoperative recovery, and the higher initial 30-day\u00a0mortality rate in this patient group is an indication of the need for careful treatment planning. Even if the risk scoring system did not include the hct level, attention should be paid to the hct test as it will not only help the surgeon\u00a0but also the patient in terms of decision-making and planning regarding the operation.The major limitation of the current study was that it was conducted at a single center; therefore, our results cannot be generalized to other centers with a higher number of patients. Another limitation was that patients were analyzed\u00a0for in-hospital mortality only and were not followed up for medium and long-term results.In the present study, low preoperative hct levels were found to be associated with prolonged ICU stay among CABG patients. It was also associated with an increased need for blood transfusion and blood drainage during and after CABG, which are possible determinants of various adverse events. Therefore, detecting and treating low\u00a0preoperative hct levels is critical as it may reduce unwanted postoperative complications. Moreover, we believe that preoperative hct levels should be an integral component of risk scoring systems to assess the postoperative mortality risk and to foresee hospital stay and cost."}
{"text": "ALBA dynamics during reproductive development in Arabidopsis at the levels of gene expression and protein localization, both under standard conditions and following heat stress. In generative tissues, ALBA proteins showed the strongest signal in mature pollen where they localized predominantly in cytoplasmic foci, particularly in regions surrounding the vegetative nucleus and sperm cells. Finally, we demonstrated the involvement of two Rpp25-like subfamily members ALBA4 and ALBA6 in RNA metabolism in mature pollen supported by their co-localization with poly(A)-binding protein 3 (PABP3). Collectively, we demonstrated the engagement of ALBA proteins in male reproductive development and the heat stress response, highlighting the involvement of ALBA4 and ALBA6 in RNA metabolism, storage and/or translational control in pollen upon heat stress. Such dynamic re-localization of ALBA proteins in a controlled, developmentally and environmentally regulated manner, likely reflects not only their redundancy but also their possible functional diversification in plants.ALBA DNA/RNA-binding proteins form an ancient family, which in eukaryotes diversified into two Rpp25-like and Rpp20-like subfamilies. In most studied model organisms, their function remains unclear, but they are usually associated with RNA metabolism, mRNA translatability and stress response. In plants, the enriched number of ALBA family members remains poorly understood. Here, we studied  ALBA-family (Acetylation lowers binding affinity) proteins belong to an ancient group of proteins found in all domains of life ,2. All mOryza sativa), nine ALBA genes were identified, showing tissue-specific expression profiles, with expression also detected in generative organs [OsALBA1, OsALBA2, OsALBA6, and OsALBA9 in the Rpp25-like subfamily, and OsALBA3, OsALBA4, OsALBA5, and OsALBA8 in the Rpp20-like subfamily [OsALBA7 has a different domain composition, not exactly falling within these two sub-families [Arabidopsis thaliana, six homologues are equally shared by the Rpp20-like  and Rpp25-like  subfamilies [ALBA genes were preferentially active in young developing tissues including root tips, cotyledons, and leaf primordia. AtALBA1 and AtALBA4 showed the highest expression in all observed tissues within Rpp20-like and Rpp25-like subfamilies while ALBA3/DAN1 was specifically expressed in flowers [In plants, ALBA homologues have been investigated in several species. Seed plant genomes underwent genome duplications and rearrangements which led to the gene duplications observed in the ALBA family ,10. In rubfamily . OsALBA7families . In Arabfamilies . Each su flowers ,13. Avai flowers , while O flowers .Plasmodium falciparum, ALBA homologues associate with factors that regulate translation repression [Leishmania infantum, temperature stress caused ALBA protein (LiAlba1/Rpp20 and LiAlba3/Rpp25) re-localization from the cytoplasm into the nucleolus and flagellum, together with PABPs [Trypanosoma brucei ALBAs were detected in association with mRNAs, exclusively in cytoplasmic stress granules following nutrient stress [ALBA genes were demonstrated following various abiotic stress and phytohormone treatments [OsALBA1, OsALBA2, OsALBA6, OsALBA7, and OsALBA8 were upregulated, while OsALBA4 was downregulated [ALBA genes in Gossypium hirsutum (cotton) leaves, roots, and stems. In leaves and roots, two genes GhALBA_4 and GhALBA_5 were significantly upregulated [AtALBA1, AtALBA2, AtALBA4, AtALBA5, and AtALBA6 enrichment was detected in the mRNA binding proteome of Arabidopsis four-day-old etiolated seedlings [Various stress conditions have been shown to cause changes in ALBA behavior. In pression . In Leisth PABPs . Similart stress ,8. In plt stress ,14,15. Ieatments . Most geegulated . SimilarALBA expression by various abiotic stresses, we studied the expression dynamics of all ALBA genes in Arabidopsis generative tissues and investigated the response of a subset of them to heat stress.Increased temperatures often has a harmful effect on plant reproduction and fertility. Reproductive development is particularly sensitive to heat stress treatment . The malArabidopsis ALBA family is well conserved and comprises six homologs. The AtALBA genes form two subfamilies (ALBA1 (At1g29250), ALBA2 (At2g34160) and ALBA3 (At3g04620)) possessing only an ALBA domain, whereas the Rpp25-like subfamily contains longer genes (ALBA4 (At1g76010), ALBA5 (At1g20220) and ALBA6 (At3g07030)) carrying an ALBA domain and a RGG rich carboxyterminal extension  with different untranslated regions (5\u2019UTR and 3\u00b4UTR). ALBA6 gene on the other hand produces four splice variants ALBA6-1 (At3g07030.1), ALBA6-3 (At3g07030.3), ALBA6-4 (At3g07030.4), and ALBA6-5 (At3g07030.5). These sequences were analyzed and their relations compared using a maximum likelihood unrooted tree construction  and in sperm cells  or sharp between bicellular and tricellular pollen (ALBA1 and ALBA4). In contrast to these genes, ALBA3/DAN1 expression, activated by the DUO1 transcription factor [ALBA2-ALBA6 was detected in sperm cells at the mature pollen stage. This enhancement was particularly strong for ALBA3/DAN1.Following the analyses of the rm cells C. With tn factor , shows aALBA expression more closely, ALBA promoter regions were fused to the \u03b2-glucuronidase (GUS) reporter gene and their activity documented in transformed (ALBA1-6) and untransformed Col-0 plants. T1 generation plants were screened for GUS expression with at least two independent lines with a representative and stable GUS expression pattern selected per construct. During reproductive development, various patterns of expression were found within the ALBA family. We observed similarities between both subfamilies. In each subfamily, there was one dominantly expressed gene (ALBA1\u2014Rpp20-like and ALBA4\u2014Rpp25-like) with the remaining two genes showing weaker expression.To investigate ALBA1 promoter is highly active in inflorescence stems, flower buds, and developing and maturing flowers  and disappeared towards the middle part. Moreover, ALBA4 activity becomes stronger during pistil maturation and its conversion into a silique, where it unequally expands from distal areas towards the center with the only signal connection in septum  and sperm cells (SC) . In the Of them, ALBA3-GFP appeared to preferentially localize in the sperm cells around sperm cell nuclei. In addition to this preferential localization in proximity to the MGU, both these proteins also accumulated in distinct foci of variable size in the VC cytoplasm.The two remaining Rpp20-like subfamily members, ALBA1-GFP and ALBA2-GFP, were less abundant. They accumulated preferentially in round foci attached to VN and in the large, elongated particles in close proximity to SC nuclei,  or moderate (42 \u00b0C for 1 h) heat stress, their inflorescences collected (1 h or 24 h post-treatment to distinguish early and late heat stress response) for RNA isolation and RT-qPCR subsequently carried out. Melting curve analysis consistently demonstrated a single homogenous melting peak for all primer sets (GAPC1 (At3g04120) and EIF1a4 (At5g60390) as reference genes for the experiments and evaluated the data  1 h and 24 h after the application of 37 \u00b0C heat stress (HS)  revealed a statistically significant decrease after the treatment. Interestingly, ALBA expression increased 24 h following HS  in ALBA expression  . All ALBcontrols A. Howeveowing HS B. The appression . HoweverproALBA6::GFP-GUS-transformed pollen was not affected by heat-stress and served as a control . Mature pollen was harvested 1 h or 24 h after HS to distinguish the early and late response, respectively. As under standard conditions , the stu control .All three Rpp20-like subfamily members showed different stress-induced localization patterns. ALBA1-GFP, less abundant in mature pollen under control conditions, increased in abundance shortly after 37 \u00b0C treatment, and accumulated around MGU in several large cytoplasmic particles, whereas the GFP signal was less abundant in pollen VC collected 24 h after the treatment A1\u2013B2. HeThe heat stress response of the two less abundant Rpp25-like subfamily members, ALBA4-GFP and ALBA5-GFP, was less dramatic. Neither showed enrichment around MGU under any conditions. Within the subfamily, a stronger signal accumulation in cytoplasmic foci was captured in ALBA4-GFP pollen after the 37 \u00b0C treatment A7\u2013B8. A ALBA3-GFP and ALBA6-GFP, being the most abundant ALBAs in untreated mature pollen , both acp < 0.001) enhanced both ALBA4-GFP and ALBA6-GFP protein accumulation in cytoplasmic foci, which were still visible, albeit more dispersed, 24 h after HS.Based on these results, we aimed to quantify changes in ALBA protein localization with respect to particular foci formation under standard and HS conditions. Strong protein re-localization upon HS focused our attention to Rpp25-like subfamily proteins. We selected two proteins, ALBA4-GFP and ALBA6-GFP for precise quantification of HS-induced protein clustering. The degree of protein clustering was quantified by the coefficient of variation (CV) reflecting fluctuations in fluorescence signal intensities. CV was estimated in untreated pollen and after the exposure of flowering plants to 37 \u00b0C for 3 h, both 1 h and 24 h after the treatment . Only opArabidopsis, PABP3, and PABP5 show an organ-specific expression pattern in floral organs, including the male gametophyte [PABP3 is natively expressed in tapetum and pollen [ALBA family proteins are known to be associated with nucleic acids ,3,4,5,7.etophyte ,23. PABPd pollen . Since tPABP3-RFP localizes predominantly in cytoplasmic foci equally distributed in the VC cytoplasm, enriched in the MGU region . A detaiDue to similarities in localization of ALBA4-GFP, ALBA6-GFP, and PABP3-RFP, we decided to analyze their co-localization. To this effect, we used plants co-expressing ALBA4-GFP or ALBA6-GFP and PABP3-RFP. Our analysis revealed a strong signal overlap between ALBA4-GFP and PABP3-RFP in the VC cytoplasm . The co-Pollen of heterozygous ALBA6-GFP/PABP3-RFP plants was used for further co-localization analysis. The ALBA6-GFP signal is strongly enriched around SC nuclei where it rarely overlaps with the red signal of the mRNA marker . On the contrary, moderate HS (42 \u00b0C) had no significant effect on ALBA expression. These findings suggest that ALBA genes are regulated in a temperature-dependent manner, and are likely involved in mild temperature stress response in Arabidopsis. As such, ALBA genes could act as thermomemory-associated genes [ALBA expression led us to investigate ALBA-GFP localization in response to heat stress in mature pollen. The application of mild HS (37 \u00b0C for 3 h) affected ALBA-GFP localization, especially for ALBA4 and ALBA6, the two more divergent Rpp25-like subfamily members, with the most stable signal localization pattern. Similar stress-triggered re-localization of ALBA proteins between the cytoplasm and cytoplasmic foci were reported in Trypanosoma and Plasmodium [In rice, stresses . In thisstresses . We quaned genes  in the mmild HS 3 \u00b0C. On tasmodium .Leishmania [Plasmodium [Trypanosoma [Arabidopsis ALBAs, including ALBA4 and ALBA6 [Trypanosoma [Toxoplasma [Leishmania [We further traced mRNA distribution in pollen by RNA-binding protein PABP3-RFP ,33 with ishmania , Plasmodasmodium  and Tryppanosoma ,34 in stpanosoma . Therefond ALBA6 , their cpanosoma , Toxoplaxoplasma , and Leiishmania ,19,31,36Collectively we demonstrated the involvement of ALBA-family proteins in male reproductive development and in the heat stress response. Moreover, we suggest that ALBA4 and ALBA6 are implicated in RNA metabolism and storage in pollen upon heat stress. These two members  can dynamically re-localize between various types of mRNA-containing granules within the cytoplasmic mRNPs continuum in a controlled, developmentally and environmentally regulated manner. Such regulation then reflects not only their redundancy but also their possible functional diversification in plants. https://www.arabidopsis.org/). Motif analysis was performed using the MEME suite 5.2.0 [All DNA, cDNA, and protein sequences used were obtained from TAIR  [Transcriptomics data for gene expression analysis were obtained from the CoNekT online Database (t.tools) .ALBA1-ALBA5 containing coding regions and their native promoters were amplified from genomic DNA using specific primers (ALBA4 (genomic DNA) and ALBA6 (ALBA6-4 isoform amplified from pollen cDNA) gene fragments were amplified from pollen cDNA and cloned using the GoldenBraid 3.0 system into the pDGB3 \u03c92 destination binary vector [ALBA4 and ALBA6 coding regions were domesticated into pUPD2 entry vector [For promoter fusion constructs, proALBA::GUS-GFP, native promoter sequence fragments of all ALBA genes were amplified from genomic DNA using specific primers  transformation. Stable transgenic plants were obtained by floral dipping [For the co-localization of ALBA4-YFP and ALBA6-mCherry, we used GoldenBraid cloning to combine both transcriptional units into a single destination vector ,47. All  dipping . Seeds oArabidopsis stable line expressing a tagged version of PABP3, the whole genomic sequence encompassing PABP3 (AT1G22760) (starting from position\u20141884 from ATG to the last nucleotide before stop codon and including introns and 5\u2019-UTR) was PCR amplified using primers eb1 & eb2  were germinated on 0.5\u00d7 Murashige and Skoog (MS) medium containing 5% (w/v) Sucrose, 25% (w/v) MES and 0.8% (w/v) Agar [/v) Agar , and tra/v) Agar . Transfo20 primer. RT-qPCR measurements were obtained using GoTaq Q-PCR Master Mix  on a LightCycler 480  with gene specific primers (GAPC1 (At3g04120) and EIF1a4 (At5g60390) expression levels and statistics calculated using R [Total RNA was extracted from inflorescences collected 1 h and 24 h after heat stress application (37 \u00b0C for 3 h and 42 \u00b0C for 1 h) using the RNeasy Mini Kit . Four biological replicates (inflorescences) were used for each experiment. RNA quantity and quality (purity) was determined using NanoDrop One . RNA quality was verified by electrophoresis in a 2% agarose gel. All samples were treated by RQ1 RNase-Free DNase . Reverse transcription (RT) was performed for 1 h at 42 \u00b0C using ImProm-II\u2122 Reverse Transcription System  with an oligo-d(T) using R . The datproALBA::GFP-GUS transgenic plants were stained for GUS activity with a solution containing 50 mM sodium phosphate buffer, pH 7, 0.2% Triton X-100, 1 mM X-Gluc  and 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferricyanide or 2.5 mM potassium ferrocyanide, 2.5 mM potassium ferricyanide. Samples were vacuum-infiltrated for 10 min and stained at 37 \u00b0C. The staining was fixed in 99% ethanol for 24 h after which it was replaced by 70% ethanol at 4 \u00b0C.The GUS staining protocol was adapted to the individual samples, with two solutions used for the final staining using the appropriate time in between 7 and 24 h. Inflorescences of T2 generation Pollen from all samples was collected and stained with 0.8 \u00b5g/mL DAPI  in GUS buffer for 15 min (mature pollen) or 1 h  . StainedproALBA::GUS-GFP inflorescences, stamens with unopened and opened anthers, pistils from unopened and opened flowers and young siliques were collected and captured by a Zeiss stereomicroscope . Nectaries, ovules, seeds, microspores, bicellular and mature pollen grains were collected and captured by a widefield fluorescence microscope Zeiss Axioimager .Fixed Pollen grains of transgenic plants carrying ALBA-GFP and PABP3-RFP, ALBA6-mCherry and ALBA4-YFP and GUS-GFP were collected on a slide containing the DAPI staining solution and imaged under the inverted confocal laser scanning microscope Zeiss LSM880  equipped with an Airyscan detector and Plan-Apochromat 100\u00d7/1.46 Oil objective. For excitation of DAPI, GFP, RFP/mCherry laser lines 405 nm, 488 nm and 561 nm were used in a sequential scanning setup. Within an experiment, all images were acquired using adjusted settings reflecting various signal intensities of the individual fusion proteins. Airyscan Processing of raw files was performed in ZEN black software .Microscopy data were analyzed in the ZEN blue 2.5 software \u2014Maximum intensity projection, 3D-view, and colocalization analysis. Coefficient of variation (CV) was estimated as described in  and modiPearson\u2019s correlation coefficients were calculated in Zen blue SW from each thresholded cross-section of the z-stack. Average values from both analyses were depicted as box plots, their statistical significance was calculated using One Way ANNOVA followed by Pairwise Multiple Comparison Procedures (Dunns method) in Sigma Plot ."}
{"text": "We analyzed the radiolarian assemblages of 59 surface sediment samples collected from the Yellow Sea and East China Sea of the northwestern Pacific. In the study region, the Kuroshio Current and its derivative branches exerted a crucial impact on radiolarian composition and distribution. Radiolarians in the Yellow Sea shelf showed a quite low abundance as no tests were found in 15 of 25 Yellow Sea samples. Radiolarians in the East China Sea shelf could be divided into three regional groups: the East China Sea north region group, the East China Sea middle region group, and the East China Sea south region group. The results of the redundancy analysis suggested that the Sea Surface Temperature and Sea Surface Salinity were primary environmental variables explaining species-environment relationship. The gradients of temperature, salinity, and species diversity reflect the powerful influence of the Kuroshio Current in the study area. Polycystine Radiolaria (hereafter Radiolaria), with a high diversity of 1192 Cenozoic fossil to Recent species, are a crucial group of marine planktonic protists . Living The East China Sea (ECS) and Yellow Sea (YS) are marginal seas of the northwestern Pacific . The twoThe Kuroshio Current originates from the Philippine Sea, flows through the ECS, and afterwards forms the Kuroshio Extension . The KurIn the ECS shelf region\u2019s summer , the KurIn the YS shelf region\u2019s summer , the YelThe radiolarian assemblages in surface sediments have been investigated in the ECS whereas there are few reports in the YS. These reports cover the ECS including the Okinawa Trough  and contDictyocoryne profunda Ehrenberg, Dictyocoryne truncatum (Ehrenberg), Dictyocoryne bandaicum (Harting) were combined as Dictyocoryne group. Photographs of some radiolarians encountered in this study are exhibited in The surface sediments were collected at 59 sites  in the YGrain size analysis of the surface sediments was conducted with a Laser Diffraction Particle Size Analyzer . The data were used to categorise grain size classes as clay (1\u20134 \u00b5m), silt (4\u201363 \u00b5m) and sand (63\u2013500 \u00b5m), and to determine different sediment types according to the Folk classification . In addia and particulate organic carbon with a 9 km resolution for the period of 1997 to 2010 were obtained from https://oceancolor.gsfc.nasa.gov/l3/. The values of the environmental variables mentioned above for each surface sediment site were estimated by linear interpolation. These values, together with depth, are shown in The values of annual temperature (SST), salinity (SSS), oxygen, phosphate, nitrate, and silicate of sea surface with a 0.5\u00b0 resolution for the period of 1930 to 2009 were derived from the CARS2009 dataset . The seaThe minimum number of specimens counted in each sample is customarily 300. However, low radiolarian concentrations are frequent in the shelf type sediments comprised mainly of terrigenous sources . Given s\u22121) and the diversity indices, including the species number (S), Shannon-Wiener\u2019s index (H\u2032 (loge)). To ensure a creditable estimate of diversity indices, which may be biased by different counting numbers, the specimens of radiolarians in each sample were randomly subsampled and normalized to the equal size of 100 tests by using rrarefy function in vegan package in R program. For each site, S and H\u2032 of sample containing all tests and subsample containing 100 tests were calculated.We calculated the absolute abundance (tests.(100 g)Relative abundance (%) of each radiolarian taxon was also calculated. Then the hierarchical cluster analysis with group-average linking was applied to analyze the variations of radiolarian assemblage among different regions. The percentage data of the relative abundance was transformed by square root for normalize the dataset. Afterwards, triangular resemblance matrix was constructed based on the Bray-Curtis similarity . Analysia, silicate, particulate organic carbon, oxygen, depth, nitrate, and silt percentage were removed from the RDA model step by step, in order to avoid collinearity  was applied to determine the character of the species data. The gradient length of the first DCA axis was 1.773 < 3, suggesting that redundancy analysis  was more suitable than canonical correspondence analysis  . RDA wasinearity . FinallyCorrelation analysis was employed to investigate the relationship between the dominant radiolarian taxa and significant environmental variables.The diversity indices calculation, cluster analysis, ANOSIM, and SIMPER were performed by PRIMER 6.0. Correlation analysis was performed by SPSS 20. DCA and RDA were conducted by CANOCO 4.5. The detailed description of the statistical methods, including the cluster analysis, DCA, and RDA are in A total of 137 radiolarian taxa were identified from the surface sediments of study area, including 75 genera, 14 families, and three orders The raw radiolarian counting data are in \u22121) > ECSSR (1776 tests. (100 g)\u22121) > ECSNR (500 tests. (100 g)\u22121) > YSR (8 tests. (100 g)\u22121). The distribution pattern of species number (Tetrapyle octacantha group M\u00fcller (55.6%), Didymocyrtis tetrathalamus (Haeckel) (7.5%), Dictyocoryne group (3.7%), Spongaster tetras Ehrenberg (2.5%), Stylodictya multispina Haeckel (2.2%), Spongodiscus resurgens Ehrenberg (2.2%), Zygocircus piscicaudatus Popofsky (2.1%), Phorticium pylonium Haeckel (2.0%), and Euchitonia furcata Ehrenberg (1.8%).Radiolarian abundance in surface sediments varied greatly in study area , showings number  was simi\u22121 to 91 tests. (100 g)\u22121, and species number ranged from 0 to 12. Tetrapyle octacantha (17.4%), Spongodiscus sp. (10.9%), Didymocyrtis tetrathalamus (9.1%), Acrosphaera spinosa (6.1%), and P. pylonium (6.1%) were the five most abundant species taxa in the YS, constituting 49.7% of the total assemblages.In general, radiolarians showed a quite low abundance value in the YS, as no tests were found in 15 samples . For thep = 0.001). Diversity indices, including S and H\u2032, displayed an overall ranking of ECSSR > ECSMR > ECSNR both in samples  and subsamples .As can be seen in R\u00a0=\u00a00.769, p = 0.001).Cluster analysis based on the relative abundance classified all but one site into three regional groups at the 60% Bray-Curtis similarity level, including the ECSNR group, ECSMR group and ECSSR group . The sigTetrapyle octacantha, Didymocyrtis tetrathalamus, and Spongodiscus resurgens dominated in the ECSNR group, with contribution of 41.70%, 9.79%, and 8.89%, respectively. The radiolarian taxa, including T. octacantha, Didymocyrtis tetrathalamus, Dictyocoryne group, Stylodictya multispina, and Spongodiscus resurgens, contributed most to the ECSMR group. The dominant species in the ECSSR group were composed of T. octacantha, Didymocyrtis tetrathalamus, Dictyocoryne group, Spongaster tetras, Z. piscicaudatus, P. pylonium, Stylodictya multispina, and E. furcata.The dominant species in each regional group were identified by SIMPER analysis with a cut-off of 50% . TetrapyThe first two RDA axes explained 39.9%  of the species variance, and 86.5% of the species-environment relation variance . ForwardThe RDA plot showed a clear distribution pattern of regional samples . The ECSSpongaster tetras, Dictyocoryne group, Z. piscicaudatus, E. furcata, P. pylonium and Stylodictya multispina, were related to high SST, while showed little relationship with SSS. Didymocyrtis tetrathalamus was positively related to SST and SSS. Tetrapyle octacantha showed a preference for high SSS. Additionally, Spongodiscus resurgens was adapted to relatively low SST and SSS.The dominant species identified by the SIMPER analysis  are dispGenerally, the number of the radiolarian tests in continental shelf sediments of the ECS and YS is several orders of magnitude lower than that of the adjacent Okinawa trough . FirstlySpongodiscus sp., were reported as typical warm species  and ECSNR group (0.06%). Members of Pterocorys are shallow-water dwellers, as reported by Pterocorys campanula frequently occurs and dominates in the South China Sea, whereas there are no reports of the dominance of P. campanula in the sediment samples of the ECS  and salinity (33.3\u201334.2 psu) . Some of furcata , Fig. 8. furcata . The rel the ECS . The higT. octacantha, Didymocyrtis tetrathalamus, Dictyocoryne group, Stylodictya multispina and Spongodiscus resurgens . After removing 3000-1, no significant correlation existed between SSS and the relative abundance of T. octacantha . Tetrapyle octacantha, as the most abundant taxon in the subtropical area  The radiolarian abundance in the YS was quite low, and no radiolarians were detected in 15 of 25 YS sites.(2) The radiolarian abundance and diversity in the ECS, which is controlled by the Kuroshio warm water, was much higher. Based on the cluster analysis, the radiolarian assemblages in the ECS could be divided into three regional groups, namely the ECSNR group, the ECSMR group and the ECSSR group.T. octacantha, Didymocyrtis tetrathalamus, and Spongodiscus resurgens.a. The ECSNR group was chiefly impacted by the Changjiang Diluted Water and Kuroshio Current, with dominant species of T. octacantha, Didymocyrtis tetrathalamus, Dictyocoryne group, Stylodictya multispina, and Spongodiscus resurgens.b. The ECSMR group was controlled by the Kuroshio Current, TWC and Changjiang Diluted Water. Species contributed most to this group included T. octacantha, Didymocyrtis tetrathalamus, Dictyocoryne group, Spongaster tetras, Z. piscicaudatus, P. pylonium, Stylodictya multispina, and Euchitonia furcata.c. The ECSSR group was affected by the Kuroshio Current and TWC, in which the TWC occupies major status. The dominant species in this group were composed of (3) The RDA results indicated that SST and SSS were main environmental variables that influenced the radiolarian composition in the ECS shelf.10.7717/peerj.9976/supp-1Table S1Click here for additional data file.10.7717/peerj.9976/supp-2Table S2Click here for additional data file.10.7717/peerj.9976/supp-3Supplemental Information 1Click here for additional data file."}
{"text": "Distal gastrectomy with lymph node dissection, a standard operative technique for gastric cancer treatment, is safely performed because the stomach has a rich vascular supply. Gastric remnant necrosis caused by cholesterol crystal embolization following distal gastrectomy has not been described previously. We report a case of gastric remnant necrosis in a patient with cholesterol crystal embolization.A 70-year-old man with a history of cholesterol crystal embolization presented to our surgery department with complaints of anorexia and dysphasia. He was diagnosed with gastric cancer invading the pyloric antrum and underwent distal gastrectomy with Billroth 2 reconstruction. On postoperative day 11, he developed abdominal pain without fever. Emergency laparotomy revealed that most parts of the remnant stomach were necrosed. Total gastrectomy with Roux-en-Y reconstruction and abscess drainage were performed. After surgery, anastomotic leakage occurred and was treated conservatively. However, the superior pancreaticoduodenal artery aneurysm suddenly ruptured and he expired.Gastric remnant necrosis after distal gastrectomy can be a gastrointestinal presentation of cholesterol crystal embolization. Perioperative/intraoperative risk assessments such as preventive total gastrectomy or intraoperative assessment with indocyanine green fluorescence angiography may be desirable to avoid this complication. The stomach has a rich vascular supply provided by a collateral arterial plexus . The safCholesterol crystal embolization (CCE) is a rare manifestation of atherosclerotic disease . CholestHere, we report the case of a patient who developed gastric remnant necrosis after a distal gastrectomy that was caused by CCE. Our aim in presenting this report is to raise the awareness of the possible risk factors for CCE and preventive measures that may be taken to avoid this complication.A 70-year-old man presented with anorexia and dysphagia. His past medical history was notable for type 2 diabetes, hypertension, chronic kidney disease requiring hemodialysis, and CCE. The CCE was triggered by a percutaneous coronary intervention in the context of myocardial infarction 7\u2009years earlier. He had no history of smoking or alcohol abuse. Physical examination revealed cyanosis of both feet with dry gangrene of the distal toes but no livedo reticularis. The initial laboratory test results revealed a serum hemoglobin level of 8.0\u2009g/dL, total white cell count of 9850/\u03bcL with 5.9% eosinophils , serum carcinoembryonic antigen level of 3.2\u2009ng/dL, and carbohydrate antigen 19\u20139 level of 15.3\u2009ng/dL. Endoscopic examination revealed a type 4 tumor (Borrmann classification) circumferentially located, with invasion of the pyloric ring  and an increased C-reactive protein level (21.13\u2009mg/dL). Abdominal CT demonstrated a gastric wall discontinuity of the remnant stomach with fluid collection in the left subphrenic space. Gastric remnant necrosis was suspected, and an emergency laparotomy was performed.Laparotomy revealed a necrotic gastric remnant. Most parts of the stomach, except for the greater curvature around the spleen, were completely necrosed Fig.\u00a0. Total gWe described a case where gastric remnant necrosis developed after a distal gastrectomy. To the best of our knowledge, this is the first report of gastric remnant necrosis after gastrectomy caused by CCE. This case is instructive because 1) gastric necrosis can be a presentation of CCE, in addition to kidney and skin involvement, and 2) the mortality of gastric remnant necrosis after gastrectomy is very high; therefore, it is essential to manage this risk before and during surgery.CCE, also referred to as atheroembolism or cholesterol embolization syndrome, is a rare manifestation of atherosclerotic disease . It occuCCE affects multiple organs, especially those vulnerable to low blood perfusion such as the skin, kidneys, gastrointestinal system, and brain . The gasThe stomach has a rich blood supply and an extensive submucosal plexus. Gastric necrosis in patients with CCE may not have been reported because of the stomach\u2019s abundant blood flow. Nevertheless, in our case, transient reduction of blood supply into the gastric remnant occurred during surgery, eventually leading to a postoperative catastrophe. The mortality associated with gastric remnant necrosis has been reported to be as high as 70% .The main arterial feeders of the remnant stomach after distal gastrectomy with D2 lymph node dissection are the short gastric artery, the posterior gastric artery, and the left subphrenic artery. When these arteries are preserved, blood flow to the gastric remnant is usually sufficient. However, this was not the case here. Interruption of the blood flow to the gastric remnant causes necrosis. Several reported cases have occurred secondary to splenic infarction . HoweverBecause the mortality of gastric remnant necrosis is very high, prevention is essential. CT angiography can be used to assess preoperative perfusion from the large vessels of the gastric walls . HoweverIn conclusion, we encountered a case of gastric remnant necrosis caused by CCE after distal gastrectomy. Gastric necrosis can be a gastrointestinal presentation of CCE, and perioperative/intraoperative risk assessments may help prevent this complication."}
{"text": "The COVID-19 pandemic and the measures adopted are having a profound impact on a major goal of public healthcare systems: universal access to health services. The objective is to synthesize the available knowledge on access to health care for non-COVID-19 conditions and to identify knowledge gaps. A scoping review was conducted searching different databases  for original articles published between December 2019 and September 2021. A total of 53 articles were selected and analyzed using the Aday and Andersen framework as a guide. Of these, 37 analyzed changes in levels of use of health services, 15 focused on the influencing factors and barriers to access, and 1 studied both aspects. Most focused on specific diseases and the early stages of the pandemic, based on a review of records. Analyses of the impact on primary care services\u2019 use, unmet needs or inequalities in access were scarce. A generalized reduction in the use of health services was described. The most frequent access barrier described for non-COVID-19 conditions related to the services was a lack of resources, while barriers related to the population were predisposing  and enabling characteristics . In conclusion, our results show a general reduction in services\u2019 use in the early stages of the pandemic, as well as new barriers to access and the exacerbation of existing ones. In view of these results, more studies are required on the subsequent stages of the pandemic, to shed more light on the factors that have influenced access and the pandemic\u2019s impact on equity of access. The pandemic due to coronavirus SARS-CoV-2 COVID-19), a novel virus initially reported in December 2019 9, a nove,4,5,6.In this regard, some strategies taken to combat soaring COVID-19 infection rates may have negatively affected access to health services for other conditions. Firstly, at the health services level, one of the most influential measures was the classification of services as essential or non-essential, following WHO guidelines, which allowed resources to be redirected to the pandemic response. However, this has also caused cancellations or delays in elective and non-urgent procedures ,5,6,7, dAnother indirect effect of the pandemic, the economic crisis stemming from the substantial curtailment of economic activity, and the ensuing rise in unemployment and loss of household income, have aggravated associated access barriers , thereby accentuating existing inequalities in access, as studies on previous economic crises have shown . AlthougIn short, as in other epidemics and previous outbreaks, the health repercussions of the current pandemic are not confined solely to COVID-19 infection and mortality. They also include indirect negative effects on healthcare access and on the quality of curative and preventive care provided for other conditions, and the exacerbation of difficulties and barriers related to socioeconomic factors ,16,17. TWhile a plethora of scientific papers have been published on COVID-19 since the start of the pandemic, studies on its impact on access to health services have not been so plentiful. A few literature reviews have been found that summarize changes in health services due to the pandemic, focusing mainly on the adoption of telemedicine ,30,31,32Access to care involves many highly interdependent factors and stakeholders at play . This stThe aim of this article is to synthesize the knowledge accrued from the onset of the pandemic in March 2020 through to September 2021 on the impact of the COVID-19 pandemic on access to health services  for non-COVID-related conditions, and to identify knowledge gaps on these subjects.A scoping review of the scientific literature  was carrIn our bibliographic search, several digital databases were consulted to minimize the risk of overlooking any relevant studies: Medline, Google Scholar, SCiELO, and Web of Science. The search was performed over two separate periods: 22 January 2021\u201331 March 2021 and 22 September 2021\u201310 October 2021. In the Medline database, using a thesaurus, MeSH terms were employed for: (a) COVID-19: \u201cCoronavirus Infections\u201d, \u201cCoronavirus\u201d, \u201cCOVID-19\u201d, \u201cSARS-CoV-2\u201d; (b) access to health services: \u201cHealth services availability\u201d, \u201cHealth services needs and demand\u201d, \u201cHealthcare disparities\u201d, \u201cNeeds assessment, healthcare\u201d, \u201cHealth policy\u201d, \u201cEquipment and Supplies Utilization\u201d, \u201cFacilities and Services Utilization\u201d \u2014that used qualitative and/or quantitative methods and analyzed or described changes in access to health services in the context of the COVID-19 pandemic. The initial selection of studies to review was performed through title and abstract screening. Where there was any doubt about whether to include a study, this was discussed with another researcher in the team. Following Aday and Andersen\u2019s framework ,40, the From the search results, 242 articles were identified for title and abstract screening, and 95 for full-text review. A total of 53 articles met the inclusion criteria for analysis .Of the 53 articles selected, 37 analyzed changes in realized access applying quantitative methods ,80,81,82With regard to the type of service, of the studies on realized access, 5 focused on health services in general ,48,49,50In terms of geographical area, 19 studies were conducted in European countries ,90,92,95With regard to the period of analysis, 38 of the selected studies were conducted over the first months of the pandemic (February to June 2020) ,92,93,98Below is a summary of results found regarding changes in realized access and potential access, following the Aday and Andersen theoretical framework ,40.Of the 38 studies that analyzed changes in realized access ,81,82,98By type of service analyzed, studies focusing on the health services in general ,47,49,50In the studies that analyzed influencing factors in the use of services in the context of the pandemic, the probability of lower utilization levels was associated with different factors. With regard to predisposing characteristics of the population, women ,79 and eThe 16 studies that analyzed potential access ,96,97,98Twelve studies described changes related to characteristics of the services ,95,97,98Fourteen studies identified barriers related to population characteristics ,96,97,98The impact of the COVID-19 pandemic has been felt worldwide in many different spheres of society, but especially in access to health services for unrelated conditions. There is now a pressing need to evaluate the changes that have arisen in this regard, and their implications for equity of access and the resilience of national health systems to future pandemics. This is, to the best of our knowledge, the first scoping review to offer a general overview of the subject, taking in the current evidence and highlighting the areas that will require further research in future studies.Most of the studies included in the analysis describe a lower level of health services\u2019 utilization and changes in potential access, as preexisting barriers have intensified and new ones have arisen. However, while investigations into the impact of the COVID-19 pandemic are still ongoing, the results of this review show that the studies conducted to date are limited in terms of scope and methodology, and that they are mainly centered on analyzing the impact on the use of services for specific diseases or population groups during the first stages of the pandemic, with a particular focus on secondary care.Studies on the use of health services in general are very scarce, as are those on access to primary care, which in many countries has been the most overwhelmed care level due to having to take on more pandemic-related care duties . Likewise, there is a considerable lack of evidence so far on how changes have taken place over the course of the different waves of COVID-19, and according to geographical context. Although some studies with longer timeframes\u2014to the end of 2020\u2014have already described new drops in health services\u2019 activity following brief periods of recovery ,63,71, fIt is important to bear in mind that access to care involves multiple interdependent factors and numerous actors. However, the results of this review show that, so far, there are almost no published studies with a wide scope using mixed methods, and that the qualitative studies available to date are still limited in both number and perspective. In regard to the latter, few studies include, in addition to that of users, other viewpoints such as that of the health professionals or managers involved in the process of taking measures or adopting practices that influenced access to care. Furthermore, the population groups selected for study were generally sufferers of a specific condition or of vulnerable status. The number of qualitative studies is probably limited due to the complexity of their development in the pandemic context, in terms of time, resources, and restrictions imposed by the mitigation measures. Approaches that combine multiple sources of evidence and different perspectives are needed to shed more light on the factors and actors that have influenced access.With regard to our main findings on the reduction in the use of services, this may be related to health systems prioritizing their response to the public health emergency, which differed according to context ,99,100. Going into more detail, the reductions in access to services described appear to have brought with them an increase in medical complications and emergencies, especially in elective procedures ,77,101, In this regard, some studies highlight the difficulties involved in maintaining normal levels of activity in certain services, even in some classed as essential, such as maternal health, oncology, or mental health ,94,97,98The few studies that analyze the influencing factors on the lower utilization of services mainly highlight a greater downturn in use among low-income users, those with limited healthcare coverage, and ethnic minorities ,74, as wAs regards the changes in potential access detected in this review, the results indicate both the exacerbation of existing barriers, related above all to structural difficulties and situations of vulnerability, and the creation of new ones. In terms of existing barriers accentuated by the pandemic, some studies reported a shortage of resources in the services to meet all the incoming healthcare requests ,95,97,98In addition, new barriers may have been created as a result of adopting alternatives to face-to-face visits  and changes in attitudes and beliefs developed as a result of the pandemic. In this regard, the use of online consultation has grown as a way to mitigate difficulties in access , but notLikewise, one of the individual characteristics that has been most influential in terms of new barriers created by the pandemic is fear of contagion ,94,95,97While it is true that various studies have identified both new barriers and the exacerbation of existing ones, the behavior of individuals in this type of public health emergency requires more in-depth analysis in order to steer the design of interventions to help counter these barriers, such as public health information campaigns or specific measures for vulnerable populations.On a final note, this review has several limitations. In the first place the nature of the studies covered varies greatly, in terms of methodology , and of geographical areas and health systems analyzed; thus, it is not possible to draw comparisons between them. Secondly, articles that analyzed access to services due to COVID-19 in addition to other illnesses were excluded from the study. This decision was made in order to rule out bias towards activity and resources destined to the treatment of other diseases. Third, no studies focusing on the impact of the pandemic control measures on access to health services were found, probably due to the limited terms used in our search to capture this area. Moreover, it is also possibly due to the difficulties involved in distinguishing the impact of the measures from other effects of the pandemic. Finally, some articles may not have been considered on being published in other languages , so this analysis may have excluded relevant information and failed to consider certain contexts. In spite of these limitations, this is the first study to address changes in access from a global perspective, with a view to shedding light on gaps in knowledge that will require further research in the future.This review analyzed studies that reported changes in health services\u2019 utilization, and the factors that influenced the use of services for non-COVID-19 conditions, during the COVID-19 pandemic. Results vary according to the context analyzed, although, in general terms, they reflect the same trend, describing a general reduction in the use of health services, the exacerbation of preexisting barriers, and the emergence of new ones. This scoping review has shown that most studies conducted to date are limited in terms of scope and methodology and are centered mainly on the impact on specific conditions or population groups during the early stages of the pandemic, focusing mostly on secondary care. Furthermore, a significant gap in knowledge was detected on whether the services have recovered to pre-pandemic levels of care use and, if not, in which areas and for what reasons. Future studies should go into greater depth on the pandemic-related changes that have influenced access to health services , according to context and over the course of the different stages of the pandemic. In any case, as an ongoing phenomenon, the real impact of the COVID-19 pandemic is yet to be determined."}
{"text": "Aspergillus niger SAP2211 (accession number: MK503444.1) as an antimicrobial, anti-cancerous and anti-angiogenic agent. The synthesized Ag-NPs were characterized following UV\u2013vis, FTIR, XRD, SEM and TEM, and were found to possess bactericidal activity against the selected pathogenic microbes, such as Staphylococcus aureus, Escherichia coli, and Salmonella typhi. Further, we evaluated cytotoxicity effect of this biogenic Ag-NPs using MMT assay on normal cardio myoblast (H9C2) and cancerous human cervical carcinoma (HeLa) cells. Doxorubicin used as positive control. This Ag-NPs have shown trivial cytotoxicity at the IC50 concentration on normal cells (IC50 = 47.17\u00a0\u00b5g/ml) over the cancer cells (IC50 = 8.609\u00a0\u00b5g/ml) with nearly 7 fold difference, indicating it as a selective anti-cancerous agent in contrast to standard drug doxorubicin (IC50 = 6.338\u00a0\u00b5g/ml). Further in-vitro assessment of wound healing capability by scratch wound healing assay, invasion by transwell matrigel invasion assay, and apoptosis via DAPI and annexin V-FITC assays were studied in HeLa cells. Synthesized biogenic Ag-NPs have shown to be anti-angiogenic in nature, which was established by in-vivo chick chorioallantois membrane assay. Overall, in vitro studies revealed that biogenic Ag-NPs positively inhibited migration, invasion, and induced apoptosis, and in-vivo CAM assay revealed that intercapillary network was reduced and the angiogenesis was inhibited.Green synthesis of nanoparticles is regarded as a safe and non-toxic process over conventional synthesis. Owing to the medicinal value of biologically derived biomolecules and utilizing them in synergy with nanoscience to offer more accurate therapeutic options to various diseases is an emerging field. One such study we present here with highlights of the synthesis and efficacy of biogenic silver nanoparticles produced from the extract of  Cancer is a life-threatening disease that is responsible for the majority of fatalities worldwide . ConventVerticillium sp, Fusarium oxysporum, Penicillium fungi, Trichoderma reesei, and Aspergillus fumigates. Ag+ ions are trapped at the cell surface after electrostatically interacting with negatively charged carboxylate groups in the mycelial cell wall  for Ag-NPs synthesis and found that it exhibited antibacterial, anticancer, and wound healing properties. These Ag-NPs are prospective drug leads due to the positive outcomes of prior research investigations as well as their low cost. It becomes indispensable to design a biocompatible and prolific nanoparticle that can specifically target HeLa carcinoma cells for therapeutic efficacy with reduced side effects on normal cells.In order to improve biological applications of Ag-NPs as therapeutic agents, the advancement of environmentally sustainable technology in material synthesis is of significant importance. To overcome their potential hazard and toxic effect, green synthesis have shown exceptional recognition and is preferred over chemical and physical methods because it is cost effective, less toxic, eco-friendly, requires less energy, gives high productivity and significantly biocompatible with high reduction potential . These bell wall , followiell wall . The funell wall  in orderell wall  and promell wall . The nan-7 cells . Hu et aAspergillus niger SAP2211 (a new strain) isolated from a marine sponge, as well as their subsequent characterization to determine standard nano-quality. The synthesized Ag-NPs was tested for antibacterial activity against pathogenic bacteria such as, Staphylococcus aureus, Escherichia coli, and Salmonella typhi. The anti-cancerous properties were examined in vitro in HeLa carcinoma cells and assessed cell viability by MTT assay, apoptosis by DAPI and annexin V FITC/PI, cell migration by wound healing scratch assay, and invasiveness assessed by transwell matrigel invasion assay. The anti-angiogenic potentiality were assessed in vivo utilizing the chorioallantoic membrane (CAM) model with commercial doxorubicin serving as positive control. The resulting Ag-NPs showed effective antimicrobial, anti-cancerous and anti-angiogenic potential against cervical HeLa cells with no adverse effect on normal cell, providing a platform for the use of this biogenic nano silver particles as potent antimicrobial, anti-cancerous and an anti-angiogenic agents.The current research focuses on the production of silver nanoparticles from All the chemicals and reagents used in the investigation are of molecular grade and purchased from HiMEDIA, Takara, and Sigma-Aldrich laboratories.Marine sponges were collected from intertidal and subtidal regions  of Marina Beach sea coast Chennai, India. The sponges were air dried for a period of 3\u20135\u00a0days and were crushed into powder.\u22121\u201310\u20137. A volume of 0.1\u00a0ml of each dilution was inoculated aseptically in 2\u00a0ml of Potato Dextrose Agar (PDA) plates and incubated at 37\u00b0C for 72\u00a0h. The fungal isolates were subculture on PDA plates in order to obtain pure culture. Pure isolates were then maintained in the laboratory at 4\u00b0C in a refrigerator for further studies.One gram of crushed sponge was serially diluted in sterilized distilled water to a concentration of 1020i) for its color, shape, chain morphology, hyphae and mycelium structure.The colony morphology of fungal isolates was characterized by Lactophenol Cotton Blue Mounting and was observed under Olympus trinocular light microscope (CHR DNA mini kit (Qiagen). Both quantity and quality of DNA were analyzed in 1% Agarose Tris Acetate EDTA gel. Forward primer-ITS1 (5\u2032-TCC\u200bGTA\u200bGGT\u200bGAA\u200bCCT\u200bGCG\u200bG-3\u2032) and reverse primers-ITS4 (5\u2032-TCC\u200bTCC\u200bGCT\u200bTAT\u200bTGA\u200bTAT\u200bGC-3\u2032) . The amplicon 18s rDNA gene was sequenced using an automated ABI\u2013DNA sequencer (Applied Biosystems 3500) at Centre for Plant Molecular Biology, Osmania University. BLAST was carried out with the NCBI Genbank database using the fungal 18s rDNA ITS gene sequence and deposited in Genbank/EMBL. Sequences were identified and matched based on maximum identity values using the multiple alignment tool Clustal W. MEGA10 was used to generate the phylogenetic tree.   were useic tree. .Aspergillus niger was cultured in Potato Dextrose Broth (PDB) in a flask then incubated at 25\u00b0C at pH 6.0 for 3\u00a0days in a rotary orbital shaker at a speed of 200\u00a0rpm. Following incubation, the biomass was separated using Whatmann No.1 filter paper and was aseptically washed with sterile distilled water to remove the remaining medium components. Biomass (20\u00a0g) was mixed with 200\u00a0ml of distilled water in a 500\u00a0ml Erlenmeyer flask and incubated  in a rotary shaker. The cell suspension after incubation was filtered with Whatmann No.1 filter paper and collected for nanoparticles synthesis. Equal quantities (1:1 ratio) of both filtered supernatant and AgNO3 (1\u00a0mM) were mixed in 250\u00a0ml Erlenmeyer flask and kept in a shaker  and were confirmed by change in its color.Ag-NPs was synthesized following the methodology adopted by The prepared Ag-NPs were characterized to determine their size, morphology and crystallinity by using UV-visible spectroscopy (Shimadzu UV-1800), Fourier transform infra-red spectrophotometer (Jasco FT/IR-6300), X-ray diffractometer (Shimadzu XRD-7000), Scanning electron microscope  and Transmission electron microscope .The reduced silver ions were analyzed in the range of 300\u2013600\u00a0nm by UV-vis. The size and morphology of the synthesized nanoparticles was determined by Scanning electron microscopy. The sample was filtered through Millipore filters of 0.2\u00a0\u00b5 to remove any contaminants. Later loaded onto a stub and coated with platinum and were intended mainly to prepare specimens for SEM observation. The size and shape of Ag-NPs were determined by TEM for which the Ag-NPs sample was diluted upto 100 times and were dropped dried on a carbon-coated Cu grid  for analysis. The size distributions of the prepared Ag-NPs on the acquired TEM images were assessed using Originpro.\u03b1 radiation with \u03bb = 1.5406\u00a0\u00c5 and 2\u03b8 (Bragg angle) ranging between 10\u00b0 and 80\u00b0 in steps of 0.02\u00b0 with sampling time of 0.60\u00a0s per step. Debye Scherrer equation was employed to calculate the crystallite size .XRD patterns of dried Ag-NPs was analyzed by Philips X-Ray diffractometer  using Cu-K\u22121 in infrared spectrum.The pellet was made from dried Ag-NPs with potassium bromide (IR grade) in 1:100 ratio for FTIR analysis. Diffused reflectance was recorded in the range of 4,000\u2013400\u00a0cmStaphylococcus aureus (MTCC 96), Escherichia coli (MTCC 443) and Salmonella typhi (MTCC 98) were procured from Department of Microbiology, Osmania University and maintained in Luria-Bertani (LB) broth at 37\u00b0C for 24\u00a0h in orbital shaker incubator.The bacterial-strains The antibacterial activity of silver nanoparticles was examined using agar well diffusion technique. The broth (0.1\u00a0ml) of each strain was uniformly plated on Nutrient agar medium using sterile cotton swabs \u2013 HiMEDIA. A well (diameter: 6\u20138\u00a0mm) was punched aseptically using a sterile cork borer on nutrient agar plate and approximately 10\u00a0\u03bcl volume of the synthesized Ag-NPs (Stock concentration of 1\u00a0mg/ml and 500\u00a0\u00b5g/ml) was injected into the well followed by incubation. This test was carried out in triplicate. As a control, conventional antibiotics  were employed, and the zone of inhibition was determined.\u00b0C in a 5% CO2 incubator for 24\u00a0h. The cultured cells were passaged using trypsin\u2013EDTA (0.25%) followed by centrifugation  and resuspended in 1\u00a0ml DMEM media. About 100\u00a0\u00b5l of both cell lines (7500 cells) were added to each well of 96 welled plate and incubated overnight (37\u00b0C in 5% CO2 incubator).Myocardial (H9C2) and human cervical carcinoma (HeLa) cell lines were procured from National Centre for Cell Science (NCCS), Pune and were maintained in Dulbecco Modified Eagle\u2019s Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS) and 1% penicillin and streptomycin antibiotics. The cells were incubated at 37\u00b0C in 5% CO2 incubator for 21\u00a0h. Untreated cells in DMEM medium were taken as negative control.Stock solution of the synthesized Ag-NPs (1\u00a0mg/ml) and doxorubicin (1\u00a0mg/ml) was filtered using 0.45\u00a0\u00b5 syringe filter and diluted with culture media to obtain 1:1 to 1:64 dilution. The defined concentration of Ag-NPs testing agent and doxorubicin (positive control) were added in respective wells and incubated at 3750 was calculated using Graph-pad Prism software.Cell viability due to biogenic Ag-NPs and doxorubicin against cultured HeLa cell lines was performed by MTT -2, 5-diphenyl tetrazolium bromide) assay and effect of same doses of Ag-NPs were tested for its toxicity on normal H9C2 cells. The degradation of cellular mitochondria has been evaluated by an estimation of blue formazan crystals produced by the reduction of MTT by means of mitochondrial succinic dehydrogenase secreted by viable cells. MTT (20\u00a0\u00b5l/well of 5\u00a0mg/ml in PBS) was added to overnight incubated 96 welled plate followed by incubation for 3\u20134\u00a0h. Mitochondrial dehydrogenase reduces the yellowish water-soluble MTT to water-insoluble formazan crystals that was solubilized by adding 100\u00a0\u00b5l of DMSO in each well of the plate followed by incubation of 30\u00a0min in a shaker incubator. The quantity of formazan which is directly proportional to the number of viable cells, was measured at 590\u00a0nm using a spectrophotometer (Bio-Rad). IC5 cells/well) were cultured in 6-well plates, incubated at 37\u00b0C for overnight. Considering IC50 of Ag-NPs assessed by MTT assay, the applied doses of Ag-NPs treatments  for 24\u00a0h were compared to the untreated negative controls cells and 10\u00a0\u00b5g/ml doxorubicin treated positive controls cells. All the cells were fixed with 3.8% paraformaldehyde and stained with DAPI (0.5\u00a0\u00b5g/ml in PBS) for 15\u00a0min at 37\u00b0C in dark. The cells were washed twice with PBS. The images were analyzed and captured using an inverted fluorescent microscope  under 20X magnification.The apparently induced apoptosis by the biogenic Ag-NPs was assessed by monitoring the nuclear cell morphology exposed to various concentrations of Ag-NPs using DAPI staining method. The HeLa cells (2\u00d7105 cells/well) and cultured at 37\u00b0C, 5% CO2 for 24\u00a0h. Untreated cells were considered as negative control and the wells containing 80% confluence (approximately) were taken for the scratch test. An even scratch on cell monolayer was made with a sterile p10 tip micropipette and care was taken to avoid any possible variation in scratch width in treated and control cells, and the floating cells were washed with PBS to clean the edges. The cells were incubated with DMEM complete medium and treated with 5, 10 and 15\u00a0\u03bcg/ml of Ag-NPs and 10\u00a0\u00b5g/ml of doxorubicin. Immediately after the procedure i.e. at 0\u00a0h the region of initial migration was measured and subsequent measurements were taken after 24 and 40\u00a0h of incubations at 37\u00b0C, under inverted fluorescence microscope , and analyzed with ImageJ software  and statistically analyzed. The percentage of relative migration of NP-treated and untreated cells was determined based on the following equation:Scratch wound healing assay is convenient and widely performed to determine cell migration capabilities of individual cells, it measures the expansion of individual cell number on edge surface of the scratch . In the 5 cells per well, and the lower chamber was filled with DMEM medium (700\u00a0\u03bcl) supplemented with 12% FBS. The cells were treated with 10 and 15\u00a0\u03bcg/ml of Ag-NPs for 18\u00a0h at 37\u00b0C and after incubation; the cells were washed twice with PBS. The cells were then fixed with 3.7% formaldehyde for 2\u00a0min at room temperature followed by washing with PBS. The cells were permeabilized with 100% methanol for 20\u00a0min at room temperature and washed twice with PBS and were stained with crystal violet for 15\u00a0min at room temperature followed by washing twice with PBS. Remaining non-invasive cells from both treated and control were removed using cotton swabs. The inhibition of cell invasion ability was assessed by counting the cells and the images were captured at 40X under an inverted microscope .The invasion of Ag-NPs treated HeLa and control (untreated HeLa) cells was performed using transwell chambers . The chamber was pre-coated with Matrigel , and later HeLa cells were seeded into the upper chamber with serum free media at a density of 2\u2009\u00d7\u2009106 cells/dish) were incubated at 37\u00b0C for 24\u00a0h, and further treated with various doses of Ag-NPs (5 and 10\u00a0\u03bcg/ml) then re-incubated for another 24\u00a0h. The control cells were not treated with NPs. The cells were trypsinized and the floating cells were pelleted by centrifugation at 2,500\u00a0rpm for 2\u00a0min. The obtained pellet was washed with ice-cold PBS (1X) and resuspended in 100\u00a0\u03bcl binding buffer (1X). The cells were stained with both Annexin V-FITC (5\u00a0\u03bcl) and propidium iodide (10\u00a0\u03bcl) in dark for 15\u00a0min at room temperature and were diluted with 400\u00a0\u03bcl of binding buffer. Apoptotic and necrotic cells were evaluated by flow cytometer  and data analysis was performed using FACs Cell Quest Pro Software.Apoptosis induced by the Ag-NPs was assessed using an Annexin V-FITC apoptosis detection kit . HeLa cells , eggs treated with HeLa cells taken as positive control, eggs treated with 5, 10, and 15\u00a0\u00b5g/ml concentrations of Ag-NPs but with no HeLa cells, eggs treated with HeLa cells along with 10\u00a0\u00b5g/ml doxorubicin and eggs treated with both the HeLa cells as well as all the above doses of Ag-NPs.The surface of the eggs was cleaned with disinfectant prior to the treatment, egg candler was used to monitor the blood vessels and, a small hole was made and opened on snub side using dissection needle in the biosafety hood. On 11th day of incubation, a sterile 33G needle was used to inject 100\u00a0\u00b5l of individual doses of biogenic Ag-NPs  to both HeLa cell treated CAM and normal CAM surface, and with doxorubicin (10\u00a0\u00b5g/ml) as positive control. The hole(s) were covered with sterile wax and incubated at 37\u00b0C in a humidified incubator for 72\u00a0h, all the experiments were setup in triplicates. The eggs were examined for vascularization on the 14th day of incubation using stereomicroscope . The number of blood vessels in all the eggs was evaluated in percent values.p < 0.05) followed by Tukey\u2019s test.The statistical analysis was performed using Graphpad Prism version 6 software, USA. The outcomes of three separate experiments were interpreted as mean \u00b1 S.D. and data analysis was performed using both one-way and two-way analysis of variance  groups of the primary amide due to proteins of A. niger and 2,912.46\u00a0cm\u22121 corresponds to O\u2013H stretching of carboxylic group of protein. The reports documented that amino acid residues and peptide carbonyl groups have a strong affinity to bind with metals and serve as an encapsulating agent, thus preventing agglomeration of nanoparticles  which are spherical and oval in shape showing aggregation ofAg- NPs . TEM desSalmonella typhi, Escherichia coli) and gram positive (Staphylococcus aureus) pathogenic bacteria by agar well diffusion method, and compared with standard antibiotics like tetracycline and ciprofloxacin (10\u00a0\u00b5g/well). The Ag-NPs were found to be effective at all concentrations for the studied bacteria  was investigated against both gram negative  of early apoptotic population in Ag-NPs treatments, with control demonstrating 6.86%  PI (\u2212)) and lower right demonstrates early apoptotic stage (Annexin (+) PI (\u2212)), upper left quadrant shows necrotic cells (Annexin (\u2212) PI (+)) and upper right (Annexin (+) PI (+)) gives count for late apoptotic phase. Results revealed that Ag-NPs treatment on HeLa cells for 24\u00a0h with 5 and 10\u00a0\u00b5g/ml Ag-NPs induced apoptosis in a concentration dependent manner . Enhanceng 6.86% . It is cng 6.86%  in 5\u00a0\u00b5g/ng 6.86%  in 10\u00a0\u00b5gng 6.86% . It is ein vivo with inhibitors and stimulators. The negative control in this experiment was eggs that had not been exposed to HeLa cells, and the vascular development in the negative control was assumed to be 100% for the measurement of angiogenesis percentage. Comparison of the mean of the number of blood vessel and percentage of angiogenesis are shown in p < 0.05) of HeLa cells inoculated CAM cells. The CAM arrangement tends to be clustered with obtruded blood vessel formation or destroyed vascular organization in all the effective dosages of nanoparticles in comparison to control groups. According to our findings, these silver nanoparticles have a dose-dependent cytotoxic impact on blood vessel endothelial cells, limiting blood vessel development in CAM.The CAM assay is a dependable method to study angiogenesis A. niger isolated from marine sponge are well documented for natural products like asperic acid, asperazine, hexylitaconic acid, and malformin C, 3,3\u2032-bicoumarin bicoumanigrin, 6-pyridinone derivates (aspernigrins A and B), furan and pyrano pyrroles pyranonigrins  of the synthesized Ag-NPs . The UV\u2013+ ions to enter the cell and lipopolysaccharide layer comprising of negative charge which attracts Ag+ ions causing enhanced uptake leading to destruction of cell wall  usually binds to the receptor of endothelial cells by activating the PI3K/Akt pathway and thereby lead to angiogenesis . GurunatA. niger inhabiting marine sponge. The biogenic Ag-NPs was highly stable with size lesser than 50\u00a0nm and crystalline nature. In the biological use of Ag-NPs, we discovered that the Ag-NPs exhibits promising antimicrobial efficacy against the studied pathogenic bacteria. Meanwhile, in vitro and in vivo assessment have demonstrated concentration dependent anti-proliferative, anti-invasive, pro-apoptotic and anti-angiogenic activities against HeLa cell lines. The results provides an insight on the use of biogenic Ag-NPs for future therapeutic application, as an alternative to commercial available drugs, with which further studies needs to be carried out.The present investigation concerns with novel biosynthesized Ag-NPs using"}
{"text": "The Fatty Liver Index (FLI) is a proxy for the steatotic component of non-alcoholic fatty liver disease (NAFLD). For sub-Saharan African populations, the contribution of dietary factors to the development of NAFLD in the etiology of type 2 diabetes mellitus (T2DM) remains to be clarified. We identified sex-specific dietary patterns (DPs) related to the FLI using reduced ranked regression (RRR) and evaluated the associations of these DPs with T2DM. This analysis used data from the RODAM, a multi-center cross-sectional study of Ghanaian populations living in Ghana and Europe. The daily intake frequencies of 30 food groups served as the predictor variables, while the FLI was the response variable. The odds ratios and 95% confidence intervals for T2DM were calculated per one standard deviation increase in the DP score using logistic regression. In males, the DP score explained 9.9% of the variation in their food intake and 16.0% of the variation in the FLI. This DP was characterized by high intakes of poultry, whole-grain cereals, coffee and tea, condiments, and potatoes, and the chance of T2DM was 45% higher per 1 DP score-SD (Model 2). Our results indicate that the intake of modernized foods was associated with proxies of NAFLD, possibly underlying the metabolic pathways to developing T2DM. In sub-Saharan Africa (SSA) and in African migrants living in Europe, type 2 diabetes mellitus (T2DM) constitutes a major health problem ,2, and tTo date, the rapid economic transition and urbanization in SSA as well as the sudden lifestyle changes upon migration from Africa to Europe are among the proposed reasons for the upsurge of T2DM among these populations . The parHere, we present two methodological advancements to study the etiologic pathways from a diet through NAFLD up to T2DM in SSA populations under various transitions. First, the method of reduced rank regression (RRR) is applied to derive dietary patterns (DPs) related to the proxy markers of NAFLD. RRR determines linear combinations of food groups as the predictor variables by maximizing the explained variation in these proxy markers as the response variables . This apConsidering that NAFLD and T2DM frequently co-occur within subjects and share similar risk factors, we hypothesized that RRR-derived DPs related to NAFLD and characterized by modernized foods are associated with T2DM. Therefore, this study aimed to establish sex-specific DPs related to FLI by RRR and determine the associations between these DPs and T2DM among Ghanaian populations under transition.n = 946), urban Ghana (n = 1619), Amsterdam (n = 1900), London (n = 1258) and Berlin (n = 662). For recruitment in Ghana, the census data of 2010 were used to draw urban (Kumasi and Obuasi) and rural participants from the Ashanti Region. The response rates in rural and urban Ghana were 76% and 74%, respectively. In Amsterdam, random selection was performed by using the municipal register to select Ghanaian migrants, who were invited by postal mail and home visits. In Amsterdam, 67% replied by response card or after a home visit, and of these, 53% of the respondents consented to participate in the study. In London, of those individuals who were invited based on their registration in Ghanaian organizations, 75% agreed and participated in the study. Berlin had a participation rate of 68%.The Research on Obesity and Diabetes among African Migrants (RODAM) study is a multi-center cross-sectional study that aims to investigate the relative contributions of lifestyle and other risk factors to obesity and T2DM among African migrants in Europe and their counterparts living in rural and urban Ghana. A detailed description of the study design and procedures has been presented elsewhere . In brieThe study protocol was reviewed and approved by the local ethics committees in Ghana , the Netherlands , the UK  and Germany (Ethics Committee of Charite-Universitatsmedizin Berlin). All participants who took part in the study were thoroughly informed about the purpose and procedures of the study and gave written informed consent.Fasting venous blood samples were collected by trained personnel according to standard operating procedures. Serum and plasma samples were obtained through centrifugation and stored at \u221280 \u00b0C until analysis. The enzymatic method (hexokinase) was used to measure the fasting blood glucose in the plasma. All biochemical analyses were performed using an ABX Pentra 400 chemistry analyzer . T2DM was defined according to the WHO guidelines as fasting plasma glucose \u22657.0 mmol/L or documented use of glucose-lowering medication or self-reported diabetes. The serum lipid profile  was measured using immunoturbidimetric assays. The biomarkers of inflammation and liver function comprised C-reactive protein (CRP), aspartate aminotransferase (AST), alanine aminotransferase (ALT) and \u03b3-glutamyl transferase (GGT). We used two sets of proxy markers to define NAFLD. These were the FLI as a single marker and a selection of biomarkers as the second set of proxy markers. The FLI was calculated for each participant according to the algorithm by Bedogni et al. (2006) . The forA semi-quantitative Ghana-specific food propensity questionnaire (Ghana-FPQ) was used to determine the usual dietary intake of 134 food items. The usual weekly intake frequencies of food groups were documented in pre-defined portion sizes for the past 12 months. We calculated the amounts of food intake (g/d) using common household measures and translated these into energy intake and nutrient consumption by applying the West African Food Composition Table (2012) and the German Nutrient Database 2010). The food items were grouped into 30 food groups according to their culinary use and nutrient profiles [. The foo2).All information on the socio-demographics, education levels, medical histories and lifestyle factors was collected using a structured questionnaire, either self-administered or by an interviewer in the preferred language. The educational status of the participants was categorized into four levels: never or elementary, lower, intermediate and higher or tertiary. Physical activity was assessed using the WHO surveillance questionnaire, and the answers were subsequently classified based on the guidelines of the IPAQ group into three levels of total physical activity: low, moderate and high . SmokingData processing and analysis was performed using the Statistical Analysis Software (SAS) (version 9.4). Participants with missing data for the variables of interest were excluded from the present analysis. Details of the exclusions are presented in Owing to the differences in dietary intakes, adipose tissue distribution, and observed T2DM prevalence between males and females, all subsequent analyses were conducted separately for males and females. First, we used RRR to derive dietary pattern (DP) scores related to the FLI as a proxy marker of NAFLD. The RRR method determined the linear combinations of predictor variables (= 30 food groups) that explained as much variation as possible in the response variable (log transformed FLI). This method has been explained in detail by Hoffmann et al. (2004) . Second,The associations between the RRR-derived DPs and T2DM were calculated by logistic regression analyses. The odds ratios and their 95% confidence intervals (CIs) for T2DM were calculated across the quintiles of the RRR-derived DP scores by using the first quintile as the reference category and per 1 score-SD. To assess the linearity assumption, we calculated the odds ratios and their 95% confidence intervals (Cls) across the quintiles of the RRR-derived DP scores, using the first quintile as the reference category. Linear trends across the quintiles were tested by modeling the median of each quintile as a continuous variable. For the associations with the FLI-related DP scores, we sequentially adjusted for the age (years) and study site  (Model 1) as well as the education level (4 categories), energy intake , smoking status (yes or no), physical activity (METs-h/week), and alcohol consumption (g/day) (Model 2). For the associations with the DPs related to the biomarkers, we additionally adjusted for the BMI and waist circumference (Model 3).In sensitivity analyses, we excluded participants with self-reported T2DM to address a potential source of reverse causation. Specifically, individuals with known T2DM who received medical treatment might have presented altered biomarkers and could have changed their diets. Consequently, we repeated all RRR analyses using the FLI or NAFLD biomarkers as response variables for both males and females. In addition, we repeated the final regression analysis for the association between RRR-derived DPs and T2DM, applying an HbA1c-based definition of the outcome, namely HbA1c \u2265 48 mmol/mol, self-reported diabetes or the use of glucose-lowering medication.2 vs. 27.8 \u00b1 5.7 kg/m2) and waist circumference (87 \u00b1 12.1 cm vs. 91 \u00b1 12.5 cm) were lower in males than in females. The participants in London showed the lowest level of physical activity  and the highest BMI (29.4 \u00b1 4.8 kg/m2) and waist circumference (95.4 \u00b1 11.3cm), while rural Ghana showed the lowest BMI (22.7 \u00b1 4.3 kg/m2) and waist circumference (81.2 \u00b1 10.9 cm) and the highest physical activity level .The estimated mean energy intake was 2533 \u00b1 837 kcal/d, and this was higher among males than females and highest in Berlin, followed by London, rural Ghana, Amsterdam and urban Ghana . The meaIn the sensitivity analysis , similarThe associations with T2DM are shown per quintile and per one SD of the RRR-derived DP scores in In the sensitivity analysis , we applIn addition to the FLI-related DP scores, we also extracted two DP scores related to the biomarkers of NAFLD . The explained variations in the NAFLD biomarkers and the response weights for the RRR-derived DP scores are presented in p for trend across quintiles = 0.0002; OR per 1 score-SD increase: 1.42; 95% CI: 1.20\u20131.68). However, this association attenuated to the null when adjusting for demographics, socioeconomics, lifestyle and anthropometry. Contrary to the males, there was no clear linear trend for the associations across quintiles with T2DM status (p for trend >0.05). Positive associations ranged from 8% increased odds of T2DM in the crude model (95% CI: 0.93\u20131.25) to 30% increased odds of T2DM in Model 3 (95% CI: 0.99\u20131.71) per one score-SD increase.Again, we conducted sensitivity analysis using an HbA1c definition as the outcome variable . The corThe relationships between NAFLD and T2DM with respect to their dietary risk factors informed the derivation of DP scores by applying the RRR method. We used two sets of proxy markers for NAFLD  as response variables and the habitual consumption of 30 food groups as predictor variables. The FLI-related DPs were characterized by frequent intakes of modernized foods and were positively associated with the odds of T2DM. This association was stronger in males than in females. The RRR-derived DP scores using CRP, liver enzymes and blood lipids as the response variables showed inconsistent relationships with food intake between males and females and implausible associations with T2DM.In our first approach, the FLI was used as a proxy marker for NALFD and as the response variable in the RRR analysis. The respective FLI-related DPs were similar between males and females and were characterized by frequent intakes of poultry, whole-grain cereals, coffee and tea, condiments, potatoes, alcoholic beverages, margarine and fish, while fermented maize products, refines cereals, roots, tubers and plantains and palm oil showed inverse correlations with the FLI. These DPs correspond to the nutrition transition observed for SSA populations when experiencing rapid economic growth, accelerated urbanization and migration to Europe ,26.Our findings partly accord with recent evidence from a meta-analysis on dietary risk factors of NAFLD . Red meaWhile many studies confirm the benefits of poultry and fish as part of a healthy diet ,33, thisInterestingly, we observed stronger relationships for the FLI-related DPs among males compared with females, despite the fact that the characteristic food groups and the explained variation in the FLI were similar between sexes. This may reflect the sex-specific contributions of NAFLD to the etiology of T2DM. Indeed, recent findings from the RODAM study confirmed the increased odds of T2DM among participants with an FLI \u226560 compared with an FLI <60. This association is stronger in men  than in women  . FurtherAdditionally, in an urban Ghanaian case control study, Frank et al. derived a DP using RRR that has been positively related with serum triglycerides and inversely related with adiponectin. This pattern is associated with higher odds of T2DM and shares similar features with the RRR-derived DPs in the present analysis, being characterized by high consumption of starchy foods and low intake of fruits and vegetables . The comIn our second approach, we used a selection of proxy markers for NAFLD as response variables for the RRR analysis, comprising liver enzymes, blood lipids and CRP. In this analysis, we observed inconsistent DP scores between men and women and biologically implausible associations with T2DM. Presumably, this selection of biomarkers may not be specific enough to operationalize NAFLD, as they also reflect other metabolic pathways to T2DM, including chronic inflammation (CRP) and dyslipidemia (blood lipids) , which mWhen interpreting the findings of our study, some limitations need to be acknowledged. First, the definition of NAFLD by the use of the FLI as a proxy marker without liver biopsy or imaging may shield detailed information on the severity classification of a fatty liver . HoweverWe identified DPs that showed adherence to modernized foods and a positive relation with the FLI, a proxy marker for fatty liver disease. These DPs were positively associated with the odds of T2DM, particularly in males. These findings give credence to the concept that modernized dietary practices among Ghanaian populations under transition may underly metabolic pathways to NAFLD and T2DM."}
{"text": "Anterior cruciate ligament injury arises when the knee anterior ligament fibers are stretched, partially torn, or completely torn. Operated patients either end up re-injuring their reconstructed anterior cruciate ligament or majority develop early osteoarthritis regardless of the remarkable improvements of surgical techniques and the widely available rehabilitation best practices. New mechanism theories of non-contact anterior cruciate ligament injury and delayed onset muscle soreness could provide a novel perspective how to respond to this clinical challenge.A tri-phasic injury model is proposed for these non-contact injuries. Mechano-energetic microdamage of the proprioceptive sensory nerve terminals is suggested to be the first-phase injury that is followed by a harsher tissue damage in the second phase. The longitudinal dimension is the third phase and that is the equivalent of the repeated bout effect of delayed onset muscle soreness. Current paper puts this longitudinal injury phase into perspective as the phase when the long-term memory consolidation and reconsolidation of this learning related neuronal injury evolves and the phase when the extent of the neuronal regeneration is determined. Reinstating the mitochondrial energy supply and \u2018breathing capacity\u2019 of the injured proprioceptive sensory neurons during this period is emphasized, as avoiding fatigue, overuse, overload and re-injury.Extended use, minimum up to a year or even longer, of a current rehabilitation technique, namely moderate intensity low resistance stationary cycling, is recommended preferably at the end of the day. This exercise therapeutic strategy should be a supplementation to the currently used rehabilitation best practices as a knee anti-aging maintenance effort. Anterior cruciate ligament (ACL) injury arises when the knee anterior ligament fibers are stretched, partially torn, or completely torn. The average annual increase of ACL injuries has shown a gradual increase in the past two decades among collegiate athletes , but simNon-contact ACL injury, involving around 80% of ACL injuries , 6\u201311, iAccordingly, this proprioceptive neuronal impairment is suggested to alter the static encoding of the affected stretch reflex in order to enhance postural control, enhance anti-gravitational capacity and to enhance shock attenuation , 12. SpiIt is notable that very small area, approximately 1%, of ACL consists of proprioceptors and some of them contribute to the position sense of the knee joint \u201319. AccoWe could possibly learn from the longitudinal dimension of DOMS and that is the repeated bout effect (RBE). Initial bout of severe DOMS-inducing unaccustomed exercise entailing eccentric contractions could be evoked for at least 6\u00a0months, but is lost between 9 and 12\u00a0months , 30. MorMemory consolidation is a lengthy, time-dependent process leading to altered and strengthened synaptic connections between neurons. The memory dimensions of these proprioceptive TAD like lesions entail several memory pathways, like short-term working memory, long-term episodic memory, inflammation and pain memory . NoteworOverall, we have every ground to suspect that ACL injuries have their own RBE that involves for example the initiation of fear memory consolidation. The lack of extinction of this RBE protective mechanism without the full functional regeneration of these proprioceptive neurons could elongate this \u2018third injury phase\u2019 with facilitated long-term memory reconsolidation and accelerated aging. Strategic focus on the maximization of the functional regeneration of these injured peripheral proprioceptive sensory neurons and the minimization of their long-term memory consolidation processes, including fear memory, is what seems to be the missing link.An earlier finding is that long-term or extended, but light to moderate concentric exercise could alleviate the symptoms of the chronic dimension of this type of proprioceptive terminal microdamage or axonal injury , 35. TheImportant to emphasize the significance of these proprioceptive sensory neurons, because they are suggested to be guiding growth, regeneration and remodelling . CurrentModerate evidence is highlighting that the quadriceps torque variability increases over time after ACLR , 38. MorEssential part of the recommended strategy is to avoid further proprioceptive sensory injury, fatigue, overuse and overloading, especially up to at least one year after ACLR, because they could facilitate the compensatory secondary microcircuits with concomitant low-grade neuroinflammation and detrimental facilitation of long-term memory reconsolidation . Good neThe incidence of second ACL injury rates are reported to be 23% , while eImportant to note, that proprioceptive loading has two dimensions after ACLR. First, the secondary spinal compensatory mechanism as a result of the neuronal microinjury and the resultant spinal loading uses more synaptic connections which means enhanced neuro-energetic usage. This secondary compensatory mechanism is theorized to be represented in the delayed latency of the medium latency response (MLR) of the stretch reflex and affects the static encoding of the stretch reflex , 12. AccIndicative from animal studies, that ASIC3 ion channels, in addition to the primary Piezo2 channels, are involved in proprioceptive mechanotransduction , 49. FurMoreover, the two dimensions of proprioceptive loading could be interrelated through GABAergic pathways. The reduction of GABAergic inhibition in the spinal cord ventral horn could contribute to the generation of persistent inward currents and exaggerated quadriceps contractions , 53, as Both of the above proprioceptive loading dimensions are suggested to be alleviated or circumvented by low resistance moderate intensity stationary bicycle training . MoreoveIn addition, the symmetric loading and cyclic feature of cycling have favourable effect on postural control and gait performance  since alAfter all, the take away message is not to stop cycling too early in the rehabilitation process of ACLR, but follow up on an extended way for at least a year or even longer, as a knee anti-aging maintenance effort. It needs to be emphasized that the proposed strategy in perspective cannot hurt and is currently in use in the early stage of ACLR rehabilitation as a best practice solution, but should be prescribed in an extended way!"}
{"text": "Background: The coronavirus disease 2019 (COVID-19) pandemic outbreak has posed new problems in the context of patients suffering from other diseases. In particular, musculoskeletal sequelae related to the state of debilitation associated with COVID-19 are important to consider in elderly patients undergoing surgery after lower limbs fracture, especially in the post-operative period. The objective of this study was to evaluate whether COVID-19 influenced biochemical parameter, recovery and mortality of surgically treated patients suffering from lower extremity fractures. Methods: Laboratory and clinical data of 30 patients were extrapolated and analyzed in the pre-operative and post-operative periods. Among these patients, 13 had COVID-19 infection (COVID-19 +), whereas 17 had no signs of COVID-19 infections (COVID-19 \u2212). Long-term clinical and functional outcomes were also analyzed. Results: Lower calcium, slightly higher values of CRP and much higher values of CPK and AST were observed pre-operatively in COVID-19 + patients, who also showed higher prevalence of long-term sequelae than COVID-19 \u2212 patients. Conclusions: COVID-19 affects long-term outcome of elderly patients with lower limb fractures in a multifactorial way. First, the virus directly damages the muscle tissue. Secondly, the lung function impairment worsens the overall performance, making rehabilitation more challenging. Fractures of the lower limbs, especially proximal femoral fractures, are quite common in the elderly. This segment of the population is considered particularly fragile due to the numerous comorbidities that can occur with increasing years; hence, it represents a critical group of patients. For these patients, coronavirus disease 2019 (COVID-19) is a further danger. In fact, it was reported that case fatality ratio (CFR) of COVID-19 increases with age. Considering an overall Italian CFR of 7.2%, its values ranged from less than 0.4% in 40 s or younger patients, 1% in 50 s, 3.5% in 60 s, 12.8% in 70 s to 20.2% in 80 s and above [In addition, musculoskeletal sequelae were evidenced in the short term, and they probably persist in the long term after COVID-19 infection . In partIn the musculoskeletal context, falls, which represent the most common mechanism for hip fracture during the pandemic outbreak, can be considered low-energy injuries associated with COVID-19 infection in elderly .The aim of the present study was to evaluate whether COVID-19 influenced post-surgical biochemical parameters, recovery and mortality in patients undergoing surgery after fracture of the femur, tibia or fibula, compared to patients without COVID-19 in the first and second wave of the pandemic in Italy.From April 2020 to November 2020, 30 patients having femur, tibia or fibula fractures were enrolled at IRCCS Istituto Ortopedico Galeazzi. Written informed consent for the participation in this study was obtained from all participants  per lo studio di patologie che interessano l\u2019apparato muscolo-scheletrico e il sistema nervoso centrale\u201d; NCT03208062). The study protocol was approved by the San Raffaele Hospital Ethical Review Board. Demographic and clinical data and serum samples of the enrolled patients were collected.Before surgery, all patients underwent nasopharyngeal swab to determine whether they were infected with SARS-CoV-2 and were hospitalized in a dedicated area, awaiting the result of the molecular test. In case of infection, the patients were transferred to a dedicated ward. All patients were treated surgically, under spinal anesthesia, within 48 h from clinical presentation. They received peri-operative antibiotic and anti-thromboembolic prophylaxis and analgesic therapy. Rehabilitation began, where possible, the day after surgery in order to allow for an early verticalization.As soon as they stabilized from a clinical point of view, the patients were transferred to a facility dedicated to rehabilitation, and they were discharged once they reached ambulatory autonomy. In case of persisting lack of independence, the patients were sent to long-term care facilities or to their home with assistance.Data concerning age, sex, diagnosis, relevant comorbidities, pharmacological treatments, complications and post-surgical transfusion of the patients were collected. The time elapsed between the surgery and the standing positioning of the patient and the mean overall stay in rehabilitation were evaluated. Patients were also evaluated after 8\u201314 months to assess the long-term outcomes and complications after orthopedic healing. During the follow-up, the most frequently reported complications of COVID-19 infection in the literature were searched in addition to the outcomes closely related to fractures and their management , such asThe clinical analysis was carried out by telephone interview by medical staff experienced in remote assessment. This was executed in order to minimize patient transfers as much as possible, given the pandemic period.Quantitative reverse transcription\u2013polymerase chain reaction (qRT-PCR) of nasopharyngeal swabs were performed to assess the presence of COVID-19. Briefly, viral RNA was extracted using total RNA Purification Kit  and the molecular detection of the SARS-CoV-2 genome was analyzed by RT-PCR using COVID-19 HT Screen kit , targeting N1 and N2 genes. Among the 30 enrolled patients, SARS-CoV-2 genes were detected in 13 patients (COVID-19 +), whereas 17 were negative for COVID-19 infection (COVID-19 \u2212).Routine blood tests were performed on patients\u2019 admission and post-surgical intervention. Hematological analyses  were performed on a Sysmex XN-2000 .Coagulation tests  were analyzed on a Sysmex CS 2500 .\u00ae CH Analyzer .Biochemical parameters  were measured on an AtellicaA complete list of the analyzed parameters with their acronym and unit of measure is reported in t test or Mann\u2013Whitney test to compare two groups one-way ANOVA or Kruskal\u2013Wallis tests were used to compare three groups in case of Gaussian or non-Gaussian distribution of the data, respectively. For the analysis of biochemical data, Kolmogorov\u2013Smirnov normality test was used to assess the data distribution. Unpaired p value of \u22640.05 was considered significative, 0.09 \u2265 p > 0.05 was considered as a tendency. GraphPad Prism 6.0  was used for the statistical analysis of data. A The evaluation of the presence of long-term sequelae in COVID-19 + and COVID-19 \u2212 patients was performed using Chi-square test for dichotomous variables and through the Wilcoxon signed rank test for continuous variables .Thirty patients, all affected by a fracture of the lower limb, were included in the study; in particular, 28 suffered a proximal femoral fracture, 1 a tibial fracture and 1 a hip peri-prosthetic fracture. Among the 30 patients, 13 were COVID-19 + and 17 were COVID-19 \u2212.There were 24 women  and 6 men .The average age of all analyzed patients was 80.6 \u00b1 9.3 years, the average age of COVID-19 + patients was 79.5 \u00b1 8.6 years and that of COVID-19 \u2212 patients was 81.4 \u00b1 9.9. Post-operative pharmacological treatments included Low Molecular Weight Heparin (LMWH), antibiotic prophylaxis, nonsteroidal anti-inflammatory drugs (NSAIDS) and steroids administration.At least one post-operative blood transfusion was performed in 66.7% of patients; of those, 61.6% were COVID-19 + and 70.6% were COVID-19 \u2212.In our cohort, 3 patients  were hospitalized in the Intensive Care Unit (ICU) after surgery. All 3 patients were COVID-19 +. One of these patients died from post-operative cardiological complications. None of the COVID-19 \u2212 patients required ICU hospitalization after surgery. For overall patients, the mean time elapsed between the surgery and the standing positioning was 3.3 \u00b1 1.3 days; in particular, it was 3.2 \u00b1 1.8 and 3.4 \u00b1 1.3 days for COVID-19 + and COVID-19 \u2212 patients, respectively. The mean overall stay in rehabilitation wards was 76.2 days \u00b1 46.4; in particular, it was 75.4 days \u00b1 46.5 and 76, 7 \u00b1 47.7 days for COVID-19 + and COVID-19 \u2212 patients, respectively. The time elapsed between hospital admission and the mean follow-up of all patients analyzed was 11.7 \u00b1 2.4 months: 9.9 \u00b1 2.8 months and 13.0 \u00b1 0.4 months for COVID-19 + and COVID-19 \u2212 patients, respectively. At follow-up, 36.7% of patients regained a level of independence comparable to that prior to the fracture. This percentage drops to 10% in patients with COVID-19 infection. Return to sociability as before the pathological event was reported in 61.5% of COVID-19 + patients compared to 64.7% of COVID-19 \u2212 patients. A higher percentage of COVID-19 + patients (69.2%) complained of sleep disorders compared to 41.2% of COVID-19 \u2212 patients. Among COVID-19 + patients, 76.9% complained about a certain degree of mental fog, described as focus trouble or difficulty to remember commonly used names and words. This percentage drops to 17.6% for COVID-19 \u2212 patients. Similarly, 76.9% of COVID-19 + and 23.5% of COVID-19 \u2212 patients complained of fatigue. Gastrointestinal problems such as loss of appetite, nausea and diarrhea were reported by 61.5% of COVID-19 + patients and 23.5% of COVID-19 \u2212 patients. As expected, 46.2% of COVID-19 + patients developed lung problems versus 5.9% of COVID-19 \u2212 subjects, following hospitalization for fracture. Moreover, 6.9% of COVID-19 + patients developed dyspnea on moderate exertion, whereas none of the COVID-19 \u2212 subjects developed this kind of symptom. After surgery and rehabilitation, 61.5% of COVID-19 + and 35.3% of COVID-19 \u2212 patients complained of arthomyalgia. The association between COVID-19 positivity during hospitalization and the presence of long-term sequelae were further investigated. In order to analyze the impact that COVID-19 has on people\u2019s health status and quality of life, the odds ratios of the most frequent clinical manifestations such as mental fog, dyspnea and fatigue in relation to the pathology were calculated and are showed in A total of 38.5% of COVID-19 + patients required the use of a new chronic drug therapy following surgery, compared to 17.6% of COVID-19 \u2212 patients. Two COVID-19 \u2212 subjects (11.7%) died after surgery and hospitalization. 3/\u00b5L versus 0.6 \u00b1 0.2 \u00d7 103/\u00b5L pre-surgery, p = 0.05). COVID-19 + patients showed a higher number of monocytes pre-surgery in comparison with COVID-19 \u2212 patients , without changes during the two first days after surgery.No modifications were observed in the number of white blood cells, in particular neutrophils and lymphocytes, neither from pre-surgery to day 2 post-surgery nor between COVID-19 \u2212 and COVID-19 + patients. An increased number of monocytes was noted on day 1 after surgery in COVID-19 \u2212 patients , activated partial thromboplastin time (APTT) and fibrinogen. p < 0.0001) and in both COVID-19 \u2212  and COVID-19 +  categories, without differences between groups. Hemoglobin levels significantly decreased from pre-surgery to day 1 and day 2 after surgery in all patients . Lower levels of calcium were observed in COVID-19 + patients pre-surgery (p = 0.02) and day 1 post-surgery  in comparison with COVID-19 \u2013 subjects; these values became similar on the second day after surgery. No changes in urea and creatinine levels were observed neither during the first two days after surgery nor between groups. Calcium levels decreased from pre-surgery to day 1 and day 2 post-surgery in all groups  and COVID-19 \u2212  patients, whereas in COVID-19 + patients values increased only from pre-surgery (7.4 \u00b1 6.0 mg/dL) to day 2 post-surgery  since these patients started from higher pre-surgical levels of this protein. No differences in CRP levels were observed between groups. The inflammatory marker C-reactive protein (CRP) increased from pre-surgery to day 1 and day 2 post surgery in all . For these markers, COVID-19 + patients showed higher pre-surgical levels which remained high post-surgery (Muscular markers creatine phosphokinase (CPK) and aspartate aminotransferase (AST) showed post-surgical increase in COVID-19 \u2212 group (112.5 \u00b1 124.4 U/L pre-surgery, 272.6 \u00b1 173.7 U/L day 1 post-surgery, -surgery . The data of the present study revealed that the long-term orthopedic complications in patients suffering simultaneously from a fragility fracture of the lower limb and COVID-19 infection are, in general, comparable to fractured subjects that did not experience this viral infection during hospitalization. From a laboratory point of view, our data show that the level of CRP is increased in the pre-operative period in COVID-19 + patients. This is compatible with a viral infection pre-existing at the fracture of the lower limb. The lower levels of calcium observed in COVID-19 + are in agreement with literature reports showing that calcium balance is a primal hit of COVID-19, closely related with the virus-associated multiple organ injuries, the increase in inflammatory cytokines  and the Of note, muscle damage markers, especially CPK and AST, display higher values in COVID-19 + patients. The important systemic inflammation in COVID-19 patients can impact nearly every organ system, including the musculoskeletal system . One-quaFrom a clinical point of view, the hospitalization length and the rehabilitation program were not significantly modified between the two groups of patients. However, COVID-19 + patients presented significantly more long-term sequelae, such as mental fog, dyspnea and fatigue. Thus, our data confirm previous studies reporting long-term disabling problems after SARS-CoV-2 infection .These concomitant pathlogies can negatively impact the recovery after a fracture in elderly patients, who usually suffer from other comorbidities. Indeed, elderlies are more subjected to complications after a fracture. For example, the traumatic event may cause thrombotic and consequent cardiovascular problems. In addition, the prolonged immobilization and hospitalization frequently lead to the development of pressure sores, pneumonia and urinary tract infections in these fragile patients. In this context, the concomitant SARS-CoV-2 infection may further worsen the clinical outcomes, especially in the long-term. Our data did not show a significant worse outcome in these patients compared to subjects without SARS-CoV-2 infection; however, a larger sample size and a longer follow-up may highlight clinical differences between the two groups. In fact, the main limitation of this study is the insufficient sample size, which could prevent detecting significant difference or bias.In conclusion, lower limb fractures in the elderly population represent life-threatening injuries, and surgery is required to provide effective pain relief, enable early mobilization and reduce morbidity and mortality. Despite the presence of SARS-CoV-2 infection, the multifactorial worsening of the long-term outcome of these patients should be carefully managed. In addition, the myalgias and fatigue consequent to the muscular damage caused by the virus may negatively impact the rehabilitation. Moreover, the COVID-19 related lung damage worsens the respiratory function, affecting the patient\u2019s general performance. In this complex contest, particular attention should be paid to treatment of the long-term COVID-19 sequelae in order to improve the clinical outcomes of these fragile patients."}
{"text": "The ongoing COVID-19 pandemic has underscored the need to optimize care for one of the most affected sectors: older adults in nursing homes and more specifically highly vulnerable populations such as residents with dementia. Research developed in collaboration with stakeholders can optimize impact, relevance, and trustworthiness of study findings thereby informing advances in care. Yet, evidence on stakeholder driven research for enhancing dementia care is limited. This symposium will provide examples of stakeholder-driven research questions that were addressed with stakeholder engagement. First, we will present current evidence about the perspectives of caregivers, including those from communities of color. The second presentation will discuss the perspective of clinical training stakeholders responsible for supporting system-wide clinical program implementation and their experiences with early and later adopter nursing homes within the context of a clinical trial. The third presentation will address the perspective of policy makers and payers via the effect of state-mandated dementia training on resident outcomes. The fourth and final present the findings from a study that examined how nursing home stakeholders responded to a payor requirements for pharmacy services and the relationship between that response and patient outcomes. We will conclude the session with a discussion of stakeholder-engagement methods and recommendations for future nursing home research, which champions stakeholder collaboration."}
{"text": "The ongoing COVID-19 pandemic has underscored the need to optimize care for one of the most affected sectors: older adults in nursing homes and more specifically highly vulnerable populations such as residents with dementia. Research developed in collaboration with stakeholders can optimize impact, relevance, and trustworthiness of study findings thereby informing advances in care. Yet, evidence on stakeholder driven research for enhancing dementia care is limited. This symposium will provide examples of stakeholder-driven research questions that were addressed with stakeholder engagement. First, we will present current evidence about the perspectives of caregivers, including those from communities of color. The second presentation will discuss the perspective of clinical training stakeholders responsible for supporting system-wide clinical program implementation and their experiences with early and later adopter nursing homes within the context of a clinical trial. The third presentation will address the perspective of policy makers and payers via the effect of state-mandated dementia training on resident outcomes. The fourth and final present the findings from a study that examined how nursing home stakeholders responded to a payor requirements for pharmacy services and the relationship between that response and patient outcomes. We will conclude the session with a discussion of stakeholder-engagement methods and recommendations for future nursing home research, which champions stakeholder collaboration."}
{"text": "Congenital factor VII (FVII) deficiency is a rare inherited autosomal recessive disorder characterized by prolongation of prothrombin time and low FVII coagulation activity, which may increase the risk of bleeding.A 66\u2010year\u2010old man with acute postoperative intracranial hemorrhage was transferred to our hospital owing to coagulation dysfunction. In coagulation tests, the FVII coagulation activity was less than 2%. Genetic analysis of the gene encoding FVII identified compound heterozygous mutations: c. 681+1 G>T and c. C1286T .To our knowledge, this is the first report describing the c. C1286T  mutation in the FVII\u2010encoding gene. We suggest that these mutations resulted in the reduced FVII activity and abnormal clotting in our patient after brain surgery. Computed tomography (CT) scan showed postoperative rebleeding at the right basal ganglia. The percentage of FVII coagulation activity (FVII:C) determines whether FVII deficiency is mild (>20% but <70%), moderate (10\u201320%), or severe (<10%).2A 66\u2010year\u2010old man with acute postoperative intracranial hemorrhage was referred to our hospital owing to coagulation dysfunction. His Glasgow Coma Scale score was E1VTM2. Laboratory examination revealed a significantly isolated prolonged prothrombin time (PT) (33.6\u00a0s) and low FVII coagulation activity (1.8%); the activated partial thromboplastin time and thrombin time were normal. The patient did not take anticoagulants or antiplatelet drugs and had no history of bleeding diseases. We collected and collated the relevant examination reports of this patient, and the results are shown in Figure\u00a09/L; mean platelet volume, 10.10 fL; and platelet count \u00d7mean platelet volume, 0.19).\u00a0Finally, the activities of other plasma coagulation factors were normal or above normal  but the activities of coagulation factor VII were low (1.8%). Therefore, by process of elimination, our diagnosis was FVII deficiency.Because FVII deficiency is rare, we initially considered the following as potential causes of our patient's coagulation disorder. First, most clotting factors (except for factor III) are synthesized in the liver, and our patient had a history of hepatitis B. However, examination of transaminase levels indicated normal liver function . Second, activation of the clotting factors  is vitamin K\u2010dependent. Our patient had received vitamin K supplements at another hospital and thus was not vitamin K\u2010deficient. Third, although platelets are required for coagulation, routine blood tests revealed no abnormalities in platelet number or size  in exon 9.To determine whether our patient's FVII deficiency was acquired or congenital, we used samples of his peripheral blood for second\u2010generation sequencing: 86\u00a0genes related to thrombosis and hemostasis  for 11\u00a0days after admission, resulting in a relatively good PT (19.8\u201324.4\u00a0s). He also twice received fresh frozen plasma in combination with rFVIIa, and on the 19th day of admission, rFVIIa alone. The total dose of rFVIIa was 15\u00a0mg; for economic reasons, rFVIIa was only administered three times. The PT was maintained at 22.3\u201324.8\u00a0s during the combined treatment. After 2\u00a0months of therapy, he was discharged uneventfully.3rFVIIa is considered the most effective treatment for congenital FVII deficiency with severe bleeding, but has three main disadvantages: (1) it requires frequent bolus injections to offset its short half\u2010life, (2) it is difficult to obtain, and (3) it is extremely expensive. Fresh frozen plasma also has a short life and requires frequent injections; however, it is cheap and easily available and can be used in large quantities over time to maintain a reasonable PT value.F7\u00a0mutations uncovered new missense mutations in only 33 of 140 cases of congenital FVII deficiency; among the 140 cases, more than 70 were reported in the past 10\u00a0years. Relevant information is summarized in Table\u00a0A literature search of F7\u00a0gene, which is located on chromosome 13.https://f7\u2010db.eahad.org/). In these cases, the most severe and common symptom was intracranial hemorrhage (2 cases), which was consistent with the patient we reported, and other manifestations included gastrointestinal bleeding (1 case), easy bruising (1 case), menorrhagia, and gum bleeding (1 case). Furthermore, the patients\u2019 age in previous reports was almost less than 40 (3\u00a0days\u201338\u00a0years). However, we report a 66\u2010year\u2010old congenital FVII deficiency elder patient. Although Ala429\u00a0mutations have been reported before ,According to the report, more than 200\u00a0mutations, mostly missense mutations, have been identified in the We performed a structural prediction analysis of the FVII protein in our patient. The results showed that the variant Val429 residue was within a hydrophobic region, as is the native residue, and was buried in the serine protease domain (surface accessibility is 1) (Figure\u00a0During the coagulation cascade, FVII needs to be activated before binding to an exposed tissue factor, thereby initiating the extrinsic coagulation pathway. Activation of FVII requires the participation of the serine protease domain and proteolytic enzymes.4F7\u00a0mutation, thus adding to the collection of variant human F7\u00a0genes. The specific pathogenesis associated with this mutation requires further experimental investigation.We identified a novel There are no conflicts of interest.Hua Tang contributed to conceptualization, software, and writing\u2014original draft. Xingzhao Luan contributed to software and image curation. Jiaqi Li contributed to methodology and software. Gen Jiang contributed to data collection. Haowen Zhen and Hao Li contributed to supervision. Wei Xiang contributed to conceptualization, methodology, and revision. Jie Zhou contributed to supervision and writing\u2014review and editing.Written informed consent was obtained from the family members of the patient.Supplementary MaterialClick here for additional data file."}
{"text": "We added a layer of BaTiO3 onto the TiO2 electron transport layer and prepared a PSC, which had an FTO/TiO2/BaTiO3/FAPbI3/spiro-OMeTAD/Au architecture with a power conversion efficiency (PCE) of 11%. Further, we used the simulation program SCAPS-1D to investigate and optimize the device parameters  resulting in devices with PCEs reaching up to 15%, and even up to 20% if we assume an ideal structure with no interlayer defects. Our experimental findings and simulations in this paper highlight the promising interplay of multilayer TiO2/BaTiO3 ETLs for potential future applications in PSCs.Since the addition of BaTiO The stock solution molar concentrations of LiTFSI and FK209 were 1.8 mmol/mL and 0.25 mmol/mL in acetonitrile , respectively. Before spin-coating the spiro-OMeTAD layer, the spin-coater was dried with a continuous flow of nitrogen in order to remove residual DMF and DMSO vapors left from the preparation of perovskite thin layers. Afterward, 50 \u00b5L of the spiro-OMeTAD solution was spin-coated on the perovskite film  for 10 s. The substrates were left resting overnight in dark and dry air. For the final step, 100 nm of gold contacts were deposited on the substrates by thermal evaporation.2 using a reference silicon cell. The area of one cell was 0.09 cm2 and the potential sweep was performed at a scan speed of 20 mV/s in the range between \u221250 and 1100 mV. For this paper, a total of 12 solar cells were prepared (six cells at a time) and characterized. The successful cells had similar characteristics so one of them was used as the starting point for the modeling and optimization of the photovoltaic system. The J-V measurements were conducted in a nitrogen-filled glove box using a Keithley 2400  source meter and a DLH400D lamp  calibrated to 100 mW/cm3), which allows efficient extraction of electrons and holes, respectively.The layer structure of the prepared PSCs is illustrated in J\u2013V characteristics including open-circuit voltages (Voc), short-circuit currents (Jsc), fill factor (FF), and power conversion efficiency (PCE). For SCAPS simulations, the input parameters are taken from the literature [The simulation was performed by using the solar cell capacitance simulator SCAPS-1D, which is based on solving one-dimensional continuity and Poisson equations . It can terature ,25,26,27J\u2013V) characteristic of the prepared PSC. The results are shown in J\u2013V characteristics. In addition, the comparison between the main solar cell parameters is shown in Using the data from 3 interlayer is added. When the perovskite layer is prepared on BaTiO3-modified TiO2, its crystal size increases leading to higher light absorption and photogeneration of charged pairs [3 onto TiO2 causes more favorable energy alignments of conduction and valence bands . This may induce a crystallization defect of the absorber layer which inhibits the expected efficient charge separation and transport. The interplay of these factors defines the net efficiency of the PSC.There are several phenomena reported that improve the efficiencies of a PSC when a BaTiOed pairs . At the ce bands b which i3 layer into our previous PSC structure [3 layer thickness on the performance of the PSC was studied in order to find its optimal thickness. We simulated the performance in a range of thickness of the BaTiO3 layer from 10 to 500 nm, and the results are presented in Since we added the BaTiOtructure  to improVoc and short circuit current Jsc stay almost constant with an increase in the thickness of the BaTiO3 layer. The addition of the BaTiO3 layer onto TiO2 causes more favorable energy alignments of conduction and valence bands. Once this alignment is fully developed, increasing the thickness of the BaTiO3 layer will not change it, and therefore Voc will stay constant. The charge separation will not be changed and Jsc will also stay constant. Thus, the only parameter that can influence the PCE is the FF. For this reason, the fill factor FF and the efficiency of the solar cell show the same saturation behavior, with the PCE rising from 9.4 to 11%. Since our experimentally prepared PSC device had a BaTiO3 layer with a thickness of 300 nm, and the PCE calculated from the fitting curve was 10.7% , we decided to take this thickness as an optimal value for further simulations. The experimental PSC with a thicker BaTiO3 layer would improve the device performance by only 0.3%, but would almost double the amount of BaTiO3 used in the production of the PSC.The open circuit voltage AN from 1014 cm\u22123 to 1019 cm\u22123. The rest of the parameters were kept constant and corresponded to the values indicated in AN are shown in Doping of the absorber layer is another important parameter that can affect the performance of the PSC, and we simulated the performance of PSC in the doping range of Voc, as can be seen in AN concentration can cause an increase in the recombination rate that can negatively affect cell performance. This can be found in the behavior of the other PSC parameters , the vacancies behave as dopants. The synthesis parameters can influence the nature of the thin film, so the crystallization of the active perovskite layer creates lattice strains, which can lead to vacancies or structural defects as is the case for polycrystalline thin films. The number of present vacancies and the defect concentration depends on the ratio of lead (II) iodide and formamidinium iodide in the precursor\u2019s solution, as well as the choice of solvents  or the lAN increases the recombination rate that strongly affects the J-V curves, reducing the performance of the device , saturating the Jsc and PCE values for absorber layer thicknesses higher than 600 nm. Thus, this value is chosen as an optimum for the thickness of the absorber layer. The Voc also shows saturation for the higher values of the absorber thickness, while the FF is decreasing to 53%.Thinner absorber layers result in lower light absorption leading to lower values of photocurrent, and consequently lower values of 2 have been shown to increase the charge recombination inside the active layer [tN), which can impact the Voc of the solar cell.In order to improve the PSC performance, the change in defect density was considered. Polycrystalline films tend to have a larger number of defects in comparison to monocrystalline films, and synthesis techniques such as crystal-oriented growth  can inflve layer . The recR is given by [n and p are the concentrations of the mobile electrons and holes, respectively. These concentrations can be found by solving the continuity and Poisson equations. At positive voltage values, where qV > 3 kT, the term tE represents the energy level of the trap defects, while tN is their concentration. n\u03c4 and p\u03c4 are the lifetimes of the electrons and the holes, respectively, and are given by the following equations:n\u03c3 and p\u03c3 are the capture cross-sections of the electrons and holes, respectively, and thv represents the thermal velocity. To study the influence of the defect density of the perovskite active layer on the cell performance, the Shockley\u2013Read\u2013Hall recombination model (SRH) was used. The neutral defects were set at the center of the band gap following the Gaussian distribution with the characteristic energy value of 0.1 eV, centered in the middle of the band gap. In the SRH recombination model, the recombination rate given by ,35: (1)Rl of the carrier is given by the equation:D is the diffusion coefficient defined by the equation: \u03bc is the charge carrier mobility. According to Equation (2), when defect density decreases, the charge carrier lifetimes increase, leading to longer diffusion lengths (Equation (3)) and a lower recombination rate (Equation (1)). These are the main factors influencing the improvement of cell performance. The diffusion length tN was investigated as a parameter in the PSC performance, and the defect density values were changed from 1014 cm\u22123 to 1018 cm\u22123. The change in the recombination rate (R) (Equation (1)) is shown in tN lowers the recombination rate and at the same time increases the diffusion length l.The defect density J\u2013V characteristics reveal an improvement with the reduction in tN. The behavior of the PSC parameters with the change of the tN concentration is shown in tN reduces all the parameters, especially Jsc and PCE as soon as the tN crosses a value of 1015 cm\u22123. The recombination rate increases and reduces the charge concentration, which further decreases the current through the device. The charge separation is reduced too, so the Voc also drops with increasing tN, and the FF shows similar behavior.Therefore, the reduction in defect density in the perovskite material can significantly improve the performance of the PSC, which is consistent with the simulation results shown in 14 cm\u22123, but it is very difficult to obtain such a low tN in experiments due to the polycrystalline nature of the perovskite films. Because of that, we set the optimized value of defect density at 1\u00b71015 cm\u22123. As can be seen from tN, gives the following PSC parameters: Voc = 1.00 V, Jsc = 23.32 mAcm\u22122, FF = 62.87% and PCE = 14.71%. The J\u2013V curve with these optimized parameters is presented in J\u2013V characteristic (Voc = 1.09 V, Jsc = 28.79 mAcm\u22122, FF = 66.45%, PCE = 20.79%.The best performance was obtained with the lowest defect density of 1\u00b710teristic . Its par3 layer in between the TiO2 ETL and the perovskite absorber layer, we improved the PCE of a FAPbI3-based solar cell from 7% to 11%. According to mentioned references, we consider that this improvement comes from influencing the electric field, which facilitated better charge separation and transport, and from a reduction in recombination processes. After using numerical simulation and optimization processes with SCAPS-1D, the theoretical PCE rises almost up to 15%. In an ideal device, the efficiencies can even reach 20%, verifying that the BaTiO3 layer can drastically improve the PSC performance and can be used in future research as a promising material for optoelectronic devices.By adding a BaTiO"}
{"text": "SCAPS-1D simulation software is used to perform an efficiency analysis of perovskite-perovskite CsPbI3/MAPbI3 bilayer solar cell. For efficiency optimization of the perovskite-perovskite bilayer solar cell, we have tried to calibrate seven parameters of the cell. These parameters are (i & ii) selection of the electron and hole transport material  variation in the: defect density of bulk material, doping concentration and the thickness of absorber layers, (vi) variation in work function of front electrode (vii) varying interface defect density. After optimization, the efficiency (\u03b7) of bilayer PSC is estimated to be 33.54%. The other PV parameters observed in optimal efficiency condition are open-circuit voltage (VOC) = 1.34V, short-circuit current density (JSC) = 27.45 mA/cm2 and fill factor (FF) = 90.49%. The CsPbI3/MAPbI3 bilayer perovskite solar cell efficiency is roughly double the efficiency of single junction CsPbI3 or MAPbI3 PSC. Our analysis observed that the variation in the doping and defect density of narrow bandgap material profoundly impacts the efficiency of perovskite-perovskite bilayer solar cells compared to the wide bandgap material.With lead-based light harvesters, perovskite solar cells (PSCs) have an efficiency of approximately 25.5%, making them a viable photovoltaic technology. The selection of the absorber materials for PSC in this work are (i) Cesium lead iodide (CsPbI Bilayer solar cell, Efficiency, Photovoltaic performance, Thickness. First-generation solar cells, or crystalline technology, have achieved efficiencies up to 25% . Second-4 cm\u22121), high mobility (up to 2000 cm2 V\u22121 s \u22121), long diffusion lengths (more than 1000nm) and low exciton binding energies of (2\u201322 meV)charge carriers [3  has been found to have better thermal stability than the organic-inorganic halide perovskites [3) with a bandgap of 1.73 eV, is optimal for photovoltaic applications and at the same time it is also a perfect material for integrating tandem solar cells with lower bandgap solar cells [3-based PSCs have improved their efficiency from 2.9 percent to 19.03 percent, with better stability, revealing that it has a huge potential for fabricating high-efficiency inorganic PSCs [PSC is the whole new phase of photovoltaic because its efficiency increased sharply in a short duration of time i. e, from 3.8% to 25.5% in a decade. The reason for this accelerated progress can be assigned to some peculiar characteristics of perovskite material, such as tunable bandgaps (1.2eV\u20132.3eV), high absorption coefficients /(FAMASnGeI3) configuration and Madan et. al [0.5Sn0.5I3/Cs2AgBi0.75Sb0.25Br6) configuration.Thus, PSC became a good choice in the field of solar energy, but due to the complex fabrication techniques of PSC, the invention of simulation tools in this field was promoted. Few solar cell simulation software are SCAPS-1D, AMPS-1D, Silvaco-TCAD, ASA. Using these simulation tools, various combinations of organic-inorganic perovskite materials can be tested, and optimal material combinations can be explored. Using SCAPS-1D recently Singh et.al , achieven et. al , achieve3 and MAPbI3 as the two absorber layers. The selection of MAPbI3 material is due to its higher efficiencies reported in the literature because of the favorable bandgap of 1.55eV, high mobility and long diffusion length of charge carriers. At the same time, the CsPbI3 material is chosen because it is thermally stable and CsPbI3 is also a potential partner for tandem devices because its bandgap (1.73eV) [3/MAPbI3, which cannot be accomplished in conventional thin-film perovskite solar cells, we improve the efficiency of PSC from 14 percent to 33 percent. Up to our knowledge this is one of the highest recorded efficiencies for PSC till now. Our results reveal that the use of narrow-bandgap material MAPbI3 has increased the absorption range of solar spectra and the bilayer fabrication of solar cell have better aligned the energy levels, which promotes the carrier extraction, resulting in higher charge carrier generation and transport of carriers in comparison to single -CsPbI3 or MAPbI3 PSC.In this study, we have focused on optimizing the efficiency of perovskite-perovskite bilayer solar cell using SCAPS (a solar cell capacitance simulator) - a 1D simulation tool with CsPbI(1.73eV) . Hereby 2+ ion. The solar cells are laminated using these tapes and 99.9% of Pb2+ ion absorption is reported [The selection of Pb as one of the components in our work despite being toxic is addressed and resolved by Li et\u00a0al. In their work they have fabricated DMDP  , 4 methareported .2The fabrication of PSC is a complex process; hence, the scientific community primarily relies on simulation tools for material and process optimization. Various simulation tools like wx-AMPS, SCAPS-1D, Silvaco-TCAD, etc., are available online for research and design. Different research groups develop these simulation codes, and generally, their updates are available from time to time. We have selected the SCAPS (a solar cell capacitance simulator)-a 1D simulator for our simulation study developed by the University of Ghent's Department of Electronics and Information Systems (ELIS) . The simPoisson equation:Continuity equation for holes:Continuity equations for electrons:D+ and NA\u2212, respectively; the electron and hole current densities are Jn and Jp, respectively. G(x) is the electron and hole generation rate while the electron and hole recombination rates are Rn(x) and Rp(x), respectively; and n and p are free electrons, and hole concentration, nt and pt are concentrations of trapped electrons and holes, respectively.Here, \u03b5 depicts the permittivity; the electrostatic potential is represented by \u03c8; q is the charge of an electron, the doping concentrations of donor and acceptor ions are N3) for higher efficiency while (ii) caesium lead iodide (CsPbI3) for better stability. The present simulation is performed in three steps.In our simulation study, two different absorber layers are selected, and the selection of the absorber material is based on (i) the methylammonium lead iodide  and Hole Transport Layer (HTL). Its configuration is FTO/TiO2/CsPbI3/MAPbI3/Spiro-OMeTAD/Au which is depicted in 2 is used as Electron Transport Layer (ETL) (iii) CsPbI3 as the first absorber layer (iv) MAPbI3 as second absorber layer (v) Spiro-OMeTAD as Hole Transport Layer (HTL) (vi) Au as a back electrode.The perovskite-perovskite bilayer solar cell with the two absorber layers CsPbIC and NV stand for effective conduction and valence band density, Eg for bandgap, NA and ND for acceptor and donor density, \u03bcp & \u03bcn for hole & electron mobility, Nt for defect density, \u03b5r for relative permittivity, \u03c7 for electron affinity.7 cm/s. The front contact of PSC has a 4.4eV work function, whereas the back contact has a 5.1eV work function. For CsPbI3 based solar cells, the interface parameters include a neutral defect type with a characteristic energy of 0.1eV and located at mid-gap. The captured cross-section for both the electron and hole is 1 \u00d7 10\u221215 cm2. In the bilayer PSC, the interface parameters at the junction of two absorber layer  are interface defect density 1\u00d7 1010 cm\u22123, neutral defect type with a characteristic energy of 0.1eV and located at mid-gap. The captured cross-section for both the electron and hole is 1 \u00d7 10\u221219 cm2.The light spectrum of AM 1.5G falls on the front electrode and, after absorption of a shorter wavelength, transmits to the bottom absorber layer for higher energy photon absorption. The simulation is performed at 300K temperature, the electron and hole velocities are taken as 1033 and MAPbI3 were simulated using SCAPS-1D software. The MAPbI3 based solar cell obtained Photovoltaic Conversion Efficiency (PCE) = 14.34% Fill Factor (FF) = 68.54%, short-circuit current density (Jsc) = 20.59 mA/cm2, open-circuit voltage (Voc) = 1.01V as shown in 3 based device produces PCE = 14.25%, FF = 71.98%, Voc = 1.09V, Jsc = 18.06 mA/cm2 as shown in oc of CsPbI3 PSC is higher than the MAPbI3 PSC because of the higher bandgap of the latter, while Jsc of MAPbI3 is higher CsPbI3 because of better absorption of the solar spectrum by MAPbI3 as compared to CsPbI3 PSC.In the present study, initially, single-junction solar cells CsPbI3 and MAPbI3 PSC closely match each other, validating our simulation study [Tables\u00a0on study , 26.Tabl3 and CsPbI3. The heterojunction mentioned above allows near-infra-red absorption and hence permits broader absorption of the solar spectrum. It also helps in increasing photo-generation of charge carriers and therefore producing higher current density. The obtained PCE from bilayer PSC = 20.39%, FF = 79.21%, JSC = 27.38 mA/cm2, VOC = 0.93V. The optimization of the bilayer PSC is further obtained by varying the material of ETL and HTL. At the same time, we have varied the thickness, Nt, and NA of the absorber layers. Furthermore, variation of electrode work functions for front contacts of the PSC was observed to achieve optimal efficiency.The study was further continued on all perovskite bilayer solar cell. The two absorber layers in all perovskite bilayer solar cell are MAPbI3.12, SnO2 presents comparable efficiency, i.e., 20.65%, 20.39%, 20.64%, respectively. The justification for the highest efficiency of ZnO can be attributed to better alignment of energy band between the conduction band and lowest unoccupied energy level (LUMO) of CsPbI3 and high mobility of charge carriers, as shown in sc, FF, and efficiency compared to other ETL materials. This observation can be attributed to the low bandgap and low mobility of charge carriers in PCBM, and hence PCBM is not suitable for the bilayer PSC device. At the same time, slight misalignment in the energy level between the PCBM and the CsPbI3 deteriorates the performance of PSC. From 3 absorber layer. Therefore, it is evident from our simulation study that the inorganic materials perform better than the organic materials.In a device architecture, electron transport layers must meet certain requirements, including (i) high band-gap to allow effective light-collection, (ii) well-matched alignment of energy-level for efficient electron transfer and preventing holes, and (iii) high value of electron mobility to reduce accumulation of charge-carriers , 34, 35.3.2\u22123 cm2V\u22121 s\u22121). The unstable, expensive  organic HTMs  leads to the incorporation of inorganic HTMs  with high mobility and carbon-based HTMs for stability [3 as an absorber layer. OC, JSC, FF and \u03b7 of the resulting PSC. From oc = 0.99V, Jsc = 27.07 mA/cm2, and FF = 84.9%) with respect to other HTL materials simulated. This behavior is attributed to better alignment of the energy level of the valence band of the absorber layer and the highest occupied molecular orbital (HOMO) of the CuSCN. After CuSCN, the performance of PSC in decreasing order is Cu2O, CuI, CuSbS2. The performance parameters with minimal suitable HTL (CuSbS2) are PCE = 18.57%, Voc = 0.88V, Jsc = 27.07 mA/cm2, and FF = 77.92%. Among all the HTMs simulated in our study, the CuSCN showed the best performance, followed by CuI. The reason is that the deeper energy level alignment contributes to the higher Voc, and also, the bandgap of CuSCN (3.4eV) is high enough to block the electron transport completely. At the same time, it effectively transports the holes to the back electrode. Also, its high optical transparency in the 300 nm\u2013900 nm wavelength range allows better light absorption in the absorber layer and, therefore, contributes to the higher Jsc. Thus the simulation reveals that inorganic HTMs perform better than the organic HTMs.The HTL must have adequate energy levels to provide the necessary driving force for charge transfer  must be slightly superior to that of the perovskite materials). It should have a high hole transfer efficiency to enhance hole conduction and prevent charge recombination . We observe that there is a slight reduction in Jsc and a slight increment in VOC on changing the thickness. For efficiency of the cell from 3 absorber layer increases. 3 on the quantum efficiency of the PSC. The maximum efficiency is achieved at 100 nm thickness, and therefore the thickness of CsPbI3 is fixed at 100nm in the rest of the studies. There is a negligible rise in efficiency less than (0.05%/10nm) below 100nm, as shown in 3 is fixed at 100nm elsewhere in the study.In 3 was fixed at 100nm while that of MAPbI3 was varied from 100nm to 1000nm. As observed from sc is significantly improved from 20 mA/cm2 to 27 mA/cm2 due to increased light absorption, which induces a higher photo-generation of charge carriers. The Voc reduces from 1.02V to 0.99V with increased thickness because of an increase in reverse saturation current (Jo), increasing carrier recombination. The FF declines from 87 to 84% due to the rise in the series resistance (Rs) of the PSC. 3 on the quantum efficiency of the bilayer PSC. The highest PCE and quantum efficiency is attained at 900nm. Therefore, the MAPbI3 thickness is fixed at 900nm elsewhere in the study. Our study shows that bilayer PSC performance is more dependent on narrow bandgap material thickness than on wide bandgap material thickness. The bandgap of the CsPbI3 absorber layer is 1.73 eV, hence it can absorb wavelengths up-to 650\u2013700nm, whereas MAPbI3 absorber layer bandgap is of the order of 1.55eV hence it is capable of absorbing wavelengths up-to 900nm. Therefore, increase in the thickness of the CsPbI3 absorber layer creates hindrance to higher wavelength photons to reach the MAPbI3 absorber layer which results in the efficiency decrease of the resulting solar cell.Now the thickness of CsPbI3.4t) of absorber layers is tuned to see its effects on perovskite-perovskite bilayer PSC's performance. The SRH model examined the impact of (Nt) in both absorber layers of PSC.The low-temperature and simple processing in perovskite halides result in significant defects at the grain boundary and interface. The presence of these defects reduces crystal quality. Defects cause perovskites to become active and prone to degradation, resulting in non-radiative recombination, impacting device performance and stability . The def\u03c3: capture cross-sectional arean: electron concentrationp: hole concentrationp: electron lifetime.\u03c4n: hole lifetime.\u03c4SRH which is inversely proportional to lifetime of charge carriers while SRH is directly proportional to the defect density of material. Thus, on increasing defect density the shokeley read hall recombination rate RSRH increases by suppressing the current density and hence reducing the efficiency of solar cell. The above equation represents the maximum and minimum value of life time of charge carriers and defect density. These equations will give rough idea of life time and defect density but in real simulation more advanced algorithms are used for the estimation of these values at each layer on both sides of layer. The Nt of the MAPbI3 was changed between 1 \u00d71013 cm\u22123 to 1\u00d7 1018 cm\u22123, while the Nt of the CsPbI3 was kept constant at 1\u00d71014 cm\u22123. As the Nt of the MAPbI3 absorber layer increases, efficiency falls from 27.13% to 7.13% the JSC drops from 27.45 mA/cm2 to 11.38 mA/cm2 and the VOC drops from 1.11 V to 0.84 V and FF was reduced from 88.88% to 70.09% and as shown in 13 cm\u22123 to 1\u00d7 1015 cm\u22123 is the optimal range as the variation in Voc, Jsc, FF and \u03b7 are negligible, but after 1\u00d71015 cm\u22123, the efficiency falls sharply.t of the CsPbI3 absorber layer is varied, while the Nt of MAPbI3 absorber layer is fixed at 1 \u00d71013 cm\u22123. It can be seen from OC and Jsc do not diminish significantly as the Nt of CsPbI3 rises from 1 \u00d7 1013 cm \u22123 to 1\u00d7 1018 cm\u22123, but FF drops from 88.88 to 81.21%, and the PCE drops from 27.19 to 24.50%. It was determined that when the Nt increases, more recombination centers are created, enhancing carrier recombination within the absorber layer while also reducing carrier lifetime, lowering the solar cell's device performance [OC, as evident from Eqs. t is 1\u00d7 1013 cm\u22123 for both absorber layers, the PV characteristics improves to, current density is 27.45 mA/cm2,VOC is 1.01 V FF 88.88%, and efficiency 27.13%. Thus, the analysis reveals that the Nt of the absorber material has a significant impact on device performance. Also, bilayer.Similarly, the Nformance , 40. As t for the MAPbI3 is 1 \u00d71015 cm\u22123 and for CsPbI3 it is 2.07\u00d71014 cm\u22123 is used elsewhere in the study.PSC performance is more dependent on narrow bandgap material defect density than on wide bandgap material density. Various defect passivation techniques are reported in the literature such as incorporating different additives in perovskite absorber layer using different deposition techniques. Annie et.al, reported hybrid chemical vapor deposition technique and zhu et.al, reported addition of ethylamine alcohol for defect passivation , 42. Theo: ideal FF in the absence of any parasitic resistanceFFk: Boltzmann constant.T: Temperatureq: elementary charge.3.5oc, carrier recombination rate, and diffusion length etc. [A) of MAPbI3 is varied from 1014 to 1022 cm\u22123 keeping the NA of CsPbI3 fixed at 1014 cm\u22123. A of MAPbI3 absorber layer on Voc, Jsc, FF, and \u03b7 and J-V curves of PSC. From the Figure, it is observed that, at low acceptor density, i.e., 1\u00d7 1013 cm\u22123 to 1\u00d7 1015 cm\u22123, there is a small amount of variation in Voc, Jsc, FF, and PCE. But as the value of NA increases greater than 1016 cm\u22123, we observe a sharp increase in Voc, FF, and PCE. The optimal value of PCE = 28.55%, Voc = 1.23V, Jsc = 26.74 mA/cm2 and FF = 86.69% is obtained at NA = 1022 cm\u22123. The observed rise in Voc can be explained using the following equations:The doping concentration is another critical parameter that directly impacts numerous optoelectronic parameters, i.e. Vgth etc. . As a reA would drop the saturation current Io, which will subsequently decrease the value of Voc.As it can be seen from the above equation that the rise in N3 was varied from 1\u00d7 1013 to 1\u00d71018cm\u22123, keeping acceptor concentration of MAPbI3 fixed at 1\u00d7 1022cm\u22123, and its effect on Voc, Jsc, FF, and \u03b7 was studied. Figures\u00a0A, respectively. Under low acceptor density, the J-V curves are nearly identical, as observed in A is more than 1016cm\u22123, the JSC falls, and the VOC rises. Eqs. oc is improved, and the JSC drops when NA rises, there will be an optimal NA that maximizes device efficiency, when NA is 1\u00d71015 cm\u22123, as shown in A is 1\u00d71022 cm\u22123 for MAPbI3 and 1\u00d71015 cm\u22123 for the CsPbI3 absorber layer, respectively. Therefore, the above results show that in MAPbI3/CsPbI3 perovskite-perovskite bilayer PSC, the narrow bandgap material is more sensitive to the doping concentration than the wide bandgap material. Various techniques for passivating the traps have been investigated in the literature to improve crystallinity and grain size, chemicals such as metal ionic doping , Lewis acid/base adduct, long-chain polymers, ammonium salts etc. [Similarly, the acceptor density of CsPbIlts etc. , 45, 46.3.6oc, Jsc, FF, and \u03b7. OC, FF, and PCE started to degrade and reached 1.14 V, 75.37%, and 22.97%, from 1.23V, 86.69%, and 28.58%, respectively, because a high value of work function was creating a barrier for the flow of electrons at the interface of ETL and front contact. The barrier would rise as it was increased, lowering PV performance, as evident from To assure appropriate collection of electrons from FTO (front contact), an ohmic contact should be established. The work function (\u03c6) of the front contact was increased from 4.1eV to 4.7eV to explore its influence on V3.7interface) at the junction of the two-absorber layer is varied between 1017cm\u22123 to 1010cm\u22123 keeping other parameters fixed to examine its effect on Voc, Jsc, FF and \u03b7. The PCE decreases from 33% to 7.48% while Voc reduces from 1.34V to 1.02V, Jsc decreases from 27.45 mA/cm2 to 12.60 mA/cm2 and FF decreases from 90.41% to 71.94%. It was observed that the PV parameters changed drastically when the values of Ninterface are varied between 1017cm\u22123 to 1013cm\u22123 while PV parameters are almost constant between 1013cm\u22123 to 1010cm\u22123 as observed from interface increases. There is greater decrease in Jsc than Voc on increase in defect density. This is due to interfacial recombination dominates charge-carrier density as Ninterface increases. The sudden decrease in Jsc from 22 mA/cm2 to 12 mAcm2 on increase in Ninterface is explained by quantum efficiency curve shown in interface) is greater than 1017cm\u22123. Thus, simulation reveals that interface engineering is necessary to have efficient solar cells. Interface engineering has been shown to be useful in minimizing power loss and recombination at various interfaces of PSCs [Interface recombination also plays a very important role in determining overall performance of the PSCs . In this of PSCs . As a re43 and MAPbI3 PSC were simulated and validated experimentally. The study was further continued for numerical simulation and analysis of perovskite-perovskite bilayer PSC with a MAPbI3/CsPbI3 heterojunction as the absorber layer. Then we have optimised for ETL material and HTL material. Furthermore, thickness, Nt and NA of both of the absorber layers CsPbI3 and MAPbI3 were optimised.In this work, we have tried to optimize the efficiency of perovskite-perovskite bilayer PSC using the SCAPS-1D simulation tool. We have estimated the efficiency using different organic-inorganic materials, and among them, the best material and optimal thickness of the material is studied. The optimal perovskite-perovskite bilayer PSC shows 33.54% efficiency. Initially, single-junction CsPbI3 absorber layer while it is 900nm for the MAPbI3 absorber layer. Moreover, the perovskite-perovskite bilayer PSC shows the best performance at defect density of 1\u00d71013 cm\u22123 and optimal performance in the range of 1\u00d71013 cm\u22123 to 1\u00d71015 cm\u22123 for both of the absorber layers. It was observed that the moderate doping concentration in the wide bandgap absorber layer and high doping concentration in the narrow bandgap absorber layer produce high efficiency.The study shows that ZnO and CuSCN were the best ETL material and HTL material, respectively, because of better alignment of absorber layer valence band with HUMO and LUMO of ZnO and CuSCN, respectively. The proposed perovskite-perovskite bilayer PSC shows the highest efficiency at 100nm thickness for the CsPbI15cm\u22123 for CsPbI3 and 1\u00d71022cm\u22123 for the MAPbI3 absorber layer, respectively. The proposed bilayer PSC shows the best PV performance at 4.1eV front electrode work function and optimal performance in the work function range 4.1eV\u20134.4 eV. Furthermore, PSC is optimized for defects at the interface of the two-absorber layer in the range 1\u00d71017cm\u22123 to 1\u00d71010cm\u22123 and the simulation results demonstrate that for optimal performance the interface defect density should be less than 1\u00d71013cm\u22123. The PCE has increased from 20.39% before optimization to 33.54% after optimization in bilayer PSC, as shown in 3 based PSC or the MAPbI3 based PSC. Thus perovskite-perovskite bilayer PSC gives higher efficiency than the single-junction PSC.The device shows optimized performance at a doping concentration of 1\u00d710Sidra Khatoon: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Wrote the paper.Satish Kumar Yadav: Analyzed and interpreted the data; Wrote the paper.Jyotsna Singh: Contributed reagents, materials, analysis tools or data; Wrote the paper.Rajendra Bahadur Singh: Contributed reagents, materials, analysis tools or data.This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.Data will be made available on request.The authors declare no conflict of interest.No additional information is available for this paper."}
{"text": "A thorough understanding of the role of the interfaces in the perovskite solar cell, along with the optimization of different parameters, is still required for further improvement in PCE. In this study, lead-free CsSnGeI3 PSC has been quantitatively analyzed using a solar cell capacitance simulator (SCAPS\u20131D). Five electron transport layers (ETL) were comparatively studied, while keeping other layers fixed. The use of SnO2 as an ETL, which has the best band alignment with the perovskite layer, can increase the power conversion efficiency (PCE) of PSC by up to 30%. The defect density and thickness of the absorber layer has been thoroughly investigated. Results show that the device efficiency is highly governed by the defect density of the absorber layer. All the PSCs with a different ETL exhibit PCE exceeding 20% when the defect density of the absorber layer is in the range of 1014 cm\u22123\u20131016 cm\u22123, and degrade dramatically at higher values. With the optimized structure, the simulation found the highest PCE of CsSnGeI3-based PSCs to be 30.98%, with an open circuit voltage (ocV) of 1.22 V, short-circuit current density (scJ) of 28.18 mA\u00b7cm\u22122, and fill factor (FF) of 89.52%. Our unprecedented results clearly demonstrate that CsSnGeI3-based PSC is an excellent candidate to become the most efficient single-junction solar cell technology soon.A cesium tin\u2013germanium triiodide (CsSnGeI Energy consumption is expected to increase, with the bulk of the demand coming from developing countries. Conventional fuel remains the greatest contributor to electricity generation worldwide. Producing energy from these resources takes a severe toll on our environment. Solar energy is one of the most abundant energy resources on Earth, as it is sustainable and inexhaustible. Solar cells are regarded as clean and sustainable sources of energy ,2. Couplresource ,4. To dao 32.33% . Kaneka ficiency . Howeverficiency .A decade ago, lead halide Perovskite solar cells (PSCs) emerged as a breakthrough photovoltaic (PV) technology. These cells have acquired significant interest in research and industrial communities due to their high-power-conversion efficiency exceeding 25% ,12,13, s25% ,15. The 10 years ,17, owin10 years ,19,20,2110 years ,23,24,253, CH3NH3SnI3 (MASnI3), and HC(NH2)2SnI3 (FASnI3), have been investigated. The latter two perovskites have intrinsically low stability [3 perovskite could be a promising alternative to Pb-based light harvesting materials, due to its improved photoelectric characteristics such as a high absorption coefficient, small exciton binding energy, high carrier mobility, etc., and is currently the strongest candidate [3 recorded the highest 3 that shows superior performance and exceptional air stability over its pure counterparts CsSnI3 and CsGeI3. The CsSnGeI3-based device shows a Tin-based halide perovskites, such as CsSnItability ,27. The andidate ,29,30,31andidate ,33. Amonof 10.1% ,35. Min of 10.1%  proposed3 perovskite solar cell, by analyzing various device parameters using a solar cell capacitance simulator (SCAPS-1D) [J\u2212V curve, and defect density, by just solving three basic semiconductor equations. It is user friendly and may be executed in both dark and light atmospheres [This study aims to suggest possible optimization routes for efficiency improvements of the CsSnGeICAPS-1D) . DiffereCAPS-1D) ,39. Amonospheres ,41,42. Sospheres ,44.2 and SnO2. TiO2 is the most common ETL for the fabrication of PSC [2 has high electron mobility and keeps better band alignment with the CsSnGeI3 absorber layer, which is supportive for electron extraction [2O was used as the hole transport layer (HTL) due to its low cost, and it is widely used in solar energy materials, as a promising inorganic HTL for PSC applications [3 device can have a simulated power conversion efficiency This work focuses on engineering the interface ETL/perovskite absorber layer. Optimizing the interfaces in the PCSs is essential for enhancing the photovoltaic performance. In this study, different materials were investigated as ETL, mainly TiOn of PSC . On the traction ,46. Cuprications . The imp3, as the light harvesting material using SCAPS, which is 1D solar cell simulation software [In this numerical modeling, a comprehensive study has been performed on CsSnGeIsoftware . The sof3/Cu2O/Au, which is represented in 2O is used for every structure, while five different ETLs are alternately used, and their performances are compared. The ETL includes: SnO2, ZnO, IGZO, CdS, and TiO2. The device simulation is carried out in the 2O 3) layer thickness, The 2, the most commonly used ETL in perovskite studies due to its mesoscopic structure. It is observed that the PSC with SnO2 acquired the highest 3 layer shown in 2/CsSnGeI3 interface. In fact, CBO is the energy difference 2 ETL, the electrons in the ETL layer can easily cross the barrier to attain the interface. The cliff formation can improve the accumulation near to ETL/perovskite, which in turn enhances the recombination in this area by back-transfer to the interface of heterojunction.Surprisingly, all ETLs had superior performance over TiOC device ,59. When2 ETL yields the lowest ocV of FF of Under open-circuit conditions, the interfacial recombination mainly occurs through the pathways of back-transfer recombination, where the electrons that have been injected into the FTO electrode, and the free holes in the absorber recombine through the deep level defect at the ETL/absorber interface, which then result in a serious rovskite ., and 2 is finally selected as the optimal ETL material for the proposed lead-free PSC.Finally, it can be concluded that the band alignment plays one of the key roles for having higher 2 ETL and to determine the influence of absorber defect density on cell performance, the defect density of the perovskite layer has been considered. The defect density values simulated in this study range from Although the interface engineering and the control at the ETL/perovskite interface is crucial for achieving a high-efficiency solar cell device, the morphology and quality of the light absorber film have been recently recognized as a major factor for determining PSC performance , given t on lead ,63. As sThe perovskite defect density effect can be explained by the Shockley\u2013Read\u2013Hall (SRH) recombination model ,65. In tAccording to the SRH model, the recombination rate can be expressed by:The lifetime of charge carriers 3 is It can be deduced from Equations (4)\u2013(7) that as the defect density in the perovskite layer increases, the carrier lifetime decreases, while the charge recombination will increase, as confirmed in e formed , resulti3. Due to the large value of mobility, the diffusion length is high, and that is why our simulated PSC shows a high efficiency of It can be observed from Equation (7) that the diffusion coefficient is proportional to the mobility of charge carrier, the electron mobility Voc=K3 was strongly correlated with the trend of It is seen in 2 layer.QE is reached with an absorber thickness of The larger 3-based perovskite solar cell has been thoroughly investigated. A normal n-i-p planar structure of FTO/ETL/CsSnGeI3/Cu2O/Au is numerically simulated and analyzed using SCAPS-1D simulation software. The impact of various ETL on the device performance was studied to get the highest possible efficiency. It has been demonstrated that a PSC with SnO2 ETL has, by far, the best performance, owing to its excellent band alignment with the perovskite layer. Furthermore, the photovoltaic performance of the cell has been optimized by tuning two major factors: CsSnGeI3 defect density and absorber layer thickness. Our study explained the significant effect of these two factors on the electrical parameters of the PSC. The results revealed that the optimal light absorber thickness and the optimal absorber defect density were 3-based perovskite solar cells.In this work, a novel lead-free CsSnGeI"}
{"text": "There is scant data on the association of the Pulsed wave-Doppler tissue imaging (PW-DTI)-derived tricuspid lateral annular peak systolic velocity (S\u2019) and poor short-term prognosis of patients with acute decompensated heart failure (ADHF).A total number of 732 participants from the Heb-ADHF registry in China were divided into three groups according to the corresponding status of tricuspid S\u2032. Demographic characteristics, comorbidities, physical examinations, lab tests, and medications were compared among the different groups. Different logistic regression models were utilized to gauge the relationship between S\u2032 and the risk of a composite of short-term all-cause mortality or 30-day heart failure (HF)-related rehospitalization.p for trend = 0.006] in comparison with S\u2032 at >11\u2009cm/s. When S\u2032 was analysed as a continuous variable, per 1\u2009cm/s increase, the OR (95% CI) for a composite outcome was . Area under curve (AUC) of S\u2032 for predicting outcome of ADHF was 0.631 . Significant inverse association was also observed in left ventricular ejection fraction (LVEF) \u226540% subgroup.The number of composite outcome events identified in the study population was 85, with the short-term all-cause death coupled with 30-day HF readmission events reaching 23 and 62, respectively. As per the multivariable adjusted analysis, S\u2032 was inversely related to the risk of a composite outcome [<10\u2009cm/s odds ratios (OR) 2.90, 95% confidence interval (CI):1.33\u20136.31; 10\u201311\u2009cm/s OR 2.18, 95% CI: 1.10\u20134.33; Inspite of the potential confounders, a more impaired tricuspid annular peak systolic velocity is associated with a poorer short-term prognosis of patients with ADHF. This is the first comprehensive evaluation of tricuspid annular systolic velocity among patients with ADHF.Tricuspid annular systolic velocity could be a predictor of poor short-term prognosis in ADHF.Tricuspid annular systolic velocity should be considered in patients with ADHF at admission. Acute decompensated heart failure (ADHF) is characterized by a relatively swift change in the signs or symptoms of heart failure (HF), thus leading to unscheduled therapy or hospitalization ,2. BurgeSeveral investigations have implicated that the right ventricular (RV) dysfunction is linked to poor outcomes across a broad spectrum of disorders, such as myocardial infarction, chronic HF, and pulmonary hypertension (PH) . HoweverIn summary, we performed a retrospective analysis to assess the relevance of S\u2032 in the poor short-term prognosis of ADHF.The Heb-ADHF (Hebei-acute decompensated heart failure) study (ChiCTR-POC-17014020) is a prospective, multicenter, and observational study, which enrolled patients discharged from hospitals with a main diagnosis of HF in accordance with Chinese HF guideline , PH(PASP >40\u2009mmHg), and pulmonary artery (PA) diameter. S\u2032 was used to quantify RV systolic function and was obtained from a RV- focussed apical view as the Doppler beam parallelly aligned with RV free wall longitudinal excursion. Baseline characteristics were compared among the three groups of patients according to S\u2032 tertiles: <10\u2009cm/s , 10\u201311\u2009cm/s , and >11\u2009cm/s . The group 3 (>11\u2009cm/s) was reckoned as a reference for statistical analysis. S\u2032<10\u2009cm/s was defined as RV systolic dysfunction on the strength of recommendation from American society of echocardiography  in the fully adjusted model. The fully adjusted model was considered well-adjusted in the light of the Hosmer-Lemeshow test  and is depicted in We identified 85 composite outcome events within the 30\u2009days of follow-up on every single discharged participant of the study population. The in-patient all-cause mortality of our present study was 2.3%, which is similar to the upshot observed in a previous study . Meanwhi\u20130.690, p\u2009<\u20090.01)  was calculated, which was 0.631 (95%CI: 0.573\u2009<\u20090.01) . In addip for trend = 0.011] in comparison with S\u2032 at >11\u2009cm/s  had a significant higher risk of short-term all-cause mortality or 30-day HF rehospitalization, with more adverse events detected across the escalating impaired S\u2019 severity. This was independent of potential confounders, such as age, sex, comorbidities, physical examinations, lab tests, baseline medications, and echocardiographic parameters. These findings imply that S\u2019 may serve as a useful tool to identify the patients with ADHF that are at a high risk of adverse events, and thus the evaluation of S\u2032 should be reckoned as a part of the comprehensive assessment of this condition.The structure of the right ventricle is characterized by a thin wall and irregular shape, with a high afterload sensitivity. Therefore, the Simpson\u2019s method, which is commonly used to calculate the LVEF and is one of the significant indices for evaluating the LV systolic function, is not applicable to assess the right ventricular ejection fraction (RVEF) in clinical practice. Several previous studies have verified a correlation between RVEF and adverse outcomes in different HF populations using various methods of RVEF assessment, which are not widely used in clinical practice owing to the disadvantages we mentioned above . CurrentTill date, cumulative studies have confirmed that RV dysfunction is a prognostic factor of undesirable outcomes across a string of cardiac conditions. In 1998, De Groote et\u00a0al. corroborated that RVEF is an independent predictor of survival in patients with moderate CHF. In 2010, Meyer et\u00a0al. proved that baseline RVEF <20% is a significant independent predicator of mortality and HF hospitalization in systolic HF. In 2014, Melenovsky et\u00a0al. reported that the right heart dysfunction is common in HF with preserved ejection fraction (HFpEF) and is driven by the RV contractile disability and afterload mismatch from PH. A recent study demonstrated that lower RVEF is associated with incident HF or death and was independent of LVEF among individuals free of HF . HoweverFew investigators reported that PH correlates with the S\u2032 of tricuspid annulus below 12\u2009cm/s. However, this finding has not been verified using right cardiac catheterization. As a complex and often misunderstood disorder, PH mostly results from the left cardiac conditions such as HF with reduced ejection fraction (HFrEF) and HFpEF ,36. Our Our findings also spotted that the systolic dysfunction of right and left ventricle coexist in a large portion of patients with DCM due to its highest prevalence in group 1. Likewise, ORs and 95% CI (S\u2019) are consistent with the results before and after adjusting the DCM.n\u2009=\u2009732) afflicted by all types of ADHF (LVEF ranging from 12 to 75%) expands previous awareness by displaying an inverse correlation between S\u2019 and risk of short-term all-cause mortality or 30-day HF readmission. There might be other explanations for the relationship; however, the findings are intriguing enough to warrant further investigations that focus largely on the comprehensive echocardiographic parameters of RV systolic function both in and out of the hospital setting. In this way, we would be capable of discerning high-risk patients with ADHF as well as optimizing preventive interventions to improve the prognosis of people with ADHF.Our present study with its relatively large study population  and tricuspid annular plane systolic excursion (TAPSE). However, we applied few major echocardiographic variables in the multivariable and sensitive analyses, and the results are consistent from start to finish. Lastly, we chose the Chinese participants as the study population, and this may limit the generalizability of our findings to other ethnicities.Inspite of potential confounders, a more impaired tricuspid lateral annular peak systolic velocity is associated with a poorer short-term prognosis of patients with ADHF. Tricuspid annular systolic velocity could be an independent predictor of poor short-term prognosis in ADHF, and thus it should be considered in patients with ADHF at admission."}
{"text": "We analysed 2006\u20132016 national influenza surveillance data in Japan with regards to age-, sex-, and predominant virus-related epidemic patterns and the prevalence of serum influenza virus antibodies. We found a significant increase in influenza prevalence in both children (\u2264\u200919\u00a0years old) and adults (\u2265\u200920\u00a0years old) over time. The influenza prevalence was higher in children (0.33 [95% CI 0.26\u20130.40]) than in adults (0.09 [95% CI 0.07\u20130.11]). Additionally, the mean prevalence of antibodies for A(H1N1)pdm09 and A(H3N2) was significantly higher in children than in adults, whereas the mean prevalence of antibodies for B lineages was relatively low in both children and adults. There was a biennial cycle of the epidemic peak in children, which was associated with a relatively higher prevalence of B lineages. The female-to-male ratios of the influenza prevalence were significantly different in children , adults , and older adults . The significant increase in influenza prevalence throughout the study period suggests a change of immunity to influenza infection. Long-term surveillance is important for developing a strategy to monitor, prevent and control for influenza epidemics. In Japan, the usual influenza epidemic starts around the beginning of January and peaks within a few weeks8. The influenza epidemic curve in Japan shows exponential growth toward the peak week and immediately decreases thereafter. This recurrent pattern has been also found in other respiratory viruses, such as the COVID-19 epidemic, in winter9. Furthermore, the spread of the epidemic is similarly located in regions over time for different predominant influenza viruses8. For example, during the pandemic caused by the novel swine influenza variant A(H1N1)pdm in 2009, epidemic clustering and transmission similar to that of seasonal influenza was observed17. This event highlighted the importance of understanding epidemic trends to estimate the risk of an epidemic. Similarly, continuous and long-term surveillance is important for the prevention of and preparation against emerging and re-emerging influenza epidemics18. In Japan, influenza surveillance has been conducted across the country by local health centres and public health institutes and infectious disease surveillance centres of the prefectural governments under the guidelines of the Ministry of Health, Labour and Welfare. Surveillance was widely expanded in the 1980s, with an increased number of sentinel clinics that report the weekly number of outpatient incident cases5.Seasonal influenza epidemics occur every winter in mild temperate regionsIn this study, we analyzed the recent trends of influenza epidemics, including the age- and sex-related prevalence and the seasonal predominant virus with respect to the prevalence of influenza antibodies, using national surveillance data obtained between 2006 and 2016 in Japan.5. The surveillance data were collected at 5000 sentinel clinics across Japan 5. The number of sentinel clinics was decided according to the population size of the administrative sector of the local health centres, making the surveillance similar nationwide. The majority of sentinel clinics have been settled, and neither the number and location of the sentinel clinics in the surveillance system nor the estimated coverage of the population by the sentinel clinics changed much over this time. In addition, the population coverage of sentinel clinics was similar for children and adults . The NESID data are available online on the NIID website6. For the observed timeframe, pathogen surveillance was conducted using polymerase chain reactions (PCR)7 of nasal swab specimens collected in approximately 10% of patients with ILI across the country. PCR for virus testing were conducted at the prefectural public health institute or NIID, and the results were uploaded onto the NIID website7.During influenza surveillance, physicians report incident cases to the local health centre via fax according to the clinical diagnosis for influenza-like illnesses (ILIs). The diagnosis of ILI by a physician is usually made using a rapid diagnostic testing kit for patients who presented with any of the four major symptoms of ILI . Local health centres report the weekly number of incident cases to the prefectural public health institutes or infectious disease surveillance centres, which are responsible for entering the incident cases  in the online database of the National Epidemiological Surveillance of Infectious Diseases (NESID), National Institute of Infectious Diseases (NIID)19. Samples of the serology surveillance were randomly collected from approximately 6000 Japanese individuals each year. We compared the influenza prevalence rate and the prevalence rate of serum influenza virus antibody.Separately, surveillance for serum antibodies against each influenza virus subtype and strain was conducted at designated hospitals across the country using the hemagglutination inhibition (HAI) assayStatistical analysis was performed using IBM SPSS version 21 . The level of significance was set to 5%.We calculated the yearly influenza prevalence rate, which is the rate of total ILI cases within the estimated coverage population by sentinel clinics, for each age group . The estimated coverage population by sentinel clinics was calculated for each age group using the national census data in 2010 as the coverage percentage of sentinel clinics within the total medical clinics , influenza antibody testing was implemented.  The HAI assay was conducted at all 47 prefectural public health institutes or the NIID, and the results were uploaded onto the NIID website19, by age group using the data of serology surveillance between 2006 and 20167 for five influenza virus: A(H1N1), A(H1N1)pdm09, A(H3N2), B/Yamagata-lineage, and B/Victoria-lineage. The difference in the prevalence of influenza antibody between children (\u2264\u200919\u00a0years old) and adults (\u2265\u200920\u00a0years old) was assessed using paired t-tests for each influenza virus. For multiple comparisons, the P value was corrected by Bonferroni\u2019s correction. To assess the relationship between the previous infection and the prevalence of antibodies, Pearson\u2019s correlation between the prevalence rate of the predominant virus strain and the prevalence of antibodies in children and adults was calculated separately.The virus subtypes and strains for the HAI assay were selected according to the vaccine virus subtypes and strains for the year: A(H1N1) subtype [A(H1N1)pdm09 subtype from 2009 onwards], A(H3N2) subtype, and the B lineage of the selected vaccine subtypes and strains, plus another B lineage that was not selected for the vaccine. We calculated the average prevalence with 95% confidence intervals (CIs) for an influenza antibody titer\u2009\u2265\u20091:40, which is considered sufficient to prevent infectionWe compared the sex ratio  of the influenza prevalence rate by age groups. We also compared the difference in sex ratios among children (\u2264\u200919\u00a0years old), adults (20\u201359\u00a0years old), and older adults (\u2265\u200960\u00a0years old) using a one-way ANOVA. For multiple comparisons, the P value was corrected using Bonferroni\u2019s correction.All methods were performed in accordance with relevant guidelines and regulations.The influenza prevalence rate was relatively higher in children aged 0\u20135 and 6\u201314\u00a0years old. The influenza prevalence rate in children younger than 20\u00a0years old was highest during the 2009\u20132010 season with the emergence of the novel swine influenza virus A(H1N1)pdm09 Fig.\u00a0.Figure 1P\u2009=\u20090.036) and adults  subtype was replaced by the A(H1N1)pdm09 subtype, which became the predominant strain almost biennially Fig.\u00a0. The preP\u2009<\u20090.05, excluding epidemic seasons with emergence of the novel swine flu virus [between the 2009\u20132010 and 2011\u20132012 seasons]). In children, the influenza prevalence rate increased significantly during high-prevalence seasons . The prevalence of the B/Yamagata-lineage increased gradually in most recent seasons. Epidemic peaks in the influenza prevalence rate in children appeared biennially, except for the 2009\u20132010 season Fig.\u00a0. This biOverall, in all age groups, the prevalence rates of serum antibody (HAI titers\u2009\u2265\u20091:40) did not largely change over time  in children (0.57 [95% CI 0.51\u20130.64]) than in adults . The mean prevalence of antibodies for B/Victoria-lineage was significantly lower (P\u2009=\u20090.001) in children (0.25 [95% CI 0.18\u20130.32]) than in adults (0.32 [95% CI 0.25\u20130.40])  between children (0.36 [95% CI 0.30\u20130.42]) and adults (0.37 [95% CI 0.31\u20130.44]). There was no correlation between the prevalence rate of the predominant virus strain and the prevalence of antibodies in children or adults.On average, the mean prevalence of antibodies for A(H1N1)pdm09 was significantly higher .In children, the difference of the influenza prevalence rate between girls and boys was largest in those aged 15\u201319\u00a0years (1.17 [95% CI 1.12\u20131.21]). In adults, the difference of the influenza prevalence rate between women and men was largest in those aged 30\u201339\u00a0years  between 2005 and 2010 was 0.09 (95% CI 0.06\u20130.11), which was the same as that in the present study21. Although the predominant influenza virus varied by year, including the seasons in which the A(H1N1)pdm09 subtype emerged, the sex ratio of the influenza prevalence rate was consistent among all age groups. We also found a significant increase in the influenza prevalence in both children (\u2264\u200919\u00a0years old) and adults (\u2265\u200920\u00a0years old) over time. The reason for this increase is unknown; however, the results suggest a change in immunity to seasonal influenza infection. Because the mean prevalence of antibodies for B lineages was relatively low in both children and adults, one factor may be the increase of predominant B lineages, especially the B/Yamagata-lineage. Prevention with respect to these epidemic trends, such as improved vaccination, i.e. matching the vaccine strain and timeliness, as well as meeting a sufficient rate of vaccination coverage for age and sex groups with a higher rate of prevalence, should be sought4.We found that the prevalence rate of influenza in children in Japan remained relatively high compared with adults, which is in line with former studies25. Similarly, there was no increase in the influenza prevalence rate in adults during the emergence of the A(H1N1)pdm09 subtype, suggesting that adults may have protective immunity against this subtype. Conversely, the results suggested that children are more susceptible to emergent virus subtypes and strains. The relatively higher prevalence of antibodies against A(H1N1)pdm09 could be attributed to the timing of the sample collection for the HAI assay in 2009, which occurred after the epidemic wave of A(H1N1)pdm09 started in August26. Considering the timing of the serum sampling, which mostly occurred before vaccination for the upcoming epidemic season, the observed prevalence of antibodies is thought to be derived from natural infection in the previous epidemic season; the increase in the prevalence of antibodies against A(H1N1)pdm09 over time may suggest residual antibodies from previous influenza infections. Although the HAI assay was conducted for vaccine virus strains, further data on antibodies using the Enzyme-Linked Immuno Sorbent Assay and whole influenza virus for antibody testing should be considered27. Additionally, our data of serum influenza antibodies included no information regarding the individual vaccination status.Although the serum antibody prevalence rates against the vaccine strains were relatively low in adults (except those aged 20\u201329\u00a0years), the influenza prevalence rate in adults was lower than in children. This observation may indicate the existence of immunity in adults from previous infection by different virus subtypes and strains17. Regarding the predominant virus subtypes, it has been found in many countries that after 2009 the A(H1N1) subtype was replaced by the A(H1N1)pdm09 subtype30. Meanwhile, our study illustrated that the prevalence of serum antibodies against influenza viruses was relatively low in children (0\u20135\u00a0years old), including antibodies against both the B/Yamagata and B/Victoria lineages. The biennial increase in the influenza prevalence rate in children in Japan during the study period appears attributable to epidemics caused by B lineage viruses. After 2010, the B/Yamagata-lineage has predominated over the B/Victoria lineage globally 35. In some countries, the number of infections by B lineage strains was increased in children35. Similarly, in Japan, the prevalence of the B/Yamagata-lineage has been increasing over time.National surveillance data for influenza over a long period, including data for age, sex, predominant virus subtypes and strains, and serum antibodies, are relatively limited37. Despite this relatively high vaccination coverage, the prevalence rate of influenza has remained similar over time, including a relatively high influenza prevalence rate in children. Therefore, further research to match vaccine virus strains with the predominant epidemic virus strains and increase the effectiveness of vaccinations in each season is needed, particularly with respect to B lineages40.In Japan, current influenza vaccination coverage is estimated at approximately 80% in school-age children and 50% in older adults45. Differences in incidence according to age and sex are thought to correspond to the immune status46. For example, women of reproductive age may have a stronger inflammatory response to infection than men of that age; thus, the rates of hospitalization for influenza infection may be higher in women than in men47.Both the incidence surveillance and serology surveillance were based on data collected from the outpatients, and thus, the data may have reflected healthcare-seeking or vaccination behavior or accessibility to testing in children and adults. However, concerning differences in the influenza prevalence rate by age and sex, previous studies  reported findings similar to those in our study, including higher incidence rates in male children than in female children and higher incidence rates in female adults than in male adults5. Furthermore, the surveillance network was immediately available for the active surveillance of COVID-1950. Long-term surveillance is important to develop and improve the strategy of monitoring, preventing and controlling future influenza epidemics.The surveillance of all infectious diseases was consolidated in Japan over decades and operated at the level of sentinel clinics to all clinic networks based on the surveillance disease category under the Infectious Disease LawSupplementary Figures.Supplementary Tables."}
{"text": "Wound healing-associated difficulties continue to drive biotechnological creativeness into complex grounds. The sophisticated architecture of skin wound sites and the intricate processes involved in the response to the use of regenerative devices play a critical role in successful skin regeneration approaches and their possible outcomes. Due to a plethora of complications involved in wound healing processes as well as the coordination of various cellular mechanisms, biomimetic approaches seems to be the most promising starting ground. This study evaluates the behavior of a crosslinked, porous collagen scaffold obtained by lyophilization and dehydrothermal reticulation (DHT). We address the key physio-chemical and mechanical factors, such as swelling, density and porosity, mechano-dynamic properties, SEM and TG-DSC, as well as important biological outcomes regarding scaffold biocompatibility and cellular metabolic activity, cytokine expression in inflammation, apoptosis and necrosis, as well as hemocompatibility and biodegradation. The mechanical and visco-elastic behavior are correlated, with the samples found to present similar thermal behavior and increased rigidity after DHT treatment. High biocompatibility rates were obtained, with no inflammatory stimulation and a reduction in necrotic cells. Higher percentages of cellular early apoptosis were observed. The hemocompatibility rate was under 2%, coagulation effects expressed after 4 min, and the DHT scaffold was more resistant to the biodegradation of collagenase compared with the untreated sample.  Our skin is an intricate mantle with remarkable capabilities, with its appearance generally reflecting the health and effectiveness of its underlying structures. At a glance, it seems frail and slender, but its importance in our homeostasis is more than skin deep. Being the largest organ of our body, and a key component of the innate immune system, it plays the role of infantry in numerous cases, either against common invaders, such as UV radiation , superfiThe microenvironment of a wound is highly refined by its own regulatory factors and its rich extracellular matrix (ECM), which determine the process of wound healing ,9. The cProduction of reproducible three-dimensional (3D) scaffolds represents one of the most important challenges in tissue engineering. Adequate biomimetic supports for cell migration and infiltration do not come easily, especially when they are required for inducing skin regeneration. In this case, the biomaterials should possess excellent biocompatibility, a suitable microstructure , controllable biodegradability and suitable mechanical properties. Currently, in skin tissue regeneration biotechnologies, natural and synthetic polymers are sought after , as well as poly  . Their iOne of the main advantages of collagen scaffolds is that they benefit wound healing by providing a skeleton of matrix for tissue types that are low in cellularity and have difficulty regenerating on their own after being affected by various external factors. The high porosity and generous cellular attachment sites of collagen in lyophilized scaffolds allow for the infiltration of additional cells, which aid remodeling. Porous scaffolds of lyophilized collagen may also present unique binding sites to cells that signal a remodeling response . The mecOther important advantages include the possibilities for customization of collagenic scaffolds in order to facilitate healing of numerous types of wounds, from superficial to chronic ones. By modifying each phase of fabrication based on the specific need of the tissues, bioscaffolds can be designed with improved therapeutic effects .However, controlling collagen biodegradation and improving its mechanical properties remain challenging, and are current barriers to its implementation within large-scale production and clinical trials. Therefore, our study aims to assess the biomimetic behavior of a collagenic scaffold in an in vitro simulated tissue microenvironment. All chemicals used were of analytical grade. The bovine Achilles tendon was provided by a local slaughterhouse, collected and stored in optional conditions for extraction. The other materials were sourced as follows: pepsin from porcine gastric mucosa ; acetic acid glacial ; hydrochloric acid w/w pepsin solubilized in 0.02 M HCl solution, pH 1.8), in accordance with the methodology described in the literature [Type I collagen was isolated from the bovine Achilles tendon (a by-product of the food industry). Collagen was isolated by the method of solubilization with non-specific enzyme  under vacuum (150 to 50 mbar), ranging the temperature during two days from 60 \u00b0C to 135 \u00b0C for a certain period of time and then cooled slowly to room temperature under vacuum, as shown in According to Xuefei et al. , a colla4/TiO2 as catalysts, converting N to NH3, which was distilled and titrated. The percentage of protein in a sample was calculated according to the Equation (1):b is the volume of the 0.1 N sulfuric acid used in sample titration (mL); a is the volume of 0.1 N sulfuric acid used in blank titration; Ne is the expected normality of the sulfuric acid solution (0.1 N); f is the correction factor of the sulfuric acid normality obtained by using sodium carbonate solution; Ws is the weight (g) of the sample; n is the conversion sfactor of total nitrogen to protein (6.25). Samples of each kind were measured in triplicate.The Kjeldahl method was used for total nitrogen content determination, using a conversion factor of total nitrogen to protein (6.25). The sample was digested in sulfuric acid  using CuSOThe moisture content was determined using Kern Moisture Analyzer DBS  and an aqueous solution of urea (aq. urea) (6 M) at 30 \u00b0C for 5 days. In order to discourage bacterial proliferation, the immersion liquids were changed every day. After wiping the immersion liquid off the surface with a filter paper, the wet weight of the samples was measured. The samples were air-dried for 24 h to obtain the weight in a dry state. The swelling ratio was calculated using Equation (2): W) were immersed for 5 min in a cylinder containing 10 mL of ethanol (V1). The volume of the ethanol containing the sample was measured (V2) and the volume of the liquid was measured again after the removal of the scaffold (V3). The porosity of the scaffold was calculated using the Equation (3), while the density was calculated using the Equation (4):The liquid displacement method was used to measure the porosity and density of the scaffolds. Ethanol was used as the displacement liquid. Collagen sponge scaffolds with a known weight  at room temperature for at least 5 min to reach equilibrious swelling. Subsequently, the sponge was removed for weighing after being gently blotted with a filter paper. The fluid uptake ability of the sample was calculated according to the following Equation (5):m0 is the weight of swollen sponge and m1 is the weight of sponge at 30 min, and at 1, 2, 3, 4, 5, 6, 7 and 8 h. Samples of each kind were measured in triplicate.The porous scaffolds were soaked in ultrapure water, and the swollen sponge was kept at 37 \u00b0C and 35% relative humidity in an incubator. At regular intervals of time, the scaffolds were removed and weighed. The weight remaining was calculated according to the following Equation (6):\u20131 and were accumulated for 400 scans at 4 cm\u22121 resolution at 22 \u00b0C. FTIR spectra of collagen scaffold samples were recorded with an Agilent Cary 630 FTIR spectrophotometer  in ATR mode, in the mid-infrared region, measuring the wavenumbers in the range between 4000\u20136500 cmAnalysis of surface morphological characteristics of samples Col-NT and Col-DHT was performed by scanning electron microscopy (SEM) analysis using a Zeiss Gemini 500 . Stress\u2013strain dependence was recorded using the DMA 242 Artemis apparatus from Netzsch , equipped with a sample holder for compression (pushrods made of fused silica), in compression mode, at room temperature, under a linear increase of compression force of 50 \u03bcN/min, at a total load varying between zero and 8 mN. DMA investigation was performed on the same apparatus, equipped with a sample holder for sharing , on samples of 15 mm diameter and 5 mm height. Flexural moduli  and the dissipation factor (tan \u03b4) were measured in temperature scan mode, under heating between \u2212100 and +280 \u00b0C with a linear increase of 2 \u00b0C/min. The mechanical oscillations were induced at a frequency of 1 Hz, under a dynamic stress of 65 kPa .\u22121 from room temperature up to 900 \u00b0C, under a flow of 50 mL min\u22121 dried air. An empty alumina crucible was used as reference.The thermal analysis TG-DSC for the Col-NT and Col-DHT samples was performed with a Netzsch STA 449C Jupiter . The samples were placed in an open crucible made of alumina and heated with 10 K\u00b7min2. After 24 h, cells were washed with PBS , harvested using trypsin (Sigma-Aldrich) and counted using Trypan Blue (Sigma-Aldrich) and a hemocytometer. The seeding density for the MTT assays was optimized at 4 \u00d7 105. Cells seeded at 4 \u00d7 105 density in a clear 24-well cell culture plate were treated with collagenic samples and controls and incubated for 24 and 48 h at 37 \u00b0C and 95% humidity with 5% CO2. After 24 and 48 h of exposure to tested compounds, cells were incubated for 4 h with MTT reagent  at 37 \u00b0C and 95% humidity with 5% CO2. After incubation, cells were treated with MTT solvent (Roche) for 15 min at room temperature. Absorbance was measured using a spectrophotometric microplate reader  at OD = 570 nm. With the LDH Cytotoxicity Detection Kit (Roche), LDH activity was measured in culture supernatants using a spectrophotometric microplate reader (ELISA reader) at 492 nm with a 600 nm wavelength reference.HEp-2 human epithelial cells (adenocarcinoma) (ATCC-American Type Culture Collection) were selected as the model for cytotoxicity assessment. MTT assay was used for measurement of cellular metabolic activity and as an indicator of cell viability, proliferation and cytotoxicity. HEp-2 cells were cultivated in DMEM culture medium  supplemented with 2 mM Glutamine (Sigma-Aldrich), 10% Fetal Bovine Serum (FBS) (Sigma-Aldrich) and 1% Pen/Strep  for 24 h at 37 \u00b0C and 95% humidity with 5% CO6 colony forming units/mL)\u2014E. coli (ATTC strain) and S. aureus (ATCC). After 24 h of stimulation, either with the collagenic material or with the bacterial strains, the supernatants were collected for cytokine quantification. Cytokine analysis was performed as per the manufacturer\u2019s instructions . The fluorokine beads  were diluted 1:100 in bead dilution buffer. Next, 50 \u03bcL of diluted bead was added to 50 \u03bcL of the sample in a 96-well filter bottom plate. Loaded 96-well plates were incubated overnight at 4 \u00b0C on an oscillating rocker (60 Osc./min). After washing, biotinylated primary antibodies (1:100 dilution) and plates were incubated at room temperature, protected from light (2 h at 60 Osc./min). After washing off the primary antibody, streptavidin-PE (1:100 dilution) was added to each well and plates were incubated . Finally, 100 \u03bcL of wash buffer was added to each well and samples were analyzed using a Luminex xMAP200 . Data points are represented as mean fluorescence intensities (MFI).RAW 264.7 murine macrophages were used in order to evaluate the immune response induced by the collagen scaffolds. Cells were grown in DMEM medium supplemented with 10% fetal bovine serum. Positive controls were represented by macrophages stimulated with two bacterial strains . In total, 10,000 cells were analyzed per measurement. Data were analyzed using FlowJo 10.0.7 software . HEK-293 T cells were cultured in DMEM medium supplemented with 10% FBS under standard cell culture conditions . Cell numbers were assessed using a hemocytometer. Trypsin/EDTA  was employed to detach the cells from the flask, either for passaging, heat shock induction or flow cytometry. For induction of apoptosis, cells were exposed to room temperature (22 \u00b0C) for a period of 24 h to collagenic scaffolds. HEK-293 T cells (3 \u00d7 106) were stained using the Alexa Fluor\u00ae 488 Annexin V/Dead Cell Apoptosis Kit according to manufacturer instructions. Stained cells were diluted in Annexin V-binding buffer. Suspended cells were used to perform the flow cytometry assay. Determination of early and late apoptosis was performed by flow cytometry using a FACS Alexa cytometer and an Alexa Fluorw/v) at 37 \u00b0C for 30 min. Then, they were incubated in the presence of citrate blood and diluted with physiological saline solution (4:5) for 1 h at 37 \u00b0C. Subsequently, the whole blood was diluted with distilled water to cause complete hemolysis (positive control) and also with physiological saline (negative control). After incubation, the samples were centrifuged at 5000 rpm for 15 min. The absorbance was measured at 524 nm for the supernatant to record the amount of hemoglobin released. The percentage of hemolysis (HR%) was calculated using the formula:The hemolysis ratio was analyzed using citrated whole blood diluted with physiological saline solution according to Balaji et al. . The sam2) was added onto the sponge surface in a glass dish and incubated for 1, 2, 3, 4 and 5 min at 37 \u00b0C. The negative control involved the addition of whole blood to the glass dish. Then, 2 mL of distilled water was added to dissolve the hemoglobin in free hemocytes. The content of hemoglobin on the samples was measured using a UV-Vis spectrophotometer at 542 nm by the following equation: The hemoglobin adsorption assay was conducted according to Yan et al. . A quant2 at 37 \u00b0C for 1 h. Then, the biodegradation was performed at 37 \u00b0C for 24 h after the addition of 200 U bacterial collagenase Clostridium hystolyticum . Digestion was completed by adding 0.25 M EDTA and cooling on ice. The samples were centrifuged for 15 min at 4 \u00b0C, and the hydroxyproline was determined for supernatants by the method described by Kolar [The method was performed according to the protocol described by Sun et al.  with minby Kolar . A standp < 0.05 was considered to be statistically significant.The statistical analysis was performed using GraphPad Prism 9 . For biocompatibility, the data were analyzed using the two-way ANOVA test. All data were expressed as the mean \u00b1 SD for triplicates. For hemocompatibility, data were analyzed using ordinary two-way ANOVA with the two-stage linear step-up procedure of Benjamini, Krieger and Yekutieli, with individual variances computed for comparison of Col-NT and Col-DHT. For biodegradability (%) the analysis was performed using the unpaired t-test method. A value of Protein concentration was determined for samples of the untreated collagen scaffold (Col-NT) and the dehydrothermally treated collagen scaffold (Col-DHT) using the Kjeldahl method. A nitrogen content of 14.77% was recorded for the untreated collagen scaffolds, leading to a total protein content of 92.35% . The dehThe moisture content was much lower in the case of Col-DHT (5.17%) compared with the Col-NT (13.23%) . The watThe DHT treatment causes crosslinking, which improves the mechanical properties of scaffolds. As a result, it was important to understand the type of crosslinking caused in the treated samples.Protein denaturants such as urea are commonly used to analyze protein stability. Julian at al.  found, bIn a high-concentration aq. urea solution, the protein\u2019s noncovalent hydrogen bonding is broken, and the protein swells significantly . The covThe swelling ratios of the collagen scaffold in DI water and urea, before and after applying the DHT treatment, are shown in the The swelling ratio in DI water for thermally treated collagen was reduced to 2.9, indicating that extra crosslinking was introduced. In contrast, the swelling ratio in urea was reduced considerably to 3.5, almost reaching the same value as the swelling ratio in water, indicating that the crosslinking upon dehydrothermal treatment mostly comprises covalent bonding, without excluding the formation of hydrogen bonding.Products that are to be used as medical devices and applied directly to wounds have to absorb all hematic and lymphatic fluids present in the wound itself. From this point of view, the porosity and the density of the collagen scaffold play important roles. The results of the porosity and density analyses are presented in the The scaffolds were easily wettable by polar solvents such as PBS. They exhibited a high swelling ability; this is because collagen contain a large number of functional groups capable of binding water. This fast-swelling behavior is a characteristic property of hydrophilic and porous materials. PBS solution has a pH of 7.4, which corresponds to the pH of blood. The use of such a solution allows for examination of the behavior of the material after its application inside the body. The percentage of scaffold swelling after immersion in PBS for 1 h, together with the results of the moisture content measurements, are presented in The water holding capacity was evaluated for both scaffolds. Based on the weight remaining percentage over time, it was found that the Col-DHT scaffold lost water more slowly than the Col-NT . After 5\u22121, moderate absorbance at 1300\u20131500 cm\u22121 and high absorbance in the regions 1500\u20131700 cm\u22121 and 2800\u20133500 cm\u22121. The amide I band associated with the stretching vibration of the carbonyl group along the polypeptide backbone was found at 1653 cm\u22121. The amide II and III bands were observed at 1550 cm\u22121 and 1238 cm\u22121, and are associated with N-H bending vibrations and C-H stretching, respectively. The amide A band was found at 3317 cm\u22121 and is associated with N-H stretching vibration and hydrogen bands [\u22121 and is related to the asymmetrical stretching of CH2.The changes in the chemical structure of the collagen that occurred upon DHT treatment were analyzed using Fourier-transform infrared spectroscopy. Significant information can be extracted from \u22121) spectra shifts to lower wavenumber compared with the Col-NT (1653 cm\u22121) but does not reach the values corresponding to gelatin (1630 cm\u22121); this proves that, during the thermal treatment, a series of changes occurs in the collagen triple helix structure, but these do not lead to a complete denaturation.In order to determine the changes in the amide I band during the dehydrothermal treatment of collagen (Col-DHT), the IR spectra for both pure collagen (Col-NT) and gelatin were recorded. Gelatin is a hydrolyzed form of collagen with a similar chemical composition, but which partially or completely loses its native triple helix structure. The variation of the amide I band was clear during the thermo-denaturation process. The center of the amine I band of the Col-DHT  can be observed. The pore size (varying from 54 nm to 265 nm) is visibly modified as compared to Col-NT, appearing condensed and well-contoured, and the rigidity of the scaffold seems to be increased. The physical-mechanical behavior of the dehydrothermically crosslinked collagen scaffolds was studied according to a protocol designed for insulating foams, in two steps: (i) identification of the linear visco-elastic domain by means of a stress\u2013strain experiment, and (ii) determination of visco-elastic properties by subjecting the sample to an oscillating force of a precise value. For both types of experiments, the applied forces and the resulted deformations were accurately measured, and the physical-mechanical properties of the scaffold material were then calculated. The samples exhibited a similar thermal behavior. In the RT-160 \u00b0C range, the samples lost ~10% of their initial mass, most likely due to the elimination of residual water molecules  . This process was accompanied by an endothermic effect with a minimum of 87.3 \u00b0C. The samples underwent oxidative degradation after 200 \u00b0C, losing ~87% of their mass up to 700 \u00b0C a. The degradation process occurred in three phases, partially overlapping, as can be seen from the exothermic effects on the DSC curve. In the first part, the oxidation of the lateral groups, labile at ~280 \u00b0C, probably occurred, followed by the oxidation of the main chain at ~325 \u00b0C. At higher temperatures, the oxidation process would have been continuous, slow and accompanied by a wide exothermic effect between 380\u2013490 \u00b0C. Around 625 \u00b0C there was a sharp exothermic effect that can be attributed to the presence of sodium in the sample or the burning of carbon dioxide. Detailed analysis of the DSC curve b indicatThe HEp-2 cell line was used to evaluate the biocompatibility of the collagenic scaffolds. An MTT assay was performed to evaluate cellular metabolic activity and an LDH assay to evaluate cytotoxicity and consequently extensive membrane damage. The results obtained by MTT assay  indicateAssessment of cellular behavior after 24 h of contact with each collagenic scaffold using a phase contrast microscope  enabled The evaluation of LDH activity can indicate intra- and extra-cellular values of pyruvate, and quantitatively measure cytotoxicity in response to applied treatments. The results obtained  indicateIn the context of skin wounds, proinflammatory cytokines are among the first factors to be produced in response to barrier damage, and they regulate the functions of immune cells in epithelialization. Proinflammatory cytokines mainly include interleukins (IL)-1\u03b2, IL-6 and interferon (IFN-\u03b3), among others, and participate in the inflammation phase of wound healing through activating downstream cascades . CytokinE. coli and S. aureus (as positive controls). The results obtained for IFN-\u03b3  response. PS is located on the inner side of the intact plasma membrane of live cells and these cells do not stain with Annexin V or PI. PS localization is turned over to the outer side of the plasma membrane of apoptotic cells and these cells bind Annexin V on the outside but still exclude PI. Annexin V binds to PS on the plasma membrane and PI is taken up and binds to the DNA . 0, i.e., the initial contact point   . These fIn correlation with the fluid uptake ability obtained for the Col-NT (35.61 \u00b1 2.54) and Col-DHT (47.74 \u00b1 1.04), the lower HR rates for the DHT sample can be explained by its ability to release hemoglobin being conditioned by the applied treatment, and, consequently, by the rigidity obtained for the fibrous scaffold. p < 0.0001) and reached a coagulation effect similar to Col-NT after 4 min (p > 0.05).The rate of hemoglobin adsorption by the collagen sponges is shown in p < 0.0001). Therefore, Col-DHT was more resistant to the biodegradation of collagenase.Biomaterial biodegradation is vital for their use both as implantable materials and externally  because it affects cell growth, cell vitality and host response . BiodegrCollagen is the most common natural polymer, being the most abundant protein on earth, and can be easily extracted from both animal and plant sources. Type I bovine collagen, extracted from tendons, skin and bones, is the most common form, being widely used as a biomaterial. The intermolecular crosslinking of collagen can be achieved by the esterification of carboxylic groups or by amide group formation, collagen being a protein with a high number of hydroxyl, carboxyl and amino groups.Without crosslinking, collagen is frequently subject to problems related to its weak mechanical properties, cracking and high swelling ratio. Its stability can be increased with the formation of an extensive network of stable intermolecular crosslinks. Dehydrothermal (DHT) treatment, a physical crosslinking method, involves the exposure collagen to high temperatures for a certain period of time under a vacuum in order to remove the water and form new crosslinks. Removing the water from a collagen scaffold may cause damage to the original hydrogen bonds within the collagen. In this research, the most favorable DHT conditions were employed, with a highest temperature of 135 \u00b0C for 3 h.In the present study, we successfully produced a crosslinked collagen sponge scaffold using DHT treatment with a highly porous structure. Porosity and density are two very important parameters that define porous scaffolds. The reduction in the porosity of the sponge upon DHT crosslinking was counteracted by an increase in density, which would favor cell growth, proliferation, and nutrient and metabolite exchange, due to the larger surface accessible to cells .SEM analysis depicted the sample\u2019s progression from a frail, fibrous and high porosity scaffold to a denser, rigid and condensed structure after the DHT treatment. As for the mechano-dynamic assessment, three domains can be identified: the first two following a conventional pattern, and the unusual third one, the latter probably associated with the progressive rupturing of the elongated fibers. The smallest feasible strain falling within the linear domain of the stress\u2013strain curve was 65%. The thermally induced evolution of the main visco-elastic parameters of the scaffold material was observed in the domain between \u221250 \u2026 +100 \u00b0C, where the \u201cmelting\u201d of the triple-helical structure of collagen occurs, at around 60 \u00b0C.TG-DSC analysis of samples indicated similar behavior for both of them. Upon close inspection, the DSC curve obtained indicated the presence of a weak endothermic effect at 220 \u00b0C, corresponding to the transition from triple-helix to an accidentally twisted chain. This transition is specific to collagen, and occurs when hydrogen bonds are broken by rising temperatures, turning collagen into gelatin.Evaluation of cellular biocompatibility in an in vitro stimulated tissue microenvironment provides great overview of the behavior of a medical device, especially in wound healing applications, where the physiopathology of the wound further complicates the affected site. The results obtained by MTT and LDH assays, performed after 24 h of sample contact with HEp-2 cells, indicate desirable biocompatibility for the sample Col-DHT, and decreased viability rates for Col-NT, further indicating the positive outcome of the DHT treatment. The monolayer exhibited better proliferation and adherence in the presence of the Col-DHT sample. The decreased viability for the sample Col-NT may be due to the different degradation process and the formation of small peptidic chains that suffocate cells and do not promote proper proliferation. As other authors have mentioned, biodegradation plays a critical role in obtaining a desirable 3D scaffold ,49.Cytokines are critical mediators that oversee and regulate immune and inflammatory responses via complex networks and serve as biomarkers for many diseases. Quantification of cytokines has significant value in both clinical medicine and biology, as the levels provide insights into physiological and pathological processes, especially in the development of novel medical devices of clinical interest. Cytokines and their clinical significance can be characterized from the perspective of their pro- and anti-inflammatory effects . ProinflE. coli and S. aureus (as positive controls), we observed lower levels of 1\u03b2 and IL-6 for the collagen samples in comparison with the positive controls; as for IFN-\u03b3, similar values for both collagenic scaffold samples were obtained, with decreased expression levels in comparison to E. coli and S. aureus controls. Conversely, stimulation with bacterial strains led to enhanced production of IL-1\u03b2, IL-6 and IFN-\u03b3. A clear distinction between the two types of collagenic scaffolds was not observed, suggesting that the dehydrothermal reticulation did not impact cytokine expression in any way. Since IFN gamma is a pro-apoptotic effector [After exposing RAW murine macrophages to samples of Col-NT and Col-DTH, as well as effector , the resThe evaluation of early/late apoptosis and necrosis provided great insights into the cellular behavior after treatment with the collagenic scaffolds. The evaluation at the point of initial contact presented higher rates of viability (over 90%). However, after 24 h, cellular viability decreased significantly, and early apoptosis occurred. These findings may indicate some limitations of the MTT and LDH assays; as we know, these provide colorimetric end-point measurements. Annexin V and Propidium Iodine labelling paint a more detailed picture of how cells are affected at the metabolic level for both early apoptosis pathways (extrinsic and intrinsic) , and falThe evaluation of hemocompatibility for scaffolds intended to be used as implantable devices is a crucial assay. The results obtained indicate a HR of 1.39 \u00b1 0.06% for Col-NT and 1.04 \u00b1 0.19% for Col-DHT. According to ASTM F 756\u20132000 requirements, both samples are non-hemolytic. These results correlate with the higher fluid uptake ability of the Col-DHT samples as compared to the Col-NT. Moreover, Col-DHT starts from a significantly lower absorption rate and reaches a coagulation effect similar to Col-NT after 4 min.The biodegradability of samples was assessed using collagenase. Collagenase is an enzyme responsible for cleaving the triple helix. It specifically catalyzes the hydrolysis of peptide bonds with glycine . The resCompared with intact human skin, the mechanical and visco-elastic behavior of the studied scaffold registers modest values (with at least ten-fold less stress accommodated at the same applied strain) . HoweverAn adapted DHT treatment with different conditions of time and temperature was employed to obtain the most appropriate collagenic scaffold that is intended to be used in due course as a medical device for wound healing. The formation of covalent crosslinking bonds was observed by analyzing the swelling ratio of collagen scaffolds in DI water and 6M aq. urea. The IR data confirm that the DHT treatment did not lead to the loss of the native triple helix structure of the collagen scaffold. SEM, TG-DSC and mechano-dynamic assessment further confirmed this and presented a detailed depiction of the scaffolds\u2019 behavior. Furthermore, we focused on analyzing the biomimetic behavior of the collagenic scaffold attained. The satisfactory biocompatibility results obtained, with no inflammatory stimulation, decreased necrotic cells and low HR rates, suggest considerable scope for further studies. Higher percentages of cellular early apoptosis were observed. Collagenase degradation rates were consistent with literature reports regarding the influence of crosslinking methods on collagen scaffold degradation. Notwithstanding the favorable results obtained so far in this study, due to complex and comprehensive requirements from legislative parties, there is a long way to go before even attempting to market this type of product. Besides the biotechnological challenges, clinical trials and CE marking approval are among the ones that still lie ahead."}
{"text": "PANGEA allows GO analysis to be performed on different sets of GO annotations, for example excluding high-throughput studies. Beyond GO, gene sets for pathway annotation and protein complex data from various resources as well as expression and disease annotation from the Alliance of Genome Resources (Alliance). In addition, visualisations of results are enhanced by providing an option to view network of gene set to gene relationships. The tool also allows comparison of multiple input gene lists and accompanying visualisation tools for quick and easy comparison. This new tool will facilitate GSEA for Drosophila and other major model organisms based on high-quality annotated information available for these species.Gene set enrichment analysis (GSEA) plays an important role in large-scale data analysis, helping scientists discover the underlying biological patterns over-represented in a gene list resulting from, for example, an \u2018omics\u2019 study. Gene Ontology (GO) annotation is the most frequently used classification mechanism for gene set definition. Here we present a new GSEA tool, PANGEA (PAthway, Network and Gene-set Enrichment Analysis;  Modern genetics and genomics owe much to work done using common model organisms. These models continue to make a significant contribution to the understanding of development, metabolism, neuroscience, behaviour and disease. With the onset of the \u2018big data\u2019 era has come a need for analysis platforms that deconvolute complex data from multispecies studies. Model organism databases (MODs) are knowledgebases dedicated to the curation, storage and integration of species-specific data for their research community. The past decade has seen a number of efforts aimed at pulling together model organism and human data to facilitate a more interdisciplinary approach; examples include MARRVEL (Model organism Aggregated Resources for Rare Variant ExpLoration) , Gene2FuAlthough these integrated resources allow search and comparison across certain data classes, large-scale data analysis remains in the domain of stand-alone bioinformatic tools such as DAVID , TermMapDespite the abundance of tools, we found that they do not fully meet community needs, primarily because they were overly focused on human gene data and were not using the most up to date data on other species. For example, Reactome pathway annotation is based on computational predictions derived from manually curated human pathways. There are a few organism-targeted analysis tools; the prokaryote-centred GSEA FUNAGE-Pro  is one eD. melanogaster, the nematode worm C. elegans, the zebrafish D. rerio, the mouse M. musculus, the rat R. norvegicus and human H. sapiens. For annotations based on a controlled vocabulary arranged in hierarchical structure, such as gene group and phenotype annotations from FlyBase, gene-to-gene set relationships were assembled after the hierarchical structure was flattened. An exception was made for GO annotations, which were assembled in two ways, with and without being flattened, allowing users to choose which output is used in the analysis. GO annotations include evidence codes that indicate the type of evidence supporting the annotation. For example, \u2018IDA\u2019 means that an annotation was supported by a direct assay, whereas \u2018ISS\u2019 means that the annotation was inferred from sequence or structural similarity. Using such evidence codes, GO gene sets were built with additional configurations: 1.) subsets based on experimental evidence codes, i.e., excluding annotations only based on phylogenetic, sequence or structural similarity and other computational analyses ; 2.) subsets excluding annotations only supported by high-throughput (HTP) evidence codes ; 3.) subsets of GO generic terms (GO slim) provided by the GOC (http://geneontology.org/docs/download-ontology/#subsets); 4.) subsets of very high-level GO term classifications used by FlyBase and the Alliance originally generated to support GO summary ribbon displays. For Drosophila phenotype annotations from FlyBase, we assembled the gene-to-phenotype association using the \u201cgenotype_phenotype_data\u201d file available in the FlyBase Downloads page, in which phenotypes are associated with individual genotypes and controlled vocabulary identifiers are indicated. This allowed us to extract only those genotypes where we could be certain that the phenotype was associated with the perturbation of a single Drosophila melanogaster gene . Because different resources use different gene or protein identifiers, we used an in-house mapping program to synchronise IDs to NCBI Entrez gene IDs, official gene symbols and gene identifiers of species-specific resources, such as MGI and FlyBase . A program was implemented in the Python programming language to identify genes expressed at a substantially higher levels in one tissue versus any other tissue. This program first groups the RNA-seq datasets based on tissue. For example, all data related to the nervous system are grouped together. It then calculates the average reads per kilobase per million mapped reads (RPKM) expression values for each gene in each tissue group. Genes were identified as preferentially expressed in a given tissue group if their average expression in the tissue group is three-fold or higher than the average expression in any other tissue group. Genes with average RPKM value lower than 10 were excluded. Genes defined in this way as \u2018tissue-specific\u2019 then get annotated with the relevant tissue to generate the tissues expression classification set.To study the diversity and dynamics of the Drosophila transcriptome, the modENCODE consortium sequenced the transcriptome in twenty-nine dissected tissues  and the https://www.flyrnai.org/) via download of a file of all available public screen \u2018hits\u2019 . RNAi reagents of optimal design were selected. The criteria for optimal design were no CAN or CAR repeat, fewer than 6 predicted OTEs  and a single gene target. RNAi reagents were mapped to current FlyBase gene identifiers using a DRSC internal mapping tool. Screens focused on major signalling pathways were selected for PANGEA analysis    and highHypergeometric testing is performed to calculate P values for GSEA using the PypeR function in R. Bonferroni correction for multiple statistical tests, Benjamini-Hochberg procedure for false discovery rate adjustment, and Benjamini-Yekutieli procedure for false discovery rate adjustment were performed using the p.adjust function in R.https://www.flyrnai.org/tools/pangea/) and is built following a three-tier model, with a web-based user-interface at the front end, the knowledgebase at the backend, and the business logic in the middle tier communicating between the front and back ends by matching input genes with gene sets, doing statistical analysis and building visualization graphs. The front page is written in PHP using the Symfony framework and front-end HTML pages using the Twig template engine. The JQuery JavaScript library is used to facilitate Ajax calls to the back end, with the DataTables plugin for displaying table views and Cytoscape and VegaLite packages for the data visualisations. The Bootstrap framework and some custom CSS are used on the user interface. A mySQL database is used to store the knowledgebase. Both the website and databases are hosted on the O2 high-performance computing cluster, which is made available by the Research Computing group at Harvard Medical School.PANGEA is a SaaS (Software as a Service) web tool  and human. For example, pathway annotations allow users to identify metabolic or signalling pathways that are over-represented in a gene list and help understand causal mechanisms underlying the observed phenotype from a screen. Pathway annotations from KEGG, PantherDB, and Reactome, as well as manually curated Drosophila gene sets, such as FlyBase Signalling Pathways and the DRSC PathON annotation  from organism-specific resources (human and fly), protein complex annotations for multiple organisms from the EMBL-EBI Complex Portal  and COMPIn summary, we have assembled more than 300,000 different gene sets that can be used in PANGEA to assess the enrichment of particular biological features in an input gene list.GSEA can be computationally intensive because of the number of gene sets being tested and potentially large number of genes entered by users. Therefore, the step of pre-processing user\u2019s input by mapping the input gene identifiers to the gene identifiers used for gene set annotation, is set up as a standalone ID mapping page (accessed by clicking \u2018Gene Id Mapping\u2019 on the top toolbar) instead of combining it with the analysis step. Gene identifiers supported by PANGEA include Entrez Gene IDs, official gene symbols and primary gene identifiers from MODs. Users might need to analyse lists of other identifiers such as UniProtKB IDs and Ensembl gene IDs. Users can use \u201cGene Id Mapping\u201d tool and select an organism of choice to map IDs. As gene annotation is an on-going process, the gene identifiers as well as gene symbols might change over time. Even with the same type of gene identifiers such as FlyBase gene ID, the IDs used by users might be from a different FlyBase release. Therefore, ID-mapping step is an optional but recommended first step to ensure that the entered IDs are synchronized with the IDs used by PANGEA gene set annotation. Users of FlyBase may also directly export a \u2018HitList\u2019 of genes generated in FlyBase to the tool by selecting the \u2018PANGEA Enrichment Tool (DRSC)\u2019 from the dropdown \u2018Export\u2019 menu. An option for users to upload a background gene list for the analysis is provided; this may be useful when analysing hits from a focused screen using a kinase sub-library instead of a genome-scale library, for example. PANGEA identifies all relevant gene sets and provides enrichment statistics such as p-values, adjusted p-values, and fold enrichment, as well as the genes shared by the input gene list and gene set members. Users have the option to set different p-value cut-offs and visualise the results using a bar graph, the height and colour intensity of which can be customised . In addiAn under-appreciated use of GSEA tools is that researchers often use them as simple gene classification tools, for example, asking \u201cwhich genes in my list are kinases?\u201d to help inform further computational or experimental analysis. Having diverse classification sets is important because depending on the type of data/experiment being analysed, different gene sets may be more useful than others. It is often useful to be able to compare similar gene sets from different sources to help evaluate the evidence for support. In addition, PANGEA not only reports genes in an enriched gene set but also reports genes not covered by the gene set category selected, which may be interesting because of their lack of characterisation. This feature can help user answer question like \u201cwhich genes in my list are not covered by KEGG annotation?\u201d.Often users need to analyse multiple gene lists and compare the results; however, majority of current web-based tools only allow the analysis of a single input list (plus background). Thus, users have to perform comparisons manually or using different tools. To address this need, PANGEA allows users to input multiple gene lists and compare results directly via a heatmap or a dot plot visualisation. For example, users might input gene hits from different phenotypic screens and compare what pathways, gene groups or biological processes that are common or different among results .Drosophila S2R+ cells. Submitting the combined list of 75 interacting proteins from the four baits via the \u2018Search Single\u2019 option at PANGEA (accessed by clicking \u2018Search Single\u2019 on the top toolbar) for Fly and performing GSEA over phenotype, SLIM2 GO BP as well as protein complex annotation from COMPLEAT (literature based) enrichment, we identified mRNA metabolic process (GO:0016071), protein folding (GO:0006457), abnormal sex-determination (FBcv:0000436), abnormal neuroanatomy (FBcv:0000435), CCT complex and Spliceosome complex among the top enriched gene sets with the most significant p-values   . Next, w<1\u00d710\u22125) . We also<1\u00d710\u22125) . Enrichm<1\u00d710\u22125) . These G<1\u00d710\u22125) ,1C, whicWe further analysed the protein complexes associated with each individual subunit using the \u2018Search multiple\u2019 option at PANGEA (accessed by clicking \u2018Search Multiple\u2019 on the top toolbar) and inputting the interacting protein lists for each bait, then compared the enrichment result using a heatmap visualisation . The resDrosophila. At the DRSC, datasets generated from more than one hundred screens are publicly available  screening is a powerful method for functional studies in vailable . We selevailable .These use cases of PANGEA for phenotype screening data as well as proteomics data demonstrate the value of the tool in validating screen results as well as generating new hypotheses for further study.GSEA is a computational method used to identify significantly over-represented gene classes within an input gene list(s) by testing against gene sets assembled based on prior knowledge. Input gene lists are typically from high-throughput screens or analyses. Here we present PANGEA, a newly developed GSEA tool with major model organisms as its focus, that includes gene sets that are usually not utilized by other GSEA tools, such as expression and disease annotations from the Alliance, phenotype annotations from FlyBase, and GO subsets with different configurations. PANGEA is easy to use and has new features such as allowing enrichment analyses for multiple input gene lists and generating graphical outputs that make comparisons straightforward for users. In addition to the use cases presented here, i.e., analysing phenotypic screening and proteomic data, we anticipate that the tool will also facilitate analysis of gene lists from other types of data. For example, analysis of single-cell RNA-seq datasets at PANGEA might help users identify pathways and biological processes that are characteristic of various cell types. Users will also be able to answer questions on classification such as, \u201cwhich genes in this list are kinases?\u201d. PANGEA is designed to accommodate a wide range of biological data types and questions, providing users with a web-based analysis tool that is easily accessible and user-friendly.We also note that gene classifications are not static, and the generic design of the tool means that it will be easy to update or expand PANGEA for more gene set classification and/or more species. In developing PANGEA, we sought to improve the effectiveness of GSEA by 1) providing multiple collections of genes classified by their function in different ways (classified gene sets); 2) ensuring the data underlying the classification of gene function was up to date; and 3) improving the visualization so that results from multiple gene sets or multiple gene lists could be compared easily.Supplement 1"}
{"text": "Computational and Mathematical Methods in Medicine has retracted the article titled \u201cResearch on Classroom Online Teaching Model of \u201cLearning\u201d Wisdom Music on Wireless Network under the Background of Artificial Intelligence\u201d [ligence\u201d  due to cFollowing an investigation conducted by the Hindawi Research Integrity team , signifi"}
{"text": "Computational and Mathematical Methods in Medicine has retracted the article titled \u201cResearch on Radiosensitivity of the Protein Kinase B Signaling Pathway in Cervical Cancer\u201d [ Cancer\u201d  due to cFollowing an investigation conducted by the Hindawi Research Integrity team , signifiThe authors do not agree to the retraction."}
{"text": "Applied Bionics and Biomechanics has retracted the article titled \u201cPrevention and Detection Research of Intelligent Sports Rehabilitation under the Background of Artificial Intelligence\u201d [ligence\u201d  due to cFollowing an investigation conducted by the Hindawi Research Integrity team , signifiThe authors do not agree to the retraction."}
{"text": "Applied Bionics and Biomechanics has retracted the article titled \u201cExploration and Research on Smart Sports Classrooms in Colleges in the Information Age\u201d [ion Age\u201d  due to cFollowing an investigation conducted by the Hindawi Research Integrity team , signifi"}
{"text": "Fusarium graminearum. The Gpmk1 mgv1 Fghog1 triple mutants had severe growth defects and was non-pathogenic. It was defective in infection cushion formation and DON production. Conidiation was reduced in the triple mutant, which often produced elongated conidia with more septa than the wild-type conidia. The triple mutant was blocked in sexual reproduction due to the loss of female fertility. Lack of any MAPKs resulted in an increased sensitivity to various abiotic stress including cell wall, osmotic, oxidative stresses, and phytoalexins, which are likely related to the defects of the triple mutant in environmental adaptation and plant infection. The triple mutant also had increased sensitivity to the biocontrol bacterium Bacillus velezensis and fungus Clonostachys rosea. In co-incubation assays with B. velezensis, the Gpmk1 mgv1 Fghog1 mutant had more severe growth limitation than the wild type and was defective in conidium germination and germ tube growth. In confrontation assays, the triple mutant was defective in defending against mycoparasitic activities of C. rosea and the latter could grow over the mutant but not wild-type F. graminearum. RNA-seq and metabolomics analyses showed that the MAPK triple mutant was altered in the expression of many ATP-binding cassette (ABC) and major facilitator superfamily (MFS) transporter genes and the accumulation of metabolites related to arachidonic acid, linoleic acid, and alpha-linolenic acid metabolisms. Overall, as the first study on mutants deleted of all three MAPKs in fungal pathogens, our results showed that although MAPKs are not essential for growth and asexual reproduction, the Gpmk1 mgv1 Fghog1 triple mutant was blocked in plant infection and sexual reproductions. It also had severe defects in responses to various abiotic stresses and bacterial- or fungal-fungal interactions.Mitogen-activated protein kinase (MAPK) cascades are activated by external stimuli and convert signals to cellular changes. Individual MAPKs have been characterized in a number of plant pathogenic fungi for their roles in pathogenesis and responses to biotic or abiotic stresses. However, mutants deleted of all the MAPK genes have not been reported in filamentous fungi. To determine the MAPK-less effects in a fungal pathogen, in this study we generated and characterized mutants deleted of all three MAPK genes in the wheat scab fungus The online version contains supplementary material available at 10.1007/s44154-021-00025-y. Fusarium graminearum is a causal agent of Fusarium Head Blight (FHB), a destructive disease of wheat, barley, and other grain cereals worldwide  and zearalenone  and MEK kinase (MEKK) genes are non-pathogenic and sterile, and have severe cell wall defects  kinases play important roles in activating cellular responses to extracellular signals, including host and environmental stimuli in plant pathogenic fungi , abundant infection cushions were formed by the wild type on wheat lemma at 2\u2009days post-inoculation (dpi)  and deletion of ant Fig.\u00a0a. TherefFghog1 mutant and apical swelling in the triple mutant. Nevertheless, irregular swellings were not observed in the Gpmk1, Gpmk1 mgv1, and mgv1 Fghog1 mutants -enrichment analysis, the top 500 up-regulated DEGs in the triple mutant were not enriched in any biological process. However, the top 500 down-regulated DEGs were significantly enriched for transmembrane transport, carbohydrate transport, interspecies interactions between organisms, and oxidation-reduction process .F. graminearum. In comparison with the wild type, 10 up-regulated and 19 down-regulated ABC transporter genes were identified in the triple mutant  and major facilitator superfamily (MFS) transporter genes in ant Fig. b. For diant Fig. b. These FAC1 adenylate cyclase gene was higher in the triple MAPK mutant than the wild type (Table S2). When intracellular cAMP level was measured, the triple mutant also showed an elevated cAMP level in comparison with the wild type  and three MEK  genes had no significant changes in their expression levels in the triple mutant. The expression levels of genes encoding the G\u03b1, G\u03b2, and G\u03b3 proteins also were normal in the tripe mutant, suggesting that the expression of well-conserved upstream G-proteins, MEKKs, and MEKs are not affected by deletion of these three MAPKs. In addition, deletion of three MAPKs resulted in no significant effect on the expression levels of the well-conserved STE12, MCM1, SWI6, RLM1, and ATF1 orthologs that are downstream transcription factors of MAPK signaling in the budding yeast  and 1017 metabolites with no significantly changes between the wild type and triple mutant  in our RNA-seq data, CON1 expression was affected (down-regulated 5-fold) in the triple mutant, likely related to the defects in conidiogenesis. In addition, deletion of three MPAKs may increase the intracellular cAMP level, which in turn activates the cAMP-PKA signaling pathway. The hyper-activation of cAMP-signaling may partially rescue some defects of the MAPK triple mutant but result in additional defects in conidiogenesis.The roles of individual MAPKs in regulating developmental and infection processes, as well as stress responses have been characterized in a variety of fungal pathogens that differ in host ranges and infection mechanisms  and AbHog1 are activated by camalexin, an indolic phytoalexin structurally related to brassinin  in the triple mutant were enriched in the fast evolving subgenome, which is under the control of heterochromatin and likely contains many genes important for adaption and infection  in stress response are not clear in F. graminearum. Because the Gpmk1 mgv1 FgHog1 triple mutant displayed similar sensitivity to CR as the mgv1 Fghog1 double mutant, indicating that Gpmk1 fails to function as a MAPK important for regulating responses to cell wall stress when MGV1 and FgHOG1 are deleted. Indeed, the role of Gpmk1 orthologs in cell wall integrity varies among different fungi. Whereas deletion of ChMK1 resulted in hypersensitivity to CR in Colletotrichun higginsianum  have showed that MAPKs can be activated by microbe-associated molecular patterns (MAMPs) or interactions with bacteria . Complete medium (CM) cultures grown at 25\u2009\u00b0C were used for assaying growth rate and colony morphology , respectively. The resulting PCR products were purified and connected to the neomycin resistance gene cassette by overlapping PCR and transformed into protoplasts of the Gpmk1 mutant as described , and then connected with the neomycin resistance gene cassette by overlapping PCR. The resulting PCR product was transformed into protoplasts of the Gpmk1 mgv1 double mutant. Transformants resistant to hygromycin, geneticin, and fludioxonil were verified by PCR for the deletion of FgHOG1  resuspended in YEPD medium. After incubation at 25\u2009\u00b0C for 6\u2009h, germination rates were counted and analyzed. After incubation at 25\u2009\u00b0C for 12\u2009h or 24\u2009h, germlings were examined with an Olympus BX-51 microscope. Each experiment was repeated at least three times independently.The final concentration of 200\u2009\u03bcg/ml CR, 0.05% H5 spores ml\u2212\u20091 in sterile double-distilled water (DDW). Wheat heads of 6-week-old cultivar XiaoYan 22 were inoculated with 10\u2009\u03bcl of conidium suspensions at the fifth spikelet from the base  glutaraldehyde, and coated with gold-palladium before examination with a JEOL 6360 scanning electron microscope as described (Boenisch and Schafer 5 spores ml\u2212\u20091) over the wound sites  were inoculated 2.5\u2009cm apart on the opposite side of CM medium. After incubation at 25\u2009\u00b0C for 3\u2009days, inhibition of colonial growth was examined. To assay its inhibitory effects on conidium germination and hyphal growth, 3\u2009ml B. velezensis (OD600\u2009=\u20091.0) was mixed with fungal conidia and then resuspended in liquid YEPD (105 spores ml\u2212\u20091). After incubation at 25\u2009\u00b0C for 6\u2009h or 12\u2009h, germination and germlings were examined with an Olympus BX-51 microscope. Tip or intercalary swelling was observed after 24\u2009h incubation. Each experiment was repeated at least three times independently.To assay fungal-bacterial interactions, C. rosea strain CanS41 . RNA-seq reads were mapped to the PH-1 reference genome using HISAT2 with its two-step algorithm  system  as described  and 2203 down-regulated (green dots) DEGs in Gpmk1 mgv1 Fghog1 triple mutant compared to the wild type.Additional file 4: Fig. S4. GO enrichment analysis of the down-regulated DEGS in the triple mutant. BP, Biological Process; CC, Cellular Components; MF, Molecular Function.Additional file 5: Fig. S5. Multidimensional scaling plot of the metabolomic profiles of the wild type and triple mutant.Additional file 6: Fig. S6. A proposed model for the functions and crosstalk of three MAPK pathways. a. Roles of F. graminearum MAPKs in fungal development, pathogenicity, DON production and abiotic stress responses. b. Roles of F. graminearum MAPKs in fungal-bacterial interaction and fungal-fungal interaction.Additional file 7: Table S1. Primers used in this study.Additional file 8: Table S2. Profiles of the differentially expressed genes in the wild type and Gpmk1 mgv1 Fghog1 triple mutant."}
{"text": "The Reading the Mind in the Eyes test (RMET) is a widely applied test of social cognition, based on mental state judgments in response to photographs of human eyes, which can elicit impairment in patients with numerous psychiatric and neurological disorders. However, interpretation of task performance is limited without the use of appropriate control tasks. In addition to a matched task requiring age judgments of the RMET stimuli, it was recently shown that a mental state judgment task of comparable difficulty, could be developed using photographs of domestic cat eyes. The current study aimed to further develop a Non-human Animal RMET (NARMET) by testing additional stimuli in the form of photographs of domestic dog eyes. A variety of additional tasks were used alongside the eyes test stimuli in a large sample of healthy young adults, to explore how alexithymia, schizotypal features, and autistic tendencies may differentially influence mental state attribution in response to cat, dog, and human eyes test stimuli. The resulting NARMET features both cat and dog trials, depicting a similar range of complex mental states to the human RMET. It shows favorable psychometric properties as well as being well matched to the RMET in terms of linguistic variables, length and difficulty. However, reading measures predicted performance on the RMET, but not on the NARMET. Although further testing is required in samples with a higher proportion of males, future application of the NARMET in neuropsychiatric populations exhibiting cognitive and behavioral difficulties could offer enhanced assessment of social cognitive skills. The Reading the Mind in the Eyes test (RMET) is a widely applied test of social cognition, involving selection of complex mental states to match photographs of the human eye region . Use of In one recent study, it was shown that a counterpart measure of comparable difficulty to the human RMET could be developed using photographs of domestic cat eyes . Cats weIt was previously found that higher accuracy on both the RMET and cat eyes test was positively associated with ratings of liking dogs on a simple animal preference questionnaire . Given tA variety of additional tasks were used alongside the eyes test stimuli to explore whether psychological factors may differentially influence performance across the human and non-human animal versions of the tasks. Because vocabulary and verbal fluency can be related to RMET performance , 28, meaAfter ethical permission was granted for the study by University of Birmingham, 210 undergraduate students without any current psychiatric or neurological diagnoses, or cat/dog phobia, volunteered to participate for course credit. Five had missing data and 1 demonstrated below chance performance on the eyes tests. A further three participants had incomplete data on a few questionnaires but were included after imputation of missing values based on group mean . The finParticipants completed the tasks individually in a lab at the University. They provided demographical information , and completed the Hospital Anxiety, and Depression Scale (HADS), Test of Irregular Word Reading Efficiency (TIWRE), and Test of Word Reading Efficiency (TOWRE). Participants then completed the three computerized eyes tasks, which were presented using Presentation  software, after being provided with Baron-Cohen et al.\u2019s glossary of mental state terms. The order of presentation of each stimuli set  was counterbalanced across participants. These were followed by computerized questionnaires: Interpersonal Reactivity Index (IRI), Toronto Alexithymia Scale (TAS-20), Revised Social Anhedonia Scale (rSAS), Autism Spectrum Quotient (AQ50), Emotional Contagion Scale (ECS), Individual Differences in Anthropomorphism Questionnaire (IDAQ), Mind Reading Motivation scale (MRM), and Oxford-Liverpool Inventory of Feelings and Experiences (O-Life).Participants read out loud 108 regular words and then 39 irregular words , 31 withThe IRI , 33 contThe TAS assesses alexithymia and has good reliability and construct validity \u201336. TherThe revised SAS  containsThis self-report measure  containsThis scale , 41 contThis self-report measure  was deveThis scale assesses tendencies toward thinking about mental states rather than ability . The devThis scale  assessesThe AQ  consistsThe RMET  were detn = 18) was selected to match to the RMET for difficulty, and to achieve sufficient reliability and internal consistency. Correct answers were based on consensus (majority response for each item in the current study were no different to our previous study). The dog eyes test stimuli were developed for the current study following the same process as for the cats eyes stimuli i.e., 36 images (plus 1 for practice) without re-use restrictions were selected from the internet, based on visual similarity to the human stimuli , with a view to matching each individual RMET trial. Each eyes test commenced with onscreen instructions to pick \u201cthe word that best describes what the person/cat/dog in the image is thinking or feeling.\u201d Images were approximately 28 cm \u00d7 9 cm high , with response options in Arial 22 point (approximately 1 cm high) outside the corners of the image, mapped to the numeric keypad which was used to respond . The first trial began after the participant pressed the space bar. There was no time limit, and a valid button response initiated the next trial.The development of the cats eyes test was described previously . Trials n = 228), as was done previously  and TAS-20 (n = 20), although more participants scored above the cut-off for the rSAS (n = 44).Accuracy scores (%) and mean reaction times  for the human , cat , and dog  stimuli were well matched. Mean accuracy for all cats plus all dogs was 72.17 \u00b1 0.15, RT 3.33 \u00b1 1.05 s. Descriptive statistics for the full set of measures can be found in r = 0.423, p < 0.0001; cats and human RMET: r = 0.483, p < 0.0001; dogs and human RMET: r = 0.468, p < 0.0001. Pairwise t-tests indicated no significant differences between any two stimulus sets . Good performers on one type of eyes stimuli tended to score highly on the other types. Eyes stimuli score distributions and correlation plots are shown in Correlations between the eyes tests were strong and positive, suggestive of convergent validity: dogs and cats: t(203) = \u22125.334, p < 0.001] and dog trials . There was no difference between cat and dog trials . In real terms, this amounts to just a few more seconds required to complete the entire human RMET in comparison to the entire set of cats plus dogs  was 0.67 for the human RMET, 0.54 for cats and 0.59 for dogs; while Fleiss\u2019 Kappa for inter-rater agreement was: human RMET = 0.44; cats = 0.39; dogs = 0.44 .SE = 0.76%), with no significant difference for accuracy .To further test reliability of the newest stimuli i.e., the dog eyes test, extra data was collected for this task plus the human RMET in an additional sample of 228 undergraduate students . Accuracy for the dogs eyes stimuli was 72.45% (SE = 0.93%), and for the human RMET was 72.86% . Stepwise linear regression models were then run with the score for each eyes stimuli set as DV, and scores for any correlated variables  as IVs.R2-values with all predictors making a significant contribution to the model. Human RMET  scores were predicted by TAS EOT , TOWRE-A , and IRI fantasy scores . There were two predictors in the best model for the cat eyes stimuli  which were TAS EOT  and MRM scores , and for the dog stimuli set , which were EOT , and IDAQ non-anthropomorphic attribution  scores.The best models were identified based on highest F = 9.474, p < 0.001, adj R2 = 0.111], i.e., TAS EOT , MRM , and IDAQ non-anthropomorphic attributions .Combining the 18 trial cats eyes test with the set of 18 dog eyes trials creates the Non-human Animal Reading the Mind in the Eyes Test NARMET: , which iThe correct answers for the NARMET and the RMET see  were comBuilding on the development of the cat eyes test , this stGiven that it was possible to create the NARMET, this may tell us something about the processes involved in these eyes tasks. Individuals appear to share a common interpretation of a fairly complex level of psychological state as reflected in the eyes of both humans and at least domesticated non-human animals such as cats and dogs. This ability seems unlikely to be a specialist skill, according to the degree of consensus seen across a few different samples during the development of the NARMET. It is still debated whether the RMET measures Theory of Mind, or emotion/mental state recognition, with difficulties posed by either interpretation. For example, Theory of Mind is often a more appropriate label when the cues are more abstract than visual . On the other hand, visual cues may be more likely to prompt a recognition matching process. The issue with this latter interpretation is that we do not know whether the mental states that are being attributed to the eyes stimuli are indeed correct, and this is the case for both the RMET and NARMET stimuli, as correct responses are simply based on consensus. In the current study, response times were recorded, although most studies do not record this data. It took little more than 3 s of presentation time to per trial to elicit an accurate response, and this was consistent for both the human and non-human animal trials. This implies a fast and automatic underlying process, and perhaps reliance on a more instinctive mirroring type mechanism versus a more reasoned abstract perspective taking process, as the latter would likely take more time due to careful evaluation of each of the verbal labels in turn. Performance on the NARMET suggests that there are some fairly reliable visual cues  that individuals may use to draw conclusions about likely mental state, and that these cues may be more crude, and/or widely perceptible, than previously thought.Although the range of mental states thought to be attributable to the cats and dogs was slightly less wide ranging than for humans, it was still quite extensive. This aligns with research showing that humans can attribute secondary emotions such as jealousy and guilt to dogs . While sMental state attribution in relation to human, cat and dog stimuli were all negatively associated with externally oriented thinking. When cats and dogs were combined into a single task, NARMET scores were predicted by mind reading motivation and non-anthropomorphic attributions, while human RMET performance was predicted by fantasy and word reading efficiency. Therefore, while NARMET performance may be more clearly associated with motivational factors, it is perhaps less susceptible to confounds related to abstraction, language or verbal skills, which can influence RMET performance . It may In conclusion, using the NARMET alongside the RMET , and theThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the University of Birmingham Research Ethics Committee. The patients/participants provided their written informed consent to participate in this study.CE conceived and designed the study, prepared materials for the data collection, performed statistical analysis, interpreted the findings, and wrote the first and final draft of the manuscript."}
{"text": "A subset of CRPC patients demonstrate increased p300/CBP activity based on a novel CTC biomarker assay. With further development, this biomarker suite may be used to identify candidates for CBP/p300 acetylation inhibitors in clinical development.Reduced SIRT2 deacetylation and increased p300 acetylation activity leads to a concerted mechanism of hyperacetylation at specific histone lysine sites  in castration-resistant prostate cancer (CRPC). We examined whether circulating tumor cells (CTCs) identify patients with altered p300/CBP acetylation. CTCs were isolated from 13 advanced PC patients using Exclusion-based Sample Preparation (ESP) technology. Bound cells underwent immunofluorescent staining for histone modifying enzymes (HMEs) of interest and image capture with NIS-Elements software. Using the cBioPortal PCF/SU2C dataset, the response of CRPC to androgen receptor signaling inhibitors (ARSI) was analyzed in 50 subjects. Staining optimization and specificity revealed clear expression of acetyl-p300, acetyl-H3K18, and SIRT2 on CTCs . Exposure to A-485, a selective p300/CBP catalytic inhibitor, reduced p300 and H3K18 acetylation. In CRPC patients, a-p300 strongly correlated with its target acetylated H3k18 (Pearson\u2019s R = 0.61), and SIRT2 expression showed robust negative correlation with a-H3k18 (R = \u22120.60). A subgroup of CRPC patients  demonstrated consistent upregulation of acetylation based on these markers. To examine the clinical impact of upregulation of the CBP/p300 axis, CRPC patients with reduced deacetylase SIRT2 expression demonstrate shorter response times to ARSI therapy (5.9 vs. 12 mo;  Androgen deprivation therapy (ADT) is the cornerstone treatment for advanced PC, but most patients develop castration-resistant prostate cancer (CRPC) 36-40 months after initiating ADT . AdditioHistone modifying enzymes (HMEs) result in histone post-translational modifications that alter gene expression and cell behavior . HMEs maCirculating tumor cells (CTCs) have generated interest as minimally invasive, biomarkers for cancer management , 10. CTCIn the current study, employing a novel Exclusion-based Sample Preparation (ESP) technology (9)  to isolate CTCs, we evaluated p300 activity, SIRT2 expression and H3K18 acetylation in CTCs in a series of patients with sensitivity or resistance to ADT. We find a concerted increase in the expression of H3k18 acetylation and acetyl\u2013p300 and downregulation of SIRT2 in CTCs in a subset of CRPC patients. Decreased SIRT2 is associated with shorter time of response to ARSIs. The results from this initial cohort support the integration of these biomarkers into prospective clinical trials.Previously validated antibodies against acetyl-p300, total p300, SIRT2 and acetyl-H3k18 were tested in single-cell staining assays using LNCaP and Du145 initially . PositivWe previously demonstrated that acetyl-p300, acetyl-H3K18, and SIRT2 reflect p300 acetylation enzyme activity in PC cells . The twoThe epigenetic biomarker suite was initially optimized on CTCs generated from several patients. Patient PBMCs (blood monocytes/mononuclear cells) were isolated from blood samples, captured via EpCAM, and then stained with the target biomarkers. PBMCs without captured by EpCAM are used as controls to compare expression intensity between CTCs as described . PBMCs dClinicopathologic characteristics are outlined in We previously found that decreased SIRT2 expression, increased p300 acetylation activity, and elevated histone H3 hyperacetylation are associated with the transition from hormone-sensitive to CRPC [We then tested whether there was a correlation between p300/CBP markers in the CTCs obtained from individual patients . Using Pn = 50). Pearson correlation analysis showed that SIRT2 mRNA levels are significantly correlated with progression-free survival time  (SPOP mutations (who were distributed evenly across the quartiles) because these patients have increased sensitivity to abiraterone [p = 0.03)  . To furt = 0.04) . We exclraterone . Patient = 0.03) . This clAlthough there are multiple available therapies for men with metastatic CRPC, there are currently few molecular biomarkers to help guide optimal treatment choice and predict prognosis in these patients. CTCs have the potential to address this need. The present study is an initial analysis of a biomarker set representing CBP/p300 activity in a series of patient CTCs. We find a strong correlation between p300 acetylation, SIRT2 and its target H3K18 acetylation in patients with advanced CRPC. We also demonstrate in a separate clinical dataset that low SIRT2 levels are associated with a shorter response to drugs that block androgen receptor signaling.We successfully isolated specific CTCs from patient blood samples, and by quantifying the protein expression in actual CTCs performed with immunocytochemistry (ICC), we found increased p300 activity and H3K18 hyperacetylation, and decreased SIRT2 expression in a subset of patients resistant to ADT treatment . We haveP300 activity is critical for the proliferation of PC3 and other CRPC cell lines. Researchers have found that the disruption of p300 transcripts through small interfering RNA inhibited PC cell proliferation both at the basal level and upon interleukin 6 stimulation . In the An important insight from our study is how the CBP/p300 axis is associated with treatment response. In one patient, a sample (575.1) was collected when ADT was initiated, and the PSA dropped to 2.4 ng/ml. A second sample (575.2) was obtained one year later when the cancer became androgen independent, and the PSA increased to 50 ng/ml with bone metastases. Acetyl-p300 and H3k18 were higher and SIRT2 was lower in 575.2 (CRPC) than in the responding hormone-sensitive PC sample (575.1). Extending our findings, in a well-annotated clinical database of mCPRC patients, we find that decreased deacetylase SIRT2 expression is associated with a shorter time of response to ARSI . SIRT2 pOur study has some limitations. Because of the small sample size, we were unable to achieve a statistical significance comparing HSPC and CRPC groups. CTCs demonstrate heterogeneity   and the The identification of a subset of CRPC patients with increased CBP/p300 activity in CTCs, and previous data demonstrating p300 activity correlates with these three epigenetic biomarkers, suggests they may be used to identify candidates for targeted treatment. P300 inhibitors have been examined in the context of advanced PCa patients, and a recent orally available p300/CBP bromodomain inhibitor CCS1477) has been found to decrease AR and MYC signaling in PC tissues [7 has beeThe PC cell lines Du145 is resistant to androgen deprivation therapy, and androgen-sensitive LNCaP were obtained from the ATCC and genotyped for validity. Du145 or LNCaP cells were then exposed to A-485 , a potenPeripheral blood was collected after informed written consent from patients with advanced PC as previously described  under a Sera-Mag (SM) streptavidin-coated magnetic beads (Cytiva) at a concentration of 50 ug per reaction were employed for all experiments. SMs were washed twice and resuspended in 0.1% Tween-20 (Fisher Scientific) in PBS prior to use. SM solutions were then incubated under agitation for 20 minutes with 1 \u03bcL (concentration) of a single capture antibody, against EpCAM . Prior to use, bead conjugates were washed an additional three times with 10% FBS.An overview of the CTC capture technology is shown in Supplementary Figure 1. CTCs were captured from PBMCs with antibody labelled SMs. PBMCs were incubated on a rotator with antibody-labelled SMs in a buffer containing 10% FBS for 20 min at 5\u00b0C. Cells bound to SMs were isolated with ESP technology using an automated magnetic head attachment for the standard Gilson PipetMax pipetting robot. SM-bound cells were moved through staining and washing wells prior to imaging at 20\u00d7 with a Nikon Eclipse Ti fluorescent microscope (Nikon) and NIS-Elements AR 4.10 software (Nikon) after a final transfer to glass-bottom chamber slides.For all staining, cells were blocked with 10% FBS prior to extracellular staining, then, if intracellularly stained, cells were treated with Permeabilization Solution (BD) and stained for intracellular markers in Perm/Wash Buffer (BD). Stains: Hoechst, and antibodies against CD45 , CD34 , CD66b , pan-Cytokeratin , SIRT2 , Anti-histone H3-acetyl K18 , p300 , acetyl-p300 .Images were analyzed with NIS Elements software (Nikon). Average background fluorescence was subtracted from each channel then cells were identified and masked based on user-defined Hoechst staining thresholds, then further evaluated for average cellular staining intensity for all other fluorescent antibodies. Data was output and analyzed in Microsoft Excel, and GraphPad Prism.Staining intensity is compared between different cells by graphing each cell as an individual data point on a scatter plot, similar to flow cytometry. When graphed in this way, cells distribute into higher and lower density regions, where cells with similar staining characteristics cluster together . These chttp://www.cbioportal.org/). There were 128 patients in this cohort with metastatic CRPC that have baseline biopsy and matched clinical data and 75 patients of this 128 sub-cohort have gene expression data captured by Poly-A RNA-seq. A subset (55 patients) of this 75 sub-cohort have records of time on either enzalutamide/abiraterone. Five patients of this cohort were excluded because they have SPOP mutations that demonstrate elevated sensitivity to antiandrogen treatment [SIRT2 mRNA distribution, and time on treatment graph were generated by GraphPad Prism v9.5.1. The p-value for time on treatment probability was calculated using Gehan-Breslow-Wilcoxon test.Data was obtained from a 444 PCF/SU2C metastatic prostate cancer patient cohort (18). RNA-seq data and enzalutamide/abiraterone treatment data were downloaded from cBioPortal (reatment . The cor"}
{"text": "Treatment-resistant hypertension (RH), defined as uncontrolled blood pressure (\u2265140/90\u2009mm Hg) despite treatment with \u22653 medications of different classes (including diuretics) at optimal doses, is associated with poor prognosis and an elevated risk of end-organ damage. In areas where HIV is endemic, such as sub-Saharan Africa, the risk of hypertension is high in people living with HIV. It remains unknown if HIV infection further increases the risk of RH. This study seeks to determine the association between HIV and RH as well as investigate other factors associated with RH in hypertensive Malawian adults.A case\u2013control study will be conducted among adult hypertensive patients attending a clinic at a referral hospital in Malawi. The cases will be hypertensive patients with a confirmed diagnosis of RH. For each case, two controls (hypertensive patients without RH), frequency matched for age group and sex, will be selected from among hospital clients attending the same hypertension clinic as the case. In both groups, HIV status will be ascertained. Additionally, information on other potential risk factors of RH, such as chronic kidney disease, obesity, hypercholesteraemia, diabetes, smoking, alcohol use, antiretroviral therapy regimen and duration, will be collected in both cases and controls. For each of the potential risk factors, ORs will be calculated to quantify the strength of their association with RH. In a multivariate analysis, conditional logistic regression will be used to assess the independent association between HIV and RH as well as the influence of the other potential drivers of RH.This protocol has been approved by the College of Medicine Research Ethics Committee (COMREC) in Malawi (P.05/22/3637). Findings from this study will be disseminated through a peer-reviewed publication in an open-access international journal. Furthermore, anonymised data will be available on request from the authors. A key strength of the case\u2013control design is that it will allow the investigation of multiple exposures that could drive treatment-resistant hypertension in people living with HIV.To the best of our knowledge, this is the first study in Malawi to understand drivers of treatment-resistant hypertension and will generate important knowledge to inform future cohort studies in settings where HIV is highly prevalent.The study will only recruit participants from one large hypertension clinic at a referral public hospital. This has the potential to exclude other adults that could be otherwise eligible  leading to selection bias.Over the last 20 years, sub-Saharan Africa (SSA) has faced a rise in the prevalence of non-communicable diseases (NCDs) because of an increase in cardiovascular risk factors such as poor diet, little to no physical activity, hypertension, obesity, diabetes and dyslipidaemia.2 5Despite its high global burden, most people who suffer from hypertension, including those living with HIV, fail to achieve adequate blood pressure control and are usually unaware of their disease status, until faced with end-organ disease. In SSA, only 27% of people with hypertension are aware of their disease, 18% are receiving treatment and yet only 7% of those suffering from hypertension have well-controlled blood pressure.3RH is defined as uncontrolled blood pressure (\u2265140/90\u2009mm Hg) despite treatment with \u22653 medications of different classes (including diuretics) at optimal doses. RH is associated with poor prognosis and elevated risk of end-organ damage which can lead to premature deaths. The global burden of RH has been estimated to be around 10.3%,Malawi, like most SSA countries, has a high burden of HIV: 10.6%A case\u2013control study will be conducted at the outpatient hypertension clinic at Queen Elizabeth Central Hospital (QECH) in Blantyre, Malawi. QECH is the largest tertiary hospital in Malawi that receives referrals from across the country. It is a free public hospital hence it serves mainly the low-income to middle-income class. A case\u2013control study design has been chosen for three reasons. First, treatment-RH is a relatively rare disease, and a case\u2013control study will allow research on this outcome. Second, it will reduce the time constraint that a prospective cohort study would present due to the need for a longer follow-up period. Third, it will allow the investigation of multiple factors associated with RH.Cases will be defined as hypertensive patients with a confirmed diagnosis of treatment-RH. In this study, treatment-RH will be defined as a blood pressure of \u2265140/90\u2009mm Hg measured using an ambulatory blood pressure monitor (ABPM) over 4\u2009hours in patients with hypertension and who are on at least three different medications including a diuretic. The 4\u2009hour ABPM will be adopted in this study since previous studies have shown and validated a 4\u2009hour ABPM as an accurate proxy of daytime (24 hours) blood pressure.Suspected RH cases will be patients who have elevated blood pressure of \u2265140/90\u2009mm Hg on the day of recruitment and who are taking any three classes of antihypertensive medication including a diuretic. The investigators will measure the blood pressure of both cases and controls using a digital blood pressure cuff. After 30\u2009min of the participants\u2019 rest and while the participant is seated, the investigators will collect three blood pressure readings 5\u2009min apart. This method was used in previous studies to measure blood pressure in Malawian adults.The controls will be sex and age-group-matched individuals who have well-controlled blood pressure (BP<140/90\u2009mm Hg). After obtaining consent in both groups, HIV status will be ascertained. Other factors such as chronic kidney disease, obesity, hypercholesteraemia, diabetes, smoking, alcohol use, ART regimen and duration will be assessed through the collection of medical history, review of notes in health passport books and blood tests.Non-pregnant adults (\u226518 years)Patients taking at least 3 classes of antihypertensive medication including a diuretic for at least a month.Patients with high blood pressure readings of \u2265140/90\u2009mm Hg on the last two hospital visits.Patients with a blood pressure reading of \u2265140/90\u2009mm Hg on the date of enrollment.Patients over 18 years with blood pressure readings of \u2265140/90\u2009mm Hg who are taking no more than two classes of antihypertensive medication.Patients taking at least three classes of antihypertensive medication but not including a diuretic on their drug regimen.Non-pregnant adults (\u226518 years) who have well-controlled blood pressure (BP<140/90\u2009mm Hg) taking any classes of antihypertensive medication.Patients must have had well-controlled blood pressure (BP<140/90\u2009mm Hg) on their last two hospital visits.Patients over 18 years with blood pressure readings of \u2265140/90\u2009mm Hg.Patients over 18 years with well-controlled blood pressure (BP<140/90\u2009mm Hg), who are not taking any antihypertensive medication.Details of the data that will be collected are outlined in In a private environment, participants will first be asked if they are aware of their HIV status. HIV status will be deemed positive if the individual is on ART or has a documented positive result in their health passport. Those who have been taking ART will provide more information on regimen(s) and how long they have been taking the drugs. This includes asking if they have been switched on ART previously.Individuals with documented negative HIV test results in their health passports within the last 3\u2009months will be marked as negative. Three months have been employed in tandem with the window period for HIV infection. Rapid antibody tests (which is what will be used in this study) can accurately detect HIV infection 90 days after exposure. An HIV test following the testing algorithm that is stipulated in the Malawi HIV Clinical GuidelinesIn previous studies,The primary outcome of the study is the adjusted OR, with a 95% CI, of the association between RH and HIV. This will be defined as the odds of HIV in RH patients divided by the odds of HIV in hypertensive patients without RH.The secondary outcome measures are the ORs, with 95% CIs, of the independent association between the covariates representing other potential risk factors: cholesterol, obesity, kidney disease and RH.In calculating the sample size, a threefold relative difference in the odds of HIV infection in cases compared with controls was considered clinically significant. Assuming an HIV prevalence of 10.6% among controls, as is seen in the general population,All data in the study will be collected and managed using the Open-Data Kit software platform. Data will be entered by the study team, and the data accuracy will be verified by the study principal investigator. Only study team members will have access to protected health information. All study-related information will be stored securely at the study site. Tablet computers used to collect the data will be password protected. Any physical participant information will be stored in locked file cabinets in areas with limited access. Patients will not be identified by name in any reports on this study. The study PI and coinvestigators will have access to the final dataset of the study.The number and percentages of cases and controls identified, and those recruited into the study and participants included in the final analysis will be reported. Additionally, the median (range) of baseline continuous variables  will be described for both cases and controls. Furthermore, the prevalence of other risk factors, HIV, obesity, hypercholesteraemia and chronic kidney disease in both RH cases and non-RH controls, will be described. In participants living with HIV, different ART regimens and documented viral load and/or CD4 counts, in both controls and cases, will be compared.To determine the primary and secondary outcomes, two main steps will be carried out. First, the crude ORs of the association between RH and exposure characteristics of interest: HIV, obesity, chronic kidney disease and hypercholesteraemia will be computed in univariate analysis with conditional logistic regression models. Similarly, the relationships between other exposure variables: smoking, alcohol intake and diabetes and RH will be established. In participants living with HIV, we will explore the relationship between the different ART regimens and RH. Point estimates, their CIs and statistical significance, assessed at a 5% level of significance, will be used to determine the strength of the association. Except for HIV, only covariates that show narrow CIs in this univariate analysis will be carried on to the next step.2 test will be used to compare categorical data between cases and controls, while the Wilcoxon Rank Sum test will be used for continuous data. Reporting of results will be in line with the Strengthening the Reporting of Observational Studies in Epidemiology guidelines.Second, using a backward stepwise approach in a conditional logistic regression model, the adjusted association between RH and HIV will be ascertained. Covariates to be adjusted for will be those that show a narrow CI for the crude OR in the first step above. For all analyses, the \u03c7Patients and the public were not involved in setting the research priorities, defining the research question or determining the outcomes of this study.This study has been approved by the College of Medicine Research Ethics Committee (COMREC) with approval number P.05/22/3637. Written consent will be sought from participants before enrolment into the study. Findings from this study will be disseminated through submission for publication in an international, open-access, peer-reviewed journal. Anonymised data from the study will be made available on request from the authors."}
{"text": "Neoadjuvant nivolumab and cabozantinib in locally advanced renal cell carcinoma in a horseshoe kidney is a novel therapeutic approach in the preoperative setting.We report a case of a 52-year old male who presented with a large inoperable tumor of the horseshoe kidney and achieved major partial radiologic response after neoadjuvant therapy with nivolumab and cabozantinib leading to radical resection of the tumor. The patient remains tumor free on the subsequent follow-up and his renal function is only mildly decreased. The systemic treatment was complicated by hepatotoxicity leading to early nivolumab withdrawal.Currently, the combination therapy based on immune checkpoint inhibitors and tyrosine kinase inhibitors represents the treatment of choice in treatment-na\u00efve patients with metastatic renal cell carcinoma in any prognostic group. The neoadjuvant treatment approach is being tested in prospective clinical trials and results are eagerly awaited. Renal cell carcinoma in a horseshoe kidney is an uncommon finding that is always challenging. Additionally, management guidance in this patient population is lacking. In some patients neoadjuvant therapy could be the only way to preserve kidney function. The initial treatment strategy should be individualized to patient needs aiming at the radical resection of the primary tumor as the only chance of getting the tumor under control in the long term.Herein, we highlight the feasibility of neoadjuvant systemic therapy with nivolumab and cabozantinib allowing the subsequent performance of radical tumor resection with negative margins in a patient with advanced renal cell carcinoma in a horseshoe kidney, removing the primary tumor while sparing the patient from lifelong dialysis. In recent years, the use of immune checkpoint inhibitors (ICIs) has revolutionized the therapeutic landscape of metastatic renal cell carcinoma (mRCC) \u20135. UndouThe current first line strategy in mRCC comprises mainly a combination of an ICI plus tyrosine-kinase inhibitor (TKI) based on prior demonstration of the benefit of these combinations. One such example is the combination of an anti-PD1 antibody nivolumab with TKI cabozantinib which has shown superior efficacy compared with sunitinib monotherapy in the first-line setting in patients with mRCC regardless of their prognosis according to the International Metastatic Database Consortium (IMDC) Risk Score for RCC, introducing a shift in the common therapeutical practice of the first-line treatment . MoreoveLocalized renal cell carcinoma (RCC) can be inoperable for several reasons including solitary kidney or locally advanced disease. Data on optimal therapeutic strategy in this patient population are scarce. The potential of the neoadjuvant treatment approach in this patient population lies in downsizing the primary tumor, enabling radical tumor resection .We describe a case of a patient with locally advanced inoperable RCC of a horseshoe kidney treated with neoadjuvant nivolumab and cabozantinib leading to radical resection of the primary tumor 7 months later.A 52-year-old Caucasian male, non-smoker, with an Eastern Cooperative Oncology Group (ECOG) status 0 with no serious comorbidities presented in October 2021 with anemia and hematuria. The abdominal CT scan revealed a horseshoe kidney, a bulky tumor at the junction of the lower kidney poles affecting a large part of the right kidney. The dimensions of the tumor were 150x120x100 mm (The combination therapy with nivolumab (240 mg intravenously every two weeks) and cabozantinib 40 mg orally daily was started in December 2021. In January 2022, 6 weeks after therapy initiation, the patient developed grade 3 hepatotoxicity according to Common Terminology Criteria for Adverse Events (CTCAE) version 5.0 manifested by elevation of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) with bilirubin levels within normal limits. Other potential causes of hepatotoxicity including infections or obstruction were ruled out. The therapy was stopped immediately and corticosteroid administration with prednisolone 1mg/kg orally was initiated with close monitoring of liver enzymes and other related parameters. Within a week of therapy, slow lowering of corticosteroid dose was possible because of a decrease in AST and ALT levels to grade 1 suggesting immune-related toxicity. In February 2022, the restaging CT scan was performed showing tumor size reduction to 90x60x100 mm, i.e. partial regression by Response Evaluation Criteria in Solid Tumors (RECIST) 1.1 was achieved  was reported only in anecdotal case reports , 9. In sAntitumor response promoted by ICIs via PD-1/PD-L1 inhibition potentially induces a long-term effect by eliminating of metastatic clones. Concerning immunotherapy in the preoperative setting, in 2021 Gorin et\u00a0al. published data on high-risk nonmetastatic RCC patients given preoperative nivolumab  with only 1 patient out of 17 having pathological response with immune-related features in the removed kidney . ResultsThe therapy preference should always be carefully considered and discussed in patients with a solitary kidney or significantly impaired renal function where kidney function preservation is at risk. Regarding the large inoperable tumor mass in this case, we decided to initiate the combination strategy of nivolumab with cabozantinib to attempt downsizing the tumor. One of the critical moments of the whole process is finding a strategy that would preserve maximum of functional renal parenchyma, and failure to do this adversely affects the patient\u00b4s prognosisThe tumor size reduction was rapid at the beginning of the therapy when the combination of both drugs was given. The tumor diameter decreased by 30% after 2 months of cabozantinib therapy with nivolumab, while an additional 4% decrease was obtained during single-agent cabozantinib therapy. The pathologist described the tumor as 85x87x50 mm in size, but only a small portion of the tumor consisted of viable tumor cells. The discrepancy between the radiological and actual tumor size has been previously described as viable tumor cells might represent only a small proportion of the remaining mass .Management guidance on tumors arising from a horseshoe kidney remains anecdotal owing to the rarity of this presentation. Only case reports or small case series provide clinical data on therapeutic management specific to this particular presentation. The variable anatomy of a horseshoe kidney, aberrant vasculature with accessory arteries and branches arising from arteries other than the aorta, and the complexity of the tumor renders surgery highly demanding . In ordeVarious histopathological subtypes of renal abnormalities have been described in association with renal tumors in a horseshoe kidney, hence a tumor biopsy preceding the operation is warranted.In the current case, no complications associated with the surgery or wound healing disturbances were noted. Wound healing problems resulting from TKI therapy have been previously published , as wereNot only efficacy but also safety is of concern when we manage a patient with localized disease considering a future surgical procedure. Identifying the optimal therapy at the very beginning is crucial as novel potent therapies emerge. The patient in the present case experienced grade 3 hepatotoxicity leading to ICI termination followed by single agent TKI. In the Checkmate-9ER trial 5.6% patients discontinued both agents and nearly 20% patients permanently stopped the combination therapy and continued with single agent therapy due to adverse events . AdverseThe present report demonstrates the potential of neoadjuvant nivolumab and cabozantinib therapy to downsize an initially inoperable RCC leading to subsequent radical surgical resection. The neoadjuvant approach with nivolumab and cabozantinib may be a viable option for patients with initially inoperable RCC, including patients with a solitary kidney.The original contributions presented in the case report are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.Ethical review and approval was not required for the case report in accordance with the local legislation and institutional requirements. Written informed consent was obtained from the individual for the publication of any potentiall identifiable images or data included in the article.AZ: writing and revision of the manuscript, collected data. HS: conceptualization, supervision, writing and revision of the manuscript. AK: collected data, revision of the manuscript. TT: revision of the manuscript. VS: revision of the manuscript. BM: revision of the manuscript. All authors contributed to the article and approved the submitted version."}