{"text": "Inconsistent findings have been reported on the occurrence and relevance of creatine kinase (CK) isoenzymes in mammalian liver cells. Part of this confusion might be due to induction of CK expression during metabolic and energetic stress.The specific activities and isoenzyme patterns of CK and adenylate kinase (AdK) were analysed in pathological liver tissue of patients undergoing orthotopic liver transplantation.The brain-type, cytosolic BB-CK isoenzyme was detected in all liver specimens analysed. Conversely, CK activity was strongly increased and a mitochondrial CK (Mi-CK) isoenzyme was detected only in tissue samples of two primary hepatocellular carcinomas (HCCs).The findings do not support significant expression of CK in normal liver and most liver pathologies. Instead, many of the previous misconceptions in this field can be explained by interference from AdK isoenzymes. Moreover, the data suggest a possible interplay between p53 mutations, HCC, CK expression, and the growth-inhibitory effects of cyclocreatine in HCC. These results, if confirmed, could provide important hints at improved therapies and cures for HCC. Creatine kinase (CK) isoenzymes catalyse the reversible transfer of the phosphate group of phosphocreatine (PCr) to ADP, to yield ATP and creatine (Cr). The CK/PCr/Cr system is present primarily in tissues with high and fluctuating energy demands such as brain, heart and skeletal muscle, and serves as a temporal and spatial \"energy buffer\" that helps to maintain a high intracellular phosphorylation potential in situations of increased metabolic demand .de novo. The liver is the main site of Cr production in the body . After ody see -6). Othe. Othede ody . Finallody  isoenzyme. On the other hand, besides BB-CK which was suggested to be present in endothelial and Kupffer cells, Vaubourdolle et al.  also proIn a number of studies reporting significant levels of CK activity in liver, interference by adenylate kinase (AdK) isoenzymes in the CK activity assays -21 is veBecause of these conflicting data, the goal of the present study was to analyse in detail the CK and AdK activities in pathological liver tissue of patients undergoing orthotopic liver transplantation.The present project was approved by the ethics commission of the University of Innsbruck. In total, 25 liver samples were analysed. Twenty-three samples were obtained from 18 explanted organs of liver transplant recipients, one sample was obtained at autopsy (no. 1), and the last sample was from a normal rat liver. According to pathomorphological criteria, the 25 samples can be divided into 5 groups: (1) Nine samples of cirrhotic liver tissue ; (2) six samples of neoplastic tissue ; (3) three samples of necrotizing liver tissue due to acute or subacute organ rejection ; (4) five samples of macroscopically normal liver parenchymal tissue  surrounding focal liver pathologies ; (5) two samples originating from a normal rat liver (no. 12) and from a patient with steatosis hepatis (no. 1).All steps were performed on ice or at 4\u00b0C. Approximately 5 g of liver tissue was homogenized in 45 ml buffer A . The homogenate was subjected to centrifugation for 5 min at 800 g. The pellet was discarded, and the supernatant centrifuged for 4 min at 5,100 g (centrifugation C2). The supernatant of C2 was further clarified by centrifugation for 12 min at 12,300 g, thus yielding the cytosolic fraction. The pellet of C2 was resuspended in 10 ml buffer A, followed by centrifugation for 2 min at 12,300 g (C3). After resuspension of the C3 pellet in 10 ml buffer A and centrifugation for a further 10 min at 12,300 g, the sediment was resuspended in 4 ml buffer A, thus yielding the mitochondrial fraction. One-ml aliquots of the different fractions were immediately frozen in liquid nitrogen and stored at -80\u00b0C until analysis.2, 2.1 mM ADP, 2.1 mM NADP, 21 mM N-acetylcysteine, 9 U/ml of hexokinase, and 5.8 U/ml of glucose-6-phosphate dehydrogenase (both from Sigma). Enzymatic activity was measured at 25\u00b0C as an increase in NADPH absorbance at 340 nm. For AdK, three separate measurements were made for each sample in the same assay medium. For CK measurements, 5.1 mM AMP was added to the assay medium to inhibit AdK activity. For each sample, three measurements with 10.3 mM PCr and three measurements without PCr  were made, and the CK activity was calculated as the difference of the respective means. All values in this paper represent specific activities per mg of homogenate, cytosolic or mitochondrial protein. Protein amounts were measured according to the method of Bradford -1). Therefore, in the absence of histochemical data, it cannot be concluded with certainty whether the increased levels of CK are due to increased vascularization of the tumour , or to induction of CK expression in the malignant cells.Interestingly, we observed a strong induction of both BB-CK and Mi-CK expression in two samples of primary HCC. Despite CK/AdK activity ratios Induction of CK expression has been observed previously in many types of tumours (see ) and mayA key player in the picture might be the p53 tumour suppressor gene. Mutations in p53 are quite prevalent in HCC, especially in tumours with low cellular differentiation ,43. On tin vivo models  the limited responsiveness of HCC to currently available therapeutic approaches and, thus, (ii) the poor prognosis associated with this disease. Cr analogues (cyclocreatine and \u03b2-guanidinopropionic acid) and also Cr itself were previously shown to have antitumour activity, both in cell culture and in  models . Similaepatoma; .The present findings shed light on some old enigmas and open up fascinating avenues for future research. Our findings do not support significant expression of CK in normal liver and most liver pathologies, but rather indicate that many of the previous misconceptions in this field can be explained by interference from AdK isoenzymes. On the other hand, given the need for improved understanding of the molecular pathogenesis of HCC, and for improved therapies and cures, the induction of CK expression in HCC described here calls for a more in-depth analysis of the interplay between p53 mutations, HCC, CK expression, and the growth-inhibitory effects of cyclocreatine in HCC.AdK, adenylate kinase; BB-CK, brain-type cytosolic CK isoenzyme; CK, creatine kinase; Cr, creatine; HCC, hepatocellular carcinoma; Mi-CK, mitochondrial CK; MM-CK, muscle-type cytosolic CK isoenzyme; PCr, phosphocreatine.The authors declare that they have no competing interests.GM and RM covered the medical part of this study. GM, FNG and MW performed the biochemical experiments. MW drafted the manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "The hedgehog pathway plays a critical role in the development of prostate. However, the role of the hedgehog pathway in prostate cancer is not clear. Prostate cancer is the second most prevalent cause of cancer death in American men. Therefore, identification of novel therapeutic targets for prostate cancer has significant clinical implications.Su(Fu). Furthermore, expression of sonic hedgehog protein is detected in majority of PTCH1 positive tumors (24 out of 27). High levels of hedgehog target genes are also detected in four prostate cancer cell lines . We demonstrate that inhibition of hedgehog signaling by smoothened antagonist, cyclopamine, suppresses hedgehog signaling, down-regulates cell invasiveness and induces apoptosis. In addition, cancer cells expressing Gli1 under the CMV promoter are resistant to cyclopamine-mediated apoptosis. All these data suggest a significant role of the hedgehog pathway for cellular functions of prostate cancer cells.Here we report that activation of the hedgehog pathway occurs frequently in advanced human prostate cancer. We find that high levels of hedgehog target genes, PTCH1 and hedgehog-interacting protein (HIP), are detected in over 70% of prostate tumors with Gleason scores 8\u201310, but in only 22% of tumors with Gleason scores 3\u20136. Furthermore, four available metastatic tumors all have high expression of PTCH1 and HIP. To identify the mechanism of the hedgehog signaling activation, we examine expression of Su(Fu) protein, a negative regulator of the hedgehog pathway. We find that Su(Fu) protein is undetectable in 11 of 27 PTCH1 positive tumors, two of them contain somatic loss-of-function mutations of Our data indicate that activation of the hedgehog pathway, through loss of Su(Fu) or overexpression of sonic hedgehog, may involve tumor progression and metastases of prostate cancer. Thus, targeted inhibition of hedgehog signaling may have significant implications of prostate cancer therapeutics. AftSu(Fu) is reported to affect \u03b2-catenin signaling ,28. We aIn addition to Su(Fu) inactivation, over-expression of Shh is another mechanism by which the hedgehog pathway is activated in cancer -10. We nOnce hedgehog pathway is activated, the target gene expression will be up-regulated. Thus, analysis of target gene expression using immunohistochemistry will be an effective way to detect hedgehog pathway activation in prostate cancer. Currently, PTCH1, Gli1 and HIP are good markers for the hedgehog pathway.Our findings not only provide novel basic understanding of prostate cancer, but also allow us to design new ways to treat prostate cancer. With a specific SMO antagonist, cyclopamine, it will be possible in the future to treat prostate cancers, which have over-expressed sonic hedgehog. However, as a downstream molecule, tumors with Su(Fu) inactivation may not respond to cyclopamine treatment. Therefore, additional small molecule inhibitors appear to be necessary to treat Su(Fu) inactivated prostate cancer. One possibility is to use Gli1 SiRNA since we have indicated that down-regulation of Gli1 may be an important mechanism by which inhibition of the hedgehog pathway by cyclopamine induces apoptosis Fig. . SanchezTaken together, our findings suggest that activation of the hedgehog pathway involves prostate cancer progression. There might be several mechanisms by which the hedgehog pathway is activated in advanced prostate cancers, including loss of Su(Fu) protein expression, over-expression of sonic hedgehog or other alterations. We demonstrate that activation of the hedgehog pathway is associated with DNA synthesis and cell invasiveness in prostate cancer cells. Inhibition of the hedgehog pathway, on the other hand, causes apoptosis possibly through down-regulation of Gli1. Our studies predict that targeted inhibition of the hedgehog pathway may be an effective way to prevent prostate cancer progression.\u00ae according to manufacturer's instruction .A total of 55 paraffin-embedded tissue blocks from patients with prostate cancer were obtained from UTMB Surgical pathology with approval from the Institutional Review Board (IRB). Pathological reports, H#E staining of each specimen were reviewed to determine the nature of the disease and the Gleason scores. Of 55 specimens, 18 were from tumors with Gleason scores 3\u20136, 15 with Gleason score 7 and 22 with Gleason scores 8\u201310. The tumor area was first identified before tissue microarray (1.5 mm in diameter for specimens) was assembled with Beecher's Tissue arrayer-IA standard avidin-biotin immunostaining technique was performed using a kit from Vector laboratories using specific antibodies to Su(Fu) (Santa Cruz Biotechnology Cat# 10933), PTCH1 (Santa Cruz Biotechnology Cat# 6149), HIP (R&D systems Cat# AF1568) and Shh (Santa Cruz Biotechnology Cat# 9024) and PSA (Vector laboratories). Positive staining was in red or brown. The specificity of antibodies was tested using the very peptide used for raising the antibodies, which abolished the specific staining. Hematoxylin was used for counterstaining (in blue). Protein was analyzed by Western analysis with appropriate antibodies [Su(Fu) antibodies were from Santa Cruz, beta-actin antibody was purchased from Sigma). The signals were visualized with the enhanced chemiluminescence detection system (Amersham).Cell lines , with triplicates for each sample and the experiment was repeated three times with the similar results. Cell were treated with 5 \u03bcM cyclopamine (or tomatidine) before (for 12 h) and during cell invasion assay (for 24 h). The rate of cell invasion was calculated by dividing cell numbers penetrated the matrigels by the number of cell in the control chambers (without matrigels).\u00ae reagent (Invitrogen), and RT-PCR was performed using Promega's RT-PCR system according to the manufacturer's protocol. Two pairs of Su(Fu) primers were used . PCR products were first purified using Qiagen's Gel Extraction Kit. Due to existence of possible Su(Fu) splicing isoforms in humans, Su(Fu) genetic mutations were screened after the PCR products were cloned into TOPO\u00ae TA cloning vectors (Invitrogen). Several independent clones (from three experiments) of each PCR product were selected for sequencing analysis in UTMB sequencing facility. All mutations were confirmed by at least six independent clones.Total RNA was isolated using Trizol\u00ae assay reagent (P/N 4319413E) for an internal control. The primers are designed to span exon-exon junctions so as not to detect genomic DNA and the primers and probe sequences were searched against the Celera database to confirm specificity. To obtain the relative quantitation of gene expression, a validation experiment was performed to test the efficiency of the target amplification and the efficiency of the reference amplification. All absolute values of the slope of log input amount vs. \u0394CT were <0.1. Separate tubes (singleplex) one-step RT-PCR was performed with 20 ng RNA for both target genes and endogenous control. The reagent we used was TaqMan one-step RT-PCR master mix reagent kit (P/N 4309169). The cycling parameters for one-step RT-PCR was: reverse transcription 48\u00b0C for 30 min, AmpliTaq activation 95\u00b0C for 10 min, denaturation 95\u00b0C for 15 sec and annealing/extension 60\u00b0C for 1 min (repeat 40 times) on ABI7000. Triplicate CT values were analyzed in Microsoft Excel using the comparative CT(\u0394\u0394CT) method as described by the manufacturer. The amount of target (2-\u0394\u0394CT) was obtained by normalization to an endogenous reference (18sRNA) and relative to a calibrator.Real-time PCR We used Applied Biosystems' assays-by-demand 20\u00d7 assay mix of primers and TaqMan probes (FAM\u2122 dye-labeled) for the target genes  and pre-developed 18S rRNA (VIC\u2122-dye labled probe) TaqManin situ cell proliferation kit  [in situ cell death kit  [BrdU labeling was performed using an emicals) . Cells wemicals) ,29. Cellpatched 1; Shh \u2013 sonic hedgehog; SMO \u2013 smoothened, BCC \u2013 basal cell carcinoma.PSA \u2013 prostate specific antigen; HIP \u2013 hedgehog-interacting protein; Su(Fu) \u2013 suppressor of fused; PTCH1 \u2013 human homologue of Tao Sheng contributed to Figures Table 1 Prostate cancer specimens and protein expression. Prostate cancer specimens and expression of several hedgehog signaling proteins are summarized in this table (A). A total of 55 specimens were used in this study. The Gleason scores and protein expression of Shh, PTCH1 and Su(Fu) are shown (B).Click here for file"}
{"text": "There is little in biology that compares in beauty and limpidity to the development of a zebrafish embryo as viewed through a light microscope. The transparent eggshell and embryo tissues expose the minutest details of cell migrations and organ assembly to the curious viewer. Within a day, distinct vertebrate features emerge: a distinct head with the outlines of two large eyes, a quickly pumping heart, a notochord, and a growing array of somites\u2014the bone and muscle precursors\u2014stretching from trunk into tapering tail.The transparent zebrafish embryo has allowed geneticists to discover a large number of mutants with anomalies in the development of external and internal organs. Seven mutations, collectively known as \u201cYou-class,\u201d turn the pointed, chevron-like somites into shallow, rounded arcs (\u201cYou\u201d stands for \u201cU-shaped\u201d). Ian Woods and William Talbot now show that the You mutation disrupts a new modulator of Hedgehog signaling.Hedgehog is an extracellular signaling protein that can impose various fates on target cells at close proximity or over longer distances. Much research is focused on understanding the factors that promote or limit Hedgehog's activity and range. Woods and Talbot propose that the You protein acts in the extracellular environment to promote Hedgehog signaling.Hedgehog was originally named for mutations that cause excess brush-like denticles to grow on the surface of fruitfly embryos, but it is now known to direct countless developmental decisions in invertebrates and vertebrates alike. In addition, several cancers are known to result from inappropriate Hedgehog signaling. In fish, Hedgehog's best-documented role is in muscle development. In the absence of Hedgehog signaling, cells destined to become slow muscle fibers fail to differentiate properly. A subset of these slow muscle cells\u2014the muscle pioneers\u2014congregate near the dorso-ventral midline of the embryo, where the dorsal and ventral halves of somites converge. When these specialized cells are absent, abnormal somite assembly leads to the U-shaped phenotype.The authors found that You mutants showed many telltale signs of reduced Hedgehog signaling. Proteins that are normally expressed at certain times during the development of slow muscle cells were not activated in You mutants, indicating that these cells did not form. Mutant embryos also displayed reduced expression of the Hedgehog receptor Patched, a universal reporter of Hedgehog signaling activity. In addition, You mutants had specific ventral spinal chord defects that are shared by known Hedgehog pathway mutants. Yet You mutants expressed Hedgehog normally. Moreover, Hedgehog targets could still be activated in You mutants in response to excess Hedgehog signaling, suggesting that the signaling cascade is left intact. The authors concluded that the You protein was a facilitator rather than a crucial transmitter in Hedgehog signaling, likely acting at a step upstream of a cell's response to Hedgehog. Normal muscle pioneers could form in chimeric embryos (embryos made of wild-type and You mutant cells) regardless of which cells\u2014the Hedgehog-producing cells or Hedgehog-responding muscle precursors\u2014expressed You. This made it most likely that the You protein acted outside the cells, perhaps as a cell matrix component.The authors mapped the You mutation and found that it disrupted the coding region of a gene encoding a putative secreted protein. The predicted You protein is closely related to members of the mouse SCUBE family, a group of proteins that are defined by characteristic extracellular motifs . This observation strengthens the hypothesis that the You protein has extracellular functions, and the researchers' experimental evidence supports a role for You in transport or stabilization of Hedgehog. At later stages You could also participate in other signaling pathways, as its expression does not always coincide with that of Hedgehog during zebrafish development."}
{"text": "These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed  Genetic studies in zebrafish have identified a new protein involved in Hedgehog signaling - a key pathway required for development in vertebrates and invertebrates Drosophila larval segments and imaginal discs, dorsoventral patterning of the vertebrate neural tube, and anterior\u2013posterior patterning of vertebrate limbs; in addition, many recent studies have illuminated the widespread and conserved role of Hedgehog signaling in development . Misregiewed in ,3,4, mediewed in ,6,7, paniewed in , and holiewed in ,10.Drosophila, diffusion of lipid-modified Hedgehog proteins is dependent on the action of tout velu, a gene involved in the synthesis of heparan sulfate proteoglycans [growth-arrest specific gene product Gas1 [After release from signaling cells, the activity and distribution of Hedgehog proteins are modulated by a variety of factors in the extracellular environment. In oglycans ,12. The oglycans . In vertuct Gas1 , and Heduct Gas1 . Moreoveuct Gas1 ,17. Geneuct Gas1 ,19.prox1. In contrast, fast muscle fibers can be identified via their multinucleate morphology and lack of prox1 expression [Hedgehog pathway function in zebrafish has been analyzed primarily in the context of skeletal muscle development and differentiation ,26,27,28pression . As devepression ,27,28. Spression ,28,29,30pression ,28.Many lines of evidence indicate that Hedgehog signals from axial tissues specify slow muscle in zebrafish. Slow muscle fibers are reduced or absent in embryos with Hedgehog pathway mutations ,31,32,33you-class\u201d mutants because of their U-shaped somites. Five of the seven you-class mutations have been cloned, and four of these genes, syu/shh, yot/gli2, smu/smoh, and con/disp1, encode members of the Hedgehog signaling pathway [ubo/prdm1, which encodes a transcriptional switch that acts downstream of Hedgehog signaling in the development of slow muscle [ubo and Hedgehog pathway mutant phenotypes. For example, Hedgehog pathway mutants have defects in the lateral floor plate of the neural tube and the dorsal aorta, which are apparently normal in ubo mutants [ubo: Hedgehog pathway mutations reduce or abolish expression of the Hedgehog target ptc1, whereas ptc1 expression is normal in ubo mutants, indicating that they can receive Hedgehog signals [Genetic screens have identified a number of mutations disrupting the Hedgehog pathway in zebrafish ,39,40,41 pathway ,36,37,39w muscle ,42. Care mutants ,43. Exam signals ,33,36,39you-class gene, you, has revealed delayed development of the dorsal aorta and the absence of lateral floor plate marker expression in addition to slow muscle defects [ptc1 and adaxial myod, is reduced in you mutants [you gene acts within the Hedgehog pathway itself rather than downstream of Hedgehog signaling in processes specific to slow muscle development. Prior to this study, the molecular identity of the you gene has remained unknown. We report the positional cloning of the you gene and show that it encodes a novel extracellular EGF-CUB  protein required for Hedgehog signaling. Functional studies provide evidence that you is essential for the transport or stability of Hedgehog signals in the extracellular environment.Previous phenotypic characterization of mutants for the eponymous  defects ,43. More mutants . These ryou mutants lacked the horizontal myoseptum and exhibit the U-shaped morphology that defines mutants of the you class . These hedgehog genes\u2014ehh, shh, and twhh\u2014are expressed at the midline in early embryonic stages. To determine whether you is required for hedgehog gene transcription, we analyzed the expression of hedgehog genes in wild-type and you mutant embryos. Expression of all three hedgehog genes appeared normal in you embryos at bud stage  region of LG 7, between simple sequence length polymorphism (SSLP) markers Z11119 and Z15270  library and initiated a chromosome walk beginning with BAC zC172H20. After identifying polymorphisms in BAC end sequences, testing these polymorphisms on our mapping panel, and iteratively rescreening the pooled BAC library, we identified a contiguous stretch of genomic sequence spanning portions of five BACs with ends that flanked you  and SCUBE2 in human (66% identity). The orthology of these genes was further supported by comparative mapping: the human genes SCUBE2, LMO1, STK33, and ST5 exhibited conserved synteny with orthologous genes in both mouse and zebrafish . Pairwibrafish , the C-terminal sequence following the CUB domain (90% identity), and the EGF repeats (74% identity). A spacer region in the center of the amino acid sequence showed lower conservation (47% identity). Examination of this spacer region in the vicinity of the CUB domain revealed a repeated motif of six cysteine residues with characteristic and regular spacing, shown in yellow in SCUBE proteins are characterized by a signal peptide and by two types of conserved extracellular domains: EGF and CUB . In all ty97you mutants, a C to T transition alters the coding sequence at residue 644, changing a glutamine codon to a stop codon  injection experiments to phenocopy defects seen in you, and mRNA injection experiments to rescue the you phenotype in mutants (myod (n = 112) in the adaxial cells (n = 70) in the muscle pioneers (myod (n = 65) or Engrailed (n = 48) expression  of embryos from you/+ intercrosses showed expression of myod in adaxial cells at 12 somites (myod expression from these intercrosses showed that 137 (24%) were homozygous mutant for you. In contrast, 23.6% (n = 127) of embryos from you/+ intercrosses injected with a mutant form of you mRNA lacked expression of myod in adaxial cells  from a you/+ intercross injected with wild-type mRNA showed strong Engrailed labeling in the muscle pioneers (ty97you), whereas 24% (n = 33) of embryos injected with control mRNA lacked Engrailed expression (you mutation). In addition, injection of you MOs resulted in loss of nkx2.2 expression in the trunk and tail of wild-type embryos at 24 hpf, and injection of 50 pg of you mRNA was sufficient to rescue nkx2.2 expression in you mutants (data not shown).When injected with 50 pg of synthetic wild-type  somites E. Genotyal cells F; 20 of you transcripts appear to be maternally deposited in zebrafish embryos  you was expressed in the eye field, in distinct bilateral domains within the developing brain, and in the developing trunk of the embryo in broad paraxial stripes , in a complex pattern in the hindbrain, and in paraxial stripes along the anterior\u2013posterior axis  of synthetic you mRNA that was sufficient to rescue the phenotypic defects observed in you mutants  was injected into embryos from a you/+ intercross, ectopic expression of myod . Because downstream targets of the Hedgehog pathway were rescued or upregulated in shh-injected you mutants, components of the Hedgehog pathway downstream of shh are most likely functional in you embryos. These results are consistent with you acting upstream of or parallel with shh in the Hedgehog pathway.To explore the possibility that the  mutants . When con = 394; B, Engrai n = 25; F, or nkx n = 17; J. This r n = 53; C and 6D, n = 78; K and 6L patched activity with MOs  or a combination of MOs targeting both ptc1 and ptc2 (n = 13 mutants). you mutant embryos injected with a ptc1 mismatch control MO did not exhibit rescued myod expression (n = 8 mutants). In similar experiments, injection of patched MOs was sufficient to rescue or expand Engrailed expression in muscle pioneers of you mutant embryos .Additional evidence that You acts upstream of the Hedgehog response derived from a loss-of-function approach, in which we activated the Hedgehog pathway by knocking down with MOs . Expressyou function to respond to Hedgehog signaling, we created genetic chimeras by transplanting cells from mutant embryos into wild-type hosts . Similarly, cells from embryos in which you function had been reduced with MOs were able to differentiate as Engrailed-expressing muscle pioneers when introduced into embryos treated with mismatch control MOs (data not shown).To determine whether a cell must be wild-type for pe hosts . Cells dyou function in order for target cells to appropriately respond to Hedgehog signals, we transplanted cells derived from wild-type donors into you mutant hosts. Of 91 chimeric mutant hosts, ten embryos exhibited rescue of Engrailed expression in genotypically mutant muscle pioneers, as defined by characteristic strong Engrailed expression in elongate nuclei at the proper position of posterior somites, where Engrailed is not normally expressed in you mutants .you is essential for Hedgehog signaling, our analysis indicates that you mutant cells are able to produce and respond to Hedgehog signals. hedgehog gene expression in the embryonic midline is normal in you mutants, indicating that You acts downstream of hedgehog gene transcription  in wild-type embryos did not result in obvious phenotypes when assayed by gross morphology or by expression of Hedgehog target genes, including adaxial myod, Engrailed in muscle pioneers, or nkx2.2 in the ventral spinal cord . For initial localization of you, bulked segregant analysis  was perescribed .http://www.rzpd.de). BAC end sequences were obtained from the Sanger Institute database  following double digest with either Pst I and EcoR I or Xba I and Xho I. Sequences were analyzed on a 3730 DNA Analyzer . Sequences generated from this BAC were used in iterated searches against the zebrafish whole-genome shotgun assembly to nucleate contigs of genomic sequence. Sequencing primers were designed from these contigs and used to generate additional sequence data for zC93A15.The CHORI211 BAC library was screened by PCR to identify positive BAC clones (you clone in pBluescript SK\u2212 (Stratagene) was isolated from a 15\u201319-hpf cDNA library (gift of Bruce Appel and Judith Eisen). A cDNA clone harboring a frameshift mutation that is predicted to truncate the you protein at amino acid residue 34 was isolated from the same library and was used as a control in overexpression experiments. A modified version of the pCS2+ expression vector was generated by cloning a 41-bp fragment into its EcoR I and Xba I sites. This stuffer fragment abolished the endogenous EcoR I, Stu I, Xho I, and Xba I restriction digest sites of pCS2+, and introduced Xba I, Sac I, Apa I, Pst I, and Xho I recognition sequences in a 5\u2032 to 3\u2032 orientation with respect to the SP6 promoter. Wild-type and mutant you clones were subcloned into the Xba I and Xho I sites of this modified pCS2+ vector. In situ probes for you were generated by linearizing this vector with Xba I, followed by antisense RNA synthesis with T3 polymerase. Synthetic you mRNA for injections was generated by digestion with Not I, followed by transcription using the SP6 mMessage mMachine kit .A full-length you/+ intercrosses were genotyped after in situ hybridization and antibody labeling as described [myod [ptc1 [nkx2.2 [ehh [shh [Probe synthesis, in situ hybridizations, and immunohistochemistry were performed using standard protocols. Embryos from escribed . Other ped [myod , ptc1 [6od [ptc1 , nkx2.2  [nkx2.2 , ehh [20ehh [shh , and monehh [shh . Genotypyou translational initiation site (5\u2032-GCCGTACAGTCCAAACAGCTCCCAT-3\u2032) or a 5-bp mismatch control MO (5\u2032-GCCcTAgAGTCgAAACAcCTgCCAT-3\u2032) was diluted in a 1x Danieau's solution with Phenol Red at 5 mg/ml prior to microinjection. Sequences for MOs targeting ptc1 and ptc2 were obtained from [Embryos were injected through their chorions with 500 pl of solution at the 1\u20134-cell stage as described . RNA wasned from .you/+ intercrosses were injected at the 1\u20134-cell stage with a 1% solution of Oregon Green 488 dextran . Approximately 50\u2013100 cells were removed from labeled donors in late blastula and early gastrula periods (4\u20135.3 hpf) and transplanted near the margin of unlabeled sibling hosts. Labeled donor embryos were allowed to develop until 24 hpf. Genotypes of donor embryos derived from you/+ intercrosses were determined by PCR. Genotypes of host embryos were determined by staining with Engrailed antibody. Donor cells in chimeras with wild-type cells transplanted into you mutant hosts were obtained either from WIK intercrosses or from genotypically wild-type embryos in you/+ intercrosses.Cellular transplantations were done according to standard methods . Embryosyou cDNA sequence has been deposited in GenBank (http://www.ncbi.nlm.nih.gov/Genbank/index.html) under accession number AY741664.The http://www.ncbi.nlm.nih.gov/LocusLink/) accession numbers for the genes and gene products discussed in this paper are Attractin (LocusID 8455), C1r (LocusID 715), C1s (LocusID 716), con/disp1 (LocusID 378448), Cubilin (LocusID 8029), ehh (LocusID 30299), Engrailed (LocusID 30244), Gas1 (LocusID 14451), Hedgehog (LocusID 42737), Hip1 (LocusID 15245), Megalin (LocusID 14725), myod (LocusID 30513), nkx2.2 (LocusID 30697), Patched (LocusID 35851), prox1 (LocusID 30679), ptc1 (LocusID 30181), ptc2 (LocusID 30189), sea urchin Fibropellin (LocusID 373313), smu/smoh (LocusID 30225), syu/ssh (LocusID 30269), Tolloid (LocusID 42945), tout velu (LocusID 36614), twhh (LocusID 30444), ubo/prdm1 (LocusID 323473), yot/gli2 (LocusID 30154), human LMO1 (LocusID 4004), human SCUBE1 (LocusID 80274), human SCUBE2 (LocusID 57758), human ST5 (LocusID 6764), human STK33 (LocusID 65975), mouse SCUBE1 (LocusID 64706), and mouse SCUBE2 (LocusID 56788).The LocusLink ("}
{"text": "FU is the human homologue of the Drosophila gene fused whose product fused is a positive regulator of the transcription factor Cubitus interruptus (Ci). Thus, FU may act as a regulator of the human counterparts of Ci, the GLI transcription factors. Since Ci and GLI are targets of Hedgehog signaling in development and morphogenesis, it is expected that FU plays an important role in Sonic, Desert and/or Indian Hedgehog induced cellular signaling.FU gene was identified on chromosome 2q35 at 217.56 Mb and its exon-intron organization determined. The human developmental disorder Syndactyly type 1 (SD1) maps to this region on chromosome 2 and the FU coding region was sequenced using genomic DNA from an affected individual in a linked family. While no FU mutations were found, three single nucleotide polymorphisms were identified. The expression pattern of FU was thoroughly investigated and all examined tissues express FU. It is also clear that different tissues express transcripts of different sizes and some tissues express more than one transcript. By means of nested PCR of specific regions in RT/PCR generated cDNA, it was possible to verify two alternative splicing events. This also suggests the existence of at least two additional protein isoforms besides the FU protein that has previously been described. This long FU and a much shorter isoform were compared for the ability to regulate GLI1 and GLI2. None of the FU isoforms showed any effects on GLI1 induced transcription but the long form can enhance GLI2 activity. Apparently FU did not have any effect on SUFU induced inhibition of GLI.The FU gene and its genomic structure was identified. FU is a candidate gene for SD1, but we have not identified a pathogenic mutation in the FU coding region in a family with SD1. The sequence information and expression analyses show that transcripts of different sizes are expressed and subjected to alternative splicing. Thus, mRNAs may contain different 5'UTRs and encode different protein isoforms. Furthermore, FU is able to enhance the activity of GLI2 but not of GLI1, implicating FU in some aspects of Hedgehog signaling.The  Drosophila, Hh signaling to the transcription factor Cubitus interruptus (Ci) is mediated by a protein complex consisting of Ci and three other cytosolic proteins. These are the costal 2 (cos2), suppressor of fused (su(fu)) and fused (fu), where fu is a kinase domain containing protein with positive regulatory activities in Hh induction of Ci mediated transcriptional activation. Hh binds to its receptor patched (ptc), a 12 membrane spanning protein, leading to the activation of another membrane protein smoothened (smo) . In Droed (smo) . Smo is iewed in ]. It is iewed in -7. In a iewed in . FU is aPTCH1, the human counterpart of ptc, underlie the Nevoid Basal Cell Carcinoma Syndrome (NBCCS) [SMO and SUFU mutations as well as overexpression of GLI1 or GLI2 can lead to BCC or medulloblastoma [Interestingly, it was discovered that mutations in  (NBCCS) ,10. Pati (NBCCS) ,12. Alsoblastoma -16. ThusFU gene, as well as for construction and subcloning of FU expression vectors. Using the available public databases the FU gene was found to be present in a sequenced BAC clone from chromosome 2. FU is located in the same region of chromosome 2q34-q36 to which the human limb malformation disorder Syndactyly type 1 (SD1) has recently been mapped in a large German pedigree [FU gene in an affected member from the German family [FU has been determined using an RNA array and Northern blots. FU is expressed in all 72 tested tissues. It is clear that not only a single transcript is expressed. Instead transcripts of different sizes are seen and some tissues apparently express more than one major transcript. From the genomic structure and the cDNA clones it was possible to predict several alternative splicing events and consequently the likely expression of different protein isoforms. Two of the isoforms were expressed in HEK293 cells and tested for their ability to regulate the activity of GLI1 and GLI2, showing positive effects on GLI2 but not on GLI1.Here three FU cDNA clones have been identified and used for sequence analysis, identification and structural description of the pedigree  and confpedigree . Its posn family . The tisFU gene in a 200 kb BAC clone (AC009974) from chromosome 2. The gene is localized to 2q35 at 217.56 Mb using the Ensembl [FU structure and named the gene STK36 (serine/threonine protein kinase 36). Chromosome 2q35 is the locus of several genetically based disorders. Both Syndactyly type 1 (SD1) and Brachydactyly type A1 (BDA1) have been mapped to this region [IHH (Indian Hedgehog) one of the vertebrate Hh homologues [IHH is located in the vicinity of FU on chromosome 2 (217.94 Mb) less than 400 kb away. In order to determine if alterations of FU are responsible for SD1, the FU coding region (exons 3\u201329) and the flanking intronic regions were sequenced using genomic DNA from an affected member of an SD1 family whose trait maps to the 2q34-q36 region [FU mutations were detected in this study, although three single nucleotide polymorphisms were identified. These included a T to C transition in intron 10, 17 bp 5' of exon 11 (IVS10-17T>C), causing gain of a BstNI site, and a G to A transition in exon 16, 17 bp 5' of the end of the exon (1748G>A), causing substitution of glutamine for arginine at amino acid 583 (R583Q) and loss of an AciI site. The altered restriction sites created by these sequence changes were tested in 44 CEPH unrelated individuals. The results showed that both changes are normal sequence variations as previously reported in the NCBI SNP database. The third change was a G to A transition in exon 27 (3008G>A), causing substitution of aspartic acid for glycine at amino acid 1003 (G1003D). By sequencing exon 27 in 8 affected and 6 unaffected members of the SD1 family [The sequence information derived from the FU cDNA clones 1HFU, 2HFU and Ngo3689 (see Methods) allowed the identification of the  Ensembl  annotatis region ,20. ReceFU exons, but they allow determination of the exon-intron organization of FU. Figure FU gene. The cDNA clones are outlined to account for the predicted structure. Only clone 1HFU and Ngo3689 contain exons from the 5'non-coding region. To the 5' side of the sequence encoded by exon 3 these clones are different, indicating that alternative 5' untranslated regions (UTR) from different exons can be used. Exons 3 to 9 encode the N-terminal kinase domain. None of the cDNA clones encodes the FU protein that has previously been described [None of the obtained cDNA clones contain sequence from all + RNA from 72 human tissues was hybridized with a labeled probe 3' of the kinase domain. It was clear from this array that all examined tissues express FU to some extent. The highest amount of FU transcripts were detected in testis and pituitary (not shown). This is in agreement with the previous results by Northern blotting, showing highest FU expression in testis [A tissue array with poly An testis . This ann testis . The Norn testis . Since on testis .To examine more specifically the expression of exons that are involved in alternative splicing events, nested PCR was performed on cDNA probes generated from whole tissue RNA by reverse transcription. Sequences containing segments including exons 8, 13 and 24 were amplified and analyzed on agarose gels .We investigated the possibility that FU expression have shown that transcripts are detected in all tissues examined. For the first time evidence is presented showing that more than one transcript can be expressed from this gene. The Northern blots clearly show that FU transcripts of different sizes indeed exist. Here the transcripts are estimated to be slightly bigger than previously reported and in some tissues more than one transcript is evident. It is clear from the available cDNAs and RT/PCR based transcript analyses that alternative splicing occurs. Additionally, it is also clear that different 5'UTRs are present in the transcripts. At least two protein isoforms, besides the previously described L-FU [Analyses of bed L-FU , may be bed L-FU . WhetherThe assessment of functionality revealed that S-FU was not able to regulate GLI1 or GLI2 when expressed in 293 cells. In contrast, both L-FU and a variant lacking a full kinase domain (2HFU) were able to enhance GLI2 induced transcription. These results are qualitatively similar to those previously reported in C3H/10T\u00bd cells . L-FU anFU is localized on chromosome 2q35 very close to IHH. Though SD1 has been mapped to this region, we have not identified a causative role for FU in this disorder. FU consists of 29 exons of which 1 and 2 encode 5'UTRs and 3 to 9 encode a kinase domain. For the first time it is shown that transcripts of different sizes are expressed and alternative splicing takes place, probably leading to the generation of different protein isoforms. FU protein is likely to be involved in the Hedgehog signaling pathway since it can enhance the activity of GLI2. In contrast, it has no effect on GLI1 and an effect on SUFU cannot be observed in 293 cells.+. The human BAC clone AC009974 was obtained from Research Genetics . The human GLI, human SUFU, 12GLI-RE-luciferase reporter and \u03b2-galactosidase vectors have been described previously [Two almost full-length human FU clones were identified in the Incyte database. Both 1HFU and 2HFU were cloned in the vector pINCY. A third clone was available from Kazusa DNA Research Institute  and termed Ngo3689 (Gene name KIAA1278). This clone was in the vector pBluescript II SKeviously .R DNA polymerase . The cDNA for the long form of FU (L-FU) was subcloned into pCDNA3.1-HisB using the NotI and XbaI sites. 2HFU and the short FU (S-FU) cDNAs were subcloned into pCDNA3.1-HisC using the KpnI and XbaI sites.Expression constructs for different isoforms of FU was obtained by direct PCR or extension overlap PCR, using end-primers having specific restriction sites and the high fidelity VentAll PCR generated products were analyzed by DNA sequencing. The Big-Dye Terminator Cycle Sequencing kit  was used according to instructions. Sequencing was performed at CyberGene AB . Sequence alignments were done using the DIALIGN program  availablFU either as single exons with flanking intronic sequences or as products containing two exons with flanking intronic sequence and the complete intervening intron. The primer sequences can be obtained upon request. PCR was performed in a standard fashion and products were sequenced using either the Thermosequenase CyTM5.5 Dye Terminator or DYEnamic ET Dye Terminator Cycle Sequencing kits . Electrophoresis and analysis were performed on either an Automated Laser Fluorescence (ALF) DNA sequencer or MegaBACE DNA sequencer (Amersham Biosciences) after purification with Autoseq columns (Amersham Biosciences). For exon 27, the PCR product was purified using the enzymatic ExoI-SAP purification method, sequenced using the Terminator Cycle Sequencing kit (Amersham Pharmacia Biotech) and analysed on an ABI 3100 genetic analyzer (Applied Biosystems). PCR products containing exon 11 or exons 15/16 were digested with BstNI or AciI, respectively, and the bands resolved on 3\u20134% agarose gels to confirm sequence changes in the patient with SD1 and to determine their frequency in a panel of 44 CEPH individuals.After informed consent was obtained, blood was taken from affected and unaffected family members and DNA extracted from peripheral blood leukocytes according to standard methods. Intronic primers were designed to amplify exons 3\u201329 of 32P-ATP using the High Prime DNA labeling kit  according to instructions. Hybridization of Northern blots was done with labeled DNA probes in ExpressHyp (Clontech) at 68\u00b0C according to instructions. The blots were then analyzed with a Fujix Bas 2000 phosphoimager .Commercially available Human MTN 12-lane Blot 2, Human Fetal MTN Blot II and Human Endocrine System MTN Blot Northern blots  were obtained and used with PCR generated hybridization probes. DNA probes were made by direct PCR, amplifying the sequences corresponding to exon 13 and 28. The generated fragments were then labeled with The expression of exon 8, 13 and 24 sequences in mRNA was assessed by nested PCR on RT/PCR generated cDNA samples from eight different tissues as provided in Human Multi Tissue cDNA Panel II (Clontech). Two sets of primers were made for each exon to be investigated. The outer pairs were used in a first PCR using 5 \u03bcl of the cDNA and Vent polymerase. In a second PCR 0.5 \u03bcl of the first PCR products was used together with the inner primer pairs. These pairs were also used for PCR of FU cDNA clones that served as controls. The primer pairs are listed in Table The cDNA clones were used in transfections of HEK293 cells in 24 well culture plates. Basically this was done as previously described . In shorT\u00d8 contributed to the experimental design; participated in sequencing, sequence analysis and subcloning; did the gene analysis, Northern blots, nested PCR, cell experiments; and made the manuscript draft. DBE and CES designed and carried out the patient analysis; and contributed to the manuscript. MM provided clones; contributed with subcloning; made the array analysis; and contributed to the manuscript. MMN and RCB provided the SD1 patient material; performed segregation analyses in the SD1 family; and edited the manuscript. PGZ contributed to the experimental design and subcloning; and edited the manuscript. RT contributed to the experimental design; did data base analysis; and edited the manuscript."}
{"text": "The EphB4 receptor tyrosine kinase has been reported as increased in tumours originating from several different tissues and its expression in a prostate cancer xenograft model has been reported.EphB4 expression and protein levels in human prostate cancer cell lines LNCaP, DU145 and PC3. Immunohistochemistry was also used to examine localisation of EphB4 in tissue samples from 15 patients with prostate carcinomas.RT-PCR, western blotting and immunohistochemical techniques were used to examine EphB4 gene and protein. EphB4 immunoreactivity in vivo was significantly greater in human prostate cancers as compared with matched normal prostate epithelium and there appeared to be a trend towards increased expression with higher grade disease.All three prostate cancer cell lines expressed the EphB4 is expressed in prostate cancer cell lines with increased expression in human prostate cancers when compared with matched normal tissue. EphB4 may therefore be a useful anti-prostate cancer target. Prostate cancer is the most frequent cause of cancer death in men in Australia. Although many genetic changes have been detected in human prostate cancer, the role of most of these in initiation and progression of the disease is unclear. Receptor tyrosine kinases (RTKs) couple ligand binding to downstream signalling cascades and gene transcription and are key regulators of normal cellular processes such as growth, differentiation, migration and apoptosis. RTKs are also critically involved in the development and progression of human cancers and are therefore useful targets for anti-cancer therapies ,2. At leLigand binding induces receptor autophosphorylation of intracellular tyrosine, threonine and serine residues and allows interactions with a variety of different proteins that regulate cell functions such as contact inhibition, cytoskeletal organisation and cell motility ,8. SeverEphB4 was identified as one of the RTKs expressed in the xenograft tissue. More recently, Xia et al (2005) report that EphB4 is commonly expressed in prostate tumour tissues and cell lines and knockdown of EphB4 protein using siRNA and antisense approaches inhibited cell growth/viability, migration and invasion both in vitro and in vivo [EphB4 gene and its protein product in prostate cancer cell lines and tumour tissue samples.Members of both classes of Eph receptor have been found to have increased gene expression and/or protein levels in tumours from many different human tissues -20. In p in vivo . Concurr2 vented tissue culture flasks at 37\u00b0C in a 5% CO2 environment. Cells were collected at >90% confluency by trypsin digestion and centrifugation for 5 min at 1000 rpm, resuspended in phosphate buffered saline (PBS) and counted using a haemocytometer.Human prostate cancer cell lines LNCaP, DU145 and PC3 were cultured in HEPES-buffered RPMI 1640 medium , pH 7.4. The medium was supplemented with 100 U/ml penicillin, 100 \u03bcg/ml streptomycin, 160 \u03bcg/ml L-glutamine and 10% heat-inactivated foetal bovine serum  in 75 cmRNA was isolated from cell lines using Tri Reagent (Invitrogen). Growth medium was aspirated from the flask of growing cells (>90% confluent) and the cells washed with phosphate-buffered saline (PBS) before being directly lysed using 1 ml of Tri Reagent. After a five min incubation with gentle rocking, the cell lysate was removed to a 2 ml eppendorf tube. The RNA fraction was extracted using the manufacturer's recommendations.DC Protein Assay Kit from Biorad  following the manufacturer's protocol and using bovine serum albumin diluted from 0.1 mg/ml to 10.0 mg/ml to determine the standard curve.Growth medium was aspirated from the flask of growing cells (>90% confluent) and the cells washed with phosphate-buffered saline (PBS) before being directly lysed using 1 ml of Cell Lytic M Cell Lysis Reagent (Sigma) supplemented with 5 \u03bcl Protease Inhibitor Cocktail (Sigma). Protein lysate was removed to a 1.5 ml microfuge tube and the solution mixed for 30 min at 4\u00b0C on a rotary mixer. Insoluble protein was pelleted by centrifugation at 4\u00b0C for 30 min and the supernatant containing the soluble proteins was stored at -80\u00b0C until required for Western analysis. Protein concentrations were determined using the 6 primers (Invitrogen), 200 \u03bcM each deoxyribonucleoside triphosphate (dNTP)  and 200 U Superscript III reverse transcriptase (Invitrogen) in a reaction volume of 30 \u03bcl. Primers specific to either EphB4 or the housekeeping genes Porphobilinogen deaminase (PBGD) and Hypoxanthine phosphoribosyl-transferase 1 (HPRT 1) were used in a PCR reaction carried out in a BioRad iCycler MyiQ Real Time thermocycler or a Corbett Rotorgene 3000 . Cycling conditions included an initial denaturation at 94\u00b0C for 15 min, followed by 45 cycles of 94\u00b0C for 30 sec, 67\u00b0C or 68\u00b0C for 30 sec, and 72\u00b0C for 30 sec, with a final extension of 72\u00b0C for 7 min.Total RNA (2 \u03bcg) was reverse transcribed at 37\u00b0C using 3 \u03bcl pD(N) primers nvitrogenProteins (50 \u03bcg) from samples extracted from prostate tumour cell lines were separated on duplicate 8% Tris-Glycine iGels . The protein separated on one of the gels was visualised by coomassie staining and the protein on the duplicate gel was electrophoretically transferred to MFS nitrocellulose membrane . Non-specific binding was blocked by incubation for 1 h at room temperature using a Western blocking buffer containing 1% casein in maleic acid buffer (Roche) diluted using TBS with 0.1% Tween-20 (TBS-T). EphB4 antigens were detected using a 1:1000 dilution of a mouse monoclonal antibody raised to human EphB4  in blocking buffer. After a 1 h incubation at room temperature, the primary antibody was detected using a HRP-labelled anti-mouse secondary antibody (Roche) and the ECL Western Blotting System from Amersham Biosciences  following the manufacturer's recommendation. Blots were exposed to Hyperfilm\u2122ECL\u2122 (Amersham Biosciences) for between 5 and 30 sec. The chemiluminescence was removed from the blot by incubation in a stripping solution containing 100 mM \u03b2-mercaptoethanol, 2% SDS and 62.5 mM Tris-HCl pH 6.7 for 20 min at 50\u00b0C with gentle agitation. The filter was then washed with TBS-Tween 20 before blocking and re-probing with a mouse anti-\u03b1-actin monoclonal antibody  then it was stripped again and probed with a rabbit anti-calnexin antibody (Sigma) for loading comparison.Cell were grown to >50% confluence in the wells of 8 well chambered slides. Before staining, the medium was aspirated and the cells washed gently with PBS. Cells were then fixed in 4% paraformaldehyde and washed well before non-specific binding sites were blocked with 3% serum in PBS for 20 min at room temperature. Cells were then incubated overnight at 4\u00b0C with a 1:200 dilution of the EphB4-specific rabbit polyclonal antibody H-200 . After rinsing with PBS, the sections were incubated with an Alexa Fluor 488 goat anti-rabbit IgG (H+L) (Molecular Probes). Immunofluorescence was visualised using a TE2000E microscope with a C1 confocal scanning head .Four consecutive 8 \u03bcm sections of formalin-fixed paraffin-embedded tissue from 15 different patients with prostate cancer were a gift from Dr Michael Brown, Medical Oncology, Royal Adelaide Hospital, Adelaide, Australia. A fifth slide, stained to visualize the histological features of the tissue, was used to identify the foci of tumour tissue within the adjacent normal prostate tissue by a trained pathologist. The paraffin was removed by incubation in Histoclear  and the section re-hydrated in ethanol before antigen retrieval by boiling in 10 mM citric acid pH 6 for 10 min. Sections were cooled, then washed in PBS before removal of endogenous peroxidase activity by incubation in 0.5% hydrogen peroxide/methanol for 30 min at room temperature. Non-specific binding sites were blocked with 3% normal goat serum in PBS for 20 min at room temperature and the Vector Laboratories  Avidin/Biotin blocking kit following the manufacturer's instructions. The sections were then incubated overnight at 4\u00b0C with a 1:200 dilution of the H-200 EphB4-specific antibody (Santa Cruz Biotechnology). After rinsing with PBS, the sections were incubated with biotinylated goat anti-rabbit IgG (Vector Laboratories) for 30 min at room temperature followed by washing with PBS. Immunoreactivity was detected with the avidin-biotin system (Vector Laboratories) using 18.5 mM 3,3'-diaminobenzidine tetrahydrochloride (Sigma) as a chromogen for 2 min. The sections were then counterstained using Harris haematoxylin, dehydrated, cleared using SUB-X clearing solution  and mounted using Entellan New . Sections were visualised and images recorded using a Nikon Eclipse E800 microscope with a Spot Camera 2.3.1 (Diagnostic Instruments) and Spot Advanced Version 3.5 software.EphB4 in three prostate cancer cell lines was determined using reverse transcription and real time PCR using two different real-time PCR machines. Cell lines used included the androgen-dependent line LNCaP derived from a lymph node biopsy (moderately differentiated), the androgen-independent line DU145 from a central nervous system metastasis (moderately differentiated with foci of poorly differentiated cells) and the androgen-independent line PC3 from a bone metastasis (poorly differentiated) [EphB4 gene and the house-keeping control gene PBGD were amplified in triplicate from cDNA made using three different RNA extractions for each cell line . Comparison of the combined data for each cell line showed that there was no statistical difference in the level of EphB4 expression in the three prostate cancer cell lines .The relative expression of ntiated) -24. For e Figure  and a see Figure  using a 0 Figure . For eacEphB4/PBGD and EphB4/HPRT 1 were all close to 1 indicating that there were comparable amounts of EphB4 and PBGD/HPRT 1 templates in each cell line RNA sample. There was no statistical difference between the ratios obtained using serial dilutions of a single cDNA sample for each cell line showing that the amplification is consistent regardless of the starting amount of template. These results support the use of both PBGD and HPRT 1 as normalisation controls for the EphB4 message.In these experiments the ratios of EphB4 under control of the constitutive CMV promoter was used as a positive control  that is dramatically up-regulated on many epithelial cancers, displays limited expression on normal adult tissue and would therefore appear to be a potential target for monoclonal therapies. EphB4 was identified by Robinson et al (1996) as one of several RTKs that were expressed in a xenograft model of prostate cancer [In recent years, experiments using monoclonal antibodies with limited normal-tissue reactivity have indicated that these are good candidates for development as therapeutic agents against cancer. e cancer  and untiEphB4 gene expression as real-time PCR using normalisation to two different house-keeping genes demonstrated that there was approximately 20% less EphB4 transcript expressed in the DU145 cell line than in LNCaP and PC3 (P < 0.05). However, as there was no significant difference in the activity of the gene in LNCaP and PC3, it is possible that EphB4 may also be regulated post-transcriptionally. The presence of a second band detected by western analysis with the EphB4-specific antibody may also indicate that EphB4 is regulated post-translationally and this needs to be explored in more detail.During the review of this article, Xia et al (2005) presented results showing that EphB4 is increased in 66% (41/62) of prostate tumours tested with low intensity expression in only 15% (3/20) normal prostate samples . Our wesAlthough Xia et al's study of cell lines also indicated an association between the level of EphB4 expression and aggressive growth, they did not report a direct correlation between increased EphB4 expression with higher grade of the tumour tissue samples. We examined a panel of 15 prostate cancer clinical specimens collected by transurethral resection. The prostate tumour samples we examined contained both normal prostate and tumour foci and this enabled a comparison of EphB4 immunoreactivity in normal prostate and tumour cells simultaneously from the same patient and the determination of whether the level of EphB4 also correlates with histological grade and/or stage of prostate carcinoma. Using immunohistochemical techniques, we showed that EphB4 is produced in increased amounts in human prostate cancer tissue compared with adjacent normal tissue and that this immunoreactivity was associated with the tumour epithelial cells themselves. There also appeared to be trend towards an increasing level of EphB4 protein in the tumours from the well-differentiated to the moderately and poorly differentiated cancers.EphB4 expression [A positive correlation between histological grade, stage of carcinoma and level of EphB4 protein has also been reported in breast and endometrial carcinoma -16. EphBpression . Howeverpression . One of pression .EphB4 are relevant to prostate cancer but despite substantial evidence in the literature that EphB4 has an important role in progression of many epithelial tumours, the mechanism by which these receptors contribute to tumorigenesis is still being resolved. In only a very few cases have Eph receptors been demonstrated to have transforming potential [EphA2 expression transforms MCF10A cells as judged by conversion to a fibroblastic morphology, growth in soft agar and the ability to engraft and metastasise in a nude mouse model [The results presented here suggest that elevated levels of otential -30. In pse model .EphB4 and neuT suggested that EphB4 over-expression by itself is not tumorigenic but provides convincing evidence that it favours an invasive/metastatic phenotype [EphB4 and neuT, tumour appearance was significantly accelerated relative to neuT-only animals, and in addition metastases were observed in the lung. It was not clear if this was an effect of EphB4 on metastasis or a result of accelerated tumour growth but these results clearly implicate over-expression of EphB4 in tumour growth and/or establishment of the invasive phenotype in the adult mammary tumours. While the single transgenic EphB4 animals did not develop tumours during this experiment it is possible that these studies were not taken out far enough to conclude that EphB4 over-expression is insufficient to induce transformation with a long latency.Although similar experiments over-expressing EphB4 in non-transformed cell lines have yet to be reported, a study by Munarini et al (2000) using transgenic mice expressing henotype . AlthougEphB4 expression in vitro have shown that EphB4 is involved in growth/viability, migration and invasion of prostate cancer cell lines and supports Munarini et al's study [Xia et al's (2005) recent experiments targeting EphB4 using siRNA to knockdown 's study . Further's study  and it hXenopus [A direct role for EphB4 in tumour angiogenesis has been suggested by experiments showing that A375 melanomas form smaller tumours in the presence of soluble EphB4  possiblyXenopus ,34. NoreXenopus . This maFurther investigation is needed to determine the roles of EphB4 in prostate cancer development and progression. The trend of increasing EphB4 reactivity toward higher grade disease seen in this pilot study might suggest that it is more important in the later stages of the tumour development such as metastasis and further investigation of EphB4 in the development of prostate cancer is warranted. Therapies that target EphB4 may prove to be successful in preventing the metastatic spread of the disease.The author(s) declare that they have no competing interests.YCL carried out most of the studies with the assistance of JP and ED and drafted the manuscript. JP and ED also participated in the analysis and interpretation of the data and revision of the manuscript. MR optimised the real-time PCR experiments, participated in the analysis and interpretation of the data and revision of the manuscript. MB optimised the Western analysis, participated in the analysis and interpretation of the data and revision of the manuscript. PB participated in the analysis and interpretation of the data and revision of the manuscript. SS conceived of and co-ordinated the study and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
{"text": "Deleted-in-AZoospermia-Like (DAZL) gene has homologs required for germ cell development in many organisms. Recently, we showed that there are several common polymorphisms within the DAZL gene that are associated with age at ovarian failure/menopause and sperm count.The DAZL and examine their phenotypes in men and women. We sequenced the DAZL gene in 519 individuals; sequences spanned the entire coding region of the gene.Here we sought to identify rare mutations in DAZL. Three individuals that were heterozygous for a DAZL mutation reported having children, while two individuals that were homozygous reported no children. These mutations were found only in infertile men and women.We report the identification of four putative missense mutations in DAZL polymorphisms and deletions with fertility in humans and model organisms, we suggest that these mutations may be associated with age at menopause and/or sperm count and warrant further biochemical and genetic investigation.Given the strong data associating  DAZ (Deleted-in-AZoospermia) gene, which are associated with azoospermia (no sperm in the ejaculate) and oligozoospermia (< 20 million sperm/mL of ejaculate) [Though infertility affects 10\u201315% of couples, only a small number of genes have been shown to be associated with infertility in women and men ,3. In adaculate) -8.DAZL (DAZ-Like) gene, an autosomal homolog of the Y chromosome DAZ gene [DAZL expression is specific to germ cells, and mutations in DAZL homologs are limited to defects in development of the germ cell lineage [DAZL could impact measures of germ cell numbers in men and women, namely sperm count and age at menopause, respectively.As many features of germ cell development are similar in both sexes, we expect that some genes may function similarly in men and women. In humans and other mammals, male and female germ cells initially develop along the same path, but take different courses after the mitotic expansion of premeiotic germ cells . OocytesDAZ gene ,11. In a lineage . We thusDAZL gene in three study populations [DAZL [DAZL, as in other organisms, may have a function in human germ cell development [In a previous study, we directly sequenced the human ulations . The firulations . The thins [DAZL . A compans [DAZL . Our worelopment . NotablyStudy populations and DNA samples are as previously described . BrieflyDAZL was sequenced, including all exons and flanking regions. Primers, primer concentrations, and PCR conditions were as indicated [DNA extraction and genotype were performed as described . The entndicated . PCR prindicated . SequencDAZL gene, listed in Table DAZL gene; all were juxtaposed to, or within, the RNA-binding domain.Single nucleotide polymorphisms (SNPs) are defined as naturally-occurring variants with a frequency greater than one percent in the human population; in contrast, mutations occur with frequencies less than one percent. Here, we identified four putative missense mutations in the 2) group predisposes this residue to being on the surface of the protein exposed to water. Histidine is also a bulky amino acid that can be either neutrally or positively charged, depending on its environment. Overall, since both amino acids are large and generally localized to the surface of the protein, this amino acid change is most likely to affect the structure of the protein surface. In this study, we identified one woman who was heterozygous for this mutation, with onset of menopause at age 45, and no family history of early menopause. She was fertile, having had three children prior to menopause.This mutation changes a highly conserved proline to a histidine in the N-terminus of the protein, just upstream of the highly-conserved RNA Recognition Motif (RRM). Although proline is usually considered a hydrophobic amino acid whose unique cyclic structure causes it to influence protein architecture, its secondary amino . It is five amino acids upstream of the RNP2 sequence which is one of the most highly conserved parts of the DAZL protein. Isoleucine and alanine are both classified as hydrophobic amino acids; however, alanine, with its shorter side chain, is not as hydrophobic as isoleucine. The structure of the homologous RNA binding domain in another protein has been deduced, and in that structure, the amino acid corresponding to the isoleucine forms a hydrogen bond with another amino acid in the structure . The shoArg115 is near the carboxy-terminal end of the RRM in a region that interacts with several other proteins . This muDAZL gene for sequence variations that are associated with male and female fertility produced not only a number of interesting common SNPs or variants [Our screen of the variants , but alsvariants .Dazl knockout allele are fertile (though it is currently debated whether they may be subfertile) and homozygous mutant mice are infertile in both sexes [Interestingly, we observed that possessing these putative missense mutations, especially a heterozygous missense mutation, was compatible with producing offspring. Each patient that was heterozygous for a missense mutation was able to produce at least one child. In contrast, the patient that was homozygous for the Arg115Gly mutation experienced 46,XX spontaneous premature ovarian failure at the early age of 34 years and did not bear any children; similarly, the male patient that was homozygous for the Asn10Cys mutation produced no sperm. This is consistent with data from the mouse, where mice heterozygous for a th sexes .in vitro, in the future [Recently, a number of potential RNA targets for DAZL have been identified, making it possible to test the effects of mutations on RNA-binding e future -39. In ae future ,40,41.DAZL gene in both men and women. Two individuals possessed homozygous mutations. Future work on how these putative mutations affect RNA and protein partner binding could provide key insights into the requirement of DAZL in human germ cell development, especially regarding key residues required for DAZL protein function. In addition, further studies may shed a light on the role of DAZL in human infertility.Intriguing mutations were observed in the The author(s) declare that they have no competing interests.JT and MR carried out the molecular genetic studies, sequence alignment and drafted the manuscript. LMN, PJT, DWC, and MIC participated in the design of the study, especially clinical aspects. JSW performed statistical analysis. RARP conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors edited, read and approved the final manuscript."}
{"text": "Schistosoma, depends upon the release of parasite eggs from the human host. However, approximately 50% of eggs produced by schistosomes fail to reach the external environment, but instead become trapped in host tissues where pathological changes caused by the immune responses to secreted egg antigens precipitate disease. Despite the central importance of egg production in transmission and disease, relatively little is understood of the molecular processes underlying the development of this key life stage in schistosomes. Here, we describe a novel parasite-encoded TGF-\u03b2 superfamily member, Schistosoma mansoni Inhibin/Activin (SmInAct), which is key to this process. In situ hybridization localizes SmInAct expression to the reproductive tissues of the adult female, and real-time RT-PCR analyses indicate that SmInAct is abundantly expressed in ovipositing females and the eggs they produce. Based on real-time RT-PCR analyses, SmInAct transcription continues, albeit at a reduced level, both in adult worms isolated from single-sex infections, where reproduction is absent, and in parasites from IL-7R\u2212/\u2212 mice, in which viable egg production is severely compromised. Nevertheless, Western analyses demonstrate that SmInAct protein is undetectable in parasites from single-sex infections and from infections of IL-7R\u2212/\u2212 mice, suggesting that SmInAct expression is tightly linked to the reproductive potential of the worms. A crucial role for SmInAct in successful embryogenesis is indicated by the finding that RNA interference\u2013mediated knockdown of SmInAct expression in eggs aborts their development. Our results demonstrate that TGF-\u03b2 signaling plays a major role in the embryogenesis of a metazoan parasite, and have implications for the development of new strategies for the treatment and prevention of an important and neglected human disease.Over 200 million people have, and another 600 million are at risk of contracting, schistosomiasis, one of the major neglected tropical diseases. Transmission of this infection, which is caused by helminth parasites of the genus  Schistosomes are parasitic worms that infect hundreds of millions of people in developing countries. They cause disease by virtue of the fact that the eggs that they produce, which are intended for release from the host in order to allow transmission of infection, can become trapped in target organs such as the liver, where they induce damaging inflammation. Egg production by female schistosomes is critically dependent on the presence of male parasites, without which females never fully develop, and (counterintuitively) on the contribution of signals from the host's immune system. Very little is understood about the molecular basis of these interactions. Here, we describe a newly discovered schistosome gene, which is expressed in the reproductive tract of the female parasite and in parasite eggs. The protein encoded by this gene is made only when females are paired with males in an immunologically competent setting. Using recently developed tools that allow gene function to be inhibited in schistosomes, we show that the product of this gene plays a crucial role in egg development. Examining how the expression of this gene is controlled has the potential to provide insight into the molecular nature of the interactions between male and female parasites and their hosts. Moreover, the pivotal role of this gene in the egg makes it a potential target for blocking transmission and disease development. Amongst the Bilateria, transforming growth factor\u2013\u03b2 (TGF-\u03b2) signaling is recognized as playing an essential role in embryogenesis in deuterostomes and in arthropod protostomes, but its role in lophotrochozoan protostomes is unclear . SchistoSchistosoma mansoni receptor kinase-1 [SmRK1], S. mansoni transforming growth factor\u2013\u03b2 type I receptor [SmT\u03b2 RI]), one type II receptor [S. mansoni, with nearly all components localized to either the surface of the worm or reproductive tissues of the female [S. mansoni has been examined with the identification of 163,000 expressed sequence tags (ESTs) [Components of TGF-\u03b2 signaling have been molecularly characterized in metazoans throughout the animal kingdom. Activation of this pathway begins at the cell surface when a dimeric ligand binds a complex consisting of types I and II receptor serine/threonine kinases . Upon lireceptor ,7  , a ligans (ESTs) ,13,14, aS. mansoni live within the mesenteric vasculature, where each female produces approximately 300 eggs each day. Transmission of schistosomiasis depends upon the release of parasite eggs from the human host. Development of an immature egg into a mature egg containing a miracidium, the stage of the parasite that invades the intermediate fresh water snail host, occurs outside of the female worm, and takes approximately 5 d. Many of the eggs produced by schistosomes fail to reach the external environment, but instead become trapped in host tissues, where pathological changes caused by the immune responses to secreted egg antigens cause disease [Sexually mature  disease . Despite disease ,16\u201318, eS. mansoni TGF-\u03b2 homolog, S. mansoni Inhibin/Activin (SmInAct). Although we found SmInAct to be expressed in adult male and female parasites, and in eggs, the localization of SmInAct expression to the reproductive organs of female parasites focused our attention on the role of this gene in egg production. A role for SmInAct in reproduction was supported by analyses of female parasites recovered from infertile infections, in which we found that SmInAct protein was undetectable. Confirmation of the importance of this TGF-\u03b2 superfamily member in the reproductive process was obtained from RNA interference (RNAi) studies, in which targeted knockdown of SmInAct in female worms or directly in the eggs that they produce resulted in a marked cessation of embryogenesis.In this study, we describe the cloning and characterization of a SmInAct was identified through a tblastn search of the Wellcome Trust's Sanger Institute's S. mansoni genome sequence using the C-terminal region of the Drosophila melanogaster dActivin sequence. We were unable to identify SmInAct in EST databases regardless of whether we searched using the coding or 3\u2032\u2013untranslated region (UTR) sequences. The 5\u2032 and 3\u2032 ends of SmInAct were amplified via rapid amplification of cDNA ends (RACE) using primers designed from within putative coding sequence and adult S. mansoni cDNA as template. The 1.3-kb, full-length SmInAct transcript contains 10 base pairs (bp) of 5\u2032UTR, 808 bp of 3\u2032UTR, and a poly-A tail. The deduced amino acid sequence of SmInAct is 161 residues long and contains many of the molecular hallmarks for a TGF-\u03b2, including a putative basic proteolytic cleavage site located at position 32 as RQRR where the bioactive, C-terminal domain (126 amino acids) is enzymatically separated from the N-terminal pro-domain. Nine invariant cysteine moieties, and invariant proline and glycine residues  and the parasitic nematodes Brugia malayi (Bm-TGH-2) and Strongyloides stercoralis (Ss-TGH-1).residues A essenti TGF-\u03b2 1 A. Phylog TGF-\u03b2 1 B, and fuSmInAct at the transcript level, real-time reverse transcriptase\u2013polymerase chain reaction (RT-PCR) was performed on cDNA from eggs, adult male parasites, and adult female parasites from mixed-sex infections. As seen in SmInAct is expressed in all stages tested at relatively similar levels. Western analyses using polyclonal antibodies against recombinant SmInAct were used to determine the protein expression profile of SmInAct. The anti-SmInAct serum recognized a 28-kDa protein in egg antigen extracts and a doublet (32 kDa and 28 kDa) in adult male and female extracts  mice carrying mixed-sex infections, which produce a significant number of dead eggs [SmInAct mRNA levels were significantly decreased, but not absent, in females from these infections  or an irrelevant control dsRNA (luciferase) for 1 wk in vitro, followed by RNA extraction and real-time RT-PCR analyses. SmInAct dsRNA\u2013treated worms showed a consistent and significant decrease in SmInAct expression of >40% when compared to SmInAct expression in worms soaked in the irrelevant control dsRNA . To specifically address the role of SmInAct in egg development, we treated eggs directly with SmInAct dsRNA. Approximately 20% of eggs laid by adult parasites during the first 2 d of in vitro culture will develop over the ensuing 5 d to contain miracidia [ex vivo were collected and soaked in dsRNA (1 \u03bcg/ml) corresponding to SmInAct or an irrelevant dsRNA for 5 d, and their development was scored. Relative to eggs soaked in an irrelevant dsRNA, where \u223c20% of the eggs developed through stage 6, eggs treated with SmInAct dsRNA aborted development at stage 2 , a cathepsin B detectable in eggs \u2013like homolog in D. melanogaster, acts as a morphogen by determining cell fate along the dorsal\u2013ventral axis in a gradient-dependent manner [D. melanogaster, a type I receptor, baboon, stimulates cellular proliferation and is essential for normal embryonic development [C. elegans are important for patterning or growth of the embryo [tig-2 and Y46E12BL.1), and, intriguingly, serial analysis of gene expression (SAGE) tags for both homologs have been found in the C. elegans embryo [C. elegans TGF-\u03b2 homologs that are resistant to RNAi affects, tig-2 and Y46E12BL.1 have no phenotype in genome-wide RNAi screens [Understanding of the developmental processes regulated by TGF-\u03b2 in invertebrates is based largely on data from the model organisms t manner . Also inelopment . Presumae embryo \u201333; howes embryo . Like th screens ,36; therS. mansoni, a member of the Platyhelminthes, the earliest branch of the Bilateria [S. mansoni, there appears to be at least three type I receptors and two type II receptors present in the genome based on a preliminary blast search for homologs. It will be important to delineate which of the S. mansoni type I and type II TGF-\u03b2 receptors are involved in SmInAct signaling and to identify the Smads important for transmitting the signal induced by this growth factor. Furthermore, identifying the genes regulated by SmInAct signaling will provide information regarding the precise function that this growth factor serves in egg maturation, as well as the functions the pathway may serve in other life stages of the parasite, including the adult male.The identification of SmInAct, a TGF-\u03b2 superfamily member, as a key component of egg development in ilateria , undersc\u2212/\u2212 mice, despite the fact that these parasites contained SmInAct transcripts . This strongly indicates that SmInAct is both transcriptionally and post-transcriptionally regulated by worms of the opposite sex as well as by signals from the host. It is well established that parasites recovered from hosts lacking CD4+ T cells are developmentally stunted and produce significantly fewer fertile eggs than those recovered from mixed-sex infections of immunocompetent hosts. Translation of SmInAct mRNA is the first identified molecular process downstream of the effect of the host immune system on schistosome development [S. mansoni. We are unaware of a link between the site of expression of SmInAct in the male schistosome and reproductive events, and further work is required to elucidate the function of SmInAct in male worms.SmInAct protein was not detectable in infertile females recovered from single-sex infections or from IL-7Relopment \u201324, and + T cells may be considered stressed due to the lack of signals received from the opposite sex and immunocompetent host, thereby restricting the translation of non-essential transcripts. SmInAct protein expression may be considered expendable considering the role it plays in embryogenesis rather than in crucial cellular functions linked to the survival of the adult worm. A more thorough investigation of the S. mansoni homologs of translation factors involved in the stress response and of the regulation of other transcripts and protein expression will be required to evaluate this possibility.In other settings, the uncoupling of transcription and translation is linked to the activation of the integrated stress response \u201341. ThisSmInAct has two exact repeats of \u201cUUUCTAUUUA\u201d that contain the consensus \u201cAUUUA\u201d ARE (underlined). Furthermore, the 3\u2032UTR of SmInAct is U-rich (43% uridines). It will be interesting to determine whether these repeats, or other regions of the long 3\u2032UTR, play a role in the post-transcriptional regulation of SmInAct expression.Post-transcription regulation of eukaryotic transcripts is controlled in part by the 3\u2032UTR . This reDrosophila BMP homologs DPP and 60A are able to induce bone development when injected into the skin of rats [Drosophila DPP mutants [It is of interest when considering the relationship of schistosomes with their mammalian hosts to note that in other systems, TGF-\u03b2 superfamily members have been shown to function across phylum boundaries ,46. For  of rats , and mam mutants , and SmI mutants , a solutS. mansoni was used in all experiments. Adult schistosomes were recovered by hepatic-portal perfusion from C57BL/6 female mice or B6 IL-7R\u2212/\u2212  that had each been percutaneously exposed to \u223c60 cercariae 8 wk earlier. Adult parasites and eggs laid were maintained in vitro in M199 , 10% fetal calf serum, 1% Antibiotic/Antimycotic (Gibco), and 1% HEPES in a 37 \u00b0C/5% CO2 atmosphere as previously described [The Puerto Rican/NMRI strain of escribed ,28.Drosophila activin homolog (dActivin) (amino acids 565\u2013669) was used to search the Wellcome Trust's Sanger Institute's S. mansoni genome assembly using the tblastn algorithm. A contig (0020320) with significant similarity to dActivin was identified. Full-length cDNA corresponding to SmInAct was isolated using total RNA (1 \u03bcg) from adult parasites and the SuperScript III GeneRacer 5\u2032 and 3\u2032 RACE kit  as per manufacturer's instructions. Gene-specific primers were designed for isolation of the 5\u2032-end (5\u2032-GGTTCAAAACTTTTCGGGTGTA-3\u2032) and 3\u2032-end (5\u2032-AATCTTGTTGTCATCCAACTCAA-3\u2032) of SmInAct and used in RT-PCR with GeneRacer 5\u2032 and 3\u2032 primers according to manufacturer's suggestions. Resulting amplicons were cloned into the TOPO cloning vector (Invitrogen) and sequenced. To verify the full-length sequence of SmInAct, primers designed from the 5\u2032 and 3\u2032 ends of the transcript were used in RT-PCR, and the resulting fragment was cloned and sequenced.The C-terminal, translated region of the http://www.ncbi.nlm.nih.gov). An unrooted phylogram was drawn using amino acids within the conserved C-terminal domain of SmInAct, and known TGF-\u03b2 superfamily members and distances were drawn using the Dayhoff Pam matrix and neighbor-joining algorithm in the PHYLIP software package developed by J. Felsenstein, University of Washington, Seattle, Washington, United States (http://evolution.genetics.washington.edu/phylip.html). Percentages at branch points are based on 1,000 bootstrap runs.Sequence similarities between the deduced amino acid sequence of SmInAct and other members of the TGF-\u03b2 superfamily were determined through multiple sequence alignments using the ClustalW algorithm, as well as the Align 2 sequences (bl2seq) program at the National Center for Biotechnology Information (http://www.qiagen.com), and contaminating genomic DNA was removed by DNase treatment using the Turbo DNA-free endonuclease . First-strand cDNA was synthesized using 500 ng of RNA, SuperScript II reverse transcriptase (Invitrogen), and oligo dT as a primer. RT-minus controls were performed to confirm the absence of genomic DNA (unpublished data).Total RNA was extracted from parasites using Qiagen's RNeasy Mini kit (http://www.appliedbiosystems.com). Total reaction volume was 10 \u03bcl with 300 nM of each primer, 5 \u03bcl of SYBR green PCR Master Mix, and 0.5 \u03bcl of cDNA as template (or water as a negative control). SmInAct primers were: forward 5\u2032-AATCTTGTTGTCATCCAACTCAA-3\u2032 and reverse 5\u2032-AACTACAAGCACATCCTAAAACAA-3\u2032. \u03b1-Tubulin primers were: forward 5\u2032-CCAGCAAATCAGATGGTGAA-3\u2032 and reverse 5\u2032-TTGACATCCTTGGGGACAAC-3\u2032. PCR efficiency (E) was determined for both primer sets by plotting cycle thresholds from a 10-fold serial dilution of cDNA and inputting the slope in the equation E = 10(\u22121/slope). For expression analyses, quantification of SmInAct transcript relative to \u03b1-tubulin was calculated using the equation: ratio = (ESm\u03b1-tubulin)CT/(SmInActE)CT where ESm\u03b1-tubulin is the PCR efficiency of the reference gene, SmInActE is the PCR efficiency of target gene, and CT is the cycle threshold. For analysis of RNAi-induced knockdown, quantification of SmInAct transcript relative to paramyosin (paramyosin primers were: forward 5\u2032-CGTGAAGGTCGTCGTATGGT-3\u2032 and reverse 5\u2032-GACGTTCAAATTTACGTGCTTG-3\u2032) was calculated using the 2\u2212\u0394\u0394Ct method. Dissociation curves were generated for each real-time RT-PCR to verify the amplification of only one product.SmInAct transcript levels in egg and adult stages were quantified relative to \u03b1-tubulin using Applied Biosystems' 7500 real-time PCR system and SYBR green PCR Master Mix  and sequenced to verify the absence of any mutations. Expression of recombinant SmInAct was induced in Escherichia coli BL21(DE3) by addition of 1 mM IPTG when cultures reached an OD600 of 0.5 at 37 \u00b0C, followed by 3 hours of shaking at room temperature. Recombinant SmInAct was expressed in bacteria as insoluble inclusion bodies. Exhaustive attempts to refold the protein using gluathione and reduced glutathione proved unsuccessful. We therefore purified the protein via nickel column chromatography under denaturing conditions (6 M urea) as per the manufacturer's protocol (Novagen). Antiserum was generated by Cocalico Biologicals  through subcutaneous inoculation of a rabbit with 100 \u03bcg of purified protein in complete Freund's adjuvant, followed by three boosts of 50 \u03bcg in incomplete Freund's adjuvant on days 14, 21, and 49, followed by exsanguinations on day 64.Eco RI (forward) and Xho I (reverse) tagged primers were designed to amplify the C-terminal bioactive region of SmInAct (forward 5\u2032-GGAATTCTCATTAACTAAAGGAGATGA-3 and reverse 5\u2032-CCGCTCGAGTTAACTACAAGCACATCCTA-3\u2032). The amplified product was cloned into the expression vector pET28a+  were separated by SDS-PAGE, electroblotted, and probed with anti-SmInAct antiserum , pre-immune serum , or a monoclonal antibody (4B1) against paramyosin. Affinity purified HRP-conjugated goat anti-rabbit IgG  was used to detect bound rabbit antibodies, while an affinity purified HRP-conjugated horse anti-mouse IgG  was used to detect the anti-paramyosin monoclonal antibody. The secondary antibodies were detected using ECL reagents as per manufacturer's instructions .For detection of SmInAct protein, 10 \u03bcg of protein extracted from eggs, adult males, and adult females via Dounce homogenizing in lysis buffer  supplemented with a protease inhibitor cocktail  as per manufacturer's instructions with T7-tagged amplicons as template . The hybridized DIG-probes were detected using an alkaline-phosphatase conjugated anti-DIG antibody (Roche), and visualized using NBT (337.5 \u03bcg/ml) and BCIP (175 \u03bcg/ml) in 0.1M Tris-HCl, 0.1M NaCl, 0.05 MgCl2. Worm sections were photographed using a Leica DMIRB microscope and DC500 camera .Localization of SmInAct in 5-\u03bcm sections of adult escribed . DIG-labSmInAct-dsRNA template encompassing the active ligand domain . Luciferase and SmCB1 dsRNAs (negative controls) were generated as described [dsRNA was synthesized using the T7 Megascript kit (Ambion) as per manufacturer's instructions. T7-tagged primers were used to generate a 381-bp escribed . For dsRt-test was used for statistical analyses of dsRNA-induced knockdown of SmInAct expression, change in expression of SmInAct in single-sex and IL-7R\u2212/\u2212 mice, and egg developmental phenotypes (control versus SmInAct dsRNA). Chi-square analyses were used to test the statistical significance of the egg developmental phenotype. The Yates correction was applied because we specified only two categories: undeveloped and developed Click here for additional data file.http://www.ncbi.nlm.nih.gov/Genbank) under accession number DQ863513. Other GenBank accession numbers of genes and sequences used in this study include: B. malayi TGH-1 (AAB71839); B. malayi TGH-2 (AAD19903); C. elegans DAF-7 (NP_497265); C. elegans DBL-1 (NP_504709); Danio rerio Activin\u03b2 A isoform 2 (AAX68505); D. melanogaster Activin (NP_651942); D. melanogaster dActivin (AF454392); D. melanogaster decapentaplegic (NP_477311); Homo sapiens Activin\u03b2 E (NP_113667); H. sapiens BMP-2 (NP_001191); H. sapiens BMP-3 (NP_001192); H. sapiens BMP-4 (NP_031580); H. sapiens BMP-5 (NP_066551); H. sapiens BMP-6 (NP_001709); H. sapiens BMP-7 (NP_001710); H. sapiens BMP-8 (NP_861525); H. sapiens GDF-5 (NP_000548); H. sapiens GDF-6 (NP_001001557); H. sapiens GDF-7 (NP_878248); H. sapiens GDF-10 (NP_004953); H. sapiens Inhibin\u03b2 A precursor (NP_002183); H. sapiens Inhibin\u03b2 B (NP_002184); H. sapiens Inhibin\u03b2 C (NP_005529); H. sapiens TGF-\u03b2 1 (NP_000651); H. sapiens TGF-\u03b2 2 (NP_003229); H. sapiens TGF-\u03b2 3 (NP_003230); Mus musculus BMP-2 (NP_031579); M. musculus BMP-3 (NP_775580); M. musculus BMP-4 (NP_031580); M. musculus GDF-10 (NP_665684); M. musculus Inhibin\u03b2 A (NP_032406); M. musculus Inhibin\u03b2 B (NP_032407); M. musculus TGF-\u03b2 1 (NP_035707); M. musculus TGF-\u03b2 2 (NP_033393); M. musculus TGF-\u03b2 3 (NP_033394); S. mansoni \u03b1-tubulin (M80214); S. mansoni paramyosin (M35499); and Strongyloides stercoralis TGH-1 (AAV84743).Sequence data reported in this manuscript are available from GenBank ("}
{"text": "Natural disasters, war, and terrorist attacks, have been linked to cardiac mortality. We sought to investigate whether a major financial crisis may impact on the medical management and outcomes of acute coronary syndromes.We analyzed the Argentine cohort of the international multicenter Global Registry of Acute Coronary Events (GRACE). The primary objective was to estimate if there was an association between the financial crisis period (April 1999 to December 2002) and in- hospital cardiovascular mortality, with the post-crisis period (January 2003 to September 2004) as the referent. Each period was defined according to the evolution of the Gross Domestic Product. We investigated the demographic characteristics, diagnostic and therapeutic procedures, morbidity and mortality.We analyzed data from 3220 patients, 2246 (69.8%) patients in the crisis period and 974 (30.2%) in the post-crisis frame. The distribution of demographic and clinical baseline characteristics were not significantly different between both periods. During the crisis period the incidence of in-hospital myocardial infarction was higher , as well as congestive heart failure . Time to intervention with angioplasty was longer during the crisis, especially among public sites (median 190 min Vs 27 min). The incidence proportion of mortality during hospitalization was 6.2% Vs 5.1% after crisis. The crude OR for mortality was 1.2 . The odds for mortality were higher among private institutions {1.9 } than for public centers {1.2 }. We did not observe a significant interaction between type of hospital and crisis.Our findings suggest that the financial crisis may have had a negative impact on cardiovascular mortality during hospitalization, and higher incidence of medical complications. The country paid a high toll for this change, with the Gross Domestic Product experiencing a sustained decline from 1998, and unemployment rates reaching approximately 25 percent. By the end of 2001 a rapid cascade of political and economic events opened the road to deep social turmoil and economic unrest that spiraled until December 2001, when the country experienced a virtual halt of vital areas of the economy. With two more years of his period still to be completed, the president left office, and so did several others over the following weeks. Less than a month after the world learned about such unusual events, the interim president addressed the Congress to announce that the country would default from all its national and international debts. Bank deposits were seized and thousands of citizens and businesses were left bankrupt while the national currency was devaluated by almost 200% compared to the US dollar. Shortly after the crisis erupted, many found their investments and personal savings reduced by two thirds when measured in hard currency. During the year of 2002, the gross national product declined by more than 11%, and the level of unemployment blast off[In comparison with other Latin American nations, Argentina used to enjoy a relatively developed economy and a fair distribution of wealth until the early 1980s. During the last decade of the 20Several elegant and landmark epidemiological studies have established a link between trauma produced by war, terrorism, festivities, and mortality -5. HowevThe Global Registry of Acute Coronary Events started in 1999 and continued throughout the crisis and the following period, thus giving us a unique opportunity to get a real time picture of the unfolding morbidity and mortality events by means of an multicenter cohort of patients whose clinical characteristics were registered with standardized methods, definitions and selection procedures. We sought to determine whether the financial crisis was associated with cardiac mortality and if medical procedures and therapies were affected by type of institution, public or private.Full details on the GRACE rationale and methodology have been published ,7. GRACEFor the purposes of this analysis we restricted our study sample to patients enrolled in centers in Argentina between April 1999 and September of 2004, including individuals who had an admission diagnosis of acute coronary syndrome . The seven sites participating in Argentina, were analyzed all together, and also stratified according to their particular profile: Private hospitals , and public hospitals . The period of time examined was divided into the crisis period, which was delimited from April 1999 to December 2002, and the post crisis period, which encompassed the time from January 2003 to September 2004. To define each period we used indicators published by the Census Bureau. We considered the beginning of the negative slope of the gross domestic product curve as the start of the crisis period, which lasted until the domestic product experienced a sustained increase over a full trimester [The primary endpoint of the study was in-hospital all-cause mortality. The secondary endpoint was non-fatal-myocardial infarction defined by the presence of at least one positive increment of cardiac biochemical marker of necrosis  plus chest pain prolonged more than 10 minutes, or new ST-segment deviation seen after the index or qualifying electrocardiogram.Summary statistics are presented as frequencies and percentages. Comparisons between groups were made using two-tailed Wilcoxon rank-sum test for continuous variables and the chi-square or Fisher's exact test for categorical variables. Odds ratios and accompanying 95% confidence intervals were computed to evaluate the effects of the crisis on hospital mortality and morbidity. The standard error for the calculation of the 95% confidence intervals for the odds ratios was calculated by means of the Wald formula, and the errors were handled independently for the different time points. Similar analyses were conducted for public and private hospitals separately. All tests were double sided and considered statistically significant at p-value < 0.5. Statistical analyses were conducted with the SAS V. 9.1 software .Of the 44,991 acute coronary syndrome patients admitted in the global registry, 3220 patients were enrolled in Argentina. The number of patients younger than 65 years old was 1527 (47%), representing the proportion of the population normally expected to be economically active. The remainder 1693 (53%) were older than 65. A final diagnosis of ST-segment-myocardial infarction was made in 1179, and 2041 qualified as unstable angina / non-ST-segment elevation myocardial infarction. Female gender represented 30% (n = 1012) of patients. Baseline characteristics comparing patients during and after crisis did not differ significantly , and related to this a lower proportion was referred to angioplasty , with a larger fraction undergoing coronary bypass surgery . We also observed some evidence of lower adherence to interventions of proven efficacy during the crisis, as shown by a lower proportion of patients receiving aspirin , angiotensin converting enzyme inhibitors , and low molecular weight heparin 43%, n = 950 Vs.60%, n = 585) , with a crude OR of 1.2  } Figure . In a stOur study provides some evidence that there may be an association between the financial and institutional collapse of Argentina and increased in-hospital cardiovascular morbidity and mortality. The link between extraordinary circumstances and increased cardiac mortality has been previously reported. A significant increase in the number of cardiac deaths was observed on the same day of major earthquakes that affected Los Angeles and Athens ,9. Also,The Argentine case is unique in that a major socio-economic collapse occurred in the absence of any natural disaster or war. GRACE provides a useful tool to assess in a standardized, structured manner, the diagnostic and therapeutic approaches performed in a representative cluster of hospitals throughout the crisis and following it. Our observations are intriguing, and pose questions on the mechanisms underlying the increased odds of mortality during the crisis compared to the post crisis period. We analyzed several mechanisms that may be responsible for the worsened outcomes during the crisis period: Differences in baseline clinical risk, in medical interventions, type of hospital, social and psychological factors, bias and chance.We did not observe any significant differences between the crisis and post-crisis period regarding the main demographic characteristics such as age, gender, prior coronary artery disease, co morbidities and Killip class on admission. The overall clinical profile is similar to other cohorts elsewhere for the same period .We anticipated an association between the crisis and access to medical care because of a direct effect on access to technology and imported medical supplies. Our observations provide some evidence to support the presumption that the crisis may have affected the quality of care. On one hand, patients enrolled in the registry were consistently treated according with the guidelines and in a similar manner compared to other regions . The proAnother factor that could have influenced the outcomes is an increased burden of medical care on the public system. The Argentine economic phenomenon has been called a \"middle class crisis\", namely of those who would normally gain access to health insurance through employment or, for small business owners and entrepreneurs, as an out of pocket expenditure. Approximately 20 million people out of a total country population of 37 million are no longer covered by neither the private sector nor a union-run mandatory health insurance, which represents a huge overload for the network of public hospitals . Public The association between the crisis period and increased in-hospital cardiac mortality could be explained by alterations in socio-economic factors or social support, both variables that were not directly measured by the registry. Socio-economic status has been used as a surrogate marker of a much complex matrix called social support. Several studies have suggested that a meaningful impairment in the quality and width of social support can be associated with higher mortality rates, both from cardiac and non cardiac causes ,19. It iIt may be argued that our observations may be due solely to the availability of better treatment modalities over time. As shown in figure Our analysis is exposed to a potential source of selection bias by the definition of each time period. In the absence of a major natural disaster, disease outbreak or war, it can be argued on the accuracy on our definitions on when the crisis started and when it ended. For that matter, we considered data published by the Census Bureau regarding the National Gross Domestic Product and industrial indicators and unemployment rates, and selected the nadir of the adjusted Gross Domestic Product curve as the onset of the crisis, and the first trimester that showed a sustained increase in the Gross Domestic Product as the arbitrary end of the financial crisis. This is subject to bias in itself and alternative definitions may have yielded different results. Nevertheless, we feel confident in that our definitions are solid and based on hard economic indicators instead of political signs or personal interpretations that are vulnerable to subjective perceptions. There is a consistent match between the evolution of the gross domestic product and other indicators such as the investment indexes, public works and private investments in real estate and construction .Another limitation to our conclusions is that GRACE was not specifically designed to provide information on socio economic status or social support, which would be alternative exposures of interest in the scenario of a deep financial crisis. We considered the broad term \"crisis\" as the exposure of interest, so we must acknowledge that the mechanisms responsible for our observations are to some extent speculative. Also, the study was not powered to detect strength of association between exposures and mortality for a specific region or country.Even in the absence of a formal level of statistical significance, the odds ratios appear to consistently point in thee direction of worse outcomes during the crisis. Figure This study provides evidence suggestive of an association between a dramatic socio-economic event and increased cardiac mortality. The spike in mortality rates that we observed was striking and above the expected death rates according to prior projections from the Ministry of Health ,21. We oThe GRACE study is supported by an unrestricted grant from Sanofi-Aventis to the Center for Outcomes Research, University of Massachusetts Medical School.Sanofi-Aventis had no involvement in the collection, analysis, and interpretation of data; in the writing of the manuscript; or in the decision to submit the paper for publication. The design, conduct, and interpretation of GRACE are undertaken by an independent steering committee.The authors have no conflicts to declare according to the Thrombosis Journal (TJ) Declaration of Competing Interest form. The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive license on a worldwide basis to the TJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in TJ editions and any other TJ products to exploit all subsidiary rights, as set out in the TJ license conditions. All authors have read and approved this manuscript.. EPG and GEB conceived and designed the study and wrote the manuscript. OD and FA contributed to study design and performed statistical analysis and reviewed the manuscript and BM supervised the study.We thank the physicians and nurses participating in GRACE. The complete list of GRACE Investigators can be found at Keith A.A. Fox, Joel M. Gore (GRACE Co-Chairs); Kim A. Eagle, Philippe Gabriel Steg, (GRACE Publication Committee Co-Chairs); Giancarlo Agnelli, Frederick A. Anderson, Jr, \u00c1lvaro Avezum, David Brieger, Andrzej Budaj, Marcus D. Flather, Robert J. Goldberg, Shaun G. Goodman, Christopher B. Granger, Dietrich C. Gulba, Enrique P. Gurfinkel, Brian M. Kennelly, Werner Klein, Jos\u00e9 L\u00f3pez-Send\u00f3n, Gilles Montalescot, Frans Van de Werf."}
{"text": "Blood doping is commonplace in competitive athletes who seek to enhance their aerobic performances through illicit techniques.Cobalt, a naturally-occurring element with properties similar to those of iron and nickel, induces a marked and stable polycythemic response through a more efficient transcription of the erythropoietin gene.Although little information is available so far on cobalt metabolism, reference value ranges or supplementation in athletes, there is emerging evidence that cobalt is used as a supplement and increased serum concentrations are occasionally observed in athletes. Therefore, given the athlete's connatural inclination to experiment with innovative, unfair and potentially unhealthy doping techniques, cobalt administration might soon become the most suited complement or surrogate for erythropoiesis-stimulating substances. Nevertheless, cobalt administration is not free from unsafe consequences, which involve toxic effects on heart, liver, kidney, thyroid and cancer promotion.Cobalt is easily purchasable, inexpensive and not currently comprehended within the World Anti-Doping Agency prohibited list. Moreover, available techniques for measuring whole blood, serum, plasma or urinary cobalt involve analytic approaches which are currently not practical for antidoping laboratories. Thus more research on cobalt metabolism in athletes is compelling, along with implementation of effective strategies to unmask this potentially deleterious doping practice Ergogenic drugs are substances commonly used to enhance the athletic performance and include illicit drugs as well as a variety of compounds that are marketed as nutritional supplements. Although such drugs have been widely used by professional and elite athletes for centuries, research indicates that in recent years competitive athletes are increasingly experiencing with illicit compounds to improve both appearance and athletic abilities. Blood doping consists on techniques administered for non-medical reasons to healthy athletes to improve the blood oxygen carrying capacity, increasing oxygen deliver to the muscles, particularly in conditions of demanding physical exercise . Owing tCobalt belongs to Group VIII of the periodic classification of elements and shares properties with nickel and iron. Cobalt is a naturally-occurring element with properties similar to those of iron and nickel. It has been reported that cobalt chloride promotes an hypoxia-like response, involving enhanced erythropoiesis and angiogenesis. The erythropoietin gene is the paradigm of oxygen-regulated genes controlled by the transcription factor Hypoxia Inducible Factor 1a (HIF-1a). HIF-1a is the key regulator of cellular and systemic oxygen homeostasis, through an increased DNA binding activity to the target erythropoietin gene sequence. Under normoxic conditions, the main mediator HIF-1\u03b1 is rapidly degraded by the proteasome. During hypoxia or cobalt chloride administration, the degradation of HIF-1a is markedly inhibited. Therefore, HIF-1a binds to HIF-1b, crosses the nuclear membrane and powerfully activates the erythropoietin gene transcription .Exposure to 120 or 150 mg/day of cobalt chloride results in the development of polycythemia with a substantial increase of hematocrit and hemoglobin, up to 20% above pre-treatment levels ,6. On thMany athletes either are unaware of or do not consider the possible health risks caused by several doping techniques. Thus, cobalt misuse or abuse in athletes should be regarded in a critical perspective, along with gene doping targeted at enhancing expression and transcription of the erythropoietin gene ,11. UnneOwing to these severe and unpredictable side effects, doping by cobalt salts may reveal as a serious threat for the scientific community and for public health. Cobalt is easily purchasable, inexpensive and not currently comprehended within the World Anti-Doping Agency (WADA) prohibited list . UnfortuAntidoping laws exist to provide a safe and fair environment for participation in sport. These laws should prevent and protect athletes from subjecting themselves to health risks through the use of unsafe, but performance-enhancing compounds. An area of major controversy is the \"sports supplement\" industry, which is poorly regulated when compared with prescription drugs, but yet is a potential source of doping violations. In this regard, pharmacokinetic characteristics, easy availability through the chemical industry and low costs would make cobalt administration the ideal surrogate or complement for rHuEpo administration, turning out to be the most suited blood doping technique for athletes seeking to improve aerobic performances with little chance of testing positive. At variance with blood doping, cobalt is not mentioned in the WADA prohibited list . NeverthThe author(s) declare that they have no competing interests.GL conceived of the study, and participated in its design and coordination and helped to draft the manuscript; MF participated in study design and helped to draft the manuscript; GCG coordinated the study design and helped to draft the manuscript. All authors read and approved the final manuscript."}
{"text": "Cultures of human MDMs or T-lymphocytes (as a nonphagocytic control) were exposed to carbon or carbon/iron particulates for various time periods and examined by transmission electron microscopy for ultrastructural changes. T-cells failed to internalize either of the particulates and showed no organelle or nuclear changes. Conversely, MDMs avidly phagocytized the particulates. MDMs treated with C particulates exhibited morphologic evidence of macrophage activation but no evidence of lysis of organelles. In contrast, MDMs treated with C/Fe particulates exhibited coalescence of particulate-containing lysosomes. This phenomenon was not observed in the case of C particulates. By 24 hr there was a tendency of the C/Fe particulates to agglomerate into loose or compact clusters. Surrounding the compact C/Fe agglomerates was a uniform zone of nearly total organelle lysis. The lytic changes diminished in proportion to the distance from the agglomerate. In such cells, the nucleus showed loss of chromatin. Although C particles induced no detectable oxidative burst on treated MDMs, C/Fe particles induced a nearly 5-fold increase in the extracellular oxidative burst by treated MDMs compared with untreated controls. Iron bound to C particles catalyzed the decomposition of hydrogen peroxide to generate hydroxyl radicals. Results of these studies suggest that, among particulates of similar size, biologic activity can vary profoundly as a function of particulate physicochemical properties.In this study, we tested the hypothesis that the presence of iron in carbon particulates enhances ultrastructural perturbation in human monocyte-derived macrophages (MDMs) after phagocytosis. We used 1-\u03bcm synthetic carbon-based particulates, designed to simulate environmental particulates of mass median aerodynamic diameter \u2264 2.5 \u03bcm (PM Respirable particulates containing transition metals such as iron, vanadium, nickel, and copper are known to catalyze the generation of reactive oxygen species (ROSs) such as the highly damaging hydroxyl radical . SequelaThe process of phagocytosis allows uncontrolled entry of iron-containing particulates into cells because these particulates have bypassed control by the protein transferrin  and its Our group has examined two naturally occurring zeolites, including forms whose biologic activity is reported to range from highly pathogenic (erionite) to essentially benign (mordenite). We found that on exposure to the same mass of a specific type of particulate, the oxidative burst increases with decreasing particle size but remains relatively independent of zeolite composition. On the other hand, the Fenton reaction depends on the type of zeolite, suggesting that the surface structure of the iron on the zeolite plays an important role . In anot2.5) that occur as airborne pollution. We made ultrastructural observations and compared human blood monocyte-derived macrophages  with human T-cells (as nonphagocytic controls) on exposure to C or C/Fe particulates. To assess the bioactivity of C and C/Fe particulates, luminescent assays using luminol for oxidative bursts were conducted after exposure of macrophages to the particulates. In addition, the ability of the particulates to produce hydroxyl radicals from hydrogen peroxide (H2O2) was studied (Fenton reaction).In the present study, we used synthetic 1-\u03bcm carbon and carbon/iron particulates, designed to simulate environmental particulates of mass median aerodynamic diameter \u2264 2.5 \u03bcm  before decomposition of the ammonium ions. The zeolite was cooled to room temperature, and solid phenol (0.21 g phenol/g zeolite) was added. A weak vacuum was pulled on the system, and the temperature was raised slowly to 60\u00b0C. Solid paraformaldehyde  was added to the zeolite/phenol material, and the temperature was raised very slowly to 120\u00b0C in a nitrogen environment. At this point the solid material turns red as the phenol/paraformaldehyde cross-linked polymer forms. The solid material was held at 120\u00b0C for 5 hr to allow for complete polymerization. The zeolite/polymer mix was pyrolyzed at 800\u00b0C for 19 hr under flowing argon. The zeolite template was removed by etching in 48% hydrofluoric acid for 6 hr. The size of the particles was confirmed by scanning electron microscopy (SEM). Bulk analysis of C/Fe particulates found aluminum content of 1.38%, silicon 0.33%, iron 0.46%, and the rest carbon.The procedures followed were adapted from a previously published procedure for the synthesis of a carbonaceous negative image of a zeolite . The syn7 cells/well (2 mL/well), and incubated at 37\u00b0C in a humidified atmosphere of 10% CO2/90% air for 48 hr to allow adherence of monocytes. Nonadherent cells were then removed, and adherent monocytes were washed twice with Seligman\u2019s buffered saline solution (SBSS) and supplied with fresh complete M-CSF\u2013free leukocyte culture medium. Cells were incubated for an additional 10\u201312 days with medium changes at 48-hr intervals to allow differentiation into the macrophage phenotype and were labeled MDMs.Peripheral blood mononuclear cells (PBMCs) were separated by Ficoll-Hypaque density gradient centrifugation from fresh heparinized blood collected by venipuncture from healthy, nontransfused consenting volunteers, as previously described . This st2/90% air, after which nonadherent cells were recovered for use in experiments.T-lymphocytes were isolated from PBMCs by negative selection with a commercially available cocktail of monoclonal antibodies and complement , using methods based on those of + cells). T-cells routinely marked 90\u201395% positive for CD3 and 25\u201335% positive for CD8, with the remainder positive for CD4, and had undetectable levels of monocyte contamination (as indicated by the absence of CD14+ cells).To assess homogeneity of populations prepared in this manner, samples were suspended in SBSS, stained with fluorescein isothio-cyanate\u2013conjugated monoclonal antibodies specific for CD3, CD4, CD8, and CD14  as previously described , and ana6 cells in 2 mL/well). Particulates were sonicated and immediately added to cultures at a non-toxic concentration of 5 \u03bcg/cm2 surface area. Trypan blue dye exclusion was used to demonstrate that the exposure of 5 \u03bcg/cm2 particles was not toxic to the cells. Plates were centrifuged for 10 min at 300 \u00d7 g immediately after addition of particulates and then incubated at 37\u00b0C in a humidified atmosphere of 10% CO2/90% air. After various periods of incubation (2\u201324 hr), MDMs were washed twice with PBS and harvested for fixation by gentle scraping after 15 min of incubation in 0.01% EDTA/PBS at 4\u00b0C. Concurrently, free particulates were separated from T-cells by density gradient centrifugation through Ficoll-Hypaque , which allows sedimentation of free particulates but not T-cells. T-cells recovered from the gradient were washed twice in PBS before fixation.C/Fe particulates 1 \u03bcm in diameter as well as similarly sized C particulates (without iron) were sterilized by steam autoclave and suspended in serum-free DMEM. MDMs differentiated as described above were washed with phosphate-buffered saline (PBS) and supplied with fresh complete DMEM (2.0 mL/well). T-cells were likewise washed and suspended in fresh medium in six-well culture plates , and then dehydrated in graded ethanol washes. Specimens were embedded in Medcast . Blocks were cured for a minimum of 12 hr at 60\u00b0C. Thin sections (~100 nm) were cut from cured blocks using an ultramicrotome  and mounted on 2-mm 300-mesh copper grids. Grids were heavy metal stained using a standard two-step uranyl acetate/lead citrate technique and then examined and photographed at 60 kV with a Philips 300 transmission electron microscope .2, four replicate wells per treatment. As negative controls, each experiment included 4 replicate wells containing MDMs, medium, and luminol but no particulates. Plates were sealed with UV-sterilized Top Seals  and centrifuged at 4\u00b0C . Luminescence was immediately measured (time 0) with a Top-Count Microplate Scintillation and Luminescence Counter (Packard), after which plates were placed in a 37\u00b0C incubator. Subsequently, luminescence was measured at 10 min intervals, with plates being incubated at 37\u00b0C between counts.Human PBMCs were plated in 96-well Optilux culture plates  and allowed to differentiate into MDMs as described above. Immediately before assay, culture medium was removed, and cells were washed twice with PBS before addition of ice-cold serum-free RPMI 1640 , 100 \u03bcL/well. A stock solution of 100 mM luminol was prepared with 20 mg luminol /mL dimethyl sulfoxide and stored at \u221220\u00b0C until use. Immediately before assays, luminol stock solution was thawed, diluted 1:100 (1 mM) in ice cold RPMI, and added to culture wells (100 \u03bcL/well). Particulates (C or C/Fe) were sonicated and added to culture wells at a concentration of 5 \u03bcg/cmLuminescence indices were calculated by dividing the mean luminescence counts per minute (cpm) of four replicate particulate-treated wells by the mean cpm of four negative control wells at each time point.N-oxide  was added, along with 50 \u03bcL of a 30% hydrogen peroxide solution . The solution was shaken in the dark for 15 min. The particles were removed by centrifugation, and the solution was analyzed in a capillary column by electron spin resonance (ESR) spectroscopy . ESR was performed with a modulating frequency of 100 kHz with a modulating amplitude of 2.090 G. The microwave power was 0.632 mW. The samples were scanned 10 times with the average taken as the representative spectra.Five milligrams of synthetic C or C/Fe particles were weighed and suspended in 500 \u03bcL of PBS (pH 7.4) solution. To this suspension, 100 \u03bcL of 5,5-dimetheyl-1-pyrolline-For the untreated cells (controls), the nucleus showed the expected rim of heterochromatin. The cytoplasmic organelles appeared normal. The microvilli showed expected formations. Nucleoli were ultrastructurally normal.An SEM image of the C/Fe synthetic particulates is shown in To assess bioactivity related to these synthesized particulates, we performed luminol assays to measure the release of ROSs on phagocytosis . These eData presented in To examine the kinetics of cell/particulate interaction, we fixed the cells 2\u20134 and 24 hr after exposure to particulates.At 2 hr postexposure, ultrastructural signs of macrophage activation were evident with generalized dilatation of endoplasmic reticulum (ER). Numerous C particulates were seen within intact lysosomes . At 24 hBy the first sampling (4 hr), particulates of similar size and contours as the stock preparation of C/Fe particulates (as seen by SEM) were present within cells. Many particulates were in lysosomes with a detectable membrane surrounding them . In otheBy 24 hr, the particulates were sometimes partially or markedly aggregated  and 7. AThe control T-cells and T-cells exposed to the C or C/Fe particulates showed no detectable ultrastructural changes. Random fields revealed healthy appearing cells. No evidence of internalized C or C/Fe particulates could be seen in the experimentally exposed group or controls. In both categories, the nuclei were generally oval and had the expected abundant heterochromatin. No ultrastructural changes were detected between the two categories.To determine the role of serum proteins in the agglomeration of C/Fe particulates, free particulates were incubated for 24 hr in complete or serum-free leukocyte culture medium, washed in distilled water, and examined by SEM. The C/Fe particulates, which had been suspended in the serum-free medium, showed no tendency to agglomerate . In contWe observed the propensity of the particles to catalyze the formation of hydroxyl radicals from hydrogen peroxide by ESR spectroscopy. The procedure involved trapping of the hydroxyl radical with DMPO . The fouThe physical properties of both the C and C/Fe particulates were such that sections for ultrastructural evaluation could be prepared without sectioning artifacts. The occasional absence of lysosomal membranes around particulates e.g.,  might beEpidemiologic studies have demonstrated that there is a direct correlation between exposure to small airborne particulates and human disease. However, the mechanism(s) by which these particulates exacerbate pulmonary or cardiovascular disease is not known. To begin to address the role of iron in these processes, we synthesized carbon-based particles with or without iron. It was interpreted that cell features associated with activation seen in the MDMs exposed to the C particulates only were a consequence of the activation brought about by the extensive phagocytosis of particulates. There was no lysis of organelles in cells treated with C particles.Consider the functional significance of some of the C/Fe-exposed cells having intact lysosomal membranes and ER, whereas others did not appear to be related to the length of time of exposure: At the 4-hour sampling, both structures seemed to be morphologically intact (but with dilated ER), whereas at 24 hr, the lysosomal membranes around the agglomerates were often ruptured and there was extensive ER dilation and vacuole formation (approximately in proportion to distance away from the agglomerate). Thus, both time and formation of the large agglomerate were positively correlated with the intracellular lesions. From a functional standpoint, it seems likely that sequelae from generation of ROSs could require time as well as sufficient concentration in an agglomerate to reach the threshold to alter the ultrastructural morphology.We also observed the following regarding the phenomenon of intracytoplasmic agglomeration of C/Fe particulates: At 4 hr postexposure, numerous particulates had become internalized. These were interpreted as being within phagosomes because the membrane could generally be followed around these variably sized particulates. At 24 hr, the particulates were often seen to be forming into much larger clusters but still generally within the lysosomal membranes. At an apparently more advanced phase, the particulates had sometimes formed a dense spherical cluster, surrounded by a zone of nearly total organelle lysis. The cause of such an intracellular lesion is not certain, but it would appear to be compatible with that resulting from reactive oxygen metabolite generation from the C/Fe particles.To explain the propensity of the C/Fe particulates to form spherical clusters within cells, we tested cell-free medium with and without serum. The agglomerates formed after the addition of C/Fe particulates (but not with C-only particulates) providing that serum was present. The spherical clusters were often approximately 10 \u03bcm in overall diameter whether in the cellular or noncellular system. The reason why the individual particulates in the intracellular clusters were smaller than particulates initially ingested by the macrophage is not apparent. One explanation may be that the large C/Fe conglomerate formation underwent a fracturing process associated with the cutting effect by the microtome blade. Given that during synthesis of the C/Fe particulates, the material is subjected to extreme acidification procedures, the acidification reached in a lysosome would not be sufficient to decompose the particle. Hence, it seems unlikely that degradation on a purely chemical basis could have occurred in the biologic environment of the lysosome and that the apparent smaller particle size is an artifact of the preparation associated with the slicing of a dense agglomeration of graphitic particles.2.5 to bring about particle aggregation  postexposure, the morphologic evidence of ultrastructural change was not detected until much later. The lesions were not seen at the 4 hr sampling but were seen at the 24 hr sampling. The reason the morphologic changes were not evident until later is not clear. One possibility is that cell injury may have occurred early but did not manifest morphologic changes until later. Another possibility is that the lesions were a consequence of the concentration of the possibly toxic products resulting from the coalescence of multiple small phagolysosomes with their contents. Still another possibility is that the physical compression on adjacent organelles as a consequence of the mass of the agglomerate might be considered. Of these, it seems most feasible that the lesions were related to concentration of possibly toxic secondary products produced by a chemical reaction from the agglomerate. The C/Fe particulates contain iron on the surface, and the cell has been demonstrated to undergo an oxidative burst on phagocytosis of the particulates. A likely oxidant produced by the cell during the oxidative burst is hydrogen peroxide. The C/Fe particle can promote the formation of hydroxyl radicals via the Fenton reaction:The ultrastructural changes noted in this study are consistent with macrophage activation and damage, which could be explained by the uncontrolled formation of ROSs.Synthetic C and C/Fe particulates (1 \u03bcm) were given to cultures of human T-cells and MDMs. The T-cells failed to ingest either particles and showed no ultrastructural changes. The MDMs avidly ingested both type of particles. In contrast, those receiving C particulates showed only ultrastructural changes associated with cell activation. Those receiving C/Fe particulates by 24 hr showed evidence of clustering and coalescence of particulates. A highly discrete, concentrated mass of particulates was sometimes surrounded by a zone of total organelle lysis. Evidence that the C/Fe particulates were bioactive was demonstrated by a nearly 5-fold increase in oxidative burst by treated MDMs. Similar cells exposed to C particulates showed no increase in this regard. The synthetic C/Fe particulates also produced hydroxyl radicals on exposure to hydrogen peroxide. We hypothesize that the formation of intracellular ROSs is responsible for the ultrastructural changes observed. Results of these studies demonstrate that particle-induced ultrastructural changes depend on phagocytosis and suggest that, among respirable particulates of similar size, biologic activity can vary profoundly as a function of particulate physicochemical properties."}
{"text": "Cobalt is classified by the IARC as a possible human carcinogen (group 2B). Although there is evidence for in vivo and in vitro toxicity, the mechanisms of cobalt-induced lung toxicity are not fully known. The purpose of this work was to identify potential signatures of acute cobalt exposure using a toxicogenomic approach. Data analysis focused on some cellular processes and protein targets that are thought to be relevant for carcinogenesis, transport and biomarker research.It has been estimated that more than 1 million workers in the United States are exposed to cobalt. Occupational exposure to 59 Co. A group of 29 of these genes, representing the main biological functions, was assessed by quantitative RT-PCR. The expression profiles of six of them were then tested by quantitative RT-PCR in a time-dependent manner and three modulations were confirmed by Western blotting. The 85 modulated genes include potential cobalt carriers , tumor suppressors or transcription factors  and genes linked to the stress response . We also identified nine genes coding for secreted proteins as candidates for biomarker research. Of those, TIMP2 was found to be down-regulated and this modulation was confirmed, in a dose-dependent manner, at protein level in the supernatant of exposed cells.A time course transcriptome analysis was performed on A549 human pulmonary cells, leading to the identification of 85 genes which are repressed or induced in response to soluble Most of these genes have never been described as related to cobalt stress and provide original hypotheses for further study of the effects of this metal ion on human lung epithelial cells. A putative biomarker of cobalt toxicity was identified. Cobalt  workers ,4. A stu workers ,8. As wi workers ,11. Some workers . A 19-mo workers .Following absorbtion by inhalation, cobalt is eliminated in the urine. Biological monitoring of accidental exposure mainly involves measuring the concentration of metal in the urine. This might be inadequate for several reasons. Firstly, the quantity of metal excreted (exposure marker) does not necessarily reflect organ damage, which varies from one person to another. Secondly, depending on the chemical form, excretion does not necessarily reflect the level of metal in the body because some forms are retained in the lungs. Thirdly, depending on its solubility, clearance can be very rapid and the cobalt may have left the body by the time samples can be taken. Therefore, a key issue in monitoring occupational exposure is the availability of adequate biomarkers.Although the chemical toxicity of cobalt has been proven, the molecular mechanisms of its toxicity are not all known. Cobalt is genotoxic ,15, and Since the lung is the main target organ of cobalt toxicity, the human A549 lung cell line was chosen as a model for this study, to evaluate cobalt toxicity. Noteworthy, this cell line has been widely documented in molecular toxicology, including hypoxia mimicked by cobalt ,20.Microarrays are currently used for large scale gene profiling, measuring sensitive cell changes in response to xenobiotic exposure. Such investigative studies may help identify new molecular targets for toxicants or provide new hypotheses about their mechanisms of action . We usedA549 is a stable tumor cell line, obtained from human lung carcinoma, with properties of type II alveolar epithelial cells . The resThe global transcriptional response was monitored using CEA microarrays GPL4263) . A549 ce63 . A549We used DAVID  web-acceAXL, IFNA4, DLG1, TNFRSF9 and SIN3A). Some discrepancies between the two techniques may be due to technical artefacts even if the primers were designed within the microarray cDNA sequence. For further analysis of gene modulation, we performed time-course quantitative RT-PCR on several genes: AXL, UBC, FBXL2 and SLC12A5 , or being induced from 2 h (UBC), or finally, early and continuous diminishing (FBXL2). For genes displaying temporal modulation, down-fluctuation quickly followed by up-regulation, as with AXL  in some specific functional classes: development, differentiation and proliferation, signal transduction and trafficking, cell defense and finally gene transcription and modification. We also selected genes coding for secreted proteins as potential hits for biomarker research. Tables ALDOA), glucose transporter 1 (SLC2A1), glyceraldehyde 3-phosphate dehydrogenase (GAPD), lactate dehydrogenase A (LDHA), proapoptotic factor (BNIP3L), phosphoglycerate kinase 1 (PGK1) and transferrin receptor (TFRC), (table TFRC which was repressed at 30 min), therefore our results agree with those already published and validate our system relative to previous reports, since they represent an appropriate internal positive control. Recently, two transcriptomic studies of hypoxia compared the action of low oxygen with that of metal ions such as cobalt or nickel on embryonic mouse fibrobasts [Cobalt is known as a \"hypoxia-simulating\" agent and mostter 1 SLCA1, glycebrobasts  and humabrobasts . 21% andbrobasts . CompariHSPCB gene coding for heat shock protein 90, was induced by a factor of 2.2 at 24 h  [ST13 and DNAJA2.The  h table . HSP90 p Cr, Cd) . However Cr, Cd) . Two othUBB, ratio 1.94, UBC, ratio 5.6) while UBC gene induction was observed in the kinetics from 4 h with qRT-PCR , is a transcription factor involved in both the initiation and termination of target gene transcription. It binds zinc and can act as a tumor suppressor [BHC80 (BHC80 protein), NT5E (CD73) and SDCCAG33 (Teashirt homolog 1). Cobalt ions have been shown to substitute for zinc in zinc finger protein domains which control the transcription of several genes and also in zinc-DNA repair proteins, inhibiting DNA repair [The protein encoded by ppressor . This geA repair ,36,37.DLG1 (disk large homolog 1) has been identified as a tumor suppressor gene in drosophila, with its mutation inducing the loss of cell polarity and neoplastic tissue growth. This gene is highly conserved. The molecular mechanism which regulates cell proliferation by DLG1 is not well known but there are arguments for implicating epithelial cell polarization in this regulation [DLG1 (disk large homolog 1) gene was strongly repressed in qRT-PCR. The anti-DLG1 antibody revealed clear depletion of DLG1 protein in Co+ samples (figure gulation . The DLGs figure . This coMAZ and DLG1) were repressed by cobalt, and in one case (DLG1), this repression was also observed at protein level.Two tumor suppressors . The three genes, FBXL2, ZNT1 and SLC12A5, are therefore appropriate candidates for research into cobalt transport proteins in human cells and will be studied further using targeted biological approaches.The ICAM1 (CD54), SERPIN C1 (antithrombin-III), IFNA4 , TFRC (transferrin receptor), PLA2R1 (phospholipase receptor A2), TNFSF6 (FAS ligand), WFDC2 (WAP four-disulfide core domain protein 2), LTBP3 (latent transforming growth factor beta binding protein 3) and TIMP2 . To further evaluate the interest of these genes, we checked the secretion modulation of the corresponding proteins. A549 cells were exposed to cobalt in a dose-response manner, to 0.2, 1 and 2 mM, and the supernatants analysed using available immunoassays. The levels of FAS ligand, WFDC2 [TIMP2 mRNA is described as being suppressed by hypoxia in endothelial cells [Biological monitoring of exposure to cobalt is mainly based on its concentration in urine. This method may be inadequate for two reasons. Firstly, measuring the quantity of excreted metal (exposure marker) does not necessarily reflect organ damage, which varies from one person to another. Furthermore, depending on the chemical form, excretion does not necessarily reflect the concentration of metal in the body; indeed, certain forms are eliminated in several phases; only 40% of cobalt oxides inhaled are excreted within 72 h . In thisd, WFDC2 , ICAM1, d, WFDC2 . Endogend, WFDC2 ,49, regual cells . Exposural cells . Therefoal cells . Since ial cells , TIMP2 mTIMP2 protein modulation in cobalt-exposed cell supernatant corroborated the gene down-regulation observed on the microarrays and with qRT-PCR. TIMP2 modulation has never been associated with metal stress. This result is innovative and will be studied further in the biological fluids of rats exposed to different chemical forms of cobalt by inhalation.FBXL2, ZNT1, SLC12A5) and tumor suppressors or transcription factors . Some of these genes provide new hypotheses for elucidating the mechanisms of cobalt intracellular chemical toxicity. Targeted biological approaches might confirm their biochemical role in the cobalt response.This study provides the first toxicogenomic analysis of human lung cell response to acute cobalt exposure. We have confirmed that genes involved in the cobalt hypoxia response and apoptosis are modulated. We have also revealed genes linked to heat shock response and proteasome function that have already been described in other metal stress responses. Newly identified genes linked to cobalt acute toxicity include potential cobalt carriers . The viability rate was determined as the ratio between the ATP in treated cells and control cells. Cobalt concentration in cell pellets was measured using flame atomic absorption spectroscopy .Total RNA was isolated using the Quiagen RNeasy miniprep kit according to the manufacturer's instructions. mRNAs were prepared using the Oligotex mRNA Quiagen kit, the purification process being repeated once to eliminate any contamination. RNA concentration was determined by OD measurement (260 nm/280 nm), purity and integrity were assessed using an Agilent 2100 Bioanalyser.Microarrays were obtained from the Service de Genomique Fonctionnelle . Two types of DNA collections were used for preparing the cDNA arrays: a collection of 5760 full length cDNA clones from the human infant brain 1NIB library, kindly provided by Genethon, and a collection of 2304 human PCR products (400\u2013600 bp) corresponding to specific key-words selected by direct query in the Unigene database. A complete description of the microarrays used in this study, including the protocols for slide production, has been submitted to the GEO database  under acFor each microarray experiment, 20 \u03bcg of total RNA were reverse transcripted and indirectly labelled using the FairPlay Microarray Labelling Kit (Stratagene). Amino reactive Cy3- and Cy5- dyes  were then chemically bound to cobalt and control cDNA respectively. Reverse labelling (or dyeswap) was performed for each experiment. Microarrays were pre-treated for 20 min with an N-methyl-pyrrolidinone solution containing 20 g/L succinic anhydride and 20 mM sodium borate, pH 8, immersed quickly in ethanol and dried by centrifugation for 6 min at 500 rpm. Following a quick rinse in RNase-free water, the slides were prehybridized in 30 ml 5X SSC, 1% SDS, 1% BSA (w/v) at 50\u00b0C for 40 min. The microarrays were then rinsed in RNAse-free water, immersed quickly in isopropanol and dried by centrifugation for 6 min at 500 rpm. The hybridization solution was prepared using 100 \u03bcl formamide, 10 \u03bcl SDS 10% and 30 \u03bcl RNase-free water. Labelled cDNA was solubilized in 17.5 \u03bcl of this solution plus 7.5 \u03bcl of 20 \u00d7 SSPE and heat-denatured. Hybridization was performed overnight at 42\u00b0C. The microarrays were quickly rinsed in 0.1 \u00d7 SSC, 0.01% SDS, washed twice for 10 min in 0.01 \u00d7 SSC, then dried quickly in a stream of nitrogen and scanned with GenePix 4000B . Cy3 and Cy5 spot fluorescence intensities were quantified after local subtraction of background using Genepix Pro 4.0 software (Axon Instrument Inc.). For each time point the result files were submitted to GeneSpring software 6.2 (Agilent Technologies) as follows. The data were first converted to take into account the results of the dyeswap reverse labelling, then normalized using the Lowess method, applying robust locally-weighted regression to smooth the intensity-dependence of the log ratios. The normalized data were then filtered on a quality test basis. This involved selecting spots detected on at least half of the microarrays with at least 70% pixels above threshold intensity (set to the median background plus two standard deviations).From these remaining spots, we selected those with fluorescence ratios  above 1.5 fold with p-value < 0.05 using a t-test statistical analysis on Genespring software and performing a Benjamini and Hochberg false discovery rate multiple testing correction.\u00ae 2 system. The amplification program consisted of 1 cycle at 95\u00b0C with 10 min-hold followed by 40 cycles at 95\u00b0C with 15 sec-hold, 60\u00b0C with 1 min-hold, and a reading step at 60\u00b0C for 1 sec. Amplification was followed by melting curve analysis between 65\u00b0C and 95\u00b0C. RNA was used as a negative template for the absence of residual genomic DNA and a negative control without cDNA was used to control overall specificity. House- keeping genes, which are generally used as reference genes, are often modulated by stress. For example, GAPDH is strongly induced by cobalt (ratio 3). To find an invariant gene at each time point, several candidates were selected for their invariance from all the microarray data, and tested as invariant genes in qRT-PCR. FIGF (c- fos induced growth factor) was selected for time points 0.5 h, 2 h and 4 h. For samples at 24 h, mRNA had to be purified from total RNA to detect TUBA3 as an invariant reference gene. Differential analysis was performed on cDNA templates obtained from cobalt-treated or untreated cells in sextuplets for each gene, in the same way as for the reference gene . The results were processed using REST-MCS software [Specific primers were designed with Primer3  using cDsoftware  and testWestern blots were performed as previously described  after 24Immunoassays were performed on culture supernatants from cells exposed to various concentrations of cobalt over a 24 h period. The supernatants were tested crude or at 10 fold concentration. TIMP2 and FASL proteins were detected using ELISA kits (Raybiotech and R&D systems respectively) according to the manufacturer's instructions. The WFDC2 protein, was analysed in Dr Hellstr\u00f6m's laboratory because they developed the WFDC2 ELISA . Other iVM designed the study and drafted the manuscript.FB carried out data acquisition and analysis and prepared the microarray results for tables and figures.OP was involved in the design stage, qRT-PCR analysis and microarray experiments.SR carried out qRT-PCR.GS carried out the RNA extraction, labelling and microarray hybridization.EQ was involved in the design stage and revised the manuscriptAll authors read and approved the final manuscript."}
{"text": "Penaeus shrimp, along with 14 previously published sequences. Using Bayesian coalescent approaches, we calculated a mean rate of nucleotide substitution for IHHNV that was unexpectedly high (1.39\u00d710\u22124 substitutions/site/year) and comparable to that reported for RNA viruses. We found more genetic diversity than previously reported for IHHNV isolates and highly significant subdivision among the viral populations in Mexican waters. Past changes in effective number of infections that we infer from Bayesian skyline plots closely correspond to IHHNV epizootiological historical records. Given the high evolutionary rate and the observed regional isolation of IHHNV in shrimp populations in the Gulf of California, we suggest regular monitoring of wild and farmed shrimp and restriction of shrimp movement as preventative measures for future viral outbreaks.Infectious hypodermal and hematopoietic necrosis virus (IHHNV) is a widely distributed single-stranded DNA parvovirus that has been responsible for major losses in wild and farmed penaeid shrimp populations on the northwestern Pacific coast of Mexico since the early 1990's. IHHNV has been considered a slow-evolving, stable virus because shrimp populations in this region have recovered to pre-epizootic levels, and limited nucleotide variation has been found in a small number of IHHNV isolates studied from this region. To gain insight into IHHNV evolutionary and population dynamics, we analyzed IHHNV capsid protein gene sequences from 89  ParvoviridaeLitopenaeus stylirostris and L. vannamei. This viral pathogen is known to cause mortalities of up to 90% in juvenile and subadult individuals of L. stylirostrisL. vannameiL. stylirostris populations in the Gulf of California L. stylirostris fishery landings have increased since that time L. stylirostris has developed resistance to IHHNV and/or the virus has reached an equilibrium with the host in terms of genes related to virulence Effective implementation of monitoring and control measures for viral epizootic outbreaks requires an understanding of the factors that underlie molecular evolution and population dynamics. This is also true for introduction of the infectious hypodermal and hematopoietic necrosis virus (IHHNV) into shrimp populations of the northern Pacific coast of Mexico. IHHNV is a single-stranded DNA-containing virus belonging to the family To better understand the molecular evolution, population structure and dynamics of IHHNV in the Pacific coast of Mexico, we analyzed capsid protein gene sequences from wild shrimp populations in the region. With sample sizes much larger than in previous studies, we were able to make inferences about levels of variation, population structure and recent population history in this virus, leading us to question whether it should be regarded as a static evolutionary lineage.L. stylirostris, L. vannamei and Farfantepenaeus californiensis) were collected from seven sites in the northwestern Pacific coast of Mexico from November 2004 to January 2005  and CP2R (5\u2032- CGG GTA TAT ATT GCA CAT CGA A-3\u2032) that were designed for this study based on a published IHHNV sequence (GenBank accession number AF273215) 2, and 1\u00b5l of extracted genomic DNA (\u223c40 ng) in a 25 \u00b5l final reaction volume. Amplification parameters included an initial denaturation of 94\u00b0C for 2 min., followed by 35 cycles of 94\u00b0C for 30 sec, 55\u00b0C for 30 sec and 72\u00b0C for 1 min. A final extension of 72\u00b0C for 7 minutes was used. The amplified DNA was electrophoresed in a 1% agarose gel, and gel purified using a Qiaquick gel purification kit . Amplified DNA samples were directly sequenced in both directions using the CP1F and CP2R primers. Sequencing was performed at the High-Throughput Genomics Unit of the University of Washington .Genomic DNA was extracted from 50\u2013100 mg of shrimp tail muscle using DNAzol\u2122  following manufacturer's instructions. Extracted DNA was resuspended in 100 \u00b5l of tris EDTA buffer and stored at \u221220\u00b0C. The IHHNV capsid gene was amplified by PCR using primers CP1F  for the initial analyses. Arlequin v.3.0b L. stylirostris and P. monodon in different geographic locations were downloaded from GenBank and included in phylogenetic analyses . We first constructed a haplotype network using statistical parsimony in the program TCS v1.21 To determine evolutionary relationships among the Mexican IHHNV isolates obtained in this study and compare them to other geographic isolates, 14 IHHNV capsid protein sequences isolated from analyses . Eight P6 generations, and sampling every 1000 generations. Convergence was acknowledged when the standard deviation of the split frequencies dropped below 0.01; parameter files from the Bayesian analysis were analyzed in TRACER To perform the Bayesian phylogenetic analysis, the data set of 61 unique IHHNV capsid sequences (47 unique haplotypes obtained in this study and 14 sequences from GenBank) was aligned using ClustalX To assess the influence of multiple convergent mutations  on the inferred IHHNV phylogenetic tree, the data set used in the Bayesian analysis was analyzed to calculate the number of parsimony informative characters with homoplasy using the computer program MacClade v.4.08 Lightner and colleagues documented the initial history of IHHNV outbreaks in Mexico and noted that the virus was first detected in the southern region of the Gulf of California 6 generations, with 10% eliminated as burnin, which seemed appropriate based on the visual inspection of the run trace, and effective sample sizes were >200.The rate of nucleotide substitution and historical effective number of infections were estimated using the computer program BEAST eN can be inferred from the BSP 7. The MCMC algorithm was run for 30\u00d7106 generations, with sampling every 3000 generations and 10% burnin. Visual examination of parameter and likelihood plots in TRACER v.1.4 Historical changes in effective population size 6 generations, with sampling every 1000 generations. The remainder of the parameters were the same as described above.To determine whether inferences from the Bayesian skyline plot might be biased by IHHNV population subdivision, we also performed separate BSP analyses for each region . Bahia Magdalena (BM) was not included in the analysis due to its geographical separation from the Gulf of California. The constant skyline model included 4\u20138 size groups depending on the data set size, and the MCMC algorithm was run for 10\u00d710a priori. In contrast, the FEL method estimates dN and dS directly from the data at each codon site. The SLAC method calculates these parameters from reconstructed ancestral sequences and compares observed dN and dS against the expected corresponding values. For all codon-based analyses, the 89 IHHNV sequence alignment was in-frame, with the first nucleotide corresponding to the first codon position.The 89 IHHNV capsid sequence alignment was analyzed for evidence of recombination breakpoints using the Genetic Algorithms for Recombination Detection (GARD) tool We also inferred whether positive selection has acted in specific IHHNV lineages, leading to differential selective pressure across the IHHNV phylogeny. This was performed using the Genetic Algorithm (GABranch) method L. stylirostris (n\u200a=\u200a83) followed by L. vannamei (n\u200a=\u200a5) and one from F. californiensis  and 64 mutations . Of the 64 substitutions, 28 corresponded to synonymous and 36 to nonsynonymous substitutions . No inseThere were 47 unique haplotypes, with only 2 shared among sites. One haplotype was present in seven individuals each from San Felipe and Golfo de Santa Clara, and a second was found in two shrimp from Empalme and four from Bahia Kino.ST\u200a=\u200a0.369, p<0.0001). Exact tests of haplotype distributions showed significant differentiation between all pairs of sites , except San Felipe vs. Golfo de Santa Clara. Pairwise \u03a6ST values also showed that all seven populations were genetically different from each other  than in the central  and southern regions . Both measures of genetic diversity decreased with increasing latitude , of which 194 were parsimony informative. Although this data set contained 13 distantly related sequences from outside of the study area, only 48 sites (5%) showed any degree of homoplasy  on the final Bayesian tree, and only 17 sites were inferred to have 3 or more mutations.The IHHNV haplotype network produced four distinct clades . The claA 50% majority-rule tree obtained from the Bayesian analysis is shown in Based on statistical parsimony assumptions of haplotype frequency and connectedness, a northern haplotype was inferred to be the ancestor of the sampled IHHNV lineages, since it is present in 14 individuals and is only 1 to 2 mutational steps away from 10 other haplotypes in the region . The IHH\u22124 substitutions/site/year. Comparison of the marginal likelihoods calculated by Bayes factors showed that the expansion growth model had the largest marginal likelihood value, and is therefore the best-fit population growth model for IHHNV. The expansion growth model had a mean mutation rate of 1.39\u00d710\u22124 (95% HPD 3.34\u00d710\u22125\u20132.91\u00d710\u22124). The rate of substitution under strict molecular clock assumptions and constant population size was very similar, with a mean mutation rate of 1.81\u00d710\u22124 (95% HPD 2.61\u00d710\u22125\u20133.39\u00d710\u22124).The mean rate of nucleotide substitution estimated from dated IHHNV capsid sequences under assumptions of both strict and relaxed molecular clocks were comparable and unexpectedly high for a DNA virus such as IHHNV. The relaxed molecular clock was favored over the strict clock, as the 95% highest posterior density interval (HPD) of the standard deviation of the lognormal marginal posterior distribution excluded zero . The relaxed molecular clock model also had a larger marginal likelihood according to the Bayes factors comparison (\u22122696.62 for the strict molecular clock compared to \u22122690.78 for the relaxed molecular clock). Mean mutation rates obtained with the five demographic models under the relaxed molecular clock ranged from 1.39 to 4.89\u00d710\u22124 substitution/site/year for the 85 sequences obtained in this study (excluding the 4 used in the molecular clock estimate). The analysis suggested that IHHNV may have been present in Mexican penaeid shrimp population in the early 1970's, has been slowly increasing since the mid 1980's, and began an exponential phase of growth in approximately the early 1990's (\u22125) and 75% (2.23\u00d710\u22124) estimated mutation rates (data not shown). However, the timing of the population expansion differed by approximately 10 years . Our analysis suggests that the common ancestor of the sampled IHHNV isolates dates to the early 1970's, which coincides with the assumed time of IHHNV introduction into the region Historical IHHNV population demography in the northwestern Pacific coast of Mexico was inferred from a Bayesian skyline plot incorporating the mean rate of 1.39\u00d710y 1990's . These dNo evidence of recombination was found at any codon site in the IHHNV nucleotide alignment. Signals of natural selection were found in some codons, the number of which varied depending on the genetic algorithm used. The overall mean dN/dS ratio of the IHHNV capsid region analyzed as estimated by the SLAC method was 0.493. Only codon 7 was found to be positively selected under the three methods . The REL method found five additional positively selected codons . Negatively selected codons under the three algorithms included codons 66, 151 and 213. Both FEL and REL algorithms detected additional negatively selected codons . Other negatively selected codons detected by the REL method were 80, 91, 92, 118, 121,163, 180, 227, 233, 249, 262.The GABranch analysis suggested surprisingly high levels of positive selection in 13 lineages of the IHHNV genealogy. Specifically, three lineages found in the northern region, six in the central and four in the south showed the highest possible dN/dS values , supported by at least 98% of the models tested.The history of IHHNV in the northwestern Pacific coast of Mexico provides a unique opportunity to study the molecular evolution and population dynamics of a marine parvovirus after its introduction into a new environment. We found that IHHNV haplotype and nucleotide diversity is higher than previously reported. Tang and colleagues analyzed the capsid gene of 14 IHHNV isolates from the Americas that included only 4 samples from the Gulf of California, and reported 1.3% segregating sites in the capsid protein gene We found that genetic diversity is not uniform across geographic regions in the northwestern coast of Mexico. In fact, IHHNV localities in the central and southern regions of the Gulf of California are an order of magnitude more variable than those in the northern region. The statistical parsimony network and Bayesian phylogenetic tree also show more geographic structure in the southern and western regions, with the central region representing an admixture of isolates of different geographic origins. These differences may be explained in light of the marine and biogeographic features present in the Gulf of California. The northern area of the Gulf is characterized by a unique cyclic current system that limits interactions with the central and southern regions of the Gulf The mixture of haplotypes evident in the haplotype network and Bayesian analysis suggests high genetic exchange among the central and southern regions and across the Baja California Peninsula. Interestingly, Bahia Kino and Bahia Magdalena haplotypes are closely related despite being separated by the strip of land that represents Baja California Sur. Natural movement of aquatic organisms across the coasts of the Baja California Peninsula is highly unlikely due to the large geographic distance. However, association of geographically distant haplotypes could be due to human-mediated transport of IHHNV infected broodstock and post-larvae between these two regions. In shrimp aquaculture, a common practice is the capture of wild shrimp in different life stages for seed, spawners and broodstock The statistical parsimony haplotype network provided a clear indication that the geographic location of IHHNV introduction is in the northwestern coast of Mexico. The rooting algorithm used by statistical parsimony assumes that gene pools contain multiple, identical sets of haplotypes that mutate periodically producing a mixture of coexisting old and new haplotypes \u22124 substitution/ site/ year, which is unexpectedly high for a single-stranded DNA virus, and comparable to RNA viruses which evolve at a rate of 10\u22123 to 10\u22125 substitutions/site/year \u22125\u20132.91\u00d710\u22124) also excludes slow, large DNA virus-like rates of evolution. It is generally assumed that DNA viruses evolve at a similar rate to that of their hosts due to viral dependence on the host's cellular machinery for replication \u22124), feline panleukopenia parvovirus (FPLV) (9.4\u00d710\u22125) \u22124) \u22124) We estimated a rate of IHHNV nucleotide substitution of 1.39\u00d710Penaeus monodon for aquaculture at that time has previously been suggested as the source of IHHNV in Mexico Additional support to our estimated substitution rate comes from close correspondence between IHHNV population growth inferred by the Bayesian skyline plot and the time of first detection and viral epizootics in the northwestern coast of Mexico. It is possible that the BSP was influenced by selection in some of the lineages and population subdivision . However, both the mean and the 25% estimated rates of nucleotide substitution produced population dynamics that fit reasonably well with the IHHNV epizootic history in the Gulf of California, although the 75% estimated rate suggests a younger population history inconsistent with the historical records. The BSP traces the IHHNV most recent common ancestor back to the early 1970's, and the introduction of The high levels of diversity we found in IHHNV contrast with previous suggestions of IHHNV low variation and stability IHHNV is a dynamic entity, with genetic differentiation among geographic regions in the Gulf of California. The presence of several quickly evolving lineages in the central and southern regions of the Gulf of California might be viewed as geographic \u201chotspots\u201d of IHHNV variability that could lead to the emergence of virulent strain(s) following changes in the host or environmental conditions. The potential for an economically devastating IHHNV outbreak is further enhanced by current global aquaculture practices, with the spread of viral diseases in shrimp aquaculture attributable to the movement of infected animals among countries and even continents IHHNV dynamics in the Gulf of California should, therefore, warrant frequent genetic monitoring in both wild and farmed shrimp populations, as well as stricter enforcement of biosafety measures. Because our data show evidence for regional isolation of IHHNV in shrimp populations, restriction of shrimp movement is likely to be an effective management tool in limiting spread of the virus. The assumption that IHHNV is a stable, static virus understates the potential for a new virulent strain to arise, leading to epizootics similar to those observed in the early 1990's.Table S1Details and GenBank accession numbers of the IHHNV capsid sequences used in this study.(0.11 MB DOC)Click here for additional data file."}
{"text": "The Hedgehog signaling pathway functions as an organizer in embryonic development. Recent studies have demonstrated constitutive activation of Hedgehog pathway in various types of malignancies. However, it remains unclear how Hedgehog pathway is involved in the pathogenesis of osteosarcoma. To explore the involvement of aberrant Hedgehog pathway in the pathogenesis of osteosarcoma, we investigated the expression and activation of Hedgehog pathway in osteosarcoma and examined the effect of SMOOTHENED (SMO) inhibition.in vitro and xenograft model in vivo. Real-time PCR revealed that osteosarcoma cell lines over-expressed Sonic hedgehog, Indian hedgehog, PTCH1, SMO, and GLI. Real-time PCR revealed over-expression of SMO, PTCH1, and GLI2 in osteosarcoma biopsy specimens. These findings showed that Hedgehog pathway is activated in osteosarcomas. Inhibition of SMO by cyclopamine, a specific inhibitor of SMO, slowed the growth of osteosarcoma in vitro. Cell cycle analysis revealed that cyclopamine promoted G1 arrest. Cyclopamine reduced the expression of accelerators of the cell cycle including cyclin D1, cyclin E1, SKP2, and pRb. On the other hand, p21cip1 wprotein was up-regulated by cyclopamine treatment. In addition, knockdown of SMO by SMO shRNA prevents osteosarcoma growth in vitro and in vivo.To evaluate the expression of genes of Hedgehog pathway, we performed real-time PCR and immunohistochemistry using osteosarcoma cell lines and osteosarcoma biopsy specimens. To evaluate the effect of SMO inhibition, we did cell viability, colony formation, cell cycle These findings suggest that inactivation of SMO may be a useful approach to the treatment of patients with osteosarcoma. Osteosarcoma is the most common primary bone malignant tumor occurring mainly in children . After iHedgehog (Hh) pathway has been implicated in different aspects of animal development, acting through several components, including the transmembrane proteins PATCHED (PTCH1) and SMOOTHENED (SMO), to activate the GLI zinc-finger transcription factors ,6. Hh paSMO shRNA.To explore the involvement of Hh pathway in the pathogenesis of osteosarcoma, we investigated the expression and activation of the Hh pathway genes in osteosarcoma and examined the effect of inhibition of SMO by cyclopamine, a specific inhibitor of SMO  or SMO sSonic Hedgehog (SHH) 2.1- to 18.8-fold . The reason for GLI1 down-regulation could not be determined. One possibility is that the GLI1 promoter is inactivated in human osteosarcomas by epigenetic modification. We found that GLI1 promoter contains a CG-rich region. Wong et al. reported that Hh pathway activity down-stream of SMO is mediated by GLI2 . Cells were then analyzed by flow cytometry using a FACS Vantage SE . Data were gated using pulse width and pulse area to exclude doublets, and the percentage of cells present in each phase of the cell cycle was calculated using FlowJo software .t-test, and differences in frequencies by Fisher's exact test. Differences were considered significant at P < 0.05.Each sample was analyzed in triplicate, and experiments were repeated three times. In all figures, error bars are standard divisions. All statistical analyses were performed using Microsoft Office Excel  and STASTISCA . Differences between mean values were evaluated by the unpaired (Hh): Hedgehog; (SMO): SMOOTHENED; (PTCH1): PATCHED; (SHH): Sonic hedgehog; (DHH): Desert hedgehog.The authors declare that they have no competing interests.TS was involved in the design and execution of the experiments, drafted the manuscript and contributed to the overall experimental design. MH conducted most of the experiments. HS was conducted a most of experiments. HG was conducted a part of experiments. YM was conducted a part of experiments. HN was conducted a part of experiments. OK was conducted a part of experiments. SK contributed to the overall experimental design. All authors read and approved the final manuscript.A, Immunohistochemical examination revealed that SMO was expressed on cytoplasm of 143B and GLI2 was localized in the nucleus of 143B. B, MTT assay showed that Sonic hedgehog promote proliferation of osteosarcoma cells. The experiment was triplicate with similar results.Click here for fileReal-time PCR was performed to quantify mRNAs of cell cycle related genes.SMO shRNA reduced levels of cyclin D1, cyclin E1, SKP2, and E2F1 transcription (error bar means S.D.). The comparative Ct (\u0394\u0394Ct) method was used to determine fold change in expression using ACTB. The experiment was triplicate with similar results.Click here for fileWe performed real-time PCR using formed tumors. Real-time PCR revealed that transcription of GLI1, GLI2, and PTCH1 was decreased in tumors formed by SMO shRNA-transfected 143B. In addition, SMO shRNA reduced levels of Cyclin E1, SKP2, and E2F1 transcription. The comparative Ct (\u0394\u0394Ct) method was used to determine fold change in expression using ACTB. The experiment was triplicate with similar results.Click here for filein vivo.Cyclopamine prevents proliferation of osteosarcoma  Immunohistochemical examination of ki67 was performed in xenograft tumors. Ki67 staining revealed that proliferation of osteosarcoma cells was decreased by cyclopamine treatment. The numbers of Ki67-positive cells was decreased to 50% of control revel by cyclopamine administration at day 14 (error bar means S.D.).Click here for file"}
{"text": "The aim of this study was to confirm recent results from a previous study focussing on the development of a method to measure the bacterial translocation through puncture holes in surgical gloves under real surgical conditions.An established method was applied to detect bacterial migration from the operating site through the punctured glove. Biogel\u2122 double-gloving surgical gloves were used during visceral surgeries over a 6-month period. A modified Gaschen-bag method was used to retrieve organisms from the inner glove, and thus-obtained bacteria were compared with micro-organisms detected by an intra-operative swab.In 20 consecutive procedures, 194 gloves  were examined. The rate of micro-perforations of the outer surgical glove was 10% with a median wearing time of 100 minutes (range: 20-175 minutes). Perforations occurred in 81% on the non-dominant hand, with the index finger most frequently (25%) punctured. In six cases, bacterial migration could be demonstrated microbiologically. In 5% (5/98) of outer gloves and in 1% (1/96) of the inner gloves, bacterial migration through micro-perforations was observed. For gloves with detected micro-perforations (n = 10 outer layers), the calculated migration was 50% (n = 5). The minimum wearing time was 62 minutes, with a calculated median wearing time of 71 minutes.This study confirms previous results that bacterial migration through unnoticed micro-perforations in surgical gloves does occur under real practical surgical conditions. Undetected perforation of surgical gloves occurs frequently. Bacterial migration from the patient through micro-perforations on the hand of surgeons was confirmed, limiting the protective barrier function of gloves if worn over longer periods. During surgery, intact surgical gloves act as a physical barrier against the transmission of blood-borne pathogens from hospital staff to patients and vice versa . SeveralIn a previous study, we established a method to evaluate the quantity of bacteria passing through undiscovered glove punctures under real surgical conditions . We demoThe purpose of this prospective investigation was to confirm our previously published results on bacterial translocations .\u00ae Indicator\u2122, M\u00f6lnycke, Gothenburg, Sweden). This patented indicator system gives visual warning of glove puncture in the presence of fluid by showing a dark green patch around the site of puncture and has been shown to effectively indicate punctures [During a period of six consecutive months from December 2007 to May 2008, gloves from a total number of 20 elective and emergency surgical laparotomies in the Department of General Surgery at the Ernst-Moritz-Arndt University, Greifswald, were analyzed. The indications for laparotomy included: perforations and resections of the gastrointestinal tract n = 17) and lavages for underlying peritonitis (n = 3). Detailed demographic data of the procedures included are summarized in table 7 and lavunctures .There was no directive to surgeons on maximum glove wearing time. Gloves were changed and examined when a perforation was detected by the indicator system or at the end of a procedure. The impermeability of all inner and outer gloves worn was tested according to DIN EN 455-1 immediately after sampling. Gloves with obvious macro-perforations at any time were excluded. The person wearing the glove, their role within the surgical team, the type of surgery, date and the wearing time were documented. Surgical sites were examined by taking one swab from an area inside the situs and at the moment assumed to be most heavily contaminated, and was further processed following standard microbiological methods.To investigate bacterial migration from patients to the hand of the surgical staff through micro-perforations in gloves, the modified and standardized Gaschen-Bag method was used as previously described . BrieflyMicrococcus luteus, enterococci and E. coli were identified.In 20 consecutive surgical operations, 194 gloves  were examined [Figure The intact surgical glove is the most important barrier to protect the patient from microorganisms from the hand of the surgical team and vice versa. The preoperative surgical hand preparation can reduce but not eradicate the resident flora on the surgeon's hands, therefore reducing but not eliminating the risk of transmission of resident organisms into the wound. Conversely, blood-borne pathogens can be transmitted from the patient to the surgeon and endanger surgical team members .The role of glove perforation as risk factor of surgical site infection (SSI) is still not well understood. In a recently published study conducted by Misteli et al., macro-perforations of surgical gloves were found to be a significant risk factor for the development of SSI in cases where prophylactic antibiotics were not administered .Neither the question if of micro-perforations compromise the aseptic barrier nor as a risk factor for SSI has been well studied yet. To our knowledge, Harnoss et al. were the first who described the translocation of microorganisms through undetected micro-perforations under real conditions . Our stuInterestingly, only the surgeon was affected in this study, with his index fingers and thumbs/middle fingers at major risk for bacterial migration Table . ResultsAs we showed previously, the incidence of micro-perforations in surgical gloves depends on the duration of wear . We demoThe results from that study clearly indicate that the risk of micro-perforations and, as a consequence, the loss of protection increases with wear duration. Based on these data, a glove change for the surgeon and the first assistant after 90 minutes and after 150 minutes for the second assistant and the scrub nurse was recommended by the authors. In the meantime, these recommendations have been adopted be the Association of the Scientific Medical Societies in Germany (AWMF) .While our study has several limitations, it encourages safety measures to lower the risk of glove perforation. The possible transmission of pathogens shown here adds only indirect evidence to the role of micro-perforations as a risk factor for SSI. Because this was a single-center study using a single glove brand and including only one type of surgery, the results may not be fully transferable to other settings or glove brands. Essentially, the frequency of micro-perforations, the percentage of translocations, and the relation between wear duration and the number of perforations may vary. Further research should include multicenter studies with clinical endpoints to confirm our results. Nonetheless, high frequencies of perforations in surgical gloves have been repeatedly described in literature, and our findings are supported by results from other groups and settings, as well as by our own group ,8,12-17.Due to ethical and safety considerations, the recommendations given by Partecke et al. and the AWMF for the daily routine in surgical settings should be followed even before final proof is available. These recommendations include a change of gloves after 90 minutes. While our findings support an earlier change, this seems to be a good compromise between safety and feasibility ,18.To improve protection of the whole surgical team and the patient, an alternative for changing gloves after 90 minutes might be an improvement of glove material or the application of double gloving . This beThis study confirms previous results that bacterial migration through unnoticed micro-perforations in surgical gloves does occur under real practical surgical conditions. Undetected perforation of surgical gloves occurs frequently. Bacterial migration from the patient through micro-perforations onto the hand of surgeons was confirmed, limiting the protective barrier function of gloves if worn over longer periods. Preventive measures for lowering the risk of glove perforation can include a change of gloves at least every 90 minutes, the use of double-gloving, or the specific strengthening of predilection sites for punctures, and are therefore strongly recommended.The authors declare a financial competing interest:M\u00f6lnycke Healthcare, Gothenburg, Sweden accepted the costs of the study including the article-processing charge.NOH had the idea for the study and planned and supervised the experiments, drafted the manuscript, and analyzed and interpreted the data. AMG participated in the design of the study and helped to draft the manuscript. NS performed most of the microbiological methods and helped to draft the manuscript. OA participated in the design of the study and helped to draft the manuscript. CDH participated in the study design and coordination, and helped to draft the manuscript. AK participated in the study design and coordination, and helped to draft the manuscript. LIP participated in the design of the study, supervised the experiments, analyzed and interpreted the data, and helped to draft the manuscript.All authors have been involved in drafting the manuscript or revising it critically for important intellectual content and have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/192/prepub"}
{"text": "Tumour stromal neovascularization was investigated in 114 invasive and 20 in situ carcinomas of the uterine cervix by staining representative sections with the specific endothelial marker anti CD31 . A digital image analyser was used to measure the immunoreactivity. The following parameters were determined in the 'hot spots': vessel counts, vessel perimeter and endothelial stained area (expressed per mm2). The results were correlated with clinical and histopathological data. There was no significant relationship between the histopathological findings  and the median vessel count. In a univariate analysis all angiogenesis parameters had prognostic value: a higher vascularity was associated with worse prognosis (P < 0.05). Multiple regression analysis showed that vascular permeation (P < 0.001) and the median vessel count (P = 0.005) were the most important prognostic indicators. In the future these criteria may be used for selection of patients for anti-angiogenesis therapy."}
{"text": "Germ cells arise from a small group of cells that express markers of pluripotency including OCT4. In humans formation of gonadal compartments  takes place during the 1st trimester (6\u20138 weeks gestation). In the 2nd trimester germ cells can enter meiotic prophase in females whereas in males this does not occur until puberty. We have used qRTPCR, Westerns and immunohistochemical profiling to determine which of the germ cell subtypes in the human fetal gonads express OCT4, DAZL and VASA, as these have been shown to play an essential role in germ cell maturation in mice.OCT4 mRNA and protein were detected in extracts from both 1st and 2nd trimester ovaries and testes. In ovarian extracts a marked increase in expression of VASA and DAZL mRNA and protein occurred in the 2nd trimester. In testicular extracts VASA mRNA and protein were low/undetectable in 1st trimester and increased in the 2nd trimester whereas the total amount of DAZL did not seem to change. During the 1st trimester, germ cells were OCT4 positive but did not express VASA. These results are in contrast to the situation in mice where expression of Vasa is initiated in Oct4 positive primordial germ cells as they enter the gonadal ridge. In the 2nd trimester germ cells with intense cytoplasmic staining for VASA were present in both sexes; these cells were OCT4 negative. DAZL expression overlapped with both OCT4 and VASA and changed from the nuclear to the cytoplasmic compartment as cells became OCT4-negative. In males, OCT4-positive and VASA-positive subpopulations of germ cells coexisted within the same seminiferous cords but in the ovary there was a distinct spatial distribution of cells with OCT4 expressed by smaller, peripherally located, germ cells whereas DAZL and VASA were immunolocalised to larger (more mature) centrally located cells.OCT4, DAZL and VASA are expressed by human fetal germ cells but their patterns of expression are temporally and spatially distinct. In the 1st trimester OCT4 was detected in most germ cells. In the 2nd trimester the onset of expression of VASA was associated with the formation of oocytes and spermatogonia both of which were OCT-4 negative. Relocation of DAZL from nucleus to cytoplasm paralleled the down regulation of OCT4 and the onset of expression of VASA. These data reveal similarities between the expression of key regulatory proteins within germ cells as they mature in male and female fetal human gonads suggesting that in the female these maturational changes are not determined by entry into meiosis. Germ ceiewed in ). Withiniewed in ) and NANiewed in  and humaiewed in ,7. We harimester . In prevrimester ; howeverDazl, an RNA binding protein that is a member of a conserved gene family members of which include BOULE and DAZ [Mvh (mouse Vasa homologue) a gene that encodes an RNA helicase which is specific to the germ cell lineage [Dazl mRNA is first detectable in post-migratory germ cells on e11.5 [Dazl gene results in germ cell loss in both males and females [Dazl -/- females germ cell loss occurred in fetal ovaries at the time of meiotic entry and adult ovaries did not contain oocytes [Dazl -/- males the pattern of germ cell loss is variable and in some studies has been reported to occur during fetal life [Studies in knockout mice have identified a number of genes the expression of which is critical for germ cell survival and functional maturation in both ovary and testis. One such gene is  and DAZ ,11. A se lineage . In miceon e11.5  and the on e11.5 . Targete females . In Dazl oocytes ,15. In Dtal life ,16 or ental life .VASA is a member of the DEAD box family of genes first identified in Drosophila where it was shown to be essential for female germ cell development [Mvh ovarian function appeared normal but males were infertile with demise of germ cells at the zygotene stage of meiosis [elopment . In mice meiosis . Mvh has meiosis ,19,20. I meiosis . First tIn the present paper we have extended our studies on the germ cell subpopulations within the human fetal ovaries and testes to determine when and where DAZL and VASA proteins are expressed and have performed co-staining for OCT4 as this is commonly used to delineate the germ 'stem cell' population ,22,23. TOCT4 mRNA was detected in both the 1st and 2nd trimester samples with a slight, but non-significant decrease in the older samples . In the testis, OCT4 and DAZL mRNAs were detectable in both 1st and 2nd trimester with no significant difference between ages  although this was less marked than that seen in ovarian samples  which was particularly striking in the ovarian samples . In the 2nd trimester, OCT4 positive germ cells were located at the periphery of the ovary whereas the most intense immunoexpression of VASA was detected in the cytoplasm of OCT4 negative germ cells (oogonia) located in nests Figure . As in tThe above data suggested that expression of DAZL and VASA was similar but not identical, in both ovary and testis. This was directly investigated by dual immunohistochemistry for DAZL and VASA in the 2nd trimester Figure . This idIn the ovarian samples the pattern of expression was further investigated by measuring germ cell diameter at 3 representative gestations  as our previous studies have established that cell diameter provides an indication of the maturational status of the human fetal female germ cell . This dein vitro can spontaneously enter meiosis emphasising the common developmental potential of the germ cells in the two sexes and the critical role played by the testicular environment in modifying germ cell fate [Germ cells within the male and female gonads develop from an apparently homogeneous bi-potential population of PGC. In both male and female human fetal gonads germ cells initially proliferate but thereafter their fates diverge with female germ cells entering meiotic prophase as early as 11 weeks gestation  whereasell fate ,26.DAZL and VASA was compared to OCT4 as studies in knockout mice have reported that both genes are essential for germ cell maturation in that species [in vitro remains unresolved . In theiewed in ,30. In trm cells .Co-incident and overlapping patterns of expression of these germ cell specific proteins were revealed by fluorescent co-immunolocalisation on fixed specimens from a range of gestational ages. Previous studies have immunolocalised DAZL in a small number of samples recovered in the 2nd trimester -34 but wDAZL is important for normal functioning of the human germ line. The first study reported a strong association between several common single nucleotide polymorphisms (SNPs) and age at menopause in a sample population of 324 women [DAZL (Arg to Gly at 115) in a region of the protein critical for RNA binding [DAZ gene on the Y chromosome, deletions of which have been frequently documented as a cause of male infertility [DAZL (Asn 10 Cys) was reported to be azoospermic [Two studies on human populations have provided preliminary evidence that expression of 24 women . In a se binding . The sitertility . Howeverospermic .VASA between 9 and 14 weeks gestation suggested to us that this was coincident with the entry of female germ cells into meiosis. However increases in both protein and mRNA were also demonstrated in male germ cells suggesting that the onset of expression of VASA was associated the maturation of the gonocytes into prespermatogonia rather than meiotic entry per se. In the ovary VASA was detected in the cytoplasm of in slightly larger, more mature germ cells than DAZL, and was also present in oocytes within primordial follicles. Previous studies that have detected expression of VASA in cytoplasm of germ cells within the fetal ovary and testes at 17 weeks gestation [st trimester and provides a useful method for identifying the different populations of germ cells present within the 2nd trimester gonads.The marked increase in expression of estation ,37. Co-sMvh mRNA has revealed a number of putative Dazl-binding sites that are conserved between human, rat and mouse [VASA although further studies are required preferably using isolated human germ cells. DAZL has also been implicated in the regulation of other conserved germ-cell RNA-binding proteins including PUM2 [Pumilio that is required for maintenance of germ line stem cells in Drosophila and Caenorhabditis elegans.Examination of the 3' UTR of the nd mouse . Our dating PUM2 , the humOCT4 expression in the less mature germ cells  to VASA expression in the more mature germ cells . In testicular samples germ cells at different stages of maturation co-exist within the same seminiferous cords. Both male and female germ cells showed a similar pattern of change with development, despite the onset of meiosis in the female but not in the male, suggesting that although increases in expression of DAZL and VASA in the ovary may be related to meiotic entry there are underlying developmental patterns common to both sexes.By documenting the differential and partially overlapping patterns of expression of OCT4, DAZL and VASA proteins in the human fetal ovary and testis we have gained new insight into parallels in the maturation of germ cells in these two organs. Our findings clearly demonstrate changes in overall germ cell maturation with increasing gestation, and indicate a switch from SRY gene as detailed in [Human fetal gonads were obtained following termination of pregnancy during the first  and 2nd trimesters . Women gave written consent according to national guidelines  and the ailed in . Testes Total RNA was extracted from fetal gonads using the RNeasy Mini Kit  for mid trimester gonads and the RNeasy Micro Kit for 1st trimester gonads  The RNA was primed for reverse transcription with oligo(dT) primer  at 65\u00b0C for 10 min. The entire reaction was added to a total volume of 38 \u03bcl containing dNTP to 1 mmol/l, dithiothreitol (DTT) to 10 mmol/l, 1\u00d7 Expand Reverse Transcriptase (RT) buffer and 120 IU RNasin ribonuclease inhibitor . One half (19 \u03bcl) of this reaction was added to 1 \u03bcl water (RT negative reaction) to act as a negative control to confirm the effiency of the DNase treatment. Fifty IU of Expand Reverse Transcriptase (Roche Diagnostics Ltd) was added to the remaining 19 \u03bcl (RT positive reaction) and both reactions were incubated for 1 h at 42\u00b0C. Reactions were stored at -20\u00b0C until required.\u00aeSYBR Green qPCR SuperMix-UDG . Amplification was continued for 45 cycles with signal acquisition at 84\u00b0C after each round of extension. Following amplification, continuous melt curve analysis was performed to ensure product accuracy and samples were analysed by agarose gel electrophoresis (data not shown) to confirm product size. Primer sequences are given in Table GAPD, OCT4, DAZL and VASA were derived by making a series of dilutions (1 in 5 to 1 in 10000) of first-strand cDNA from a mid trimester ovary. The number of cycles needed to yield a fluorescent signal above background  at each dilution was plotted against the log of relative concentration using LightCycler Software . The dilutions yielded a straight line for each product, confirming that Cp is a good indicator of target concentration across at least 2 orders of magnitude. The slopes of these curves are a measure of the efficiency of the PCR, which gave an amplification rate of 1.8-fold/cycle for GAPD and DAZL, and 1.7-fold/cycle for OCT4 and VASA. All gene amplification reactions were performed in triplicate. Calculations of mRNA concentration were made relative to GAPD.Quantitative real-time RT-PCR was performed using the Lightcycler (Roche Diagnostics Ltd) as described previously . ReverseFetal gonads were homogenised in 1\u00d7 RIPA buffer containing: 25 mM Tris, 1% Triton, 0.05% sodium deoxycholate, 0.1% SDS and 150 mM NaCl. Total protein was measured using the Protein Assay DC Kit from Bio-Rad . Samples were denatured in 1\u00d7 reduced sample buffer containing: 625 mM Tris (pH 6.8), 5% glycerol, 2% SDS, 0.0025% bromophenol Blue, 2.5% \u03b2-mercaptoethanol and 5 \u03bcg of total protein was loaded onto individual wells in a SDS-PAGE gel made with 10% (w/v) acrylamide; samples of pre-stained protein size markers were run on each gel . Following separation of proteins they were transferred onto PVDF Immobilon-Fl membranes ; non-specific binding sites were blocked by incubating membranes in Odyssey blocking buffer . All membranes were incubated with primary antibodies diluted in Odyssey blocking buffer overnight at 4\u00b0C. Proteins were detected using rabbit-anti-VASA  diluted 1 in 500 together with mouse anti-\u03b2 tubulin  diluted 1 in 300, mouse anti-DAZL  diluted 1 in 500, with rabbit anti-\u03b2-tubulin  diluted 1 in 1000, or with goat anti-OCT4 (Santa Cruz) together with rabbit anti-\u03b2-tubulin (Santa Cruz) diluted 1 in 1000. Membranes were washed in PBS containing 0.1% Tween and bound antibodies were detected using fluorescently labelled secondary antibodies: goat anti-rabbit 680  and goat anti-mouse 800  for VASA and \u03b2-tubulin respectively; goat anti-mouse 680  and goat anti-rabbit 800  for DAZL plus \u03b2-tubulin; while OCT4 and \u03b2-tubulin, were detected using donkey anti-goat 680  and goat anti-rabbit 800 . Secondary antibodies were all diluted 1 in 10000 in Odyssey blocking buffer and incubated for 1 h at room temperature; bound fluorescent secondary antibodies were visualised using a LI-COR-Odyssey Infrared Imager .Immunolocalisation was carried out using standard methods . BrieflyThree representative non-adjacent tissue sections from ovaries at gestational ages 14, 16 and 19 weeks immunostained for DAZL and VASA were analysed. The cell diameter of all immunopositive germ cells on each section was calculated as the average of two orthogonal measurements and classified as expressing DAZL, VASA or both. Data were analysed by analysis of variance with Tukey-Kramer post hoc testing.RAA and PTKS designed the study and wrote up the manuscript. GC and NF performed QRTPCR, Western and immunohistochemical analysis and acquired images on the confocal microscope. SC performed tissue collections. All authors read and approved the final manuscript."}
{"text": "DAZ-like (DAZL) gene located on the short arm of autosomal chromosome 3 (3p24), an essential master gene for the premeiotic development of male and female germ cells, is the father of the Y-chromosome DAZ gene cluster and encodes for RNA-binding proteins. Reported instances of positive association of DAZL gene mutations with infertility in men have been found in a Taiwanese population but not in Caucasians. There is no study from Tamil Nadu, South India, to demonstrate the role of DAZL gene in male infertility; we, therefore, analyzed a total of 287 men, including 147 infertile and 140 normozoospermic fertile controls from rural areas of Tamil Nadu, South India, to assess the phenotypic effect of DAZL mutations in this region of the world. Interestingly, all our samples showed absence of the A386G (T54A) mutation that was found to be associated with spermatogenic failure in the Taiwanese population. Therefore, we suggest that the A386G (T54A) mutation is not associated with male infertility in Tamil Nadu, South India.The  Male infertility accounts for ~50% of the cases, with quantitative or qualitative abnormalities of sperm production leading to spermatogenic failure. Genetic abnormalities, as well as numerical and structural chromosomal abnormalities, have been identified in men with unexplained oligozoospermia  in the so-called AZFc (AZoospermia Factor c) region. Among cases with Yq microdeletions, deletion involving the DAZ gene family is the most frequent finding. The DAZ gene is believed to have been transposed to the Y chromosome during primate evolution after the divergence of the New World and Old World monkeys, i.e. 35 \u00d7 106 years ago,[DAZL) located on the short arm of autosomal chromosome 3 (3p24), arose ~30-40 million years ago. DAZL is highly homologous to the DAZ gene clustered on the Y chromosome, with 83% similarity in the coding region of the cDNA.[DAZ and DAZL are transcribed exclusively in the germ line and encode RNA-binding proteins of the highly conserved RNA-recognition motif (RRM) class. The DAZL gene has been demonstrated to be an essential master gene for the premeiotic development of male and female germ cells.[The ome Yq11.3 in the ome Yq11.3 in the ome 3 3p2, arose ~et al,[DAZL gene may be responsible for spermatogenic defects in some cases and that the genetic defect is inherited in an autosomal recessive fashion.[DAZL gene in some infertile patients in a Taiwanese population was observed by Teng et al.[DAZL gene mutations with infertility in men.Lilford et al, suggeste fashion. A mutating et al. There arDAZL plays a crucial role in spermatogenesis in humans merits investigation. There has been no study on infertile men from Tamil Nadu, South India, that has attempted to demonstrate the role of DAZL gene in male infertility. We, therefore, analyzed 147 infertile and 140 normozoospermic fertile controls from rural areas of Tamil Nadu, South India, to assess the phenotypic effect of DAZL mutations.Whether This study was conducted on subjects attending infertility clinics in Erode and Nilgiris Districts of Tamil Nadu, South India. We collected samples of blood from 45 infertile men, semen samples from 72 infertile men, and paired samples (blood and semen of the same patient) from 30 infertile men; 140 normozoospermic (> 20 million sperms / ml of semen) males (10 paired samples) of proven fertility served as controls. All the procedures followed were in accordance with the ethical standards of the Center for Cellular and Molecular Biology, Hyderabad.Semen samples were obtained by masturbation on two different occasions, separated by a 3-week interval, following a 3-day period of sexual abstinence. Semen samples were allowed to liquefy for 30 min at 37\u00b0C. Sperms in the ejaculates were analyzed for their motility, number, and morphology as per the guidelines of the WHO, 1999. Written DAZL were designed and synthesized . DNA samples were analyzed for the presence of the exon 3 of DAZL by polymerase chain reaction (PCR) in a 0.2-mL thin-wall tube under the following conditions: 50 ng of DNA, 1.2 mM MgCl2, 200 \u00b5M dNTPs, 5.0 pMol of each specific primer, and 1 IU AmpliTaq Gold in a 10 \u00b5L reaction volume. Amplification was carried out in a MJ Research Thermal Cycler  using the following cycling conditions: after an initial denaturation step at 94\u00b0C for 5 min, cycle parameters were 94\u00b0C for 1 min, 60\u00b0C for 1 min, and 72\u00b0C for 60 sec for 30 cycles, with a final extension of 72\u00b0C for 10 min. Amplified products were quantified by 2% agarose gel electrophoresis.DNA was extracted from 10 ml of peripheral blood and fromet al.[DAZL sequences of the infertile and normozoospermic fertile control men were edited and compared with the reference sequence using AutoAssembler\u2122 software .PCR products were optimized for sequencing.et al. Purified6 spermatozoa / ml), 50 asthenozoospermic (> 60% of nonmotile sperms), 24 oligoasthenozoospermic, and 1 each of varicocele , azoospermic (no sperms in the ejaculate), teratozoospermic , and necrozoospermic (100% dead sperms) infertile men. Analysis of exon 3 of the DAZL gene in a total of 287 men, including 147 infertile and 140 normozoospermic control men of Tamil Nadu, South India, revealed the complete absence of the previously reported A386G mutation in the DAZL gene. DAZL gene showing homozygous wild-type (A/A) allele at position 386.The seminogram of 147 infertile men ranged from azoospermia to oligozoospermia. There were 69 oilgozoospermic  of exon 2, which was seen in 3.5% and 2.59% of infertile and fertile men, respectively. Another variant was A386G, with a change of threonine to alanine (T54A) in exon 3, which was seen in 7.39% of the infertile and 0.86% of the fertile men. Thangaraj et al,[DAZL gene in an Indian population comprising people of different ethnic / linguistic origins: A260G (T12A) of exon 2 in 8.1% and 7.4% of the infertile and fertile control men, respectively, and A437G polymorphism in four fertile and one infertile man. Another variant, A386G, leading to a change of threonine to alanine (T54A) in the exon 3, was not found in infertile men or fertile controls in the Indian subcontinent. Similarly, our study on 147 infertile men and 140 normozoospermic fertile control men from rural areas of Tamil Nadu, South India, belonging to Dravidian linguistic family, for exon 3 showed complete absence of A386G (T54A) mutation in both infertile and fertile normozoospermic control men.In humans some very limited studies have been carried out on the ng et al, identifiaj et al, reportedet al.[et al.[et al.[et al.[DAZL gene may not be associated with male infertility in the Indian subcontinent. Our study on infertile and fertile normozoospermic men of Tamil Nadu, South India, revealed complete absence of the T54A mutation in exon 3 of DAZL. Therefore we suggest that the A386G (T54A) mutation is not associated with male infertility in Tamil Nadu, South India.Three independent studies conducted recently also did not find the T54A mutation in Caucasian populations.\u201316 Similet al. The distl.[et al. As the Tl.[et al. suggestel.[et al. suggeste"}
{"text": "Herpesviridae, little information is available about the function of the two proteins. In this study, the C-terminus of DEV UL26 protein (designated UL26c), which contains the whole of UL26.5, was expressed, and the recombinant UL26c protein was used to immunize BALB/c mice to generate monoclonal antibodies (mAb). The mAb 1C8 was generated against DEV UL26 and UL26.5 proteins and used subsequently to map the epitope in this region. Both the mAb and its defined epitope will provide potential tools for further study of DEV.The Unique Long 26 (UL26) and UL26.5 proteins of herpes simplex virus are known to function during the assembly of the viruses. However, for duck enteritis virus (DEV), which is an unassigned member of the family 520IYYPGE525, which was located at the C-terminus of the DEV UL26 and UL26.5 proteins, was identified by mAb 1C8. The result of the ELISA showed that this epitope could be recognized by DEV-positive serum from mice. The 520IYYPGE525 motif was the minimal requirement for reactivity, as demonstrated by analysis of the reactivity of 1C8 with several truncated peptides derived from the motif. Alignment and comparison of the 1C8-defined epitope sequence with those of other alphaherpesviruses indicated that the motif 521YYPGE525 in the epitope sequence was conserved among the alphaherpesviruses.A mAb (designated 1C8) was generated against the DEV UL26c protein, and a series of 17 partially overlapping fragments that spanned the DEV UL26c were expressed with GST tags. These peptides were subjected to enzyme-linked immunosorbent assay (ELISA) and western blotting analysis using mAb 1C8 to identify the epitope. A linear motif, 520IYYPGE525. The mAb and the identified epitope may be useful for further study of the design of diagnostic reagents for DEV.A mAb, 1C8, was generated against DEV UL26c and the epitope-defined minimal sequence obtained using mAb 1C8 was  UL26.5. This protein is present in the B-capsids of the HSV-1 assembly but is absent after the completion of DNA encapsidation and is not found in the mature virion [Herpesviruses exist widely in nature. The genomes of herpesviruses consist of linear double-stranded DNA; they differ in size (from approximately 124 to 235 kb), sequence arrangement and base composition . B-capsie virion .Herpesviridae [Anseriformes. DVE is a form of hemorrhagic enteritis that occurs in captive or free-flying waterfowl [Duck enteritis virus (DEV), an unassigned member of the family sviridae , is the aterfowl  and causaterfowl . The DEVaterfowl . CurrentUL26 and UL26.5, two nested in-frame genes, encode a capsid maturation protease and the minor capsid scaffold protein of DEV [The DEV has a linear double-stranded DNA genome of approximately 180 kb with a G+C content of 64.3% . The genn of DEV .B-cell epitopes are antigenic determinants that are recognized and bound by membrane-associated receptors on the surface of B lymphocytes . They caUL26 gene  of DEV, we used prokaryotic expression of the C-terminal 360-amino acid (348-707aa) protein in E. coli BL21 (DE3) after induction by Isopropyl-\u03b2-D-thiogalactopyranoside (IPTG) and termed the recombinant protein UL26c. Western blotting using murine antibody against DEV showed that UL26c could react with DEV antibody  infected with DEV , was used as an antigen to react with mouse anti-DEV antibody in this study. The results of both western blotting and ELISA showed that this peptide defined by mAb 1C8 could react with murine anti-DEV antibody , and smaller amounts of VP24 and VP21, the products of the UL26 gene. The UL26 and UL26.5 genes are expressed as 3'-coterminal transcripts, and the promoter for the UL26.5 gene is located within the coding region of the UL26 gene in HSV-1 [UL26 gene encodes a self-cleaved protease that generates the capsid proteins VP21 and VP24 [UL26.5 gene encodes the scaffold protein VP22a [UL26.5 gene, and itself, at a site 25 amino acids from the C terminus of its product [Herpesviridae and, to date, there has been no report of the structure and function of proteins UL26 and UL26.5 in DEV. It has been reported that the genes UL26 and UL26.5 in DEV are similar to their homologues in other alphaherpesviruses [Formation of the herpesvirus capsid is the first step in viral morphogenesis. The capsid of HSV-1 is found in the mature virions and in the nuclei of infected cells from which they originate. There are three distinct types of capsid, A-, B- and C-capsids, in infected cells . The B-cin HSV-1 -29. The and VP24 . Cleavagand VP24 . The UL2in VP22a , which hin VP22a . The B-cin VP22a . The UL2 product . DEV is sviruses . It has UL26 gene. Figure UL26 and UL26.5 by the alignment of the homologous in HSV-1. The DEV UL26 gene encodes a deduced protein of 707 amino acids [UL26.5 gene is in frame with UL26; therefore, the UL26.5-encoded proteins possess the same M site as the UL26 protein. Consequently, we hypothesized that the six bands detected using western blotting in this study may indicate the six products of UL26 and UL26.5.In this study, we expressed the C-terminus of DEV UL26 and immunized mice with both recombinant protein UL26c and the DEV particles, using a prime-boost protocol, and one mAb (1C8) was generated by cell fusion. Interestingly, six bands were detected in DEV-infected CEFs in western blotting analysis using mAb 1C8 in this study Figure . These mno acids . Comparino acids , which a520IYYPGE525, because any deletion of residues from either end of 520IYYPGE525 destroyed the ability of mAb 1C8 to bind. Comparative analysis of the amino acid sequences of the identified epitope with those of another 14 alphaherpesviruses revealed that the C-terminus of the linear B-cell epitope 521YYPGE525 is conserved among the selected alphaherpesviruses, except PRV, VZV and ILTV. It has been reported previously that the motif YYPGE is conserved in the scaffold proteins of alphaherpesviruses [in vitro but had a specific effect on incorporation of the portal. This indicated that this deletion had blocked DNA packing but had not interfered with the assembly of B-capsids [A series of 17 fragments that spanned the UL26c protein were expressed with a GST tag in this study, and used to screen for the minimal epitope recognized by mAb 1C8 using western blotting and ELISA. It was demonstrated that the minimal sequence of the epitope defined by mAb 1C8 appeared to be sviruses . It was -capsids ,34. Therin vitro neutralization test showed that mAb 1C8 could not neutralize the infectivity of DEV. The absence of neutralizing activity against DEV might indicate that this region has low immunogenicity or, more probably, that this region is not exposed on the surface of the virion. Indeed, the products of the HSV-1 UL26 gene are components of viral capsids, which are located inside of the viral tegument and envelope, while the products of the UL26.5 gene are components of B-capsids [UL26.5 gene, which also contains the sequences of the epitope defined by 1C8.The result of the -capsids . The pro-capsids . The B-c-capsids  and the The mAb 1C8 and its epitope, which was defined in this study, may prove to be very useful tools for the development of immunity-based therapeutic and diagnostic techniques for DEV, although the mAb lacked neutralizing ability.In this study, we generated a mAb, 1C8, and identified a novel linear B-cell epitope on the DEV UL26 and UL26.5 proteins using this mAb. The identified epitope and mAb 1C8 may increase our understanding of the function and location of the UL26 and UL26.5 proteins in DEV. It will also be a potential tool for the design of diagnostic reagents for DEV.2 atmosphere at 37\u00b0C. Chicken embryo fibroblasts (CEF) were prepared from 9- to 11-day-old specific-pathogen-free (SPF) embryonated eggs according to standard procedures. The DEV Clone-03 strain was purified from a commercial Chinese DEV vaccine using the plaque assay, as described previously [The SP2/0 cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM)  supplemented with 10% fetal bovine serum (FBS)  and 1% penicillin-streptomycin in a humidified 5% COeviously . The vireviously .UL26 gene, we expressed a fragment of 1083 bp at the C-terminus of the DEV UL26 gene (UL26c) by amplifying the gene fragment from DEV Clone-03. The sequences and locations of the primers used for amplification and expression of the gene in this study are shown in Table Given that it is difficult to induce prokaryotic expression of the full E. coli BL21 (DE3) . A series of fusion proteins with the expected molecular weights were induced by IPTG and stained with Coomassie blue after SDS-PAGE as described previously [After construction, each recombinant expression construct was transformed into eviously . For preThree 8-week-old BALB/c mice were primed subcutaneously with DEV virus particles mixed with an equal volume of Freund's complete adjuvant , followed by two boosts of immunization with the recombinant protein UL26c. The protocols used for the preparation of mAbs and ascitic fluid have been described previously ,38. All The specificity and reactivity of the mAb 1C8 were also determined by western blotting using recombinant UL26c protein and CEF infected by DEV, respectively. Purified recombinant UL26c protein, truncated proteins and DEV in CEF were separated by denaturing SDS-PAGE. For western blotting, all the proteins and the virus were transferred onto nitrocellulose membranes, and detected as described previously . PurifieThe reactivity of the mAb with different truncated recombinant UL26 proteins was determined further by ELISA as described previously . BrieflyThe mAb 1C8 was tested for the presence of DEV-neutralizing antibodies. The CEF lysates containing DEV were mixed with ascites fluid containing mAb 1C8 and incubated at 37\u00b0C for 1 h; unrelated ascites fluid and PBS, used as negative controls, were treated in the same way. The mixture was added to the prepared CEF and incubated at 37\u00b0C. After 2 h of incubation, the mixture was removed and the cells were overlaid with 1% low-melting-point agarose containing 8% FBS. At 72 h post-incubation, the cells were overlaid again with 1% low-melting-point agarose containing 0.1% Ponceau. After further incubation at 37\u00b0C for 24 h, the plaques were counted and compared.To investigate whether the peptides could be recognized by anti-DEV antibody, the epitope peptide F12 was purified and used as antigen to coat ELISA plates (10 \u03bcg/well) to react with mouse anti-DEV antibody and mouse sera, respectively. Purified rGST was used as the negative control for F12. In addition, the purified F12 and rGST were also used to detect the reactivity of the epitope peptide by western blotting.Alphaherpesvirinae using the MEGALIGN program in Lasergene (DNAStar) with CLUSTAL W multiple alignments, as described previously [The mAb 1C8-defined epitope sequences and flanking sequences of DEV were compared with those of 14 other selected herpesviruses of the eviously . The 14 The authors declare that they have no competing interests.XL, SL and XK designed research; XL, ZH, YS and DY performed research; XL, SL, XK, HL and YW analyzed data; and XL, SL and XK wrote the paper. All authors read and approved the final manuscript."}
{"text": "Neisseria are of importance to human disease and health. Neisseria meningitidis is a major cause of meningitis, while Neisseria gonorrhoeae is the agent of the sexually transmitted disease gonorrhea and Neisseria lactamica is a common, harmless commensal of children. Comparative genomics have yet to yield clear insights into which factors dictate the unique host-parasite relationships exhibited by each since, as a group, they display remarkable conservation at the levels of nucleotide sequence, gene content and synteny. Here, we discovered two rare alterations in the gene encoding the CcoP protein component of cytochrome cbb3 oxidase that are phylogenetically informative. One is a single nucleotide polymorphism resulting in CcoP truncation that acts as a molecular signature for the species N. meningitidis. We go on to show that the ancestral ccoP gene arose by a unique gene duplication and fusion event and is specifically and completely distributed within species of the genus Neisseria. Surprisingly, we found that strains engineered to express either of the two CcoP forms conditionally differed in their capacity to support nitrite-dependent, microaerobic growth mediated by NirK, a nitrite reductase. Thus, we propose that changes in CcoP domain architecture and ensuing alterations in function are key traits in successive, adaptive radiations within these metapopulations. These findings provide a dramatic example of how rare changes in core metabolic proteins can be connected to significant macroevolutionary shifts. They also show how evolutionary change at the molecular level can be linked to metabolic innovation and its reversal as well as demonstrating how genotype can be used to infer alterations of the fitness landscape within a single host.Three closely related bacterial species within the genus  N. meningitidis, N. gonorrhoeae and N. lactamica exclusively colonise mucosal surfaces in humans. While N. gonorrhoeae leads to gonorrhea, the other two species persist mainly in their host in the absence of disease. N. meningitidis does occasionally cause severe, life threatening illness, however. Little is known about the factors and elements that dictate the unique human interactions exhibited by each species. Moreover, the evolutionary relationships between these species are poorly characterized. Here, we describe two successive alterations in a single gene that can be linked first to all species within the genus Neisseria and then the species N. meningitidis. We also show these signature alterations have phenotypic consequences by affecting core respiratory metabolic processes. These findings have significant implications for the evolution of related bacterial species within a single host and provide a novel perspective on the episodic and reversible nature of innovative adaptation.The closely related bacterial species  Neisseria comprises Gram-negative, oxidase-positive diplococci that are frequently isolated from the mucosal surfaces of humans and two closely related species are important pathogens of man Neisseria gonorrhoeae is the etiologic agent of gonorrhea that remains one of the most common sexually transmitted diseases contributing to worldwide morbidity, mortality and infertility. Although treatable with antibiotics, no vaccine is currently available against the gonococcus. Neisseria meningitidis is primarily a commensal of the human oropharynx that, under incompletely understood circumstances, causes invasive disease and meningitis. Most cases of meningococcal disease are caused by clonal complexes of related sequence types (STs), the so-called hyper-invasive lineages The genus N. gonorrhoeae and N. meningitidis display remarkable conservation and uniformity at the levels of coding sequences, gene content and synteny. Nonetheless, comparative genome analyses have identified genes and gene clusters unique to either N. gonorrhoeae or N. meningitidis but few if any of the corresponding products can be specifically connected to the differential host interactions observed. A prime example of this situation would be the genes required for biosynthesis of polysaccharide capsule, which is essential to systemic meningococcal disease, and that are absent in N. gonorrhoeae. However, only a limited subset of capsular serogroups is associated with disease and 16\u201320% of meningococcal carriage isolates do not possess these genes N. meningitidis but how this element might relate to speciation or specifically to meningococcal biology remains unclear N. meningitidis and N. gonorrhoeae are further complicated by the existence of the closely related species Neisseria lactamica, a harmless commensal found predominantly in the upper respiratory tracts of infants and children N. meningitidis in which carriage is low during infancy and rises to high levels in adolescents and young adults, carriage of N. lactamica is high in young children but declines with age N. gonorrhoeae and N. meningitidis were identified iga1 and pptA genes encoding an extracellular endopeptidase and a protein targeting phosphoethanolamine transferase Despite their differing host interactions, mechanisms of transmission and ecology, N. gonorrhoeae and N. meningitidis are most consistent with allopatric divergence from a single common ancestor. Such a model was first proposed by Vazquez and colleagues based on the relatively reduced diversity of N. gonorrhoeae strains measured by multilocus enzyme electrophoresis (vs N. meningitidis) of house keeping genes and the fact that the primary niche for all human Neisseria species other than N. gonorrhoeae is the oropharynx N. gonorrhoeae arose as a clone of N. meningitidis that could colonize the urogenital tract. Prolonged physical isolation, niche specialization and genetic isolation would thus have driven speciation. This model was further supported by the analyses of the porA gene (encoding the class 1 outer membrane porin protein PorA) that is found in all strains of N. meningitidis and N. gonorrhoeae but absent in N. lactamica and other commensal Neisseria species N. gonorrhoeae examined to date carry an identical frameshift mutation that disrupts the integrity of the porA ORF Neisseria, ggt and adhC (encoding gamma-glutamyl transpeptidase and S-nitrosoglutathione oxidoreductase respectively), are also intact in N. meningitidis but inactivated due to frameshift mutations in N. gonorrhoeaeN. gonorrhoeae denotes descent from an organism carrying active forms of the genes, it remains unknown how extant isolates of N. meningitidis and N. gonorrhoeae might relate to such an ancestral population. Despite the potentially confounding contributions of shared ancestry and genetic exchange, a recent study utilizing multilocus sequence typing (MLST) demonstrated the ability to readily categorize isolates of N. meningitidis, N. gonorrhoeae and N. lactamica into three distinct species The highly conserved genetic structure and human host restriction observed for c oxidases have been implicated in major evolutionary transitions in anthropoid primates and carnivorous plants Neisseria genomes is of the c-family or cytochrome cbb3 oxidase type cbb3 oxidases consist of four subunits encoded by tandemly arranged genes (B) where dioxygen is reduced c-type cytochromes believed to channel electrons to the dinuclear center cbb3 oxidase in some organisms has a high affinity for oxygen and is often associated with growth under conditions of oxygen-restriction N. gonorrhoeae and N. meningitidis inhabit niches associated with low oxygen tension cbb3 oxidases couple oxygen reduction to translocating protons across the inner membrane such that metabolic energy is conserved for subsequent ATP synthesis Oxygen reductase members of the heme-copper superfamily act as terminal oxidases in all domains of life and play a central role in aerobic energy generation and conservation ed genes  [23]. CcN. gonorrhoeae and N. meningitidis also possess a truncated denitrification pathway in which nitrite (NO2\u2212) is first reduced to nitric oxide (NO) by NirK (AniA) that is then reduced to nitrous oxide (N2O) by NorB nirK and norB genes are differentially controlled by a number of transcriptional regulators that are responsive to changes in the levels of oxygen, NO2\u2212 and NO N. gonorrhoeae and N. meningitidisN. gonorrhoeae and N. meningitidis is their highly recombinogenic nature that results from inter- and intraspecies genetic exchange Neisseria species, this largely restricts imports to donors from within the genus. In the particular case of N. meningitidis, interspecies recombination at numerous loci encoding surface antigens has been widely documented N. gonorrhoeae, N. meningitidis and N. lactamica species represent cohesive, differentiated entities Neisseria species remains poorly understood. Moreover, it remains unclear what genetic elements dictate the unique human interactions exhibited by each species.A cardinal feature of N. meningitidis as it is found in all strains examined and absent from all isolates of N. gonorrhoeae and N. lactamica and of other commensals tested. Although this mutation results in the truncation of an essential component of the cytochrome cbb3 oxidase, the sole neisserial respiratory oxidase, it conditionally affects nitrite consumption by the nitrite reductase that functions in the denitrification pathway. These findings provide evidence that an alteration in the circuitry of respiratory electron-transfer networks is associated with N. meningitidis speciation.Rare genomic changes, signature mutations occurring in the genomes of particular clades, have frequently been employed to resolve phylogenetic uncertainties O-linked protein glycosylation system in N. gonorrhoeae strain MS11 c-type cytochrome domain architecture as opposed to the di-heme form found in all other CcoP proteins (as annotated by possessing the IPR004678 domain of the InterPro database)  to that in N. gonorrhoeae save for the presence of transitional substitution in codon 366 (CAG to TAG resulting in a premature stop codon). The N. meningitidis forms would then be predicted to be truncated at the end of the AlaSerPro-rich, low complexity region (LCR) that separates the second and third c-type heme domains and encompasses the glycan attachment site ccoP from 78 additional N. meningitidis isolates used in this study  . When this study  further  species . Thus, tccoP genes using the majority rule consensus tree constructed with Clonalframe revealed five distinct branches corresponding to each of the Neisseria species: N. meningitidis, N. gonorrhoeae, N. lactamica and other Neisseria including N. cinerea, N. polysaccharea, N. sicca, N. subflava and N. flavescens further differentiating these isolates from one another. Within each clade, ccoP genes were well conserved  although ccoP genes belonging to commensal isolates other than N. lactamica were much more diverse (p-distance\u200a=\u200a0.165)  . This wa=\u200a0.165)  where synalFrame .N. meningitidis, we sought to determine what phenotypic consequences might ensue from such an alteration. We therefore took a comparative approach to addressing this point by constructing strains of N. meningitidis MC58 expressing the tri-heme CcoP form found in N. gonorrhoeae and strains of N. gonorrhoeae VD300 expressing the truncated di-heme form from N. meningitidis . Like CcoP, c5 is predicted to be membrane-associated and also possesses an AlaSerPro-rich LCR that encompasses the attachment sites of its O-linked glycan between its two c-type heme domains N. meningitidis, a tetracycline resistance gene cassette insertion mutation in cycB that disrupts the integrity of the ORF distal to the first heme domain was shown to abolish nitrite reduction and nitrite-dependent growth under microaerobic conditions N. gonorrhoeae, a cycB null mutation was reported to result in increased sensitivity to growth inhibition by excess oxygen and small decreases in respiratory capacity c5 is a prime candidate to act as an electron carrier in pathways ultimately targeting both cytochrome cbb3 oxidase and NirK.In another approach, BLAST searches were performed using the third heme encompassing domain immediately C-terminal of the major AlaSerPro-rich LCR in c5 and the tri-heme CcoP form, we examined what genetic interactions might exist between cycB and the different ccoP alleles with regard to the truncated dentrification pathway. To this end, a cycB null mutation was generated in which the entire open reading frame was deleted. Derivatives of N. gonorrhoeae carrying this allele were distinctive in that they exhibited a severe growth defect manifested as poor plating efficiency and slow growth that was not seen in equivalent strains carrying the previously characterized cycB insertion mutation (data not shown). While profiling of c-type heme proteins confirmed the absence of intact c5 in both backgrounds, strains carrying the cycB insertion mutation expressed a c-type heme protein whose migration corresponded to that predicted for a truncated, mono-heme c5 form resulting from disruption of the open reading frame at residue 171  backgrounds (data not shown). Taken together, these results document clear differences in the requirements for nitrite reduction associated with di- and tri-heme encoding ccoP alleles. Accordingly, the findings strongly suggest that strains of N. meningitidis are fundamentally distinct from those of other neisserial species with regard to respiratory denitrification.Reciprocal experiments were carried out in nditions . Both N.sumption . These rc growth . Measurec growth . These pc growth . To ensuN. meningitidis, transposon insertion mutations were generated in the cloned ccoP gene that were then introduced into a wildtype background. However, transformants were only recovered for those insertions that mapped 3\u2032 to the ORF encompassing the second c-type heme domain (i.e. within the LCR and third c-type heme domain). To ensure that this selectivity was not due to some peculiarity of the constructs themselves, a strain carrying a second active copy of ccoP at an ectopic site was created. Transformants for all insertion mutations were recovered using this merodiploid strain . Here as a control, a strain carrying a tandem duplication of ccoP (by Campbell-type plasmid integration) was used in which the distal gene copy was non-functional due to a deletion of the promoter and translational initiation sites. Transformants for all insertion mutations were recovered using this strain and importantly, all those that could not be recovered in the wildtype background mapped exclusively in the non-expressed ccoP copy  were likely identical in both species.To examine the role of CcoP in d strain . A similcoP copy . As mutaccoP, a transcriptional fusion construct was made in which expression was linked to tac-UV5 control sequences and introduced at an ectopic site in the neisserial genome. As this construct does not include an associated QlacI gene, repression requires a background expressing LacIQ. For practical purposes, we therefore carried out these experiments in N. gonorrhoeae which enabled us to first introduce the ectopic de-repressible ccoP allele in a background expressing di-heme CcoP from the endogenous locus  and the third heme domain of N. gonorrhoeae CcoP was constructed. This was done in a manner such that the relative spacing between the two heme domains in the hybrid was maintained as seen for wildtype c5 and was facilitated by using a conserved stretch of residues in the AlaSerPro-rich linker domains  and a di-heme expressing ccoP allele. The c5-CcoP chimaera was detected as a novel cytochrome c species that migrated with a mobility equivalent to that seen for endogenous c5  share 74% sequence identity with the corresponding C-terminal segment of c5 and 47% with the first heme domain of c5. Such a scenario would account for the presence of the AlaSerPro-rich region between the second and third CcoP heme domains. Although it is difficult to establish amino acid identity within these AlaSerPro rich regions (due to their underlying low complexity), both the lengths of the AlaSerPro stretches (34 residues in c5 versus 42 in CcoP) and overall alanine richness (47.1% Ala residues in c5 versus 47.6% in CcoP) are similar between the two. Moreover, these stretches each bear serine occupancy sites for the glycans associated with the general O-linked glycosylation system in N. gonorrhoeaec5 and the tri-heme CcoP provide strong evidence for modular-based evolution underlying CcoP neofunctionalization.Given its unusual activity and unique distribution within oP forms . This hyNeisseria represent an intriguing model system in which to investigate the evolution trajectories of related pathogenic and commensal bacteria in a single host. Here, we report the identification of a SNP unique in its association with the species N. meningitidis that leads to truncation of the c-type heme protein CcoP, an essential component of its sole, terminal respiratory cytochrome oxidase. The dichotomy in neisserial phylogeny revealed through this altered molecular character raises the obvious question as to why this change appears to be so adaptive on the one hand and yet at the same time, so restricted in its distribution. From the sole viewpoint of aerobic respiration, CcoP functions by supporting cytochrome cbb3 oxidase activity. However, we failed to discern any phenotypic alterations in either the N. gonorrhoeae or N. meningitidis strains varying solely in expression of the di- versus tri-heme forms under standard lab conditions. Therefore, a key factor here may be the altered circuitry of electron transfer favoring microaerobic (oxygen reduction by cytochrome cbb3 oxidase) versus combined microaerobic denitrifying (oxygen reduction by cytochrome cbb3 oxidase supplemented by nitrite reduction by NirK) respiration. For example, the ability of di-heme CcoP to promote solely cytochrome cbb3 oxidase activity (at the expense of reduced electron carriage to NirK) could be adaptive under more aerobic conditions or in situations where nitrite levels might be diminished. Moreover, nitrite reduction could come with significant metabolic cost as it generates nitric oxide that can be toxic and growth inhibitory N. meningitidis strains express the NorB nitric oxide reductase (reducing nitric oxide to innocuous nitrous oxide), toxic NO can accumulate so rapidly that growth inhibition occurs before sufficient NorB activity has been expressed  N. meningitidis as NirK-dependent, nitrite sensitivity occurring under a number of growth conditions N. meningitidis strains are under relaxed selective constraints with regard to NirK-mediated nitrite reduction. Specifically, nirK was not detected in 7 of 26 N. meningitidis strains examined by microarray-based genome hybridization technology nirK found frameshift and inactivating missense mutations in 5 of 23 and 8 of 31 strains respectively N. meningitidis, this is not the case in N. gonorrhoeae and other Neisseria species. In the latter strains, alleles encoding intact NirK are found in all available genomic and individual sequences  is a molecular marker of species within the genus Neisseria. The ability of tri-heme CcoP to act as a redox partner in a pathway that ultimately can transfer electrons to NirK would dramatically reshape the organization of electron transport chain, providing broader connectivity to electrons emanating from bc1 through c4 as well as c5  and N. lactamica isolates used here that were derived from carriage studies within the United Kingdom as well to other commensal species for which the data set is small. Nonetheless, the ccoP tri-heme allele is present in all Neisseria species for which data are available and it is conspicuously absent in any other species including members of the most closely related genera in the family Neisseriaceae such as Chromobacterium, Eikenella, Kingella, and Laribacter and more distant relatives within Betaproteobacteria.Another extraordinary aspect of the l as c5  [51], [5ccoP allele suggests that N. meningitidis as a clade has either undergone a relatively recent, dramatic reduction in population size (with a ccoP SNP -bearing strain first to pass the bottleneck) or that there has been a selective sweep of the SNP allele through the population via natural genetic transformation. Both scenarios are plausible given the relatively short time period over which sequential bottlenecks associated with epidemic spread can lead to clonal descent N. meningitidis, N. lactamica and other commensal Neisseria species inhabit the same apparent oropharyngeal niche and bi-directional, interspecific genetic exchange of some loci occurs frequently N. meningitidis expressing tri-heme CcoP and of N. lactamica and other commensal species expressing di-heme CcoP arise but are purged due to reduced fitness. Consistent with this idea, the low p-distances observed by ClonalFrame for ccoP genes belonging to N. meningitidis, N. lactamica and N. gonorrhoeae are indicative of the conserved nature within species such that diversity may result in reduced fitness of the organism. The lack of recombination observed by RDP3 analysis  further support this hypothesis. Therefore, other as yet unidentified differences in gene repertoire or expression are likely epistatic to ccoP.The SNP-associated analysis  among N.in vitro studies have identified both azurins (members of the cupredoxin family) and c-type heme cytochromes as electron donors to other members of the blue, copper - containing nitrite reductase (CuNIR) family in vivo. Although both N. meningitidis and N. gonorrhoeae express a lipoprotein form of azurin termed Laz, it has been reported that Laz is nonessential for growth under either aerobic or anerobic conditions (in the presence of nitrite) c550 protein was recently shown to disrupt NirK dependent growth and nitrite utilization in Bradyrhizobium japonicumc-type heme domains translationally fused to the carboxy-termini of the nitrite reductase domain have been identified in other proteobacterial species by genome mining c-type cytochrome provided conclusive evidence for the direct transfer of electrons between these partners cycB and ccoP here along with related observations c5 and CcoP (presumably in the context of cbb3) come in close contact with NirK. However, the NirK lipoprotein in its active trimer form is proposed to be linked to the outer membrane cbb3 oxidases must be integrated into the inner membrane in order to fulfil their role in proton pumping essential to ATP synthesis. While the carboxy terminal extensions  found in CcoP and c5 might function to bridge a potential periplasmic gap, more detailed studies of the spacial distribution and organization of the structures involved are needed to address this matter. Regardless of the molecular nature of electron transfer between CcoP and NirK, our finding here that a component of the oxygen reducing respiratory complex can be essential to the activity of an alternative reductase is unprecedented.An important aspect of this topic relates to which redox partners carry out direct electron transfer to neisserial NirK. Although Neisseria. They also demonstrate that microaerobic denitrification is a metabolic pathway of major influence in these bacteria and support the position that N. gonorrhoeae, N. lactamica and N. meningitidis fully deserve their designation as a distinct species, because they are clearly evolving independently. These findings also provide a dramatic example of how evolutionary change at the molecular level can be linked to metabolic innovation and its reversal as well as demonstrating how genotype can be used to infer alterations of the fitness landscape within a single host.In summary, these findings provide a novel perspective on the evolution of species within the genus N. meningitidis isolates initially employed in the evaluation of the (MultiLocus Sequence Typing) MLST typing method were used for ccoP sequence analysis th century, included several isolates from each of seven recognised hyper-invasive clonal complexes: (Sequence Type) ST-1, ST-5, ST-4, ST-11, ST-32, ST-8, and ST-41/44 in addition, to isolates belonging to clonal complexes ST-22, ST-23 and ST-13 (cc269) as well as isolates with unique sequence types. A total of 11 unencapsulated N. meningitidis isolates containing the capsule null locus were also investigated and these included isolates from clonal complexes ST-53, ST-198 and ST-334 (Neisseria and N. gonorrhoeae isolates used for sequence studies are listed in 2 atmosphere. DNA was extracted using an IsoQuick Nucleic Acid Extraction kit (Orca Research Inc.) according to manufacturer's instructions. The neisserial strains used for functional studies are described in 2 as described previously 3, in 25 ml Sterilin McCartney bottle shaken at 190 r.p.m. 2. Growth was monitored by measuring the optical density at 600 nm (OD600) in a WPA biowave CO 8000 Cell Density Meter. E. coli DH5\u03b1 and HB101 were used for plasmid propagation and cloning experiments and were grown on Luria-Bertani media (LB). Antibiotics were used at the following concentrations for N. gonorrhoeae: chloramphenicol, 10\u00b5g/ml; erythromycin, 8\u00b5g/ml; tetracycline, 4\u00b5g/ml; for N. meningitidis: erythromycin, 8\u00b5g/ml; tetracycline, 20\u00b5g/ml; for E. coli: chloramphenicol, 30 \u00b5g/ml; erythoromycin 300\u00b5g/ml; kanamycin 50\u00b5g/ml; ampicillin 100\u00b5g/ml; tetracycline, 15\u00b5g/ml; streptomycin, 100\u00b5g/ml. pUP6 is a derivative of pHSS6 that carries two gonococcal DNA uptake sequences lac promoter/operator at an intergenic chromosomal site located between the gonococcal genes lctP and aspC. Cloning in front of the lac promoter thus allows for chromosomal integration of the insert between lctP and aspC in N. gonorrhoeae and subsequent IPTG inducible expression A total of 71 d ST-334 . The nonccoP genes from strains described in Amplification and sequencing of Nucleotide sequence data for forward and reverse strands were assembled with the STADEN software package ccoP locus of N. meningitidis with the tri-heme ccoP allele of N. gonorrhoeae and vice versa, the endogenous ccoP locus of N. gonorrhoeae with the di-heme ccoP allele of N. meningitidis, the strains MC58 and VD300 were transformed with the plasmids pUP6NGOccoP::mTnerm#22 and pUP6NMEccoP::mTnerm#17 respectively, and selected on GC agar plates containing erythromycin  reactions into an otheriwse wildtype allele. Each pair of PCR fragments containing the mutation was created using primers FE1141 (5\u2032-CGGAATTCGAGCTCTCTTTATCTGTTTCCTGTTAGTAC-3\u2032) in combination with FE1156 (GTAGACCTATTTGCCATCCGCTTTGGCGGC-3\u20325\u2032-AACGGTTTC), and FE1155 (GTCTACTAGGAAACCGTTTGTGCCGCCTGCC-3\u20325\u2032-CGGATGGCAAA) in combination with Av2045 (5\u2032-TTGGACGACGGACGAAGTCTC-3\u2032) was used to make the second overlapping PCR fragment. Altered base pairs including the novel stop codon and an AccI restriction site (underlined) are shown in bold. The overlapping PCR fragments were spliced together using primers ccoP seq5\u2032 (5\u2032- TCGGTTATCTGGTTATGTATCC -3\u2032) and Av2044 (5\u2032-GAATACGCTCTCCCTCTTTACC-3\u2032). Purified PCR products were used to genetically transform N. gonorrhoeae strains AccI digestion of PCR fragments. Direct DNA sequencing of PCR fragments derived from the transformants was done, using appropriate primer sets, to verify the introduction of the stop codon and the absence of any other alterations.The premature stop codon was introduced into N. gonorrhoeae ccoP gene along with 133 bp upstream of the gene and 151 bp downstream of the gene was amplified using primers FE1140 (5\u2032-TACTCTATATCGTCTTCAACAGG-3\u2032) and FE1144 (5\u2032-CAAAAATATCAGTCGGTCTGACTGC-3\u2032). The resulting PCR fragments were digested with unique, flanking EcoRI/SacI sites and cloned into the polylinker of pUP6, yielding plasmid pUP6NGOccoP. Similarly, the N. meningitidis ccoP gene along with 133 bp upstream of the gene and 350 bp downstream of the gene was amplified using primers FE1140 and FE1181 (5\u2032-GCGGGATCCGAGCTCTTACAACAAATAGGCAGTCTGCG-3\u2032). The resulting PCR fragments was digested with unique, flanking EcoRI/BamHI and cloned into the polylinker of pUP6, yielding plasmid pUP6NMEccoP. Mini-transposon (mTn) mutagenesis was performed on both pUP6NGOccoP and PUP6NMEccoP as previously described cm) or erythromycin (mTnerm), were isolated, mapped by PCR and sequencing using appropriate primer sets, depending on the location of the transposon insertion. Primer sequences and the detailed location of each transposon insertion site are available upon request.The ccoP gene the coding region of ccoP and 20 bp of upstream DNA, to include the RBS, was amplified by PCR from N. gonorrhoeae strain VD300 by using the forward primer av2226 (TTAATTAATGTGATAACGGAGCAAAACAATG - 3\u20325\u2032 - CGAAAACC), PacI site underlined, and the reverse primer FE1144 (5\u2032 - CAAAAATATCAGTCGGTCTGACTGC - 3\u2032). The PCR reaction was performed by Advantage HD polymerase (AH diagnostics) to create blunt ends. The resulting PCR product was cut with PacI and cloned into pGCC6, digested with PmeI and PacI, at an intergenic chromosomal site located between the gonococcal genes lctP and aspC and linked to the lac promoter/operator. The resulting plasmid pGCC6NGOccoP was then used to transform strain KS351 (ccoP2x) and transformants were selected for growth on GC agar plates containing chloramphenicol. To inactivate the ccoP allele from the endogenous locus, the N. gonorrhoeae strain carrying the ectopic de-repressible ccoP allele (KS345) was transformed with pUP6NGOccoP::mTnerm#26  integration of pUP6NGOccoP on the chromosome. The resulting N. gonorrhoeae strain carrying a tandem duplication of ccoP (KS344) was transformed with a series of characterized pUP6NGOccoP::mTnerm and pUP6NGOccoP::mTncm plasmids and transformants were selected on GC plates containing erythromycin and chloramphenicol respectively. The location of each transposon insertion, to either the expressed or non-expressed copy of ccoP, was determined by PCR using appropriate primer sets (available upon request).To create an N. meningitidis strain MC58 was transformed with the plasmid pGCC6NGOccoP to create a strain carrying an ectopic copy of N. gonorrhoeae ccoP. Transformants were selected on GC agar plates containing chloramphenicol and confirmed correct by appropriate PCR primer sets and immunoblotting followed by heme-staining to visualize expression of the tri-heme form of CcoP. The resulting N. meningitidis strain (KS350) carrying the ectopic N. gonorrhoeae ccoP and the wildtype strain MC58 were transformed in parallel with a series of characterized pUP6NMEccoP::mTnerm plasmids and transformants were selected on GC plates containing erythromycin.For this purpose, the wildtype cycB insertion mutants, cycB::tet was introduced into MC58 and into VD300 by transformation and transformants were selected for growth on GC agar plates containing tetracycline. To obtain a complete deletion of cycB in N. gonorrhoeae the primers FE2223 (5\u2032 - TCCGCAAAGCGGTGGAAATG- 3\u2032) and FE2220 (5\u2032 \u2013 GTTTAAACTGTCGCGGAGTTGTTTCATTTG - 3\u2032) were used to amplify an 800 bp fragment of genomic DNA upstream of the cycB gene and the primers FE2221 (5\u2032-TGAAACAACTCCGCGACAGTTTAAACACTATATGGCAAACCAATCCGGTGC -3\u2032) and FE2225 (5\u2032 \u2013TATTTTGACAAACCACCGGAG - 3\u2032) were used to amplify a 900 bp fragment of genomic DNA downstream of the cycB gene. The PCR products contained regions of homology at the 3\u2032 end of the upstream fragment and at the 5\u2032 end of the downstream fragment such that they could be spliced together by PCR-based splicing-by-overlap extension leaving out the entire cycB gene. This was done by using the primers FE2224 (5\u2032\u2013TTCATCCGGACAAACGCGTTG -3\u2032) and FE2222 (5\u2032\u2013AACCTGTCGCTCTACGGCGAAC- 3\u2032). The purified PCR product was used to genetically transform N. gonorrhoeae by a non-selective transformation technique c5 expression, including the truncated c5 form seen in the cycB::tet mutants, was verified by heme-stained blots of whole cell extracts.To generate the cycB and the cycB-ccoP hybrid allele was performed by cloning PCR amplified products into a unique SacI restriction site in plasmid p2/16/1 iga locus of the gonococcal chromosome. The resulting plasmids were then used to transform the mutant KS337  and transformants were selected for growth on GC agar plates containing erythromycin.Ectopic expression of cycB allele the coding region including about 250 bp of upstream DNA was amplified by PCR from N. gonorrhoeae strain VD300 by using the forward primer c555F_SacI (GAGCTCAATTGGCAAAGGTTATCTTGCG - 3\u20325\u2032 \u2013 TGCA) in combination with the reverse primer FE2200 (GAGCTCACACCCATTTGATGTCATTTCC - 3\u20325\u2032 \u2013 ATTC), SacI sites underlined.For cloning of the wildtype cycB-ccoP hybrid allele was constructed by PCR-based splicing-by-overlap extension such that the region encoding the amino-terminus of cycB encompassing the first c-type heme domain and about 250 bp of upstream DNA was fused to the region encoding the third heme domain of ccoP. The relative spacing between the two heme domains in the hybrid protein was maintained as seen for wildtype cycB by facilitating a conserved stretch of four residues (Ala-Ala-Pro-Ala) in the C-terminal end of the AlaSerPro-rich linker domains. The cycB part of the hybrid allele, including about 250 bp of upstream DNA, was amplified by PCR using the flanking primer c555F_SacI in combination with the primer FE2216 (5\u2032 \u2013 TCCGCTTTGGCCGCAGGGGCTGCCGCACCCTTGTC \u2013 3\u2032). The region encoding the third heme domain of ccoP was amplified by PCR using the flanking primer FE2218 (GAGCTCATTCGATATGAATCCGGATTTCTG \u2013 3\u20325\u2032 \u2013 CCGG), SacI site underlined, in combination with the primer FE2217 (5\u2032 \u2013 ACAAGGGTGCGGCCGCACCTGCCGCCAAAGCGGATG\u2013 3\u2032). The two overlapping PCR fragments were spliced together by using the flanking primers c555F_SacI and FE2218.The Nitrite concentrations in culture media were measured by a colourimetric assay as previously detailed c-type cytochromes were prepared by harvesting bacteria from plates into 10mM Hepes buffer pH 7.0, subjecting the suspension to 5 cycles of freezing and thawing, and finally suspending the bacteria in 1% w/v n-dodecyl \u03b2-D-maltoside (Sigma-Aldrich). After 10 min incubation at 50\u00b0C samples were separated on 10% or 12% Criterion XT Precast Gels  and blotted onto PVDF membranes. To visualize heme-dependent, peroxidase activity of the c-type cytochromes, the membranes were first incubated with SuperSignal West Pico Chemiluminiscent Substrate, according to manufacturers instructions , and then exposed to X-ray film  Whole-cell extracts for detection of Figure S1ccoP in the 33 alleles among Neisseria species. The scale above the graph is in amino acids. CcoP functional domains are represented as distinct blocks with green blocks representing heme groups and the red bar depicting the AlaSerPro-rich region. Black vertical bars above this represent synonymous nucleotide polymorphisms with non-synonymous polymorphisms depicted below the diagram. Red vertical bars both above and below represent synonymous and non-synonymous polymorphisms respectively detected among N. gonorrhoeae, N. lactamica and N. meningitidis isolates only. The asterisk (*) indicates the position of the stop codon found among N. meningitidis isolates. The vertical bars found beside to the left of the alignment beside allele numbers indicate the species to which the ccoP alleles belong; black: N. gonorrhoeae; red: N. lactamica; blue: N. meningitidis; green: other Neisseria species including N. cinerea, N. polysaccharea, N. subflava, N. mucosa, N. flavescens and N. sicca.CcoP polymorphisms. Distribution of polymorphisms along the 1, 336 nt of gene (7.54 MB TIF)Click here for additional data file.Figure S2N. meningitidis. Cultures of wild-type (MC58) (open squares); NgoccoP (KS348) (open circles); cycB (c5-) (filled squares) and NgoccoP, cycB (KS349) (filled circles) growing under aerobic conditions (A) and under microaerobic conditions without nitrite (B). The results shown are representative of three independent experiments.Effects of CcoP domain alterations on aerobic and microaerobic growth in (0.10 MB TIF)Click here for additional data file.Figure S3N. gonorrhoeae. Cultures of wild-type (VD300) (open squares); and mutants ccoP2x (KS335) (open circles); cycB (KS336) (filled squares); ccoP2x, cycB (KS337) (filled circles); NmeccoP (KS340) (open triangles); NmeccoP, cycB (KS341) (filled triangles) growing under aerobic conditions (A) and under microaerobic conditions without nitrite (B). The results shown are representative of three independent experiments.Effects of CcoP domain alterations on aerobic and microaerobic growth in (0.09 MB TIF)Click here for additional data file.Figure S4cycB insertion mutant expresses a truncated c5 protein. The cycB gene, encoding the c5 protein, was disrupted by insertion of a tetracycline resistance (TetR) gene c5 ORF that terminates at residue 171 followed by eleven residues derived from sequences within the tetracycline resistance gene insertion before a stop codon (indicated by an asterisk). This results in a 182 residue c5 protein retaining the membrane-proximal heme domain (in gray).The (0.05 MB TIF)Click here for additional data file.Figure S5N. gonorrhoeae strains: 1, wild-type (VD300) and mutants 2, cycB (KS336); 3, ccoP2x (KS335); 4, ccoP2x, cycB (KS337); 5, NmeccoP(KS340); 6, NmeccoP, cycB (KS341); were grown under microaerobic conditions plus 5 mM nitrite. Samples were taken after one (1) and six (6) hours of growth, and whole cell lysates were analyzed by immunoblotting with anti-NirK antibodies.NirK expression during growth under microaerobic conditions. (0.15 MB TIF)Click here for additional data file.Figure S6c5-CcoP translational fusion. A translational fusion consisting of the amino-terminus of c5, encompassing the first c-type heme domain, and the third c-type heme domain of CcoP was made by exploiting a conserved stretch of residues  in the AlaSerPro-rich linker domains. Also underlined are the two cysteine and single histidine residues found in a CXXCH motif required for disfulfide bonding to the vinyl groups of heme. The total number of amino acids (and thus the relative spacing) between the two c-type heme domains was maintained as seen for wildtype c5. The hybrid-encoding gene was then expressed from an ectopic site.Strategy for construction of a (15.81 MB TIF)Click here for additional data file.Table S1(0.15 MB DOC)Click here for additional data file.Table S2(0.09 MB DOC)Click here for additional data file.Table S3(0.04 MB DOC)Click here for additional data file.Table S4(0.03 MB DOC)Click here for additional data file."}
{"text": "We present a tool for tracking coronary vessels in MRIscans of the human heart to aid in the screening of heartdiseases. The vessels are identified through a single click insideeach vessel present in a standard orthogonal view. The vesselidentification results from a series of computational stepsincluding eigenvalue analysis of the Hessian of the MRI imagefollowed by a level set-based extraction of the vessel centerline.All identified vessels are highlighted using a virtual contrastagent and displayed simultaneously in a spherical curvedreformation view. In cases of over segmentation, the vessel tracescan be shortened by a click on each vessel end point. Intermediateanalysis results of the vessel computation steps can be displayedas well. We successfully validated the tool on 40 MRI scansdemonstrating accuracy and significant time savings over manualvessel tracing."}
{"text": "Phytophthora are among the most destructive plant pathogens and therefore have attracted considerable attention during the past two decades. Although it has been realized that a close phylogenetic relationship exists, so far sharp distinction has been made between the obligate biotrophic downy mildews and the hemibiotrophic Phytophthora. In the study presented here, it is shown that a continuum of character states from hemibiotrophic Phytophthora species to obligate biotrophic downy mildews is present. Intermediate character states between downy mildews and Phytophthora species exist in several rare parasites of grasses, which are not embedded within the major clades of the downy mildews but are placed sister to these, with unresolved affinities to both these clades and to Phytophthora. They still have retained traits hitherto thought to be exclusive for Phytophthora. A careful review of previous research is presented and it is highlighted that uniquely for downy mildews, Poakatesthia may form an intracellular mycelium, growing through several host cells. In addition, scanning electron microscopy reveals that sporangiophore growth is not determinate in Viennotia and that outgrowth from sporangiophores is very similar to Phytophthora infestans. It is concluded that the sharp morphological distinction between downy mildews and Phytophthora species (that are often placed in separate families and even different orders), is rather artificial, since all features thought to be exclusive to Phytophthora or the downy mildews are united in the rare grass-parasitizing down mildew genera Viennotia and Poakatesthia and the enigmatic genus Sclerophthora. Therefore, several paradigms regarding the distinction between Phytophthora and the downy mildews need to be reconsidered.Downy mildews and root and foliar rots caused by  Phytophthora species are among the most destructive rot-causing pathogens of plants, responsible for several catastrophic events, like the sudden oak death in North America, caused by Ph. ramorumPh. infestansPhytophthora species often have a much wider host range. In addition to these characteristics, there are three main morphological characteristics that are thought to distinguish Phytophthora species from downy mildews. First, downy mildews do not form intracellular mycelium, but invade host cells only by haustoria Phytophthora is able to grow through both living and dead cells Phytophthora the sporangiophore may grow further after sporangia have formed. Third, it is generally believed that in downy mildews all sporangia ripen simultaneously, while in Phytophthora sequential maturation takes place. These differences were thought to be of major importance and have been used as an argument to postulate a deep divide between downy mildews and Phytophthora, placing the downy mildews in a family of its own, the Peronosporaceae, while Phytophthora \u2013 on the basis of its thallus growth and general morphological characteristics \u2013 has usually been placed in the family Pythiaceae of the order Pythiales Phytophthora. Only in one study Phytophthora was found to be monophyletic, often with maximum support Phytophthora infected plants usually rot and die, whilst those infected with downy mildews may remain almost or completely asymptomatic for long periods and may even recover, particularly in secondary infections of natural populations. However, the effectors secreted by these pathogens are similar Phytophthora which is initiated by necrosis inducing proteins Bremia, only seldom do plants die from infections with this pathogen. Bremia is not culturable on artificial media and therefore it is unlikely that necrotic parts of infected plants can serve as a source of nutrition for the hyphae. In general, the downy mildews have evolved into well adapted obligate biotrophic pathogens, which may be transmitted with the seeds of their host plants and many hardly cause observable symptoms. This is especially the case in Basidiophora and some species of Hyaloperonospora, which systemically infect their hosts and in effect develop endosymbiotically Phytophthora and the obligate biotrophic downy mildews, the question then whether some missing links between these two groups still exist. Recent molecular phylogenetic studies Hyaloperonospora, Perofascia; downy mildews with coloured conidia \u2013 Peronospora, Pseudoperonospora; downy mildews with pyriform haustoria \u2013 Basidiophora, Benua, Bremia, Novotelnova, Paraperonospora, Plasmopara, Plasmoverna, Protobremia). However, in none of the analyses to date did these apparent sister relationships receive high bootstrap support and therefore this molecular evidence must be treated cautiously. If the before mentioned artefact in phylogenetic reconstruction Phytophthora remains unclear. G\u00f6ker et al. Hyaloperonospora and Perofascia had started from hosts in the Poaceae and Thines et al. Phytophthora and the rather basal position of the graminicolous downy mildews that was revealed by recent molecular phylogenetic investigations.Because of the close phylogenetic relationship revealed by molecular studies and the similarity in the effector genes between the hemibiotrophic Phytophthora, can also be observed in Viennotia , the apophyses, which are typical for iennotia . In scanapparent . In bothapparent . These aPhytophthora-like outgrowth in the genus Viennotia is unique for downy mildews. Outgrowth in Viennotia and Phytophthora takes place trough the middle of the scar left after sporangium dispersal and not as previously depicted by de Bary Plasmopara halstedii, abnormal sporulation with outgrowth from a sporangiophore bearing sporangia has been observed on sunflower roots by Novotelnova Phytophthora has been considered the most important characteristic in delimitating downy mildews. Therefore the finding that in Viennotia sporangiophore growth is indeterminate provides important evidence that sharp distinction made between Phytophthora and downy mildews based on morphogenetic criteria is rather artificial.The possibility for Phytophthora mycelium may grow through both living and dying cells. Intracellular mycelium is not uncommon in Phytophthora species, , although many species of this genus also produces digit-like haustoria. In Poakatesthia penniseti, a rare downy mildew parasite of Pennisetum glaucum, it has been observed that intracellular, callose-covered, hyphae form from haustoria, which may grow through several host cells before they enter the apoplast again PoakatesthiaSclerophthora, some basal Pseudoperonospora and Peronospora species, as well Peronosclerospora, which general mycelium morphology is much alike PoakatesthiaPoakatesthia penniseti raises questions regarding the obligate biotrophy of this downy mildew. Unfortunately, as only the type collection is available as a herbarium specimen, this conclusion can not be supported by cultivation experiments.It is generally assumed that in downy mildews hyphal growth only takes place extracellularly and only the determinate haustoria intrude into host cells, whilst in Sclerophthora is able to grow on artificial media is not unexpected, as there is a long-standing and ongoing debate Phytophthora. In a recent phylogenetic reconstructions, the placement of this genus could not be unambiguously resolved Sclerophthora is controversial becomes already apparent from its name: \u201cSclero\u201d is referring to the thick-walled oospores, which are similar to those of the graminicolous downy mildew Sclerosporaphthora\u201d refers to the Phytophthora-like vegetative mycelium including sporangiophores. The main reasons for the inclusion of Sclerophthora in the downy mildews have been the morphology of the oospores and the determinate sporangiophore growth. However, like in Phytophthora, sporangia do not form synchronously in this genus Sclerophthora in Phytophthora has been the similarity in the shape of sporangia und the supporting sporangiophores Phytophthora on grounds of oospore morphology might still be justified. Also the apparently fast and rather long independent evolutionary history, which can be deduced from the long branch for Sclerophthora in Thines et al. Phytophthora.The finding of Tokura SclerosporaSclerospora amongst the downy mildews Sclerophthora nor Sclerospora has been reported again and so it is possible that the observations made by Tiwari & Arya Sclerophthora the ripening of sporangia is asynchronous Viennotia, sporangiogenesis is synchronous.The second downy mildew genus which has been reported to be culturable on artificial media is Graminivora, Poakatesthia, Viennotia), Sclerophthora and Phytophthora. Taking into account the comparison given in Phytophthora is always present in downy mildews and that most characteristics thought to be exclusive to Phytophthora can also be observed in lineages of the graminicolous downy mildews.Therefore, in addition to the LM and SEM observations reported here, a careful examination of the literature also reveals that several characters states are in common for some genera of the graminicolous downy mildews with lasting sporangiophores  need to be rethought, as there are downy mildews species which show traits that are at variance with these basic assumptions.Phytophthora. Phytophthora and downy mildews are both phylogenetically and morphologically connected by \u201cbridging taxa\u201d and share an intimate relationship. The downy mildews are therefore to be considered a more specialised sister-taxon to some advanced Phytophthora lineages, as they have evolved from a Phytophthora-like ancestor at a time, when some other basal lineages of Phytophthora s.l. had already parted from the downy mildew-Phytophthora s.str. lineage . Whether the \u201cbridging taxa\u201d of the graminicolous downy mildews take an intermediate phylogenetic position between Phytophthora and all other downy mildew clades or whether the plesiomorphic, Phytophthora-like, character states that can be observed in some downy mildews have been lost several times independently can so far not be resolved.The arguments listed above necessitate a critical revision of the paradigm that downy mildews are much different from Sclerophthora and in the rare downy mildew species Poakatesthia penniseti and Viennotia oplismeni, several pathogenicity effector genes and developmental genes intermediate to the model organisms in Phytophthora and the downy mildews could be found. Therefore, the investigation of these organisms might shed light on the shift from hemibiotrophy to obligate biotrophy and thereby help to decipher the most basal chapter in downy mildew evolution.It seems likely that in the enigmatic genus Of the extremely rare parasites Poakatesthia penniseti and Viennotia oplismeni only the type collections are available , which were investigated in cause of this study. The Phytophthora specimen depicted in this study is deposited in the herbarium of the University of Hohenheim (HOH) as HUH 992.For light microscopy (LM) of sporangia and sporangiophores, small pieces of the samples were transferred to 5% chloral hydrate to restore turgidity. Preparation for scanning electron microscopy was done as previously described"}
{"text": "There is no validated gold-standard diagnostic support tool for LSS, and therefore an accurate diagnosis depends on clinical assessment. Assessment of the diagnostic value of the history of the patient requires an evaluation of the differences and overlap of symptoms of the radicular and cauda equina types; however, no tool is available for evaluation of the LSS category. We attempted to develop a self-administered, self-reported history questionnaire as a diagnostic support tool for LSS using a clinical epidemiological approach. The aim of the present study was to use this tool to assess the diagnostic value of the history of the patient for categorization of LSS.The initial derivation study included 137 patients with LSS and 97 with lumbar disc herniation who successfully recovered following surgical treatment. The LSS patients were categorized into radicular and cauda equina types based on history, physical examinations, and MRI. Predictive factors for overlapping symptoms between the two types and for cauda equina symptoms in LSS were derived by univariate analysis. A self-administered, self-reported history questionnaire (SSHQ) was developed based on these findings. A prospective derivation study was then performed in a series of 115 patients with LSS who completed the SSHQ before surgery. All these patients recovered following surgical treatment. The sensitivity of the SSHQ was calculated and clinical prediction rules for LSS were developed. A validation study was subsequently performed on 250 outpatients who complained of lower back pain with or without leg symptoms. The sensitivity and specificity of the SSHQ were calculated, and the test-retest reliability over two weeks was investigated in 217 patients whose symptoms remained unchanged.The key predictive factors for overlapping symptoms between the two categories of LSS were age > 50, lower-extremity pain or numbness, increased pain when walking, increased pain when standing, and relief of symptoms on bending forward . The key predictive factors for cauda equina type symptoms were numbness around the buttocks, walking almost causes urination, a burning sensation around the buttocks, numbness in the soles of both feet, numbness in both legs, and numbness without pain . The sensitivity and specificity of the SSHQ were 84% and 78%, respectively, in the validation data set. The area under the receiver operating characteristic curve was 0.797 in the derivation set and 0.782 in the validation data set. In the test-retest analysis, the intraclass correlation coefficient for the first and second tests was 85%.A new self-administered, self-reported history questionnaire was developed successfully as a diagnostic support tool for LSS. Lumbar spinal stenosis (LSS) is a well-recognized spinal disorder and a term used to describe a complex set of symptoms, physical findings, and radiological abnormalities caused by a narrowed spinal canal. The presence of a narrow canal in radiographic imaging does not in itself define the syndrome, and a diagnosis of LSS is defined by symptoms and clinical findings that must be supported by radiographic evidence. Computed tomography and magnetic resonance imaging are often non-specific and there may be discrepancies between clinical symptoms and imaging findings in cases of LSS -3.There is no validated gold-standard diagnostic support tool for LSS, and therefore an accurate diagnosis depends on clinical assessment. However, there are few scientific evaluations of the sensitivity and specificity of diagnoses based on clinical history and physical examinations, or appropriate correlations of these data with imaging and operative findings. Katz et al. used the opinion of two expert orthopedic surgeons to define the presence or absence of LSS , and fouThere are two categories of leg symptoms caused by LSS . One typFull-blown cauda equina syndrome only occurs in rare instances, but the above symptoms can occur as a part of cauda equina syndrome ,7. ThereAssessment of the diagnostic value of the history of the patient requires an evaluation of the differences and overlap of symptoms of the radicular and cauda equina types; however, no tool is available for evaluation of the LSS category. Therefore, we attempted to develop a self-administered, self-reported history questionnaire as a diagnostic support tool for LSS using a clinical epidemiological approach. The aim of the present study was to use this tool to assess the diagnostic value of the history of the patient for categorization of LSS.A series of 137 patients with LSS and 97 with lumbar disc herniation who successfully recovered following surgical treatment in our department during 2000 and 2003 were included in this study  was developed as a diagnostic support tool for LSS.This study was performed in six university hospitals, ten medical centers, and thirty one hospitals and clinics affiliated with university hospitals or medical centers during January and March in 2004. A series of 115 patients with LSS gave informed consent to participate in the study and answered the SSHQ before surgery. All these patients recovered following surgery. Patients with cervical myelopathy, diabetic neuropathy, previous surgery, inflammatory disorders, and degenerative scoliosis were excluded. All patients were evaluated by study investigators using the same protocol as that in derivation study 1. Operative and follow-up visit notes were reviewed to determine if stenosis was confirmed intraoperatively and if symptoms improved following surgery. Nerve root compression resulting exclusively from a herniated nucleus pulposus was not considered as a part of LSS syndrome. All LSS patients were categorized into radicular or cauda equina types based on history, physical examination, and MRI findings using the same criteria as those in derivation study 1. There were 55 patients with radicular type LSS and 60 patients with the cauda equina type  and inflammatory disorders were also excluded. This study included 250 patients who complained of leg symptoms, including cases of LSS (n = 165), lumbar disc herniation (n = 61), diabetic neuropathy n = 13), and peripheral vascular disease (n = 11)  curve were estimated. History and physical examination variables were dichotomized at clinically sensible cut-off values. Pinprick, strength, and Achilles reflexes were each classified as always normal or with at least 1 abnormal finding. Univariate analyses were performed to derive predictors of LSS using logistic regression analysis. Two-by-two contingency tables were prepared to calculate the sensitivity, specificity, and likelihood ratio of the SSHQ. The area under the ROC curve for the derivation data set was estimated to investigate the internal validity of the clinical prediction rule, and the area under the ROC curve for the validation data set was estimated to examine the external validity. Reliability was investigated based on the reproducibility in the test-retest method. Test-retest analysis was performed in 217 patients with a 14-day period between the first and second tests. Test-retest data were examined graphically by plotting the difference between tests against the mean of the 2 tests . The intKey factors for predicting overlapping symptoms between the two types of LSS are shown in Table Based on the results of univariate analysis for predictors of LSS, we developed the SSHQ as a diagnostic support tool for LSS  declare that they have no competing interests.SKonno, SKikuchi, SKokuban, YT, YS, KY, MO, TY and HT conceived the study and participated in the study design. SK performed the statistical analysis. SK drafted the initial manuscript for journal submission and participated in revisions. SKonno, SKikuchi, SKokuban, YT, YS, KY, MO, TY and HT coordinated data collection at each site. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:Japanese version of the SSHQ. A copy of the Japanese version of the SSHQ for Japanese readersClick here for fileEnglish version of the SSHQ. A copy of the English version of the SSHQClick here for file"}
{"text": "When voters in Washington State banned hound hunting with an eye to protecting cougars, they unwittingly triggered a chain of events that wildlife biologists are still trying to understand.  Now the forests are removed, the land covered with fields of corn, orchards bending with fruit and the magnificent habitations of rational and civilized people.\u201d\u2014John Adams, 1756 [.Braced for savagery and sacrifice, European settlers in the New World came to the Pacific Northwest to tame the final frontier, the last refuge of \u201cdismal wilderness.\u201d While colonists in the East were poisoning, shooting, and trapping cougars to extinction during the 1880s, hundreds of thousands of pioneers flooded into what would soon become the new state of Washington. Following the well-worn pioneer playbook, Pacific Northwest immigrants converted forests to farmland and pasture and, fearing local predators as unacceptable threats to life, property, and game, paid bounty hunters to destroy all carnivores, large and small.It would take over 30 years to exterminate the wolf, and several more decades to nearly eliminate the cougar\u2014whose famously reclusive, solitary nature may have helped the cat survive a systematic eradication effort. Yet even against a backdrop of ongoing persecution, complaints of cougar attacks on livestock and game continued apace, and legislators, assuming that more complaints meant more predators, increased incentives for hunters to thin the population. By 1940, two United States Fish and Wildlife Service senior biologists reported that cougars had been \u201cexterminated in practically all of their former range in the United States and are fast being eradicated from many parts of the West\u201d .Ironically, a measure passed to protect wildlife triggered a chain of events that led to the highest rates of human-caused cougar mortality since the height of the bounty era\u2014even as the public clamored for higher cougar harvests.Puma concolor, about 400,000 years ago, went extinct in North America during the last ice age, 10,000\u201312,000 years ago, then recolonized the continent from surviving populations in Central and South America [P. concolor lost two-thirds of its historic range during the bounty era, which ended in most western states in the 1960s. Though cougar abundance increased in the West after states reclassified the cats as game animals, a designation that afforded them limited protection, the World Conservation Union considers P. concolor \u201cnear threatened\u201d and warns that the species may soon qualify as \u201cvulnerable\u201d if current persecution and habitat degradation trends continue [Genetic evidence suggests that cougars evolved as a distinct species,  America , acquiriAlthough reliable population estimates are notoriously difficult to generate for shy, wide-ranging, low-density animals, the Washington Department of Fish and Wildlife (WDFW) estimates that 2,500 to 4,000 cougars now inhabit the state\u2014and they're finding it harder and harder to steer clear of humans. Washington's human population increased 21% between 1990 and 2000, far faster than the national average of 13% .Worried about the loss of prime cougar habitat and persecution of a top predator, animal welfare and environmental groups sponsored a statewide initiative (I-655) to outlaw the use of hounds to hunt cougars, a longstanding rural tradition\u2014and the most efficient method of killing cougars\u2014regarded as cruel by many city-dwelling voters. Anxiety over cougars, always a hot-button issue in the sparsely populated counties in northeastern Washington, reached a fever pitch after I-655 passed in 1996.Yet in spite of predictions that an exploding cougar population would leave a trail of mutilated horses, dogs, and children, the measure's impacts were neither what supporters had hoped nor opponents feared. Ironically, it triggered a chain of events that led to the highest rates of human-caused cougar mortality since the height of the bounty era\u2014even as the public clamored for higher cougar harvests. Wildlife biologists are still trying to understand the impacts of such heavy hunting on the ecology, behavior, and persistence of one of Earth's most secretive species. Whether they can find a way to help Washington residents and cougars coexist remains to be seen.Catherine Lambert originally set out in 2002 to study regional variations in the reproductive response of cougars in the Pacific Northwest, but shifted gears when her radio-collared research subjects kept turning up dead. Lambert, then a student at Washington State University's Large Carnivore Conservation Laboratory, was shocked to find that nearly half of 52 radio-collared cats had been shot by hunters or in response to livestock depredation attributed to cougars. The mounting body count suggested that the population could be in serious trouble from overhunting. But Lambert's field observations ran directly counter to the popular belief that I-655 had triggered a cougar population explosion.Contrary to popular belief\u2014and the rationale behind legislation authorizing emergency and public safety hunts\u2014increased complaints did not signal a growing cougar population.That was because WDFW officials, well aware that losing hound hunting could reduce the number of cats killed, had liberalized hunting regulations to maintain traditional harvest levels. The agency extended the hunting season by six months, doubled the legal bag limit, and rolled cougar \u201ctags,\u201d or licenses, into big-game packages, which made them far more attractive to elk and deer hunters, known as \u201cboot hunters.\u201d Before the ban, WDFW sold 1,000 cougar tags a year. The new policy gave tens of thousands of deer and elk hunters the legal right to shoot cougars.The Idaho Observer, bearing the horror movie headline \u201cCougar Carnage at the Promised Land Ranch\u201d and featuring a grisly photo of a wounded colt [But perceptions die hard. Despite the agency's efforts\u2014and even though I-655 allowed the agency to use hounds to protect the public\u2014the incidence of cougar complaints, which averaged about 250 a year before I-655, more than doubled the following year before peaking at 936 in 2000. Cougar\u2013human conflicts increased along with public anxiety, particularly in Okanogan County, an area where apprehension about cougars runs deep\u2014the state's only recorded fatal attack on a human occurred here in 1924. The mood is captured by a 2003 column by Joel Kretz in a crusading libertarian monthly published across the border, ded colt .As frustration with the hound-hunting ban festered, Okanogan County commissioners threatened to defy state law by declaring open season on the \u201cgrowing\u201d cougar population, and by 2004, nine statewide bills had been introduced to reverse or circumvent I-655; two passed. Speaking for the Okanogan Farm Bureau, Kretz testified in favor of one that authorized hounds for public safety hunts and another that sanctioned emergency safety hunts in a pilot program that gave commissioners in five northeastern counties local control over cougar management. After years of complaining to politicians and the press about an \u201cexploding\u201d cougar population, Kretz was elected state representative from four of the five pilot counties in 2004. In 2007, he introduced a bill to extend the emergency safety hunt program another year.As the \u201ccougar problem\u201d was debated on editorial pages, in public forums, and at state and county hearings\u2014and the management of an enigmatic species moved from the hands of wildlife biologists first to voters and then to politicians\u201458,000 deer and elk hunters hit the woods with cougar tags in their pockets. And Catherine Lambert, worried about losing so many collared cougars, set out to test her suspicion that public perception about an exploding cougar population was dead wrong.When Lambert joined the Large Carnivore Conservation Laboratory in 2002, its director, Rob Wielgus, was investigating declines of mule deer and endangered mountain caribou in the Selkirk Mountains, their last stand in the lower 48 states. Years of intensive timber harvest had transformed the ancient stands of old-growth forests rich with arboreal lichen, the mainstay of the caribou winter diet, into clear-cut blocks rife with forest edges and early seral vegetation like seedlings, saplings, and immature trees, destroying critical caribou habitat and forage.White-tailed deer\u2014historically rare in these parts\u2014thrive on the immature vegetation left behind by forestry practices, and their numbers rose as those of native prey species declined. One explanation for the white-tails' success could be that they outcompeted native species for resources. But Wielgus found support for an alternative hypothesis called apparent competition, a negative interaction between prey species that occurs due to shared enemies rather than shared resources. As the white-tails invaded native ungulate range, moving upland in the summer, cougars followed, and their numbers expanded along with their prey base\u2014for a while. Cougar predation on white-tails was density-dependent\u2014it increased or decreased in relation to population growth\u2014but continued to increase on caribou and mule deer even as their populations declined ,9. This Without intervention\u2014such as culling cougars or changing forestry practices to discourage white-tails\u2014Wielgus feared that neither the Selkirk caribou nor the mule deer populations would recover. Wildlife managers in the region agreed to increase hunting to limit predation. But why were cougars selecting for the native species? At first, Wielgus wondered if mule deer had hybridized with white-tailed deer and were somehow easier to kill, but DNA analysis showed no white-tail gene introgression into mule deer taken by cougars. Then his team analyzed \u201ca huge dataset\u201d on deer kills from global positioning system readings and realized that male cougars were killing white-tails at lower elevations, while females were killing mule deer at higher elevations.Cougars appeared to be causing consternation everywhere, eating endangered caribou and deer and attacking livestock and pets, and even the occasional human. Cougar attacks on humans are extremely rare\u2014lightning strikes are more common\u2014but eight of nine documented attacks occurred in the 1990s, including two serious attacks on children in northeastern Washington, providing fodder for the post-I-655 legislative blitz to expand hunting. What if all the problems were the result of a hunted\u2014rather than a growing\u2014cougar population? Evidence from studies on African lions  and wolvWhen Lambert began work on Wielgus's cougar project, his team had already started to capture and radio-collar 52 cats, first in study sites around the Selkirk Mountains in northeastern Washington, southern British Columbia, and northern Idaho, and later in another site in Colville National Forest in northeastern Washington see . The tea\u201cThis is where it gets really depressing,\u201d Wielgus told a recent national meeting of science writers, where he presented his latest results. Aside from some older females, \u201cwe don't have any four-year-old cougars left.\u201d Hunters, as Lambert discovered firsthand, accounted for 92% of cougar deaths\u2014and indirectly killed five of 21 dependent kittens by shooting their mothers.2 at the beginning of the study to 0.85 cougars/100 km2 in the last two years. As Lambert reported last year in the Journal of Wildlife Management [2 in Alberta, Canada, for example, and 3.5\u20133.7 cougars/100 km2 in British Columbia).Based on an annual census, the minimal total density fell from 1.46 cougars/100 kmnagement , even thThe population was growing at the start of the study, when Wielgus discovered cougar selection on caribou and mule deer, but started to decline by 30% a year in 2000\u2014just when complaints reached an all-time high. If current harvest rates continued, the cougar population would disappear within 30 years. Contrary to popular belief\u2014and the rationale behind legislation authorizing emergency and public safety hunts\u2014increased complaints did not signal a growing cougar population. \u201cAs complaints were going up, the population was tanking,\u201d Wielgus says.The intensive hunting in the Selkirks did achieve one thing: it relieved predation pressure on caribou and mule deer. Mule deer populations have recovered beyond expectation, but white-tailed deer are also increasing\u2014at the rate of 30% a year. The strategy just facilitated the invasion of the white-tail, Wielgus says, which will likely outcompete mule deer for resources down the road.Wielgus's team continued studying the population in Colville National Forest, another area with fears about a growing cougar population and heavy hunting, though on a smaller scale. Based on low survival and maternity rates\u2014kitten survival rates were also low\u2014the population was in rapid decline, mostly due to female mortality. Yet by census count, the population appeared stable over time, but not sustainable. The team found more juveniles than expected, no decline in total or adult density, and a shift in population structure toward younger independent males. The hunted population acted as a sink, attracting immigrants and younger animals, which masked the loss of females. But males won't stick around if there aren't any females left. And a population without females has no future.Wielgus saw a similar dynamic with grizzly bears when he tested the notion that trophy hunting increases offspring production, survival, and population growth by reducing the abundance of competitive or cannibalistic adult males. Deer and other traditional game animals typically respond to predation (or hunting) with increased reproduction and survival. But top carnivores, which have not adapted to predation over evolutionary time, should not be expected to respond like prey species, Wielgus reasoned. Instead, he found that hunting older adult male grizzly bears in small populations attracted dispersing, potentially infanticidal males, led to increased sexual segregation and reduced reproduction, and ultimately compromised population growth and persistence. Reduced cub production, Wielgus argued, occurred because adult females moved into territories where resources and, presumably, infanticidal males were scarce .The same thing appears to be happening with cougars. \u201cAs we kill all these big resident adult animals, the younger guys come to the funeral,\u201d Wielgus says. And that could explain cougar selection on mule deer. The immigrant males hang out in lower elevations, killing white-tailed deer where prey densities are very high, but females move to higher elevations\u2014where prey densities are lower\u2014and kill mule deer incidentally. It stands to reason that females would go where prey densities are high, but they don't. Wielgus is testing the possibility that females go to resource-poor areas to avoid immigrant males\u2014which easily travel 150 miles (240 km) to find a potential mate\u2014to protect their kittens. He doesn't have direct evidence of infanticide, but notes that more kittens turn up dead when unrelated immigrant males enter the system than when their fathers are there.Wielgus found the probable source population for the Colville immigrants in another study area to the southwest, where white-tailed deer are still rare. Unlike both heavily hunted populations, kitten and adult female survival rates were high\u2014and adult male survival rates were twice as high. In this \u201clightly hunted\u201d population, the mule deer population was healthy and cougar complaints were low. Hunting was acting as a form of habitat degradation. The lightly hunted populations have stable habitat use, home ranges, and population growth. But in heavily hunted populations, \u201cwe appear to have chaos,\u201d Wielgus says, with no adult males, an influx of immigrants from surrounding areas, home ranges and densities \u201cshifting all over the place,\u201d more infanticide, and far more cougar\u2013human conflicts. \u201cAnd we suspect\u2014this is what we're studying now\u2014that these teenage males cause more problems than older residents and that this heavy harvest exacerbates the problem rather than making it better.\u201dWhile state law prohibited WDFW officials from commenting publicly on I-655, agency biologists saw the two legislative measures authorizing hounds for safety hunts as an opportunity to reassert control of cougar management see . For theIronically, once the initiative to ban hound hunting passed, \u201cpresumably to protect cougars,\u201d Rob Wielgus says, \u201cit resulted in a big harvest of cougars, a decline in the female component, and the influx of teenage males. The road to hell is paved with good intentions. All my data suggest that we should go back to hound hunting, which is regulatory, density-dependent, and sustainable.\u201dWhereas hound hunters typically select for trophy toms, deer and elk hunters kill indiscriminately. \u201cHunters are up in a tree stand waiting for a deer to come by and all of a sudden they see a cougar,\u201d says WDFW's Rich Beausoleil. Before the big-game package was created, he says, \u201cthey wouldn't have had a license to take that cougar, but now, because they have the tag, they take it.\u201dBeausoleil and Donny Martorello, a WDFW carnivore expert, studied harvest statistics before and after the 1996 ban . Before Wielgus thinks that hound hunting may lead to a self-regulated, density-dependent harvest, a theory he's testing now. Hound hunters typically go where residents have reported an incident, and tend not to overharvest, since cougars occur at such low densities. But deer and elk hunters kill far more cougars incidentally. \u201cWe documented that as cougar numbers go down, deer numbers go up, and what I think is happening is that when deer numbers go up, you get more boot hunters, which means more guys with cougar tags in their pocket, so they kill more cougars, which means more deer, which means they kill more cougars,\u201d he explains. The smaller the cougar population, the higher the hunting. \u201cThat's inversely density-dependent,\u201d Wielgus says. \u201cSome people call that the road to extirpation.\u201dFor Wielgus, mounting evidence over the past decade argues that it's time to rethink wildlife management models. \u201cWe're learning all kinds of things that are counterintuitive,\u201d he says, like the notion that shooting animals may not reduce their numbers. Traditional management models have been based on white-tail populations in Pennsylvania and deer mice, he says, but large carnivore behavior and population dynamics are completely different.As for understanding the dynamics of cougar predation on endangered prey, Wielgus says that it's important to ask why the predators are there in large numbers. \u201cIf there's a really high density of white-tails, the predators are going to come in, so the long-term solution is getting the habitat back in shape such that it's not so attractive to white-tailed deer,\u201d he says. \u201cAnd if white-tails are expanding into areas where they're historically nonnative and wolves aren't there to kill them, which they historically may have done elsewhere, something has to take their place.\u201d Hunting may be the best short-term solution, Wielgus says. \u201cYou could say, \u2018Let's not hunt the white-tails,\u2019 but then it's bye-bye mountain caribou and bye-bye mule deer. Meanwhile our entire ecosystem is suffering.\u201dHeavy hunting, as Wielgus showed, alleviated predation pressure on endangered ungulates only by sending the cougar population to the brink of collapse. And heavy hunting on a smaller scale didn't even reduce the population, or the complaints, because of increased immigration. Since predatory behavior is learned\u2014a cougar might discover that caribou herds concentrated in small forest patches or livestock in fenced pastures make easy pickings\u2014individual cats can cause a lot of trouble see . When WiWDFW is now seeking public comment on its next game-management plan , which wFor the wildlife officials who spend their days mediating conflicts with cougars, the prospects for coexistence depend on public education. \u201cIf you put your dog out to do his business at 1 a.m. with no lights on and no noise, and a cougar just happens to be passing by, it's likely to figure out that lunch comes out the back door every night at one in the morning,\u201d says WDFW enforcement officer Jim Brown.Convincing the public to accept top predators as an integral part of a healthy landscape is Beausoleil's long-term goal. But it won't be easy. Gray wolves have been sighted around Lake Chelan, just west of Okanogan County, far from established packs in neighboring Idaho. \u201cIf the wolves get here, we won't even be thinking about cougars,\u201d says State Representative Kretz. \u201cThey're a hundred times worse.\u201dHunting was acting as a form of habitat degradation. The lightly hunted populations have stable habitat use, home ranges, and population growth. But in heavily hunted populations, chaos prevails.When top predators like cougars and wolves disappear, surprising things happen. By creating a \u201clandscape of fear,\u201d predators change prey behavior. Reintroducing gray wolves into Yellowstone National Park drove deer, elk, and moose out of willow stands, releasing grazing pressure on songbird habitat and increasing songbird diversity . The absSuch benefits are a tough sell among those who view large carnivores as threats to life and property. While public safety is still a top priority for WDFW, agency biologists, unlike politicians, must also worry about the needs of resident wildlife. \u201cOne of the things we'll never get a handle on is the folks who move to the end of a box canyon in the middle of nowhere, and maybe they come from the city, and they see a cougar and say, \u2018Hey, I saw a cougar, you've got to remove him,\u2019 \u201d says Beausoleil. \u201cWell, no, that's not what we do. You're living in cougar country now.\u201d He hopes that one day the developers whose brochures tout all the bounding hills, wildflowers, deer, and elk will tell people about all the bear and cougar there too.In 1946, US Fish and Wildlife biologist Stanley Young wrote that cougars \u201care so destructive to man's interests that they cannot be tolerated except in the wildest areas\u201d . But he The days when wildlife managers viewed the cat of many names as vermin to be eradicated are long gone. Modern managers promote predators' role as guardians of ecosystem integrity, but they are also employees of the state and must balance the needs of the species with the will of the electorate. As America's great stretches of wilderness rapidly disappear into the transfigured landscapes of advancing development, the fate of the cougar depends on whether \u201crational and civilized people\u201d can see that the world would be a poorer place without predators."}
{"text": "We introduce a generalization of the well-known ARCH process, widely used for generating uncorrelated stochastic time series with long-term non-Gaussian distributions and long-lasting correlations in the (instantaneous) standard deviation exhibiting a clustering profile. Specifically, inspired by the fact that in a variety of systems impacting events are hardly forgot, we split the process into two different regimes: a first one for regular periods where the average volatility of the fluctuations within a certain period of time  For the last years the physical community has broaden its subject goals to matters that some decades ago were too distant from the classical topics of Physics. Despite being apparently at odds with the standard motivations of Physics, this new trend has given an invaluable contribution toward a more connected way of making Science, thus leading to a better understanding of the world surrounding us In this work, we make use of the celebrated heteroscedastic model, the instantaneous volatility for mere historical reasons. Traditionally, a Gaussian is assigned to the random variable viz., price fluctuations modelling, the case The Engle's formulation of an autoregressive conditional heteroscedastic  As described above, the statistical features of the macroscopic observables are the result of the nature of the interactions between the microscopic elements of the system and the relation between microscopic as well as the macroscopic observables. In the case of the \u201cfinancial\u201d i.e., impact) in the system, no matter when they took place, by changing the surrounding conditions as agent-based models suggested In our case, we want to emphasize the fact that people tend to recall periods of high volatility . Thence, our proposal is nothing but the use of simple mechanisms that in a coarse-grained way master a good part of our decisions.We are therefore dealing with a model characterized by 5 parameters, namely: In this section we present the results obtained by the numerical implementation of the model. For comparison, we will use the results of a prior model that can be enclosed in the class of We have adjusted the probability distributions of Concerning the persistence of the volatility, we have settled on the Detrended Fluctuation Analysis (DFA) Let us now present our results for As we increase the value of Concerning the instantaneous volatility, Cases for which the kurtosis excess is relevant  log-index fluctuations, ent  see . Compari see .It is worthy to be mentioned that all the three values of the parameters are plausible. First, within an application context, i.e., fat tails and strong persistence), the distributions are very well described by a type-2 Gumbel distribution in large part of the domain, which explains the emergence of the tails.We have studied a generalization of the well-known http://mesonpi.cat.cbpf.br/ssolar/).Our results have been obtained from numerical simulation using code written in fortran language and run on the 64-bit ssolarII cluster ("}
{"text": "IL28B gene already found in different populations, mostly infected with viral genotypes 1 and 3. Egypt has the highest prevalence of HCV infection in the world, which is mostly due to viral genotype 4. We investigated the role of several IL28B SNPs in HCV spontaneous clearance in an Egyptian population. We selected nine SNPs within the IL28B genomic region covering the linkage disequilibrium (LD) block known to be associated with HCV clearance in European populations. These SNPs were genotyped in 261 HCV-infected Egyptian subjects (130 with spontaneous clearance and 131 with chronic infection). The most associated SNPs were rs12979860 (P\u200a=\u200a1.6\u00d710\u22127) and the non-synonymous IL28B SNP, rs8103142 (P\u200a=\u200a1.6\u00d710\u22127). Interestingly, three SNPs at the two bounds of the region were monomorphic, reducing the size of the LD block in which the causal variants are potentially located to \u223c20 kilobases. HCV clearance in Egypt was associated with a region of IL28B smaller than that identified in European populations, and involved the non-synonymous IL28B SNP, rs8103142.Spontaneous clearance of hepatitis C virus (HCV) occurs in \u223c30% of acute infections. Host genetics play a major role in HCV clearance, with a strong effect of single nucleotide polymorphisms (SNPs) of the  IL28B gene, which encodes IFN-\u03bb3, on spontaneous HCV clearance reported in populations of different backgrounds, mostly infected with viral genotypes 1 and 3  infects 170 million people worldwide and is thus a major Public Health problem IL28B, rs12979860, and the spontaneous clearance of HCV genotype 4 in an Egyptian sample IL28B SNPs in the spontaneous clearance of HCV in a larger Egyptian cohort. We found that the clearance effect was restricted to a region of IL28B smaller than that identified in European populations and that this effect also involved rs8103142, a non synonymous IL28B SNP.Egypt has the highest prevalence of HCV infection of any country in the world, with a seroprevalence ranging from 10% in children to 45% in adults http://www.unaids.org/en/regionscountries/countries/egypt) as well as among injection drug users (\u223c0.6%) This study combined data from two Egyptian cohorts. The first included 3994 individuals from a large epidemiological study in a village of the Nile delta, the details of which have been described elsewhere IL28B genomic region (IL28B) of these three SNPs, using the European CEU population available data from HapMap (http://www.hapmap.org) and 1000 Genomes project 2>0.3, with any of the three initial SNPs. Within the chromosome 19 region defined by these two SNPs, we included three additional regularly spaced SNPs  in LD, with an r2>0.3, with any of the three initial SNPs. Finally, we also selected the non synonymous SNP rs8103142 not present in the public databases but reported to be in strong LD with rs12979860 in European populations P-value<0.005 or low-quality genotype clustering. No individuals were excluded on the basis of genotyping call rate.We genotyped a total of nine SNPs within the c region . We firshttp://www.broad.mit.edu/mpg/haploview) software.Univariate tests of association between the genotyped SNPs and the clearance/persistence status of HCV infection were carried out using PLINK software IL28B region were monomorphic, whereas the frequencies of the other SNPs were similar to those observed in European populations. Univariate association analyses showed that the six polymorphic SNPs in the Egyptian population were strongly associated with spontaneous HCV clearance (\u22127] and rs8103142 . Association analyses conducted for these two SNPs separately in our two cohorts provided very similar results in terms of allele frequencies and odds-ratios indicating that possible HBV co-infection in some patients of our first cohort could not affect these results. In our whole sample, and taking rs8103142 as an example, the proportion of subjects with HCV clearance was much higher in subjects carrying the protective TT genotype (66% of clearers) than in those with CT (39% of clearers) or CC (23% of clearers) genotypes  was introduced into the model, the other five SNPs ceased to be significantly associated with clearance, confirming that this association was based on a single signal. We then estimated pairwise LD between the six polymorphic SNPs. The LD pattern of these SNPs, and that of rs12979860 in particular see , in thispulation . Interesn  haplotypes (one of which was much more common than the other) and five \u201cat risk\u201d haplotypes (conferring a predisposition to chronic infection) . The twoIL28B variants in the spontaneous clearance of HCV genotype 4 infection in an Egyptian population. In particular, the magnitude of the association with rs12979860 observed is similar to that reported in many studies conducted on HCV genotype 1 infection IL28B SNPs, showed that the LD block of the IL28B SNP cluster associated with HCV clearance was shorter than that in European populations. In particular, this analysis reduces the chromosomal region in which the causal SNPs are potentially located to about 20 kilobases of the IL28B genomic region, excluding the IL28A genomic region. Finally, both our univariate and haplotype analyses clearly showed that the core association depended on two SNPs, rs12979860 and rs8103142. SNP rs8103142 replaces a lysine residue by an arginine residue at position 70 (K70R) in IFN-\u03bb3, a substitution predicted to be benign by Polyphen IL28B involvement in HCV infection.These results confirm the major role of Figure S1Linkage disequilibrium pattern for the six polymorphic SNPs in the Egyptian and European populations. Panel A shows linkage disequilibrium (LD) in terms of r2 values between rs12979860 and the eight other genotyped SNPs in two different populations (Egyptian/European). European r2 values were estimated from the CEU data from Hapmap and the 1000 Genomes project, Egyptian values were estimated from our overall sample. No data for rs8103142 were available for the CEU population, so the r2 value for this SNP could not be estimated for the European population. The SNPs rs955155, rs10424607 and rs576832 were monomorphic in the Egyptian population, and it was therefore not possible to estimate r2 values for these SNPs in the Egyptian population. Panel B shows the pairwise r2 for combinations of the six polymorphic SNPs of the IL28B genomic region in both the Egyptian population  and the CEU European population . No data for rs8103142 were available for the CEU population. Differences of less than 10% between the two r2 values are indicated in dark grey; differences of less than 25% are shown in light grey and differences of more than 25% are shown in white.(DOC)Click here for additional data file."}
{"text": "L'ost\u00e9oporose endocrinienne devrait devenir rare aujourd'hui puisque les endocrinopathies ont b\u00e9n\u00e9fici\u00e9 d'un diagnostic plus pr\u00e9coce. Cependant elle reste fr\u00e9quente, sous diagnostiqu\u00e9e et peu prise en charge. Sa gravit\u00e9 est essentiellement li\u00e9e au risque fracturaire, et au risque \u00e9lev\u00e9 de morbi-mortalit\u00e9. Le but de notre travail est de d\u00e9terminer le profil ost\u00e9odensitom\u00e9trique des patients suivis pour endocrinopathie et de d\u00e9finir les caract\u00e9ristiques de l'ost\u00e9oporose et de l'ost\u00e9op\u00e9nie chez ces patients. Il s'agit d'une \u00e9tude de type transversale, descriptive portant sur 63 patients suivis pour endocrinopathies au service d'Endocrinologie-Diab\u00e9tologie du CHU Mohamed VI de Marrakech, s\u2019\u00e9talant sur une p\u00e9riode de 02 ans allant du d\u00e9but du mois de Janvier 2012 au mois de Janvier 2014. La moyenne d\u2019\u00e2ge des patients \u00e9tait de 36,30 \u00b1 15,38 ans, avec un sex-ratio de 0,31. Les pathologies endocriniennes \u00e9taient domin\u00e9es par l'hypogonadisme (32%), et par l'hypercorticisme (19%), suivis par l'hyperthyro\u00efdie (11%). Le T-score moyen au niveau du rachis et au niveau du f\u00e9mur \u00e9tait respectivement de -1,65% \u00b1 1,88 DS, et -0,85 \u00b1 1,70 DS. L'atteinte de la densit\u00e9 min\u00e9rale osseuse a \u00e9t\u00e9 plus fr\u00e9quente au niveau du rachis . L'ost\u00e9oporose a \u00e9t\u00e9 surtout constat\u00e9e au cours des hypogonadismes, hypercorticismes, hyperthyro\u00efdies et hyperparathyro\u00efdies. N\u00e9anmoins elle a \u00e9t\u00e9 observ\u00e9e \u00e9galement au cours des hypothyro\u00efdies et d'autres \u00e9tiologies non connues pour \u00eatre responsables d'une ost\u00e9oporose. Ce travail nous a ainsi conduits \u00e0 situer l'int\u00e9r\u00eat de rechercher syst\u00e9matiquement l'atteinte osseuse devant toute endocrinopathie susceptible de provoquer une atteinte rhumatologique. La plupart des pathologies endocriniennes ont un retentissement osseux qui est pris en compte dans la morbidit\u00e9 de ces maladies. En effet, le tissu osseux fait l'objet d'un perp\u00e9tuel remodelage sous contr\u00f4le, entre autres, de facteurs hormonaux. Ainsi, la plupart des d\u00e9sordres endocriniens s'accompagnent de remaniements de l'appareil ost\u00e9o-articulaire. Il s'agit principalement de l'ost\u00e9oporose . Cette dIl s'agit d'une \u00e9tude transversale, \u00e0 vis\u00e9e descriptive \u00e9tendue sur une p\u00e9riode de 02 ans allant du d\u00e9but du mois de Janvier 2012 au mois de Janvier 2014, int\u00e9ressant les patients suivis pour endocrinopathie au service et en consultation d'Endocrinologie-Diab\u00e9tologie du CHU Mohamed VI de Marrakech. Les crit\u00e8res d'exclusion sont: les patients suivis pour un rhumatisme inflammatoire et les patients suivis pour une maladie syst\u00e9mique. La saisie et l'analyse des donn\u00e9es ont \u00e9t\u00e9 r\u00e9alis\u00e9es \u00e0 l'aide du logiciel SPSS version 10.Caract\u00e9ristiques d\u00e9mographiques et cliniques: La moyenne d\u2019\u00e2ge de nos patients \u00e9tait de 36,30 \u00b1 15,38 ans, avec des extr\u00eames de 12 \u00e0 73 ans. On note une nette pr\u00e9dominance du sexe f\u00e9minin, avec un Sex-ratio de 0,3. La moyenne de l'indice de masse corporelle des patientes \u00e9tait de 25,12 \u00b1 6,22 Kg/m2. Tandis que celle des patients \u00e9tait de 23,72 \u00b1 7,28 Kg/m2. Les femmes m\u00e9nopaus\u00e9es repr\u00e9sentaient 27,1% de la population de l\u2019\u00e9tude. Les autres comorbidit\u00e9s sont repr\u00e9sent\u00e9es par l'hypertension art\u00e9rielle , le diab\u00e8te , la dyslipid\u00e9mie  et le tabagisme .Nature de l'endocrinopathie: le motif de consultation des patients \u00e9tait domin\u00e9 par l'am\u00e9norrh\u00e9e primaire et secondaire (16%), le syndrome de cushing (16%) et les hyperthyro\u00efdies (10%). Le d\u00e9lai entre le d\u00e9but des sympt\u00f4mes et la premi\u00e8re consultation \u00e9tait de 5,5 ans \u00b1 8,3 ans. Les pathologies endocriniennes chez cette population \u00e9taient tr\u00e8s diversifi\u00e9es. Elles \u00e9taient domin\u00e9es par l'hypogonadisme rencontr\u00e9 dans 32% des cas et par l'hypercorticisme dans 19% des cas, suivis par l'hyperthyro\u00efdie constat\u00e9e chez 11% des patients , le T-score moyen au niveau du rachis \u00e9tait de -1,65% \u00b1 1,88 DS le qualifiant d'ost\u00e9op\u00e9nique, avec un T-score moyen f\u00e9moral de -0,85 \u00b1 1,70 DS. L'atteinte de la DMO a \u00e9t\u00e9 plus fr\u00e9quente au niveau du rachis  avec une ost\u00e9oporose dans 36,5% des cas et une ost\u00e9op\u00e9nie dans 25,4% des cas. L'atteinte f\u00e9morale a \u00e9t\u00e9 surtout une ost\u00e9op\u00e9nie, pr\u00e9sente chez 26,4% des patients avec une ost\u00e9oporose chez seulement 17,5% des cas   .Au cours de l'hypogonadisme: les anomalies de la DMO rachidienne ont \u00e9t\u00e9 constat\u00e9es dans 75% des cas avec hypogonadisme, avec essentiellement une ost\u00e9oporose dans 45% des cas. Cette derni\u00e8re avait concern\u00e9e 13,3% des cas au niveau du f\u00e9mur, avec une ost\u00e9op\u00e9nie f\u00e9morale dans 40% des cas.Au cours de l'hypercorticisme: chez les patients avec hypercorticisme, l'atteinte de la DMO rachidienne avait concern\u00e9 66,7% des patients, avec une ost\u00e9oporose dans 50% des cas et une ost\u00e9op\u00e9nie dans 16,7% des cas. L'atteinte de la DMO f\u00e9morale a \u00e9t\u00e9 constat\u00e9e chez 33,3% des patients.Au cours de l'hyperthyro\u00efdie: le pourcentage de l'ost\u00e9oporose rachidienne a \u00e9t\u00e9 de 33,3% au cours de l'hyperthyro\u00efdie, tandis que l'ost\u00e9op\u00e9nie rachidienne a \u00e9t\u00e9 observ\u00e9e chez 33,3% des patients. Au niveau du f\u00e9mur, l'ost\u00e9op\u00e9nie a \u00e9t\u00e9 constat\u00e9s chez 66,7% des patients.Au cours de l'hyperparathyro\u00efdie: parmi les patients ayant une hyperparathyro\u00efdie, 33,3% avaient une ost\u00e9oporose rachidienne, et 33,3% avaient une ost\u00e9op\u00e9nie rachidienne. L'atteinte de la DMO f\u00e9morale a \u00e9t\u00e9 constat\u00e9e chez 66,7% des patients.Au cours des autres endocrinopathies: l'analyse de l'atteinte de la DMO dans les autres endocrinopathies avait montr\u00e9 une ost\u00e9oporose dans 25% des cas d'hypothyro\u00efdie, dans 50% des cas ph\u00e9ochromocytome, et dans 22,2% des cas d'hyperparathyro\u00efdie. L'ost\u00e9op\u00e9nie a \u00e9tait constat\u00e9e respectivement chez 37,5%, 25% et 22,2% des patients.La chronologie d\u00b4apparition de l'atteinte de la DMO: l'atteinte de la DMO a \u00e9t\u00e9 diagnostiqu\u00e9e essentiellement apr\u00e8s ou simultan\u00e9ment \u00e0 la d\u00e9couverte de l'endocrinopathie, par contre elle en \u00e9tait r\u00e9v\u00e9latrice dans 14% des cas  et des ost\u00e9oblastes (formation). Cette balance formation-r\u00e9sorption est plac\u00e9e sous l'influence de nombreux facteurs, notamment nutritifs et endocriniens . De nombCertaines ont un effet anabolique sur le tissu osseux en favorisant l'action des ost\u00e9oblastes ou en inhibant celle des ost\u00e9oclastes: l'hormone de croissance (GH) et l'insulin-like growth factor 1 (IGF1), l'insuline et les st\u00e9ro\u00efdes sexuels  . D'autreIl s'agit des prostaglandines dont la PGE2, des interleukines, de facteurs de croissance \u00e9pidermiques qui sont des acteurs locaux activateurs des ost\u00e9oclastes. \u00c0 l'inverse, le monoxyde d'azote (NO) inhibe la r\u00e9sorption osseuse .L'activit\u00e9 physique a \u00e9galement un effet sur le remodelage osseux. Les forces de d\u00e9formation et de pression modifient l'activit\u00e9 de remodelage osseux. Une ost\u00e9op\u00e9nie est d'ailleurs observ\u00e9e apr\u00e8s un s\u00e9jour en microgravit\u00e9 .L'ost\u00e9oporose cortisonique est la premi\u00e8re cause des ost\u00e9oporoses secondaires. Longtemps n\u00e9glig\u00e9e, son importance grandit, notamment dans le cadre de nouvelles indications de corticoth\u00e9rapie au long cours. En effet Il existe un lien \u00e9pid\u00e9miologique certain entre la corticoth\u00e9rapie et les fractures. Certaines \u00e9tudes estiment m\u00eame que des fractures surviennent chez 30 \u00e0 50% des patients sous cortico\u00efdes au long cours. Enfin, l'exc\u00e8s de cortico\u00efdes favorise l'apparition d'un hypogonadisme et la diminution de production d'androg\u00e8nes surr\u00e9naliens [L'hypogonadisme est la deuxi\u00e8me cause d'ost\u00e9oporose secondaire apr\u00e8s la corticoth\u00e9rapie . Il reprLa PTH stimule la r\u00e9sorption osseuse et donc le flux de calcium et de phosphate de l'os vers le plasma. Elle augmente la r\u00e9absorption tubulaire du calcium et diminue celle des phosphates. Elle stimule enfin la 1\u2019-hydroxylase r\u00e9nale dans le tubule proximal. L'hypers\u00e9cr\u00e9tion de PTH par les glandes parathyro\u00efdes est la cons\u00e9quence d'une production excessive, inappropri\u00e9e de PTH ayant pour principale cons\u00e9quence m\u00e9tabolique une hypercalc\u00e9mie. La plupart des hyperparathyro\u00efdies sont asymptomatiques, de d\u00e9couverte fortuite au cours d'un bilan biologique ou d'une \u00e9chographie cervicale . L'hyperLes hormones thyro\u00efdiennes T3, T4) sont des activateurs du m\u00e9tabolisme de base. Leur s\u00e9cr\u00e9tion est plac\u00e9e sous le contr\u00f4le de la TSH hypophysaire, elle m\u00eame plac\u00e9e sous l'influence de la s\u00e9cr\u00e9tion hypothalamique de TRH. Chez l'enfant, elles jouent principalement un r\u00f4le dans la croissance et la maturation du tissu osseux . L'ost\u00e9o, T4 sontLes autres endocrinopathies \u00e9taient tr\u00e8s peu repr\u00e9sent\u00e9es dans notre s\u00e9rie avec un effectif insuffisant pour pouvoir en d\u00e9duire des conclusions.L'atteinte de la DMO au cours des pathologies endocriniennes est fr\u00e9quente mais reste sous diagnostiqu\u00e9e et peu prise en charge. Sa gravit\u00e9 est li\u00e9e au risque accru de complications, entre autres une augmentation du risque fracturaire, qui est un puissant facteur de risque de morbi-mortalit\u00e9 prouv\u00e9 dans la litt\u00e9rature. La grande fr\u00e9quence en population g\u00e9n\u00e9rale et l'importance du retentissement osseux des hyperparathyro\u00efdies, hyperthyro\u00efdies et des situations d'hypogonadisme et d'hypercorticisme les placent parmi les pathologies endocriniennes pour lesquelles l\u2019\u00e9valuation osseuse est la mieux connue. Ce travail montre une fr\u00e9quence \u00e9lev\u00e9e de l'ost\u00e9oporose et de l'ost\u00e9op\u00e9nie chez les patients suivis pour des pathologies endocriniennes, m\u00eame les moins connues pour l'avoir entrain\u00e9e. Il nous a ainsi conduits \u00e0 situer l'int\u00e9r\u00eat de rechercher syst\u00e9matiquement l'atteinte osseuse devant toute endocrinopathie susceptible de provoquer une atteinte rhumatologique. Mais aussi l'int\u00e9r\u00eat d'un bilan \u00e9tiologique bien conduit, \u00e0 la recherche d'une pathologie endocrinienne devant toute ost\u00e9oporose ou ost\u00e9op\u00e9nie."}
{"text": "Le but de notre travail est de d\u00e9terminer le profil des auto-anticorps chez 30 patients ayant un lupus syst\u00e9mique avec ou sans atteinte r\u00e9nale afin d\u2019\u00e9tablir une corr\u00e9lation clinico-immunologique entre la n\u00e9phropathie lupique et ces auto-anticorps. Il s'agit d'une \u00e9tude transversale de 30 patients atteints de lupus \u00e9ryth\u00e9mateux syst\u00e9mique diagnostiqu\u00e9s au service de dermatologie durant la p\u00e9riode de D\u00e9cembre 2010 \u00e0 D\u00e9cembre 2012 et r\u00e9alis\u00e9e conjointement avec le laboratoire d'immunologie. Les anticorps anti-ADN \u00e9taient retrouv\u00e9s chez 17 patients (56.7%) suivis des anti-SSA dans 12 cas (40%). Cinq patients (62.5%) ayant une atteinte r\u00e9nale avaient des anticorps anti DNA n\u00e9gatifs. Parmi ces patients avec atteinte r\u00e9nale, 37.5% avaient des anticorps anti SSA sans anticorps anti DNA. La moiti\u00e9 des patients ayant une atteinte r\u00e9nale (50%) avaient des anticorps anti SSA positifs. Notre s\u00e9rie montre l'importance des anticorps anti-SSA surtout chez des patients avec des anticorps anti-DNA n\u00e9gatifs non seulement pour le diagnostic du lupus syst\u00e9mique mais aussi pour d\u00e9celer certaines manifestations syst\u00e9miques comme l'atteinte r\u00e9nale. Le lupus \u00e9ryth\u00e9mateux syst\u00e9mique (LES) est une maladie auto-immune caract\u00e9ris\u00e9e par la production d'un large panel d'auto anticorps: les anticorps antinucl\u00e9aires particuli\u00e8rement les anticorps anti-DNA natifs. De nombreuses publications ont \u00e9tabli une corr\u00e9lation clinico-immunologique de patients atteints de LES, mais peu d\u2019\u00e9tudes se sont int\u00e9ress\u00e9es de mani\u00e8re pr\u00e9cise \u00e0 la pr\u00e9valence des diff\u00e9rents auto-anticorps en cas d'atteinte r\u00e9nale. En effet, la n\u00e9phropathie lupique est fr\u00e9quente dans l\u2019\u00e9volution du lupus syst\u00e9mique (20 \u00e0 50% des cas selon les s\u00e9ries) et influence consid\u00e9rablement le pronostic fonctionnel et vital de cette pathologie . La survIl s'agit d'une \u00e9tude transversale de 30 patients atteints de lupus \u00e9ryth\u00e9mateux syst\u00e9mique diagnostiqu\u00e9s au service de Dermatologie au CHU Ibn Rochd de Casablanca. Elle a \u00e9t\u00e9 r\u00e9alis\u00e9e conjointement avec le laboratoire d'immunologie et a \u00e9t\u00e9 men\u00e9e sur une p\u00e9riode de deux ann\u00e9es (D\u00e9cembre 2010-D\u00e9cembre 2012). Les patients remplissaient au minimum quatre crit\u00e8res de l'American Coll\u00e8ge of Rheumatology (ACR) [Parmi les 30 patients, 26 \u00e9taient de sexe f\u00e9minin et 4 de sexe masculin avec un sexe ratio H/F de 0.15. La moyenne d\u2019\u00e2ge \u00e9tait de 35 ans avec des extr\u00eames de 14 \u00e0 59 ans. Les manifestations cutan\u00e9es \u00e9taient observ\u00e9es chez 29 malades (96.7%) et l'atteinte h\u00e9matologique chez 28 patients . Huit patients avaient une atteinte r\u00e9nale soit 26.7%. La n\u00e9phropathie lupique a \u00e9t\u00e9 class\u00e9e de type III de l'OMS dans 2 cas, de type IV dans 4 cas et de type V dans 2 cas. Les AAN ont \u00e9t\u00e9 positifs chez 25 des 30 patients, avec un aspect mouchet\u00e9 (40%) et homog\u00e8ne (23.3%). Les anticorps anti-ADN \u00e9taient retrouv\u00e9s chez 17 patients (56.7%) suivis des anti-SSA dans 12 cas (40%), anti SM/RNP dans 7 cas (23.3%), anti SSB et anti nucl\u00e9osome chez respectivement 6 cas (20%), anticorps antihistone dans 3 cas (10%) et anticorps anti SM dans 2 cas (6.7%). Cinq patients (62.5%) ayant une atteinte r\u00e9nale avaient des anticorps anti DNA n\u00e9gatifs . Parmi cDans cette s\u00e9rie, la moiti\u00e9 des patients atteints de lupus syst\u00e9mique n'avaient pas d'anticorps anti-DNA. Dans ce groupe, parmi ceux ayant une atteinte r\u00e9nale, 37.5% avaient des anticorps anti-SSA positifs. Ainsi, l'apport des anticorps anti-SSA parait fondamental en cas de lupus syst\u00e9mique avec atteinte r\u00e9nale. Certes, notre s\u00e9rie se heurte au biais du faible \u00e9chantillonnage, n\u00e9anmoins; il s'agit d'une \u00e9tude prospective men\u00e9e dans un service de dermatologie ayant utilis\u00e9 un panel d'auto-anticorps repr\u00e9sentatif. Ceci a permis par cons\u00e9quent une comparaison plus large et une corr\u00e9lation clinico-immunologique entre diff\u00e9rents auto-anticorps en mati\u00e8re de n\u00e9phropathie lupique. Dans notre s\u00e9rie, l'atteinte r\u00e9nale \u00e9tait not\u00e9e dans 26.7% des cas qui \u00e9taient dans leur majorit\u00e9 des stades avanc\u00e9s IV et V (75%). La fr\u00e9quence de cette atteinte r\u00e9nale dans notre contexte est en accord avec les donn\u00e9es de la litt\u00e9rature (20 \u00e0 50% des cas selon les s\u00e9ries) . Cette aUn suivi r\u00e9gulier des patients lupiques avec anticorps anti SSA positifs surtout ceux avec des anti-DNA n\u00e9gatifs s'impose afin de d\u00e9celer une atteinte syst\u00e9mique notamment r\u00e9nale d'autant plus que cette manifestation est s\u00e9v\u00e8re dans notre contexte."}
{"text": "Cette \u00e9tude visait \u00e0 \u00e9valuer la performance du syst\u00e8me de gestion logistique (SGL) des intrants de lutte contre le paludisme (ILP) dans le D\u00e9partement du Littoral, au B\u00e9nin, en 2017.Il s\u2019agissait d\u2019une \u00e9tude transversale \u00e9valuative qui s\u2019\u00e9tait d\u00e9roul\u00e9e en juin 2017. Elle portait sur les structures de stockage et de cession des ILP ainsi que le personnel impliqu\u00e9 dans leur gestion. La performance du SGL \u00e9tait \u00e9valu\u00e9e \u00e0 partir de la conformit\u00e9 observ\u00e9e pour les composantes et sous-composantes de la \u00ab Structure \u00bb, du \u00ab Processus \u00bb et des \u00ab R\u00e9sultats \u00bb par rapport aux normes ou standards d\u00e9finis par le Minist\u00e8re de la Sant\u00e9.Un total de 36 structures a \u00e9t\u00e9 enqu\u00eat\u00e9 avec leurs cibles secondaires. Il r\u00e9sulte que 52,78% des d\u00e9p\u00f4ts r\u00e9partiteurs r\u00e9unissaient les conditions optimales de stockage des intrants alors que seulement 33,33% des agents charg\u00e9s de la gestion des ILP \u00e9taient form\u00e9s en gestion logistique. La performance du SGL des ILP \u00e9tait insuffisante . La structure, ainsi que le processus avaient une conformit\u00e9 Insuffisante par rapport aux normes , engendrant des r\u00e9sultats jug\u00e9s mauvais . La sous-composante la plus insuffisante \u00e9tait le syst\u00e8me d\u2019information de la gestion logistique (SIGL).Cette \u00e9tude met en \u00e9vidence la place du SIGL pour une meilleure performance de la gestion des ILP. Une attention particuli\u00e8re devra \u00eatre accord\u00e9e \u00e0 ce volet. Le paludisme est la maladie parasitaire la plus r\u00e9pandue dans le monde . En 2016Type d\u2019\u00e9tude: Il s\u2019agit d\u2019une \u00e9tude transversale \u00e9valuative qui s\u2019est d\u00e9roul\u00e9e dans le d\u00e9partement du Littoral du 6 au 29 juin 2017.Population d\u2019\u00e9tude: Les cibles primaires de notre \u00e9tude \u00e9taient constitu\u00e9es par les d\u00e9p\u00f4ts de pharmacie  et points de cession des ILP) des FS publiques et priv\u00e9es du d\u00e9partement du Littoral. Les Cibles secondaires \u00e9taient: les gestionnaires des d\u00e9p\u00f4ts r\u00e9partiteurs de zones (GDRZ), les responsables des entrep\u00f4ts des FS, les commis \u00e0 la vente des m\u00e9dicaments (au point de cession), les b\u00e9n\u00e9ficiaires des ILP, les responsables de FS et le chef du service de pharmacie et pharmacovigilance du programme national de lutte contre le paludisme (PNLP).Echantillonnage: Trente-deux FS ont \u00e9t\u00e9 s\u00e9lectionn\u00e9s par tirage al\u00e9atoire simple, sur les 52 du d\u00e9partement. Les responsables de ces FS, ainsi que les responsables de d\u00e9p\u00f4ts et commis des postes de cession ont \u00e9t\u00e9 enqu\u00eat\u00e9s. De m\u00eame, les d\u00e9p\u00f4ts r\u00e9partiteurs des quatre zones sanitaires (ZS) du d\u00e9partement, ainsi que leurs responsables ont \u00e9t\u00e9 \u00e9galement enqu\u00eat\u00e9s. Un b\u00e9n\u00e9ficiaire, identifi\u00e9 par commodit\u00e9, a \u00e9t\u00e9 enqu\u00eat\u00e9 dans chaque FS.La performance du SGL des intrants de lutte contre le paludisme a \u00e9t\u00e9 appr\u00e9ci\u00e9e sur la base de la combinaison des scores de conformit\u00e9 de la structure, du processus gestionnaire et des r\u00e9sultats, par rapport aux normes du Minist\u00e8re de la Sant\u00e9 , 7. La sLes donn\u00e9es ont \u00e9t\u00e9 recueillies par des enqu\u00eateurs form\u00e9s. Les outils utilis\u00e9s sont: un questionnaire pour les gestionnaires de DRZ, responsables d\u2019entrep\u00f4ts de FS, les commis \u00e0 la vente et clients externes; un guide d\u2019entretien pour les responsables de FS et le chef du service de pharmacie et pharmacovigilance du PNLP; une fiche de d\u00e9pouillement des outils de gestion; une grille d\u2019observation des magasins et entrep\u00f4ts. Les outils ont \u00e9t\u00e9 pr\u00e9-test\u00e9s dans deux FS du d\u00e9partement de l\u2019Atlantique avant l\u2019enqu\u00eate, puis corrig\u00e9s au besoin.\u00ae et analys\u00e9es avec le logiciel STATA.11. Les proportions de conformit\u00e9 par rapport aux normes ont \u00e9t\u00e9 calcul\u00e9es globalement pour les 36 structures \u00e9valu\u00e9es, par sous-composante, puis par composante.Les donn\u00e9es ont \u00e9t\u00e9 saisies \u00e0 l\u2019aide du logiciel ExcelL\u2019enqu\u00eate a \u00e9t\u00e9 autoris\u00e9e par le Minist\u00e8re de la sant\u00e9 et les responsables d\u00e9partementaux ainsi que ceux de chacune des FS. Le consentement oral des participants a \u00e9t\u00e9 obtenu avant leur implication dans l\u2019enqu\u00eate. Leur anonymat a \u00e9t\u00e9 conserv\u00e9 lors du traitement des donn\u00e9es.L\u2019ensemble des 36 structures pr\u00e9vues ont \u00e9t\u00e9 enqu\u00eat\u00e9es, dont quatre d\u00e9p\u00f4ts r\u00e9partiteurs, 32 entrep\u00f4ts de FS, dont 12 publics, 18 priv\u00e9s et deux confessionnels. Par ailleurs, 32 responsables de FS, 32 commis \u00e0 la vente des ILP et autres intrants, 01 chef du service de pharmacie et pharmacovigilance du PNLP et 32 b\u00e9n\u00e9ficiaires des ILP dans les FS ont \u00e9t\u00e9 enqu\u00eat\u00e9s.Disponibilit\u00e9 des ressources humaines: chaque DRZ est g\u00e9r\u00e9 par un comptable qui assure aussi la comptabilit\u00e9 du bureau de zone. Au niveau des entrep\u00f4ts des FS, on notait une \u00e0 trois personnes charg\u00e9e(s) de la gestion des m\u00e9dicaments et ILP. Les profils des responsables se pr\u00e9sentent comme suit: 14 comptables ; 9 aide soignants ; 6 Infirmiers . Les autres  sont 3 et repr\u00e9sentent 9,37%. Le nombre d\u2019ann\u00e9es m\u00e9dian d\u2019exp\u00e9rience des agents dans la gestion des d\u00e9p\u00f4ts est de 5 ans . Dix agents (dont 8 du secteur public) sur les 36, soit 27,78% \u00e9taient \u00e0 leur poste il y a moins de 3 ans.Formation du personnel en gestion logistique: des 36 agents de d\u00e9p\u00f4ts pharmaceutiques, 12 (dont 2 Gestionnaires de DRZ), soit 33,33% ont b\u00e9n\u00e9fici\u00e9 d\u2019une formation en gestion logistique des ILP. Parmi eux, 4 ont b\u00e9n\u00e9fici\u00e9 d\u2019une remise \u00e0 niveau au cours des 3 derni\u00e8res ann\u00e9es. Il n\u2019y a pas eu de nouvelle formation au cours de 3 derni\u00e8res ann\u00e9es.Supervision: des 36 agents enqu\u00eat\u00e9s, 31, soit 86,11% ont d\u00e9clar\u00e9 avoir \u00e9t\u00e9 supervis\u00e9s au moins une fois au cours des trois derniers mois par leur hi\u00e9rarchie. Les \u00e9quipes de supervision venaient de la direction d\u00e9partementale de la sant\u00e9 (DDS), du PNLP ou parfois \u00e9taient des \u00e9quipes conjointes.Infrastructures et moyens de transport des ILP: Dix-neuf structures (2 DRZ et 17 entrep\u00f4ts de FS) sur les 36, soit 52,78% disposant de magasin r\u00e9unissent au moins 80% des conditions optimales pour le stockage des ILP. Parmi ces derni\u00e8res, on retrouve seulement cinq FS priv\u00e9es sur les 18 enqu\u00eat\u00e9es.Outils de gestion de stocks des ILP: Vingt-trois (23) structures sur les 36, soit 63,89% disposaient de 100% des fiches de gestion de stock des 12 ILP \u00e0 l\u2019\u00e9tude. Le remplissage des fiches \u00e9tait \u00e0 jour dans 47,22% des cas, soit 17 structures sur les 36.\u00ae) \u00e9tait disponible au niveau des quatre DRZ. Trois GDRZ sur 4 \u00e9taient form\u00e9s \u00e0 son utilisation. Il \u00e9tait fonctionnel et utilis\u00e9 pour les activit\u00e9s dans deux DRZ sur les 4.Trois DRZ sur les quatre et 8 entrep\u00f4ts de FS sur les 32 enqu\u00eat\u00e9s (25%) avaient transmis les rapports des 6 derniers mois en respectant le d\u00e9lai et le rythme (la promptitude). La compl\u00e9tude des rapports des FS au niveau des DRZ pour les 6 derniers mois \u00e9tait de 67,91% soit 67 rapports re\u00e7us sur 110 attendus. Dans 21 structures sur 36, soit 58,33% on notait une discordance entre les donn\u00e9es du rapport et celles de l\u2019inventaire physique au moment de l\u2019\u00e9laboration des rapport/commandes. Le logiciel de gestion  des structures disposaient de la liste des ILP retenus par la politique nationale et s\u2019y r\u00e9f\u00e8rent pour les commandes. La quantification des besoins en ILP se fait \u00e0 chaque niveau de la pyramide et 77,78 % des responsables de la gestion des ILP en sont responsables. Les niveaux minimum et maximum des diff\u00e9rents ILP ont \u00e9t\u00e9 d\u00e9finis dans 14 structures sur les 36 enqu\u00eat\u00e9es, soit 38,89%. Selon les GDRZ et des entrep\u00f4ts des FS la faible disponibilit\u00e9 des intrants au niveau central limite leur application.Nous avons trouv\u00e9 que 66,67% des structures r\u00e9unissaient 80% et plus de crit\u00e8res normatifs de stockage des ILP dans les magasins. Toutes les structures (100%) respectent le stockage des p\u00e9rim\u00e9s mais 31 sur 36, soit 86,11% avaient encore des intrants p\u00e9rim\u00e9s dans les FS.La disponibilit\u00e9 des ILP a \u00e9t\u00e9 appr\u00e9ci\u00e9e sur douze intrants traceurs. Dans les DR, la disponibilit\u00e9 des ILP dans les DRZ le jour de l\u2019enqu\u00eate et au cours des 6 derniers mois est r\u00e9sum\u00e9 sur la Au cours des six derniers mois, le taux de disponibilit\u00e9 des ILP dans les DRZ variait de 0% (pour l\u2019Art\u00e9m\u00e9ther 20 et 80 mg) \u00e0 100% (pour la SP). Dans les FS ce taux variait entre 11,70% pour Art\u00e9m\u00e9ther 20 mg et 86,36% pour la Quinine injectable 600 mg .Un gestionnaire de DRZ sur les 4 et 28,12% des responsables d\u2019entrep\u00f4ts de FS ont d\u00e9clar\u00e9 avoir \u00e9t\u00e9 satisfaits de la livraison des quantit\u00e9s d\u2019ILP command\u00e9es. Sur 32 clients externes interrog\u00e9s, 22 ont d\u00e9clar\u00e9 \u00eatre satisfaits de la disponibilit\u00e9 des ILP dans les FS ; ils repr\u00e9sentent 68,75%. Vingt et neuf d\u2019entre eux, soit 90,63% trouvaient que les prix des intrants vendus \u00e9taient supportables.La conformit\u00e9 des sous-composantes de la \u00ab Structure \u00bb variait de 47,30% pour le SIGL, \u00e0 76,85% pour \u00ab l\u2019infrastructure et les moyens de transport \u00bb. La conformit\u00e9 de la sous-composante \u00ab Technologie \u00bb \u00e9tait \u00e0 75%; celle des \u00ab outils de gestion \u00bb, des \u00ab ressources financi\u00e8res \u00bb et des \u00ab Ressources Humaines \u00bb \u00e9taient respectivement de 73,73%, 68,33%, et 53,09%. L\u2019appr\u00e9ciation de la performance de la composante \u00ab Structure \u00bb est insuffisante avec conformit\u00e9 de 63,20% du total attendu . La confCette \u00e9tude a permis d\u2019appr\u00e9cier le niveau de performance du SGL des ILP dans le d\u00e9partement du Littoral en 2017. Elle a identifi\u00e9 comme point de faiblesse majeur, l\u2019insuffisance de mise en \u0153uvre du SIGL. Les 36 structures (32 entrep\u00f4ts de FS et 4 DRZ) pr\u00e9vus ont \u00e9t\u00e9 investigu\u00e9s, avec leurs cibles secondaires. Elles repr\u00e9sentent 60% des FS du d\u00e9partement. Les 32 entrep\u00f4ts, s\u00e9lectionn\u00e9s de mani\u00e8re al\u00e9atoire, regroupaient aussi bien des FS publiques que priv\u00e9es. La m\u00e9thode d\u2019\u00e9chantillonnage ainsi que l\u2019effectif des cibles, garantissent donc la repr\u00e9sentativit\u00e9 des r\u00e9sultats \u00e0 l\u2019\u00e9chelle du d\u00e9partement.La sous-composante ressources humaines a \u00e9t\u00e9 appr\u00e9ci\u00e9e \u00ab Insuffisante \u00bb avec 53,09% du score attendu, compte tenu des insuffisances not\u00e9es en termes d\u2019effectif (surtout au niveau des DRZ), de qualification, de formation et d\u2019organisation. Au niveau des DRZ il n\u2019y avait qu\u2019un seul agent, le comptable, ayant par ailleurs d\u2019autres charges au bureau de zone, alors qu\u2019il devrait \u00eatre second\u00e9 par un magasinier ou un logisticien. Seulement 33,33% des agents ont b\u00e9n\u00e9fici\u00e9 d\u2019une formation en gestion logistique des ILP. Cette proportion est en de\u00e7\u00e0 des r\u00e9sultats obtenus par Kolapo et al.  en R\u00e9pubIl r\u00e9sulte de l\u2019\u00e9tude que 52,78% des structures enqu\u00eat\u00e9es disposaient de magasin r\u00e9unissant au moins 80% des conditions optimales pour le stockage des ILP et autres intrants/m\u00e9dicaments. En RDC, 64,2% la proportion des FS remplissait au moins 80% des conditions de stockage de produits contraceptifs . Au Nig\u00e9Cette sous-composante a \u00e9t\u00e9 appr\u00e9ci\u00e9e \u00ab mauvaise \u00bb avec 47,30% du score attendu. Des points faibles du SIGL observ\u00e9s sont: la faible promptitude et compl\u00e9tude des rapports des FS et DRZ; une faible proportion de gestionnaires des ILP form\u00e9s sur le remplissage des outils du SIGL  avec pour corollaire des insuffisances dans le remplissage des fiches de gestion de stock. Cette situation pr\u00e9valait aussi bien dans les FS publiques que priv\u00e9es et \u00e9tait d\u2019autant plus important que les structures priv\u00e9es sont les plus nombreuses et tr\u00e8s faiblement impliqu\u00e9es dans les activit\u00e9s de lutte contre le paludisme. Diagne et al. en 2012 . Ce mauvLa quantification des besoins en ILP se faisait par les structures elles-m\u00eames dans 77,78% sous la responsabilit\u00e9 des gestionnaires des ILP. Mais le processus a des d\u00e9faillances li\u00e9es \u00e0 la faible disponibilit\u00e9 des donn\u00e9es du SIGL pour la prise de d\u00e9cisions. En effet dans notre \u00e9tude, seulement 47,67% des structures utilisaient les donn\u00e9es du SIGL pour l\u2019estimation des besoins. Contrairement aux observations de Adino et al. en 2011 \u00e0 Addis-Abeba , les quaDans la pr\u00e9sente \u00e9tude, 63,89% des structures disposaient de 100% des fiches de gestion de stock des 12 ILP \u00e9valu\u00e9s. La compl\u00e9tude des fiches \u00e9tait bonne dans 47,22% des structures enqu\u00eat\u00e9es. Selon Ou\u00e9draogo et al. [Le jour de la visite, tous les DRZ et toutes les FS \u00e9taient en rupture d\u2019au moins un intrant. La diversit\u00e9 des intrants, leur faible disponibilit\u00e9 au niveau des agences de la CAME, les insuffisances dans l\u2019utilisation des outils de gestion par les FS, le manque de rigueur dans le suivi des consommations des intrants \u00e0 tous les niveaux sont autant d\u2019\u00e9l\u00e9ments susceptibles d\u2019expliquer ces r\u00e9sultats. La faible disponibilit\u00e9 des intrants dans les agences de la CAME s\u2019exprime par la non satisfaction des quantit\u00e9s et des diff\u00e9rents types d\u2019intrants command\u00e9s par les DRZ. Des auteurs ont diversement obtenu d\u2019autres r\u00e9sultats. Ou\u00e9draogo et al en 2006 en RDC  ont trouIl se d\u00e9gage des relations de cause \u00e0 effet entre les r\u00e9sultats des diff\u00e9rentes sous-composantes dans notre \u00e9tude. En effet, l\u2019insuffisance en nombre et en formation des ressources humaines charg\u00e9es de la gestion des ILP, coupl\u00e9e \u00e0 des insuffisances dans leur supervision peut avoir pour cons\u00e9quences les faiblesses dans l\u2019ex\u00e9cution des diff\u00e9rentes fonctions du cycle logistique, notamment la mise en \u0153uvre du SIGL. Ces faiblesses vont se r\u00e9percuter dans la disponibilit\u00e9 des intrants. La non-conformit\u00e9 des magasins de stockage aura des effets n\u00e9gatifs sur la qualit\u00e9 des intrants \u00e0 offrir aux b\u00e9n\u00e9ficiaires, l\u2019ensemble engendrant une performance globale du SGL des ILP jug\u00e9e insuffisante.La pr\u00e9sente a r\u00e9v\u00e9l\u00e9 que la performance globale du SGL des ILP dans le d\u00e9partement du Littoral en 2017 \u00e9tait \u00ab Insuffisante \u00bb. Des points faibles les plus importants identifi\u00e9s portaient sur le SIGL, avec pour corollaires, la faible disponibilit\u00e9 des intrants ainsi que la faible disponibilit\u00e9 et utilisation des donn\u00e9es du syst\u00e8me pour les prises de d\u00e9cisions. Vu l\u2019importance des intrants dans la lutte globale contre le paludisme, la mise en place dans les centres de sant\u00e9 y compris le secteur priv\u00e9, d\u2019une d\u00e9marche qualit\u00e9 portant sur le SIGL ainsi que le d\u00e9veloppement d\u2019un syst\u00e8me de veille pour l\u2019identification et la destruction des circuits parall\u00e8les d\u2019approvisionnement et d\u2019introduction d\u2019intrants hors la liste officielle sont n\u00e9cessaires.Il existe des dysfonctionnements dans la gestion des ILP au B\u00e9nin comme dans plusieurs autres pays en Afrique, entrainant des p\u00e9remptions et des ruptures de stock paradoxales;Plusieurs acteurs sont impliqu\u00e9s dans la gestion des ILP dans le syst\u00e8me, entre autres le PNLP, la centrale d\u2019achat des m\u00e9dicaments essentiels, les partenaires techniques et financiers, les ZS, les FS aussi bien publiques que priv\u00e9es;Un circuit de l\u2019information sur l\u2019approvisionnement et l\u2019utilisation des ILP est d\u00e9fini et diffus\u00e9 au niveau des diff\u00e9rents acteurs.Cette \u00e9tude d\u00e9montre que la performance du SGL des ILP dans le d\u00e9partement du Littoral au B\u00e9nin \u00e9tait \u00ab Insuffisante \u00bb; cette situation constitue un obstacle \u00e0 la lutte efficace contre le paludisme;Le d\u00e9veloppement d'un SGL des ILP efficace pour la lutte contre le paludisme n\u00e9cessite: la mise en place dans les centres de sant\u00e9 y compris le secteur priv\u00e9, d\u2019une d\u00e9marche qualit\u00e9 dans la collecte et l\u2019utilisation des donn\u00e9es sur le syst\u00e8me logistique de lutte contre le paludisme;Le d\u00e9veloppement d'un syst\u00e8me de veille pour l\u2019identification et la destruction des circuits parall\u00e8les d\u2019approvisionnement et d\u2019introduction d\u2019intrants hors la liste officielle dans les stocks d\u2019intrants de lutte contre le paludisme.Les auteurs ne d\u00e9clarent aucun conflit d'int\u00e9r\u00eats."}
{"text": "Staphylococcus aureus bacteria lacking the SPase I SpsBthat are viable and able to grow in vitro when over-expressinga native gene cassette encoding for a putative ABC transporter. This transporterapparently compensates for SpsB's essential function by mediating alternativecleavage of a subset of proteins at a site distinct from the SpsB-cleavage site,leading to SpsB-independent secretion. This alternative secretion system alsodrives the main mechanism of resistance to an arylomycin-derived SpsB inhibitor,by means of mutations in a putative transcriptional repressor(cro/cI) causing over-expression of the ABC transporter.These findings raise multiple interesting biological questions. Unraveling themechanism of SpsB-independent secretion may provide an interesting twist to theparadigm of bacterial secretion.Secretion of proteins into the extracellular environment is crucial for thenormal physiology and virulence of pathogenic bacteria. Type I signal peptidase(SPase I) mediates the final step of bacterial secretion, by cleaving proteinsat their signal peptide once they are translocated by the Sec or twin-arginine(Tat) translocon. SPase I has long been thought to be essential for viability inmultiple bacterial pathogens. Challenging this view, we and others have recentlycreated  Staphylococcus aureus is an important human pathogen that can causelife-threatening invasive infections, such as bacteremia, endocarditis, pneumonia, andosteomyelitis. Because of its nominal essentiality, Type I signal peptidase (SPase I)has been investigated as a potential antibacterial target. Several factors makeS. aureus SpsB an attractive antibiotic target S. aureus have been generated 2cro/cI confer resistance to arylomycin-derived SpsB inhibitors inS. aureus3S. aureuscro/cI locus are associated with over-expression of the 3-genelocus immediately downstream of cro/cI which encodes a putative ABCtransporter 3S. aureus lethality caused by eitherpharmacologic inhibition or genetic ablation of SpsB, and is associated with secretionof alternatively cleaved proteins 3S. aureus SpsB in vitro. Togetherthese findings introduce a new concept, which challenges the common belief that SpsB isabsolutely essential for viability, and which invites a number of interestingquestions.A surprising observation from resistance studies performed by our group and others isthat mutations in the locus encoding for the putative transcriptional regulatorS.aureus strain and an S. aureus strain that lacks SpsBwhile over-expressing the ABC transporter show that only a minor subset of proteins thatare normally SpsB-cleavable is alternatively secreted 3First, to what extent does the putative ABC transporter compensate for the absence offunctional SpsB? Proteomic studies of the secretome of a wild-type invitro, it is unable to establish infection in a mouse model S. aureus virulence factors in vitro bacterial growth from in vivoinfectivity. An interesting consideration that follows is that since S.aureus is a commensal of mammalian skin and nares The observation that the alternative cleavage occurs N-terminal of the SpsB cleavage sitesuggests the involvement of a membrane-localized protease. Although the strain lackingSpsB and over-expressing the ABC transporter appears to grow well in vitro? To speculateon the answer, it would be relevant to understand the mechanism by which SpsB inhibitionleads to bacterial death. Two main hypotheses, that are not mutually exclusive, can beproposed. First, in the absence of SpsB activity, cell death may be caused byaccumulation of unprocessed proteins leading to disruption of membrane integrity. Thishypothesis raises the possibility that the ABC transporter is directly or indirectlyinvolved in removal of unprocessed proteins. It is possible that the transporter enablesa hypothetical membrane-associated proteolytic enzyme to degrade these unprocessedmembrane proteins. Second, under SpsB inhibitory conditions, cell death may occurbecause certain secreted proteins that are essential for viability cannot be secreted.In the context of this hyopothesis, it can be speculated that in the absence of SpsB,the ABC transporter enables secretion of an individual protein or a combination ofproteins that is otherwise essential. Although such proteins have not been identified asyet, this possibility also cannot be excluded. Future experiments to elucidate themechanism by which the ABC transporter compensates for the essentiality of SpsB shouldhelp address this question.Second, by which mechanism does the alternative ABC transporter-mediated secretionpathway compensate for the essentiality of SpsB cro/cI mutations) rendersS. aureus much more sensitive to treatment with anarylomycin-derived SpsB inhibitor in mice cro/cI itself is a likelycandidate. It is possible that cro/cI is part of an as yet to bedefined signaling mechanism that senses the presence of arylomycin in a naturalenvironment.Third, what is the physiological role of the putative ABC transporter? Over-expression ofthe ABC transporter to overcome a loss of secretion may be a protective mechanism in anatural environment in which arylomycin-like antibacterials are present, and this couldbe relevant for niche competition. In this context, it is noteworthy that inactivationof the ABC transporter  are found as an intact collinearunit in 133 of 145 Staphylococcus genomes examined. However, the operonis disrupted in a subset of strains in at least two pathogenic staphylococcal species.First, in two S. epidermidis genomes, the genes encoding ABC2 and ABC3are missing entirely . The loss of these two genes likely reflects the lackof a functional ABC transporter, as each is essential for resistance of a S.aureus USA300 cro/cI mutant to SpsBinhibitors S.aureus genomes analyzed, the operon has been interrupted by the obviousinsertion of an ~15 kb transposable element between the ABC2 and ABC3 encoding genes. While the gene encoding ABC3 in these strains may no longer be under thecontrol of the cro/cI promoter, it is unclear whether it can still beexpressed and whether an active ABC transporter can be formed. Thus, the operon is notuniversally intact in all Staphylococcus genomes; further experimentalstudies are needed to determine whether insertion of the transposable element in thecro/cI - ABC transporter operon inactivatesSpsB-independent secretion.Fourth, is the Cro/CI - ABC transporter operon universally conserved in pathogenicS.aureus that is able to bypass the nominal essentiality of SpsB raises anumber of interesting questions. Determining the molecular mechanism of this alternativesecretion pathway has the potential to provide new insights into the basic biology ofbacterial secretion and to aid design of new antibacterial therapies.In conclusion, the discovery of a potential new secretion system in"}
{"text": "Cryptococcus gattii species complex harbors the main etiological agents of cryptococcosis in immunocompetent patients. C. gattii molecular type VGII predominates in the north and northeastern regions of Brazil, leading to high morbidity and mortality rates. C. gattii VGII isolates have a strong clinical relevance and phenotypic variations. These phenotypic variations among C. gattii species complex isolates suggest that some strains are more virulent than others, but little information is available related to the pathogenic properties of those strains. In this study, we analyzed some virulence determinants of C. gattii VGII strains  isolated from patients in the state of Piau\u00ed, Brazil. The C. gattii R265 VGIIa strain, which was isolated from the Vancouver outbreak, differed from C. gattii CG01, CG02 and CG03 isolates  when analyzed the capsular dimensions, melanin production, urease activity, as well as the glucuronoxylomannan (GXM) secretion. Those differences directly reflected in their virulence potential. In addition, CG02 displayed higher virulence compared to R265 (VGIIa) strain in a cryptococcal murine model of infection. Lastly, we examined the genotypic diversity of these strains through Multilocus Sequence Type (MLST) and one new subtype was described for the CG02 isolate. This study confirms the presence and the phenotypic and genotypic diversity of highly virulent strains in the Northeast region of Brazil.The  Cryptococcus neoformans\u2013Cryptococcus gattii complex are the etiological agents of cryptococcosis, a life-threatening disease that affects the lungs and brains of humans and animals  of the species revealed five distinct molecular types: VGI, VGII, VGIII, VGIV, and VGIV/VGIIIc  obtained from Piau\u00ed, Brazil.in vitro assays were performed to measure the best characterized cryptococcal virulence factors. The production of melanin by C. gattii VGII isolates was assessed employing both spot plate and spectrophotometric assays. After 72 h of incubation of cryptococcal isolates serially diluted onto minimal media containing L-DOPA, we noticed that CG01, CG02, and CG03 isolates displayed increased rates of pigmentation when compared to R265 . In addition, we evaluated the laccase activity, by the quantification of melanin-like pigment upon exposure to L-DOPA; after 72 h of incubation, the supernatant was collected and the amount of melanin-like pigment was detected spectrophotometrically (OD405). In comparison to the R265 strain, CG02 cultures showed a fourfold increase in laccase activity, the CG01 cultures showed a twofold increase in laccase activity, and the CG03 cultures showed no significant differences in laccase activity . Urease activity was also analyzed for CG01, CG02, and CG03 isolates. Following the incubation of each strain in the Roberts urea broth, the amount of urease was quantified spectrophotometrically in the supernatant (OD560). The urease activity of CG01 and CG03 cultures were similar to that of R265, whereas the CG02 isolate displayed a slight increase in urease activity compared to R265 .To evaluate possible differences regarding the virulence between the isolates, Figure 2A). Determination of the capsule diameter ratio showed that all three strains had a larger capsule size compared to the R265 strain . The amount of secreted GXM was evaluated by ELISA. All three strains presented higher amounts of polysaccharide content in the culture supernatant compared to R265 strain . Capsular morphological analysis by scanning electron microscopy revealed a clear difference among capsular fibers of the isolate cells . Although the secretion of capsular components, such as GXM, is required for capsule assembly, capsule enlargement also requires polysaccharide molecules with higher effective diameters .Capsule enlargement and GXM secretion are essential factors for cryptococcal pathogenesis ; these fiameters . We thenC. neoformans-C. gattii species complex are facultative intracellular pathogens that can survive in macrophages .Members of the rophages . Since crophages , we assen = 5 animals/isolate) and compared host survival and fungal burden. Differences in virulence profile were observed for all investigated isolates. Mortality curves revealed that the CG02 isolate displayed a hypervirulent profile in the intratracheal model of infection (LT50 = 21 days)  and the intranasal inhalation model . In fact, the CG02 strain produced a higher pulmonary fungal burden overall after 10 and 15 days post-infection  and was the only isolate detected in the brain after 10 days of infection . Based on prior studies, the VGIIa R265 strain was chosen as a positive control for virulence  . The CG03 had an attenuated virulence profile then compared to R265 . Both CG01 and CG03 were unable to reach the brain . Lungs infected with R265, CG01, CG02 and CG03 isolates  all comprised mostly of cryptococcal cells (cryptococcomas).Phenotypic variations linked to virulence factors were observed for the investigated isolates and these were compared to R265 strain. To evaluate whether these phenotypes are directly related to the isolates virulence, mice were infected mice ( = 31.6) . CG01 haC. gattii VGII isolates in our study, we performed the ISHAM MLST consensus typing scheme. DNA samples were sequenced for all seven loci according to the ISHAM typing scheme (Table 1). The MLST profiling of the isolates revealed a clear genetic diversity. CG01 was classified as the sequence type 125 (ST 125), while CG03 belongs to the ST 127. A new subtype was described for CG02 isolate, which was named as ST 454.With the intent of evaluating the genetic diversity of the three g scheme . The seqg scheme  were useC. gattii species complex has attracted attention as a public health issue  demonstrated that virulence is related to the distinct characteristics of individual strains and is not specifically associated with a particular C. gattii species complex molecular type  from Piau\u00ed, Brazil. The pathogenic factors linked to these differences were mostly related to the surface architecture of C. gattii, including melanin synthesis, capsular structure and urease activity. The pathogenicity analyses were based on assays performed in vitro and in vivo with macrophages and mice, respectively. Additionally, it was demonstrated that the CG02 strain is hypervirulent in comparison to the R265 (VGIIa) strain; CG02 also has the ability to penetrate into the central nervous system (CNS), leading to the development of meningoencephalitis, which is not a common characteristic of C. gattii VGII species. The ability of CG02 strain to transpose the blood brain barrier must be one of the reasons as to why it displays a higher virulence profile when compared to R265 and other CG strains. Despite no information about the MAT locus identity of the isolates here described, a higher proportion of MAT alpha strains are present in Brazil , ST127 (CG03), and ST452 (CG02) indicated significant differences in the colonization of the lungs and brains of mice. ST125 (CG01) and ST127 (CG03) displayed a dominant pulmonary infection in mice and some phenotypic similarity with the isolate R265 (ST20-VGIIa). In comparison to members of the C. neoformans species complex, isolates of the C. gattii species complex usually cause lung infections, and their VGII strains are less efficient in spreading to the human brain  guideline. Mice were housed in groups of five in filtered top ventilated cages and were provided with food and water ad libitum. All efforts to minimize animal suffering were made. Before mortality analysis, mice were intraperitoneally anesthetized with 100 mg/kg ketamine and 16 mg/kg xylazine. The mice were analyzed twice daily for any signs of suffering, defined by weight loss, weakness, or the inability to eat or drink; they were sacrificed following any signs of suffering. The Universidade Federal do Rio Grande do Sul (UFRGS) Ethics Committee for Use of Animals (CEUA \u2013 19801) approved the use of animals in the present work.C. gattii strains were used in the study. The first strain, R265 (ATCC MYA 4093), was previously identified  of molecular type/genotype VGII involved in this study were isolated from immunocompetent patients who had cryptococcal meningitis  . For subsequent experiments, minimal medium was used .Four different entified . The thr Brazil) . Such st560 nm) in urea broth were performed after a 4 h interval. All phenotypic assays were performed thrice. For capsule measurements, R265, CG01, CG02, and CG03 were grown in YPD for 24 h at 30\u00b0C and 200 rpm. The culture was then centrifuged for 10 min at 3,522 \u00d7 g and the cells were washed twice with phosphate-buffered saline (PBS). Aliquots of 104 cells were incubated in RPMI-1640 medium  in a final volume of 500 \u03bcL in 24-well plate for 72 h at 37\u00b0C and 5% CO2. Cells were mixed with India ink and analyzed under microscope as described above. Cell and capsule sizes were measured using ImageJ software (NIH2). Total cell size was defined as the total diameter of the cell, including the capsule. Capsule size was calculated as the difference between the diameter of the total cell and the cell body diameter, defined by the cell wall. At least 100 cells were measured for each growth condition.Pigmentation, urease activity, capsule formation and ability to grow at 37\u00b0C were evaluated for each isolate. Melanin production was visually determined following the growth of cryptococcal cells, which had been serially diluted in solid minimal medium supplemented with 1 mM L-3,4-dihydroxphenylalanine (L-DOPA) and incubated for 72 h either at 30\u00b0C or 37\u00b0C . LaccaseStaining of the cryptococcal surface components (chitin and GXM) was performed as described . Fungal g . The supernatant fluids were collected and again centrifuged at 15,000 \u00d7 g  to remove smaller debris. The pellets were discarded and the resulting supernatant was concentrated approximately 20-fold using an Amicon  ultrafiltration cell  supplemented with 10% Fetal Bovine Serum (FBS \u2013 Sigma) in each well of the 96-well culture plates (TPP). After 24 h of incubation (37\u00b0C and 5% CO2), the medium was replaced with fresh medium containing 1 \u00d7 106 cells of each fungal strain, obtained after a 18 h of growth in YPD and extensive washing in PBS and opsonization with anti-GXM antibody 18B7 . The plates were then further incubated (2 and 24 h at 37\u00b0C and 5% CO2). Yeast cells that were not internalized by the macrophages were removed with PBS washes. Fungal survival was evaluated after macrophage lysis with sterile ice-cold water and subsequent plating on YPD for Colony Forming Units (CFU) determination. This assay was performed in thrice for each strain.Assays were conducted to evaluate the susceptibility of the 5 yeast cells using an intranasal inhalation infection model. We also performed intratracheal infection of mice with 2 \u00d7 106 yeast cells/mL . The infection was performed and monitored twice daily for moribund signals. The median survival values were calculated by the Kaplan\u2013Meier survival analysis. Animal studies were approved by the Federal University of Rio Grande do Sul Ethics Committee.Virulence studies were conducted as previously described . Fungal 5 yeast cells and monitored twice daily for moribund signals. Mice were euthanized by CO2 inhalation. The lungs and brain were homogenized in PBS, diluted and plated on YPD for CFU determination at each time point for fungal load determination .Fungal cells were cultured in 50 mL YPD medium at 30\u00b0C overnight with shaking, washed twice and resuspended in PBS. Groups of 5 female BALB/c mice (\u223c5 weeks old) were intraperitoneal anesthetized with Ketamine (100 mg/kg) and Xylazine (16 mg/kg) and then infected with 1 \u00d7 10URA5, CAP59, LAC1, GPD1, PLB1, SOD1) and the IGS1 region. For each locus studied, different genetic sequences present within a species are assigned as distinct alleles. The combination of the identified alleles at each of the loci defines the allelic profile or sequence type for each isolate. The data generated can be used to determine whether the fungal isolates are clonal or have undergone recombination. The URA5, IGS1, CAP59, LAC1, GPD1, PLB1, and SOD1 gene fragments were amplified using the published PCR conditions for all seven loci  were determined using the online C. gattii MLST database4. The new allele was submitted to the ISHAM MLST database for inclusion.Isolates were subtyped using MLST using partial sequence analysis of six housekeeping genes (ven loci . PCR proVB, LM, AF, JR, ES, GdSA, SF, CS, AS, LK, and MV prepared the experimental design. VB, LM, AF, JR, and ES conducted the phenotyping, CFU analysis, and animal experimentation. VB, GdSA, and SF performed the MEV, immunofluorescence and LS measurements. SF, CS, AS, LK, and MV provided reagents and equipment. VB, LM, AF, JR, ES, GdSA, SF, CS, AS, LK, and MV discussed the results and wrote and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Eugenol and its isomer isoeugenol are both used as flavouring agents or food additives in food products, and have both some similar biological properties. However, the difference in biological activities between eugenol and isoeugenol is rarely studied. In this study, the profiles of antioxidant, DNA-protective effects and antibacterial activities of eugenol and isoeugenol against several common foodborne pathogens were investigated and compared under various experiment conditions. Results showed that eugenol and isoeugenol had strong antioxidant activity, the protective effect against DNA damage and antibacterial activity. In addition, it was found that isoeugenol exhibited the higher biological activities mentioned above than eugenol, which was because isoeugenol had a carbon\u2013carbon double bond closer to the benzene ring compared with eugenol. However, the specific reason needs to be further studied. Environmental factors can easily lead to food oxidation while microorganisms can easily result in food poisoning and food spoilage, which is one of the most important issues facing the food industry and consumers . AccompaEugenol , a natural phenolic compound found in essential oils from plants including clove, cinnamon, basil, and nutmeg, has been considered non-mutagenic, non-carcinogenic and generally recognized as safe (GRAS) by Food and Drug Administration , antibacTherefore, the aim of the present study was to investigate and compare the profiles of antioxidant, DNA-protective effects and antibacterial activities of eugenol and isoeugenol against selected foodborne pathogens through a variety of antioxidant and antibacterial methods under various experiment conditions, which is very important for the preparation of eugenol isomers and their application in food and medicine.2,2-Diphenyl-1-picrylhydrazyl (DPPH), 2,6-ditert-butyl-4-hydroxytoluene (BHT), 2,2\u02b9-azobis (2-methylpropionamidine) dihydrochloride (AAPH) and 2,2\u02b9-azino-bis (3-ethylbenothiazoline-6-sulfonic acid) diammonium salts (ABTS) were from Sigma (USA). 2, 4, 6-Tri (2-pyridyl)-s-triazine (TPTZ), eugenol and isoeugenol were purchased from Fluka (Switzerland). Propidium iodide (PI) was from BD Biosciences. The pBR322 plasmid DNA was from Takara Bio Co. Ltd. . Nutrient agar (NA) and nutrient broth (NB) mediums were from Beijing Aoboxing Bio-tech Co. Ltd. . Other chemicals used were all of analytical grade.Staphylococcus aureus ATCC 25923, Bacillus subtilis ATCC 6051 and Listeria monocytogenes ATCC 19115. Three Gram-negative bacteria were Escherichia coli ATCC 25922, Salmonella typhimurium ATCC 19430, and Shigella dysenteriae CMCC (B) 51252. Strains were provided by the College of Life Science, Shanxi Normal University, and cultured at 37\u00b0C on nutrient agar (NA) and nutrient broth (NB) mediums.Six kinds of common food spoilage bacteria are selected in the study. Three Gram-positive strains were 50 value, that is the effective concentration at which free radicals are scavenged by 50% and is obtained by interpolation from regression analysis.The scavenging rate and scavenging activity of the sample on DPPH radicals were determined as described in a previous report . The sca50 value were calculated using the equation described for DPPH assay.The ABTS cation radical scavenging activity was determined according to the method described by Xu et al. . The sca4 solution (100\u20131000\u00a0\u03bcM), and FRAP value was expressed as millimoles Fe(II) per gram sample.The reducing ability was determined by using FRAP assay described by Xu et al. . The staS\u00a0\u00d7\u00a0N/W. In this formula, S was the volume of sodium thiosulphate solution (blank corrected) in mL, N was the normality of sodium thiosulphate solution (0.02\u00a0N) and W was the weight of oil sample (gram).Lipid peroxidant value (POV) of samples was evaluated according to the method of Li et al. with some modi\ufb01cations . The sam2+ and H2O2 was estimated with the DNA nicking assay as described in the previous report [The ability of samples to protect supercoiled pBR322 plasmid DNA against Fes report .The ability of samples to protect supercoiled pBR322 plasmid against AAPH was measured according to the method described by Zhang and Omaye  with som7\u00a0CFU/mL of bacteria spread on nutrient agar (NA) medium. Oxford cups (6\u00a0mm in diameter) were placed on the inoculated agar, and then 100\u00a0\u03bcL of sample was added with a micropipette. The diameter of zone of inhibition (ZOI) was measured after 24\u00a0h of incubation at 37\u00b0C. Tests were performed in triplicate.The sample was first dissolved and then sterilized by filtration through 0.22\u00a0\u03bcm Millipore filters. Antibacterial tests were then carried out by the Oxford cup method using 100\u00a0\u03bcL of suspension containing 107\u00a0CFU/mL. The tubes were incubated at 37\u00b0C for 24\u00a0h and then examined for evidence of the growth. The MIC and MBC were determined according to the method described by Diao et al. [Two fold serial dilutions of samples were prepared in sterile NB medium. To each tube 100 \u03bcL of the exponentially growing bacterial cells was added to give a cell concentration of approximately 1\u00a0\u00d7\u00a010o et al. .7\u00a0CFU/mL). The cultures were incu bated at 37\u00b0C and shaken at 120\u00a0rpm. At selected time intervals, samples from test culture were taken and the absorbance at 600\u00a0nm (OD600) was measured.One hundred microliters of samples filtrating through 0.22\u00a0\u03bcm Millipore filters was added to 4.8\u00a0mL of the sterile NB medium, and then mixed with 100\u00a0\u03bcL of a 10\u00a0h culture of tested bacteria  equipped with a CellQuest software (BD Biosciences) were used to analyse 1\u00a0\u00d7\u00a0104\u00a0cells after 30\u00a0min of reaction in a dark environment at room temperature. Cells were sorted into living and necrotic cells, and this assay was repeated five times.Logarithmic phase bacteria were collected by centrifugation at 6000\u00d7g for 5\u00a0min, washed three times, and resuspended in PBS (pH 7.4). Tested bacteria were treated with different concentrations of samples. After 0.5 and 1\u00a0h, cells containing approximately 1\u00a0\u00d7\u00a010p\u00a0<\u00a00.05) between the means by Data Processing System  and Excel program.One-way analysis of variance (ANOVA) and Duncan\u2019s multiple range tests were carried out to determine significant differences , indicating that the scavenging activity of isoeugenol was slightly higher than that of eugenol. However, the scavenging activity of eugenol and isoeugenol on DPPH radicals was lower than that of Trolox (EC50 was 13.5\u00a0\u03bcg/mL). The profile of scavenging activity of eugenol isomers on ABTS was similar to the result of the scavenging DPPH radicals. Somewhat differently, the EC50 values on scavenging ABTS cation radicals were 146.5 and 87.9\u00a0\u03bcg/mL for eugenol and isoeugenol, and the scavenging activity of isoeugenol was significantly higher than that of eugenol (p\u00a0<\u00a00.05), which was lower than of Trolox (EC50 was 84.34\u00a0\u03bcg/mL). These differences in data between DPPH and ABTS assays were likely due to different experimental conditions. The disappearance of DPPH and ABTS cation radicals is directly proportional to the amount of antioxidant present in the reaction mixture. Similarly, eugenol and isoeugenol showed a concentration-dependent scavenging of the DPPH and ABTS cation radicals at certain concentrations. Their antioxidant activity in the above assays may be mediated through direct trapping of the free radicals through transfers of hydrogen or electron [The scavenging activity of eugenol and isoeugenol on DPPH and ABTS radicals is shown in electron .Table 1.p\u00a0<\u00a00.05). These results suggested that eugenol isomers could result in reducing Fe3+/ferricyanide complex to the ferrous form (Fe2+), and had a remarkable potency to donate electron to reactive free radicals, transforming them into more stable non-reactive species and terminating the free radical chain reaction.The FRAP may serve as a significant indicator of the potential of antioxidant activity . Table 1p\u00a0>\u00a00.05) with the prolong of treatment time and only a 2.8% increase from days 10 to 30 , and increased from 1.2% to 23.4% and 67.2% for 60\u00a0min (p\u00a0<\u00a00.05) respectively. And under the same conditions, the necrosis rate of E. coli treated with isoeugenol dramatically increased to 14.7% and 80.8% for 30\u00a0min (p\u00a0<\u00a00.05) and increased to 28.6% and 92.7% for 60\u00a0min (p\u00a0<\u00a00.05) respectively. As expected, similar results were observed for L. monocytogenes cells treated with eugenol and isoeugenol after incubation with different times  was potently inhibited by eugenol and isoeugenol to the same extent [Eugenol and isoeugenol are the members of the phenylpropanoids class of chemical compounds, and there have been some studies on their antioxidant activity respectively ,5,9,10. e extent . The pre2+ and H2O2 has been reported by Nam et al. [Reactive oxygen species (ROS) are a major source of oxidative stress in cells and are generated by external and internal factors, resulting in the damage of proteins, carbohydrates, lipids and DNA. More and more evidence suggested that oxidative breakage of mammalian cellular DNA led to cell death, tissue damage and a wide array of neurological and pathological disorders . Previoum et al. , which wFrom the above results, eugenol and isoeugenol exhibited better antioxidant activities and DNA damage protective effect, which may be mediated through direct trapping of the free radicals or inhibiting the propagation of radical chain reactions through transfers of hydrogen or electron . The traE. coli and L. monocytogenes based on growth curve analysis and flow cytometry assays. Expectedly, similar to results of the antioxidant activity, isoeugenol also exhibited stronger antibacterial activity than eugenol as a whole. The phenolic hydroxyl group had weak acidity, which partly resulted in its inhibitory activity on bacteria. In addition, polyphenols perform multiple biological functions and many of these functions have been attributed to its antioxidant activity [Some studies have reported the antibacterial activity of eugenol against some bacteria ,28\u201330, bactivity , and a pIn conclusion, it is clear that eugenol and isoeugenol had an excellent reducing power and exerted antioxidant activity against DPPH, ABTS, lipid peroxidation, and possessed the protective effect against DNA damage induced by hydroxyl radical and AAPH, as well as antibacterial activities against several common foodborne pathogens. Their antioxidant activity and DNA damage protective effect were dose-dependent, increasing with a higher dosage in a certain concentration range, and the antibacterial effects were significantly influenced by incubation time and concentration. In addition, it was found that isoeugenol exhibited a higher antioxidant activity, DNA damage protective effect and antibacterial activity than eugenol, which was probably because isoeugenol had a carbon\u2013carbon double bond closer to the benzene ring compared with eugenol, indicating that the biological activity of eugenol and isoeugenol mainly came from their structure, while subtle differences in the structure of eugenol isomers can lead to obvious change in their biological activity."}
{"text": "GRM1 expression was silenced in MDA-MB-231 cells to study changes in expression of inflammatory genes regulated by mGluR1. Results were confirmed by ELISA using GRM1-silenced and overexpressed cells and mGluR1 inhibitors. A functional role for these differentially expressed genes was determined in vitro and in vivo. 131 genes were differentially expressed in GRM1-silenced MDA-MB-231 cells, with some of these falling into four major canonical pathways associated with acute inflammation, specifically leukocyte migration/chemotaxis. Upregulation of three of these genes  and their corresponding protein was confirmed by qPCR analysis and ELISA in GRM1-manipulated TNBC cells. Upregulation of these cytokines enhanced endothelial adhesion and transmigration of neutrophils in co-culture assays and in 4T1 mouse tumors. Our results suggest mGluR1 may serve as a novel endogenous regulator of inflammation in TNBC.Breast cancer remains a major cause of death among women. 15% of these cancers are triple negative breast cancer (TNBC), an aggressive subtype of breast cancer for which no current effective targeted therapy exists. We have previously demonstrated a role for mGluR1 in mediating tumor cell growth, endothelial cell proliferation, and tumor-induced angiogenesis in TNBC. In this study, we explore a role for mGluR1 in regulating inflammation in TNBC.  The only current systemic treatment options for TNBC include cytotoxic chemotherapeutics that target rapidly replicating cells and produce significant morbidity. The identification of new molecular targets to treat TNBC thus has the potential to produce new effective therapies for TNBC while reducing toxicity associated with standard chemotherapy and addressing a critical unmet need in breast cancer therapy.Approximately 15% of all breast cancer cases in the U.S. are triple negative breast cancer (TNBC), an aggressive subtype that lacks receptors for estrogen, progesterone and human epidermal growth factor receptor 27. Determining how to stimulate the influx of these immune infiltrates could potentially reduce mortality associated with TNBC. However, the immune system can play a dual role in cancer, acting both as a suppressor or promoter of tumor growth. The system is complex and involves various factors secreted by tumor cells, surrounding stromal and invading immune cells8. In breast cancer, immune cells, including tumor-associated neutrophils (TANs) play a major role in determining tumor cell fate through expression of various inflammatory agents, including chemokines14. Thus, polarizing the TIM in favor of an anti-tumor phenotype could potentially be effective as a treatment for TNBC.Recently, a link between the tumor immune microenvironment (TIM) and TNBC has been established, in which increased immune infiltrates positively correlated with improved pathologic complete response, decreased distance recurrence, and improved progression-free survival15. mGluR1 belongs to the Group I mGluR family whose over-expression has been linked to melanoma17. We detected high levels of mGluR1 in various TNBC cells compared to normal breast epithelial cells and observed inhibiting or silencing mGluR1 inhibits breast cancer growth and angiogenesis, both in vitro and in vivo20. In addition, we have demonstrated GRM1 and mGluR1 are expressed at significantly higher levels in human breast cancer tissue compared to patient-derived normal breast tissue18. In this study, we observe mGluR1 as an inhibitor of both the production of inflammatory chemoattractants by TNBC cells as well as the induction of neutrophil (PMN) transmigration. These findings suggest mGluR1 may serve as a novel endogenous regulator of inflammation in TNBC by initiating signals in breast cancer cells that modulate PMN transmigration and function within the TIM.Previously, we identified metabotropic glutamate receptor-1 (mGluR1) as a possible therapeutic target in TNBC. Metabotropic glutamate receptors (mGluRs) are a family of G-protein coupled receptors known to mediate reflexes in the nervous systemGRM1-silenced MDA-MB-231cells . The effect of riluzole on MDA-MB-231 CXCL1 levels was not significant. Unlike riluzole, after treatment with BAY, a dose-dependent increase in CXCL1 levels did occur in both SUM159 and BT549 cells by 24\u2009hours with a significant increase of 2-fold at the highest dose tested (10 \u03bcM). MDA-MB-231 cells were not as responsive, with a small but significant increase only at the highest dose. However, at 48\u2009hours, these levels continued to increase with BAY significantly increasing CXCL1 levels by up to 3-fold in all 3 cell lines.mGluR1-mediated regulation of CXCL1 and IL-8 was further demonstrated using mGluR1 inhibitors BAY36-7620 (BAY) and riluzole in BT549, SUM159 and MDA-MB-231 cells, which also express mGluR1 Fig.\u00a0. All 3 c24. However, after 48\u2009hours, a dose-dependent increase in IL-8 levels were observed in SUM159 cells with a significant increase of about 1.5-fold at the highest dose tested (50 \u03bcM). BT549 cells were unresponsive to lower levels of riluzole but did induce a significant 2.5-fold increase at the highest dose tested. MDA-MB-231 cells were still unresponsive to riluzole. The response of SUM159 and MDA-MB-231 cells to BAY was much more robust with a dose-dependent increase in IL-8 levels as early as 24\u2009hours and still evident after 48\u2009hours. At the highest dose tested (10 \u03bcM), BAY induced a significant increase of at least 2-fold at both times points. Similar to riluzole treatment, BT549 cells were unresponsive to lower levels of BAY but a significant increase of over 2-fold was observed at higher levels (0.5\u20131.0 \u03bcM).Unlike CXCL1, IL-8 chemokine secretion levels varied between cell lines with SUM159 expressing high levels at 24\u2009hours with less detection in the BT549 (just above background) and MDA-MB-231 cells Fig.\u00a0. After 226. This process is triggered by binding of chemokine to its receptor on PMNs, causing integrin clustering on the cell surface of the PMN, resulting in increased binding of integrin to ICAM-1 on the endothelium. Following these events, PMNs migrate across the endothelium. mGluR1\u2019s ability to regulate this process was examined. Endothelial monolayers were exposed for 30\u2009minutes to conditioned medium from either GRM1-silenced or overexpressed cells (cultured for 24-hours) prior to adding labeled PMNs for 30\u2009minutes. This incubation process allows for chemokines expressed in the medium to bind their receptors on the endothelium30. After 30\u2009minutes, monolayers were washed to remove non-adherent PMNs and remaining PMNs were detected by fluorescence. As a positive control, monolayers were treated with TNF\u03b1 for 6\u2009hours. As expected, treatment of the endothelium with TNF\u03b1 induced an almost 2-fold and 3-fold increase in PMNs adhering to the monolayers compared to NS or LACZ controls  increase in PMNs present in the medium from GRM1 silenced cells compared to NS medium  but significant decrease in the number of PMNs present compared to medium from LACZ cells.Following adhesion to the vascular endothelium, PMNs will transmigrate across the monolayer moving towards a chemokine gradient. To examine a role for mGluR1, inserts containing endothelial monolayers were placed in medium from either ium Fig.\u00a0. In the GRM1-expressing 4T1 mouse tumor model to measure PMN presence in the tumors after injections with riluzole or sunitinib, an anti-angiogenic drug known to regulate PMN migration32. As our previously published growth curve demonstrates19, treatment with riluzole or sunitinib significantly decreased tumors by 50% compared to vehicle DMSO. In this same study, we measured PMN presence and found decreased tumor volume corresponded with a significant increase in PMN presence, detected by anti-Ly6G positive staining  transmigration. This was demonstrated in various TNBC cells where inhibition of mGluR1 using either the mGluR1 inhibitors  or an shRNA directed at mGluR1 increased expression of CXCL1 and IL-8 and overexpressing In vivo, we also observed that treating the syngeneic mouse 4T1 mammary cancer model with riluzole increased the presence of PMNs in the tumors, which coincided with decreased tumor growth19. This suggests that mGluR1, in addition to its direct effect on tumor cell growth and survival20 is capable of regulating inflammation within the TIM. However, recent findings suggest riluzole\u2019s anti-tumor properties in breast cancer are likely largely mediated through mGluR1 independent mechanisms36. In that study, riluzole inhibited cell growth, invasion and migration in both GRM1 silenced and over-expressed cells suggesting lack of GRM1 involvement. In addition, a recent microarray analysis demonstrated cell cycle genes to be major pathways regulated by riluzole further suggesting alternative pathway(s) by which riluzole functions other than mGluR24. Further in vivo studies utilizing more specific mGluR1 inhibitors, such as BAY36-7620, are necessary to definitively define a role for mGluR1 in mediating inflammation within the TIM. Nonetheless, riluzole\u2019s ability to mediate PMN migration in the 4T1 tumor model in the present study is important because riluzole is an already FDA-approved drug that can be quickly translated into the clinic.38 a link between chronic inflammation and neoplastic progression has long been recognized41. Within the TIM, there is a complex mix of cell types contributing inflammatory factors including cancer cells themselves. TANs were originally thought to promote cancer by affecting angiogenesis42 or by modulating the TIM in favor of immunosuppression. However, based on recent evidence45, it appears the TIM can be manipulated to polarize TANs to acquire anti-tumor phenotypes involving CXCL1 and TNF\u03b148. TNBC cell\u2019s ability to regulate PMN adhesion and migration through production of these chemoattractants strongly confirms these studies and suggests mGluR1 as a novel endogenous regulator of leukocyte phenotype within the TIM.The role of inflammation in cancer is complex, demonstrating both pro- and anti-tumor properties. Although acute inflammation is associated with anti-tumor immune responsesGRM1 silencing (95-fold increase). Recent studies demonstrate a strong association of TIL presence with increased metastasis-free survival and decreased distant recurrence in early stage TNBC5. These studies correlate with other studies involving TANs where in early-stage tumors, TANs possess anti-tumorigenic properties and actually activate TILs52. Thus, it appears targeting mGluR1 early in the treatment regime may play an important role in stimulating an adaptive immune response in TNBC. In support of this, riluzole has been shown to increase survival of CD8 T-cells in HIV-1-infected individuals and enhance proliferation of anti-CD3/CD28 stimulated T cells53.In addition to PMNs, data from the microarray analysis show lymphocyte migration and chemotaxis to be strongly upregulated by Previously, we identified mGluR1 as a promising target for breast cancer therapy based on its roles promoting angiogenesis and tumor cell growth. Our results now implicate mGluR1 and riluzole as novel endogenous inhibitors of inflammation and PMN transmigration in TNBC. Further studies into the mechanism by which mGluR1 and riluzole mediate these effects could be very useful in the development of therapeutic targets for treating TNBC cancer and would provide more insight into the role inflammation plays on the progression of TNBC.54. The human microvascular endothelial cell line HMEC-1 was obtained from Centers for Disease Control and cultured as described previously19. Cell lines were authenticated via cytogenetic analysis or used within 6 months of purchase or stored in liquid nitrogen. The specific mGluR1 inhibitor, BAY36-7260, and riluzole were purchased from Tocris Bioscience . All tumor digestion reagents were purchased from Sigma Aldrich .Cell culture reagents were purchased from Thermofisher Scientific . TNBC cell lines were purchased from ATCC except the SUM159 cell line was a kind gift from Stephen Ethier . The mouse 4T1-12B cell line was a kind gift from Fred MillerGRM1 shRNA vector (shGRM1) or non-silenced control vector (NS) were obtained from Karmanos Cancer Institute by subscription to Thermo Scientific GIPZ shRNAmir library. Lentiviral particles containing these vectors were generated by reverse transfection of these constructs with Trans-Lentiviral package mix, into HEK293T cells using Arrest-In/Express-In transfection reagent. Approximately 106 TU/ml was used to infect MDA-MB-231 cells in the presence of polybrene (10\u2009\u03bcg/ml) and stable cultures generated by growing in puromycin (1\u2009\u03bcg/ml) as previously described36. GRM1 silencing was confirmed by Western blot and RT-QPCR.Reagents for transduction assays were purchased from ThermoFisher Scientific. GIPZ Lentiviral particles containing GRM1 vectors has been described previously36. Lentiviral particles containing the GRM1 vector or LACZ control vector were generated by reverse transfection of these constructs with Virapower packaging mix into HEK293T cells using Lipofectamine 2000 reagent. A dilution (1:1) of viral supernatant was used to infect low GRM1-expressing MDA-MB-468 cells using polybrene (10\u2009\u03bcg/ml). Stable cultures were generated by growing in blasticidin (5\u2009\u03bcg/ml).Construction of Lentiviral GRM1 silenced or NS MDA-MB-231 cells using puromycin (10\u2009\u03bcg/ml) for two weeks, cells were plated in triplicate overnight and RNA extracted using RNeasy Plus Mini Kit . RNA was quality assessed using the 2100 Bioanalyzer System and hybridized to the Illumina\u00ae Human HT-12v4 array. Data was uploaded to BeadStudio, background-corrected and normalized using rank invariant algorithm. Differentially expressed genes were identified using Illumina Custom Error Model and genes differentially expressed were uploaded to Genomatix software suite to determine over-represented canonical pathways. The online DAVID tool was used to determine Gene Ontology Biological Process terms over-represented by the data.After stably selecting GRM1, CXCL1, IL6, IL8, and housekeeping gene GAPDH as listed in Table\u00a0Total RNA was extracted using Qiagen\u2019s RNeasy Plus Mini Kit and reverse transcription performed using High Capacity cDNA Reverse Transcription Kit (Thermo Scientific) according to manufacturer protocols. QPCR was performed using ABsolute QPCR Mix with ROX (Thermo Scientific) according to manufacturer using the sense/anti-sense primers for 20. Controls without RT were used to confirm lack of genomic DNA. Relative fold change in GRM1, CXCL1, IL6, or IL8 expression compared to NS or LACZ control was determined using the following equation: 2\u2212ddCt, where \u2212ddCt is difference between the dCt of the cytokine gene and the housekeeping gene normalized to the control values.Thermal cycling was performed as previously described30\u201360\u2009\u03bcg of protein isolated from TNBC cells was separated by SDS-polyacrylamide gel electrophoresis (10%) and transferred to PVDF membranes. Immunodetection of mGluR1 was performed using anti-mGluR1 antibody  with appropriate secondary antibody and detected by chemiluminescence. Blots were further reprobed with antibody against GAPDH .36, and chemokine expression was normalized to cell counts.CXCL1 and IL-8 levels in culture supernatants from stably transduced cells or after treatment with TNF\u03b1 (10\u2009ng/ml), BAY36-7620, riluzole, or vehicle (0.01% DMSO) were measured by sandwich ELISA  according to manufacturer protocol. Since these inhibitors are known to inhibit cell growth, relative TNBC cells numbers were determined after each experiment using MTT analysis4) were injected into mammary fat pads of female BALB/c mice  and allowed to grow until tumors reached a mean volume of 62\u2009mm3 (approximately 10 days). Mice were then divided into groups of 10 and treated daily with i.p. injections of riluzole (18\u2009mg/kg), sunitinib (20\u2009mg/kg), or vehicle (DMSO) for 14 days. Tumor size was measured three times a week using a Vernier caliper and tumor volume estimated using the following formula: length\u2009\u00d7\u2009width\u2009\u00d7\u2009depth/2. After 14 days of treatment, mice were euthanized and their tumors harvested, minced, and digested in enzyme solution (1\u2009g tissue/10\u2009ml solution) containing collagenase type IV (0.15\u2009mg/ml), collagenase type I (0.4\u2009mg/ml), DNase I (1.25\u2009mg/ml) and BSA (0.5%) for 1\u2009hour. PMNs were identified as described below. Animals were housed in a pathogen-free facility and all animal studies were performed in accordance with local IACUC at Wayne State University.4T1 cells  for 30\u2009minutes at 37\u2009\u00b0C. The percentage of PMNs in the tumor digestion mixture was determined by FACS analysis after washing mixture through a 70 \u03bcm nylon strainer and labeling with FITC-conjugated anti-Ly6G antibody .Heparin anti-coagulated blood was obtained from healthy volunteers after informed consent and in accordance with ethical guidelines of Wayne State University. PMNs were isolated using Ficoll-Paque followed by dextran (1%) density gradient centrifugation as described previously5/well and allowed to attach for 30\u2009minutes. After 30\u2009minutes, HMEC-1 monolayers were washed 3 times with PBS and remaining PMNs detected by measuring FITC fluorescence using BioTek Synergy 2 plate reader.HMEC-1 cells were grown to confluence in 96-well black plates and exposed for 30\u2009minutes to conditioned medium from stably transduced cells (cultured for 24\u2009hours) or to TNF\u03b1 (10 ng/ml) for 6\u2009hours as a positive control. After incubation, the medium was removed and labeled PMNs added to HMEC-1 monolayers at 2\u2009\u00d7\u2009106 per insert) and allowed to migrate for 1.5\u2009hours. Media in the bottom of wells was then removed and PMNs collected by centrifugation, resuspended in PBS and detected by FITC fluorescence.HMEC-1 cells were grown to confluence on BD cell culture inserts (8 \u03bcm pore size) in 24-well plates containing EGM-2 complete medium. Upon confluence, medium in bottom of wells was replaced with 24\u2009hour conditioned medium from stably transduced cells, after which labeled PMNs were added  for Macintosh. All numerical results are expressed as mean\u2009\u00b1\u2009SEM and statistical analysis performed by one-way or two-way repeated-measures analysis of variance (ANOVA) followed by multiple comparison procedure with Student-Newman Keuls method. A value of p\u2009\u2264\u20090.05 was considered significant.Public Health Service Policy on Humane Care and Use of Laboratory Animals .All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. All procedures performed in studies involving animals were in accordance with the ethical standards of the institution or practice at which the studies were conducted. Animal studies were approved by the local Institutional Animal Care and Use Committee (IACUC) at Wayne State University which is structured and operated in accordance with NIH\u2019s Office of Laboratory Animal Welfare (OLAW) All procedures performed in studies involving human participants were performed with their consent and in accordance with the Declaration of Helsinki and have been approved following Expedited Review (IRB #123016MP4E) by the Chairperson for the Wayne State University Institutional Review Board (MP4).Supplementary Information FileDataset 1"}
{"text": "Nrf1 gene has capability to be differentially transcripted alongside with alternative mRNA-splicing and subsequent translation through different initiation signals so as to yield distinct lengths of polypeptide isoforms. Amongst them, three of the most representatives are Nrf1\u03b1, Nrf1\u03b2 and Nrf1\u03b3, but the putative specific contribution of each isoform to regulating ARE-driven target genes remains unknown. To address this, we have herein established three cell lines on the base of the Flp-In T-REx system, which are allowed for the tetracycline-inducibly stable expression of Nrf1\u03b1, Nrf1\u03b2 and Nrf1\u03b3. Consequently, the RNA-Sequencing results have demonstrated that a vast majority of differentially expressed genes (i.e. >90% DEGs detected) were dominantly up-regulated by Nrf1\u03b1 and/or Nrf1\u03b2 following induction by tetracycline. By contrast, the other DEGs regulated by Nrf1\u03b3 were far less than those regulated by Nrf1\u03b1/\u03b2 (i.e. ~11% of Nrf1\u03b1 and ~7% of Nrf1\u03b2). However, further transcriptomic analysis revealed that the tetracycline-induced expression of Nrf1\u03b3 significantly increased the percentage of down-regulated genes in total DEGs. These statistical data were further validated by quantitative real-time PCR. The experimental results indicate that distinct Nrf1 isoforms make diverse and even opposing contributions to regulating different subsets of target genes, such as those encoding 26S proteasomal subunits and others involved in various biological processes and functions. Collectively, Nrf1\u03b3 acts as a major dominant-negative inhibitor competitively against Nrf1\u03b1/\u03b2 activity, such that a number of DEGs regulated by Nrf1\u03b1/\u03b2 are counteracted by Nrf1\u03b3.The single  It is important to note that the unique function of Nrf1 is finely tuned by a steady-state balance between production of the CNC-bZIP protein (i.e. translation of transcripts) and concomitantly  processing in order to give rise to distinct multiple isoforms  before being turned over. These distinct proteoforms of Nrf1 are postulated to together confer on the host robust cytoprotection against a vast variety of cellular stresses through coordinately regulating distinctive subsets of important homoeostatic and developmental genes. The transcriptional expression of such key genes are driven by antioxidant response elements (AREs) and/or other cis-regulating consensus sequences, some of which are conversed with the activating protein-1 (AP-1) binding site, within these gene promoter regions.Nuclear factor-erythroid 2-related factor 1  acts as a transcription factor belonging to the cap\u2019n\u2019collar (CNC) basic-region leucine zipper (bZIP) family, which is indispensable for maintaining both cellular homoeostasis and organ integrity during normal development and growth, as well as the adaptative responses to other pathophysiological processesNrf1 is allowed for differential transcriptional expression to yield multiple mRNA transcripts (between ~1.5\u2009kb and ~5.8\u2009kb) and subsequently alternative translation into distinct polypeptide isoforms (between ~25-kDa and ~140-kDa), which are determined to be differentially distributed in embryonic, fetal and adult tissues, including liver, brain, kidney, lung, heart, skeletal muscle, bone, testis, ovary, placenta and others7. Amongst such isoforms, the full-length Nrf1 (designated Nrf1\u03b1) is yielded by the first translation initiation signal within the main open reading frame (ORF) of alternatively spliced mRNA transcripts, in which the exon 4  is removed from its long isoform TCF11 (transcription factor 11) in the human5. Albeit Nrf1 lacks the Neh4L region, it was identified to retain a strong transactivation activity that is largely similar to the TCF11 ability8.The single gene of 9. By bioinformatic analysis, it is thus inferred that Nrf1\u03b2 lacks the N-terminal domain  and its adjacent acidic domain 1 11. Later, Nrf1\u03b2 is also determined to exhibit a weak transactivation activity14, but stimulation of Nrf1\u03b2 activity appears to be dependent on distinct stressors that had been administrated in different cell lines15. Furthermore, a small dominant-negative isoform, called Nrf1\u03b313, is produced by another potential in-frame translation starting at the putative methionine of position 584, as well as by the putative endoproteolytic processing of longer Nrf1 proteins. When generation of Nrf1\u03b3 is blocked, the transactivation activity of Nrf1\u03b2 is significantly increased12. On the contrary, when Nrf1\u03b3 is forcedly expressed, the consequence enables it to make a possible interference with the functional assembly of each of the active transcription factors (i.e. Nrf1\u03b1 or Nrf2) with its heterodimeric partner (i.e. sMaf and other bZIP proteins), in order to down-regulate expression of AP1-like ARE-driven target genes13.By contrast with Nrf1\u03b1, the short isoform Nrf1\u03b2 [which was early designated as LCR-F1 (locus control region-factor 1)] is determined to be generated through the in-frame translation that is initiated by an internal perfect Kozak\u2019 starting signal (5\u2032-puCCATGG-3\u2032), which is situated within and around the four methionine codons between positions 289 and 297 in the mouseNrf1\u03b1, HEK293DNrf1\u03b2 and HEK293ENrf1\u03b3, which are allowed for stably tetracycline (Tet)-induced expression of human\u00a0Nrf1\u03b1, Nrf1\u03b2, and Nrf1\u03b3, respectively. The similarities and differences of structural domains of these three isoforms were shown diagrammatically  in the parallel experiments. The inducible expression of Nrf1\u03b1, Nrf1\u03b2 and Nrf1\u03b3 was under control by Tet for distinct experimental requirements, before which the positively-selected clones of cell lines were maintained within double antibiotics 150\u2009\u03bcg/ml hygromycin B and 15\u2009\u03bcg/ml blasticidin. The resulting selected cell lines were named HEK293control, HEK293CNrf1\u03b1, HEK293DNrf1\u03b2 and HEK293ENrf1\u03b3, respectively. Thus they were also abbreviated to control, Nrf1\u03b1, Nrf1\u03b2, and Nrf1\u03b3, as shown in the subsequent experimental results. Of note, the stable expression of distinct isoforms was monitored by interaction of Tet with its repressor TetR leading to release from the Tet operator and then induction of interested gene transcription.To gain an in-depth insight into distinct contributions of human\u00a0Nrf1 isoforms  to the precision regulation of different subsets of its target genes, each of these isoform-expressing cell lines was herein established by Flp recombinase-mediated integration on the base of the Flp-In T-REx-293 host cells. These cell lines had been transfected with each of pcDNA5/FRT/TO-V5 expression constructs for distinct cDNA sequences encoding Nrf1\u03b1, Nrf1\u03b2 and Nrf1\u03b3  \u22640.001 (ref.17), along with an absolute value of Log2 (fold change) \u22651, and identified by calculating each gene expression in sample groups versus controls as indicated in the Stat Chart  were up-regulated  but the other 44 genes (i.e. 4.4%) were down-regulated (green bar). And, transcriptional expression of as many as 1675 genes was also significantly regulated upon stable expression of Nrf1\u03b2 in the Tet-inducible HEK293DNrf1\u03b2 cells, 94.8% of which (i.e. 1588 genes) were up-regulated and the other 5.2% (i.e. 87 genes) were down-regulated  were down-regulated, the other 86 genes (i.e. 76.1%) were still up-regulated . An overview of the primary sequencing data was then depicted in Table\u00a0art Fig.\u00a0. By compart Fig.\u00a0 in theirted Fig.\u00a0, red barted Fig.\u00a0. By strited Fig.\u00a0. This imAfter normalization by the control, each isoform-specific or their common DEGs amongst three Nrf1 isoforms were statistically shown with the Venn diagram Fig.\u00a0. Their sdatabase for annotation, visualization and integrated discovery (DAVID) of bioinformatic resources consists of an integrated biological knowledgebase with analytic tools, which is used for systematic extraction of biological features and/or meanings associated with large lists of genes18. Therefore, in order to investigate the relationship and difference in gene regulation by amongst these three Nrf1 isoforms, the enriched functional annotation of GO terms . This is helpful to further understand biological functions of distinct subsets of genes regulated by each Nrf1 isoform.Further data analysis of thousands of DEGs involved in distinct biological processes is an important downstream task following RNA-Seq to understand relevant meanings of those \u2018interested\u2019 genes regulated by each isoform of Nrf1. Of note, the gene ontology (GO) is an internationally-standardized functional classification system of genes, which offers a dynamically-updated controllable vocabulary with a strictly defined concept to describe comprehensively properties of distinct genes and their products in any organisms, and also covers three major domains, including cellular component, molecular function and biological process. The enrichment analysis of GO provides all relevant terms that are significantly enriched in the DEGs, by comparison to the genomic background, and then filters the DEGs that correspond to potential biological functions. The s Tables\u00a0\u2013S7 was ms Tables\u00a0\u2013S10 was The top 20 of significantly enriched functional annotation terms Fig.\u00a0. Almost Furtherly, the results obtained from relevant pathway enrichment analysis Tables\u00a0\u2013S10 reve20 ) being down-regulated by Nrf1\u03b2. By contrast, 6 of the top 10 RPKM Nrf1\u03b3-specific genes were up-regulated, whereas the other 4 genes were down-regulated by this isoform ) was down-regulated. Another 9 of the top 10 RPKM genes were commonly up-regulated by three Nrf1 isoforms, with only an exception of LCP1 (lymphocyte cytosolic protein 1) that was significantly down-regulated by Nrf1\u03b2 but up-regulated by the other two isoforms 22 and STRING (lower three panels)23, respectively. Distinct expression profiles of these putative genes involved in the networks were extracted from distinct RNA-Seq data sets, which were reflected with different gradient colors in accordance with fold changes , BRD9 (bromodomain containing 9) and FBXW7 (F-box and WD repeat domain containing 7) were differentially regulated by Nrf1\u03b3 from other two isoforms, another three genes RUSC2 (RUN and SH3 domain containing 2), CAPN1  and HCFC1 (host cell factor C1) were differentially regulated by Nrf1\u03b2, the remaining one gene C8ORF33 (chromosome 8 open reading frame 33) was differentially regulated by Nrf1\u03b1. By comparison of the network identified with the STRING database, 5 of 11 genes showed an uniform regulation trend, whilst the other 6 genes were differently regulated: i) three genes MAFG, NRF1 (nuclear respiratory factor 1) and FBXW7 were differentially regulated by Nrf1\u03b3 from other two isoforms; ii) two genes C3ORF35 (chromosome 3 open reading frame 35) and MAFK (v-maf musculoaponeurotic fibrosarcoma oncogene homolog K) were differentially regulated by Nrf1\u03b2; and iii) only one gene SP7 (Sp7 transcription factor) was differentially regulated by Nrf1\u03b1. Collectively, the interaction network analysis indicates that three isoforms of Nrf1 could diversely regulate its target genes. Such changes in the expression abundance of one isoform may also influence its overall transcriptional regulation of Nrf1-target genes. In fact, transcriptional expression of different subsets of target genes (driven by AP1-like AREs) was principally attributable to the precision regulation by distinct functional heterodimers of CNC-bZIP family members  with small Maf or other bZIP factors24. Such transcription of these factors was also further compared to determine distinct Nrf1-specific effects . This notion also appeared to be further supported by the observation that both the mRNA levels , siRNA (i.e. siNrf2) or constructive activation of Nrf2 mutant (i.e. caNrf2\u0394N). In turn, these results also unravel that significant changes in the expression of Keap1 are accompanied by altered expression of Nrf2, but not Nrf1\u03b1. This implies a feedback circuit existing between Nrf2 (rather than Nrf1) and its negative regulator Keap1.Intriguingly, the N-terminal Neh2 (Nrf2\u2013ECH homology 2) domain of Nrf2, which contains a redox-sensitive Keap1 (Kelch-like ECH-associated protein 1)-binding degron targeting the homoeostatic CNC-bZIP protein to ubiquitin ligase cullin-3 and Rbx1-dependent proteasomal degradation pathwayels Fig.\u00a0 and protels Fig.\u00a0 of Keap129. Importantly, coordinated regulation of proteasomes by Nrf1, but not Nrf2, occurs through proteasome-limited proteolytic processing of the former CNC-bZIP protein into a mature active factor to mediate Nrf1-target proteasomal gene expression in the \u2018bounce-back\u2019 response to relative lower doses of proteasomal inhibitors33. Nrf1-mediated induction of proteasomes subunits results in significant increases in mRNA expression levels of all proteasomal subunits only upon exposure to lower concentrations of proteasomal inhibitors, but this feedback compensatory response is prevented by high concentrations of proteasomal inhibitors34. Therefore, there exists a bidirectional regulatory feedback circuit between Nrf1 and the proteasome35. However, our data revealed that almost none of proteasomal subunits were differentially expressed at basal levels, because they appeared to be unaffected by stably-induced expression of any one of Nrf1 isoforms  is crucial for eukaryotic cells to adjust its capacity of protein degradation to changing proteolytic requirements, because these proteins are marked with polyubiquitin chains targeting for their degradation by the 26S proteasome, an ATP-dependent complex consisting of the 20S proteolytic particle capped by one or two of the 19S regulatory particlesrms Fig.\u00a0.Figure 5PSMA1, PSMA4, PSMB7, PSMC2 and PSMD12 by real-time qPCR  of BTZ enabled for significant stimulation of Nrf1\u03b3 to increase mRNA expression levels of all the examined proteasomal subunits, albeit the detailed mechanism(s) remains to be further explored.To address this, we validated Nrf1-stimulated induction of proteasomal subunits by its inhibitors. Experimental cells that had pretreated with 1\u2009\u03bcg/ml of Tet alone or plus a low (0.01\u2009\u03bcmol/L) or a high (10\u2009\u03bcmol/L) concentration of bortezomib (BTZ) for 16\u2009h were subjected to further determination of mRNA expression levels of some proteasomal subunits, including PCR Fig.\u00a0. As expe38, GCLM , GCLC 42, MT1E 43, PGC-1\u03b2 44 and LPIN1 (lipin1)45. As expected, the experimental results revealed that these Nrf1-target genes exhibited different trends to be expressed specifically in distinct isoform-expressing stable cells , and then determined by real-time qPCR. As shown in , KPNB1 (karyopherin subunit beta 1), FOXC1 (forkhead box C1) and ELOVL5 (ELOVL fatty acid elongase 5) were differentially up-regulated by Nrf1\u03b2, at less increased levels than equivalents regulated by Nrf1\u03b1 and Nrf1\u03b3  and KRT19 (keratin 19) were differentially down-regulated by Nrf1\u03b2  was down-regulated by Nrf1\u03b1 and Nrf1\u03b3, but up-regulated by Nrf1\u03b2 24. The transcriptional expression of AREs-driven genes is thus determined by differential recruitment of Nrf1, Nrf2 and Nrf3, in different combinations with each of their heterodimeric partners , to target gene promoters. Of note, Nrf1 and Nrf2 are two important CNC-bZIP transcription factors expressed ubiquitously in various vertebrate tissues and thus elicit their putative combinational or competitive functions. Relative to the well-known water-soluble Nrf2, less attention has hitherto been drawn to the membrane-bound Nrf124. However, major discoveries that had been made in the past twenty-five years have convincingly revealed that Nrf1, but not Nrf2, has been shown to be indispensable for maintaining cellular homoeostasis and organ integrity during normal development and healthy growth, as well as a vast variety of other patho-physiological processes. Importantly, several significant pathological phenotypes were developed in different transgenic mice (expressing distinct mutants of loss-of-function of Nrf1), including embryonic lethality, fetal anemia, lipid metabolic disorder, obesity, fatty liver, NASH, liver cancer, neurodegenerative diseases, hyperinsulinemia, diabetes, Warbug effect with high glycolysis. In addition, other mice expressing gain-of-function mutants of Nrf1 displayed glucose metabolic disorder, insulin resistance, diabetes and reduced body-weight. Thus it is inferable that the functional activity of Nrf1 is finely tuned, to a robust homeostatic extent, by a steady-state balance between its production and the concomitant processing into distinct isoforms before being turned over, which are together coordinated to confer on the host cytoprotection against a variety of cellular stresses.Differential expression of different subsets of cognate genes is dependent on their enhancers and promoter regions containing distinct Nfe2l1/Nrf1 gene, though differentially expressed, in different mammalian species. These isoforms are synthesized by translation through distinct initiation signals  embedded in different lengths of open reading frames, portions of which can be alternatively spliced from intact or longer transcripts. The resulting variations in the abundance of each isoform may not only influence the whole transcriptional functions of Nrf1 to regulate distinct subsets of cognate target genes and also contribute to the nuance in between distinct pathological phenotypes24. Therefore, it is of crucial important to determine differences in transcriptional regulation of cognate genes mediated by each Nrf1 isoform. Although this is hard, our present study has identified differential expression profiles of distinct target genes regulated by Nrf1\u03b1, Nrf1\u03b2 and Nrf1\u03b3 alone or in their cooperation respectively. Here, we have further determined differences in the transcriptional regulation of Nrf1-target genes by between each Nrf1 isoforms. Notably, Nrf1\u03b1 and Nrf1\u03b2 are two major isoforms contributing to the main Nrf1-mediated transcription of downstream genes at RNA levels, such that a vast majority of differentially expressed genes are up-regulated by Tet-inducible expression of these two isoforms. On the contrary, stably Tet-inducible expression of Nrf1\u03b3 as a putative dominant-negative inhibitor is likely to interfere with the putative functional assembly of active transcription factors , leading to down-regulation of several key genes, some of which are up-regulated by Nrf1\u03b1 and Nrf1\u03b2. These findings are consistent with our previous reports48. Collectively, these findings are very helpful to elucidate which isoforms of Nrf1 contribute to different transcription of distinct subsets of target genes that are involved in those significant pathological phenotypes. Thus, this study has provided three cell models to facilitate the future development of Nrf1 isoform-specific targets for chemoprevention against relevant diseases 49.Accumulating evidence has also unraveled that over eleven of distinct Nrf1 isoforms are produced from the single 48, which revealed that this low molecular weight isoform acts as a dominant-negative inhibitor of Nrf1 competitively against the functional heterodimeric assembly of either an active transcription factor  or another homologous trans-repressor (i.e. Bach1 and Bach2) with one of their cognate partner sMaf or other bZIP proteins . Therefore, it is plausible that either transactivation or transrepression of distinct subsets of similar and/or different target genes driven by AP1-like ARE/EpRE batteries depends possibly on a nuance between different temperospatially-assembled heterodimeric complexes of these CNC-bZIP factors with their partners. This is to say, understandably, that the dominant-negative form of Nrf1\u03b3 is much likely to counteract (or interfere with) the putative activity of its prototypic factors Nrf1\u03b1/\u03b2 to transactivate or transrepress their downstream genes. For this reason, it is thus deduced that if some genes are down-regulated by Nrf1\u03b1/\u03b2, this down-regulation is abolished or even reversed to allow for their activation by Nrf1\u03b3. In addition, there also exists an exception that a few number of Nrf1-target genes , whereas antibody against KEAP1 was purchased from Sangon Biotech . Mouse monoclonal antibody against the V5 epitope was from Invitrogen Ltd, whilst anti-\u03b2-actin and secondary antibodies were obtained from Zhongshan Jinqiao Co .All chemicals were of the highest quality commercially available. Hygromycin-B and blasticidin were purchased from Invitrogen Ltd, which served as double screening drugs to select the positive clones by final concentrations of 150\u2009\u03bcg/ml and 15\u2009\u03bcg/ml, respectively. The inducible reagent tetracycline hydrochloride was from Sangon Biotech Co  and used at a final concentration of 1\u2009\u03bcg/ml. The proteasome inhibitor bortezomib was purchased from ApwxBio (USA). The antibody against endogenous Nrf1 proteins was acquired from our lab  containing 2\u2009\u03bcg/ml protease inhibitor cocktail . The protein concentration of lysates was quantified by using BCA Protein Assay Reagent . Equal amounts of protein prepared from cell lysates were loaded into each electrophoretic well so as to be separated by SDS-PAGE, followed by visualization by immunoblotting with each of indicated antibodies as described previously53, and \u03b2-Actin was served as an internal control to verify amounts of proteins that were loaded in each well.Experimental cells were harvested in a denatured lysis buffer . Then, 1.5\u2009\u03bcg of total RNAs were used as a template for the subsequent synthesis of cDNA by using a RevertAid first strand cDNA synthesis kit . The resulting cDNA products (15\u2009ng) served as the templates of quantitative real-time PCR within 5\u2009\u03bcl of the MixGoTaq qPCR Master Mix . Each of RT-qPCR with distinct pairs of primers , along with the negative control cells, were allowed for growth in 6-well plates, before being induced by tetracycline (1\u2009\u03bcg/ml) for 12\u2009h. Such similar three independent experiments were conducted to prepare the samples on the same experimental conditions. Total RNAs were extracted by using an RNAsimple total RNA kit  and the integrity of RNAs was checked by an Agilent Bioanalyzer 2100 system . For each sample, equal amounts of total RNAs from three independent experiments were pooled for RNA-Seq. Subsequently, RNA-Seq was carried out by Beijing Genomics Institute  on an Illumina HiSeq 2000 sequencing system  after the sample library products are ready for sequencing.54. Then, the clean reads were mapped to the reference human genome (GRCh37/hg19 from UCSC database) by using SOAP2 (ref.55), and gene expression levels were calculated by using the RPKM (Reads Per Kilobase of feature per Million mapped reads) method16. The expression of genes regulated by each Nrf1 isoforms, relative to the control sample, was calculated as Log2 (fold change), with a P-value calculated corresponding to the differential gene expression test and FDR , and the differential expressed genes (DEGs) were further identified by the Poisson distribution model method (PossionDis)56, which was developed referring to \u201cThe significance of digital gene expression profiles\u201d57 by BGI. Similar methods have also been applied in recent publications60. Both FDR \u22640.001 and the absolute value of Log2 (fold change) \u22651 were herein taken as the threshold to identify differentially expressed genes. To give a better understanding of potential functions of the DEGs, both GO and KEGG pathway analysis were performed by using the online tools DAVID (https://david.ncifcrf.gov/) and KEGG (http://www.kegg.jp/) databases, respectively. In addition, the putative interaction networks of Nrf1-related genes were searched from the databases of BioGRID (https://thebiogrid.org/) and STRING (https://string-db.org/), before being annotated with sequencing results by the Cytoscape software61. The sequencing data have been submitted to NCBI SRA (PRJNA501789). For detailed descriptions, please see relevant supplementary contents at http://www.genomics.cn/en/index.Before sequencing analysis, all mRNAs were fragmented into short fragments (about 200\u2009bp) and the low-quality reads in which its percentage  is greater than 50% were removed during data filtering. After examining the sequence quality and removing the \u201cdirty\u201d raw reads, which contain low quality reads and/or adaptor sequences, clean reads  were generated and stored as the FASTQ formatt-test or Fisher\u2019s exact test, as appropriate. The resulting value of p\u2009<\u20090.05 was considered as a significant difference. In addition, statistical determination of the \u2018dry\u2019 sequencing analysis was aforementioned.The \u2018wet\u2019 experimental data provided in this study were represented as the mean\u2009\u00b1\u2009SD and were analyzed using the Student\u2019s Supplementary Info FileDataset 1"}
{"text": "When focused, this source can ionize gas targets, which we demonstrate here through the ionization of atomic xenon at wavelengths ranging from 5\u2009\u03bcm to 9\u2009\u03bcm. This opens up new opportunities for fundamental atomic and molecular physics, enabling experimental tests of strong-field ionization theories in the extreme long-wavelength, few-cycle limit and the direct excitation of vibrational transitions in organic molecules.For the last several decades, the wavelength range accessible for strong-field, few-cycle studies has remained limited to the visible, near infrared and mid-wave infrared regimes. In particular, sources in the long-wave infrared have been lacking. We report the development of a 1 kHz, few-cycle laser source with up to a 9\u2009 These applications would strongly benefit from longer wavelength driving sources as the pondermotive energy of an electron accelerated by a laser field scales with the square of the wavelength. The extension of strong-field, ultrafast science into the MWIR regime9 has allowed for scientific advances such as the first demonstration of a table-top coherent X-ray source11, the generation of isolated attosecond pulses with photon energies up to 300\u2009eV2, as well as the first femtosecond-resolved measurement of chemical bond dynamics with angstrom resolution5.The interaction of strong laser fields with atoms and molecules has been of considerable interest for decades. Technical developments in this area have led to, among other breakthroughs, the generation of attosecond pulses\u03bcm) regime. The quadratic wavelength scaling of the energy of the photoelectrons presents an enticing reason for pushing to longer wavelengths. Additionally, broadband pulses in this regime allow for the simultaneous excitation of many molecular ro-vibrational energy levels13. Unlike LWIR sources emphasizing high average power, intense few-cycle fields in the LWIR promise to deliver new strong-field studies in molecular phenomena14. Other interesting possibilities with intense, ultrafast sources in this wavelength regime include the observation of dynamics due to the breakdown of the dipole approximation at modest intensities16 and extreme modification of optical waveforms via shock formation17. However, the development of high energy, ultrafast laser sources in the LWIR has proven to be a technologically challenging endeavor.Such studies have motivated the development of intense ultrafast sources at even longer wavelengths in the long-wave infrared  durations18 and have progressed slowly since their early use in strong-field ionization experiments19. A standard method for generating femtosecond pulses in this region employs difference frequency generation (DFG), where two high frequency fields are mixed in a suitable nonlinear medium to produce a new field which can possess a much longer wavelength24. Recently, a new source based on optical parametric chirped-pulse amplification has demonstrated 200\u2009\u03bcJ, ~8-cycle pulses with a MWIR wavelength of 7\u2009\u03bcm25, while another based on DFG has achieved sub-cycle fields at 30\u2009\u03bcJ, spanning 2\u20139\u2009\u03bcm, but with a central wavelength of 4.2\u2009\u03bcm26. To date, no strong-field ionization studies have been reported with these sources due to the difficulty of achieving the required peak intensities.The most intense sources currently available in the LWIR, based on CO\u03bcm. Using this apparatus we demonstrate, to the best of our knowledge, the first strong-field ionization in the LWIR with femtosecond pulses. These results utilize a collinear DFG scheme, which has several advantages. First and foremost, the technique requires only one nonlinear crystal after an optical parametric amplifier (OPA) while simultaneously delivering fields without spatial chirp (ensuring feasibility for achieving high peak intensities). Secondly, the short path length and minimal number of transmissive optics produces near transform-limited, few-cycle pulses. Finally, with a front-end based on Ti:Sapphire and an OPA, technology present in most strong-field science laboratories, this technique can be readily implemented at other facilities.In this work we demonstrate an intense, tunable light source in the LWIR possessing only 2.8 cycles under the FWHM at a central wavelength of 8.9\u2009et al.27. DFG between the signal and idler of the OPA is performed in an interferometer-based setup. Collinear overlap is ensured by observing the spatial chirp of the LWIR mode in the far field. This allows the beam to be focused to the smallest possible area and, thus, produce the highest peak intensities.As shown in Fig.\u00a02(I) crystal . With this crystal, up to 4.2 mJ  of the OPA can be used in the DFG process. Incident energies greater than 4.2 mJ accelerate degradation of the crystal and show signs of nonlinear back-conversion. By tuning the central wavelength of the signal from 1300\u2009nm to 1450\u2009nm, with the corresponding idler changing from 2000\u2009nm to 1730\u2009nm, the central wavelength of the DFG output is tuned from approximately 3.5\u2009\u03bcm to 9\u2009\u03bcm.For DFG, we use a 1\u2009\u00d7\u20091\u2009\u00d7\u20090.1 cm, anti-reflective (AR) coated AgGaS\u03bcm region that is highly reflective (\u224890%) of the OPA signal. This increases the usable peak power in the LWIR by as much as a factor of 2.2 at wavelengths greater than 8\u2009\u03bcm without hindering other characteristics of the LWIR field, such as pulse duration (see section 2 of Supplementary Information). As shown in Fig.\u00a0\u03bcJ at 5.3\u2009\u03bcm and up to 80\u2009\u03bcJ at 8.9\u2009\u03bcm center wavelengths.As we require a collinear arrangement for high peak intensities, the LWIR field must be separated from the higher frequency beams using a 1\u2009mm thick, AR coated, low-pass, Germanium (Ge) filter. However, the OPA\u2019s large fluence on the Ge surface produces a high density of free carriers that can attenuate the LWIR pulse by as much as 55%. We reduce the free carrier density by incorporating a coated, 1\u2009mm thick, zinc selenide window before the Ge filter, which has an AR coating for the 3\u201312\u200928. As shown in Fig.\u00a0\u03bcm. Figure\u00a0\u03bcm central wavelength, Fig.\u00a0\u03bcm yield pulses with fewer than three optical field cycles under the FWHM.A characterization of the electric field is performed using a cross-correlation frequency resolved optical gating (XFROG) device\u03bcm on the top row and down to 5.3\u2009\u03bcm on the final row.In addition to the retrieved fields shown in 2(b) and 2(c), XFROG results over a broad range of wavelengths from our LWIR apparatus are shown in Fig.\u00a027. This, combined with the OPA\u2019s passively CEP stable idler29, provides a straightforward route to phase stable LWIR fields.We plot the electric field for a carrier envelope phase (CEP) of zero for Fig.\u00a0\u03bcm, 8\u2009\u03bcm, and 5.3\u2009\u03bcm (not shown) using an ion time-of-flight (iTOF) apparatus. Figure\u00a0\u03c7(3) processes in the AGS crystal was investigated and, to our best knowledge, these processes are not present in this system. The iTOF was designed to support the 2.5\u2009cm back-focus required for the experiment, otherwise it is a common arrangement with an extractor, repeller, and drift tube. Figure\u00a0+ ionized using a \u03bb\u2009=\u20098.9\u2009\u03bcm pulse which clearly shows all the abundant Xe isotopes. No higher charge states of Xe were observed. Further details of the detection system are found in the Methods section. Figure\u00a0+ as a function of input pulse energy (top axis) in log-log scale for \u03bb\u2009=\u20098\u2009\u03bcm. These results represent, to the best of our knowledge, the first strong-field ionization results, with femtosecond pulses, in the LWIR. The wavelength dependence of ionization versus intensity will be presented in an upcoming publication.As proof of this source\u2019s ability to deliver intense fields across a large wavelength range, we measure the strong-field ionization of xenon (Xe) atoms at 8.9\u2009\u03bcm, we undertook two measures for determining the intensity range. First, we determined the beam waist at the gas target in the iTOF using a scanning slit and a thermopile detector. The measurement, described in section 3 of the supplement, determined that the setup could achieve a 1/e2 radius waist of 30\u2009\u03bcm for the back-focusing system in Fig.\u00a02. Further improvement in the beam quality, such as using a spatially filtered OPA30, can dramatically improve the focusing characteristics without sacrificing the peak power. Our second route to determining the peak intensity implemented a fit of our data to the Perelomov-Popov-Terent\u2019ev (PPT)31 formulation of strong-field ionization theory. PPT was recently shown to accurately describe experimental results for multi-cycle pulses from 400\u2009nm to 3.9\u2009\u03bcm32. Fitting our data, shown as the dashed blue line in Fig.\u00a02 (bottom axis), which is a factor of 2.5 lower than the estimate from our beam waist measurement. As the source delivers few-cycle fields, the effect of a varying CEP was also considered and found to have an insignificant change in the overall ionization rate. If we consider the intensities predicted from our fit to PPT, we observe Xe+ ionization at a Keldysh parameter33 value of 0.23 and in a region where the HHG cutoff19 is nearly 400\u2009eV. With more attention to the focusing quality of the source, it should be possible to reach the 100 TW/cm2 mark.To better understand the ionization versus intensity results at 8\u2009\u03bcm to 8.9\u2009\u03bcm. Our collinear DFG scheme maintains broadband transform-limited pulses in this wavelength range. We experimentally measured the pulse durations to be between 70 to 90\u2009fs, depending on the wavelength, delivering a 5.8 cycle field at 5.3\u2009\u03bcm and 2.8 cycles at 8.9\u2009\u03bcm. Over this entire wavelength range, the source can be focused on target to peak intensities high enough to induce strong-field ionization in Xe. To the best of our knowledge, these are the longest wavelengths that a femtosecond pulse has been used to ionize neutral atomic targets, paving the way for many new and exciting studies in the intense long-wave infrared regime.We have demonstrated the generation of intense, few-cycle pulses in the LWIR tunable from 5.3\u20092 Type (I) crystal (AGS). This allows the weak sum frequency beam to be spatially separated from the much stronger gating field using an iris. After collecting the generated sum frequency signal in a spectrometer, a spectrogram  pulse, as compared to using only the Ge window. A series of additional tests were performed to determine the nature of this observation. The analysis determined that the transmission of LWIR light through Ge increases as the fluence of the OPA signal decreases on the Ge surface. This can be explained by the OPA signal (0.85\u20130.9\u2009eV) performing a one photon transition to Ge\u2019s direct band gap (0.8\u2009eV), which subsequently allows LWIR photons to be lost to free carrier absorption (FCA). This is further supported by two facts. First FCA rates increase wavelength squared, making 8\u2009\u03bcm more susceptible than 5\u2009\u03bcm, which is what we see. Secondly, the AR coating on the ZS window reflects more than 90% of the OPA signal, which removes the first step of the proposed mechanism.When a 1\u2009mm thick ZS window is inserted before the 1\u2009mm thick Ge window in the path leading out of the AGS crystal, we find that the available energy for the LWIR pulse increases approximately 20% (220%) for a 5\u2009\u22127 torr, consisting mainly of common atmospheric gases. The Xe gas sample was introduced by backfilling the vacuum chamber to a pressure of approximately 2\u2009\u00d7\u200910\u22125 torr for the studies at 8.0\u2009\u03bcm. For each intensity point, a time-of-flight spectrum is recorded for 1.2 million laser shots, which requires 20\u2009minutes. Ion yields shown in Fig.\u00a0All ionization experiments were performed using an ion time-of-flight (iTOF) mass spectrometer. The chamber background pressure was 1\u22c510\u03bcJ) amount of LWIR leakage on the PyD. This allows for single-shot monitoring of the LWIR pulse energy by recording the peak of the electronic signal with an analogue to digital converter synchronously with the iTOF signal. The single-shot PyD was calibrated for each wavelength, by measuring the average power with a thermopile sensor and also taking into account the in-coupling window of the vacuum chamber. Finally, a periscope steers the main LWIR into the iTOF apparatus and is back focused inside the chamber with a spherical concave mirror of 25\u2009mm focal length.Simultaneously, a pyroelectric detector (PyD) was used to the measure a small fraction of the LWIR beam to allow for single-shot pulse energy tagging. For this tagging, we used the Fresnel reflection from a Ge window See Fig.\u00a0 filteredSupplementary information"}
{"text": "Protocatechuic acid exerts multiple health\u2010promoting effects such as anticancer, anti\u2010atherosclerosis, and neuroprotection in animal models. While protocatechuic acid produced in the lower gastrointestinal tract by microbial catabolism of several flavonoids is bioavailable, the pharmacokinetics of protocatechuic acid has not been evaluated so far in humans following its oral consumption. In this open\u2010label and single\u2010dose pharmacokinetic trial, 16 healthy adults followed a low\u2010phytochemical diet for three days. Next, after overnight fasting, participants consumed 150\u00a0g of chicory containing 248\u00a0\u03bcmol of protocatechuic acid. Blood, urine, and fecal samples were collected before and up to 24\u00a0hr after chicory consumption. Protocatechuic acid in the free and glucuronide/sulfate\u2010conjugated forms was almost undetectable in serum, urine, and fecal samples before chicory consumption. Chicory consumption increased the levels of protocatechuic acid and its glucuronide/sulfate conjugates in biological samples. The maximum serum concentrations of protocatechuic acid in the free\u2010, glucuronide\u2010, and sulfate\u2010conjugated forms were 3,273, 519, and 340\u00a0nmol/L, respectively. The recovery of total protocatechuic acid in blood circulation, urine, and feces was 23.79%, 12.17%, and 12.79% of the ingested dose, respectively. Moreover, glucuronide and sulfate conjugates of protocatechuic acid made up 34.79%, 60.15%, and 72.70% of its total recovery in blood circulation, urine, and feces, respectively. Collectively, protocatechuic acid from chicory is bioavailable and undergoes partial glucuronidation and sulfation in human adults, and its regular consumption may exert health\u2010promoting effects. Chicory was from Hebei Vilof Agritech Co., Ltd, which were transported in a light\u2010proof foam box with a cold supply chain and consumed by the subjects in 24\u201336\u00a0hr after harvest.Protocatechuic, gallic, caffeic, 5\u2010caffeoylquinic, and chicoric acid were purchased from Chengdu Must Bio\u2010Technology Co., Ltd. Caftaric acid was from Extrasynthese . Solutions of standard phenolic acids were prepared in 50% methanol\u2013water (volume/volume). \u2010glucuronidase  and women (n\u00a0=\u00a08) participants by word of mouth among the physical examinees at the Physical Examination Center of Guangdong Second People's Hospital. The participants were nonsmokers and not taking any medication or nutritional supplements in the last three months. All participants had regular daily bowel movements. None of the women participants were pregnant. They were healthy as judged by a medical questionnaire, with normal blood values for blood pressure, aspartate aminotransferase, and alanine aminotransferase. All participants were informed about the purpose of the study and gave written informed consent before their inclusion in the trial. This trial was approved by the Ethics Committee of the School of Public Health at Sun Yat\u2010sen University [2017 No. 009] and registered at ClinicalTrials.gov as ChiCTR1800014393. This trial was conducted in accordance with the Declaration of Helsinki of 1975 as revised in 2008.We recruited healthy adult men  bioavailability of protocatechuic acid from chicory juice. The flowchart of participants in this pharmacokinetic trial is summarized in Figure 2.4Phenolic acids in chicory and biological samples were extracted and determined by a high\u2010performance liquid chromatography assay with electrochemical detection (HPLC\u2010ECD) as previously described with minor modifications ; time to achieve maximum serum concentrations (Tmax); the area under the concentration\u2013time curve to 24\u00a0hr (AUC0\u201024); and terminal elimination half\u2010life (T1/2z). The apparent bioavailability of protocatechuic acid together was quantified using AUC0\u201024 divided by its ingested amount. Urinary and fecal recoveries were calculated using the total content of urinary and fecal protocatechuic acid divided by its ingested amount.The pharmacokinetic parameters of protocatechuic acid in the free, glucuronide, and sulfate conjugates were calculated using DAS 2.1 (BioGuider Co.), with a noncompartmental model: maximum serum concentrations (C2.7SD. The significance of differences between the baseline (0\u00a0hr) and the indicated time points after chicory consumption was assessed by ANOVA for repeated measures and Dunnett's 2\u2010tailed t test, assuming the baseline values as the reference category. p\u00a0< .05 was considered significant.Data are presented as means\u00a0\u00b1\u00a033.1Phenolic acids consist of derivatives of hydroxybenzoic acids and hydroxycinnamic acids. Representative HPLC chromatograms of phenolic acid extracts from chicory are shown in Figure 3.2All participants, which included eight men and eight women, were generally healthy with normal blood biochemistry and body mass index Table .3.3max of 3,273\u00a0\u00b1\u00a0729\u00a0nmol/L at 1\u00a0hr postconsumption  was incubated in fresh human fecal suspensions with gut microbiota, and the content of protocatechuic acid was then quantified. The initial substrate dose was 1\u00a0\u00b5mol, from which 95.8\u00a0\u00b1\u00a03.3%, 86.0\u00a0\u00b1\u00a03.0%, 79.3\u00a0\u00b1\u00a05.7%, 91.5%\u00a0\u00b1\u00a04.7%, and 72.8\u00a0\u00b1\u00a04.0% for gallic, caffeic, 5\u2010caffeoylquinic, caftaric, and chicoric acid, respectively, were recovered at the initial time point (0\u00a0hr) from the fecal suspensions  is highly bioavailable (Czank et al., \u2010/\u2010 mice through similar mechanisms by promoting endothelium\u2010dependent vasodilation (Liu et al., Because in vitro studies have shown that protocatechuic acid and its glucuronide/sulfate conjugates at the dosage of 1,000\u00a0nmol/L exert anti\u2010atherosclerosis\u2010related effects in macrophage\u2010derived foam cells and vascular endothelial cells (Amin et al., Previous studies in humans and animal models have shown that gut microbiota metabolism of certain polyphenols is able to generate protocatechuic acid (Czank et al., Glucuronidation and sulfation are the most important phase II metabolic pathways for polyphenols (Manach, Scalbert, Morand, Remesy, & Jimenez, 1/2z of sulfated conjugate, recoveries of urinary glucuronide conjugate, and fecal\u2010free form of protocatechuic acid were significantly different between men and women. These data highlighted that much work is needed to be accomplished in the issue of gender\u2010dependent pharmacokinetics of polyphenols in humans, which might help to explain the variable health\u2010promoting efficacy between men and women (Campesi, Marino, Cipolletti, Romani, & Franconi, Although the pharmacokinetics of polyphenols in humans has been well studied, little is known about their differences between men and women (Lu & Anderson, Two limitations in this study should be born in mind. Firstly, although our findings from the in vitro fermentation assays showed that gallic, caffeic, 5\u2010caffeoylquinic, or chicoric acid could not be converted to protocatechuic acid by fresh human feces with gut microbiota, we did not exclude the possibility that the conversion of those phenolic acids to protocatechuic acid happens in humans owing to the fact that only a small proportion of gut microbiota can be cultivated in vitro (Gilbert et al., 5In conclusion, we have demonstrated for the first time that protocatechuic acid is bioavailable and undergoes partial glucuronidation and sulfation in healthy human adults following chicory consumption. Because protocatechuic acid possesses multiple biological effects in animal models, future clinical trials are worthy to confirm whether chicory recapitulates its effects in humans.None.D.W. conceived and designed the experiments; J.Z., H.X., L.H., H.W., and Q.L. performed experiments; J.Z, H.X., L.H., H.W., and Q.L. analyzed data; W.L. revised the manuscript; and D.W. and J.Z. wrote the paper. All authors read and commented the manuscript.This study was approved by the Ethics Committee of the School of Public Health at Sun Yat\u2010sen University.\u00a0Click here for additional data file."}
{"text": "Digital, art\u2010 and story\u2010based resources can be viable and engaging knowledge translation strategies in health care. Understanding the usability of these approaches can help maximize their impact. The aim of this work is to understand what aspects of \u2018My Asthma Diary\u2019, an art\u2010based digital knowledge translation tool for parents of children with asthma, has an impact on usability.Sequential explanatory mixed methods pilot study.Eighteen parents of children with asthma reviewed \u2018My Asthma Diary\u2019 in a paediatric emergency department and completed a usability questionnaire. Follow\u2010up interviews were conducted with five parents and analysed with qualitative description.We identified four themes which complemented the quantitative results: (a) the eBooks are relatable and mirror personal experience; (b) the digital format is convenient and easy to navigate; (c) the narrative structure aids learning; and (d) the narrative and illustrations are synergistic. We summarize core usability considerations for subsequent research and creative knowledge translation tool development in other contexts. How can creative methods of representing research be optimized to improve research engagement and optimize illness self\u2010management? Creative knowledge translation (KT) strategies are increasingly regarded as viable means of supporting this engagement by providing research evidence in palatable, meaningful and comprehensible formats  and two mediating factors   as visible in Figures 2.2hosted  arts\u2010based KT resources usable, in part because of the emergent status of such approaches   were approached on a convenience basis to discuss the study. Eligible parents were English speaking and identified as a primary caregiver for a child with asthma or asthma\u2010related concern. Parents were invited to review one of four eBook prototypes (i.e. prototype three), complete a paper\u2010based 27\u2010question usability questionnaire and consent to a follow\u2010up interview. Parents were fully informed about the study prior to providing verbal consent to participate.).The questionnaire included four pre\u2010 and post\u2010test visual analog scale (VAS) measures  anchored at 0  and 10 (\u2018very much\u2019), 15 descriptive VAS measures specific to three dominant usability constructs  and four open\u2010ended questions. The VAS was developed based on recognized usability constructs and additional measures adapted for arts\u2010based KT  and descriptive statistics. Statistical significance was set at .05. Open\u2010ended questions were content analysed. Qualitative data were analysed inductively, guided by qualitative description. Audio recordings were listened to repeatedly, detailed notes and analytic memos were made, and data were loosely grouped thematically. Themes were revised and categories regrouped as analysis progressed. Rigour was enhanced through detailed memos and through team meetings where emerging findings were discussed and rigorously questioned. Problems encountered while using the eBooks were classified as critical or general incidences (i.e. usability issues that do or do not impair use), and participants were asked for suggestions to improve the eBooks function in relation to occurring incidences. We then used a sequential mixed analysis approach to analysing and integrating qualitative and quantitative data , parametric , which they regarded as an appropriate length . Descriptive statistics illustrate positive ratings on constructs related to effectiveness, efficiency and satisfaction. Outliers were encountered; for instance, participants occasionally provided very low ratings on the enjoyment, contribution of drawings to information and quality of information subscales. Open\u2010ended responses and follow\u2010up qualitative interviews suggest that participants may not have accessed the information icons  embedded throughout the tool, relying exclusively on the storyline to receive information. One participant who provided a low enjoyment rating found the story was \u2018scary and intimidating\u2019 for first time parents dealing with asthma , confidence in managing asthma day\u2010to\u2010day (p\u00a0=\u00a0.055) and confidence in managing asthma exacerbations (p\u00a0=\u00a0.021) using the related\u2010samples Wilcoxon signed\u2010ranks test . We ran paired t tests to obtain data on mean differences and standard deviations. Paired t tests revealed significant improvements in knowledge (t(17)\u00a0=\u00a03.09, p\u00a0=\u00a0.007) between pre  and post  measures; and significant improvements in confidence in managing asthma exacerbations (t(17)\u00a0=\u00a02.33, p\u00a0=\u00a0.032) between pre  and post  measures.Given the small quantitative sample and lack of random sampling, we conducted pre\u2013post evaluations of knowledge gain (6.2n =\u00a01), technical school (n =\u00a03) and university (n\u00a0=\u00a01) levels. Interviews lasted an average of 36\u00a0min (range: 24\u201341.83\u00a0min). Iterative data collection and analysis confirmed that participants were identifying few usability issues; it appeared unlikely that further incidents would be encountered through additional data collection.Of eight parents who consented for follow\u2010up, five  completed a telephone interview. All self\u2010identified as the child's primary caregiver; had been managing asthma for a period ranging from 1\u20138\u00a0years; and had educational attainments at the high school (\u00a0=\u00a08.29), including its format, content, method of delivery and length. Four themes were identified from the qualitative analysis and are presented here as narrative statements: (a) the eBooks are relatable and mirror personal experience; (b) the digital format is convenient and easy to navigate; (c) the narrative structure aids learning; and (d) the narrative and illustrations are synergistic. These themes are discussed in reference to affiliated quantitative measures and open\u2010ended questionnaire responses.Parents had an overwhelmingly positive response to the eBooks. They consistently reported that the information was clear  and relevant, the digital format was appealing and easy to use , and the storyline (mean\u00a0=\u00a07.46) and characters (mean\u00a0=\u00a07.03) were relatable and engaging. Parents unanimously reported satisfaction with the eBook (mean6.2.1(participant 3)It talks to you\u2026and everyone can find a way to relate to it. Participants unanimously reported that the eBooks were highly relatable (mean\u00a0=\u00a07.46), regardless of whether the storyline reflected precisely their experiences. The emotional connection made possible through the telling and reliving of the fictional mother's story was a source of relatability for many participants and the uncertainty surrounding the asthma trajectory often mirrored participants' experiences. Delivering information through a first\u2010person narrative enhanced participants' emotional connection and provided emotional validation \u2014the eBook was regarded as more personal than other methods of delivering information (e.g. pamphlets) and enabled participants to \u2018put yourself in their shoes\u2026 it's a real person\u2026 it's real information\u2026 it was very comforting\u2019 (participant 3).All participants emphasized how the eBook was appropriate for use with their child with asthma. The engaging illustrations and story made the eBook useful for reading with their child . Participant 3 expressed, \u2018you can't put a medical document in front of a four\u2010year old\u2019 and \u2018here's a story and\u2026 she relates to this!\u2019. Participants one and four credited the eBook to opening a dialogue about asthma with their child. Parents recognized the need for children to learn about his/her asthma and the eBook was seen as a useful tool to facilitate this learning.Participants expressed that the storyline reflected the reality of living with childhood asthma, thereby increasing its relatability. Specifically, participants noted that the ending of the story, wherein the central character (a 6\u2010year\u2010old boy) achieves asthma control but does not outgrow asthma, was particularly salient, believable (participants 1\u20135) and hopeful (participant 3). As participant 1 emphasized, the \u2018growing out of asthma\u2019 discourse was prevalent among her family and friends; the concluding sentiments in the eBook provided a needed reflection of the reality of living with asthma. For others, the turning point signified by the asthma clinic referral (participant 4), or the seasonal variations in asthma  present in the narrative were particularly reflective of parents' experiences.One participant identified that the use of multicultural names and characters effectively \u2018reflects the communities we are living in\u2019 and signified inclusivity (participant 5). While other participants did not explicitly identify this as a factor having an impact on relatability, it may have influenced the high quantitative (mean\u00a0=\u00a07.46) and unanimously positive qualitative relatability ratings among the diverse participant sample. Namely, all participants, including the fathers, were able to relate to the story, despite the narrator being a mother. As participant 2 explained, he was still able to relate to the narrative because stories need not be interpreted literally and because having a mother as the central character may indeed reflect a reality of the caregiving experience.6.2.2(participant 3)The digital format was convenient. It gives instant access anytime I need it. \u00a0=\u00a08.29). Participants identified that convenience, portability and accessibility were augmented through the digital delivery. Digital delivery was also linked with ease of use for participants, a finding supported by the quantitative \u2018ease of finding information\u2019 measure, (mean\u00a0=\u00a07.77). Although each participant used the digital format in different ways, all participants used the navigational arrows to advance through the eBook. However, if and how participants accessed the \u2018important\u2019 information icons and external resource links varied, with few participants making use of the external resources .All participants were satisfied with the digital delivery format, consistent with the quantitative results .Most participants preferred the digital delivery to a paper\u2010based format . One participant (participant 3) expressed nostalgia\u00a0for paper\u2010books but concurrently stated that the eBook was a highly useful and convenient modality for asthma education. Similarly, in an open\u2010ended response, one participant requested paper copies so that the information could be re\u2010visited. Overwhelmingly, participants recognized the digital format as appropriate and reflective of the current digital era: a belief that \u2018everyone has a computer\u2019 (participant 4) or would use their hand\u2010held device to access information (participant 2) rendered the eBook a contemporary educational modality. For one participant (participant 5), the digital approach enhanced the eBooks' credibility: \u2018you see some of the brochures and you just know that they've been there for 20\u00a0years and are stale and out of date, not that reliable\u2026 because the format was digital you think, okay this is new, or newer, than a dusty old brochure or pamphlet and likely easier to update\u2019.6.2.3(participant 4)The storyline helped understand the parent's perspective\u2026 and triggers your memory. Participants found the story to be an effective communication approach because it helped organize information in a manner that \u2018flowed\u2019. The narrative gave structure to information that otherwise would be a series of facts. Parents expressed satisfaction with the quality of information provided; embedding information within a sequential narrative allowed participants to follow and make sense of the information (participants 1\u20135). In this way, the narrative \u2018made the information manageable\u2019 (participant 3), improved information recall  and enhanced the eBooks' ease of use, thereby supporting the quantitative findings.\u00a0=\u00a07.05, enjoyment in reading eBook measure). As participant 3 expressed, \u2018Putting the important information into a story, makes me feel better\u2026 it's not just some medical information booklet that you get and you read it and your bored and you don't understand half of what they're saying\u2026\u2019. An important component of this appeal was that the storyline situated the information in the context of family life: \u2018this wasn't just a generic asthma brochure but was a story of a family. That reinforced the seriousness of the condition\u2019 (participant 5).Participants identified that the flow of information was appealing , which supports the quantitative findings . In addition to the seasons, participants often identified the discussion of triggers , specifically pertaining to the family pet, as reflective of their own experiences (participant 5). When the storyline did not reflect the specifics of the participant's experience, the eBook was regarded as useful in \u2018getting the conversation going\u2019 (participant 1).6.2.4(participant 4)The narrative and the visuals work together. \u00a0=\u00a06.97, contribution of drawings to information; mean\u00a0=\u00a08.1 contribution of story to information; mean\u00a0=\u00a09.04, ease of understanding), which suggests that the narrative and visual components of the eBook work together synergistically. Indeed, participants reinforced this notion through statements such as \u2018the storyline triggers your memory\u2026 and the pictures help us think\u2019 (participant 4).The illustrations enhanced the eBooks' aesthetic and aided in its functionality. Participants expressed that the illustrations contributed to comprehension, engagement and overall appeal (participants 1\u20135). They referred to the interplay between the story and illustrations, a finding supported by participants' quantitative ratings (meanThe illustrations reinforced and complimented the eBook content. Participants emphasized how the illustrations improved information clarity and made the research\u2010based information more comprehensible (participants 1\u20135); the amount of detail in the illustrations reinforced the key learning points  and at times, helped re\u2010orientate participants to what their children were experiencing. A particularly effective illustration in this respect was a visual rendering of constricted bronchial tubes Figures , 3, 4, tThe participants enjoyed the illustrations and style, which helped relate to and engage with the information provided. As one participant expressed, \u2018if there were no drawings, or illustrations, [the eBook] would be very boring\u2019 (participant 2). While four out of five participants related to the illustrations and one felt the depictions were \u2018dead\u2010on\u2019 (participant 1), participant 4 found the mother looked exceedingly worried; she expressed concern that this could worry her child if they read the eBook together. Interestingly, the same participant felt that the eBook could emphasize the experience of uncertainty more thoroughly. Overall, the qualitative results support and expand on the quantitative findings: the story contributed more to the information than the illustrations, but both were integral to the effectiveness, efficiency and satisfaction of engaging with the eBook.6.3(participant 2)Color is more attractive and captures our imaginations. Participants unanimously preferred the coloured versions of the eBooks  to the black and white versions . The black and white versions were seen as \u2018unfinished\u2019 (participant 5), less relatable and the illustration details  and \u2018familiar\u2019 (participant 4) graphic novel style of prototype four, while the remaining two preferred the illustration style of prototype three. Participants were divided into whether the comic\u2010like depiction was engaging, or whether it appeared juvenile.Participants had mixed perspectives about font. Participant 1 preferred the boldness and ease of reading of the comic font , where participant 2 found the comic font difficult to read, stating, \u2018there is no sign of where words start or stop\u2019. Two participants commented on how the text font \u2018matched\u2019 the illustration styles for all prototypes; the sans\u2010serif font was regarded as a \u2018softer, more conversational\u2019 match for the diary (participant 5).6.4We encountered two general incidents. First, 80% of participants did not notice the Table of Contents icon in the lower corner of each page. We classified this as a general incident since it did not impede participants' ability to navigate sequentially through the eBook. Participants suggested various strategies to improve icon visibility . Second, two participants identified that the \u2018important\u2019 icons  could be more noticeable. Three additional open\u2010ended responses suggested that the \u2018important\u2019 icons were not accessed. Participants suggested describing these icons and their importance in the eBooks' introduction, or adding colour or animation to the icons.6.5There were limitations to our study. We did not conduct real\u2010time, in\u2010person usability testing in a naturalistic environment, which could have revealed different usability issues , fit with purpose (e.g. does it communicate research in a meaningful and comprehensible way?), efficiency  and satisfactory display (e.g. is using the tool enjoyable?). Regardless of the creative modality employed, consideration to user\u2010centred design principles is necessary to ensure that KT tools are functional and appealing Bastien, . This isThe authors have no conflicts of interest to report.The Research Ethics Board at the University of Alberta granted approval for this study. Informed consent was obtained prior to parent's involvement in the quantitative study arm. Parents consented to follow\u2010up qualitative interviews following completion of the questionnaire. Verbal consent was obtained prior to completing the telephone interviews."}
{"text": "PM2.5 samples from three rural  and two urban (more populated) sites (Bayam\u00f3n and Ponce) from Puerto Rico were analyzed for various inorganic constituents. A total of 59 trace elements were analyzed, of which eight were considered with the greatest toxic potential. The highest annual average concentration of PM2.5 was reported at the urban site of Ponce (5.82 \u00b1 1.40 \u03bcg m\u22123), while Bayam\u00f3n\u2019s average concentration was not as high (4.69 \u00b1 1.30 \u03bcg m\u22123) compared to concentrations at the rural sites Humacao, Guayama, and Guayanilla  compared to that of all the rural sites (~ 6.40 \u03bcg m\u22123). The lowest summer PM2.5 values were obtained at the Humacao site with an average of 5.76 \u03bcg m\u22123. Average Cu and Zn concentrations were 3- and 2-fold higher at the urban sites (0.68 ng m\u22123 and 6.74 ng m\u22123 respectively) compared to the rural sites (0.17 ng m\u22123 and 4.11 ng m\u22123). Relative toxicity of inorganic PM extract indicates Bayam\u00f3n (urban) and Guayama with similar low LC50 followed by Humacao, Guayanilla, and finally Ponce (urban) with the highest LC50. Of the eight potential toxic metals considered, only Fe was found to be higher at the rural sites. To our understanding, there are different sources of emission for these metals which potentially indicate main anthropogenic sources, together with the trade winds adding periodically volcanic and African Dust Storm particulates that affect Puerto Rico. These results are the first of their kind to be reported in Puerto Rico.The exposure to airborne particulate matter (PM) and its constituents is an important factor to be considered when evaluating their potential health risk. Transition metals found in PM are known to contribute significantly to the exacerbation of respiratory ailments. Exposure to these constituents results in the induction of oxidative stress in the bronchial epithelium, thus promoting the secretion of inflammatory mediators. Therefore, it is important to know the contributions of PM Furthermore, inorganic materials like toxic metals, minerals , salts (ammonium sulfates and nitrates), and soil dust particles are also part of airborne PM complex mixture . This type of study and information has neither been previously reported nor has been a comparison done between rural and urban sites on the island. With the current understanding of the importance of PM metal toxicity, we must further explore the presence of these constituents, and fill the gap in the understanding of the etiology and source of exposure against the Puerto Rican population.In this study, we evaluate and compare particle pollution in two main urban cities of Puerto Rico, one on the north coast (Bayam\u00f3n) and one on the southern (Ponce). We also evaluate PM2.5 have been measured and reported in a systematic way around the island of Puerto Rico  on PTFE 2.0-\u03bcm Teflon filters by the Puerto Rico Environmental Quality Board (PR-EQB), which maintains a PM monitoring stations network at various locations in the Island as part of their monitoring program , May to August (S2), and September to December (S3)\u00a0for Bayamon and Humacao. For the other stations \u00a0two period were included, Jan-May and August to December. S2 was of major interest given that it is associated with the passing of African dust events which are seasonal and enriched particulate matter with both organic and inorganic compounds  and Bayam\u00f3n (n = 44 filters); and the rural stations: Humacao (n = 43 filters), Guayama (n = 94 filters), and Guayanilla (n = 94 filters). These sites can be observed in Fig. PM2.5 filters obtained from the PR-EQB were soaked in 50 mL of hexane/acetone 1:1 ratio and extracted using a microwave extraction apparatus (MAE) . Extraction glassware was washed using a modified cleanup procedure from a previous study  and heated at 90 \u00b0C for 2 h to minimize polyatomic ion interferences. The final volume of extracts was completed to 2.50 mL with Nanopure water . The element concentration was determined for all samples after two readings of 5 replicates each (10 readings per sample of which the instrument discards 3 and the average obtained from the remaining). Analyses included the following elements: silver (Ag), aluminum (Al), arsenic (As), gold (Au), barium (Ba), beryllium (Be), bismuth (Bi), bromide (Br), calcium (Ca), cerium (Ce), cesium (Cs), cadmium (Cd), cobalt (Co), chromium (Cr), copper (Cu), dysprosium (Dy), europium (Eu), erbium (Er), iron (Fe), gallium (Ga), gadolinium (Gd), germanium (Ge), mercury (Hg), holmium (Ho), lanthanum (La), lithium (Li), lutetium (Lu), potassium (K), magnesium (Mg), manganese (Mn), molybdenum (Mo), sodium (Na), nickel (Ni), neodymium (Nd), niobium (Nb), praseodymium (Pr), lead (Pb), rubidium (Rb), rhenium (Re), sulfur (S), antimony (Sb), scandium (Sc), selenium (Se), silicon (Si), samarium (Sm), tin (Sn), strontium (Sr), tantalum (Ta), terbium (Tb),thorium (Th), titanium (Ti), thallium (Tl), thulium (Tm), uranium (U), vanadium (V), tungsten (W), yttrium (Y), ytterbium (Yb), zinc (Zn), and zirconium (Zr). Analytical curves were prepared using PE5 and PE29 standard multi-element stock solutions , in a 5% v/v HNO3 solution. An Rh solution (40 \u03bcg L\u22121 in 1% v/v HNO3) was used as an internal standard, injected online with every solution.Dried samples of 0.10 to 1.00 mg were sent out for elemental analyses using an ICP-MS . Each sample was diluted in 100 \u03bcL of bi-distilled nitric acid  following the manufacturer\u2019s procedure on human lung cells (BEAS-2B). Briefly, an average of 104 cells was seeded per well in a 96-well plate and left adhering for 24 h, then treated with PM2.5 extract for another 24 h at a concentration range of 25 to 200 \u03bcg/mL in cell media. After incubation, each well was carefully aspirated to remove treatment media and the MTT -2,5-diphenyl tetrazolium bromide) reagent added at 50 \u03bcL of media + 50 \u03bcL/MTT Reagent per well. The plates were incubated for 3 h at 37 \u00b0C, aspirated carefully to remove the MTT reagent containing media, and then 150 \u03bcL of MTT solubilizing solution added to each well. The plate was placed on a shaker gently and left for 15 min to facilitate the solubilization of the formed formazan salts. The absorbance was measured at near 570 nm using a microplate reader.The cytotoxicity of PM2.5 concentrations was carried out using Student\u2019s t test for paired comparisons between municipalities ). The toxic metal distribution and sampling site comparison graphs were generated and plotted using GraphPad Prism 8.0.0 for Windows . The determination of the LC50 for the airborne PM2.5 graphs was generated using the ATT Bioquest LC50 Calculator . The statistical analysis to assess the relationship between sampling site PM2.5 concentrations are shown in Figs. 2.5 concentration was registered in Ponce (7.58 \u03bcg m\u22123) followed by Guayama (6.92 \u03bcg m\u22123), Bayam\u00f3n (6.57 \u03bcg m\u22123), Guayanilla (6.5 \u03bcg m\u22123), and Humacao (5.76 \u03bcg m\u22123). All of the summer PM2.5 averages were significantly higher (p < 0.0001) when compared to the rest of the year at each municipality , while the relative humidity ranged from 72.00 to 80.30%. The prevailing wind directions were E/SE (4.2 and 1.4%) and NE (7.1 and 1.4%). The overall wind speed was an average of 5.7 mph. Bayam\u00f3n (north) and Ponce (south) were among the municipalities covering more than 50% of the manufacturing operations according to the manufacturing industry census of Puerto Rico (2015). The annual average PM2.5 concentration at the Ponce urban site was significantly higher than those of any of the other rural and urban (Bayam\u00f3n) sites, with an approximate mean of 4.69 \u00b1 0.41 \u03bcg m\u22123, while Ponce had an average of 5.82 \u00b1 0.22 \u03bcg m\u22123. Guayama and Guayanilla followed with an annual mean concentration of 4.93 \u00b1 1.20 \u03bcg m\u22123 and 4.88 \u00b1 1.50 \u03bcg m\u22123 respectively. Humacao\u2019s annual PM2.5 concentration mean was the lowest of all the concentrations (4.33 \u00b1 0.22 \u03bcg m\u22123) recorded for the 12 months.The annual PM2.5 extracts at all sites  was rich in As and Ni, followed by Guayanilla which is located downwind west from Ponce. The Guayanilla extract was the richest in Hg followed by Bayam\u00f3n. The relative abundance of Hg in the extract was encountered during the period from January to May. The annual level of Hg in the Guayanilla PM2.5 extract was significantly higher than any of the other sites studied. Nevertheless, Hg was found to be present at all sites in airborne PM2.5 extracts . Bayam\u00f3n and Humacao are similar in the sense that they both have relatively high concentrations of Fe, Al, Zn, Cu Fig. \u2013c and e,ama Fig. . In summ\u22123respectively), while not measured in Ponce, and the lowest concentration in Guayama (0.34 ng m\u22123). These concentrations need to be adjusted considering the extraction efficiency of the method employed (see the \u201c\u22123 respectively) followed by Guayanilla (1.90 ng m\u22123) and Ponce; respectively, the lowest concentrations found were in Guayama (0.04 ng m\u22123). The highest levels of Ni in the air were characteristic of Ponce with an annual average of 2.50 ng m\u22123 followed by Guayanilla and Guayama (0.17 and 0.07 ng m\u22123 respectively). This presents supporting evidence that Ni is a toxic metal characteristic of the southern region. Similarly, the highest concentrations of ambient Hg were detected in Guayanilla (0.4 ng m\u22123) while the concentration of Hg in the rest of the sites was in the picogram per cubic meter range (Bayam\u00f3n and Ponce followed). Therefore, Hg is also characteristic of the southern ambient air particles, particularly in hot spots. Another characteristic toxic metal in the south coast was As. The highest levels of As found in the sites studied in Puerto Rico ambient air were found in Ponce (0.30 ng m\u22123), while Guayanilla and Guayama exhibited values \u2248 0.06 ng m\u22123 and Bayam\u00f3n and Humacao values of \u2248 0.02 ng m\u22123. Metals characteristic of the northern coast were Cu in Bayam\u00f3n and Humacao sites with concentrations in the orders of 0.70 and 0.20 ng m\u22123 respectively, while the other southern stations ranged from 0.09 to 0.02 ng m\u22123 . Concentrations of chromium also found in Bayam\u00f3n and Humacao were very similar in air \u2248 0.18 ng m\u22123, followed by Ponce (0.13 ng m\u22123) and Guayanilla and Guayama (0.04 and 0.02 ng m\u22123 respectively). Vanadium also had a similar concentration profile compared to Cr, with the highest concentrations in the air found in Bayam\u00f3n and Humacao (0.12 and 0.15 ng m\u22123 respectively), followed by Ponce (0.1 ng m\u22123), and thereafter by Guayanilla and Guayama (0.05 and 0.02 ng m\u22123 respectively). Concentrations of Cd and Pb were very similar between all stations. Therefore, we describe Cr as to be at higher concentrations and thus associated with urban activities.Atmospheric toxic metal concentrations throughout the year are higher in urban sites compared to those of rural sites. The highest annual average concentrations were observed in Bayam\u00f3n and Humacao sites  and a positive control (Triton X-100) , a similar concentration of 25 \u03bcg/mL did not show any relative toxicity, while the cell viability was comparable to the control. A higher concentration of this extract (50 \u03bcg/mL) killed almost 31.79 \u00b1 0.52% of the cultured cells. The LC50 for the inorganic PM2.5 extract from Humacao was 68.89 \u03bcg/mL. However, when we obtain the relative toxicity of the other airborne PM extracts, we determined that Guayama (LC50 43.5 \u03bcg/mL) and Bayam\u00f3n (44.71 \u03bcg/mL) have comparable LC50 exhibiting similar toxic responses on human lung epithelial cells. These two sites comprise airborne PM2.5 that generates the most toxic response among all the sites studied. Guayanilla and Humacao follow with also close LC50s of 52.7 \u03bcg/mL and 68.89 \u03bcg/mL respectively. Finally, Ponce (urban site) in the south coast includes airborne PM2.5 which generates the least toxic effect with the highest LC50 (78.5 \u03bcg/mL). There were large differences in the toxicity between (Ponce and Humacao) when compared to Bayam\u00f3n, Guayama, and Guayanilla  was not as toxic as our northern counterpart Bayam\u00f3n, as an exposure of 100 \u03bcg/mL, saw a decrease of 36.49 \u00b1 0.01% in cultured cells. Instead, the rural site of Guayama had a higher cytotoxic effect from the inorganic particles extract, with a 100-\u03bcg/mL exposure decreasing their survivability by 38.21 \u00b1 0.08%. Guayanilla  shows more toxicity than its closest urban site of Ponce.BEAS-2B cell cultures were exposed to the annual PM00) Fig. . The res2.5 extracts from five different sites in Puerto Rico, selected by their location  and urban (north and south), during the 12 months in 2013. The samples were selected at random from a previously sampled pool granted by the Environmental Quality Board of Puerto Rico. This assessment provides a first-of-its-kind insight into the inorganic constituents of PM2.5 in the northeastern and southern regions of Puerto Rico, classifying the sample sites as rural or urban locations. Besides, it provides the basis for an initial comparison of PM2.5 in the Caribbean region.Here, we report the measurement of 59 trace elements found in airborne PM2.5 from the municipalities of Guayama and Guayanilla  of which 4 days of ash fallings were reported for Puerto Rico.Bayam\u00f3n and Ponce (both urban sites) are considered among the most developed areas with industrial growth in Puerto Rico. Hence, the enrichment of particle pollution increases due to elevated anthropogenic activity. Humacao , located in the east of the Island, is considered to have low industrial activity, most of which is related to the pharmaceutical industry. Humacao receives most of its airborne particulate from the reposition and deposition from the North Atlantic trade winds and the Caribbean Sea including local natural and anthropogenic sources. This study also includes PM50 43.5 \u03bcg/mL). Some of these toxic metals, such as Ni and V, are products originating from fossil fuel combustion, reported in the air samples monitored during the year  compared to the other sites throughout the island of Puerto Rico, particularly more rural areas like Humacao, Guayama, and Guayanilla. As much as 1728 pounds of several toxic metals  were released into the ambient air in Guayama by just one company in 2013 (EPA Toxic Release Inventory (TRI)). Incidentally, the ambient air from Guayama represents one of the most toxic extracts evaluated , we choose to focus on the most commonly associated with industrial activity. The most abundant toxic metals at the different sites are shown and summarized in Fig. Considering the differences among the distribution of toxic metals based on location, we found that V, Al, Pb, and Fe were higher at the rural sites compared to the urban sites; meanwhile, Cu and Zn, which are known to be vastly deposited in more urbanized regions due to fossil fuel combustion and biomass burning, were found to be elevated at the urban sites. It appears that the main reason for the high concentration levels of the toxic metals studied are the various sources of emission previously discussed in our study areas. Likewise, trade winds transporting African dust also contribute to the overall load of higher metal concentrations during the periods of May\u2013September Fig. .2.5 extract\u2019s inorganic constituents, both rural and urban sites in the E/NE region of Puerto Rico had the highest toxic potential  compared to the southern region. This is could very well be associated with an earlier deposition of particles (E/NE) transported by the trade winds. In terms of the relative toxicity of PM2.5 inorganic extracts, the urban site of Bayam\u00f3n and rural site of Humacao and Guayama had the most significant cytotoxic effect, with an LC50 difference of 35.10% for the average toxic response. Considering the urban and rural sites in the south region, there is a distinguishable trend towards a higher geological toxic potential increasing to the northeast. Guayama\u2019s PM2.5 toxicity closely resembles that of Bayam\u00f3n\u2019s, compared to the other southern sites, followed by Ponce and the least toxic being Guayanilla (Fig. 2.5 concentrations to which humans are exposed to, these extracts do not consider the coarse particulate fraction found in PM2.5. The concentrations to which we are exposed could be pari passu to the ones used as treatments in this study. PM2.5 constituents are known to be inducers of oxidative stress, shown by a significant reduction in the intracellular GSH concentrations and an increase in the expression of antioxidizing enzymes (Palleschi et al. Evaluating the toxic potential of the PMlla Fig. . The dat2.5 as previously stated. Furthermore, this study did not consider organic pollutants, which constitute another source of exposure to humans. There were some limitations to this study given the lack of available air filter samples provided by the PR-EQB due to distribution with other proyect. However these samples are valuable since after\u00a0\u00a0Hurricane Maria September of 2017\u00a0all filter samples at the agency\u2019s storage bank were lost. This adds to the importance and significance of our work since similar information will not be available regarding trace metal concentrations on the island of Puerto Rico before those years. We believe these results will be the beginning of major studies regarding the change of particle pollution in the Puerto Rico environment before the events of Hurricane Maria, The Great Earthquake of January 7, 2020, and how anthropogenic pollution changed during the COVID-19 crisis.The results of this study show that the toxic metals associated with industrial activity, particularly biopharmaceuticals, contribute to the enrichment of the local particle pollution in the Puerto Rico environment. Although this seems to be the case, addressing our previous study and contrasting the trace metal content, there has been a considerable decrease in airborne toxic metal content in Puerto Rico (Molinelli et al."}
{"text": "Angioleiomyoma of the pulmonary artery is rare in the literature and few studies have been reported. Here we present a rare case of angioleiomyoma arising from the pulmonary artery in a young patient.A 27-year-old male patient presented to our clinic due to the incidental finding of a nodule in the right lower lobe of the lung, which was unchanged from the prior year. Preoperative CT scans showed a well-demarcated nodule of soft tissue density penetrated by the basal branch of the right anterior basilar artery (RA8b). Single-port video-assisted RS8 segmentectomy was performed under the guidance of preoperative 3-dimensional reconstruction for histologic confirmation of the tumour. The tumour appeared as a solid tumour of a tube-like structure with vascular endothelium, composed of spindle-shaped smooth muscle cells lacking nuclear atypia and homogenous red-dye substances. The spindle cells were positive for immunostaining for smooth muscle actin (SMA), desmin and Ki-67 and were negative for immunostaining for Dog-1, HMB45, and Melan-A. A pathological diagnosis of primary angioleiomyoma of the pulmonary artery was finally made.This report is a reminder for thoracic surgeons that angioleiomyoma should be included in the differential diagnosis of lung neoplasms, especially for the mass of soft tissue density penetrated by pulmonary blood vessels shown by CT. Awareness of this rare entity should potentially prevent underdiagnosis and improper surgical treatment. Angioleiomyoma is a benign soft tissue tumour comprising mature smooth muscle cells with a prominent vascular component . It typiA 27-year-old male patient complained of the incidental finding of a nodule in the right lower lobe of the lung on a routine health examination in October 2019, which was unchanged on repeat examinations from the prior year. No related subjective symptoms were noted and the physical examination showed no abnormalities. The results of routine blood biochemistry, oncological biomarkers and flexible bronchoscopy were normal. Contrast-enhanced computerized tomography of the chest showed a well-demarcated mass with a maximum diameter of 1.7\u2009cm in the right anterior basilar segment of the lung (RS8). The lesion, which displayed a soft tissue density in the periphery, was penetrated by the basal branch of the right anterior basilar artery (RA8b)  in 2002, but reclassified under \u2018pericytic tumours\u2019 in the updated classification because of morphological features shared with myopericytoma, that is, showing a perivascular concentric arrangement of smooth muscle cells . AdditioClinically, angioleiomyoma usually occurs in the lower extremities and appears as a solitary, slow-growing, mobile, firm and occasionally painful cutaneous mass . The paiPreoperative diagnosis of angioleiomyoma is difficult before histopathology . CompletTo the best of our knowledge, only two cases of angioleiomyoma of the pulmonary artery have been reported so far , 7. The We believe this report emphasizes the necessary awareness of thoracic surgeons that angioleiomyoma should be included in the differential diagnosis of lung neoplasms, Although an accurate preoperative diagnosis can be challenging, in our opinion, CT imaging findings presenting as a soft-tissue density nodule penetrated by the pulmonary blood vessel may indicate the possibility of angioleiomyoma. Due to the benign nature of this tumour, sublobar resection is appropriate for the treatment of angioleiomyoma of the pulmonary artery.Additional file 1. Video\u00a01 Legend. Single-port RS8 segmentectomy was performed through the fifth intercostal space between anterior axillary line and midaxillary line. Insufflation technique was utilized to establish intersegmental border (Asian Cardiovasc Thorac Ann 2019 Nov; 27 ["}
{"text": "This is in stark contrast to the otherwise similar metabolism of cancer cells, and previous results obtained in activated macrophages and dendritic cells. Our results establish a novel metabolic pathway whereby glucose provides glycerol to the headgroup of TAG during classical macrophage activation.Altered lipid metabolism in macrophages is associated with various important inflammatory conditions. Although lipid metabolism is an important target for therapeutic intervention, the metabolic requirement involved in lipid accumulation during pro-inflammatory activation of macrophages remains incompletely characterized. We show here that macrophage activation with IFN\u03b3 results in increased aerobic glycolysis, iNOS-dependent inhibition of respiration, and accumulation of triacylglycerol. Surprisingly, metabolite tracing with  Activation of macrophages with pro-inflammatory stimuli, also known as classical M1 activation, induces a profound shift in energetic metabolism characterized by aerobic glycolysis and decreased mitochondrial substrate oxidation . Lipid ade novo fatty acid synthesis from glucose contributes to lipid accumulation in macrophages in murine models of sterile inflammation . Finally, we show that nitric oxide produced by inducible nitric oxide synthase (iNOS) inhibits mitochondrial respiration and therefore oxidation of FA, which instead accumulates in lipid droplets.We show here that activation of macrophages with interferon gamma (IFN\u03b3), a major mediator of sterile and bacterial-induced inflammation, increases glucose uptake and lactate release. Further, IFN\u03b3 increases total TAG levels, and induces lipid droplet accumulation that depends on exogenous lipids. Metabolite tracing with In order to study the metabolic basis of lipid droplet accumulation, we used IFN\u03b3 to activate MafB/c-Maf double deficient Maf-DKO) primary mouse macrophages. These cells are a bona fide alternative to other macrophage sources such as RAW cells as they are not transformed cells with distorted metabolism typical of cancer cells; maintain a differentiated macrophage phenotype when expanded in culture; and functionally integrate into tissues without causing tumors when transplanted into mice , 21. ActKO primarIFN\u03b3 induced a 2-fold increase in glucose uptake rate and a 2-fold increase in lactate release rate . Moreove13C glucose. We then monitored 13C incorporation into TAG using liquid chromatography-mass spectrometry (LC-MS). We consistently observed a mass increase of 3 Da in major TAG species extracted from cells activated in medium containing U-13C glucose compared to TAG from cells activated in medium containing unlabeled glucose  glucose . Using c carbons . Importa labeled . Similar glucose , indicat glucose , providied cells . Our resde novo fatty acid synthesis, we activated macrophages in the presence of the fatty acid synthase  glucose concentration, there were mass shifts of 3 Da in major TAG species extracted from cells activated in medium containing 24 mM U-13C glucose . BODIPY-fatty acid accumulated within lipid droplets, suggesting that exogenous fatty acid incorporated into TAG contained in these organelles . We confinto TAG .de novo fatty acid synthesis.Externally derived fatty acids must be activated before incorporation into TAG by esterification with coenzyme A through a reaction catalyzed by fatty acyl-CoA synthetase. Indeed, the fatty acid CoA synthetase inhibitor triacsin prevented BODIPY-fatty acid accumulation in lipid droplets , reducedLipid droplets might have accumulated because of increased fatty acid uptake. We observed increased expression of the scavenger receptor CD36 upon activation with IFN\u03b3, but addition of a blocking anti-CD36 antibody previously shown to inhibit fatty acid uptake  did not q < 0.1, fold change > 2; q < 0.05)  . The pat < 0.05) ,B, consi < 0.05) \u201335, hintTo test this possibility, we first determined macrophage \u03b2-oxidation activities under basal conditions. Incubation of macrophages for 24 h with the carnitine palmitoyltransferase I inhibitor etomoxir reduced OCR by 23.5 \u00b1 0.4% , which iNext, we tested if inhibition of mitochondrial respiration by nitric oxide contributed to accumulation of neutral lipid upon activation with IFN\u03b3 , 37. We de novo fatty acid synthesis. In order to study the contribution of metabolites to lipid synthesis, previous studies have relied on the detection of radioactivity in total lipids extracted from cells incubated in the presence of 14C-labeled glucose  which contained DMEM, 44 mM sodium bicarbonate, 10% FCS, glucose (4.8 mM), and glutamine (0.8 mM) with or without IFN\u03b3 10 ng/mL or IL-4 10 ng/mL (both from Preprotec), and C75, etomoxir, triacsin, oligomycin, DETA/NO, or SEITU  at the indicated concentrations. In a set of experiments, FCS was replaced with delipidated serum  plus a 1:100 dilution of lipid mixture  containing cholesterol, and arachidonic, linoleic, linolenic, myristic, oleic, palmitic, and stearic acids.MafB/c-Maf double deficient (Maf-DKO) macrophages were a kind gift from Dr. Michael H. Sieweke (Center d'Immunologie de Marseille-Luminy). Maf-DKO cells were grown in DMEM containing 20% L929-conditioned medium and 10% FCS. BMDM were differentiated from bone marrow cells obtained from C57BL6 mice in the presence of DMEM containing 20% L929-conditioned medium and 10% FCS. Maf-DKO cells were predominantly octaploid (8c) whereas BMDM were diploid (2c) and octaploid (8c) as determined by DNA quantification with DAPI staining (data not shown). For experiments, cells were incubated for 24 h at 37\u00b0C and 5% COCells were incubated in 24-well plates for 24 h after which they were washed once with cold PBS and detached with cold PBS/EDTA 1 mM. Cells were stained with anti-CD86 , I-A/I-E  or anti-CD36  antibodies in FACS buffer  for 30 min on ice, washed once, and resuspended for cytometry analysis. Cells were acquired with an LSRFortessa II flow cytometer (BD Biosciences) and analyzed with FlowJo .Cells were incubated in 24-well plates for 24 h after which they were washed once with cold PBS, fixed with PBS containing formaldehyde 4% for 10 min, and washed three times with PBS. Cells were incubated at room temperature (RT) for 30 min with HCS LipidTOX Green Neutral Lipid (ThermoFisher Scientific) diluted 1:1,000 in PBS, washed three times with PBS, scraped off, and resuspended in PBS for flow cytometry analysis. For microscopy analysis, cells were grown on microscope slides inside wells of 24-well plates followed by the same procedure as for flow cytometry with the addition of DAPI. For ADRP staining, cells were incubated at RT for 1 h in blocking buffer . Then, rabbit polyclonal anti-ADRP antibody (Abcam) was added at a final 1:200 dilution, and cells were incubated for 2 h at RT. After washing with blocking medium, cells were incubated at RT for 2 h in blocking medium containing Alexa Fluor 647-conjugated goat anti-rabbit antibody (ThermoFisher Scientific) at a 1:1,000 dilution. After washing with blocking medium, cells were mounted with Fluoromount-G (Southern Biotech). Images were taken with a Leica SP8 confocal microscope, and analyzed with Fiji.Cells were washed once with cold PBS. PBS was then removed and cold PBS/EDTA 5 \u03bcM solution was added. Cells were incubated for 5 min at RT, gently detached by pipetting, and transferred to FACS tubes and kept on ice. Tubes were spun down at 200 g for 5 min at 4\u00b0C, after which PBS/EDTA was removed. Cells were resuspended in 200 \u03bcL of LGLG medium containing 2 \u03bcL of a 1:10 dilution of Mitosox (ThermoFisher Scientific), and incubated at 37\u00b0C in a water bath for exactly 25 min. DAPI was then added to exclude dead cells and cells were analyzed by flow cytometry.Glucose, lactate, and triacylglycerol were determined using commercially available enzymatic assay kits (BioAssay Systems or BioVision) following the manufacturers' instructions. Glycerol 3-phosphate and activity of cG3PDH were quantified as previously described , 59. CytTotal cell protein was extracted from cells using CelLytic M (Sigma) and kept at \u221220\u00b0C until further analysis. Protein was heated for 5 min at 50\u00b0C  or 95\u00b0C (for iNOS and arginase-1) in 5x Laemmli buffer containing 2-mercaptoethanol. Samples were loaded into acrylamide gels and protein was transferred to PVDF membranes followed by detection with chemiluminiscence using the total OXPHOS rodent WB antibody cocktail (Abcam), or anti-INOS , anti-arginase-1  or anti-\u03b2-actin antibodies  plus appropriate HRP-conjugated secondary antibodies.e Extracellular Flux Analyzer (Seahorse Bioscience). Cells were incubated for 24 h in XF-96 cell culture plates at a density of 105 cells/200 \u03bcL per well in LGLG medium in the presence or absence of IFN\u03b3 10 ng/mL, and SEITU, etomoxir, DETA-NO and oligomycin at the indicated concentrations. One hour prior to the experiment, LGLG medium was removed and 175 \u03bcL of assay medium (LGLG medium containing 44 mM sodium chloride instead of 44 mM sodium bicarbonate in order to prevent pH buffering and to maintain medium osmolarity) were added. Drugs (25 \u03bcL) were injected during the assay at the following final concentrations: oligomycin (1 \u03bcM), CCCP (carbonyl cyanide m-chloro phenyl hydrazone) as uncoupler (2 \u03bcM), and rotenone (100 nM) plus antimycin (1 \u03bcM). The experiment was performed at 37\u00b0C and 20% oxygen using a mix-wait-measure protocol of 3-0-3 min with three initial basal rate measurements.Oxygen consumption rate was measured with an XF1-BODIPY 500/510-C12 (Life Technologies) into cells using a fluorescent plate reader, as previously described (5 cells per well in the presence or absence of IFN\u03b3 10 ng/mL. Cells were washed once with warm PBS and incubated at 37\u00b0C for 30 min with 100 \u03bcL of LGLG without FCS (serum free LGLG medium). Staining solution consisted of one part 2x serum free LGLG medium plus one part 8% trypan blue that served as fluorescence quencher. To this staining solution C1-BODIPY 500/510-C12 diluted 1:4,000 from a 1 mg/mL stock was added. Fatty acid incorporation was started by adding 100 \u03bcL of pre-warmed (37\u00b0C) staining solution  to each well already containing 100 \u03bcL of serum free LGLG. Fluorescence (Ex485/Em528) was measured from the bottom of the plate on a Synergy H4 (BioTek) plate reader set at 37\u00b0C. Data were acquired at intervals of 80 s for up to 30 min, time at which fluorescence plateaued. In a different experiment, cells were incubated for 24 h in LGLG medium containing delipidated serum, IFN\u03b3 10 ng/mL and C1-BODIPY 500/510-C12 at a final dilution of 1:4,000. In another set of experiments, cells were incubated for 24 h in LGLG medium containing FCS and IFN\u03b3 10 ng/mL. Cells were washed once with warm PBS, and incubated at 37\u00b0C for 30 min in LGLG medium containing delipidated serum plus triacsin (1 \u03bcM), after which C1-BODIPY 500/510-C12 was added. After 10 min of incubation at 37\u00b0C cells were washed swith PBS, fixed, and stained with DAPI and anti-ADRP antibody as mentioned above.Fatty acid uptake was determined by measuring incorporation of the fluorescent fatty acid analog Cescribed . Briefly13C) glucose (Cambridge Isotope Laboratories) instead of glucose. In another set of experiments, cells were incubated in the presence of IFN\u03b3 10 ng/mL in medium containing 24 mM uniformly-labeled (U-13C) glucose plus L-glutamine 4, or 24 mM of glucose plus 4 mM U-13C, U-15N L-glutamine (Cambridge Isotope Laboratories). In another set of experiments, cells were incubated in the presence of LGLG containing delipidated serum instead of FCS plus 50 \u03bcM oleic acid or U-13C oleic acid (Sigma) conjugated to BSA. After 24 h, cells were washed once with cold PBS, scraped off, counted, resuspended in 100 \u03bcL of PBS, and kept frozen at \u221280\u00b0C until further analysis. For lipid extraction, cells were thawed and extracted using modified Bligh and Dyer method (Cells were incubated in 6-well plates in the presence of IFN\u03b3 10 ng/mL in LGLG medium. Some wells contained 4.8 mM uniformly-labeled (U-r method . Samplesr method . For fatMus musculus downloaded from SwissProt (2016/10/05). Proteins were quantified by MS1-based label-free quantification and statistical analysis was performed using SafeQuant .Comparisons between two groups were made using a two-tailed unpaired The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD017148 and 10.6019/PXD017148. Other raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.MR-B conceived the study. MR-B, DB, and XG designed experiments. XG, AS, and MR-B performed experiments and analyzed data. XG, AS, and DB provided resources. MR-B and XG wrote the paper.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Prostate cancer (PCa) is the most common malignant tumor affecting males worldwide. The substantial heterogeneity in PCa presents a major challenge with respect to molecular analyses, patient stratification, and treatment. Least absolute shrinkage and selection operator was used to select eight risk-CpG sites. Using an unsupervised clustering analysis, called consensus clustering, we found that patients with PCa could be divided into two subtypes (Methylation_H and Methylation_L) based on the DNA methylation status at these CpG sites. Differences in the epigenome, genome, transcriptome, disease status, immune cell composition, and function between the identified subtypes were explored using The Cancer Genome Atlas database. This analysis clearly revealed the risk characteristics of the Methylation_H subtype. Using a weighted correlation network analysis to select risk-related genes and least absolute shrinkage and selection operator, we constructed a prediction signature for prognosis based on the subtype classification. We further validated its effectiveness using four public datasets. The two novel PCa subtypes and risk predictive signature developed in this study may be effective indicators of prognosis. Despite the ongoing development of therapeutic strategies, the heterogeneity of PCa contributes to treatment failure  is a major public health threat . Based o failure . TherefoDuring the process of DNA methylation, methyl groups are added to CpG islands on the DNA molecule. Hypermethylation acts on promoters and could lead to gene silencing, whereas hypomethylation is associated with chromosomal instability and a loss of imprinting . In manyNovel methylation-based subtypes have been reported in PCa. For example, the Cancer Genome Atlas Research Network  conducte2 (3 (4 (5 (RNA-seq data (in the form of HTSeq-Counts and HTSeq-FPKM), DNA methylation (450 K), somatic variation, copy number alterations (CNA), and clinical information for patients with PCa were downloaded from The Cancer Genome Atlas (TCGA) database2 . The gen2  . Least aSPOP) was evaluated. Then, the mRNA levels of SPOP in different subtypes were compared by Wilcoxon\u2019s test.Simple nucleotide variants were compared between subtypes using the GenVisR R package . Genes wRND3 was differentially expressed between the subtypes, as determined by a Wilcoxon test. The type and frequency of CNAs in RND3 were explored. Furthermore, the relationship between CNA types and mRNA expression levels of RND3 were evaluated by the Wilcoxon test.To explore the difference in CNAs between subtypes, genes with significant differences in copy number between subtypes were identified by chi-squared tests. Among these genes, https://www.tumorfusions.org/) were used to analyze the difference in TMPRSS2\u2013ERG fusion gene expression between the subtypes . To obtain fold changes, HTSeq-Counts were analyzed using the DESeq2 R package . The halthe GSEA . Finallythe GSEA .Furthermore, expression levels of genes that were crucial for PCa were compared between the subtypes by Wilcoxon tests.p < 0.05. Then, survival-associated genes were screened from the DEGs by Cox regression and log-rank tests. Finally, genes for LASSO were filtered out.A weighted correlation network analysis (WGCNA) could be used find phenotype-associated gene modules . TherefoBefore training, 477 patients were randomly divided into a training set and internal validation set using the caret R package . InformaFirst, time-dependent receiver operating characteristic (tdROC) curves were used to evaluate the predictive accuracy of the signature in the training set, internal validation set, and external validation sets  using the timeROC R package . Then, aUnivariate and multivariate Cox regression analyses were used to explore whether the risk score is an independent predictor of prognosis. Finally, the clinical diagnostic value of the signature was compared with that of clinical features (Gleason score and PSA) by a decision curve analysis (DCA) . DCA is p < 0.05 were defined as statistically significant. In the survival analysis, the survival outcome was defined as DFS or biochemical recurrence-free survival (BCR) based on clinical records.R 3.6.3 was used for all statistical analyses. Values of k = 5, indicating that the cohort could be divided into up to five subtypes. However, one cluster consisted of only a single patient when k = 4 or 5. Additionally, the cluster-consensus value for each cluster was not large enough under k = 4 or 5  and relative change in the area under the CDF curve are shown in = 4 or 5 . Thereforognosis . For k =lation_L . Furtherlation_L . As showSPOP was higher in the Methylation_H subtype than in the Methylation_L subtype. SPOP is one of the most frequently mutated genes in primary PCa. Based on the tumor-suppressive role of SPOP in PCa and the results of loss-of-function assays, SPOP mutations are expected to include the invasion and proliferation of PCa cells  for the training set, internal validation set, and external validation sets  were 0.72, 0.66, 0.76, 0.76, 0.84, and 0.74, respectively . FurtherIn univariate Cox regression analyses, six variables  were associated with a worse prognosis . In a muWe have recently described the advantages and necessity of multi-omics approaches for studies of PCa . In thisSPOP, which is the most frequently mutated tumor-suppressor gene in primary PCa, were lower in the Methylation_H subtype than in the Methylation_L subtype . With respect to the clinical applications of these findings, we have the following suggestions. Because RNA-seq data in TPM format were used to train the signature, we suggest employing the same data format of data in clinical applications. Considering batch effects of measurement techniques, gene expression levels should be measured by similar techniques, even though the signature performed well in the validation data sets, in which genes were profiled by array-based methods. Furthermore, the risk levels were determined by the median risk score in the patient cohorts. In the future, the study cohort should be further expanded to obtain a more objective and stable threshold range.Collectively, we identified two subtypes with different methylation statuses at eight CpG sites and evaluated the high-risk characteristics of the Methylation_H subtype based on epigenomics, genomics, transcriptomics, disease status, immune cell infiltration, and functional analyses. Finally, based on these two novel subtypes, an eight-gene predictive signature was constructed and validated using various public datasets.The original contributions presented in the study are included in the article/EZ, MZ, and YS were responsible for the design and conception of the research project. EZ, YS, MZ, FS, OM, JH, YG, and HW contributed to the data acquisition or data analysis and data cleaning. EZ and YS participated in the drafting of the manuscript and the rigorous modification of the manuscript to clearly convey the research contents. All authors are responsible for the authenticity and reliability of this study and have no objection to the final submitted manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Periodontal diseases can lead to chronic inflammation affecting the integrity of the tooth supporting tissues. Recently, a striking association has been made between periodontal diseases and primary cancers in the absence of a mechanistic understanding. Here we address the effect of periodontal inflammation (PI) on tumor progression, metastasis, and possible underlining mechanisms. We show that an experimental model of PI in mice can promote lymph node (LN) micrometastasis, as well as head and neck metastasis of 4T1 breast cancer cells, both in early and late stages of cancer progression. The cervical LNs had a greater tumor burden and infiltration of MDSC and M2 macrophages compared with LNs at other sites. Pyroptosis and the resultant IL-1\u03b2 production were detected in patients with PI, mirrored in mouse models. Anakinra, IL-1 receptor antagonist, limited metastasis, and MDSC recruitment at early stages of tumor progression, but failed to reverse established metastatic tumors. PI and the resulting production of IL-1\u03b2 was found to promote CCL5, CXCL12, CCL2, and CXCL5 expression. These chemokines recruit MDSC and macrophages, finally enabling the generation of a premetastatic niche in the inflammatory site. These findings support the idea that periodontal inflammation promotes metastasis of breast cancer by recruiting MDSC in part by pyroptosis-induced IL-1\u03b2 generation and downstream CCL2, CCL5, and CXCL5 signaling in the early steps of metastasis. These studies define the role for IL-1\u03b2 in the metastatic progression of breast cancer and highlight the need to control PI, a pervasive inflammatory condition in older patients. Porphyromonas gingivalis , Fusobacterium nucleatum (F. nucleatum), and Prevotella intermedia can potentially serve to initiate or promote tumor development, as seen for gastric cancer with Helicobacter pylori infection [P. gingivalis and F. nucleatum have been attributed to pancreatic and colorectal cancer in lymph node (LN) metastases [Periodontal diseases are characterized by inflammation affecting the integrity of the tooth supporting tissues, among them gingivitis and periodontitis are the most common. Periodontitis affects nearly half of the US adult population . Strikinnfection . Interesnfection \u201311. Hightastases , 13. Thetastases . PeriodoSeveral animal models have been used to mimic cellular complexities that occur in human periodontal diseases. Gram-negative bacteria are thought to be important periodontal pathogens. The lipopolysaccharide (LPS) component of the cell wall of these microorganisms, is a significant inflammatory stimulus that triggers an innate immune response. Thus, injections of LPS into the mouse gingival tissues is capable of recreating a sterile model of periodontal inflammation (PI), not involving the pervasive nature of untreated bacterial infections , 16. TolInflammatory pathways are key mediators for cancer development and metastatic progression. Using the PI model of chronic LPS injection in the gingiva we observed an immune response after 3 weeks Fig. . As expeP\u2009<\u20090.0001). Previous studies have highlighted the recruitment and expansion of MDSC in the periodontal inflammatory process induced by P. gingivalis infection [+ and CD206+ expression in the tumor bearing mice with PI, compared with sham injected mice allografted with tumor alone (P\u2009<\u20090.05). In addition, M1 macrophages, characterized by F4/80+ and MHCII+ staining, were similarly increased in mice with PI. The presence of MDSC and M2 macrophage in the cervical LNs was suggestive of a tumorigenic niche. Not entirely surprising, the M1 and M2 macrophages in the spleen seemed to be depleted in tumor bearing mice with PI, compared with mice with either tumors or PI alone, in support of an active recruitment process to the site of inflammation. We observed recruitment of macrophage and MDSC to the cervical LNs of mice with PI, concomitant with tumor cells.To better characterize the tumor tropism mediated by PI, a syngeneic metastatic model was tested using orthotopically grafted 4T1 cells in the fourth mammary gland Fig. . LN micrnfection . LikewisNumerous factors can induce the recruitment and differentiation of MDSCs. The chronic injection of LPS into the gingival tissue, used to initiate the sterile PI model, could mediate a host response by the production of proinflammatory factors capable of recruiting macrophages and MDSC . In tryiWe next sought to determine the relevance of IL-1\u03b2 expression by gingival fibroblasts on breast cancer metastatic progression. We found that PI tissues had expression of NF-\u03baB phosphorylated-p65 and NLRP3 in the fibroblastic cells, indicating active inflammasome signal I and signal II signaling Fig. . HoweverTo evaluate the role of IL-1\u03b2 in immune cell recruitment, a panel of chemokines and cytokines were measured from gingival fibroblasts treated with LPS with or without anakinra. LPS was found to elevate CCL2 expression by almost sixfold and CXCL12 expression by threefold Fig. . Anakinr+ and CD33+, compared with the healthy gingiva  recruitment to the LNs in the neck and associated TGF-\u00df expression seemed to be the greatest in the PI mouse model, compared with either control or the PI mice treated with anakinra , and to a lesser extent macrophage  and functional  markers. Granulocytic MDSC  in the premetastatic niche, as well as in the tumor of the head and neck tissues. This data also confirmed a colocalization of IL-10, IL-2, and TGF-\u03b2 showing the immunosuppressive expression pattern initiated by these MDSC. While TGF-\u00df expression is also a feature of M2 macrophage, no such co-expression was observed in our tissues. Activated M2 macrophage are reported to have low IL-2 expression in response to IL-6 [P. gingivalis is reported to promote the expansion of MDSC and consequently suppressed the host response [+/CD33+ MDSC, suggested that its infiltration can be an inherent feature of periodontitis, rather than tumor progression  in PBS or 10\u2009\u03bcl endotoxin-free PBS vehicle into mandibular buccal mucosa 2 times a week for 3 weeks [4 cells) intracardially (early metastasis model 1) or received 4T1 cells (105 cells) in the mammary fat pad (early metastasis model 2). Sample size of at least five mice per group were selected to achieve 80% power. Both experiments were terminated 2 weeks following cancer cell injections. Tumor size was measured by Vernier caliper and tumor volumes calculated according to the formula V (mm3)\u2009=\u2009L (major axis)\u2009\u00d7\u2009W (minor axis)\u2009\u00d7\u2009H\u2009\u00d7\u20096/\u03c0. The axillary, cervical LNs, and gingival tissues were collected for further experiment. The late metastasis model was established after 3 weeks of PI model establishment, where the 4th mammary fat pad was injected with 105 4T1 cells. The anakinra  was administered daily, starting on the day of tumor introduction. Following the injection/grafting of tumors the mice were randomized prior to allocating to the control and treatment groups. Tumors were resected when they reached 100\u2009mm2 and metastatic progression allowed to progress for up to 10.5 weeks. The axillary, cervical LNs, the neck tissue, and gingival tissue were collected for further evaluation. The investigators were blinded to the group at the time of allocation to the tumor or treatment groups. However, the groups were known to the investigators during data collection and analysis.Procedures and animal experiments were approved by Institutional Animal Care & Use Committee (IACUC003638) at Sinai Medical Center. Four-week-old, female BALB/c mice  were used in the syngeneic xenografting and PI models described. The PI model was generated as previously reported by injecting 10\u2009\u03bcg LPS  for 10\u2009min. Luciferase activity was assayed using luciferase substrate buffer . Protein concentrations were evaluated using BCA protein assay kit  on a microplate reader . Relative luciferase Unit was calculated on a Luminometer  according to the formula, Relative luciferase Unit\u2009=\u2009(reporter activity\u2009\u2212\u2009background)/protein concentration.LNs and spleen tissues were prepared using mechanical dissociation of minced tissue to obtain single cell suspensions. The following antibodies were used for flow cytometry: anti-Ly6G/Ly6C (Cat #58-5931-82), anti-Cd11b (Cat #12-0112-82), anti-CD86 (Cat #11-0862-82), anti-F4/80 (Cat #17-4801-82), anti-MHCII (Cat #13-5321-82), and anti-CD11c (Cat #11-0116-42) all from eBioscience, San Diego, CA) and anti-CD206 . After being stained with a standard protocol, all events were analyzed with FlowJo software  and frequencies among live cells were obtained.3 pieces and maintained in Alpha Modifications Minimum Essential Medium (\u03b1-MEM) with 10% fetal bovine serum supplemented with 100\u2009U/ml penicillin, and 100\u2009\u03bcg/ml streptomycin  at 37 \u00b0C with 5% CO2. Cells between passage 3 and 7 were used.Mouse gingival fibroblasts were cultured from mandibular buccal gingival tissues obtained from 6-week-old female Balb/c mice. The gingival tissues were cut into 1\u2009mmThe 4T1 mouse mammary carcinoma cells were obtained from the American Type Culture Collection  and were cultured in RPMI 1640 medium supplemented with 10% FBS, 100\u2009U/ml penicillin, and 100\u2009\u03bcg/ml streptomycin. Human gingival fibroblasts were cultured following a previously published report .4T1-Luc cells were established as follows: the pGL4 luciferase reporter vector was obtained from Promega. This vector containing a hygromycin B selectable marker and was transfected into 4T1 cells by using Nucleofector\u2122 Kit V  with the Amaxa Nucleofector (Lonza Group Ltd.), followed by a 30\u2009\u03bcg/ml hygromycin B  selection for 7 days. The expression level of luciferase was then evaluated by luciferase assay.Mouse gingival fibroblasts were serum-starved for 24\u2009h, then treated with 1\u2009\u03bcg/ml LPS with or without 500\u2009ng/ml anakinra for 24\u2009h. Total mRNA was isolated from gingival fibroblasts or gingival tissue using RNeasy mini kit . cDNA was synthesized from 1\u2009\u03bcg of total RNA with the iScript cDNA kit (Bio-Rad Laboratories). Receptors mRNA expression was determined by quantitative RT-PCR using primers in Supplementary Table Gingival fibroblasts were serum-starved for 24\u2009h, then treated with 1\u2009\u03bcg/ml LPS for 24\u2009h. Cells were further cultured in the presence of 20\u2009\u03bcg MDCF-DA (Sigma-Aldrich) for 20\u2009min and imaged with a fluorescence microscope .Gingival fibroblasts were serum-starved for 24\u2009h, then treated with 1\u2009\u03bcg/ml LPS with or without 500\u2009ng/mg anakinra for 24\u2009h. Cytokine concentrations in cell lysates were then determined using the Mouse Cytokine Array C3  following manufacturer\u2019s instructions. Data were quantitated with Quantity One (Bio-Rad Laboratories)For short-term cultures, gingival fibroblasts were serum-starved for 24\u2009h, then treated with 1\u2009\u03bcg/ml LPS for 24\u2009h. For long-term cultures, gingival fibroblasts were treated with 1\u2009\u03bcg/ml LPS in \u03b1-MEM containing 2% FBS for 14 days. Proteins were detected following a previously published western blot procedure . The fol2 laser ablation spot size at a frequency of 200\u2009Hz and ablation energy of 3\u2009dB. Area of analyzed tissue varied from 400\u2009um2 up to 1000\u2009um2 with multiple areas imaged per specimen. Image analysis was performed with MCD viewer (Fluidigm) and HistoCAT [Literature was reviewed to identify markers relevant to the tumor and premetastatic niche. Metal conjugated antibodies were obtained with custom conjugations with Fluidim Maxpar Antibody Labeling Kit . Human gingival specimens were collected from crown lengthening surgery  and gingivectomy (periodontitis tissues) by informed consent.Immunohistochemical localization of select proteins were performed on standard protocol on 4% paraformaldehyde fixed, paraffin embedded tissues using anti Luciferase , NLRP3 (LifeSpan Biosciences), 8-OHdG (Abcam), TUNEL , IL-1\u03b2 (R&D Systems), Gr1.1 , CD33 (Abcam), CD11b (Abcam), and Pan cytokeratin antibodies (Santa Cruz Biotechnology). Quantitation of positive staining was normalized to total number of cells per field by NIH Image software.ELISA was performed for the expression of IL-1\u03b2 , CCL2, CCL5, CXCL5 and CXCL12  on conditioned media from human gingival fibroblasts expanded for 24\u2009h in the presence or absence of LPS. IL-1\u03b2 ELISA was also performed on conditioned media from mouse gingival fibroblasts and blood plasma from mice of early metastasis models.t test. Difference was considered significant when P\u2009<\u20090.05.Data were expressed as mean\u2009\u00b1\u2009SEM. The statistical significance of differences was assessed by using ANOVA or student\u2019s Supplement table 1Supplement table 2Supplemental Figure 1Supplemental Figure 2Supplemental Figure 3"}
{"text": "While being a monomer in physiological conditions, under the necessary stimulus\u2014usually a mutation, it tends to form fibrils, which later participate in the disease development. This process can potentially be regulated  by many cellular components and it is being hypothesized that the cell membrane might play a key role in the oligomerization pathway. Studies involving cell membranes pose several difficulties; therefore, an alternative in the form of membrane mimetics is a very attractive solution. Here, we would like to present the first study on hCC oligomerization under the influence of phospholipid liposomes, acting as a membrane mimetic. The protein\u2013mimetic interactions are studied utilizing circular dichroism, nuclear magnetic resonance, and size exclusion chromatography.Studies revolving around mechanisms responsible for the development of amyloid-based diseases lay the foundations for the recognition of molecular targets of future to-be-developed treatments. However, the vast number of peptides and proteins known to be responsible for fibril formation, combined with their complexity and complexity of their interactions with various cellular components, renders this task extremely difficult and time-consuming. One of these proteins, human cystatin C ( The process of hCC interaction with the membranes constitutes an interesting and important target of studies. It may explain the process of hCC toxicity against cells and its consequences, e.g., the processes leading to the occurrence of hereditary cystatin C amyloid angiopathy [Amyloid is a name used for the description of a specific protein (or peptide) that aggregated into its insoluble form featuring characteristic fiber-like shape . The pheide (A\u03b2) , immunogide (A\u03b2) , and hum\u03b2) [hCC) . The lasgiopathy  or Alzhegiopathy .The studies of protein\u2013membrane interactions are, however, complicated, time-, and cost-consuming experiments when performed on biological membranes isolated from natural sources. Previously, we performed a structural and dynamic analysis of the membrane mimetic\u2014mixed micelle combining zwitterionic dodecylphosphocholine (DPC) and anionic sodium dodecyl sulfate (SDS) components . In factThe number of techniques allowing to study interactions between proteins and membrane mimetics is rather scarce. Current techniques involve electrochemical techniques ,16, micrhCC protein  reaches an equilibrium state between the monomer, being the major component, and the dimer. This results in two sets of overlapping signals observed in the NMR spectra, making them difficult for interpretation [hCC V57P variant (stable dimer) is a demanding task as the subunits of the dimeric variant are virtually identical, once again causing an overlap of NMR signals. As a result, the assignment of the backbone resonances was not yet performed for hCC V57P dimer. The oligomeric state of hCC is important in context of its structural studies since any interaction with ligands may cause changes in the oligomeric equilibrium of the amyloidogenic protein. However, due to technical difficulties  at present, NMR measurements can be performed on stable monomeric hCC V57G variant only.The studies performed so far revealed that in solution the wild type retation . SimilarhCC V57G mutant (stable monomer) to explore the structural and dynamic aspects of the interactions between the hCC V57G protein and the DMPC phospholipid bilayer. For the purpose of this study, DMPC was chosen as a membrane mimetic due to its high abundance in mammalian membranes and relatively easy procedure of liposome preparation [hCC V57G sequence involved in interaction with DMPC bilayer.In this study, we used the paration . DMPC isparation ,27,28,29hCC protein resulting from the interactions of the protein with the dimyristoylphosphocholine (DMPC) phospholipid. Recording of the CD spectra turned out to be difficult, due to high light scattering propensities of the DMPC liposome solution. However, after the prolonged process of liposome formation , no increase of Membranes). It is possible that the interactions between hCC V57G and the liposomes are rather weak and require higher liposome concentrations for the changes of protein structure to be observed. On the other hand, performing the experiments at higher DMPC concentrations proved not to be possible due to the high light-scattering properties of the solution.Circular dichroism (CD) spectroscopy experiments were performed to visualize the changes in the secondary structure of the trations . Collect protein . ContrarMost of the phospholipid-based liposomal solutions  have a tendency for strong light scattering. The only way to make the solutions more transparent is to decrease the liposome size, as the intensity of light scattered by a sphere is directly related to its radius . In expetion see . HoweverhCC protein caused by the presence of different concentrations of DMPC liposomes, indicating interactions between the molecules and possible impact on further oligomerization of protein. The incubation of the hCC V57G with DMPC solutions did not cause any particular changes in the oligomeric state of the analyzed protein. No changes in the intensity of signals or retention times were observed in the chromatograms indicating that, regardless of the incubation temperature, the hCC V57G monomer is stable in the presence of DMPC liposomes  experiments were performed to verify if there are any changes in the oligomeric state of iposomes A,B. This factors ,31. The hCC V57G and cell membrane were monitored by NMR spectroscopy using the DMPC phospholipid as a membrane model. The hCC V57G exhibit good dispersion, confirming that in this experimental condition the hCC V57G is properly folded  . For sevhCC V57G mutant by PGSE-NMR deliver an additional confirmation of the stability of the 3D structure at different experimental conditions. The translation diffusion coefficient  . The obtsolution .S, which is a measure of the degree of spatial restriction of the motion, an effective correlation time The analysis of tumbling ,34. Fourme scale .The experimental sonances . The relhCC V57G in solution reveals that rotational diffusion tensor can be presented as prolate axially symmetric [hCC V57G in solution [The structural analysis performed for ymmetric . The D\u2225 on rates ,37. The solution .hCC V57G comprises two The secondary structure of than 0.8 . At the The values of local parameters\u2014residues .hCC V57G sequence, we can conclude the low intensity of chemical exchange . As a result, only a small amount of molecules in the bound state are present in the solution. Therefore, the rotational and translational motions observed during the measurement are very similar to those observed for the V57G variant in solution. The relaxation parameters, on the other hand, are quite sensitive to the existence of a transition state, even a couple of percent of a different conformation can be detected by the analysis of relaxation data.An additional possibility of fast and simple identification of the residues undergoing conformational exchange slower than the overall molecular tumbling can be derived from analysis of  product . The R1Rme frame . InspecthCC V57G in the environment of DMPC-The experimental data acquired for db 6RPV) , suggestPV) [csp A,B, whicPV) [csp C. The mahCC V57G interaction with the DMPC liposome. The presence of the DPMC-hCC interactions with the DMPC phospholipid.The backbone mobility in a low-frequency time frame is another important aspect of  product A. Inspec-strands . They prhCC V57G and DMPC membrane mimetic. The acquired experimental data demonstrated that the hCC V57G variant does not migrate into the DMPC bilayer but locates itself on the lipid surface. The bilayer exhibits a rather weak attraction to the N-terminal part of the protein and hCC oligomerization seems to be rational. However, to fully verify it further, detailed studies involving advanced membrane constructs, natural membranes, and hCC variants prone to oligomerization processes are required.The presented study focused on the description of the interaction sites between hCC V57G variant was obtained using site-directed mutagenesis as previously described [E. coli OmpA protein (causes the secretion of a protein into periplasmic space), temperature-sensitive E. coli BL21(DE3)-competent cells (Novagen) using the standard LB medium and temperature-induced expression, according to the protocol described earlier [The DNA of escribed . Plasmidescribed ) contain earlier .The lyophilized DMPC powder was suspended in PBS buffer . If the solution was used in NMR experiments, the buffer contained 10% Dof times . After thCC V57G protein was dissolved at the concentration of 10 v/v five step dilution series with the highest concentration of g for 5 min to remove any insoluble particles from the solution. The CD spectra were registered with JASCO J-815 spectropolarimeter for supernatants at 295 K in the UV range of 195 to 260 nm and analyzed with Jasco Spectra Manager software.The hCC V57G protein was dissolved at the concentration of 30 The hCC monomer\u2013dimer equilibrium has changed.The results were analyzed with Chromax 2007  and OriginPro 2018  software to verify if the z-gradient unit and NMR measurements were performed on Agilent DDR2 800 NMR spectrometer operated at magnetic field strength of 18.8 T =25S form of J(\u03c9)=S2AG is the gradient strength. The Diffusion experiments were conducted on an Agilent DDR2 800 NMR spectrometer utilizing a standard PGSE (Pulsed Gradient Spin Echo) pulse sequence  containined from ."}
{"text": "All molecular systems, from small molecules to macromolecules, exhibit specific characteristics for a specific environment and time. In order to gain an accurate understanding of the functions of all types of molecules, studies of their structure and dynamics are essential. Through dynamic studies, using techniques such as spectroscopy, structure determination, and computer analysis, it is possible to collect functional information on molecules at specific times and in specific environments. Such information not only reveals the properties and mechanisms of action of molecules but also provides insights that can be applied to various industries, such as the development of new materials and drugs. Herein, I discuss the importance of molecular dynamics studies, present the time scale of molecular motion, and review techniques for analyzing molecular dynamics. Imagine this example of why molecular dynamics research is important. There is an advertisement for a new vehicle in the newspaper. It is built primarily for driving on the road like a car, but it can fly like a light aircraft and can be sailed like a ship on rivers or seas. Of course, it is equipped with fully autonomous driving capability, and powered by sustainable energy. Below the introduction to each of these versatile features is a picture of the vehicle engaged in each mode of transport . We can extrapolate a lot from these three pictures by imagination, but some key questions remain unanswered. How will this vehicle transform from one mode of transport to another ? How long will each transformation take? How long can this transport run without replacing its energy source? How perfect/safe is its autonomous driving? How does it handle traffic conditions on the road, sky, and sea? We cannot say anything with confidence with just three pictures. Each mode of transport will have its own operating characteristics, and these characteristics will also change in adaptation to changes in operating environment. We will need tons of pictures and/or intelligently produced videos to accurately understand the vehicle\u2019s characteristics under all conditions we may encounter in each mode of transportation. With continuous information (as is provided by videos), we can accurately understand the vehicle\u2019s performance, whereas fragmented information (such as that from pictures) is insufficient to understand the new vehicle.This transportation-based analogy illustrates the importance of continuous observation, like movies, for the understanding of complex processes such as those studied in the sciences. In nature, there are many molecules  with interesting and important molecular properties that can be elucidated using various scientific techniques.Among these, techniques for obtaining high-resolution structural information are essential as they provide intuitive insights into important structural and functional characteristics of molecules that play important roles in life. Currently, the three dimensional structures of small molecules can be obtained from repositories such as the Cambridge Structural Database (CSD) , which cVarious techniques such as spectroscopy, structure determination and computer analysis are applied to the study of molecular dynamics . In ordeMeanwhile, techniques such as X-ray diffraction/scattering, NMR, Cryo-EM, MicroED, and neutron scattering/diffraction are widely applied to study the mechanism of action by revealing the structure of a molecule ,15,20. TAdditionally, computational molecular dynamics analysis by density-functional theory (DFT) or MD simulation provides an understanding of the functions of molecules and insights into their industrial or medical applications, such as in drug design ,35,36,37Comprehensive molecular dynamics information for pinpointing the functions and properties of molecules can be inferred from information gleaned from multiple snapshots obtained using traditional techniques and the most advanced techniques. Examples of these include temporal characterization based on autocorrelation and pump probe technology combined with microscopy, spatial evolution analysis using X-ray and electron diffraction techniques, and monitoring of the temporal and spatial evolution of materials using nonlinear time-resolved spectroscopy .In this special issue, we deal with the topic of molecular dynamics\u2014those of small molecules to macromolecules. The issue includes a collection of comprehensive articles and reviews of research findings on a wide range of subjects related to molecular dynamics and the development of the technologies that makes its study possible. The results from this broad range of studies not only provide important insights about the technology but also facilitate a broader understanding of molecular dynamics studies across the various sciences."}
{"text": "Oesophageal squamous cell carcinoma (OSCC) is a prevalent malignancy with high morbidity and mortality as a result of early metastasis and poor prognosis. Metastasis is a multistep process, involving various signalling pathways. Circular RNAs (circRNAs) are a class of covalently closed noncoding RNAs, the aberrant expression of which is reported to be involved in several biological events, including cell transformation, proliferation, migration, invasion, apoptosis and metastasis. Several studies have reported interactions between circRNAs and metastasis\u2010associated signalling pathways. The abundance, stability and highly specific expression of candidate circRNAs make them potential biomarkers and therapeutic targets in OSCC. In this review article, we comprehensively describe metastasis\u2010related circRNAs and their interactions with epithelial\u2013mesenchymal transition\u2010associated molecules. We also describe the molecular mechanisms and clinical relevance of circRNAs in OSCC progression and metastasis. The aberrant expression of circular RNAs (circRNAs) is reported to be involved in several biological events, including proliferation, cell cycle, apoptosis and metastasis. In this review article, we comprehensively describe metastasis\u2010related circRNAs and their interactions with epithelial\u2013mesenchymal transition\u2010associated molecules, as well as the molecular mechanisms and clinical relevance of circRNAs in oesophageal squamous cell carcinoma progression and metastasis. CDCcell division cyclecircRNAcircular RNAEMTepithelial\u2013mesenchymal transitionECesophageal carcinomaFERMT1fermitin family member 1Foxoforkhead box O classGLUT1glucose transporter 1GSK3\u03b2glycogen synthase kinase\u20103\u03b2HMGA2high mobility group AT\u2010hook 2ITCHItchy E3 Ubiquitin Protein LigaseLNMlymph node metastasisLPAR3lysophosphatidic acid receptor 3miRNAmicroRNAMMPmatrix metalloproteinaseNF\u2010\u03baBnuclear factor\u2010\u03baBNRIP1nuclear receptor\u2010interacting protein 1NTRK2neurotrophic receptor tyrosine kinase 2OCoesophageal cancerOSoverall survivalOSCCoesophageal squamous cell carcinomaPI3Kphosphatidylinositol\u20104,5\u2010bisphosphate 3\u2010kinasemTORmammalian target of rapamycinPPARperoxisome proliferator\u2010activated receptorPTENphosphatase and tensin homologRBBP7RB\u2010binding protein 7RBPRNA\u2010binding proteinTNMtumour node metastasisTTC17tetratricopeptide repeat domain 17XRCC1X\u2010ray repair cross\u2010complementing 1ZEB1zinc\u2010finger E\u2010box\u2010binding homeobox 1Oesophageal cancer (OC) is one of the major challenges to human health, representing the eighth most common malignancy worldwide . AlthougTP53, a pivotal gene that affects tumour progression, chromosomal instability and the regulation of metastasis, are corroborated in more than 90% of cases [CDKN2A, which controls cell\u2010cycle arrest, were reported in more than 60% of cases and were found to be associated with stepwise progression from inflammation to cancerous lesions [Oesophageal squamous cell carcinoma (OSCC) is the major histological type of OC, constituting approximately 90% of the annual OC incidence . The devof cases , 11. Mor lesions , 12. Oth lesions . Further lesions . Meanwhi lesions . For ins lesions . ConsideIn the years after the initial discovery of circRNA via electron microscopy in 1976 , only spIn\u2009vitro, cell proliferation and migration increase with circ\u2010TTC17 expression. Statistical analysis demonstrated that a relatively high circ\u2010TTC17 expression level is correlated with tumour node metastasis (TNM) stage, lymph node metastasis (LNM) and inferior overall survival (OS) [SMAD7 intron 1 on chr18:46470601\u201346470865. The down\u2010regulation of circ\u2010SMAD7 was verified in OSCC plasma samples and specimens and reported as negatively correlated with TNM stage and LNM. Furthermore, the high expression level of circ\u2010SMAD7 positively affected the proliferation and migration of OSCC cell lines. Although further investigations are required to determine the underlying mechanism, circ\u2010SMAD7 exhibits potential diagnostic merit in OSCC [Recent studies have highlighted the prevalence and highly tissue/cell\u2010type\u2010specific expression of circRNAs in OSCC through a combination of bioinformatics and molecular biological methods. For example, differential expression profiles of 861 circRNAs in different tumour and nodal stages were detected via microarray analysis and quantitative RT\u2010PCR, among which hsa_circRNA_100873 was the most significant candidate with a consistent expression pattern. Patients with early tumour stage, late nodal stage and relatively higher metastatic ability presented different hsa_circRNA_100873 levels compared with the healthy group and the group containing advanced tumour stage with early nodal stage. Moreover, miR\u2010522\u20103p, miR\u20101236\u20103p, miR\u20103064\u20105p, miR\u20106504\u20105p and miR\u2010943 were predicted to bind to hsa_circRNA_100873. This discrepancy in hsa_circRNA_100873 expression confirmed its function in regulating the invasion and metastasis of OSCC . In addival (OS) . Moreoveval (OS) . circ\u2010SM in OSCC .in\u2009vivo and in\u2009vitro through promotion of cell\u2010cycle progression by sponging miR\u2010339\u20105p. Moreover, cell division cycle 25A (CDC25A) was predicted and verified as a downstream targeting molecular signalling protein [Besides tissue/cell\u2010type\u2010specific expression, circRNAs also exhibit aberrant expression patterns in exosomes. Exosomes mediate cell\u2010to\u2010cell communication and reshape the tumour microenvironment by transporting biomolecules, including circRNAs, thus contributing to tumour growth and metastasis. Hence deciphering the role of exosomal circRNAs would also provide new insights into OSCC. A recent study reported that patients with OSCC with LNM have significantly higher serum exosome has_circ_0026611 levels than patients with OSCC without LNM. Higher expression of has_circ_0026611 is associated with clinical characteristics, such as T and N stages, and postoperative radiotherapy and chemotherapy [ protein . AlthougThe investigation of differentially expressed circRNAs between healthy and cancerous tissues and plasma, and between primary and secondary tumours, sheds light on the promising role of circRNAs as potential OSCC biomarkers and therapeutic targets. In addition, we discuss the clinical relevance of circRNAs and provide a reference point for future studies of OSCC metastatic characterization. Therefore, the aberrant expression of circRNAs has a tumour\u2010suppressive or oncogenic role that closely correlates with the clinicopathological appearance, prognosis and outcome of OSCC. However, despite the generally accepted correlation between circRNAs and OSCC, the integrated signalling pathways and molecular mechanisms associated with circRNA regulation remain unclear.Several studies have elucidated the versatile functional patterns of circRNAs, from sponging miRNAs to interacting with proteins to regulate host genes, transcription and encoding of proteins. Herein, we review the general biological roles of circRNAs involved in OSCC and summarize those worth investigating in other tumours, with the intent of providing new insights into OSCC research.It has been documented that circRNAs regulate gene expression via multiple approaches, among which the role of miRNA sponges has been reported most frequently in OSCC. Some circRNAs possess miRNA binding sites and serve as competitive endogenous RNAs to hamper direct base pairing between miRNA and untranslated regions of target mRNA, thus regulating miRNA\u2010inhibitory gene expression and up\u2010regulating target gene expression.In\u2009vitro, the ciRS\u20107/miR\u2010876\u20105p/MAGE\u2010A family axis was also corroborated to facilitate tumour growth and metastasis by increasing proliferation markers (Ki67 and PCNA) and metastatic markers  [in\u2009vitro in OSCC by sponging miR\u20101301\u20103p, further impacting the expression of collagen type I alpha 1 [Herein, we review the relevant circRNA\u2013miRNA axis Table\u2009 and selend MMP9) . Notablynd MMP9) . Recent nd MMP9) . Overallnd MMP9) . Further alpha 1 . circRNA alpha 1 , hsa_cir alpha 1 , ciRS\u20107  alpha 1  and circ alpha 1 , circLAP alpha 1  and circ alpha 1 , have be alpha 1 , circLAP alpha 1 , circula alpha 1  and circ alpha 1  all achiLuciferase reporter gene experiments and functional rescue validation have contributed to the identification of a growing number of circRNAs shown to function through a sponge mechanism. However, most circRNA mechanistic studies are relatively independent, neglecting the fact that various circRNAs and miRNAs exist in OSCC. Due to the complex interconnected networks of circRNAs and miRNAs, integration analysis between circRNAs may lead to new research directions for OSCC to better characterize the relationships between circRNAs. Nonetheless, the interconnected mechanism of circRNA\u2013miRNA sponging confirms that this network plays a role in oesophageal oncogenic expression by interacting with a single common pathway or multiple pathways. Hence the potential regulatory role of the circRNA\u2013miRNA target gene axis may serve as a promising tool for cancer diagnosis and therapy.Apart from sponging miRNAs, circRNAs can also interact with other cellular components, such as proteins, to activate or inhibit downstream signalling pathways that affect the malignant behaviour of tumours . Circulain\u2009vitro and repressed cell growth in\u2009vivo via the cir\u2010ITCH/Wnt network, the relationship between cir\u2010ITCH and ITCH requires further validation [Because most circRNAs are derived from protein\u2010coding genes and spliced cotranscriptionally , 46, it lidation . circRNAlidation . HoweverApart from sponging miRNAs, circRNAs can also target other cellular components, such as RNA\u2010binding proteins (RBPs) . ThroughDespite the earlier\u2010mentioned noncoding functions, increasing evidence indicates that circRNAs may not be a true class of noncoding RNAs, with at least a small subset of them being translatable , via seqBased on the aforementioned functional patterns and accumulating evidence of the distinct expression profile of circRNAs in OSCC, it can be deduced that circRNAs are implicated in OSCC development and metastasis\u2010related cellular events. Hence investigation of metastasis\u2010associated circRNAs may improve molecular and cellular insights into OSCC progression and metastasis. To date, hundreds of circRNAs have been implicated in metastasis\u2010related processes, including EMT. EMT, the transition from epithelial to mesenchymal states, has been identified as the main promoter and requisite for metastasis. EMT\u2010related markers can be detected at the invasive front of the tumour and further elaborated by mechanistic studies to drive the dissemination of tumour cells and initiate metastasis , 55, whiHerein, we review the current research on circRNAs related to the metastasis of OSCC while emphasizing the regulatory functions and mechanisms of circRNAs that contribute to the development of malignant phenotypes of OSCC.Metastasis, as the end product of a multistep cell biological process involving the dissemination of tumour cells from the primary site to distant sites, not only is the main cause of cancer\u2010related deaths but also represents a significant challenge to humans successfully fighting cancer . One hunIn view of the regulatory role of circRNA in metastatic pathways, it may be clinically applicable as a diagnostic and therapeutic tool. Indeed, features of circRNAs, such as abundance, conservation, stability, and tissue\u2010 and developmental stage\u2010specific expression, indicate the promising role of circRNA as a biomarker in cancer. Studies have shown that circRNA can be applied to evaluate the effect of diagnosis and treatment and to predict the prognosis and metastasis of many diseases, including OSCC , 80, 81.in\u2009vivo and in\u2009vitro. In addition, circRNA_100876 enhances migration, invasion and EMT processes, while eliminating cell\u2010cycle arrest and inhibiting apoptosis. Silencing circRNA_100876 increases the protein level of epithelial\u2013phenotype E\u2010cadherin and reduces mesenchymal\u2013phenotype N\u2010cadherin, vimentin and the EMT\u2010associated transcription factor SNAIL. Clinical data have further shown that high expression of circRNA_100876 strongly correlates with multiple metastatic indicators, such as tumour invasion depth (P\u2009=\u20090.017), LNM (P\u2009=\u20090.027) and vascular invasion (P\u2009=\u20090.036) [hsa_circRNA_100876 has been reported as up\u2010regulated in OSCC samples and contributes to the\u2009acceleration of tumour progression both =\u20090.036) .in\u2009vitro studies have revealed a mechanism underlying the regulatory role of circRNA in metastasis. Higher hsa_circ_0012563 expression was validated in OSCC in both clinical specimens and OSCC cell lines and was shown to be positively correlated with a lower survival rate and metastasis. In\u2009vitro, hsa_circ_0012563 positively affects cell proliferation, migration, invasion and apoptosis. Moreover, siRNA\u2010based experiments demonstrated that X\u2010ray repair cross\u2010complementing 1 (XRCC1) is the downstream molecule, and silencing of hsa_circ_0012563 increases the expression of XRCC1, consequently increasing the abundance of the EMT marker E\u2010cadherin and inhibiting N\u2010cadherin expression. Meanwhile, repression of XRCC1 also partly neutralizes the inhibitory effect on E\u2010cadherin protein expression and promotes the effect on N\u2010cadherin protein expression [In\u2009vitro, hsa_circ_0006948 promotes proliferation, migration and invasion capacity and induces EMT. In addition, miR\u2010490\u20103p was found to bind to hsa_circ_0006948. The high mobility group AT\u2010hook 2 (HMGA2) was reported to facilitate EMT before it was verified to be a direct target of hsa_circ_0006948/miR\u2010490\u20103p and affect the expression of vimentin, N\u2010cadherin and E\u2010cadherin. Thus, hsa_circ_0006948 could directly bind miR\u2010490\u20103p to regulate HMGA2, further inducing EMT [La ribonucleoprotein 4 (LARP4) with a length of 1313 nucleotides. The functional relevance of circLARP4 is primarily exhibited in hindering cell proliferation and migration, driving apoptosis and impeding the EMT process by affecting the protein levels of E\u2010cadherin and N\u2010cadherin. circLARP4 inhibits miR\u20101323 activity, thereby modulating the PTEN\u2010mediated PI3K/AKT pathway to impact the EMT process and other biological behaviours of OSCC cells [in\u2009vitro and promotes tumour growth in\u2009vivo. By sponging miR\u2010140\u20103p, circNTRK2 further up\u2010regulated the expression of nuclear receptor\u2010interacting protein 1, which is related to various oncogenic pathways, thereby exerting its oncogenic role [Other pression . In addipression . Similarcing EMT . hsa_cirCC cells . circRNAnic role .Interestingly, research has shown that OSCC radioresistant cell lines possess stronger molecular characteristics\u2009with lower E\u2010cadherin expression and higher vimentin and SNAIL expression. The level of hsa_circRNA_100367 is also elevated in this radioresistant cell line and is positively associated with EMT. Meanwhile, silencing hsa_circRNA_100367 enhances the expression of EMT\u2010related molecules, such as vimentin and SNAIL, through the hsa_circRNA_100367/miR\u2010217/Wnt3 axis . Similarin\u2009vitro. Besides the alteration of EMT markers, circRNA can also directly facilitate the metastasis process in\u2009vivo. High expression of circ_0000654 was first detected in OSCC specimens and confirmed to be significantly associated with an increased T stage and local LNM in patients with OSCC. In\u2009vitro, circ_0000654 was found to accelerate OSCC progression by adsorbing miR\u2010149\u20105p and indirectly activating the IL\u20106/STAT3 signalling pathway. In addition, a lung metastasis model was constructed through vein injection, and hematoxylin and eosin staining revealed that knockdown of circ_0000654 significantly reduces lung metastasis with less OSCC cell infiltration [LPAR3 gene, could promote migration, invasion and metastasis in\u2009vivo and in\u2009vitro. However, simple alterations in protein levels of transfer\u2010associated molecules, such as MMP2 and MMP9, in the sh\u2010circLPAR3 group alone are not sufficient to account for the prometastatic effect of circLPAR3 in\u2009vitro, and more direct evidence is required to verify this inference.The studies discussed earlier focus on the relationship between circRNAs and metastasis by detecting the protein levels of EMT markers ltration . HoweverTreatments for OSCC have been developed to cure or delay the disease, including endoscopic therapy, surgical resection, chemotherapy, chemoradiotherapy and neoadjuvant chemoradiotherapy. Notably, the alliance of neoadjuvant chemoradiotherapy and surgery benefits patients with OSCC with curable potential ; neverthBecause circRNAs are expressed differently in drug\u2010resistant tissues and cell lines, it would be reasonable to speculate on their role in OSCC tumour resistance. In fact, a study reported the down\u2010regulation of circPSMC3 in OSCC tissues and gefitinib\u2010resistant cell lines. Vector overexpression of circPSMC3 significantly increased cellular sensitivity to gefitinib, with a lower survival rate of OSCC cells and corresponding gefitinib\u2010resistant cells, and lower half\u2010maximal inhibitory concentration value of gefitinib than the control group. circPSMC3 also accelerated apoptosis, with high cleaved caspase\u20103 protein expression. The underlying mechanism of circPSMC3 was also explored, showing that circPSMC3 down\u2010regulates PTEN by acting as an miR\u201010a\u20105p sponge to suppress the progression of OSCC, meaning that the circPSMC3/miR\u201010a\u20105p/PTEN axis may be a reliable treatment strategy in the future . ciRS\u20107 PRKCI gene, with 1484\u2009bp in length. Flow cytometry and western blotting revealed that inhibited circPRKCI expression augments cell apoptosis with an increase in radiation dose, while colony formation assay results revealed that PARP9 enhancement overturns the circPRKC inhibition\u2010mediating effect on cell radiosensitivity. circPRKCI affects the anti\u2010radioresistant phenotypes in\u2009vitro by sequestering miR\u2010186\u20105p and further activating PARP9 [circRNAs also have the potential to modulate the radioresistance of OSCC. circPRKCI is formed by cyclization of exons 15 and 16 of the ng PARP9 . Collectin\u2009vitro and in\u2009vivo.Elevated levels of circVRK1 attenuate cell proliferation, migration and EMT and reinforce cell sensitivity to radiotherapy. Overexpression of miR\u2010624\u20103p and inhibition of PTEN reverse the radiosensitivity enhancement induced by circVRK1. Hence circVRK1 suppresses OSCC radioresistance via the miR\u2010624\u20103p/PETN axis . A similOne of the common features of tumour cells is that they proliferate indefinitely. To sustain rapid growth and progression, altered metabolism is essential to provide more nutrition to the tumours . Emerginin\u2009vitro by down\u2010regulating pyruvate kinase. Loss\u2010of\u2010function experiments were conducted to further explore the relationship between hsa_circ_0006168, miR\u2010384 and RB\u2010binding protein 7 (RBBP7), and hsa_circ_0006168 was found to facilitate cell growth, migration, invasion and glycolysis by regulating miR\u2010384/RBBP7. In addition, the S6K/S6 pathway becomes activated by up\u2010regulating RBBP7 induced by hsa_circ_0006168 to modulate OC progression [Similarly, knockdown of hsa_circ_0006168 inhibits glucose consumption and lactate production gression . Lendinggression .Manifold literature has deepened our understanding of circRNAs and their relevance to various physiological and pathological processes. The intricate mechanisms underlying multitargeting circRNAs are associated with the initiation, metabolism, metastasis and other pathological OSCC processes. However, some obstacles still need to be overcome for future studies and application.From the detection aspect, the earlier\u2010mentioned studies have been based on second generation sequencing and focused on exon\u2010derived circRNAs. However, many issues are associated with short\u2010read RNA sequencing, in particular the inability to confirm the full\u2010length sequence and accurately quantify the circRNA. Meanwhile, novel detection methods, such as nanopore technology, catalogue full\u2010length circRNA with higher accuracy for circRNAs with low expression and mitochondrial circRNAs . Long\u2010rein\u2009situ hybridization to provide intracellular localization data in OSCC, whereas none of the earlier\u2010discussed studies provided in\u2009situ data to assess potential intratumour heterogeneity related to the expression of circRNAs. A recent study found that ciRS\u20107 is abundantly expressed in tumour stromal cells within the tumour microenvironment and is completely absent in colon cancer cells [in\u2009situ hybridization could be applied to clarify the cellular expression patterns of circRNA more adequately in OSCC and exclude the influence of matrix on the results.From the validation aspect, it is important to clarify circRNA localization because its function is highly dependent on its space specificity. Select studies have leveraged fluorescence er cells . The impIn addition, predominant mechanistic studies of circRNAs in OSCC focus on their role as miRNA sponges in modulating downstream molecules, because most circRNAs are localized in the cytoplasm. However, one circRNA possesses multiple miRNA binding sites. Thus, focusing on one miRNA might neglect that some miRNAs have opposite downstream effects. It is thus important to determine whether circRNAs act through several miRNAs simultaneously, or through one primary miRNA when in conditions with very low levels of additional miRNA binding sites. Moreover, other general function patterns, such as the interaction between proteins and DNA, have rarely been investigated in OSCC and deserve more attention .Because circRNAs can alter the characteristics of tumours, several factors can lead to altered levels of circRNA. It was reported that ZEB1, as a key transcription factor, could bind the promoter region of hsa_circ_0001178 and increase its expression in colorectal cancer ; similarFurthermore, the development of OSCC is a complex process with multiple stages and successive activation of various cytokines and mechanisms. Investigations focusing on the aberrant expression of primary and metastatic OSCC tissue might provide more holistic evidence of the role of circRNAs in different periods of metastasis. In addition, although circRNAs are expected to assist in clinical diagnosis, prognosis and treatment according to current data, a single study may not be comprehensive and sufficiently in\u2010depth to verify whether circRNA could serve as a therapeutic target and as an upstream regulator. Further evidence, especially via clinical trials, is required.In summary, OSCC is a multistage and multifactorial disease with a mechanism that has not been fully elucidated. The lack of early typical clinical symptoms leads to late diagnosis and poor prognosis in patients with advanced OSCC, particularly in patients with distant metastasis. circRNAs as novel noncoding RNAs have been shown to mediate various biological events, including cell transformation, proliferation, migration, invasion, apoptosis and metastasis in OSCC. The aberrant expression of circRNAs was substantiated in OSCC and correlated with multiple clinicopathological features, including metastasis. In addition, various circRNAs play crucial roles in the development, metastasis and resistance to chemotherapy and radiotherapy in OSCC. In this regard, circRNAs exhibit promising value in clinical diagnostic, prognostic and therapeutic applications. Identifying an increasing number of circRNAs that affect OSCC is important, while exploring deeper triggers of alternative splicing that generate aberrant circRNAs might provide new insights into OSCC. Therefore, investigations on the regulation of OSCC by circRNAs are still in their infancy, and future mechanistic studies together with clinical research appear to be a future endeavour.The authors declare no conflict of interest.XF and SMS conceived and designed the project. XF acquired, analysed and interpreted the data. XF wrote the manuscript. XF, SMS and L\u2010HR made manuscript revisions. RS organized the research project, reviewed the manuscript and arranged necessary resources from the grants. All authors approved the final version of the manuscript."}
{"text": "Hepatocellular carcinoma (HCC) is one of the most common malignancies globally. Despite aggressive and multimodal treatment regimens, the overall survival of HCC patients remains poor.Circular RNAs (circRNAs) are noncoding RNAs (ncRNAs) with covalently closed structures and tissue- or organ-specific expression patterns in eukaryotes. They are highly stable and have important biological functions, including acting as microRNA sponges, protein scaffolds, transcription regulators, translation templates and interacting with RNA-binding protein. Recent advances have indicated that circRNAs present abnormal expression in HCC tissues and that their dysregulation contributes to HCC initiation and progression. Furthermore, researchers have revealed that some circRNAs might serve as diagnostic biomarkers or drug targets in clinical settings. In this review, we systematically evaluate the characteristics, biogenesis, mechanisms and functions of circRNAs in HCC and further discuss the current shortcomings and potential directions of prospective studies on liver cancer-related circRNAs.CircRNAs are a novel class of ncRNAs that play a significant role in HCC initiation and progression, but their internal mechanisms and clinical applications need further investigation. HCC was the sixth most common malignancy and the third leading cause of cancer-related death globally in 2020, accounts for 75\u201385% of primary liver cancer cases and has been ranked second in terms of mortality in men . ChronicEmerging evidence indicates that noncoding RNAs (ncRNAs) are involved in many cellular biological and physiological processes and even pathological disease processes . Among tDrosophila, mice and humans, and is also found in the hippocampus , 2316, 2Adenosine deaminase-acting on RNA (ADAR1) was found to be an RNA-editing enzyme and to play a suppressive role in circRNA formation. This function was correlated with its adenosine-to-inosine (A-to-I) editing process, which frequently occurs near the location of reverse complementary matches (RCMs), a conserved feature of circRNA biogenesis . InteresThe emerging roles of circRNAs emphasize the importance of sequencing these circular transcripts. In the past decade, RNA sequencing (RNA-seq) technology has developed rapidly and has become an indispensable tool for analyzing the differential expression of genes and differential splicing events of mRNA at the transcriptome level .Next-generation sequencing  is currently the main way to sequence circRNAs. In next-generation sequencing, the coordination of gene cluster replication decreases with increasing read length, resulting in a decline in the quality of base sequencing. Therefore, next-generation sequencing is a high-throughput and short-read technique. Since most circRNAs are derived from exons, this alignment-based method is unable to distinguish circular reads from the overlapping regions of corresponding linear transcripts. The biggest drawback is that next-generation sequencing\u2019s relatively short-read capacity considerably limits its detection ability in structural variant detection and genome assembly .Emerging long-read sequencing technologies have become a powerful participant in genomics. Compared with short-read approaches, long-read technologies can generate continuous ultralong sequences directly from native DNA. However, oligo(dT) primers are not suitable to use for circRNA sequencing because of their lack of poly(A) tails, and as a result, long-read sequencing technology cannot be widely applied in circRNA studies .Strikingly, a recent report presented a novel algorithm (CIRI-long) for detailed analysis of full-length circRNAs using nanopore sequencing technology. This technology utilized full-length circular reverse transcription (which was performed with random primers and SMARTer reverse transcriptase) to amplify circRNAs by producing long complementary DNA (cDNA) molecules containing multiple copies of full-length circRNA sequences. Then, a nanopore approach was used to directly sequence full-length circRNA sequences, and a specific algorithm was applied to quantify circRNA expression and recognize full-length mutant transcript sequences. The data showed that compared with Illumina RNA-seq , nanopore sequencing can enhance the detection efficiency for circular reads (with a 20-fold increase) and provide a fivefold increase in identifying alternative circularization events, indicating its higher sensitivity for circular isoform identification. Furthermore, nanopore sequencing can recognize circRNAs at a relatively low abundance and capture nonclassical circRNAs more sensitively, such as a new type of intronic self-ligated circRNA .Although many studies suggest that some circRNAs have the potential to be novel diagnostic or prognostic markers, the key problem is how to detect circRNAs in body fluids more efficiently. Very recently, our group reported a fully integrated electrochemical point-of-care testing (POCT) platform based on Au nanoflower (AuNF)/peptide nucleic acid (PNA)-modified carbon-fiber microelectrodes (CFMEs) . The plaThese new technologies provide more possibilities for the study of circRNAs. Undoubtedly, an increasing number of new technologies will emerge in the future, opening uncharted territory in circRNA research.With the development of RNA sequencing technology, the whole genome transcriptional map of circRNAs in HCC has been reported in several studies , 36, 37.To identify the circRNAs involved in HCC tumorigenesis, a recent study detected differential circRNA expression between HCC tissues and adjacent noncancerous liver (ANL) tissues. In this study, 13,686 distinct circRNAs were identified in total, excluding those with very low abundance, and the expression levels of the identified circRNAs were further analyzed. The results showed that 236 circRNAs were differentially expressed in HCC compared with matched ANL tissues, of which 108 were upregulated and 128 were downregulated [Another study identified 220 circRNAs that were differentially expressed between patients who experienced postsurgical pulmonary metastasis and those who did not. Among the identified circRNAs, 144 were upregulated and 76 were downregulated .HCC is characterized by a clear gender disparity, and AR is thought to be critical for this bias . To veriThese sequencing and bioinformatics analysis statistics demonstrate the possible involvement of circRNAs in HCC tumorigenesis and development. Many studies have reported that circRNAs play an important role in HCC, although their specific functions and internal mechanisms are still under investigation , 39\u201360 .Table 1OWith further developments in the study of circRNAs, the mechanisms of circRNAs have been gradually revealed. Through pre-mRNA back-splicing, circRNAs gain high stability to exert their important regulatory functions. It is universally acknowledged that circRNAs play a vital role as competing endogenous RNAs (ceRNAs) to regulate downstream signaling pathways \u201363. MeanThe primary location of circRNAs is the cytoplasm, which is a precondition for them to exert posttranscriptional regulation functions . NumerouOngoing investigations have reported that some circRNAs can function as miRNA sponges in HCC. CircSMARCA5 is a circRNA derived from exons 15 and 16 of the SMARCA5 gene and is downregulated in HCC . In HCC A large amount of evidence has confirmed the existence of the circRNA-miRNA pathway. However, it can be seen from the examples above that circRNAs usually sponge more than one miRNA to exert their function , 37, 52.RBP is a general term for a group of proteins possessing RNA recognition motifs that function by binding RNA to regulate its metabolic processes . RBPs plSeveral groups have reported that circRNAs may combine with RBPs to regulate gene expression , 70, 71.As mentioned above, circRNAs can physically combine with specific RBPs to facilitate or inhibit their function. Interestingly, one study revealed that a specific circRNA can alter the subcellular localization of its target RBP, providing a novel pattern for RBPs to perform specific functions under unusual cellular localization . HoweverEmerging evidence has demonstrated that some circRNAs may act as dynamic scaffolding molecules to regulate protein functions. Ongoing studies have shown that circRNAs can bind corresponding proteins in specific subcellular locations and facilitate the colocalization of relevant proteins, which may modulate protein\u2013protein interactions .An outstanding study revealed that circACC1 combines with the regulatory \u03b2 and \u03b3 subunits of AMPK to form a ternary complex and thereby facilitates the stabilization and activity of the AMPK holoenzyme . In HCC,Recently, our laboratory demonstrated that circSORE could bind the master oncogenic protein YBX1 to prevent YBX1 nuclear interaction with the E3 ubiquitin ligase PRP19 and inhibit PRP19-mediated YBX1 degradation, thereby inducing sorafenib resistance . In contAll these circRNAs serve as protein scaffolds. However, they exhibit different biological functions, suggesting that circRNAs can play different roles as protein scaffolds. Recent years have witnessed excellent progress in understanding of this novel mechanism in HCC, to which our group has made a contribution . Given tCircRNAs are regarded as ncRNAs due to the lack of essential components for cap-dependent translation, including the 5\u2032 cap and the poly(A) tail. However, emerging evidence indicates that circRNAs may have the potential to encode proteins in a cap-independent manner . circRNACircZNF609 is one of the few endogenous circRNAs that have been reported to act as translation templates. Structurally, circZNF609 contains a 753-nt open reading frame (ORF) spanning from the start codon of the host gene to a stop codon created 3 nt after the splice junction . MechaniRecently, a novel circRNA, circ\u03b2-catenin, was identified as a protein-encoding circRNA whose translation can promote HCC cell growth through activation of the Wnt pathway . The stuThese results broaden our understanding of the human proteome. Currently, there is only one report on the translational function of circRNAs in HCC, indicating that the internal mechanisms of encoding circRNAs lack in-depth study. Our group suggests using a bioinformatics database to predict whether ORFs, IRESs or m6A modification sites exist in candidates. CircRNAs possessing these basic conditions may have the potential to encode proteins, which requires subsequent experimental analysis for further verification. The abundance and subcellular localization of circRNAs may lead to inferior translation efficiency compared with their cognate mRNAs. Hence, it remains controversial whether circRNA-derived proteins could achieve observable effects on the development of HCC .Emerging evidence has indicated that circRNAs play vital roles in HCC tumorigenesis and progression and are involved in cell proliferation, tumor metastasis, immune escape and drug resistance Fig.\u00a0 36, 37,, 51\u201353. Investigations have reported that several circRNAs are expressed at an extremely high level in the early stages of HCC, suggesting that these specific circRNAs may promote tumorigenesis. A previous study demonstrated that circCDYL can regulate tumorigenesis by promoting the stem-like properties of HCC cells and showed that circCDYL-transduced HCC cells present a higher expression level of stem cell-associated genes with a markedly increased percentage of EpCAM\u2009+\u2009cells. Moreover, overexpression of circCDYL increased the expression of Ki-67 and alpha-fetoprotein (AFP), indicating that circCDYL promotes the malignant proliferation of HCC cells . AnotherOn the other hand, emerging evidence indicates that circRNAs can regulate tumor cell apoptosis through specific mechanisms . ApoptosHence, the important role played by circRNAs in cell proliferation and tumorigenesis is becoming even clearer, providing insights for a deeper understanding of HCC pathogenesis.Epithelial-to-mesenchymal transition (EMT) refers to a biological process by which epithelial cells are transformed into cells with a mesenchymal phenotype, and EMT plays a vital role in the ability of malignant tumor cells derived from epithelial cells to obtain characteristics that enable invasion and metastasis . MechaniRecent advances have shown that some EMT-related circRNAs can affect the EMT process in HCC. For instance, circARFGEF2 was found to be overexpressed in portal vein tumor thrombus (PVTT) and HCC tissues and to promote the EMT process via a miR-143-3p/FOSL2 axis and PCBP1/CD44v6 axis , leading to a remarkable acceleration in intrahepatic and pulmonary metastasis . MoreoveConsequently, circRNAs are considered key factors with well-characterized functions in regulating the EMT process, cancer cell invasion and metastasis in HCC.Immune dysfunction plays an important role in HCC development. Experimental evidence has shown that the circRNA expression profile changes during viral infection, which can regulate the function of the immune system . SubsequFor instance, a recent study found that HCC cells secrete circUHRF1 through exosomes and that circUHRF1 can inhibit NK cells from secreting IFN-\u03b3 and TNF-\u03b1 by upregulating the expression of TIM-3 in NK cells. This study showed that the level of plasma exosomal circUHRF1 was negatively correlated with the infiltration level of NK cells in tumors . ResearcThese examples confirm that circRNAs can affect HCC development and prognosis by regulating the immune system of HCC patients, which prompted us to wonder whether circRNAs will become an ideal immunotherapy target in the future.Statistics indicate that most HCC patients are diagnosed at an advanced stage. At present, the main drug treatment for unresectable HCC includes chemotherapy  and targeted therapy , but conventional systemic chemotherapy lacks survival benefits.Currently, multikinase inhibitors, monoclonal antibodies and immune checkpoint inhibitors are the main targeted molecular therapies approved for treatment of advanced-stage HCC; however, the effects of these treatments are not satisfactory , 94. TheIncreasing evidence has indicated that ncRNAs are critical for the development of sorafenib resistance in HCC , 98. OurMeanwhile, ongoing studies have shown that circRNAs play a vital role in the development of drug resistance . Our groIn summary, we must further clarify the mechanism underlying drug resistance and explore how circRNAs function in resistance to molecular targeted drugs. Identifying a specific circRNA that could be used as a new therapeutic target to avoid drug resistance would be an important step forward.\u201cSecondary prevention\u201d  can improve the prognosis of HCC patients. The poor prognosis of most patients with HCC is due to the diagnosis of advanced HCC, and the reaction of advanced HCC to all treatment regimens is not satisfactory . At presEmerging evidence has demonstrated that circRNAs hold great potential as a novel attractive class of diagnostic biomarkers for HCC due to their resistance to RNase R digestion and their stability during circulation. Recent studies have indicated that circRNAs can not only be detected in tumor tissues but also in exosomes, blood, saliva and urine \u2013107. TheCircRNAs have gradually been recognized as possible prognostic biomarkers. For instance, circSLC3A2, which is elevated in HCC tissues, plays an oncogenic role by sponging miR-490-3p to modulate PPM1F expression and could serve as a prognostic biomarker due to its positive correlation with poor survival in patients with HCC . In contHowever, the clinical feasibility of using circRNAs still needs to be verified in a large cohort of HCC patient samples. Meanwhile, inventing efficient circRNA detection methods, such as the POCT platform, is also of great significance.Recently, an increasing number of studies have focused on the significance of circRNAs in HCC and their correlation with HCC tumorigenesis and development, and some authors have proposed that circRNAs have the potential to serve as therapeutic targets in HCC Table . For exaCurrently, the main treatment for high-grade (middle and advanced) HCC is chemotherapy and molecular targeted therapy; however, the development of resistance to HCC treatments is an unavoidable problem, including resistance to traditional chemotherapy and even first-line molecular targeted therapies, such as sorafenib . As prevRecently, circRNA-based therapy has attracted increasing attention. Compared with other drugs, such as monoclonal antibodies or small molecule inhibitors, circRNA-based therapy has several advantages. First, circRNA drugs have a long half-life , while traditional therapeutic drugs are unstable once they enter the circulatory system; therefore, with circRNA drugs, the patient dosing frequency can be decreased compared with that for antibodies or small molecules . Second,On the other hand, proteolysis-targeting chimeras (PROTACs) are a burgeoning and promising field and can modulate protein concentrations at a posttranslational level by coopting the ubiquitin\u2013proteasome system . As prevGenerally, whether circRNAs have clinical value merits further study and discussion. Although circRNAs have the potential to serve as diagnostic markers, prognostic markers, therapeutic targets or novel drugs, these roles are based only on theoretical assumptions and predictions; thus, more substantive studies are needed to verify these conjectures Table .Substantial progress has been achieved in specific circRNAs. These findings not only reveal a previously unexpected complexity of cellular regulatory mechanisms but have also identified many circRNAs with important physiological and clinical significance. Although the progress is exciting, it has led to many more questions than answers, which require future investigation.6A modification of circRNAs has been proposed to facilitate the cytoplasmic export of circRNAs [First, most studies have focused on a specific circRNA and its downstream mechanisms, while the upstream mechanisms remain largely unknown. For example, how exactly are circRNAs formed? Under what circumstances do pre-mRNAs form circRNAs rather than mRNAs? Are there any factors that are specifically required for back-splicing but not for splicing? How are circRNAs exported from the nucleus to the cytoplasm? These issues are rarely mentioned in most current studies. However, research groups have tried to answer these questions, and mcircRNAs . HoweverSecond, current biological tools and methods applied in circRNA-related studies still have some obvious shortcomings. Due to the high degree of sequence similarity between circRNAs and their cognate mRNAs, off-target effects of circRNA knockdown are difficult to avoid or completely eliminate. Similarly, the same dilemma has been observed in circRNA FISH and circRNA pull-down experiments. To successfully overexpress circRNAs, special sequence elements that promote circularization are usually inserted at both ends of the linear circRNA sequence. Inevitably, a large number of \u201clinear circRNAs\u201d will be produced due to the low efficiency of circularization. Whether this by-product will affect experiments remains to be further studied. Furthermore, the CRISPR-Cas9 system may be restricted in knockout studies of circRNAs because deletion of the whole genome sequence could disturb the expression of cognate mRNAs and impact specific biological functions. These challenges highlight the need for more advanced technologies for circRNA interference, detection and other functional studies. Very recently, Chen and colleagues reported that the CRISPR-Cas13 technique combined with guide RNA targeting sequences spanning junction sites featured in circRNAs can be applied to knock down circRNAs. Furthermore, compared with shRNA-mediated knockdown, RfxCas13d\u2013BSJ-gRNA-mediated circRNA knockdown showed higher efficiency and specificity and lower rates of off-target effects on cognate mRNAs .Finally, the number of circRNAs that truly have cellular and physiological functions remains to be explored. In particular, our research has shown that the expression of circRNAs in HCC is widely reduced, suggesting that low expression levels will lead to nonfunctionalization . Given tIn recent years, an increasing number of studies have begun to focus on circRNAs; thus, circRNA-related research is progressing at a steady and fast pace. In the following section, we propose several challenging and innovative future research directions in the field of circRNAs.First, the current research remains at the cellular and animal levels, and how to facilitate translation toward clinical application will become a hot topic in the future. Because circRNAs are stable and have been detected in many types of body fluids, further studies are warranted to confirm their potential as biomarkers, therapeutic targets or novel drugs.Second, whether a circRNA with relatively low abundance can achieve measurable effects remains controversial. Future studies should focus on certain types of circRNAs with the same properties instead of a specific circRNA. For example, a striking study reported that endogenous circRNAs with 16\u201326\u00a0bp that form imperfect RNA duplexes can act as inhibitors of double-stranded RNA (dsRNA)-activated protein kinase (PKR) related to innate immunity .Generally, HCC is a multistep, multistage and multifactor comprehensive hereditary malignancy, and the specific pathogenic mechanisms remain unclear. Despite the availability of a comprehensive treatment regimen, including surgery, chemotherapy, targeted therapy and immune therapy, the overall survival of patients with advanced HCC is still unsatisfactory. Notably, circRNAs are a novel class of ncRNAs that play a significant role in HCC initiation and progression. As described in this review, circRNAs are aberrantly expressed in HCC and associated with the clinicopathological features and prognosis of HCC patients. Unexpectedly, there is a high degree of heterogeneity among HCC-related circRNAs, and individual circRNAs may have prooncogenic or antioncogenic roles and function through various pathophysiological mechanisms. Given the stability and polyfunctionality of circRNAs, circRNAs might serve as diagnostic indicators, prognosis predictors, therapeutic targets or novel nucleic acid drugs for precise treatment of HCC, thus improving the quality of life and extending the survival of HCC patients."}
{"text": "However, pathophysiological conditions (insulin resistance) are characterized by a sustained DNL in the liver and aimed at preventing the excess accumulation of glucose, which result in increased tissue content of PA and disrupted homeostatic control of its tissue concentration. This leads to an overaccumulation of tissue PA, which results in dyslipidemia, increased ectopic fat accumulation, and inflammatory tone via toll-like receptor 4. Any change in dietary saturated FAs (SFAs) usually reflects a complementary change in polyunsaturated FA (PUFA) intake. Since PUFA particularly n-3 highly PUFA, suppress lipogenic gene expression, their reduction in intake rather than excess of dietary SFA may promote endogenous PA production via DNL. Thereby, the increase in tissue PA and its deleterious consequences from dysregulated DNL can be mistakenly attributed to dietary intake of PA.Palmitic acid (PA) is ubiquitously present in dietary fat guaranteeing an average intake of about 20 g/d. The relative high requirement and relative content in the human body, which accounts for 20\u201330% of total fatty acids (FAs), is justified by its relevant nutritional role. In particular physiological conditions, such as in the fetal stage or in the developing brain, the respectively inefficient placental and brain blood\u2013barrier transfer of PA strongly induces its endogenous biosynthesis from glucose  Palmitic acid (PA) is one of the most abundant saturated fatty acids (SFAs) in nature, which is present in animal and human tissues, plants, algae, fungus, yeast, and bacteria. Its distribution varies both within species and among species, and its content can be influenced by several environmental factors as the variation of soil pH, nutrient\u2013ion interaction, age, water, and climate , 2.The average dietary intake of PA is around 20\u201330 g/d representing about 8\u201310%en  and can In evaluating the effects of food on health, the overall macronutrient composition and structure need to be considered, i.e. the \u201cfood matrix\u201d , meaningDietary PL represents 1\u201310% of total daily fat intake . PL is mOver 90% of dietary FAs are esterified to TAG preferentially hydrolyzed by digestive lipases  on sn-1,PA peculiar tissue distribution results in its better incorporation in several tissues, for example, adipose tissues, with a lower deposition of fat in the visceral depots and higher in the subcutaneous fat . InteresMost of the studies aimed at evaluating dietary FA intake rely on food frequency questionnaires (FFQs), and food diaries where even repeated measurements do not necessarily provide valid measures of individual intake. Extreme intakes may reflect under- and overreporting rather than true low or high intakes, and subjects most prone to reporting bias may be repeatedly misclassified in quantiles of the distribution . In addir = \u22120.02 to 0.09)  \u201360.Factors other than dietary intake have been suggested to influence FA composition in tissues, first FA metabolism efficiency, genetic variations, and even intrauterine and perinatal program. In fact, considering the relationship between the tissue FA composition and dietary fat, among plasma lipid fractions, only TAGs appear to reflect dietary polyunsaturated FA (PUFA) and SFA, but not monounsaturated FA (MUFA)  within tde novo lipogenesis (DNL) with the accumulation of VLDL-TAG PA that led to linoleic acid (LA) reduction probably due to dilution effect, whereas with high-fat  DNL is neglectable  and further desaturation via SCD1 to form oleic acid (OA). A possible protective capacity of OA to drive PA to be deposited in the neutral form of TAG , by the insertion of one double-bond through stearoyl-CoA desaturase-1 (SCD1) , which rm of TAG , 65 and m of TAG .When the energetic sources are in excess, the non-fat surplus, mainly carbohydrates, is converted to FA by DNL, a pathway that begins with the conversion of acetyl-CoA into malonyl-CoA by acetyl-CoA carboxylase (ACC). During fed and insulin-stimulated conditions, ACC increases malonyl-CoA levels whereas AMP-activated protein kinase (AMPK) stops the synthesis, probably by inhibiting sterol regulatory element-binding protein (SREBP) .Further evidence indicates that adipose tissue DNL supports metabolic homoeostasis of distant organs, as in liver and muscle, by producing cytokine-like lipids, lipokines, with antidiabetogenic and antiinflammatory activities, such as POA and branched FA esters of hydroxy FA (FAHFA) , 68.In normal conditions, adipose tissue is the major site for DNL, which significantly contributes to body lipid reserves, energy storage, and to the maintenance of serum TAG homeostasis that derived instead from dietary sources \u201375. FurtOn the other hand, under specific conditions in the liver, such as insulin resistance, the impaired glycogen biosynthesis and consequent accumulation of glucose induce DNL that may contribute up to 26% to ectopically intrahepatocellular lipids in the pathogenesis of nonalcoholic fatty liver disease (NAFLD). In fact, hepatic DNL is positively correlated with insulin resistance and fatty liver, whereas the correlation with adipose tissue DNL is the opposite , 79\u201381.In addition, a high-carbohydrate diet, particularly rich in simple sugars as fructose \u201384, actiRegulation of DNL occurs through the regulation of transcriptional factors as SREBP-1c and carbohydrate-responsive element-binding protein (ChREBP), activated by increased insulin signaling and increased glucose concentrations, respectively, and both induced by feeding , 92\u201395.via decreased expression of SREBP-1c  is quite controversial . The CocIn vitro cell culture studies showed that PA in the free form in the medium elicits, insulin resistance  and FADS2 (rs3834458) were associated with unfavorable FA profile in red blood cells . It has via DNL. Thus, the increase in tissue PA from dysregulated DNL and its deleterious consequences can be mistakenly attributed to dietary intake of PA .The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "We present an approach to discriminate SARS-CoV-2 virus types based on their RNA sequence descriptions avoiding a sequence alignment. For that purpose, sequences are preprocessed by feature extraction and the resulting feature vectors are analyzed by prototype-based classification to remain interpretable. In particular, we propose to use variants of learning vector quantization (LVQ) based on dissimilarity measures for RNA sequence data. The respective matrix LVQ provides additional knowledge about the classification decisions like discriminant feature correlations and, additionally, can be equipped with easy to realize reject options for uncertain data. Those options provide self-controlled evidence, i.e., the model refuses to make a classification decision if the model evidence for the presented data is not sufficient. This model is first trained using a GISAID dataset with given virus types detected according to the molecular differences in coronavirus populations by phylogenetic tree clustering. In a second step, we apply the trained model to another but unlabeled SARS-CoV-2 virus dataset. For these data, we can either assign a virus type to the sequences or reject atypical samples. Those rejected sequences allow to speculate about new virus types with respect to nucleotide base mutations in the viral sequences. Moreover, this rejection analysis improves model robustness. Last but not least, the presented approach has lower computational complexity compared to methods based on (multiple) sequence alignment.The online version contains supplementary material available at 10.1007/s00521-021-06018-2. The coronavirus disease 2019 (COVID-19) caused by SARS-CoV-2 viruses, whose origin lies probably in Wuhan (China), is a severe respiratory disease . Yet theTherefore, an analysis of virus sequences is essential to understand the spreading and the behavior of the virus population. One aspect is to distinguish several types of the virus, which may force different symptoms and medical conditions. Thus, sequences have to be compared regarding their genomic structure. This can be done by alignment methods or by alignment-free approaches, both coming with pros and cons. Further, the sequences have to be distinguished or classified with respect to their virus types. For this purpose, interpretable models are favored in comparison with black-box approaches like deep networks, because a medical interpretation of the classification decision process is highly desirable. In fact, this could help to detect new virus variants.The analysis of the genomic structure by sequencing is currently topic of ongoing research to better understand the molecular dynamics . ObviousCoronaviridae possess a single-stranded, positive-sense RNA genome ranging from 26 to 32 kilobases in length and frequently are extremely similar [Viruses of the family  similar . Therefo similar . Further similar . The mol similar . Yet, SN similar . General similar , 86. The similar , 72.Frequent mutations in SARS-CoV-2 genomes are in the genes encoding the S-protein and RNA polymerase, RNA primase, and nucleoprotein. Applying a sequence alignment and similarity comparison using the Jaccard index, a method for monitoring and tracing SARS-CoV-2 mutations was established in . HoweverAlignment-based methods usually rely on variants of the Levenshtein distance , which, lgorithm  and for lgorithm , 68, wheN being the number of sequences and l is the uniform sequence length. Other alignment-based methods for SARS-CoV-2 data consider (multiple) longest common subsequences with similar complexity [In case of multiple sequence alignments (MSAs), the dissimilarity problem is NP-hard . Currentmplexity .Bag-of-Words , informmplexity  and the Distance , 40. Rectraction , 42, 92.traction , 95. Theinterpretable machine learning methods for clustering and classification [In the present publication, we investigate whether alignment-free dissimilarities are suitable for the identification of SARS-CoV-2 clusters/classes in combination with fication , 5. Thisfication , whereasAlthough deep neural network approaches provide impressive results in sequence classification , 69, 72,Therefore, we focus on applying prototype-based methods using alignment-free dissimilarity measures for sequence comparison. In fact, prototype-based machine learning models for data classification and representation are known to be interpretable and robust , 82, 93.In order to investigate SARS-CoV-2 viruses in terms of sub-type spreading, two virus sequence datasets were considered.Rhinolophus affinis. After preprocessing, 160 complete human sequences are obtained as described in [B and C are sequences obtained from A by two mutations: the synonymous mutation T8782C and the non-synonymous mutation C28144T changing a leucine to a serine. A further non-synonymous mutation G26144T changing a glycine to a valine lead from B to type C. In this sense, the classes (virus types) code implicitly the evolution in time of the virus.The first one, abbreviated by ribed in , where tIn our data analysis, we removed two sequences, whose accession numbers occur twice in the data record, and another two, which we identified as not human resulting in 156 final sequences. Additionally, we take the type/class information as label for the virus genome sequences and, hence, as reference. A detailed data description as well as complete list of sequences can be found in . The virThe complete data information is found in supplementary files S12 Data.The second dataset including 892 complete genomes has been selected from the National Center for Biotechnology Information (NCBI) Viral Genome database  and GenBRemark, although the SARS-CoV-2 virus is an RNA virus, the sequences provided by databases are given using the DNA coding. In the following, we take over this convention and do not explicitly refer to that later.Again, the complete data information is found in supplementary files S12 Data.Natural Vectors and Bag-of-Words.Several approaches were published to represent sequences adequately for alignment-free comparison. These methods range from chaos game representation to standard unary coding or matrix representations. An overview is given in , 94, 95.Natural Vectors (NV) for nucleotide sequence comparison are based on a statistical sequence description for the distribution of nucleotide positions within a sequence relative position of the kth nucleotide L in the sequence. Let r. With this convention, we get L. Further, we denote by L in the sequence. The kth centralized moment K for a sequence K and =A,C,G,T , 42. LetNatural vectors are usually compared in terms of the  used in .L. These weights have to be taken into account during the expectation value calculations [The NV description of sequences can also be applied to nucleotide sequences containing ambiguous characters (degenerate bases) collected in the extension set cument}E , 92. ThiBag-of-words (BoW) based on 3-mers, where the set S of words contains all possible 64 triplets defined by the nucleotide alphabet probability densities. If the latter constraint is dropped, we have discrete representations of positive functions. The assignments of the triplets to the vector components Another popular method to compare RNA/DNA sequences is the method =A,C,G,T , 21, 84.cross-entropy. Yet, other divergences like R\u00e9nyi divergences could be used [Obviously, comparison of those histogram vectors can be done using the usual Euclidean distance. However, motivated by the already mentioned density property, an alternative choice is to compare them by means of divergence measures . In the  be used . We refe be used  for a geThe assignment of the nucleotide triplets to the histogram dimension is found in supplementary material S13 Histogram Coding of Nucleotide Triplets.Median Neural Gas algorithm (MNG) is a neural data quantization algorithm for data compression based on (dis-)similarities [k-median centroid method improved by neighborhood cooperativeness enhanced learning, where k is the predefined number of representatives [k data points to serve as representatives of the data. Thereby, the data space is implicitly sampled according to the underlying data density in consequence of the so-called magnification property of neural gas quantizers [The larities , 16. It ntatives , 49. In antizers , 78.It should be emphasized that despite the weak assumption of a given similarity matrix, MNG always delivers exact data objects as representatives. Hence, any averaging for prototype generation like in standard vector quantizers is avoided here. This is essential, if averaged data objects are meaningless like for texts, music data, or RNA/DNA sequences, for example.Affinity propagation (AP) introduced by Frey and Dueck in [c-means or neural maps, where the number c of prototypes has to be chosen beforehand, AP starts assuming that all N data points are potential exemplars and reduces the number of valid prototypes (cluster centroids) iteratively. More precisely, AP realizes an exemplar-dependent probability model where the given similarities Dueck in  is an itk serves as prototype for data point i. The availabilities k is seen as a potential prototype for the points i.The cost function During the optimization, both kinds of messages are iteratively exchanged between the data by means of the alternating calculations according tording to .Hence, y ratios . The iter graphs , which cr graphs .The number of resulting clusters is implicitly determined by the self-similarities ustering . Common Learning Vector Quantization (LVQ) is an adaptive prototype-based classifier introduced by T. Kohonen [generalized LVQ [ Kohonen . A cost-ized LVQ . This coized LVQ . In partf and the classifier functionf is chosen as sigmoid: W to obtain an optimum prototype configuration in the data space.During the learning, the cost-based LVQ minimizes the expected classification error g (SGDL) , 57 of \\standard generalized LVQ (GLVQ). If both The dissimilarity x,w from  come intrding to  is not rnetworks .divergence-based GLVQ (GDLVQ). We refer to [The resulting LVQ variant is denoted as refer to  for furtm being the projection dimension usually chosen Generalized Matrix LVQ (GMLVQ) [Another popular choice is the squared Euclidean mapping distanceposed in  with thementclasspt{minima (GMLVQ) . Note thechnique .classification correlation matrix, i.e., the matrix entries i and j, which contribute to the class discrimination [After training, the adapted projection matrix mination , 77. Thuained in  are not Instead of the linear ested in  or impliested in , 80.self-controlled evidence (SCE) [A trained LVQ model can be applied to newly incoming data of unknown distribution. However, care must be taken to ensure that the model remains applicable and that there is no inconsistency with the new data. Therefore, each LVQ can be equipped with a reject option for the application phase , 29. If ce (SCE) . The thrIn fact, this reject option improves the robustness of the model .The method of stochastic neighbor embedding (SNE) was developed to visualize high-dimensional data in a typically two-dimensional visualization space . For thit-distributed SNE (t-SNE) was developed [Yet, SNE suffers from the fact that the distance densities in the original data space are frequently heavy-tailed , which leveloped .Alphabet A natural vector representation mentclass2pt{minimA BoW-representation for 3-mers is generated for each sequence Coding of all sequences of A, B, or C taken as class labels.Training data are all samples of For all LVQ variants, we take only one prototype per class.For GMLVQ, the projection matrix is chosen as W using the GLVQ for NV representation.Training of W and GDLVQ is not applicable for this sequence representation due to mathematical reasons.Training of W using the GLVQ for BoW representation.Training of W and Training of SGDL training as tenfold cross-validation to determine the best LVQ architecture for the given problem.W.W and If GMLVQ architecture is selected for final training: training of both Determination of the reject thresholds for each prototype for self-controlled evidence use based on the Final training of the best LVQ architecture with optimum training schedule to achieve best prototype configuration Training of LVQ-classifiers for lts from  obtainedCompression of the subset of 706 US sequences of March by MNG to achieve 50 representatives by MNG using 50 prototypes.Generating a balanced subset consisting of all China samples (63), all Europe samples (33), and USA samples (114) for cluster analysis. The US samples comprise the 50 representatives from MNG and all US samples from January and February. The samples from other regions are not considered for cluster analysis. We denote this balanced dataset extracted from Clustering and identification of stable cluster solutions using affinity propagation by means of the control parameter Clustering Classification of the Evaluation of the data rejected by the SCE rule.Classification of the In the following, we describe and motivate the steps of data processing and analysis. W containing one prototype per class and the mapping matrix According to the processing workflow, we trained several LVQ classifier variants for the entclass1pt{minimaThe list of rejected sequences is provided in supplementary material t-SNE as depicted in S5 Fig. The respective cluster centroids are visualized in S6 Fig.The clustering of the A, 95 data points to class B, and 2 data points to class C. According to the SCE decision, 59 data points were rejected from classification by the learned GMLVQ classifier. The result is given in S7 Fig using the t-SNE as visualization scheme. The visualization of the classification result by means of the Applying the trained GMLVQ classifier to the The distribution of the sequence data from the A, 293 data points to class B, and 20 data points to class C, whereas 495 data points are rejected according to the SCE rule. The class assignments are visualized in S11 Fig.The classification of the full The predicted virus type or the rejection decision for each sequence from The classification analysis of the ested in . Only seentclass1pt{minimaested in . Thus, wested in .This agreement, however, is obtained by alignment-free sequence comparisons. More precisely, the nucleotide-based BoW sequence coding delivers a perfect separation of the given classes for the learned mapping distance N of data, we have an overall complexity of l, we finally obtain an overall complexity of Yet, the computational complexity of a single dissimilarity calculation for the encoded sequences is only  methods , becauseFurther, because GMLVQ is an interpretable classifier, we can draw further conclusions from the trained model: The resulted classification correlation matrix utations , 28. TheFurther, the GMLVQ prototypes serve as class \u201cdetectors.\u201d If the encoded sequences are most similar to them with respect to the mapping distance, the sequences are assigned to the respective classes according to the WTA rule . Howevert-SNE visualization S7 Fig of t-SNE and AP implicitly reflect data densities in the data space. Class densities, however, do not have to coincide with the overall data density. Thus, the Application of the GMLVQ to the C for the C samples in the Comparing the class distributions of the sequences with respect to origins (regions) and collection dates for dings in . Thus, tWe observe from the visualization S11 Fig of the classification for the generalized matrix learning vector quantizer classifier model (GMLVQ) for a dataset with given virus type information, which was obtained by phylogenetic tree analysis [In this contribution, we investigate the application of interpretable machine learning methods to identify types of SARS-CoV-2 virus sequences based on alignment-free methods for RNA sequence comparison. In particular, we trained a analysis . GMLVQ sBy means of the trained GMLVQ, we first verified the SARS-CoV-2 virus types determined in this first dataset. Further, considering a classification correlation matrix delivered by GMLVQ optimization, we are able to identify features which contribute decisively to a type separation.Second, we applied the trained GMLVQ to another dataset obtained from the NCBI database without virus type information. Using the self-controlled evidence property of the GMLVQ, we are able to classify these sequences to the previously identified types, avoiding the application of the model to inconsistent data compared to the training data. Further, the rejected data allow speculations about new virus types with respect to nucleotide base mutations in the viral sequences.Yet, an appropriate training and data coding for successful GMLVQ application require a careful and precise data handling as well as model training regime, i.e., respective expert knowledge.Future work will consider the replacement of the WTA rule  by a fuzSupplementary material 1 (pdf 601 KB)Supplementary material 2 (XLSX 45KB)Supplementary material 3 (XLSX 10 KB)Supplementary material 4 (XLSX 25KB)Below is the link to the electronic supplementary material."}
{"text": "The purpose of this study was to evaluate annual incidence and burden of revision THAs and to project the future burden in South Korea.The annual number of hip arthroplasties is increasing combined with the aging population worldwide. In accordance with the increasing number of primary hip arthroplasties, the number of revision total hip arthroplasties (THAs) is expected to increase. The incidence and burden of revision THAs in the United States and have been reported by registry studies. To identify potential differences according to ethnics and regional practice, it is important to obtain data from East Asia. Nevertheless, there has been a lack of studies on the burden and future projection of revision THA based on a large-scale database in East AsiaWe identified primary THAs, primary hemiarthroplasties (HAs) and revision THAs, which were performed from 2010 to 2018, using database of Health Insurance and Review and Assessment (HIRA); nation-wide medical claim system of South Korea. The annual incidence rates  of primary THA, primary HA and revision THA, and the annual burden of revision THA; the number of revision THAs divided by the sum of primary hip arthroplasties and revision THAs, were calculated. The future burden of revision THAs were projected through 2030 using generalized linear model with Quasi-poisson regression.During the 9-year period, the annual incidences of primary THA, primary HA and revision THA increased by 47, 29 and 3%, respectively, while the revision burden decreased from 0.13 to 0.10. Compared to 2018, the annual incidences of primary THA, HA, and revision THA were projected to increase by 7.2, 2.3 and 1.1% per year, respectively, whereas the burden of revision THA was projected to decrease to 0.07 in 2030.Trends of revision THA in South Korea were similar with those of national registry studies from the United States. The annual incidence of revision THA has steadily increased, whereas its burden has decreased. Findings of our study could be used for epidemiological comparison between Western countries and East Asia as well as for the establishment of medical policies of revision THA in East Asian countries.The online version contains supplementary material available at 10.1186/s12891-021-04235-3. Total hip arthroplasty (THA) is one of the most effective orthopedic procedures and has been utilized as the treatment of choice for the patients with advanced osteoarthritis of the hip \u20134. HowevIn the United States, the annual number of revision THA has steadily increased, , 9 but tThere might be regional differences in the burden of revision THA according to ethnicity, implant design, fixation method; cemented versus cementless, and bearing surface .Number of studies outside the United States reported the annual incidence of revision THA \u201316. EpidNevertheless, there is lack of epidemiological study of revision THA in East Asia, which is necessary for regional comparison of the revision THA burden between Western countries and East Asia and for awareness of worldwide tendency.The purpose of this study was 1) to analyze the burden of hip arthroplasty including primary THA, HA and revision THA from 2010 to 2018 and 2) to provide a future projection of these procedures to 2030 in South Korea.This is a retrospective study using secondary register-based data analysis. The Korean Health Insurance and Review and Assessment (HIRA) database includes medical claims from entire South Korean institutions. Ninety-seven percent of South Korean population is obliged to register into the Korea National Health Insurance Program (KNHIP).The remaining 3% of the population is covered by the Medical Aid program, which is paid by the government. Data of patients under the.Medical Aid program are submitted to HIRA in the same manner as KNHIP. Therefore, the HIRA database included the entire South Korean population.The HIRA database contains demographics, diagnoses, procedures and prescriptions of all THA patients in South Korea.We identified primary THAs, primary HAs and revision THAs, which had been done from January 2010 to May 2014 in South Korea, using Electronic Data Interchange (EDI) codes of THA (N0711) and hemiarthroplasty (HA) (N0715).Since June 2014, the Korean National Health Insurance Service (NHIS) added complex surgical procedure codes  (N2070) and hemiarthroplasty-hip (complex) (N2710)) for the specific 21 complex conditions for reimbursement of an additional cost to the medical institute  and complex revision THA .The numbers and crude incidence rates  of THA, HA, and revision THA procedures were calculated according to age and gender. Annual incidence rate of each arthroplasty was calculated by dividing the number of each procedure at each year with corresponding year-specific South Korean population. The annual population data were acquired from database of the Korean Statistical Information Service. Then, the incidence rate per 100,000 person-year was calculated. The annual rates were stratified according to age and gender.The burden of revision THA was defined as the proportion of revision THAs to overall sum of hip arthroplasties; primary THAs, primary HAs and revision THAs . The futFrom 2010 to 2018, 87,213 primary THAs, 116,079 primary HAs, and 25,232 revision THAs were done in South Korea. The number of each surgery at each year is summarized in Table\u00a0During the 9-year period, the annual crude incidence of primary THA and that of primary HA increased by 47%  and 29% , respectively. Nevertheless, the annual incidence rate of revision THA remained stable at an average of 5.5/100,000   16,792 \u2013 27,451) and 18,384 , respectively, while the number of revision THA was predicted to be 3241 (95% CI 3042 \u2013 3454) in 2030  to national registry data of Australia, New Zealand, England, Wales, Sweden and Norway . In the As opposed to the study of Heckmann et al., Patel et al. reported an increase of revision THA burden in England and Wales from 0.09 in 2008 to 0.11 in 2012 .The annual incidence rate  of primary THA and revision THA increased from 101 to 134 and from 19.2 to 21.1 per 100,000 Danish inhabitants from 1996 to 2002, respectively. The incidence rates of primary THA and revision THA increased by 30 and 10% during the same period . In lineIn a previous study of THA epidemiology from South Korea, both the number and incidence rate of primary hip arthroplasty increased steadily from 2007 to 2011, but there was no significant change in the number of revision THA during the period .The worldwide trend of decrease in the burden of revision THA Table  means reThere might be some explanations for this decrease of the revision burden. First, surgical technique for primary THA has been improved with time . Second,The strength of our study was that the study is based on national registry data. The results cover nearly 100% of all hip arthroplasties in South Korea. Such data are only available in few countries. Our study was based on national registry data and has inherent limitation. We could not identify the reason of arthroplasty, type of original prosthesis, type of fixation; cementless versus cemented, bearings surfaces and the reason of revision surgery in patients undergoing revision THA, because of de- identification of the HIRA database.In this study, we confirmed an increase in number and incidence of revision THA as well as primary THA and HA from 2010 to 2018 in South Korea. The burden of revision THA in that period gradually decreased from 0.13 to 0.10, which was similar to reports from Western countries.Additional file 1. Complex conditions for reimbursement in arthroplasty in South Korea."}
{"text": "However, precise measures of symmetry are often difficult to formulate and apply in a meaningful way to biological systems, where symmetries and asymmetries can be dynamic and transient, or be visually apparent but not reliably quantifiable using standard measures from mathematics and physics. Here, we present and illustrate a novel measure that draws on concepts from information theory to quantify the degree of symmetry, enabling the identification of approximate symmetries that may be present in a pattern or a biological image. We apply the measure to rotation, reflection and translation symmetries in patterns produced by a Turing model, as well as natural objects . This method of symmetry quantification is unbiased and rigorous, and requires minimal manual processing compared to alternative measures. The proposed method is therefore a useful tool for comparison and identification of symmetries in biological systems, with potential future applications to symmetries that arise during development, as observed This article is part of the theme issue \u2018Recent progress and open frontiers in Turing\u2019s theory of morphogenesis\u2019. We see symmetry in virtually all forms of life, from single-cell eukaryotes like ydamonas  to complydamonas . Symmetrydamonas , the dynydamonas ,5 and thydamonas \u20138. Symmeydamonas ,10. Grouydamonas ,12.not possessed by the patterned state.A general mathematical theory for the role of symmetry in the formation of spatio-temporal patterns through nonlinear dynamical processes was developed, in part, through interactions between mathematicians and experimental fluid dynamicists . The speSymmetries in models consisting of coupled differential equations typically have one or more of the following consequences, as discussed in : multiplSymmetries are often approximate in biological settings and the quantification of asymmetry can, in conjunction with mathematical models, potentially provide useful insights into underlying regulatory mechanisms. Many biological studies do not explicitly provide a definition of symmetry, but instead assume that readers understand what is meant by, for instance, bilateral symmetry in flowers . Indeed,minima in the resulting TI function are then identified as approximate symmetries of the object. Moreover, the relative values of the TI measures at these minima provide a way to quantify deviation from perfect symmetry. While this approach can be automated, optimization of the images to enhance contrast and crop out neighbouring objects can improve identification of the approximate symmetries. We apply this measure to a number of test cases, and show that it correctly identifies fivefold symmetry in patterns produced by a Turing model, and approximate rotation and translation symmetries in organic objects including flowers and leaves. By quantifying the asymmetry of approximate symmetries in a system, this measure allows for comparison across diverse samples, and a method for identifying and quantifying changes in symmetries due to perturbation in an unbiased way.Here, we propose a measure of asymmetry that is grounded in concepts of entropy and information theory , and app. 2et al. [Methods for the quantification of asymmetry have appeared in a variety of contexts, ranging from automatic facial recognition  to quantet al. ,37 to quet al. ,39. A diet al.  or rotatet al. . The metTransformation Information has been proposed as a quantitative measure of symmetry breaking in the context of condensed matter systems . It linkIn order to define the transformation information-based measure of asymmetry, we first construct a positive-valued function, \u2061(pi/qi) ,41. One In practice, since we apply this measure to images, we use pixel intensities as a choice for the function equation  over the (a)In appendix A, we provide an algorithm for the application of TI to identify approximate symmetry in biological images. We summarize these steps in We consider a reaction\u2013diffusion system, numerically studied in \u201323, thatvided in .We use the numerical scheme proposed in  to solvea shows a fivefold regular pattern similar to the ones obtained in [figure 1a is already stored as an array of intensity values given that we numerically solve equations  of the method for identifying the coordinates of the image centre is not necessary and does not impact the results of the symmetry analysis.For the pattern shown in figure 1equation  and Step\u03bc=u+v in  as the sc provides an alternate representation of TI in the form of a polar plot (as in Step (4) of the algorithm). In both representations, we mark a peak of d, where blue indicates positive values and red indicates negative values. Such a minimum can be considered an approximate symmetry, with the deviation from perfect symmetry measured by the difference of TI from zero. The local maximum of TI, with d, corresponds to rotations by angles which can be considered least symmetric. The difference in intensities are large and the value of TI associated with these approximate antisymmetries can be useful in providing context for interpreting values of the measure associated with symmetries.Figure 1. 3The proposed method of identifying approximate symmetries can be applied to biological objects which can exhibit a variety of symmetry properties, for instance, objects which possess a left/right or anterior/posterior symmetry. This type of symmetry is called bilateral symmetry, where an object produces two mirror image halves when divided along an axis . For thiMeasures have been proposed to quantify the deviation between two halves in a bilaterally symmetric object such as a leaf ,30. In tbay leaf , we compa, which can be classified as having a strong degree of bilateral symmetry about the central vein. Although this central vein is not straight and the leaf may not be exactly divided along the horizontal in the image, we can attempt to detect the symmetry by considering a reflection about a horizontal line through the centre of the image. The deviation from perfect symmetry becomes more apparent in figure 2b, which shows the reflected image superimposed on the original image. Panel (c) quantifies the asymmetry using the difference in total pixel intensity between the image and its reflection, with red (blue) indicating higher values for the original (transformed) image.Consider the image of the leaf shown in figure 2c indicates that considering reflections about a slightly tilted axis may provide a better approach for bilateral symmetry. We therefore find a centre point using the algorithm described in appendix A and compute the TI for reflections about an axis with angle d shows the axis that minimizes TI (solid green) for axes within the dashed lines. The minimum TI is associated to an angle of approximately e.The difference in pixel intensity shown in figure 2f by thresholding on the greyscale image. We find a central point by equalizing the total area of the leaf above/below and left/right, and consider the SI for axes shown between the dashed orange lines in panel (f). The same angle of approximately h), although the centre points found by the two methods are not exactly in the same location.In order to compare the TI approach to the area-based SI measure of asymmetry proposed in , we alsofigure 2Micrasteria) shown in figure 3b. This cell consists of two semi-cells and is regenerating its smaller bottom portion after having previously divided. As with the bay leaf, the bilateral symmetry can be associated with a reflection, this time about a vertical line through the centre of the cell. Although the upper and lower sections of the cell have a similar structure, there is a clear asymmetry between the top and bottom with the top having longer cellular extensions and the bottom still regenerating. As a result, the line dividing the upper structure of the desmid from the lower structure does not fall in the centre of the organism. Thus, the upper and lower halves cannot be easily detected by considering reflection symmetries. The difference between the image of the desmid and its reflection about the central line is shown in panel (a). The difference for reflection about the line dividing the upper and lower halves is shown in panel (c). Since the differences are larger in panel (c), transformation-based methods have difficulty detecting the upper and lower structure in the image.Another example of bilateral symmetry can be seen in the microscope image of the freshwater unicellular desmid , there are a number of possibilities that would be interesting to explore as a way of extending this measure in a similar way. Spatially dependent transformations may also provide a path towards identification of the upper and lower portions of the desmid, e.g. one could consider transformations consisting of a reflection along with an appropriate rescaling of the portion of the image on one side of the reflection axis. See the discussion of . 4Pachypodium flower in figure 4a is used here to illustrate the identification of approximate rotation symmetries. The specimen has not been flattened before being photographed, so the non-planar curvature of petals adds to the asymmetry. Figure 4b shows the excess of red pixel intensity over the average pixel intensity across the three colour bands. The edge of the flower along with the centre have been manually identified with appropriately tuned thresholding on various combinations of the colour intensities in figure 4c. The longest distance from the centre to the petal edge is also marked in panel (c).The The flower has five petals that are approximately evenly spaced and similar in size. There is a clear reflection asymmetry to the petal morphology, and thus one might expect rotational symmetries but not reflection symmetries of an idealized model of the flower.c. We compute TI associated to rotations at 12 evenly spaced angles about centre points within a 500 by 500 pixel window near the centre of the flower, and downsample the image by a factor of 16. Figure 4e shows the search window within the image, with the middle of the d), provides a good measure for the quality of the symmetries for rotations. The motivation to consider this measure is that, for perfect symmetries, TI has very large amplitude of variation as a function of rotation angle (see \u00a72(a) and e. We also compare this to finding the centre by minimizing TI associated to reflections about horizontal and vertical lines passing through the search window, indicated by the green-circled e shows that the horizontal coordinate of the centre is well-approximated, presumably because the flower is aligned nearly optimally for vertical reflections to minimize TI. The vertical coordinate is further off , since there is no such alignment for vertical reflections. However, we do note a small local minimum in the TI associated to vertical reflections that is near the manually identified centre, indicated with the green dotted line in figure 4f. Lastly, we attempted the method of matching areas left/right and up/down, and indicate the result with a circled triangle in the search window. This provides a closer match than the reflection TI, but not as good as the rotation TI measure.We explore transformation-based automated methods for identifying the centre of the flower for rotations and reflections as compared to the manual identification shown in figure 4et al. [b). The symmetries detected as minima of this measure (which we denote by ZI) are the rotations associated to exact fivefold symmetry: We compute TI associated to rotations about the identified centre point by an angle re point . We compy et al.  (figure entified . By conta). The difference in pixel intensity between the transformed and original image for these two rotations are shown in figure 5d,e. Red in these images indicates higher pixel intensity for the original image, and the dashed lines indicate the location of the rightmost petal in the original and transformed images. Although the other rotation angles (c). The difference in pixel intensity between the reflection about f, with the dashed line indicating the axis of reflection.According to the local minima of the rotations (and \u221273\u2218 a. The di. 5a) of b), has a minimum at the centre which corresponds to the identity transformation (c) shows the absolute value of the Fourier spectrum of the deviation of We explore TI in the context of translation symmetry using the Turing model  and 2.32.3 on a a) of b)) and the Fourier spectrum (column panel (c)) show an associated increase in signal along the preferred We can induce a preferred direction by introducing a symmetry-breaking advection term of the form equation . For lar. 6minima in TI over the set of all transformations associated with potential symmetries. The minima in the TI function correspond to transformations exhibiting the highest degree of symmetry and are, therefore, considered the approximate symmetries with a lower TI value indicating that the symmetry is closer to exact. In addition, TI can be used to identify an optimal axis of symmetry for translation transformations, and optimal coordinates of the centre of the image for rotation transformations. These two features provide an advantage over current symmetry measures. In particular, current measures may introduce user error through identification of symmetry axes and landmark points on the boundary of the object of interest, both of which are determined algorithmically in the approach developed in this work. Importantly, the symmetry properties identified by the new measure were verified and shown to be reasonable for representative biological images and Turing patterns.In this study, we have developed an asymmetry measure based on transformation information (TI) and implemented it as a tool for identifying approximate symmetries in uni- and multicellular biological systems. The TI measure, originally proposed in the context of condensed matter systems, quantifies the difference between an object and its transformation associated with a symmetry of interest. In order to identify a set of approximate symmetries, we search for local b. There is a stem at the centre, with a series of opposing pairs of leaves moving outward in the image. The structure exhibits a fractal symmetry in leaf arrangement associated with rotation and rescaling of the image. Figure 7a shows TI for transformations that are a composition of rotation by an angle b), remains fixed under the identity transformation associated to c), (d). Panel (c) corresponds to the transformation with d) is associated to the transformation by We applied the new measure to a range of objects with distinct symmetry properties, including fivefold patterns produced by a Turing model, a bilaterally symmetric algal cell and leaf, and a pentamerous flower with rotational symmetry, thereby demonstrating the flexibility of the measure as well as its ability to reliably identify different types of symmetries. As an illustration that the TI approach applies beyond the symmetries commonly considered by other measures in the literature, we consider the cross-section through a catnip stem shown in figure 7The potential applications of this measure are broad, and especially suitable for analysis of objects under different conditions, e.g. TI can be used to quantify (i) the extent to which organic structures (such as leaves and flowers) manifest phenotypic plasticity in response to different environmental conditions, (ii) morphometric changes during ontogeny and growth, (iii) phenotypic transformations attending evolutionary transitions, (iv) pheno-type genetic variants within populations and (v) assessing pathological conditions.Symmetry is a ubiquitous feature of organic systems, and is often correlated with fecundity, survival and evolvability. The measure proposed here provides a robust and rigorous method for identifying approximate symmetries in any object, providing insights into fundamental structures and their properties. In addition, it can provide insights into the establishment of polarity through symmetry breaking in biological structures. It is worth noting that this measure provides an accurate description of symmetry phenomena in biological objects, but does not currently identify the corresponding symmetry-breaking mechanisms. While we primarily use the Turing reaction\u2013diffusion process as an example of a pattern formation mechanism here, many other mechanisms have been identified and studied in the context of biological development, i.e. mechanochemical , local a"}
{"text": "Aim: The aim of this study was to determine the health problems experienced by young adults after the COVID-19 vaccine. Method: This study is a quantitative and descriptive study and was completed with 590 undergraduate students studying at a state university in Central Anatolia in the spring semester of the 2021\u20132022 academic year. The data were collected by the researcher through a one-to-one interview with the students and a questionnaire prepared in line with the literature. Number, percentage and chi-square tests were used in the analysis of the data. Results: A total of 81.4% of the students participating in the study had the BioNTech\u2013Pfizer vaccine. A total of 67.3% of them had two doses of COVID-19 vaccine, 35.9% of the vaccinated students experienced some health problems in the days following the vaccination, and the most common health problems were fatigue, a cough, sleep disturbance, psychological discomfort, a heart ache feeling and sweating. Most of the post-vaccine health problems lasted for 2 days, 3.7% of the participants were diagnosed with hypertension, 2.7% were diagnosed with diabetes mellitus and 10.52% of the female participants went to the doctor due to menstrual irregularity and received treatment. It was determined that 12.2% of the vaccinated students gained weight after vaccination and 63.89% of those who gained weight attributed this to increased appetite, 9.2% continued to have a cough and 9.2% used herbal products. Conclusion: It was determined that one out of every three young adults experienced a health problem after the COVID-19 vaccine. It is recommended that studies be conducted in different sample groups. COVID-19 is a contagious disease caused by coronavirus 2 (SARS-CoV-2); it manifests itself ,4,5.The disease first occurs when the virus binds to the cell receptor into which it will enter. Then, the RNA of the virus enters the cell. COVID-19 has two stages that it must perform in the cell. The first is binding to the receptor, and the other is membrane fusion. These stages are assisted by the Coronavirus Spike Protein (CSP). The CSP is found both in the receptor of the target cell and in the envelope membrane of the virus. The disease is mainly airborne. Spike protein is found in all COVID disease species that can be transmitted to humans. The spike protein is a Type 1 transmembrane protein. The N-terminal side faces the extracellular space and the C-terminal side faces the intracellular space. As the infection begins, the spike protein is cleaved by furin to form Spike 1 and Spike 2. Spike 1 contains a receptor-binding domain. The receptor-binding domain allows COVID-19 to bind to the complementary peptide domain on ACE2. Spike 2 facilitates the fusion of viral and host cell membranes. Interventions made during all these events will cause the failure of the stages. The N-terminal or C-terminal domains of Spike 1 can serve as a receptor-binding area. COVID-19 uses its C-terminal domain to bind to ACE2. It has been stated that the dimerization of the ACE2 peptide domain allows two viruses to bind simultaneously and increases the viral load. Proteases, ions and pH have direct and indirect roles for membrane fusion. While calcium stabilizes the peptide structure fusion, zinc and magnesium do the opposite ,7,8,9,10The best way to prevent the disease is to prevent transmission. COVID-19 PCR tests are one of the most important tools in diagnosing the disease and preventing its transmission. However, poor sampling techniques, sample deterioration and contamination of samples cause false negative results. According to the results of seroconversion, disease states can be determined. This may be an indicator of false negative results ,12.Many different vaccine studies are still being carried out in the scope of combating COVID-19 around the world. All developed vaccines are reviewed by the WHO and those which meet the requirements are approved . AlthougHowever, there are not enough studies to determine the long-term effects of vaccines approved for emergency use, the level of vaccination and opinions about vaccines.However, it is a fact that vaccines protect against deaths due to communicable diseases and save the lives of at least 2.5 million people every year . DespiteHerd immunity occurs when a sufficiently large portion of the population becomes immune to a contagious disease . VaccineRecent vaccine studies are using different novel technologies, including the use of lipid nanoparticle mRNA, inactivated virus particles, DNA, nonreplicating viral vectors such as spike, receptor-binding domains of spike and viral nucleocapsids .The purpose of starting vaccination studies quickly during pandemics is to protect healthy people from disease, to prevent epidemics and to prevent deaths. However, until effective vaccine studies are completed, epidemics become pandemics and hospitalization and death rates increase exponentially. For this reason, some of the vaccines developed are approved for immediate use by the WHO and vaccinations are started. Some of the vaccines that have been approved for emergency use by the World Health Organization in the COVID-19 pandemic are used in Turkey. BNT162b2 (Pfizer\u2013BioNTech), Sinovac: CoronaVac and Turkovac vaccines are still used in Turkey .The Pfizer\u2013BioNTech vaccine has been recognized as the first mRNA-based vaccine authorized for human use for infectious diseases. As with all vaccines, various side effects may occur after vaccination. These side effects were determined as muscle discomfort, fatigue, headaches, fever, swelling, joint pain, tingling, itching and chills ,30.Synthetic mRNA-based vaccines provide adaptive immunity by essentially hijacking the cell\u2019s replication mechanism. For this, the vaccine genome needs to be delivered to ACE2 target cells with an excellent delivery vehicle. Recalibrated host cells produce viral antigens that trigger and stimulate an adaptive immune response through antibody production and T-cell response in exocytosis . HoweverTurkovac, on the other hand, was developed by the Presidency of Turkish Health Institutes (T\u00dcSEB) by starting phase I trials in 2020, and it has been included in the vaccine list after receiving approval for emergency use in Turkey at the end of 2021, and it is still being applied .The aim of this study was to determine the health problems experienced by young adult university students studying in the Central Anatolian region of Turkey after having the COVID-19 vaccine.This descriptive study was planned quantitatively with the participation of undergraduate students studying at a state university in Central Anatolia in the spring semester of the 2021\u20132022 academic year.p = 0.5, 1 \u2212 p or q = 0.5) of at least 384 students. An example of stratification was used, taking into account the number of students enrolled in the faculties. For the determined total number of 384 students, there were at least 54 from the Faculty of Medicine, 11 from the Faculty of Dentistry, 33 from the Faculty of Education, 27 from the Faculty of Engineering and Architecture, 54 from the Faculty of Health Sciences, 82 from the Faculty of Sport Sciences, 34 from the Faculty of Communication, 15 from the Faculty of Economics and Administrative Sciences. There must have been at least 21 students from the Faculty of Agriculture and Natural Sciences and at least 53 students from the Faculty of Theology.The population of the research consists of 6254 undergraduate students studying at a state university located in Central Anatolia. The sample of the study was determined by using a \u00b15% margin of error, a 95% confidence interval and sample rate size formula .COVID-19 Post-Vaccine Identification Form: It consisted of 29 questions to identify the health problems, if any, after COVID-19 vaccination and was prepared by the researchers in line with the literature.p values of \u22640.05 were considered statistically significant.The Statistical Package for the Social Sciences 21.0  program was used for statistical analysis. Frequency, mean, standard deviation and minimum\u2013maximum values were examined for descriptive analysis. A chi-square test was used to determine the differences between groups. The results were evaluated within the 95% confidence interval and Institutional permission from the relevant university and ethics committee approval from the Ethics Committee were obtained before starting the research (number: E-39243114-770-62444). The purpose of the study was explained to the individuals participating in the study and their written and verbal consent were obtained.Some demographic data of the students participating in the study are given in In p < 0.05). There was no statistically significant difference between income status, chronic disease status and health problems of the type of vaccine administered (p > 0.05) ( > 0.05) .COVID-19 is still in effect and continues to affect people\u2019s lifestyles. However, there are serious decreases in mortality and hospitalization rates due to herd immunity, which is caused by the availability of many different vaccines, vaccinating people and having the disease .Finding different vaccines with different technological methods has become easier with the analysis of the mechanism of action. However, the induction of proteases such as furin, the modification of subunits such as S1 and S2, and methods of adapting host cells to these vaccine technologies are considered to increase the possibility of the immune system encountering new unknown situations and health problems.There are three types of COVID-19 vaccines, one mRNA and two inactive, applied in Turkey. Vaccination rates have increased, and hospitalization and death rates due to COVID-19 have decreased despite the fact that the vaccination application is challenging and some precautions have been undertaken . COVID-19 measures have begun to be relaxed, and it can be said that it is almost back to the pre-pandemic period. In cases where the vaccine is so important, the talk of health problems with human interaction creates a negative effect, causing the vaccination rates to not increase sufficiently and rapidly.In this study, we aimed to determine the post-vaccine health problems in young university students who were administered one of the three types of COVID-19 vaccines administered in Turkey. A total of 54.90% of the participants in the study were men and the mean age was 20.74 \u00b1 2.32 years. The mean age of the participants in the study by Truong et al., (2022) was <21, and our study is consistent with studies conducted with young adults in the literature .In our study, 42.7% of the participants received expert information about the vaccine, and 73.01% of the expert information received was from the doctor. Mohamed et al., (2021) stated in their study that 38% of the participants received expert information. Our study is compatible with the literature on obtaining expert information about COVID-19 vaccines.Currently, three types of COVID-19 vaccines are used in Turkey. It was determined that the vast majority of the participants, 84.4%, had received the vaccine developed by Pfizer\u2013BioNTech. In addition, 67.7% received two doses and 16.6% received three doses. The World Health Organization recommended at least two doses of the COVID-19 vaccine. In their study, Okamoto et al., (2022) stated that 76.5% of the participants had two doses of COVID-19 vaccine. This result is compatible with the literature; it can be said that the recommendations of official authorities such as the World Health Organization and the Turkish Ministry of Health are taken into account among young people .A total of 35.9% of those who had been vaccinated reported health problems after vaccination. In studies in the literature, the incidence of health problems in vaccinated patients is between 30.6% and 59.2%. The literature supports our study findings. Mannan et al., (2020) reported in their study that the most common health problems were fever, a cough, sore throat, nausea and vomiting, shortness of breath, and diarrhea. Marshall et al., (2021) reported that acute myocarditis occurred in seven patients after receiving the BioNTech vaccine in their study. Moeller et al., (2021) reported in their study that psychological disorders were observed among children and young people who received the BioNTech vaccine. In our study, the participants who reported that there was a feeling of heart pain, but did not receive a diagnosis related to it, were 1% of the people who stated that they had health problems. In addition, it was determined that 0.7% of them had psychological disorders. These results revealed that the studies conducted after the vaccine showed similar health problems at almost similar rates, confirming each other ,37.It was determined that 19.05% of the post-vaccine health problems lasted for 1 day, 40% for 2 days and 19.05% for 3 days. Riad et al. (2021) reported that most of the local (94.2%) and systemic (93.3%) health problems improved within three days after vaccination, and these results are consistent with our study .In our study, participants stated that high blood pressure disease (3.7%), diabetes mellitus (2.7%) and menstrual cycle irregularity (4.7%) occurred after vaccination. Meylan et al., (2021) reported in their study that individuals who received BioNTech and Moderna vaccines experienced hypertensive events. Samuel et al., (2022) stated that hyperglycemia has been reported in some individuals receiving the BioNTech, Moderna, AstraZeneca and Janssen vaccines. In his study, Male (2021) reported that changes in the menstrual cycles of individuals with the COVID-19 vaccine were reported; however, how long they lasted and what may have caused them should be investigated in detail ,40,41. In our study, it was stated that 12.2% of the participants gained weight after vaccination and 63.89% reported the reason for the weight gain was due to increased appetite. Vaccine-induced weight gain and increased appetite have not been reported in the literature. It is thought that the results of the study will guide future studies.In addition, people have started to use various support products to strengthen the immune system during the COVID-19 pandemic. These include black seed and vitamins. A total of 70.37% of the participants in the study reported that they used vitamins. Saeed et al., (2022) reported in their study that cholecalciferol levels change inversely with the severity of the disease. Calder et al., (2020) stated in their study that long-term daily doses of vitamin D protect against acute respiratory tract infections. For this purpose, the reason for the use of supplemental vitamins can be explained ,43.In our study, it was determined that working status affected thinking about the vaccine. In order to enter the workplace in Turkey, the PCR test result has to be negative. Therefore, it can be evaluated that the working situation (a kind of necessity) may have influenced thoughts about getting vaccinated.Health problems were observed in 35.9% of the participants. At the same time, 67.2% of the participants had two doses of vaccine. It is considered that people who are hesitant about the vaccine due to health problems may take the next doses more easily because they do not have any health problems after the first dose of the vaccine or because their health problems last a short time. Thus, it has been determined that having at least two doses of vaccine affects the state of having health problems after vaccination. Income status and chronic disease status did not affect participants\u2019 thoughts about vaccination.A limitation of the study was that since the study was conducted in one region and with young adults only, it cannot be generalized to the whole population. It is recommended that larger studies are conducted with different age groups and different regions. All the data obtained from the study include the self-reports of the participants participating in the study.The COVID-19 pandemic, which continues rapidly all over the world, continues to affect vaccination studies, various restrictions and social life. The aim of this study was to determine the health problems experienced by young people, if any, after they have had the COVID-19 vaccines applied in Turkey.While some health problems are experienced with similar incidence in different countries where the same vaccine is administered, some health problems were reported for the first time in this study.The true long-term health problems related to vaccines will only be fully determined years after the date of administration. The limitation of our study is that it was only applied to young people. Studies with more participants will also help to determine if there are different health problems not mentioned in this study."}
{"text": "These new compounds formed two series according to the substitution of position 2 on the quinoxaline core, with chlorine or phenylacetylene respectively. Each of these isomers was evaluated for antiproliferative activity against neuroblastoma cell lines SK-N-SH and IMR-32 by MTT assay. All cell viability assay results were analyzed using R programming, as well as a statistical comparison between groups of compounds. Our evaluation showed no difference in drug sensitivity between the two neuroblastoma cell lines. Moreover, trans derivatives were observed to display better activities than cis derivatives, leading us to conclude that stereochemistry plays an important role in the antiproliferative activity of these compounds. Further support for this hypothesis is provided by the lack of improvement in antineoplastic activity following the addition of the phenylacetylene moiety, probably due to steric hindrance. As a result, compounds with nitrofuran substituents from the TDAE series demonstrated the highest antiproliferative activity with IC50 = 2.49 \u00b1 1.33 \u03bcM and IC50 = 3.96 \u00b1 2.03 \u03bcM for compound 11a and IC50 = 5.3 \u00b1 2.12 \u03bcM and IC50 = 7.12 \u00b1 1.59 \u03bcM for compound 11b against SK-N-SH and IMR-32, respectively. Furthermore, an in silico study was carried out to evaluate the mechanism of action of our lead compounds and predict their pharmacokinetic properties.The quinoxaline core is a promising scaffold in medicinal chemistry. Multiple quinoxaline derivatives, such as the topoisomerase II\u03b2 inhibitor XK-469 and the tissue transglutaminase 2 inhibitor GK-13, have been evaluated for their antiproliferative activity. Previous work reported that quinoxaline derivatives bearing an oxirane ring present antiproliferative properties against neuroblastoma cell lines SK-N-SH and IMR-32. Likewise, quinoxalines with an arylethynyl group displayed promising antineoplastic properties against glioblastoma and lung cancer cell lines, U87-MG and A549 respectively. Here, 40 new quinoxaline derivatives bearing an oxirane ring were synthesized using a tetrakis(dimethylamino)ethylene (TDAE) strategy and a Sonogashira cross-coupling reaction. Each reaction with TDAE furnished a pair of diastereoisomers  Neuroblastoma is a neuroendocrine tumor of the sympathetic nervous system that develops from immature nerve tissue cells called neuroblasts. With 90% of cases diagnosed under 5 years old, it is the most common extra-cranial solid tumor, and the 4th cause of cancer in children. Treatment options for this pediatric cancer rely on risk classification, depending on age at diagnosis and staging, among other factors, with surgery remaining the only effective treatment. The most threatening risk group, called \u201cHigh-risk Neuroblastoma\u201c, is a therapeutic challenge because of its frequent metastases at the time of diagnosis . This grQuinoxaline derivatives show a wide range of therapeutic properties such as anti-infectious ,13, antiAnother derivative of interest is the arylethynylquinoxaline GK-13, which demonstrated antiproliferative activity by inhibiting tissue transglutaminase 2 (TG2) , a ubiqu50 = 3.9 \u00b1 0.2 \u03bcM and IC50 = 5.0 \u00b1 0.9 \u03bcM for the most active compound, similar to the reference XK-469 (IC50 = 4.6 \u00b1 1.0 \u03bcM and IC50 = 13.0 \u00b1 2.9 \u03bcM) against neuroblastoma cell lines SK-N-SH and IMR-32, respectively +: 305.0452; Found: 305.0450.cis isomer 2b: yield: 42%, yellow solid, mp = 103 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.62 , 4.73 , 7.06 , 7.29 , 7.68\u20137.76 , 7.88 , 8.19 . 13C-NMR : \u03b4 (ppm) = 58.87, 59.31, 126.61 (2C), 127.84 (2C), 128.14 (2C), 129.21, 130.46, 130.98, 132.86, 140.34, 141.12, 145.68, 147.67. HRMS-ESI: m/z calcd for C16H11ClN2O [M+Na]+: 305.0452; Found: 305.0449.p-tolyl)oxiran-2-yl]quinoxaline (3)2-chloro-3-+: 319.0609; Found: 319.0606.4)2-chloro-3-{3-[4-(trifluoromethyl)phenyl]oxiran-2-yl}quinoxaline : \u03b4 (ppm) = 4.49 , 4.56 , 7.58 , 7.68 , 7.79\u20137.82 , 8.01\u20138.04 , 8.14\u20138.18 . 13C-NMR : \u03b4 (ppm) = 59.06, 60.29, 123.97 , 125.74 , 126.25, 128.30, 129.29, 130.82, 131.00 , 131.53, 140.01, 140.93, 141.67, 146.30, 148.14. HRMS-ESI: m/z calcd for C17H10ClF3N2O [M+H]+: 351.0507; Found: 351.0504.cis isomer 4b: yield: 48%, yellow solid, mp = 109 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.66 , 4.78 , 7.35 , 7.45 , 7.71\u20137.79 , 7.89\u20137.92 , 8.15\u20138.18 . 13C-NMR : \u03b4 (ppm) = 58.73, 58.83, 123.79 , 124.86 , 127.06, 128.21, 129.15, 130.30 , 130.70, 131.29, 137.02, 140.27, 141.24, 145.49, 146.91. HRMS-ESI: m/z calcd for C17H10ClF3N2O [M+H]+: 351.0507; Found: 351.0503.5)2-chloro-3-[3-(4-chlorophenyl)oxiran-2-yl]quinoxaline : \u03b4 (ppm) = 4.39 , 4.55 , 7.40 , 7.81 , 8.02\u20138.05 , 8.15\u20138.19 . 13C-NMR : \u03b4 (ppm) = 58.93, 60.55, 127.29 (2C), 128.27, 128.97 (2C), 129.27, 130.76, 131.41, 134.50, 134.74, 140.92, 141.60, 146.31, 148.41. HRMS-ESI: m/z calcd for C16H10Cl2N2O [M+Na]+: 339.0062; Found: 339.0059.cis isomer 5b: yield: 31%, yellow solid, mp = 113 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.58 , 4.73 , 7.05 , 7.24 , 7.73\u20137.78 , 7.90\u20137.92 , 8.16\u20138.18 . 13C-NMR : \u03b4 (ppm) = 58.72, 58.81, 127.99 (2C), 128.13 (2C), 128.22, 129.16, 130.63, 131.18, 131.45, 134.07, 140.29, 141.20, 145.55, 147.24. HRMS-ESI: m/z calcd for C16H10Cl2N2O [M+Na]+: 339.0062; Found: 339.0062.6)2-chloro-3-[3-(2-chlorophenyl)oxiran-2-yl]quinoxaline : \u03b4 (ppm) = 4.47 , 4.70 , 7.27\u20137.35 , 7.39 , 7.47 , 7.79 , 8.00\u20138.03 , 8.16\u20138.19 . 13C-NMR : \u03b4 (ppm) = 58.28, 58.95, 126.25, 127.21, 128.26, 129.32, 129.40, 129.61, 130.68, 131.37, 133.47, 134.11, 141.00, 141.67, 146.32, 148.37. HRMS-ESI: m/z calcd for C16H10Cl2N2O [M+Na]+: 339.0062; Found: 339.0062.7)2-chloro-3-[3-(4-fluorophenyl)oxiran-2-yl]quinoxaline : \u03b4 (ppm) = 4.40 , 4.56 , 7.12 , 7.44 , 7.79\u20137.84 , 8.02\u20130.06 , 8.17\u20139.21 . 13C-NMR : \u03b4 (ppm) = 59.00, 60.81, 115.93 , 127.85 , 128.42, 129.43, 130.88, 131.52, 131.85 , 141.11, 141.75, 146.46, 148.68, 163.25 . HRMS-ESI: m/z calcd for C16H10ClFN2O [M+Na]+: 323.0358; Found: 323.0351.cis isomer 7b: yield: 36%, yellow solid, mp = 98 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.60 , 4.72 , 6.77 , 7.27\u2013 7.29 , 7.71\u20137.78 , 7.90\u20137.92 , 8.16\u20138.18 . 13C-NMR : \u03b4 (ppm) = 58.83, 58.87, 115.03 , 128.28, 128.45 , 128.73 , 129.25, 130.68, 131.21, 140.40, 141.25, 145.69, 147.51, 162.59 . HRMS-ESI: m/z calcd for C16H10ClFN2O [M+Na]+: 323.0358; Found: 323.0358.8)2-chloro-3-[3-(3-fluorophenyl)oxiran-2-yl]quinoxaline : \u03b4 (ppm) = 4.40 , 4.56 , 7.12 , 7.42\u2013 7.46 , 7.80\u20137.83 , 8.02\u20138.06 , 8.16\u20138.20 . 13C-NMR : \u03b4 (ppm) = 58.94, 60.44 , 112.75 , 115.86 , 121.76 , 128.28, 129.30, 130.39 , 130.77, 131.44, 138.64 , 140.94, 141.64, 146.33, 148.34, 163.15 . HRMS-ESI: m/z calcd for C16H10ClFN2O [M+Na]+: 323.0358; Found: 323.0361.cis isomer 8b: yield: 38%, brown solid, mp = 128 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.61 , 4.75 , 6.72\u20136.78 , 7.02\u20137.10 , 7.71\u20137.78 , 7.89\u20137.92 , 8.17\u20138.20 . 13C-NMR : \u03b4 (ppm) = 58.71 , 58.74, 113.83 , 115.19 , 122.38 , 128.15, 129.22, 129.51 , 130.62, 131.17, 135.54 , 140.30, 141.18, 145.57, 147.16, 162.31 . HRMS-ESI: m/z calcd for C16H10ClFN2O [M+Na]+: 323.0358; Found: 323.0357.9)4-[3-oxiran-2-yl]benzonitrile : \u03b4 (ppm) = 4.51 , 4.55 , 7.58 , 7.73 , 7.82\u20137.85 , 8.05\u20138.07 , 8.17\u20138.19 . 13C-NMR : \u03b4 (ppm) = 59.22, 60.04, 112.70, 118.47, 126.59 (3C), 128.35, 129.31, 130.92, 131.67, 132.61 (2C), 140.94, 141.30, 141.76, 147.82. HRMS-ESI: m/z calcd for C17H10ClN3O [M+Na]+: 330.0405; Found: 330.0403.cis isomer 9b: yield: 38%, yellow solid, mp = 103 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.66 , 4.81 , 7.39\u20137.47 , 7.77\u20137.80 , 7.92\u20137.95 , 8.14\u20138.17 . 13C-NMR : \u03b4 (ppm) = 58.56, 58.76, 112.12, 118.30, 127.44 (2C), 128.28, 129.12, 130.85, 131.47, 131.68 (2C), 138.35, 140.22, 141.28, 145.42, 146.60. HRMS-ESI: m/z calcd for C17H10ClN3O [M+Na]+: 330.0405; Found: 330.0404.10)2-chloro-3-[3-(4-nitrophenyl)oxiran-2-yl]quinoxaline : \u03b4 (ppm) = 4.58 , 7.65 , 7.83\u20137.85 , 8.05\u20138.08 , 8.18\u20138.20 , 8.30 . 13C-NMR : \u03b4 (ppm) = 59.30, 59.82, 124.08 (2C), 126.75 (2C), 128.36, 129.32, 130.94, 131.72, 140.94, 141.79, 143.21, 146.29, 147.71, 148.27. HRMS-ESI: m/z calcd for C16H10ClN3O3 [M+Na]+: 350.0303; Found: 350.0298.cis isomer 10b: yield: 21%, yellow solid, mp = 220 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.71 , 4.84 , 7.53 , 7.76\u20137.81 , 7.91\u20137.94 , 7.97 , 8.15\u20138.18 . 13C-NMR : \u03b4 (ppm) = 58.44, 58.80, 123.13 (2C), 127.66 (2C), 128.28, 129.14, 130.90, 131.51, 140.21, 140.30, 141.30, 145.38, 146.48, 147.75. HRMS-ESI: m/z calcd for C16H10ClN3O3 [M+Na]+: 350.0303; Found: 350.0298.11)2-chloro-3-[3-(5-nitrofuran-2-yl)oxiran-2-yl]quinoxaline : \u03b4 (ppm) = 4.64 , 5.04 , 6.80 , 7.36 , 7.83\u20137.86 , 8.05\u20138.07 , 8.13\u20138.16 . 13C-NMR : \u03b4 (ppm) = 52.82, 58.30, 111.83, 112.68, 128.37, 129.21, 130.99, 131.77 (2C), 140.30, 141.62, 145.67, 146.03, 150.84. HRMS-ESI: m/z calcd for C14H8ClN3O4 [M+Na]+: 340.0096; Found: 340.0087.cis isomer 11b: yield: 27%, brown solid, mp = 157 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.62 , 4.91 , 6.38 , 7.01 , 7.82\u20137.86 , 8.03 , 8.20 . 13C-NMR : \u03b4 (ppm) = 53.34, 56.92, 112.35, 112.71, 128.36, 129.26, 131.01 (2C), 131.95, 140.81, 141.89, 146.40, 146.79, 152.46. HRMS-ESI: m/z calcd for C14H8ClN3O4 [M+Na]+: 340.0096; Found: 340.0092.12)ethyl 3-oxirane-2-carboxylate : \u03b4 (ppm) = 1.35 , 4.13 , 4.30\u20134.37 , 4.78 , 7.77\u20137.81 , 7.99\u20130.02 , 8.07\u20138.10 . 13C-NMR : \u03b4 (ppm) = 14.14, 54.42, 54.71, 62.18, 128.27, 129.30, 130.86, 131.81, 140.76, 141.80, 146.47, 146.86, 167.57. HRMS-ESI: m/z calcd for C13H11ClN2O3 [M+Na]+: 301.0350; Found: 301.0352.13)diethyl 3-oxirane-2,2-dicarboxylate (3): \u03b4 (ppm) = 1.03 , 1.36 , 4.11 , 4.35\u20134.41 , 5.04 , 7.75\u20137.83 , 8.00\u20138.02 , 8.07 . 13C-NMR : \u03b4 (ppm) = 13.79, 13.99, 58.83, 62.02, 62.16, 63.30, 128.33, 129.25, 130.90, 131.90, 140.26, 141.70, 145.38, 146.19, 163.04, 164.77. HRMS-ESI: m/z calcd for C16H15ClN2O5 [M+Na]+: 373.0562; Found: 373.0552.yield: 67%, yellow solid, mp = 64 \u00b0C. 1H-NMR  before being dried with sodium sulfate. Each compound was then purified by flash chromatography puriFlash\u00ae using an IR-50SI-F0040 regular silica column and a dichloromethane/cyclohexane gradient (40:60 to 60:40).To each quinoxaline of the previous series , dichlorobis(triphenylphosphine)palladium(II) (0.05 eq.) and cuprous iodide (0.1 eq.) dissolved in acetonitrile in a two-necked flask, were added triethylamine (10 eq.) and phenylacetylene (1.5 eq.). The reaction mixture was stirred for 2h at room temperature. Then, the mixture was extracted in dichloromethane (3 \u00d7 40 mL) and washed with H14)2-(phenylethynyl)-3-(3-phenyloxiran-2-yl)quinoxaline : \u03b4 (ppm) = 4.43 , 4.77 , 7.28\u20137.52 , 7.80 , 8.10\u20138.13 , 8.16\u20138.20 . 13C-NMR : \u03b4 (ppm) = 60.37, 61.07, 85.53, 97.04, 121.03, 125.94 (2C), 128.52 (2C), 128.78 (3C), 128.93, 129.32, 129.91, 130.72, 130.91, 132.21 (2C), 136.46, 138.63, 140.60, 141.68, 151.54. HRMS-ESI: m/z calcd for C24H16N2O [M+Na]+: 371.1155; Found: 371.1147.cis isomer 14b: yield: 80%, orange solid, mp = 125 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.65 , 4.93 , 7.07 , 7.29\u20137.31 , 7.47\u20137.50 , 7.70\u20137.75 , 7.98\u20138.00 , 8.15\u20138.18 . 13C-NMR : \u03b4 (ppm) = 59.24, 59.38, 85.37, 96.80, 121.35, 126.66 (2C), 127.80 (2C), 128.02, 128.77 (2C), 128.84, 129.22, 130.05, 130.45, 130.69, 132.23 (2C), 133.24, 138.08, 140.02, 141.17, 150.28. HRMS-ESI: m/z calcd for C24H16N2O [M+Na]+: 371.1155; Found: 371.1147.p-tolyl)oxiran-2-yl]quinoxaline (15)2-(phenylethynyl)-3-+: 363.1492; Found: 363.1488.16)2-(phenylethynyl)-3-{3-[4-(trifluoromethyl)phenyl]oxiran-2-yl}quinoxaline : \u03b4 (ppm) = 4.50 , 4.72 , 7.31 , 7.38\u20137.42 , 7.61 , 7.70 , 7.80\u20137.82 , 8.11\u20138.14 , 8.15\u20138.19 . 13C-NMR : \u03b4 (ppm) = 60.08, 60.62, 85.33, 97.14, 120.91, 124.02 , 125.79 , 126.18 (2C), 128.57 (2C), 129.00, 129.36, 130.09, 130.95 , 130.95, 131.06, 132.11 (2C), 138.61, 140.60, 141.82, 150.87. HRMS-ESI: m/z calcd for C25H15F3N2O [M+Na]+: 439.1029; Found: 439.1023.cis isomer 16b: yield: 83%, white solid, mp = 159 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.67 , 4.98 , 7.35 , 7.43\u2013 7.50 , 7.71\u20137.77 , 8.00\u20138.02 , 8.13\u20138.15 . 13C-NMR : \u03b4 (ppm) = 58.82, 59.19, 85.17, 97.01, 121.20, 123.84 , 124.81 , 127.09, 128.84 (2C), 128.92, 129.19, 130.20, 130.22 , 130.77, 130.95, 132.23 (2C), 137.37, 137.96, 139.97, 141.30, 149.53. HRMS-ESI: m/z calcd for C25H15F3N2O [M+Na]+: 439.1029; Found: 439.1024.17)2-[3-(4-chlorophenyl)oxiran-2-yl]-3-(phenylethynyl)quinoxaline : \u03b4 (ppm) = 4.41 , 4.70 , 7.30\u20137-40 , 7.77\u20137.79 , 8.09\u20138.12 , 8.13\u20138.16 . 13C-NMR : \u03b4 (ppm) = 60.35, 60.41, 85.44, 97.04, 120.98, 127.25 (2C), 128.57 (2C), 128.98, 129.01 (2C), 129.34, 130.03, 130.83, 130.98, 132.16 (2C), 134.63, 135.07, 138.61, 140.61, 141.75, 151.14. HRMS-ESI: m/z calcd for C24H15ClN2O [M+Na]+: 405.0765; Found: 405.0762.cis isomer 17b: yield: 58%, red solid, mp = 160 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.60 , 4.92 , 7.04 , 7.24 , 7.46 , 7.68\u20137.77 , 7.98\u20138.01 , 8.13\u20138.15 . 13C-NMR : \u03b4 (ppm) = 58.80, 59.17, 85.26, 96.92, 121.24, 128.03 (2C), 128.07 (2C), 128.81 (2C), 128.91, 129.20, 130.14, 130.65, 130.86, 131.82, 132.22 (2C), 133.95, 137.99, 139.98, 141.25, 149.86. HRMS-ESI: m/z calcd for C24H15ClN2O [M+Na]+: 405.0765; Found: 405.0764.18)2-[3-(2-chlorophenyl)oxiran-2-yl]-3-(phenylethynyl)quinoxaline : \u03b4 (ppm) = 4.65 , 4.77 , 7.28\u20137.44 , 7.53 , 7.79 , 8.10\u20138.13 , 8.16\u20138.20 . 13C-NMR : \u03b4 (ppm) = 58.77, 59.56, 85.45, 96.94, 121.18, 126.19, 127.26, 128.51 (2C), 128.97, 129.32, 129.46, 129.48, 129.88, 130.81, 130.93, 132.19 (2C), 133.55, 134.56, 138.64, 140.73, 141.83, 151.05. HRMS-ESI: m/z calcd for C24H15ClN2O [M+Na]+: 405.0765; Found: 405.0759.19)2-[3-(4-fluorophenyl)oxiran-2-yl]-3-(phenylethynyl)quinoxaline : \u03b4 (ppm) = 4.42 , 4.72 , 7.09\u20137.14 , 7.30\u20137.40 , 7.44\u20137.48 , 7.79 , 8.09\u20138.13 , 8.14\u20138.17 . 13C-NMR : \u03b4 (ppm) = 60.28, 60.46, 85.48, 96.95, 115.80 , 121.02, 127.68 , 128.57 (2C), 128.97, 129.34, 130.00, 130.80, 130.97, 132.16 (2C), 132.27 , 138.61, 140.63, 141.74, 151.27, 163.09 . HRMS-ESI: m/z calcd for C24H15FN2O [M+H]+: 367.1241; Found: 367.1234.cis isomer 19b: yield: 90%, brown solid, mp = 156 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.62 , 4.91 , 6.74\u20136.78 , 7.27\u20137.29 , 7.45\u20137.48 , 7.69\u20137.75 , 7.98\u20138.01 , 8.13\u20138.15 . 13C-NMR : \u03b4 (ppm) = 58.83, 59.12, 85.29, 96.86, 114.88 , 121.28, 128.39 , 128.80 (2C), 128.89, 128.99 , 129.19, 130.12, 130.60, 130.82, 132.22 (2C), 138.04, 139.99, 141.22, 150.03, 162.46 . HRMS-ESI: m/z calcd for C24H15FN2O [M+H]+: 367.1241; Found: 367.1236.20)2-[3-(3-fluorophenyl)oxiran-2-yl]-3-(phenylethynyl)quinoxaline : \u03b4 (ppm) = 4.62 , 4.94 , 6.72\u20136.77 , 7.03\u20137.10 , 7.46\u20137.49 , 7.69\u20137.75 , 7.98\u20138.01 , 8.14\u20138.16 . 13C-NMR : \u03b4 (ppm) = 58.80 , 59.10, 85.22, 96.91, 113.91 , 115.08 , 121.24, 122.40 , 128.80 (2C), 128.85, 129.25, 129.43 , 130.12, 130.64, 130.86, 132.23 (2C), 135.90 , 138.01, 139.98, 141.24, 149.78, 162.31 . HRMS-ESI: m/z calcd for C24H15FN2O [M+H]+: 367.1241; Found: 367.1233.cis isomer 20b: yield: 90%, brown solid, mp = 124 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.44 , 4.72 , 7.06\u20137.11 , 7.17\u20137.20 , 7.29\u20137.41 , 7.77\u20137.80 , 8.09\u20138.11 , 8.14\u20138.16 . 13C-NMR : \u03b4 (ppm) = 60.25 , 60.30, 85.44, 97.00, 112.68 , 115.71 , 121.00, 121.78 , 128.58 (2C), 128.97, 129.34, 130.00, 130.42 , 130.85, 130.98, 132.18 (2C), 138.63, 139.20 , 140.61, 141.77, 151.04, 163.22 . HRMS-ESI: m/z calcd for C24H15FN2O [M+H]+: 367.1241; Found: 367.1233.21)4-{3-[3-(phenylethynyl)quinoxalin-2-yl]oxiran-2-yl}benzonitrile : \u03b4 (ppm) = 4.57 , 4.90 , 7.34\u20137.42 , 7.49\u20137.53 , 7.74 , 7.92\u20137.95 , 8.12\u20138.16 . 13C-NMR : \u03b4 (ppm) = 59.37, 61.01, 86.04, 96.56, 111.78, 119.11, 120.69, 127.60 (2C), 129.12, 129.33 (3C), 130.89, 131.66, 131.99, 132.31 (2C), 133.11 (2C), 138.49, 140.22, 141.47, 142.61, 151.84. HRMS-ESI: m/z calcd for C25H15N3O [M+Na]+: 396.1107; Found: 396.1106.cis isomer 21b: yield: 86%, yellow solid, mp = 190 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.99 , 5.15 , 7.40 , 7.57\u20137.60 , 7.84\u20137.91 , 8.00 , 8.12\u20138.15 . 13C-NMR : \u03b4 (ppm) = 57.89, 59.72, 85.58, 96.83, 111.10, 118.81, 120.87, 127.76 (2C), 128.98, 129.30, 129.59 (2C), 131.04, 131.57, 131.87, 132.14 (2C), 132.78 (2C), 137.95, 139.67, 140.21, 140.96, 150.54. HRMS-ESI: m/z calcd for C25H15N3O [M+Na]+: 396.1107; Found: 396.1104.22)2-[3-(4-nitrophenyl)oxiran-2-yl]-3-(phenylethynyl)quinoxaline : \u03b4 (ppm) = 4.61 , 4.74 , 7.33 , 7.42 , 7.66 , 7.81\u20137.83 , 8.12\u20138.18 , 8.29 . 13C-NMR : \u03b4 (ppm) = 58.52, 59.16, 85.08, 97.14, 121.08, 123.06 (2C), 127.68 (2C), 128.89 (2C), 128.95, 129.15, 130.30, 130.96, 131.13, 132.24 (2C), 137.90, 139.87, 140.70, 141.34, 147.68, 149.09. HRMS-ESI: m/z calcd for C24H15N3O3 [M+Na]+: 416.1006; Found: 416.0997.cis isomer 22b: yield: 75%, yellow solid, mp = 210 \u00b0C. 1H-NMR : \u03b4 (ppm) = 4.71 , 5.02 , 7.50 , 7.70\u20137.78 , 7.96 , 7.99\u20138.01 , 8.10\u20138.13 . 13C-NMR : \u03b4 (ppm) = 59.71, 60.55, 85.27, 96.97, 120.89, 124.07 (2C), 126.69 (2C), 128.64 (2C), 129.02, 129.35, 130.17, 131.14, 131.18, 132.10 (2C), 138.62, 140.64, 141.89, 143.79, 148.19, 150.34. HRMS-ESI: m/z calcd for C24H15N3O3 [M+Na]+: 416.1006; Found: 416.0996.23)2-[3-(5-nitrofuran-2-yl)oxiran-2-yl]-3-(phenylethynyl)quinoxaline : \u03b4 (ppm) = 4.65 , 5.39 , 6.83 , 7.35 , 7.43\u20137.47 , 7.68\u20137.71 , 7.81\u20137.74 , 8.11\u20138.15 . 13C-NMR : \u03b4 (ppm) = 53.33, 57.35, 85.24, 97.49, 112.34, 113.32, 120.89, 128.69, 128.79 (2C), 129.06, 129.29, 130.29, 131.18, 131.30, 132.35 (2C), 138.90, 140.54, 142.02, 149.48, 152.62. HRMS-ESI: m/z calcd for C22H13N3O4 [M+Na]+: 406.0798; Found: 406.0794.cis isomer 23b: yield: 24%, red solid, mp = 150 \u00b0C. 1H-NMR : \u03b4 (ppm) = 5.55 , 6.05 , 6.75 , 7.24 , 7.47\u20137.52 , 7.79\u20137.86 , 8.02\u20138.05 , 8.16\u20138.19 . 13C-NMR : \u03b4 (ppm) = 36.92, 69.25, 84.82, 98.34, 112.04, 112.96, 120.69, 128.46, 128.89 (3C), 129.11, 130.46, 130.92, 131.23, 132.61 (2C), 137.22, 139.12, 142.10, 155.42, 156.33. HRMS-ESI: m/z calcd for C22H13N3O4 [M+Na]+: 406.0798; Found: 406.0792.24)ethyl 3-[3-(phenylethynyl)quinoxalin-2-yl]oxirane-2-carboxylate : \u03b4 (ppm) = 1.34 , 4.19 , 4.28\u20134.39 , 5.00 , 7.40\u20137.46 , 7.66\u20137.68 , 7.78\u20137.82 , 8.08\u20138.12 . 13C-NMR : \u03b4 (ppm) = 14.14, 54.84, 55.32, 62.10, 85.18, 96.99, 121.06, 128.66 (2C), 128.98, 129.36, 130.13, 131.10, 131.23, 132.34 (2C), 138.84, 140.55, 141.97, 149.48, 167.94. HRMS-ESI: m/z calcd for C21H16N2O3 [M+Na]+: 367.1053; Found: 367.1051.25)diethyl 3-[3-(phenylethynyl)quinoxalin-2-yl]oxirane-2,2-dicarboxylate (3): \u03b4 (ppm) = 1.05 , 1.31 , 4.15 , 4.30\u20134.39 , 5.32 , 7.38\u20137.44 , 7.66 , 7.73\u20137.80 , 8.04 , 8.08 . 13C-NMR : \u03b4 (ppm) = 13.83, 13.95, 59.56, 62.07, 62.22, 63.21, 85.00, 97.58, 121.03, 128.64 (2C), 128.99, 129.28, 130.16, 131.10, 131.33, 132.35 (2C), 138.85, 139.95, 141.80, 147.94, 163.24, 165.18. HRMS-ESI: m/z calcd for C24H20N2O5 [M+H]+: 417.1445; Found: 417.1445.yield: 84%, yellow solid, mp = 113 \u00b0C. 1H-NMR - 2,5-diphenyltetra-zolium bromide  assay according to our previous work .\u2122 RPMI-1640 Glutamax\u2122) supplemented with 10% fetal bovine serum (Lonza) and 1% penicillin-streptomycin 5000 U/mL (Fisher Gibco\u2122 Pen Strep) at 37 \u00b0C and 5% CO2. Cell cultures between 3 and 17 passages from defrosting were used for MTT assays.Neuroblastoma cancer cells, namely SK-N-SH  and IMR-32  cells, were purchased from the American Type Culture Collection and routinely maintained in standard RPMI 1640 (L-glutamine +) culture medium . The purity of all compounds was determined over 95%, before testing, by integrations on 1H-NMR spectra, and confirmed by UHPLC. Stock solutions were aliquoted and stored at \u221220 \u00b0C. For culture and experiments in living cells, the drugs were freshly diluted at an appropriate concentration in a culture medium.2 for SK-N-SH and 31,250 cells/cm2 for IMR-32 respectively) were detached with 20% trypsin Fisher Gibco\u2122  and seeded by 150 \u03bcL/well of a 96-well plate  for 24h for SK-N-SH, and 72h for IMR-32. The culture medium was then replaced by the same volume of freshly diluted drugs at an appropriate concentration , or fresh culture medium for control wells. These concentrations were diluted 2-fold for drugs with IC50 < 10 \u03bcM for more accurate IC50 determination. Each of the 6 concentration points of the dilution range was iterated 4 times. To avoid more than 4% DSMO at the highest concentration, which could have an impact on cell viability, the maximal tested concentration was 100 \u03bcM. After 72h of drug treatment, the medium of each well was replaced by 150 \u03bcL of fresh medium containing MTT at 0.5 mg/mL, and cells were incubated at 37 \u00b0C for 4h. Then, the MTT solution was removed and 150 \u03bcL/well of DMSO was used to dilute the formazan crystals formed by the mitochondrial reductase of surviving cells. Finally, absorbance was measured at both 550 and 600 nm with a POLARstar Omega BMG LABTECH  plate reader. At least three independent experiments (in quadruplicate) were performed, and data were expressed as mean \u00b1 SD.Exponentially growing cells ) and median (Equation (3)) allowing us to remove outliers with a 1.96 cut-off for 95% data accuracy [Outliers were identified by univariate analysis estimating location and scale. Thus, two accuracy .(2)zi=x50 was determined a by 4-parameter logistic regression fitting model using R package \u2019drm\u2019 [Y is the response, a is the lower asymptote, d is the upper asymptote, X is the concentration, c is the EC50, b is the slope factor of the curve.ICge \u2019drm\u2019 , as showge \u2019drm\u2019 , where Yp-values were calculated to quantify statistical significance, with the criterion set at p < 0.05. The IC50 obtained for each experiment was statistically analyzed first by the nonparametric Wilcoxon Mann\u2013Whitney test to compare the IC50 distribution between the cell lines, between cis isomers and trans isomers, and between TDAE and Sonogashira series. Secondly, we performed a nonparametric Kruskal\u2013Wallis one-way analysis of variance and finally a nonparametric post-hoc Dunn\u2019s test for pairwise comparison to assess whether the IC50 of each isomer from each series differs significantly with varying epoxide substituents. All these tests were performed in RStudio using the native \u201cR Stat Package\u201d and \u201crstatix\u201d package [Statistical analyses were performed using R programming.  package  for Dunn3 cube, and exhaustiveness to 64. The other parameters were adopted as the program\u2019s default values. Analysis of the results was performed by ranking the different ligand poses accordingly to their binding energy. We considered the molecule adopting the lowest energetic conformation as a promising compound. Visual analysis of the lowest energy solutions for each compound allowed us to identify the protein binding site. All the figures were drawn using the program ChimeraX.Crystal structures of human Topoisomerase II\u03b2 in complex with DNA (PDB code: 3QX3)  and huma\u00ae 10.3. Pharmacokinetic parameters were determined with GastroPlus\u00ae 9.8.2. From GastroPlus\u00ae, a compartmental model was repeated for each drug as an administration to a 70 kg fasted human with normal gut physiology in a 100 mg immediate-release tablet dosage form.The drug database for pharmacokinetic modeling was set up with MedChem Studio\u2122 4.0 from the Simulation-Plus software suite. Drug likeliness parameters were determined with ADMET Predictortrans derivatives were significantly more active than cis ones from both TDAE and Sonogashira series. Secondly, we evaluated the influence of the substitution of position 2 on the quinoxaline core. Combining the epoxide and the arylethynyl group within the same structure in the Sonogashira series improved the antiproliferative activity of 6 out of the 20 compounds synthesized in the TDAE series. Since this induced a loss of activity for the other quinoxaline derivatives, it seems to demonstrate that the activity of most compounds is negatively influenced by the steric hindrance from the 2-arylethynyl substituent. Thirdly, we evaluated the influence of a variety of substituents on the oxirane ring in both the TDAE and Sonogashira series. As in the previously described TDAE series [50 was observed for the derivatives on which the epoxide is substituted by 5-nitrofuran . Our analysis also revealed that the nature of the epoxide\u2019s substituent and the substitution pattern of the benzene ring can have a considerable impact on the antiproliferative activity of the synthesized compounds. Indeed, halogenated phenyl  and 5-nitrofuran 11 seem to be the most appropriate options from the TDAE series. Likewise, unsubstituted benzene 14, fluorinated phenyl 20, 5-nitrofuran 23, and carboxylate 25 are the most active compounds in the Sonogashira series.In this work, three chemical aspects of our synthesized compounds were evaluated. Firstly, we demonstrated the influence of stereochemistry on the antiproliferative activity of our compounds. The E series , the low50 against SK-N-SH and IMR-32, we could think that our compounds are not substrates of the P-gp which is an encouraging feature. Furthermore, most compounds are active against aggressive MYCN amplified cell line IMR-32, which is also an encouraging feature for further evaluations. In conclusion, we presented in this work multiple quinoxaline derivatives that display antiproliferative activity against resistant cell lines and aggressive ones. Moreover, we evaluated each compound against two neuroblastoma cell lines that were different in many aspects, more specifically by their expression of the efflux pump P-gp and the MYCN gene amplification. Since no significant difference could be demonstrated between ICFurther work will allow us to dig into the mechanism of action of these molecules. From our work, several hypotheses are made. From the similarity of structure with compounds XK-469 and CQS, which are both topoisomerase II\u03b2 inhibitors, we could think that our products have the same target. Based on the results of our molecular docking study and the structural similarity with compounds XK-469 and CQS, which are both topoisomerase II\u03b2 inhibitors, we were able to suggest that our products have the same target. Similarly, it allowed us to identify another potential target: the tissue transglutaminase responsible for tumor resistance. According to other oxirane ring carrier molecules described in the literature , other m"}
{"text": "Recently, we found that insulin protects neurons against excitotoxicity by decreasing the delayed calcium deregulation (DCD). However, the role of insulin in O2\u2013\u2022 production in excitotoxicity still needs to be clarified. The present study aims to investigate insulin\u2019s effects on glutamate-evoked O2\u2013\u2022 generation and DCD using the fluorescent indicators dihydroethidium, MitoSOX Red, and Fura-FF in cortical neurons. We found a linear correlation between [Ca2+]i and [O2\u2013\u2022] in primary cultures of the rat neuron exposed to Glu, with insulin significantly reducing the production of intracellular and mitochondrial O2\u2013\u2022 in the primary cultures of the rat neuron. MK 801, an inhibitor of NMDAR-gated Ca2+ influx, completely abrogated the glutamate effects in both the presence and absence of insulin. In experiments in sister cultures, insulin diminished neuronal death and O2 consumption rate (OCR). Glutamate excitotoxicity is involved in the pathogenesis of many disorders, including stroke, traumatic brain injury, and Alzheimer\u2019s disease, for which central insulin resistance is a comorbid condition. Neurotoxicity of glutamate (Glu) is primarily associated with hyperactivation of the ionotropic N-methyl-D-aspartate receptors (NMDARs), causing a sustained increase in intracellular free calcium concentration ([Ca The present study aims to investigate the effect of insulin on glutamate-induced O2\u2013\u2022 generation in cultures of rat cortical neurons, with an emphasis on the relationship between the dynamics of superoxide production and the increase in [Ca2+]i in single neurons in response to the application of exogenous Glu i and [O2\u2013\u2022], wherein intracellular [O2\u2013\u2022] includes both cytosol and mitochondrial superoxide. To investigate whether insulin can influence glutamate-evoked changes in intracellular Ca2+ and superoxide, neurons were treated with Glu (100 \u03bcM) in the presence or absence of insulin (100 nM), and the intracellular [O2\u2013\u2022] and [Ca2+]i dynamics were monitored for 30 min  and [O2\u2013\u2022] . Tukey\u2019s post-test showed that Glu-treated neurons had significantly higher levels of [Ca2+]i (p < 0.0001) and superoxide (p < 0.001 to p < 0.0001) compared to those of intact neurons. At 30 min after the addition of Glu, the mean levels of [O2\u2212\u2022] were significantly higher (p < 0.0001) compared to those in the intact control neurons. Insulin significantly decreased the Glu-evoked [Ca2+]i (p < 0.01 to p < 0.0001) and [O2\u2013\u2022] (p < 0.05 to p < 0.0001). At 30 min, superoxide production in neurons treated with insulin and Glu was 35% lower (p < 0.0001) than in neurons treated with glutamate alone. Primary cultured rat cortical neurons were coloaded with the low affinity fluorescent Car 30 min . Two-way2+]i and [O2\u2013\u2022], indicating a major role for NMDA receptors (p < 0.0001). There were no statistically significant differences in [Ca2+]i or [O2\u2013\u2022] between neurons treated with MK 801 and glutamate in the presence (p > 0.05) or absence of insulin (p > 0.05). These results suggest that NMDAR-gated Ca2+ influx is critically involved in the glutamate-evoked superoxide generation of superoxide in cortical neurons exposed to glutamate, regardless of the presence or absence of insulin. MK 801, a non-competitive NMDAR inhibitor, completely abolished Glu-induced increases in [Ca2+]i and intracellular superoxide levelsin neurons treated with glutamate in the absence of insulin (p < 0.0001) and in the presence of insulin  within a 30 min period of exposure to Glu. A significant Pearson linear correlation was found between the mean levels of [Ca2+]i and mitochondrial superoxide, respectively, and then treated with 100 \u03bcM glutamate in the presence or absence of 100 nM insulin . Rat cortical neurons were coloaded with Fura-FF and Mito-HE to simultaneously monitor changes in intracellular [Ca insulin . 2+]i  and mitochondrial superoxide levels . Bonferroni\u2019s post-test shows that insulin significantly diminished glutamate-evoked rise in [Ca2+]i (p < 0.05) and mitochondrial superoxide levels (p < 0.01 to p < 0.0001). At 30 min after treatment, the mean superoxide level in neurons treated with insulin and Glu was lower by 49% (p < 0.01) compared to neurons treated with Glu alone. There was a significant linear correlation between [Ca2+]i and superoxide levels for Glu-treated neurons in the absence of insulin (p < 0.0001) and in the presence of insulin . Two-way ANOVA with repeated measures revealed significant effects of time and insulin on glutamate-induced changes in both [Ca2+]i in neurons. Thus, taken together, these results suggest that insulin prevents the glutamate-induced increase both in intracellular and mitochondrial superoxide production by diminishing the Glu-dependent rise in [Ca2\u2013\u2022] generation and oxygen metabolism during excitotoxicity of Glu, we measured oxygen consumption rates (OCR) in cortical neurons exposed to Glu (100 \u00b5M) in the presence or absence of insulin (100 nM). Kruskal\u2013Wallis, followed by Dunn\u2019s multiple comparison test, revealed that Glu exposure reduced maximal respiration by 31% (p < 0.001) and spare respiratory capacity by 58% (p < 0.001) compared to control. In agreement with the data shown in 2+]i and [O2\u2013\u2022] levels are concomitant with the glutamate-induced decrease in maximal respiration and SRC. Insulin significantly attenuated the inhibitory effects of Glu on maximal respiration (p < 0.01) and spare respiratory capacity (p < 0.05) compared to Glu alone. Since the latter relates to the amount of extra adenosine triphosphate (ATP) that can be produced by oxidative phosphorylation in response to increased energy demand, the protective effects of insulin against a glutamate-evoked increase in [Ca2+]i and superoxide levels may be related to its preventive action against glutamate-induced impairment of mitochondrial bioenergetics, given that Ca2+, ATP, and superoxide exist in a network, with each able to control the others i and preventing the onset of DCD [2\u2013\u2022], the main sources of excitotoxic ROS in neurons , the inhibitory effect of insulin on [O2\u2013\u2022] accumulation appears to be related to its effect on [Ca2+]i dynamics.Correlations close to linear were observed between mean i and [O2\u2013\u2022], regardless of the presence or absence of insulin, indicating a pivotal role for NMDA-type ionotropic glutamate receptors (2+]i and [O2\u2013\u2022] showed that the growth of [O2\u2013\u2022] occurs synchronously with the onset of DCD in each cell. Cessation of Ca2+ entry into the cell with the help of MK-801 abolished the formation of [O2\u2013\u2022] (2+ in the buffer (not shown). These results are consistent with previous data on the key role of Ca2+ influx through NMDAR in ROS accumulation during glutamate excitotoxicity.MK-801, an inhibitor of NMDAR-dependent Caeceptors . Simultaf [O2\u2013\u2022] . Similar2+ influx . However, a contribution of mitochondrial superoxide production to total [O2\u2013\u2022] production cannot be quantified from Mito-HE and HE fluorescence data, as these probes have different rates of oxidation with superoxide i. Before DCD development, NMDAR-gated Ca2+ influx is counterbalanced with mitochondrial Ca2+ uptake and its efflux produced by the plasma membrane Ca2+-ATPase and the Na+/Ca2+-exchanger (NCX). The development of DCD and profound mitochondrial depolarization cancel Ca2+ uptake by mitochondria and reverse F1Fo-ATP synthase to glycolytic ATP-consuming ATPase i i in excitotoxicity. NCX  plays a for Ca2+ ,37. NCX- [Ca2+]i ,29,38,39the cell . Therefo2+]i and superoxide levels concomitantly with the decrease in SRC  . Insuline in SRC . Insulinepletion , where S2+]i, an increase in [ATP]i, and a decrease in mitochondrial and cytosolic superoxide formation. Short-term insulin exposure in our experiments appears to be relevant for in vivo conditions of intranasal insulin therapy. Intranasally managed insulin has been shown to reach a peak value in the rat brain 15 min after administration . The rap2+]i and (ii) decreasing the superoxide yield rate by the same increment in [Ca2+]i. The effects of insulin on glutamate excitotoxicity are associated with improved spare respiratory capacity and the ability to produce additional ATP due to oxidative phosphorylation. Given that generation of [O2\u2013\u2022] generation is considered to be causal for neuronal death, the prevention of the onset of oxidative stress with insulin appears to at least partially explain its neuroprotective action in glutamate excitotoxicity. We found that short-term exposure to insulin prevents glutamate-evoked superoxide generation in cultures of rat cortical neurons by diminishing the glutamate-induced rise in [Ca2+]i, was on average 32% and 46% lower in insulin-treated neurons, estimated using HE and Mito-HE. This suggests that the increase of [Ca2+]i, while necessary, is not the only factor affecting the magnitude of superoxide production. Given a recent finding that NMDAR-induced superoxide production requires non-ionotropic NMDAR signaling via PI3K, the inhibitory effect that insulin has on superoxide generation may perhaps be related to interference between insulin receptor i, cortical neurons were loaded with a low-affinity Ca2+ indicator, Fura-FF, in the form of acetoxymethyl ester  in the presence of a non-ionic detergent, Pluronic F-127 (0.02%) which was acquired from Molecular Probes  to facilitate the penetration of Fura-FF into the cells. We used the low-affinity calcium dye Fura-FF in the experiments because long-term exposure to high doses of Glu (100 \u00b5M) results in such a high intracellular calcium concentration ([Ca2+]i) that high-affinity probes, such as Fura-2/AM, are rapidly saturated with calcium and does not reflect true changes in [Ca2+]i [2+]i, including in experiments on Glu excitotoxicity [2+]i in different phases of OCD and presented corresponding images proving that Fura-FF AM penetrates well into the cell and is fairly evenly distributed in the cytosol. Mitochondria in cells (in neurons in particular) are able to accumulate Fura-FF only when using concentrations of Fura-FF/AM that are 2 orders of magnitude higher than those that are usually used to load cells. Therefore, mitochondria can only be loaded in a state isolated from cells.To measure [Ca [Ca2+]i ,35. Furas of Glu 0 \u00b5M resutoxicity ,29. Comptoxicity . In our s of Glu 0 \u00b5M resu2+]i occur in the cytosol, and Fura-2, which is widely used in research, is quickly saturated with calcium and does not reflect true changes in [Ca2+]i in the cytosol [2+]i and [O2\u2013\u2022], cells were loaded with 1 \u03bcM of dihydroethidium (HE) fluorescent probe or triphenyl phosphonium linked hydroethidine (Mito-HE) fluorescent probe, a.k.a. MitoSOX Red, for the last 20 min of the \u201cFura-FF/AM loading period\u201d in buffer at 37 \u00b0C. After loading, the cells were washed with saline of the following composition (in mM): NaCl\u2014135; KCl\u20145; CaCl2\u20142; MgCl2\u20141; HEPES\u201420; glucose\u20145, pH 7.4. Insulin, at 100 nM, was added 5 min before 100 \u03bcM glutamate in Mg2+ free. To wash out Glu, a nominally Ca2+-free solution was used to exclude any pathways for Ca2+ entry from the buffer into the cytosol in the post-glutamate period. To assess the amount of Ca2+ accumulated by mitochondria, mitochondria in the final part of the experiments were depolarized using the FCCP protonophore (1 \u03bcM). To calibrate the maximum signal of the Ca2+ indicator, ionomycin  in the presence of 5 mM Ca2+ was added at the end of the experiment. The solutions were changed 3 times, 1 mL each. The cells were incubated on a microscope stage at 24\u201325 \u00b0C . The Olympus IX-71 microscope was equipped with a 20x fluorite objective for measuring the fluorescence of various fluorescent probes. The light source is a Xenon arc lamp (175 W), the light of which alternately passes through interference filters installed in a computer-controlled wheel, which provides filter change in 50\u2013200 ms . A shutter between the lamp and the wheel with light filters block the radiation for the time when the signal is not recorded, preventing photo destruction of the object under study. The dichroic mirror reflects the exciting light toward the objective and transmits the radiation from the sample (colored cell) toward the detector. A lens focuses the excitation light on the sample and collects its fluorescence by directing it through a dichroic mirror to a detector. Cell fluorescence passed through the emission filter wheel, which was controlled synchronously with the excitation wheel. The image was detected using a CCD camera CoolSNAP HQ2 . The image analysis system was controlled with the MetaFluor 6.2 computer program . The recording signals from cell indicators and images were recorded every 30 s. Fura-FF fluorescence was excited alternately at 340 and 380 nm and recorded at 525 nm. HE and Mito-HE excitation/emission fluorescence were 565/610 nm. Cell fluorescence was normalized relative to basal levels in resting cells; the typical interval between the acquisition of successive images (time-lapse) was 30 s.Fura-FF was tested on neurons precisely because under the action of Glu, such high i. Given that superoxide causes neuron death, these results seem to explain the neuroprotective action of insulin in glutamate excitotoxicity. Insulin effects are also related to the improvement of spare respiratory capacity, the ability to produce additional ATP by oxidative phosphorylation in neurons during glutamate action.We found that insulin prevents glutamate-evoked intracellular and mitochondrial superoxides generation in primary cultures of rat cortical neurons by decreasing the glutamate-induced rise in [Ca"}
{"text": "Lacticaseibacillus rhamnosus JB-1, and Limosilactobacillus reuteri 6475 treatment and performed Gene Set Enrichment Analysis (GSEA) to identify enrichment in pathway activity. L. rhamnosus, but not L. reuteri treatment altered several pathways in the blood and hippocampus, and the rhamnosus could be clearly distinguished based on mRNA profile. In particular, L. rhamnosus treatment modulated the activity of interferon signaling, JAK/STAT, and TNF-alpha via NF-KB pathways. Our results highlight that psychobiotics can induce complex changes in host gene expression, andin understanding these changes, we may help fine-tune selection of psychobiotics for treating mood disorders.Discovery of the microbiota-gut\u2013brain axis has led to proposed microbe-based therapeutic strategies in mental health, including the use of mood-altering bacterial species, termed psychobiotics. However, we still have limited understanding of the key signaling pathways engaged by specific organisms in modulating brain function, and evidence suggests that bacteria with broadly similar neuroactive and immunomodulatory actions can drive different behavioral outcomes. We sought to identify pathways distinguishing two psychoactive bacterial strains that seemingly engage similar gut\u2013brain signaling pathways but have distinct effects on behaviour. We used RNAseq to identify mRNAs differentially expressed in the blood and hippocampus of mice following  Anxiety and depression are two of the most common mood disorders in the western world becoming increasingly prevalent in millennials and adolescents ,2. The CLacticaseibacillus rhamnosus JB-1, which has previously been shown to reduce anxiety and depression-like behaviours in mice [Numerous direct and indirect interactions between bacteria endemic to the gut, and the central nervous system characterize what is known as the microbiota-gut\u2013brain axis . The int in mice ,9,10.L. rhamnosus JB-1.It is incompletely understood how JB-1 facilitates these cognitive and behavioural changes, although both the peripheral nervous system and the immune system are critical mediators ,9,11. SpLimosilactobacillus reuteri 6475 (LR6475) is a probiotic bacteria that has previously been shown to modulate social behaviours; rescuing autism-spectrum-disorder-like social deficits induced by a maternal high-fat diet in mice [ in mice . Mechani in mice ,18. LR64 in mice ,20. Howe in mice . The reaHere, in an attempt to identify potential pathways distinguishing two psychoactive bacterial strains that seemingly engage similar gut\u2013brain signaling pathways but have distinct effects on behaviour, we compare transcriptomic changes in blood and hippocampus, a region of the brain responsible for memory and emotion and closely linked with depression ,23,24, fp-value = 0.049)  of normalized, filtered mRNA in the blood of mice shows no distinct groups between PBS and LR6475 fed mice; however, JB-1 fed mice differ greatly from the cluster PBS and LR6475-fed mice form along both PC 1 and 2 (adonis = 0.049) A. As the= 0.049) B and a f= 0.049) D; howeveTo elucidate additional sources of grouping along PC1 and 2 in the blood, Gene Set Enrichment Analysis was performed, comparing KEGG and Hallmark gene set expression in JB-1-fed mice to LR6475 and to PBS-fed independently. LR6475 and PBS-fed mice were not compared as their groups were not distinct in PCA. Many pathways from both KEGG and Hallmark were found differentially expressed in both directions, in both JB-1 comparisons, and are summarized in . All of p-value = 0.17)  A. Only 2 = 0.17) B. When c = 0.17) C,D; howep-value = 1.3 \u00d7 10\u22124) and LR6475-fed mice  compared to PBS-fed mice, and KEGG_VIBRO_CHOLERAE_INFECTION was enriched in PBS compared to LR6475 . With so few discerning features between individual gene expression and enrichment analysis, it remains unclear what is driving the distinction seen between PBS and the other treatment groups in the PCA. Additional PCs were checked (up to PC12) but none alone explain the distinction.Enrichment analysis of hippocampal mRNA following treatment was also poorly able to identify the source of PCA group distinction. No Hallmark pathways were found differentially expressed in any of the three comparisons. KEGG_RIBOSOME was enriched in the hippocampi of both JB-1  which relies on unsupervised clustering of genes to construct a network with modules of commonly co-expressed genes.Using a power of 13 for blood and merging at a threshold of 0.05, 24 eigengenes were identified and mapped to the cluster dendogram A. There For hippocampal mRNA, a power of 30 was used, and merging at a threshold of 0.04, 9 eigengenes were identified and mapped to a cluster dendrogram A. No staHere, we examined blood and hippocampal transcriptional changes induced by two lactobacillus species that have previously been demonstrated to have distinct effects on behaviour in mice ,10,16,21Immunomodulatory actions have been described for both JB-1 and LR6475 and in the case of JB-1 these have been demonstrated to mediate effects on behaviour ,9,10,16.We also observed marked changes in mRNA related interferon signaling with significant diminution of HALLMARK_INTERFERON_ALPHA_RESPONSE, HALLMARK_INTERFERON_GAMMA_RESPONSE, and HALLMARK_INFLAMMATORY_RESPONSE in the blood of mice treated with JB-1 in comparison to both PBS and reuteri 6475. The Interferons are known to play a role in the link between the immune system and mood disorders. INF-\u03b1 is used to treat hepatitis C and is associated with a 30\u201370% increased risk of emergent depression . InterfeHALLMARK_TNFA_SIGNALLING_VIA_NFKB was underexpressed in both JB1 blood comparisons. These are genes that are regulated by NF-KB in response to TNF-\u03b1. TNF-\u03b1 signaling through NF-KB has previously been shown to activate microglia and increase neuroinflammation in mice showing depression-like behaviour . Mice inFinally, FKBP12, one of the genes increased in expression in the blood of JB-1-fed animals compared to the other treatment groups, is a known inhibitor of mTOR signaling . This maThe Janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling pathway controls several processes in the cerebral cortex and hippocampus, including microglial activation, synaptic plasticity, gliogenesis, and neurogenesis ,46,47. HWithin all comparisons made, only two genes were significantly overexpressed in the hippocampus-TPPP3 and SGK1 which were altered in the JB-1 vs. PBS-fed comparison. Tubulin polymerization-promoting protein family member 3 (TPPP3) is a protein that regulates microtubule dynamics , and SerSeveral mRNAs were upregulated in the blood of JB1-fed mice compared to both LR6475 and PBS-fed mice. They were: FKBP1A, SNRPN, CELF4, GPM6B, APBB1, NCDN, RUNDC3A, CPE, and CLSTN1.Neuronal membrane glycoprotein gene (GPM6B) codes for a protein involved in bone formation and osteoblast function, as well as being a binding partner of the serotonin transporter (SERT) ,59. It hCarboxypeptidase E (CPE) codes for an exopeptidase that removes C-terminal lysine or arginine acids from peptides . Rodrigun = 118) compared to healthy subjects (n = 236) [Calsyntenin-1 (CLSTN1) codes for a protein that encourages vesicle association with KLC1 in axonal anterograde transport . CLSTN1 n = 236) . The mecn = 236)  confirmen = 236)  were colLacticaseibacillus rhamnosus JB-1 (2 \u00d7 10\u2079), Limosilactobacillus reuteri 6475 (2 \u00d7 10\u2079), or PBS . Mice were gavaged once per day for 2 weeks and sacrificed 3 h after the last gavage. Trunk blood was collected and whole brains were flash frozen and stored. Later, hippocampi of alternating side half brains were isolated and stored for RNA isolation.7\u20139-week-old male balb/c mice from Charles River Laboratories were orally gavaged with 200 \u00b5L of either Total RNA was isolated from fresh whole blood using a PureLink RNA mini kit for total RNA isolation and using the manufacturer-recommended protocol for whole blood extraction.Total RNA from hippocampi was isolated first by homogenizing the tissue with mortar and pestle in lysis buffer, followed by up-down pipetting through a 27-gauge syringe. After the tissue was completely homogenized, the same PureLink RNA mini kit was used to extract total RNA using the manufacturer-recommended protocol for tissue extraction.Four samples from each gavage group, totaling at 12 samples for blood and hippocampus, underwent paired-end RNAseq  on an illumina NextSeq for mRNA discovery and analysis.p-value < 0.05, and an |FC| > 1.5. p-values were adjusted using Benjamini\u2013Hochberg method [Raw RNAseq data were adaptor trimmed and aligned using the \u2018RNA-Seq Alignment\u2019 app in Illumina BaseSpace which uses the Spliced Transcripts Alignment to a Reference (STAR) alignment method with the USCS mm10 refseq gene annotation file . Next trg method .Percent variables and principal components were calculated using DESeq2\u2032s plotPCA function on the list of internally normalized and filtered genes, and then graphed using ggplot2 .p-values values generated by DESeq2\u2032s \u2018results\u2019 function were used by the generally applicable gage  package in R to generate enrichment results to the KEGG and Hallmark pathway gene sets [p-value < 0.05.Fold change and adjusted ene sets . KEGG paene sets  and showHere, we identified several pathways and genes that may be associated with JB-1, treatment that may plausibly be related to the effects of these organisms on behavior, summarized in . Some arThere are certain limitations to the current study. The brains used in the study were not perfused following collection, and therefore could contain a small amount of blood from within capillaries in the hippocampus. Furthermore, only male mice were used, there is evidence that the outcome of gut\u2013brain signaling can be sex dependent and thus sex comparisons would be worthy of examination in the future. This is particularly pertinent as in humans mental health disorders disproportionately affect women. Finally, WGCNA recommends 15 samples minimum for analysis and we performed the analysis with 12, which may have reduced the precision of the results.Overall, our results highlight that microbes labeled as psychobiotics, or potential psychobiotics, induce complex changes in systemic gene expression which are far from uniform between organisms. A better understanding of the many pathways impacted by individual organisms may help develop more tailored microbe-based approaches to specific mental health issues."}
{"text": "Patient satisfaction is an important quality indicator of health care service. The concept of home\u2010based palliative care has been recently introduced in Bangladesh, but the patients' satisfaction with this care remained unexplored. This study aimed to assess the satisfaction of the cancer patients receiving this care.This cross\u2010sectional study was conducted among 51 surviving cancer patients above 18 years of age registered under the home\u2010based care service of the Department of Palliative Medicine, Bangabandhu Sheikh Mujib Medical University, Dhaka, Bangladesh. Data were collected by face\u2010to\u2010face interviews using a structured questionnaire based on the FAMCARE P16 questionnaire from February to March 2019. Descriptive analysis was done for the sociodemographic and satisfaction\u2010related indicators. A correlation matrix was done to see the correlation among the satisfaction indicators.R\u2009=\u20090.814, p\u2009<\u20090.001). Also, satisfaction regarding the provision of information and support provided to the family is highly correlated .The majority of the patients (88.2%) were satisfied with the service provided by the home care team. Most (76.5%) of the patients were women, and the mean age was 56.25\u2009\u00b1\u200914.8 years. The median duration of getting home\u2010based care was 4 months. Main satisfaction indicators were\u2014assessment of physical symptoms (70.6%), providing information about pain management (70.6%), the inclusion of the family in decision making (76.5%), coordination of care between the members of the home care team (84.3%) and availability of doctors, nurses and palliative care assistants (74.5%). A high correlation was observed between satisfaction regarding the care of physical symptoms and provision of information (Despite the limitations, the overall satisfaction level of the patients regarding home\u2010based palliative care services in Bangladesh is very high. Home\u2010based palliative can be a solution to provide palliative care to patients who are unable to access institution\u2010based care and improve their quality of life. In Bangladesh, there are some isolated initiatives of providing home\u2010based palliative care have been taken. Approximately 0.6 million patients need palliative care in Bangladesh, but less than 4000 people have received this care until now.Patient satisfaction is one of the main indicators in assessing the quality of the service provided by the home\u2010care team. However, there is no such study done to assess the satisfaction level of cancer patients receiving this service. This study assessed the satisfaction with care in the cancer patients receiving home\u2010based palliative care in Bangladesh.22.1This cross\u2010sectional study was conducted amongst all surviving cancer patients currently registered under the Department of Palliative Medicine, BSMMU, Shahbag, Dhaka, Data collection was carried out in February and March 2019.2.2The home\u2010based palliative care service is provided by the Department of Palliative Medicine, BSMMU to the registered patients living within 20\u2009km radius of the university. The home care team consists of one doctor, two to three nurses, and five trained palliative care assistants (PCAs). They work 5 days per week. Patients who are unable to visit hospital due to physical condition, distance, financial constraints, or lack of caregivers are considered to be eligible for this service irrespective of their disease stage. This service includes wound care, adjusting medications, general physical and mental care and follow\u2010up, interaction with the caregivers to give temporary respite from their caregiving duties, as well as bereavement support. The PCA includes specially trained individuals who do the initial visits. They are involved in minor wound care, general physical care, helping the family caregivers, and listening to the patients' and their caregivers' problems. Doctors and nurses visit each patient once a week. They are involved in major wound care, adjustment of medication, and communication with the patients and their family members about which the PCAs cannot elaborate. The visits are need based. Usually, every patient gets two to three visits per month, although extra visits are given based on patients' condition and caregiver demand.Satisfaction is the fulfillment of the individual needs and expectations of the patients and their families, and is assessed by a two\u2010way communication between the receivers of the care and the provider of the care.2.3All the surviving cancer patients who registered under this service up to February 2019, above 18 years of age, willing to participate, and got at least three visits from the home care team were included in the study. Those who were delirious, disoriented, or unable to communicate were excluded. Those caregivers (paid or family members) who take care of the patients at least 5 days per week are included in the study. Occasional caregivers were excluded.2.4According to the Center of Palliative Care (CPC) database up to February 2019, the number of registered cancer patients receiving home\u2010based palliative care was 60. During data collection three patients died, four\u00a0patients were not eligible for the study due to delirium, and three\u00a0patients refused to give informed consent. So the final sample size of the study was 51.2.5The questionnaire had two major parts. The first part contained the sociodemographic, disease, treatment, and primary caregiver\u2010related information collected from the hospital record.The second part of the questionnaire contained questions from the FAMCARE P\u201016 questionnaire developed by Lo et al.2.6Initial data were collected from the hospital case sheets .The investigators accompanied the home care team to the patients' home, and the interviews were conducted in their presence. Informed consent was obtained from both the patients and their primary caregivers. Mini Mental State Examination (MMSE) was done to determine the consent\u2010giving capacity of the patient. The consent was obtained either in written or verbal form depending on the patients' condition.The patients and the caregivers were recruited in pair and were interviewed together. The duration of each interview was 30\u2009minutes to 1\u2009hour. Very frail patients were given multiple visits to complete an interview.2.7All data were analyzed by SPSS version 22.0 after editing and logical checking.Categorical variables such as sex, education, marital and occupational status, knowledge and belief about the disease prognosis, treatment, and side effects, the relationship of the primary caregiver with the patient were reported as frequency and percentage. Continuous variables such as age, monthly family income, duration of getting home\u2010based palliative care were presented in mean, SD, and median as appropriate. Number of satisfied patients with each component was presented in frequency and percentage.The level of satisfaction was presented in three categories based on mean and SD. The value below lower limit of mean\u2009\u2212\u20091\u2009\u2009SD was categorized as not satisfied, the range between upper and lower limit of mean\u2009\u00b1\u20091\u2009SD was categorized as satisfied and the value above mean\u2009+\u20091\u2009SD was categorized as very satisfied.p\u2009<\u20090.05 was considered as significant.Correlation matrix was done to see the correlation among the satisfaction indicators. 3The majority (76.5%) of the patients were women, and the mean age was 56.25\u2009\u00b1\u200914.8 years. More than half (58.8%) of the patients were married and lived with their partners. Almost 97% of the patients had family members as their primary caregivers, mostly their children (53.2%) or spouses (29.8%), and 57.6% of the primary caregivers were women. Common sites of the primary cancer were breast (39.2%), genitourinary system (23.5%), and gastrointestinal tract (17.6%). More than half (55.8%) of the patients had metastasis at the time of referral to palliative care, and 80% of them were currently only on palliative management. The median duration of receiving home\u2010based palliative care of the patients was four months (ranging from 6 days to 1 year) , providing information about pain management (70.6%), the inclusion of the family in decision making (76.5%), coordination of care between the members the home care team (84.3%) and availability of doctors, nurses and PCAs in the time of need (74.5%) Table .The majority of the patients (88.2%) were satisfied with the service provided by the home care team Figure .R\u2009=\u20090.814, p\u2009<\u20090.001), followed by satisfaction regarding the support given to the family . Also, satisfaction regarding the provision of information and satisfaction regarding the support given to the family were highly and significantly correlated \u00a0\u00a0Table .4Home\u2010based palliative care has been introduced recently in Bangladesh. This is the first study in Bangladesh assessing the satisfaction with the care of the patients' receiving such care.Measuring patients' satisfaction is important for evaluating the outcome of the care provided by the home care team. It gives valuable information about the patient's experience with the service, measures their compliance with the treatment, identifies the underlying weaknesses, and evaluates the performance of the home care team.The majority (80.4%) of the patients in this study are very satisfied with the attention given by the home care team members during the assessment of their sufferings. It indicates better communication between the home care team and the patients, where more than half (61%) of the patients attending government hospitals of Bangladesh show dissatisfaction about the health care providers' lack of attention to their symptom description.The majority of the patients in our study are very satisfied with the inclusion of family members in decision making (76.5%) and availability of the doctors and nurses in need (75.5%), in contrast to earlier studies where the main dissatisfaction arises from the long waiting time for the doctors and nurses in hospitals.One major limitation of this study is that this study was conducted on the home\u2010based palliative care service provided by a single institution, so the findings of the study cannot be generalized. Also the greater picture of home\u2010based palliative care in Bangladesh is not reflected in this study. Due to the cross\u2010sectional nature of this study, the perception of satisfaction among the patients cannot be measured over time.5Patient satisfaction is one of the important quality indicators of health care service. Despite the limitations, overall satisfaction on the care provided by the home care team is high. As home\u2010based palliative care continues to develop, further research is needed to evaluate the satisfaction level of the patients over time.Jheelam Biswas: Conceptualization; data curation; formal analysis; investigation; methodology; project administration; resources; software; validation; visualization; writing\u2013original draft; writing\u2013review and editing. Mithila Faruque: Conceptualization; formal analysis; project administration; software; supervision; validation; writing\u2013original draft; writing\u2013review and editing. Palash Chandra Banik: Conceptualization; data curation; formal analysis; methodology; project administration; software; supervision; validation; writing\u2013original draft; writing\u2013review and editing. Nezamuddin Ahmad: Funding acquisition; resources; supervision; validation; writing\u2013original draft; writing\u2013review and editing. Saidur Rahman Mashreky: Conceptualization; formal analysis; methodology; supervision; validation; visualization; writing\u2013original draft; writing\u2013review and editing.The authors declare no conflict of interest.Ethical approval for both the research and consent procedure  was obtained from the Ethical Review Committee, Bangladesh University of Health Sciences (BUHS), and permission for data collection was obtained from the Department of Palliative Medicine, BSMMU. The written informed consent was taken from all the eligible patients and their primary caregivers. As they were terminally ill patients, their health conditions were considered during data collection.The lead author Jheelam Biswas affirms that this manuscript is an honest, accurate, and transparent account of the study being reported; that no important aspects of the study have been omitted; and that any discrepancies from the study as planned  have been explained.Supporting information.Click here for additional data file.Supporting information.Click here for additional data file."}
{"text": "In 10% of term deliveries and 40% of preterm deliveries, the fetal membrane (FM) ruptures before labor. However, the ability to predict these cases of premature rupture of membranes (PROM) and preterm premature rupture of membranes (PPROM) is very limited. In this paper, our objective was to determine whether a prediction method based on T2 weighted magnetic resonance imaging (MRI) of the supra-cervical FM could predict PROM and PPROM.This prospective cohort study enrolled 77 women between the 28th and 37th weeks of gestation. Two indicators of fetal membrane defects, including prolapsed depth >5\u00a0mm and signal abnormalities, are investigated for our prediction. Fisher\u2019s exact test was used to determine whether prolapsed depth >5\u00a0mm and/or signal abnormalities were associated with PROM and PPROM. The sensitivity, specificity, positive predictive value, negative predictive value, and accuracy were calculated for prolapsed depth >5\u00a0mm, signal abnormalities, and the combination of prolapsed depth >5\u00a0mm and signal abnormalities.Among 12 women with PROM , 9 had membrane prolapse >5\u00a0mm and 5 had FM signal abnormalities. Among 65 women with rupture of membranes at term, 2 had membrane prolapse >5\u00a0mm and 1 had signal abnormalities. By Fisher\u2019s exact test both indicators, membrane prolapse >5\u00a0mm and signal abnormalities, were associated with PROM  and PPROM . Additionally, membrane prolapse >5\u00a0mm, signal abnormalities, and the combination of the two indicators all demonstrated high specificity for predicting PROM  and PPROM .in vivo and may be able to identify women at high risk of PPROM.MRI can distinguish the supra-cervical fetal membrane  During pregnancy, the developing fetus is surrounded by the amnion and chorion, collectively called the fetal membrane (FM). In a healthy pregnancy, the FM remains intact until delivery at term, when the rupture of membranes (ROM) occurs either naturally during labor or is induced by the physician. However, in 10% of term deliveries the FM ruptures before labor onset, which is defined as a prelabor rupture of membranes (PROM) . Participants were included if they were age 18 years or older and had a healthy singleton pregnancy. Participants were excluded if they had a twin pregnancy, contraindications to MRI, BMI over 40, major fetal anomalies, placenta implantation, or cervical cerclage. Between April 2017 and Feb 2020, 82 pregnant women were enrolled in the original study in the Department of Obstetrics and Gynecology Outpatient Clinic at Washington University School of Medicine. Written informed consent was obtained from each participant, including consent to future research. For the prospective cohort study, MRI images of the pelvis were collected at multiple time points during pregnancy. For this study, we used the last examination for each patient, performed between the 28MR images were acquired with a 3.0 Tesla unit . Patients were imaged in the left lateral position with their feet entering the magnet bore first. A 30-channel phased-array torso coil covered the entire pelvis. Each subject underwent MRI sequences that included axial and oblique sagittal planes T2 weighted (T2W) half-Fourier acquisition single-shot turbo spin-echo sequence images. The scanning parameters were as follows: repetition time 1800 ms, echo time 94 ms, matrix 320\u00d7650, layer thickness 4.0\u00a0mm, slice spacing 0.8\u00a0mm, number of layers 30, flip angle 140\u00b0. The axial and oblique sagittal T2W scanning fields of view were 400\u00d7400 mm and 350\u00d7350 mm, respectively. The total scanning time for T2WI was 3 minutes.RadiAnt DICOM viewer \u00a0was used to assess MR images of the cervix and FM. The images were analyzed without knowledge of pregnancy outcomes by two radiologists (W. Q. and W. W.) with 10-year and 1-year of experience in abdominal MRI, respectively. In order to examine the observer variability, the images were independently and blindly analyzed by the two observers at two different times with a minimum 60-day interval. The consensus was reached through in-person discussion and review in cases of disagreement.\u00a0The following parameters of the FM overlying the cervix were evaluated: a prolapsed depth >5\u00a0mm, defined as a protrusion of amniotic membranes into the internal cervical os by greater than 5\u00a0mm from the shoulder of the original internal os as measured along the lateral border of the funnel Figure\u00a01Clinical data recorded included the following: age, parity, last menstrual period dates, medical disorders, and past obstetric outcomes. Current pregnancy information collected included whether or not cerclage was placed, whether or not the woman was treated with progesterone, and any antepartum complications. Hospital records were reviewed after delivery to determine pregnancy outcome. The principal outcome was PROM, which included any rupture before labor . PPROM i\u00ae\u00a0v. 19.0 for Windows\u00ae\u00a0 and GraphPad Prism . Intra- and inter-observer agreements were calculated by means of the kappa index (\u03ba). Reliability\u00a0is rated as \u2018moderate\u2019 for values between 0.41\u20130.60, as \u2018substantial\u2019 for values between 0.61\u20130.8 and as \u2018excellent\u2019 for values above 0.80 .The\u00a0pregnancy outcomes were as follow: 12 women had PROM , and 65 women had term ROM  and PPROM . The abilities of these measures to predict PROM and PPROM are presented in\u00a0This study provides evidence that two FM indicators derived from MRI can be used to predict PROM and PPROM. This is the first study to demonstrate the feasibility of using MRI to assess supra-cervical FM. These two MRI features, membrane prolapse >5\u00a0mm and FM signal abnormalities, reflect the membrane stretch under unbalanced load and/or pre-weakened FM, and likely indicate the increased risk of PROM and PPROM.in vivo before delivery to the FM surface area ex vivo after delivery revealed that the FM is stretched in vivo by approximately three-fold and is under approximately 15 mmHg pressure . Nonetheless, our study identified two potential MRI-based risk factors of FM rupture: pre-weakened FM, as reflected by signal abnormalities, and abnormal stretch force upon FM, as reflected by FM prolapse. This study suggests that clinical MRI can be used to identify women at increased risk of PPROM. Further\u00a0studies\u00a0with larger sample sizes are\u00a0needed\u00a0to evaluate the reproducibility of our findings and provide information for future comparative\u00a0effectiveness\u00a0and\u00a0cost-effectiveness\u00a0studies. Moreover, further MRI analyses may be able to identify women at high risk of PPROM, so as to provide appropriate antepartum surveillance and antenatal treatment.The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.The prospective cohort study and this study were approved by the Washington University in St. Louis School of Medicine Institutional Review Board . The patients/participants provided their written informed consent to participate in this study.WQ and PZ designed the experiment. WQ and WeiW evaluated magnetic resonance images. ZS, WenW, PW, and QW collected the data and aided in preparation of the manuscript. RM co-supervised the research. YW obtained funding for the project, supervised the work, and participated in preparation of the manuscript. All authors contributed to the article and approved the submitted version.We thank Deborah Frank for editing the manuscript. We also thank Jessica Chubiz and Megan Steiner for coordinating the clinical team to enroll patients.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Small and Medium Enterprises (SMEs), as productive economic businesses, have a vital role in the economy. The role of SMEs in various countries, especially in third world countries, including Indonesia, is undoubtedly one of the supporting sectors of the economy  of the total business actors in Indonesia; on the other hand, large businesses only have a share of 0\u20130.01% or about 5,400 units. In terms of employment, micro-businesses absorb around 107.2 million workers (89.2%), small businesses 5.7 million (4.74%), and medium enterprises 3.73 million (3.11%) . However, this increase occurred in the medium business classification at 7.51% (yoy) compared to the previous quarter at 5.5% (yoy). Meanwhile, micro and small enterprises each slowed down by 12.7% (yoy) and 10.4% (yoy) compared to the previous quarter's growth of 13.6% (yoy) and 10.8% (yoy), respectively. Based on business classifications, most of the SME loans were channeled to medium-sized business loans, namely 44.5% and the rest for small businesses at 30.1% and micro enterprises at 25.4%.Based on the results of research conducted by Bank Indonesia, it was identified that one of the constraints of banking in extending credit to SMEs is the limited banking information regarding SMEs that are potential and their eligibility, as well as low levels of financial literacy in SMEs, which have an impact on credit absorption by the banking sector. To improve this performance, it is necessary to increase the knowledge, financial literacy, and decision-making abilities of SME entrepreneurs. Hence, this study aims to develop an empirical model of strategies for improving the organizational performance of SMEs as part of improving company performance to build economic resilience in Indonesia.The development of SMEs cannot be separated from their financial management problems. In running a business, of course, good financial management is needed through good knowledge and skills, which, in this case, there are not many SME players who can make it happen. The majority of SMEs are run by families with a lack of financial stability and difficulties in resolving the problems at hand. SMEs tend to lack the resources to exploit technology, resulting in low efficiency, cannot follow existing best practices, and cannot carry out further analysis to measure their performance. The need to increase knowledge for SMEs is a must to improve performance, financial performance, and overall organizational performance, create innovations, and solve problems faced.Every business organization needs to have knowledge management capabilities to improve its learning competencies (Liao et al., One of the knowledge capabilities that need to be improved and the most important thing related to improving SMEs' financial performance is increasing financial literacy. One of the obstacles for banks in extending credit to SMEs is the limited information from the banking sector regarding these SMEs' potential and feasibility. Increasing financial literacy will impact credit absorption by banks, considering that not all SMEs can take advantage of financial products and services. Strategies to increase financial literacy will also help SMEs in business management, starting from budgeting, planning for saving business funds, and overall financial performance. Furthermore, organizational learning ability through problem-solving activities is one of the most important strategic dynamic abilities (Purwanto et al., For this reason, success to improve the performance of SMEs requires a series of several interrelated variables and influences, starting from the knowledge management capabilities possessed, the level of literacy, which is to improve performance, is mediated by abilities both in terms of creativity, and speed in solving any problems that are encountered. This relationship can be illustrated in This study finds a relationship and a new working model that to improve the organizational performance of SMEs, good financial literacy and knowledge capabilities are required to be mediated by creativity and speed in problem-solving. Improving the performance of SMEs from the financial aspect is not always resolved by assisting in the form of loans, but it requires the ability of SMEs to manage and use them (Prahiawan et al., The model confirms the impact of knowledge management capabilities on organizational performance, consisting of financial and non-financial performance. It is essential to emphasize that both knowledge and innovation are fundamental things that are useful for solving problems, and, if implemented effectively, efficiently, and sustainably, can be used as a competitive advantage. On the other hand, in case we face new problems, and beyond our knowledge, the tools we can rely on are our cognitive abilities, especially our creativity.All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Objectives: The central sterile supply department (CSSD) provides sterile perineal care sets (SPC sets) for use with patients. However, the SPC sets exceed the standard, and the sterilization process incurs high cost. Therefore, a CSSD nursing team set out to find ways to save costs by providing clean perineal care sets (CPC sets) instead of sterile sets. We examined the rate of catheter-associated urinary tract infection (CAUTI) after using CPC sets, measured the satisfaction of the nursing staff who use the CPC sets, evaluated the decrease in the cost to the hospital. Methods: The CSSD nursing team presented some evidence of the benefits of using the CPC sets to the infection control subcommittee and asked for their approval to use CPC sets instead of SPC sets. After approval by the subcommittee, the CSSD nursing staff began to use CPC sets for patients. The incidence of CAUTI was monitored, and a satisfaction survey of the nurses who used the CPC sets was performed. We compared the costs between the SPC set and the CPC set to determine the cost savings. Results: The CAUTI rate did not change after using CPC sets. The nurses who used the CPC sets indicated no difference in satisfaction between the SPC and CPC sets, and the cost of the CPC set was cheaper than the SPC set (27 Baht per set). Conclusions: In a quality improvement effort, using the CPC set was safe for patients. The users were satisfied with the CPC set and trusted the safety of the instruments. Moreover, using the less expensive CPC sets saved the hospital >700,000 Baht per year."}
{"text": "Each spring and fall billions of songbirds depart on nocturnal migrations across the globe. Theory suggests that songbirds should depart on migration shortly after sunset to maximize their potential for nightly flight duration or to time departure with the emergence of celestial cues needed for orientation and navigation. Although captive studies have found that songbirds depart during a narrow window of time after sunset, observational studies have found that wild birds depart later and more asynchronously relative to sunset than predicted.We used coded radio tags and automated radio-telemetry to estimate the time that nearly 400 individuals from nine songbird species departed their breeding or wintering grounds across North America. We also assessed whether each species was most likely beginning long-distance migratory flights at departure or instead first making non-migratory regional flights. We then explored variation in nocturnal departure time by post-departure movement type, species, age, sex, and season.We found that 90% of individuals from species that were likely initiating long-distance migratory flights departed within 69\u00a0min of civil dusk, regardless of species, season, age, or sex. By contrast, species that likely first made non-migratory regional movements away from the migratory destination departed later and more asynchronously throughout the night. Regardless of post-departure movement type, 98% of individuals departed after civil dusk but otherwise showed no preference in relation to twilight phase.Although the presence of celestial orientation cues at civil dusk may set a starting point for departure each night, the fact that species likely beginning long-distance migration departed earlier and more synchronously relative to civil dusk than those first making non-migratory regional movements is consistent with the hypothesis that departing promptly after civil dusk functions to maximize the potential for nightly flight duration and distance. By studying the onset of migration, our study provides baseline information about departure decisions that may enhance our understanding of departure timing throughout migration.The online version contains supplementary material available at 10.1186/s40462-023-00382-5. To synchronize their physiology and behavior with the annual and diel rhythms of the environment, organisms have evolved endogenous time-keeping mechanisms such as circannual and circadian clocks , 2. OrgaMost songbirds migrate nocturnally , and by Despite long-held predictions that songbirds should initiate migratory flights during a narrow window of time after sunset and their demonstrated ability to do so in captivity, observations of individual birds in the wild have repeatedly failed to match theory or captive studies. The general pattern observed in wild songbirds thus far is that although many individuals depart within the first four hours after sunset, departure can occur at any time between sunset and sunrise , 25\u201334. One clue may be that nearly all field studies of nocturnal departure time have been conducted at stopover sites, rather than at breeding or wintering sites, when birds are first initiating migration for the season (but see ). StopovWe used automated radio telemetry  to estimSetophaga coronata), which may migrate medium distances to the mid-Atlantic or long distances to Central America or the Caribbean (Table\u00a0Setophaga kirtlandii), we collected data from the same population during both spring and fall migration, and for another, Swainson\u2019s Thrush (Catharus ustulatus), we collected data from the same season, but at two different locations . All individuals were captured in mist nests, aged and sexed when possible [To enhance our ability to draw broad conclusions, we collected data from nine species of migratory songbirds from two wintering sites and four breeding sites in North America Table\u00a0. All spean Table\u00a0. For onepossible , and banpossible . Radio tSetophaga ruticilla), Ovenbirds (Seiurus aurocapilla), Swainson\u2019s Warblers (Limnothlypis swainsonii), or Quebec-breeding Swainson\u2019s Thrushes make extensive non-migratory regional movements after departure [Setophaga striata), and Yellow-rumped Warblers breeding at the same Nova Scotia breeding sites as the present study have all been previously documented making non-migratory regional movements for days or weeks after departure [Catharus bicknelli) or Gambel\u2019s White-crowned Sparrows (Zonotrichia leucophrys gambelii). To account for this apparent difference in post-departure movement type between species within our sample, we tracked individuals after departure using the Motus Wildlife Tracking System [Previous light-level geolocator and/or radio-tracking data from the same breeding and wintering sites as the present study provides no clear evidence that Kirtland\u2019s Warblers, American Redstarts . Variation in the density and location of stations outside of the wintering and breeding areas for each species prevented us from definitively determining the distance travelled for each individual on the night of departure. To assess whether departing individuals were most likely initiating non-migratory regional flights or long-distance migratory flights, we estimated net displacement distance for individuals that were detected at least once after departure. We defined net displacement as the total distance moved in the general direction of the eventual migratory destination  each time an individual was detected by a station. To calculate net displacement, we first determined the bearing and great circle distance from the site of departure to the station each individual was detected at using packages \u201cswfscMisc\u201d, \u201cgeosphn\u2009=\u200920) or between sunrise and sunset (n\u2009=\u200918), assuming that departure during morning twilight or after sunrise was indicative of birds making short-distance local movements through normal daily activities and/or small home range shifts out of range of the stations but without leaving the breeding or wintering site [n\u2009=\u20093) rather than after astronomical dawn, because the latter is never experienced during the departure period due to Alaska\u2019s extreme northern latitude.At the Alaska breeding site, we used two automated telemetry receivers that were not part of Motus to record departure of Gambel\u2019s White-crowned Sparrows. Time of departure was estimated as the time of last detection at the breeding site . At all ing site . For the\u22126\u00ba), sunset position is easily observable, skylight polarization patterns are at maximum visibility, and a few of the brightest stars become visible. During nautical twilight (\u22126\u2013\u221212\u00ba), the position of the sun is not visible, skylight polarization gradually dims from 50 to 0% brightness, and dozens of additional stars become visible. During astronomical twilight (\u221212\u2013\u221218\u00ba), light from the sun is no longer visible and stars eventually reach their maximum brightness [To calculate nocturnal departure time in relation to the time of local sunset, civil dusk, and sun elevation angle, we used the package \u201csuncalc\u201d  in Progrightness , 59, 60.For comparison of nocturnal departure time between species, we qualitatively described obvious differences because the shape of departure time distributions varied widely, violating assumptions of parametric and non-parametric central tendency tests. To test for differences in the variability of nocturnal departure, we used Fligner-Killeen tests. To compare nocturnal departure between seasons in Kirtland\u2019s Warblers and between locations in Swainson\u2019s Thrush, we used Mann-Whitney-Wilcoxon tests. To explore age, sex, and year effects on the timing of nocturnal departure, we used ANOVA or Kruskal-Wallis tests. To estimate cloud cover during the hour surrounding civil dusk for each individual, we downloaded hourly weather data (31\u00a0km resolution) for each breeding or wintering site from the Copernicus Climate Change Service\u2019s ERA5 reanalysis . We thenAll individuals included in the analyses initiated departure flights nocturnally and permanently departed their breeding or wintering sites for the season. Tracking data indicated that wintering Kirtland\u2019s Warblers and Ovenbirds typically travelled\u2009>\u2009500\u00a0km towards the breeding grounds in the first few nights after departure. American Redstarts and Swainson\u2019s Warblers were less frequently detected within the first few nights after departure, making it more difficult to assess progress towards the migratory destination immediately after departure. However, because they generally appeared to move at similar rates to Kirtland\u2019s Warblers and Ovenbirds, and previous tracking data from the same study sites has not provided evidence of regional movements post-departure, we classified them as migrating at departure Fig.\u00a0A. OveralX2\u2009=\u2009130.7, df\u2009=\u20091, n\u2009=\u2009324, P\u2009<\u20090.001). Similarly, species likely beginning migration departed at higher sun elevation angles and more synchronously with respect to sun angle (-13.8\u2009\u00b1\u20096.7\u00ba) than those first making regional movements , but this difference reversed and was no longer significant when using time after civil dusk . As a result, we use time after civil dusk as a measure of departure time hereafter.Although individuals from species likely beginning migration primarily departed during a narrow window of time, this window of time spanned multiple periods of twilight both within and between species. Thus, regardless of post-departure movement type, we found no clear preference for departing during a single period of twilight Fig.\u00a0 bottom. n\u2009=\u2009112, P\u2009<\u20090.001). When comparing Swainson\u2019s Thrush from two different breeding locations, we found that individuals breeding in Quebec (62.4\u2009\u00b1\u2009208.7\u00a0min) departed earlier after civil dusk than individuals breeding in Nova Scotia Swainson\u2019s Thrush (117.7\u2009\u00b1\u2009198.8\u00a0min), but the difference was not significant .Within each species, we found almost no variation in nocturnal departure time by age, sex, or year, irrespective of the metric used Tables\u00a0 and 3. Fn\u2009=\u2009251, P\u2009=\u20090.087). Among species likely beginning migration at departure, we found no significant difference in departure time between overcast (33.5\u2009\u00b1\u200933.6\u00a0min after civil dusk) and mostly clear nights . Similarly, among species likely first making regional flights, we found no difference in departure times related to cloud cover .To determine if the visibility of celestial cues correlated with nocturnal departure time, we compared departure time on overcast (\u2265\u200995% cloud cover) and mostly clear nights (\u2264\u200925% cloud cover), but we found no evidence that cloud cover affected nocturnal departure time. Across all species, 103 of 396 individuals (26%) departed on overcast nights and 148 (37%) departed on mostly clear nights, but we found no significant difference in departure time on overcast nights (41.4\u2009\u00b1\u200998.3\u00a0min after civil dusk) and mostly clear nights  and Great Reed Warbler  flights that lasted more than four hours began shortly after sunset, while flights lasting less than one hour began variably either before sunset or throughout the period between sunset and sunrise. Thus, although there was some variation in the timing of departure across the entire migration period, the vast majority of long-distance migratory flights by Eurasian Hoopoes and Great Reed Warblers began within a narrow range of time after sunset, which suggests that individuals may depart on migratory flights at relatively consistent times throughout migration. However, even if departure times are relatively consistent throughout migration, it is entirely possible that individuals pursuing either time- or energy-minimizing migration strategies depart shortly after civil dusk and instead differ in the frequency of long-distance and short-distance flights, average flight speed, time of flight cessation, and/or time spent at stopover. Only further study of departure times across entire migrations will be able to determine whether early nocturnal departure is part of a time- or energy-minimizing migration strategy, or whether individuals depart shortly after sunset prior to any expected long-distance flight, regardless of their overall migration strategy.Holding other important factors constant , individuals departing shortly after civil dusk consistently throughout their migrations could fly longer and farther each night and arrive to their migratory destination days earlier than individuals consistently departing several hours later in the middle of the night. If this were true, early nocturnal departure could be one aspect of a time-minimizing migration strategy that songbirds use to ensure timely arrival to their migratory destinations. However, it is generally not known whether songbirds depart at consistent times during migration. Using some of the only data available to address this question, Liechti et al.  found thIn contrast to birds that immediately begin migration after departure, birds that first make regional flights should be under no pressure to maximize nightly flight duration. By leaving later in the night, Swainson\u2019s Thrush, Blackpoll Warblers, and Yellow-rumpled Warblers breeding in Nova Scotia may be able to reap the energetic and survival benefits of nocturnal flight , 19 but To accurately orient and navigate, migratory birds use multiple compasses  that are calibrated with information derived from celestial cues \u201324, and Despite the lack of a clear preference for departing during a single phase of twilight, the fact that 98% of individuals in our study waited until after civil dusk to depart, even with extreme differences in the timing of civil dusk relative to sunset , indicates that there is something special about civil dusk. At least two possible explanations exist, and the evidence is equivocal. It could be that the level of darkness present at civil dusk, in addition to the circadian clock, is necessary for full expression of migratory behavior, as has been shown in captive Gambel\u2019s White-crowned Sparrows . ExperimOur study reveals the potential power of studying departure from breeding and wintering sites at the beginning of migration. By at least partially controlling for immediate differences in migratory route, proximity to ecological barriers, and distance remaining on migration, we were able to document a long-predicted but seldom observed biological pattern. We observed a remarkable degree of synchrony, relative to civil dusk, in the timing of nocturnal departure by species that were likely initiating migratory flights that was consistent across season, age, and sex. By contrast, we found that species likely carrying out non-migratory regional movements departed later and more asynchronously relative to civil dusk. The fact that nearly all individuals waited until after civil dusk to depart highlights the importance of civil dusk, but it remains unclear if the availability of celestial cues at civil dusk sets a starting point for nightly departure  or whethBelow is the link to the electronic supplementary material.Additional file 1. Table S1. Basic descriptive information for populations included in this study. Age classes include hatch year (HY), after hatch-year (AHY), second-year (SY), after second-year (ASY), and unknown (U)."}
{"text": "Scalable fabrication of two-dimensional (2D) arrays of quantum dots (QDs) and quantum rods (QRs) with nanoscale precision is required for numerous device applications. However, self-assembly\u2013based fabrication of such arrays using DNA origami typically suffers from low yield due to inefficient QD and QR DNA functionalization. In addition, it is challenging to organize solution-assembled DNA origami arrays on 2D device substrates while maintaining their structural fidelity. Here, we reduced manufacturing time from a few days to a few minutes by preparing high-density DNA-conjugated QDs/QRs from organic solution using a dehydration and rehydration process. We used a surface-assisted large-scale assembly (SALSA) method to construct 2D origami lattices directly on solid substrates to template QD and QR 2D arrays with orientational control, with overall loading yields exceeding 90%. Our fabrication approach enables the scalable, high fidelity manufacturing of 2D addressable QDs and QRs with nanoscale orientational and spacing control for functional 2D photonic devices. Dehydration and surface-assisted assembly enable rapid, scalable quantum dot and quantum rod 2D arrays with nanoscale precision. Quantum dots (QDs) and quantum rods (QRs) exhibit appealing features of bright and tunable narrowband photoluminescence (PL) emission that have attracted extensive interest in the wake of numerous successful state-of-the-art device applications  to promote surface diffusion and self-organization  DNA origami  from their original organic solvent to aqueous buffer, which substantially shortens the time required for their synthesis from a few days to a few minutes. This approach can be applied to QDs and QRs with various sizes, aspect ratios, spectra, and shell surfaces . The dQDface DNA .et\u00a0al. , commercial QDs/QRs dispersed in an organic solvent are initially mixed with an aqueous solution containing an excess thiolated ssDNA and sodium salt, forming a phase separated liquid double layer . The mix+ and phase transfer catalyst, dehydration volume ratio, and dehydration time on the DNA density per dQD/dQR. Commercial organic 6- and 14-nm CdSe/ZnS QDs with emission wavelengths of 600 (QD600) and 660 nm (QD660), respectively, and 4/16 nm (diameter/length) and 5/29 nm CdSe/CdS QRs with emission wavelengths of 560 (QR560) and 620 nm (QR620), respectively, were selected to prepare dQD600, dQD660, dQR560, and dQR620 using dehydration-assisted DNA conjugation (O-(2-mercaptoethyl)-O\u2032-methyl-hexa(ethylene glycol) (mPEG) and then conjugated with thiolated DNA (mQDs/mQRs) . These results showed that our approach substantially increases DNA surface density up to 10-fold compared with the traditional method , which may be due to the greater ZnS shell thickness of QD660 that may decrease the effect of surface defects and ligands. In addition, we found two key factors to prepare high-density DNA functionalization of QDs and QRs, namely, Na+ and 1-butanol/water volume ratio. An AGE assay was used to characterize DNA loadings on QD660 based on increased gel retardation. We first prepared dQD660 using thiolated DNA (51 nt) with or without NaOH and the phase transfer catalysts trioctylphosphine oxide (TOPO) and tetrabutylammonium bromide (TBAB). We first tested NaOH instead of NaCl as a control, as NaOH has been shown to be necessary in the previous QD/QR phase transfer protocols  . By compDs/mQRs) . Considerotocols . Meanwhirotocols . The incMono-mercapto ligand capped QDs/QRs usually suffer from poor colloidal stability due to dynamic thiol-ZnS or thiol-CdS interactions (n = 3) for QD600-Cy5, QD660-Cy5, QR560-Cy5, and QR620-Cy5, respectively, indicating an increasing number of dye acceptors due to the high-density of DNA functionalization on the QD/QR surface  at the 3\u2032 terminus . For com surface . We esti surface . It shou surface .Having demonstrated the highly efficient hybridization ability of dQDs and dQRs, we next sought to test the loading efficiency of dQDs/dQRs onto DNA origami structures. A rigid 6HB wireframe rhombic DNA origami (Rh) was designed using ATHENA . MoreoveHaving demonstrated excellent colloidal stability and hybridization ability of dQDs/dQRs, we next sought to develop a strategy to fabricate QD/QR 2D arrays. Here, we used Rh to demonstrate a SALSA strategy to fabricate DNA origami lattices directly on a solid substrate with control over relative origami orientation. The key to achieve relative orientational control of origami tiles within a 2D lattices is to introduce anisotropic lateral interactions between neighboring origamis . Althoug+ mediated SALSA where the monovalent cation promotes the diffusion and assembly of origami tiles; (ii) thermal annealing to break misassembled origami tiles for error correction; and (iii) controlling the same side of the origami landing on the substrate. Without or with a low concentration (<100 mM) of Na+, the affinity of the origami to the mica surface was so high that the origami tiles could not diffuse to form ordered lattices once they attached to the surface (fig. S22). Without sufficient thermal annealing, only small 2D arrays were observed due to misassembled origami tiles (fig. S23). Heating at a higher temperature (>60\u00b0C) will start to denature DNA origami and lower the surface coverage (fig. S23). Longer annealing times also help to produce large 2D origami lattices to some extent (fig. S24). We found that the conditions described in Methods yielded the best 2D lattices observed thus far.We discovered three synergistic effects that are key to the formation of large origami lattices: (i) Na+ mediating the binding affinity and possibly the elevated temperature promoting dynamics, this method was able to bias the nonbinding face of the origami landing on the mica surface  and up to 73% of QRs were distributed within 30\u00b0 in a 1-\u03bcm2 area using the zipper-like hybridization mode (2 area (fig. S31). This result shows that the zipper-like geometry can form rigid binding by reducing the distance between QRs and DNA nanostructures, which is consistent with results from previous reports  due to uncontrolled nucleation of origami lattices on the surface with random initial orientations and positions. Future work might extend our approach using lithographically defined substrates to manipulate the initial nucleation steps of SALSA. The flexible and accurate angle control of the 6HBs in wireframe origami structures will also enable us to precisely tune the orientation of anisotropic functional materials like nanorods and explore their arrangement-dependent properties. Together, the use of dehydration-assisted DNA conjugation and SALSA is expected to facilitate the translation of nanoscale DNA origami design strategies into surface nanofabrication, where scalable production and nanoscale precision are essential to achieve target device performance.In the current implementation, 2D origami lattices were limited in size , and tris  were purchased from Life Technologies Corporation DBA Invitrogen. Mica discs  were purchased from Ted Pella Inc. and used for all AFM imaging.CdSe/ZnS core/shell QDs [catalog numbers: 900218 (QD600) and 900249 (QD660)], CdSe/CdS core-shell type QRs [catalog numbers: 900512 (QR560) and 900514 (QR620)], MPA , mPEG  were purchased from Sigma-Aldrich. Basic Agarose  was purchased from IBI Scientific. TBE 10\u00d7 buffer [(pH 8.3) catalog number: 1610733] was purchased from Bio-Rad Laboratories Inc. TAE 10\u00d7 buffer  and phosphate-buffered saline (PBS) 1\u00d7 buffer  were purchased from Corning. All DNA oligonucleotides were purchased from Integrated DNA Technologies  with standard desalting or high-performance liquid chromatography (for dye-modified DNA oligonucleotides) as purification method. Thiol-modified oligos ordered from IDT are shipped in their oxidized form, with the sulfur atoms protected by an S\u2500S bond (Mod Code: /5ThioMC6-D/ or /3ThioMC3-D/), and were reduced using TCEP in 100\u00d7 excess. All DNA oligonucleotides were received as dry pellets. Sodium chloride , MgClg for several seconds to facilitate a liquid phase separation. DNA-functionalized QDs/QRs were then recovered as a sublayer of the resulting two immiscible liquids. To remove excess ssDNA, DNA-functionalized QDs/QRs were purified and concentrated using an ultracentrifugal filter (Amicon 100 kDa) five times at 8000g for 3 min for each centrifugation step. The whole process was carried out under ambient conditions, assisted only by sonication, vortex mixing, and centrifugation-facilitated phase separation.dQDs/dQRs were prepared using dehydration-assisted directly phase transfer from commercial organic QDs/QRs. Briefly, 5 \u03bcl of QD  was incubated with thiolated ssDNA (21 nt) (sequence: 5\u2032-thiol-AAA AAA AAA CCC AGG TTC TCT-3\u2032) at a desired molar ratio  in the presence of 100 mM NaOH or NaCl to reach a final volume of 50 \u03bcl. Such solution was sonicated at 37 Hz around 5 min and then immediately combined with 600 \u03bcl of 1-butanol followed by a quick vortex for several seconds. Subsequently, 200 \u03bcl of 0.5\u00d7 TBE buffer was added to the above solution followed by another quick vortex and a brief centrifugation at 2000g for several seconds, and the aqueous layer was recovered. The vortexing and centrifugation steps were repeated until all aqueous layers were collected. MPA-QDs were purified to remove excess MPA and concentrated using an ultracentrifugal filter (Amicon 30 kDa) six times at 8000g for 5 min for each centrifugation step. After purification, the MPA-QDs were diluted to 500 \u03bcl with nuclease-free water and incubated with 20 \u03bcl of mPEG for 4 days at room temperature. The MPA/mPEG-QDs were purified and concentrated using an ultracentrifugal filter (Amicon 30 kDa) six times at 8000g for 5 min and then buffer-exchanged into 10 mM tris using a NAP-5 desalting column . Aqueous QDs were incubated with thiolated-ssDNA at desired molar concentration for conjugation . Last, purified DNA-conjugated QDs/QRs concentrations were determined by measuring the absorbance of samples at 350 nm.Aqueous QDs were prepared as described previously, with minor modifications  five times at 8000g for 3 min for each centrifugation step.Aqueous QD660 was prepared as described above. mdQD660 was prepared using dehydration-assisted DNA condense from aqueous QD660. Briefly, 5 \u03bcl of QD660 (100 nM) was incubated with thiolated ssDNA (51 nt) (sequence: 5\u2032-thiol-AAA AAA AAA AAA AAA AAA AAA AAA AAA AAA TTG TGA CAG CTG GAT CGT TAC-3\u2032) at a desired molar ratio (500:1) in the presence of 100 mM NaOH to reach a final volume of 50 \u03bcl. Such solution was sonicated at 37 Hz around 5 min and then immediately combined with 600 \u03bcl of 1-butanol followed by a quick vortex for several seconds. Subsequently, 200 \u03bcl of 0.5\u00d7 TBE buffer was added to the above solution followed by another quick vortex and a brief centrifugation at 2000g for several seconds to facilitate a liquid phase separation. DNA-functionalized QD660 were then recovered as a sublayer of the resulting two immiscible liquids. DNA-functionalized QD660 sample without purification (15 \u03bcl) was combined with 3 \u03bcl of 6\u00d7 loading buffer (New England Biolabs) and loaded to a 1% agarose gel with 0.5\u00d7 TBE. Each gel was run at 65 V for 60 min in 0.5\u00d7TBE at 4\u00b0C. Gels were then visualized under blue light transilluminator.To investigate the impact of NaOH, TOPO, and TBAB on DNA density per QD, dQD660 was incubated with thiolated DNA (51 nt) (sequence: 5\u2032-thiol-AAA AAA AAA AAA AAA AAA AAA AAA AAA AAA TTG TGA CAG CTG GAT CGT TAC-3\u2032) (case 1), or combined with NaOH (case 2), or NaOH and TOPO (case 3), or NaOH and TBAB (case 4), or NaOH, TOPO, and TBAB (case 5) before sonication. In a typical experiment, for above case 1, 20 \u03bcl of thiolated ssDNA was added to 5 \u03bcl of octadecylamine capped QD660 at a molar ratio of 500:1 to reach a final volume of 50 \u03bcl. For above case 2, 20 \u03bcl of thiolated ssDNA was added to 5 \u03bcl of octadecylamine capped QD660 at a molar ratio of 500:1 in the presence of 100 mM NaOH to reach a final volume of 50 \u03bcl. For above case 3, 5 \u03bcl of octadecylamine capped QD660 was incubated with 5 \u03bcl of TOPO (1 g/10 ml) for 30 min, and 20 \u03bcl of thiolated ssDNA was added to above mixture at a molar ratio of 500:1 in the presence of 100 mM NaOH to reach a final volume of 50 \u03bcl. For above case 4, 5 \u03bcl of octadecylamine capped QD660 was incubated with 2 \u03bcl of TBAB (0.3 M) for 30 min, and 20 \u03bcl of thiolated ssDNA was added to above mixture at a molar ratio of 500:1 in the presence of 100 mM NaOH to reach a final volume of 50 \u03bcl. For above case 5, 5 \u03bcl of octadecylamine capped QD660 was incubated with 5 \u03bcl of TOPO (1 g/10 ml) and 2 \u03bcl of TBAB (0.3 M) for 30 min, and 20 \u03bcl of thiolated ssDNA was added to above mixture at a molar ratio of 500:1 in the presence of 100 mM NaOH to reach a final volume of 50 \u03bcl. Such solution was sonicated around 5 min and then was immediately combined with 600 \u03bcl of 1-butanol followed by a quick vortex for several seconds. Subsequently, 200 \u03bcl of 0.5\u00d7 TBE buffer was added to the above solution followed by another quick vortex and a brief centrifugation at 2000g for several seconds to facilitate a liquid phase separation. DNA-functionalized QD660 were then recovered as a sublayer of the resulting two immiscible liquids. DNA-functionalized QD660 sample without purification (15 \u03bcl) was combined with 3 \u03bcl of 6\u00d7 loading buffer (New England Biolabs) and loaded to a 1% agarose gel with 0.5\u00d7 TBE. Each gel was run at 65 V for 60 min in 0.5\u00d7 TBE at 4\u00b0C. Gels were then visualized under blue light transilluminator.To investigate the impact of dehydration volume ratio on DNA density per QD, different 1-butanol/water volume ratio was used to prepare the dQD660 during dehydration process. In a typical experiment, thiolated ssDNA (51 nt) (sequence: 5\u2032-thiol-AAA AAA AAA AAA AAA AAA AAA AAA AAA AAA TTG TGA CAG CTG GAT CGT TAC-3\u2032) was added to octadecylamine capped QD660 at a molar ratio of 500:1 in the presence of 100 mM NaOH to reach a final volume of 50 \u03bcl. Such solution was sonicated around 5 min and then was immediately combined with 50, 300, 450, 600, or 750 \u03bcl of 1-butanol followed by a quick vortex for several seconds. Subsequently, 20, 100, 150, 200, or 250 \u03bcl of 0.5\u00d7TBE buffer was added to the above solution followed by another quick vortex and a brief centrifugation at 2000g for several seconds to facilitate a liquid phase separation. DNA-functionalized QD660 were then recovered as a sublayer of the resulting two immiscible liquids. DNA-functionalized QD660 sample without purification (15 \u03bcl) was combined with 3 \u03bcl of 6\u00d7 loading buffer (New England Biolabs) and loaded to a 1% agarose gel with 0.5\u00d7 TBE. Each gel was run at 65 V for 60 min in 0.5\u00d7 TBE at 4\u00b0C. Gels were then visualized under blue light transilluminator.Various dehydration time was tested for dQD660 preparation. In a typical experiment, thiolated ssDNA (51 nt) (sequence: 5\u2032-thiol-AAA AAA AAA AAA AAA AAA AAA AAA AAA AAA TTG TGA CAG CTG GAT CGT TAC-3\u2032) was added to octadecylamine capped QD660 at a molar ratio of 500:1 in the presence of 100 mM NaOH to reach a final volume of 50 \u03bcl. Such solution was sonicated around 5 min and then was immediately combined with 600 \u03bcl of 1-butanol followed by a quick vortex for several seconds. After 0, 30, 60, or 90 min of incubation and shaking, 200 \u03bcl of 0.5\u00d7TBE buffer was added to the above solution followed by another quick vortex and a brief centrifugation at 20006 M\u22121 cm\u22121, 2.9 \u00d7 107 M\u22121 cm\u22121, 2.3 \u00d7 107 M\u22121 cm\u22121, and 6.4 \u00d7 107 M\u22121 cm\u22121. DNA concentration was determined by FAM fluorescence calibration curve, where fluorescence was excited at 485 nm with emission recorded from 500 to 700 nm. For comparison, DNA-functionalized QDs/QRs (mQDs/mQRs) were also prepared by a method as described above.To quantify DNA density per QD/QR, 5\u2032-thiolated DNA with an extra FAM at the 3\u2032 terminus (21 nt) (sequence:5\u2032-thiol-AAA AAA AAA CCC AGG TTC TCT-FAM-3\u2032) was used to prepare DNA-conjugated QD/QR. The concentrations of QDs/QRs were obtained by ultraviolet-visible (UV-vis) extinction spectroscopy with diameter-dependent extinction coefficients calculated from an empirical equation (2).To fabricate mQD600-Cy5, dQD600-Cy5, mQD660-Cy5, dQD660-Cy5, mQR560-Cy5, dQR560-Cy5, mQR620-Cy5, and dQR620-Cy5 FRET pairs, mQD600, dQD600, mQD660, dQD660 mQR560, dQR560, mQR620, and dQR620 were incubated with twofold excess complementary DNA with a Cy5 modifier at the 3\u2032 terminus (sequence: 5\u2032-AGA GAA CCT GGG-Cy5\u20133\u2032) in PBS buffer. After 2-hour incubation, the fluorescence emission spectra of QDs/QRs alone and in the presence of Cy5 were recorded. To fabricate the QD/QR-DNA origami assemblies, wireframe rhombic origami with binding overhangs was incubated with mQD660, dQD660, mQR620, and dQR620 at room temperature overnight, respectively . One hundred microliters of 100 nM DNA scaffold  was mixed with 20 equivalent all corresponding staple strands, and the final buffer condition was adjusted to in 1\u00d7 TMg. The final concentration of the scaffold was about 20 nM. The mixed solution was annealed in a polymerase chain reaction thermocycler: 95\u00b0C for 5 min, 85\u00b0C down to 76\u00b0C for 5 min/\u00b0C, 75\u00b0C down to 30\u00b0C for 13.75 min /0.5\u00b0C, 29\u00b0C down to 25\u00b0C for 10 min/\u00b0C, and then held at room temperature. The crude origami sample was directly used for SALSA without further purification. All DNA sequences are summarized in tables S6 and S7.The 6HB wireframe rhombic origami was folded using a reported method  was placed on top of the liquid surface in the well, floating with the cleaved side in contact with the solution surface. Then, the microplate was sealed and placed on a hotplate shaker  for 12 cycles of heating at 60\u00b0, 55\u00b0, and 50\u00b0C for 1 hour each  with 200 rpm shaking and then let the setup naturally cool down to room temperature. Note that heating temperatures above were instrument settings, and actual sample temperatures were measured to be 50\u00b0, 47\u00b0, and 44\u00b0C, respectively. The mica disc was then taken out of the microplate well and carefully rinsed with 100 \u03bcl of 1\u00d7 TMg buffer (with 0.5 M Na+) 10 times, with 1\u00d7 TMg buffer (without Na+) 6 times, and with 1\u00d7 TNi (40 mM tris and 12.5 mM MgCl2 with a pH adjusted to 8.3 \u00b1 0.2) 3 times before incubating with 50 \u03bcl 1\u00d7 TNi on the disc for 5 to 10 min. After the incubation, the disc was rinsed with 100 \u03bcl of Milli-Q water three times and dried with compressed air. Next, the mica disc was kept under vacuum for at least 1 hour before AFM imaging. For QD/QR binding experiments, the SALSA sample on the mica disc after annealing was only rinsed 12 times with 100 \u03bcl of 1\u00d7 TMg buffer (with 0.5 M Na+) and kept wet before the next step. Iterations of the synthesis method for optimization were noted with the results in the Supplementary Materials.In a typical SALSA process, the as-synthesized origami was mixed with a concentrated NaCl solution (5 M) for a 1.5-ml solution with a final origami concentration of 500 pM and a Na+) containing 1 nM dQDs/dQRs in a well of a 24-well microplate and incubated for 4 hours with 200 rpm shaking. The mica disc was then taken out of the microplate well and carefully rinsed with 100 \u03bcl of 1\u00d7 TMg buffer (with 0.5 M Na+) 10 times, with 1\u00d7 TMg buffer (without Na+) 6 times, and with 1\u00d7 TNi (40 mM tris and 12.5 mM MgCl2 with a pH adjusted to 8.3 \u00b1 0.2) 3 times before incubating with 50 \u03bcl of 1\u00d7 TNi on the disc for 5 to 10 min. After the incubation, the disc was rinsed with 100 \u03bcl of Milli-Q water three times and dried with compressed air. dQDs/dQRs were functionalized with a 5\u2032-thiol\u2013modified DNA (sequence: 5\u2032-thiol-AAA AAA AAA CCC AGG TTC TCT-3\u2032) for a \u201cshear-like\u201d hybridization or a 3\u2032-thiolated DNA (sequence: 5\u2032-CCC AGG TTC TCT AAA AAA AAA-thiol-3\u2032) for a \u201czipper-like\u201d hybridization. For orientation analysis of QR 2D arrays, only the angles of QR monomers in the AFM images were measured and counted in the analysis. OrientationJ (Distribution function (9-\u03bcm2 images) or the Measure function (1-\u03bcm2 images) with the horizontal x axis as 0\u00b0.After rinsing, SALSA origami lattices on a mica disc were placed on the liquid surface of 1 ml of 1\u00d7 TMg buffer  was drop casted on 400-mesh carbon film square grids . For DNA origami and QD/QR-origami assemblies, 10 \u03bcl of wireframe DNA origami objects with or without attached QDs/QRs (5 nM) was adsorbed on glow-discharged 400-mesh carbon film square grids and stained by 2% aqueous uranyl formate solution containing 25 mM NaOH.k = 0.4 N/m, fo = 70 kHz; Bruker) or on an Asylum Research Jupiter XR AFM (Oxford Instruments) in tapping mode using an ARROW-UHF ultrahigh-frequency probe .AFM measurements were performed under air condition in either on an Icon Atomic Force Microscope (Bruker) in ScanAsyst mode using a ScanAsyst-Air silicon tip on nitride lever  were measured using a multimode microplate reader (Tecan Spark). Quantum yields of QDs/QRs were determined using the relative quantum yield determination method with rhodamine 101 in spectroscopic-grade ethanol as standard  (Absorbance spectra were measured using an Evolution 260 Bio UV-vis spectrophotometer (Thermo Fisher Scientific), and steady-state emission spectra (\u03bbJ) and F\u00f6rster distance (R0) were calculated using A(\u03bb) is the molar absorptivity spectrum of the acceptor in M\u22121 cm\u22121, and \u03bb is the wavelength in nm (2 is the orientation factor (assumed to be 2/3), \u03a6D is the quantum yield of the donor, and n = 1.35 is the refractive index of the medium. The molar extinction coefficients for Cy5 were obtained from the suppliers.The overlap integral  is circularly polarized with a quarter-wave plate (AQWP05M-600) to ensure uniform excitation. The emission is filtered with a Semrock BrightLine 409-nm longpass filter to remove the laser light, and then sample emission passes through a half-wave plate (HWP) (AHWP05M-600) and a wire-grid polarizer (WP25M-VIS). For acquiring energy spectra, the light was directed into a Princeton Instruments Acton spectrometer and a Princeton Instruments ProEM 512 \u00d7 512 charge-coupled device array. As the HWP is rotated, the change intensity is recorded by integrating the entirety of the spectral range (roughly 533 to 700 nm), as it passes through the parallel (perpendicular) polarizer, and the degree of polarization at each detection angle is calculated using"}
{"text": "Every student has a varied level of mathematical proficiency. Therefore, it is important to provide them with questions accordingly. Owing to advances in technology and artificial intelligence, the Learning Management System (LMS) has become a popular application to conduct online learning for students. The LMS can store multiple pieces of information on students through an online database, enabling it to recommend appropriate questions for each student based on an analysis of their previous responses to questions. Particularly, the LMS manages learners and provides an online platform that can evaluate their skills. Questions need to be classified according to their difficulty level so that the LMS can recommend them to learners appropriately and thereby increase their learning efficiency. In this study, we classified large-scale mathematical test items provided by ABLE Tech, which supports LMS-based online mathematical education platforms, using various machine learning techniques according to the difficulty levels of the questions. First, through t-test analysis, we identified the significant correlation variables according to the difficulty level. The t-test results showed that answer rate, type of question, and solution time were positively correlated with the difficulty of the question. Second, items were classified according to their difficulty level using various machine learning models, such as logistic regression (LR), random forest (RF), and extreme gradient boosting (xgboost). Accuracy, precision, recall, F1 score, the area under the curve of the receiver operating curve (AUC-ROC), Cohen\u2019s Kappa and Matthew\u2019s correlation coefficient (MCC) scores were used as the evaluation metrics. The correct answer rate, question type, and time for solving a question correlated significantly with the difficulty level. The machine learning-based xgboost model outperformed the statistical machine learning models, with a 85.7% accuracy, and 85.8% F1 score. These results can be used as an auxiliary tool in recommending suitable mathematical questions to various learners based on their difficulty level. Mathematics is the most fundamental subject taught in elementary schools because it helps in developing critical thinking and logical reasoning. It is important to know that every student has a different set of skills and proficiency for learning mathematical concepts and that they are provided with questions in accordance with their individual abilities. Owing to advancements in technology and artificial intelligence, the most popular way of interacting and communicating with students through online learning is using the Learning Management System (LMS). This system uses an online database to store information on students. Thus, it can recommend appropriate questions to each student based on previous questions they have solved. The LMS is an online learning platform that can systematically evaluate and monitor learners\u2019 skills .It is important to ask learners appropriate questions to evaluate their abilities. In numerous previous studies, questions were classified after considering various variables, ensuring that the most suitable question would be suggested next for the learner. Jayalakshmi and Sheshasaayee  and Ray However, most previous studies on question classification have focused on small-scale datasets using the conventional method of analysis to accompany their experimental and theoretical assumptions. Although their theories are significant and applicable for small sets of data, they become ineffective when applied to large-scale data because they require the incorporation of a more advanced algorithm to classify more complex questions. Unlike the limitations of using statistical analysis on large-scale data, machine-learning models are more powerful and capable of solving high-dimensional problems that are difficult for humans to resolve. Therefore, there is an urgent need to classify large-scale questions using an improved method for classifying problems based on machine learning.In this study, we used various machine learning models, such as logistic regression (LR) , random The main contributions of this study are given as follows:The most relevant features found through the statistical t-test analysis were answer rate, question type, and solving time; these variables correlated most significantly with the difficulty level.To compare the performance of the several machine learning models more reliably, we considered seven evaluation metrics.The xgboost model outperformed the other machine-learning models in the multi-class classification problem with the maximum accuracy, F1-score, Kappa and MCC scores.The remainder of this manuscript is sectioned as follows: In Section 2, we have explained the concept of question difficulty and how it can be applied using a machine learning approach for readjusting the new difficulty levels of questions. Section 3 introduces the overall data pipeline process and the construction of the machine-learning model and describes the evaluation metrics we used for assessing the results of our experiment. Section 4 describes the results of feature selection based on statistical analysis. We have also described the results of the model performance based on several machine-learning models. In Section 5, the conclusions are presented.Many previous studies have explored the concept of item difficulty levels. According to one study, item difficulty level is defined as the percentage of students who choose the correct answer out of all other students, as well as a scale that measures the degree of difficulty experienced by students when solving a set of problems. The level of question difficulty can be affected by the characteristics of the question or the type of learning or problem-solving model used , 12.Other researchers have differentiated difficulty levels by examining socio-psychological perspectives. For example, Kim  has explSimilarly, Watering and Rijt  inferredThere is currently a trend toward using artificial intelligence to classify difficulty levels instead of the socio-psychological methods conventionally used. In other words, learning patterns can be analyzed by identifying learners\u2019 behaviours through a quantitative analysis of questions. Zhao et al.  proposedThe scope of machine learning can be broken down into three main sub-fields, namely supervised learning, unsupervised learning, and reinforcement learning, each of which plays an important role in the field; therefore, when learning the basics of artificial intelligence, each should be thoroughly explored in equal measure. For our analysis, we focused on using the supervised learning approach. In supervised learning, a trained model is used to learn multiple features that can be classified into multiple classes or labels from the observed data; then, a new label value is predicted based on the prediction value that most accurately matches the actual target variable.In most recent research, machine learning approaches have been used to solve multi-classification problems; these approaches have shown excellent performance in various domains. In a study by Petersen and Ostendorf , the difAn LMS is an online solution platform that manages learners and evaluates their skills through various online lecture courses. In our study, we analyzed the dataset provided by our collaborator ABLE Tech, a mathematical LMS-based solution platform targeting teenagers from elementary to high school.The workflow system architecture used in this study, which consists of two parts, is shown in When constructing the master table, certain students were excluded because information on them was unavailable. Initially, the provided data comprised 8.15 million rows; after preprocessing, only 3.12 million rows were used for the actual analysis. Additionally, it comprised information on students of various grades who responded to each mathematical question based on a unique ID value . Since there were various grades of students for each question, the standard solution time could also be extracted as a new variable. In this study, the average and median solution times were compared and applied to a new variable as the median value, meaning that the question that was solved most frequently could be obtained using the problem ID. In the table wherein the questions have been sorted according to this frequency, the rate of correct answers that students solved for each problem ID could also be calculated as a new variable. The rate of correct answers refers to the percentage of students who correctly answered each question; each question had been divided into three components, namely chapter, episode , chapter , and chapter type . The response options for the mathematical questions were largely divided into subjective and multiple-choice types. For the target variable, the difficulty of the existing labelled question was re-labelled to \u201chigh\u201d, \u201cmedium\u201d, or \u201clow\u201d as a multi-category for analysis, where \u201chigh\u201d and \u201clow\u201d mean that the item is of high and relatively low difficulty, respectively. The seven final variables used in this study were the rate of correct answers, major chapter, intermediate chapter, small chapter, solution time, type of correct answer, and difficulty. The final data sample is shown in In this study, we examined and analyzed the multi-class classification problem in relation to the level of difficulty in solving mathematical problems. Instead of using all the various classifier models, we focused on using optimal machine learning algorithms that had been employed in related research and were well-suited to our field of research. The following models were implemented and tested: logistic regression (LR), k-nearest neighbors algorithm (kNN), stochastic gradient descent (SGD), classification and regression tree (CART), support vector machine (SVM), multi-layer perceptron (MLP), random forest (RF), extra trees ensemble classifier (ET), adaboost (ADA), categorical boosting (CatBoost), gradient boosting machine (GBM), light gradient boosting machine (LightGBM), and extreme gradient boosting machine (XGB).p(y = 1|x) represents the probability of the binary outcome (y = 1) given the independent variables (x), and z = b0 + b1x1 + b2x2 + \u2026 + bnxn represents the linear combination of the independent variables (x) and their coefficients (b), where b0 is the intercept and b1 to bn are the coefficients of the independent variables x1 to xn. The function e is the base of the natural logarithm. The logistic function on the right-hand side of the equation (1/(1 + ez\u2212)) maps the linear combination of the independent variables (z) to a probability value between 0 and 1, which represents the predicted probability of the binary outcome (y = 1) given the independent variables (x). The logistic function is also called the sigmoid function, and it has an S-shaped curve that is useful for modelling probabilities.Logistic regression (LR) is a statistical method that models the relationship between a dependent variable (binary outcome) and one or more independent variables (predictors). The dependent variable is represented as a binary variable (0 or 1) and is modelled using a logistic function. The logistic function transforms the linear combination of the independent variables into a probability value between 0 and 1. The following model can be represented mathematically as follows:yi is the output of the i-th neighbor, and The k-Nearest Neighbor (kNN) algorithm is a simple and popular machine learning model used for classification and regression tasks. The algorithm works by finding the k closest data points in the training set to the input data point and predicting the output based on the majority vote of the k neighbors for classification, or the average value of the k neighbors for regression. The kNN model defines the distance between two data points as a metric function, such as the Euclidean distance or Manhattan distance. The prediction of the model can be written as:\u03b8 are the model parameters, \u03b7 is the learning rate, J is the cost function for a single training example (xi), and \u2207J is the gradient of the cost function with respect to the model parameters for a single training example. The update is performed for each training example in the dataset.Stochastic Gradient Descent (SGD) is an iterative optimization algorithm used to minimize the cost function in machine learning models. It works by updating the model parameters for each training example, unlike batch gradient descent which updates parameters based on the entire training dataset. SGD is more efficient and less computationally expensive than batch gradient descent and is widely used in deep learning models. The mathematical equation for updating the parameters in SGD can be represented as:yi is the true target value for the i-th sample, pi is the proportion of samples that belong to the i-th class in the subset of data at that node.Classification and Regression Trees (CART) is a decision tree algorithm used for both regression and classification problems. It creates a binary tree structure where each internal node corresponds to a decision based on a feature and each leaf node corresponds to a prediction. The algorithm recursively partitions the data into smaller subsets based on the best split at each node. The splitting criterion used in CART is the reduction in variance or the Gini index for regression and classification problems, respectively. The optimal split is chosen based on the criterion that maximizes the reduction in variance or the Gini index. The algorithm stops when a stopping criterion is met, such as reaching a maximum tree depth or having too few samples at a node. Mathematically, the CART algorithm seeks to minimize the mean squared error (MSE) for regression problems:xi, yi), where xi is a feature vector and yi is the corresponding target class label, it seeks to find the hyperplane wT x + b = 0 that separates the data into two classes:w|| is the L2-norm of the weight vector, and the constraint ensures that the data is correctly classified and lies outside the margin. It is known for its ability to handle high-dimensional data and non-linear decision boundaries through the use of kernel functions. However, it can be sensitive to the choice of hyper-parameters and is not suitable for large datasets.Support Vector Machines (SVM) is a machine learning algorithm used for classification and regression problems. The algorithm tries to find the best hyperplane that separates the data into different classes while maximizing the margin between the hyperplane and the nearest data points of each class. Mathematically, given a set of training data  or cross-entropy. MLPs are commonly used for classification and regression problems, and their performance can be improved by increasing the number of layers, adding regularization techniques, or using different activation functions. However, they can be sensitive to the choice of hyper-parameters and prone to over-fitting if the number of parameters is too large.A Multi-Layer Perceptron (MLP) is a feed-forward artificial neural network that consists of multiple layers of nodes, where each node in one layer is connected to every node in the subsequent layer. The nodes in the MLP are called neurons, and they apply a non-linear transformation to the input data. Mathematically, given a set of input data x, the output of the MLP is calculated as follows:ft(x) is the prediction of the t-th decision tree for the input x. The randomness introduced in Random Forest helps to reduce over-fitting and improve the accuracy of the model.Random forest (RF) is an ensemble learning method that combines multiple decision trees to make predictions. It is used for both regression and classification problems, and is known for its high accuracy and robustness to noise and over-fitting. The output of the algorithm is the average or majority vote of the individual trees. Mathematically, the output of a Random Forest model for a new sample x is:F(x) is the model\u2019s prediction for a new input, n is the number of trees in the ensemble, and fi(x) is the prediction of the ith decision tree in the ensemble. Each decision tree is built using a random subset of the features and a random threshold value for each split. The final prediction is determined by averaging the predictions of all the trees in the ensemble.Extra Trees (ET) ensemble classifier is a machine learning algorithm that combines multiple decision trees to create a predictive model. ET builds on the Random Forest algorithm, but with some key differences. Like Random Forest, ET creates multiple decision trees using bootstrap samples of the training data and random subsets of the features. However, it also selects the splitting point at each node of the tree using a random threshold value, rather than finding the best threshold. This randomization can result in less bias and variance in the model, and can improve the accuracy. The mathematical equation for ET is similar to that of a decision tree ensemble:F(x) is the final strong classifier, ft(x) is the weak classifier at iteration t, and \u03b1t is the weight assigned to the weak classifier. The weight \u03b1t is calculated based on the performance of the weak classifier on the training data, and is higher for more accurate classifiers. During training, AdaBoost assigns initial weights to each sample in the training set. These weights are then updated at each iteration based on the accuracy of the weak classifier on the training data. The final output of the strong classifier is determined by combining the weighted outputs of the weak classifiers. AdaBoost is a powerful algorithm that can achieve high accuracy with relatively few weak classifiers. However, it can be sensitive to outliers and noise in the data.AdaBoost (Adaptive Boosting) is a popular boosting algorithm that combines multiple weak classifiers to form a strong classifier. The basic idea behind AdaBoost is to iteratively train weak classifiers on the training data, and assign higher weights to the misclassified samples at each iteration. This allows the subsequent weak classifiers to focus more on the previously misclassified samples. Mathematically, the AdaBoost algorithm can be expressed as follows:Fm(x) is the model\u2019s prediction at iteration m, Fm\u22121(x) is the prediction at iteration m \u2212 1, \u03b3m is the learning rate for iteration m, and hm(x) is the weak model at iteration m. However, CatBoost uses a unique algorithm for handling categorical data, which involves splitting the categorical features into ordered groups and encoding them as numerical values. This approach can result in more accurate and efficient models for datasets with categorical features.Categorical boosting (CatBoost) is a gradient boosting algorithm that is designed to handle categorical features in machine learning problems. It uses a combination of ordered boosting, categorical features processing, and gradient-based decision tree algorithms to achieve high accuracy with categorical data. CatBoost also includes a set of techniques to prevent over-fitting and handle missing data. The mathematical equation for CatBoost is similar to other gradient boosting algorithms:Fm(x) is the model\u2019s prediction at iteration m, Fm\u22121(x) is the prediction at iteration m \u2212 1, \u03b3m is the learning rate for iteration m, and hm(x) is the weak model at iteration m. The weak model is usually a decision tree that predicts the residuals of the previous model. The GBM algorithm iteratively adds new weak models to the ensemble until the desired level of accuracy is achieved.Gradient Boosting Machine (GBM) is a machine learning algorithm that creates a predictive model by combining multiple weak models. GBM works by iteratively fitting new models to the residuals of the previous models, and combining their predictions to improve the overall accuracy. GBM is a powerful algorithm that can handle a variety of data types and is commonly used for regression and classification problems. The mathematical equation for GBM can be represented as:Similar to the gradient boosting machine (GBM) framework, LightGBM is the lightweight version of the gradient boosting mechanism and it is designed to be highly efficient and scalable, making it well-suited for large-scale machine learning applications. LightGBM uses histogram-based algorithms for computing gradients, which reduces memory usage and computation time. It also uses a leaf-wise tree growth strategy, which can lead to better accuracy with fewer trees. The mathematical equation for LightGBM is similar to the standard gradient boosting algorithm. However, LightGBM also introduces a new feature called \u201cleaf-wise growth,\u201d which means that the tree is grown by splitting the leaf that results in the largest reduction in the loss function, rather than the traditional level-wise approach. This results in a more accurate and efficient model.\u03b8 represents the model parameters, l is the loss function, yi is the actual value, fk) is a regularization term that penalizes complex models. The main goal is to accurately predict the target variable based on a large number of features. Given the brief summary of each machine learning-based models, hyper-parameter tuning is important for achieving optimal performance under each machine learning method. Accordingly, we used GridSearchCV to automatically find the optimal parameter values using the Python-based scikit-learn package. GridSearchCV is a lattice search technique that solves the complexity of machine learning models and reduces the repetitive computation time required to find optimal parameter values [Extreme Gradient Boosting (XGBoost) is a machine learning model that uses a gradient boosting framework to improve the performance of decision trees. The xgboost model is designed to handle large-scale datasets and is known for its speed, accuracy, and robustness. The xgboost model combines the outputs of multiple decision trees to make more accurate predictions. Each decision tree is trained on a subset of the data and the residuals of the previous trees, and the final prediction is made by aggregating the predictions of all the trees. The xgboost model uses a loss function to measure the difference between the predicted and actual values, and the gradient of the loss function is used to update the parameters of the model. The objective function of xgboost is defined as:r values \u201321. TablTo compare the model\u2019s performances, different evaluation criteria were used. Accuracy was used as an index to evaluate the similarity of the predicted data with the actual data and thereby determine the accuracy of the model. The confusion matrix, which is used as a performance indicator in binary classification, is an indicator that shows the level of confusion in a trained classification model when calculating the predicted values. The one-vs-rest (OVR) method was used to calculate the confusion matrix in this study, and the results were used for multiple classification. In other words, after being divided into \u201chigh\u201d, \u201cmedium\u201d, or \u201clow\u201d based on the difficulty levels, the questions could be classified into two groups, such as \u201chigh\u201d and \u201cmiddle/low,\u201d \u201cmiddle\u201d and \u201chigh/low,\u201d and \u201clow\u201d and \u201chigh/middle,\u201d and the final value would be calculated as the average value for each category. In the case of an unbalanced dataset, the reliability could be further improved by measuring the values of precision and recall, which have been recommended more than the accuracy score has in existing research. Precision and recall can be evaluated intensively for the predictive performance of positive datasets by using the true-positive (TP), false-positive (FP), and false-negative (FN) values calculated from the confusion matrix. The precision and recall values were calculated using the following equations:po is the observed proportion of agreements between the raters and pe is the proportion of agreements expected by chance. po is calculated as the number of observed agreements between the raters divided by the total number of ratings, while pe is calculated as the product of the marginal proportions of each rater\u2019s categories. It ranges from -1 to 1, where values closer to 1 indicate higher agreement between the model and the ground truth labels. Also, MCC is another metric that takes into account the true positives, true negatives, false positives, and false negatives. MCC can be calculated by using the concepts of confusion matrix metrics. The following equation computes the MCC score:The F1 score is an index combining both precision and recall. This index is used to evaluate the balance between precision and recall; the closer it is to 1, the better the performance. Finally, the AUC-ROC curve was used to evaluate the model\u2019s performance. Using this curve, the change in TP ratio  and the change in FP ratio  can be visually evaluated. In addition, due to the imbalanced dataset in terms of difficulty levels, comparing our models with accuracy and F1 scores may not be sufficient enough to justify which model is the best model. In this case, we additionally used two statistical methods of Cohen\u2019s Kappa and Matthew\u2019s Correlation Coefficient (MCC) metrics to further investigate and analyze our model comparisons. Cohen\u2019s Kappa measures the agreement between two raters  by accounting for the agreement that could occur by chance. The formula for Cohen\u2019s Kappa is as follows:The difficulty levels of mathematical questions can be evaluated on a numerical or character basis. In this study, the difficulties of the questions were classified based on the characteristics of the questions. Given the provided data, the values in the \u201cmulti-difficulty\u201d variable for each question ranged from 0 to 10; these were converted and labelled as \u201chigh,\u201d \u201cmedium,\u201d or \u201clow\u201d based on the given range of scores.The data on the mathematical questions used for the multi-class classification problem were obtained from 2015 to 2022, and they comprised approximately 320,000 rows. In this study, there were about 17,050 questions grouped by question IDs , and the grade range of students was from the 3rd grade of elementary school to the 2nd grade of high school; elementary, middle, and high school students accounted for 51.4, 47.8, and 0.83% of the total number of students, respectively, with there being more elementary and middle school students than high school students. Accordingly, there were more questions corresponding to elementary and middle school students; brief information on the variables used in the experiment is shown in A statistical t-test analysis was performed to verify the results of feature selection between the candidate variables. Variables other than answer type influenced question difficulty among the independent variables. Variables other than answer type were significant at a significance level of \u00b15%, and all the p-values were smaller than 0.05. The results of the significance tests are presented in In this study, considering the characteristics of various items, we attempted to classify item difficulties. A statistical t-test analysis was conducted to verify whether the characteristics of each item had a significant effect on its difficulty. The analysis revealed a positive correlation between the rate of correct answers for the items, each section of the item , and the solution time. However, there was no correlation with the answer type of the item; therefore, this characteristic was excluded from our analysis. The rate of correct answers for each item, each section of the item, and the solution time had p-values less than 0.05, supporting the assumptions in our experiment. Additionally, the difficulty of the mathematical question items was classified using various machine learning techniques. The xgboost model showed superior performance to those of statistical machine learning techniques, such as logistic regression, support vector machine, random forest, decision tree-based models, and k-nearest neighbor models. The xgboost model also had the best accuracy, F1, AUC-ROC, Kappa and MCC of 85.7%, 0.858, 0.961, 0.784 and 0.785 respectively."}
{"text": "Bilateral femoral neck stress fractures are relatively rare injuries that occur frequently in military recruits, athletes and patients with osteoporosis, renal bone disease, metabolic bone disease, and chronic steroid use. Herein, a case of an elderly patient with bilateral femoral neck stress fractures is reported.A 65-year-old man presented to the author\u2019s hospital with right hip pain for over a month. The patient was a farmer, had a long history of field labor before the onset of pain, denied any history of trauma.The patient was diagnosed with a right subcapital fracture of the femoral neck after examination. The patient complained of only right hip symptoms, and hip computed tomography showed no abnormalities in the left hip. A tension fracture of the left femoral neck was missed due to unawareness of the abnormal signal of the left femoral neck seen on right hip magnetic resonance imaging.During the first hospitalization, the patient underwent total hip arthroplasty (THA) on the right hip. Two months after the operation, the patient started to have pain in the left hip and underwent left THA again for a displaced left femoral neck fracture.The patient eventually underwent bilateral THA surgery and had a satisfactory functional recovery. But the oversight in the diagnostic process led to the patient undergoing left THA that could have been avoided.For patients who complain of hip pain but deny a history of trauma, we should be concerned about the presence of a hip fracture even if the patient\u2019s radiograph does not report a positive result. The most sensitive method is bilateral magnetic resonance imaging examination of the hip. Femoral neck stress fractures require early diagnosis and treatment to prevent complications. Fullerton and Snowdy classified stress fractures of the femoral neck as nondisplaced fractures on the compression side, nondisplaced fractures on the tension side or displaced fractures. Additionally, stress fractures can also be subdivided into fatigue fractures, where a normal bone is unable to respond adequately to abnormal stress (overload or overuse), and insufficiency fractures, where abnormal bone is unable to withstand normal stress. The most common symptom of a femoral neck stress fracture is pain in the hip and the inability to stand. Stress fractures in elderly patients often manifest as displaced fractures, which may be related to the decline in pain sensitivity in elderly individuals and inactive therapeutic interventions due to economic reasons. The treatment method for a femoral neck stress fracture needs to be considered according to the patient\u2019s physical condition, economic condition, age, fracture type and other factors. The general treatment methods include conservative treatment, internal fixation with cannulated screws, and sliding hip screw fixation, but patients with hip joint deformities are generally recommended to undergo valgus osteotomy, hip replacement  and so on.According to the literature, stress fractures mostly occur in athletes, soldiers or elderly individuals. Femoral neck fractures represent 11% of all stress fractures in athletes.We report the case of an elderly patient with bilateral femoral neck stress fractures. The first right THA was performed for the right subcapital fracture of the femoral neck. At that time, the nondisplaced left femoral neck fracture on the tension side was missed. Two months after the operation, the patient underwent left THA again for a displaced left femoral neck fracture.A 65-year-old Chinese male presented at our hospital with a 1-month history of onset of right hip pain. The pain was tolerable at that time, and the pain worsened 2 weeks later. A pelvic X-ray showed a fracture of the right femoral neck. The patient was a farmer, and he denied a recent history of trauma, glucocorticoid intake or radiotherapy. He had been a smoker and heavy drinker for more than 20 years.The blood examination and biochemical laboratory values were within normal limits. Whole-body bone mineral densitometry (BMD) was measured by dual-energy X-ray absorptiometry to assess the mineralization status of bones. BMD measured at the L1\u2013L4 level showed severe osteoporosis with a T score value of \u22124.1 and a Z score value of \u22122.6. At the left femoral neck level, the T score was \u22122.9 and the Z score was \u22121.7; at the right femoral neck level, the T score was \u22123.1 and the Z score was \u22121.9. The imaging examination is shown in Figure We recommended that the patient undergo right-sided THA. The patient consented and underwent right THA through a posterolateral approach under general anesthesia. During surgery, we found sclerosis, steatosis and necrosis at the fracture end of the right femoral neck. Two days after surgery, the patient was asked to exercise his quadriceps and calf muscles in bed and use a walker to move with the assistance of a sports therapist. Meanwhile, postoperative pelvic radiographs showed that the THA surgery was very successful Fig. . OverallTwo months after the operation, the patient was admitted to the hospital due to pain in the left hip. At the same time, he denied a history of trauma. The left lower limb could not be straightened when lying down. Blood examination and biochemical laboratory values were within normal limits. The imaging examinations are shown in Figure \u20137 However, we found that these patients are the most accessible in the clinical setting. Therefore, it is crucial to diagnose these patients promptly and to intervene early and correctly. Failure to identify potential occult fractures in a timely manner may result in serious secondary injury to the patient. In this case, the patient had a left-sided tension femoral neck fracture that was not detected at the first visit, leading the patient to undergo THA surgery on the right side alone. Occult fractures that are not effectively treated slowly develop into displaced fractures through daily life.Femoral neck stress fractures are rare injuries. To the best of our knowledge, the literature reports related to femoral neck stress fractures are mostly case reports on soldiers and athletes, and there are few reports on femoral neck stress fractures in elderly patients.,5,28\u201332 Fatigue fractures may also be secondary to patients with abnormal femoral neck anatomy.,33\u201335 The other type of fracture is an insufficiency fracture, in which the quality of the bone is reduced for various reasons, such as senile osteoporosis, postmenopausal osteoporosis, renal bone disease, vitamin D deficiency and other metabolic bone diseases, cortisol use, neurological sexual anorexia, and the use of certain drugs.,26,36,37 Devas et al proposed the earliest classification method for femoral neck stress fractures, which are divided into 2 types according to whether the fracture end is displaced: Type I, simple compression fracture without displacement; and Type II, compression fracture with displaced fracture ends. Blickenstaff and Morris summarized a new classification method: Type I, no obvious fracture line on X-ray, only localized bone thickening in the femoral neck; Type II, fracture line visible on X-ray through the neck or spur of the femur without displacement of the fracture end; and Type III, completely displaced femoral neck fracture. Fullerton and Snowdy further proposed a new classification based on the fracture mechanism (compression and tension fractures) and fracture displacement: Type I, compression fracture of the medial femoral neck; Type II, tension fracture of the lateral femoral neck; and Type III, completely displaced femoral neck fracture. Early diagnosis of femoral neck stress fractures is actually difficult. There may be only partial osteosclerosis or no positive signs at all on pelvic X-ray. Therefore, further hip computed tomography and magnetic resonance imaging (MRI) scans are required when the patient indicates a history of hip pain without positive signs on the pelvic radiograph. Hip MRI is currently the most sensitive imaging test for diagnosing femoral neck stress fractures. For elderly patients, whole-body BMD is also necessary. We recommend further laboratory tests, such as serum vitamin D, bone metabolism indicators and serum electrolytes, for such patients. Treatment depends on the type of fracture. It is necessary to comprehensively consider the patient\u2019s financial situation, age, physical condition and many other factors to formulate the most appropriate treatment plan for individual patients. In general, compression fractures can first be treated conservatively. However, conservative treatment of tension fractures has a high failure rate, and surgery is often considered after failure. Displaced fractures are recommended for surgical intervention. For younger patients, internal fixation with cannulated screws or sliding hip screw fixation is often the treatment of choice, while hip replacement is the usual option after failure of initial surgical treatment. Importantly, etiological treatment should be initiated promptly after surgical treatment to avoid subsequent fractures. For example, patients with osteoporosis require standardized anti-osteoporosis treatment. In addition, proper postoperative rehabilitation is essential. Some patients with a unilateral femoral neck stress fracture may develop a contralateral femoral neck stress fracture during postoperative rehabilitation due to stress changes.Based on the literature summary, we reviewed the case reports of femoral neck stress fractures and the corresponding treatment plans Table . The eti A complete BMD test at the time of admission can confirm the diagnosis of osteoporosis. The patient was a farmer, and his occupation required him to work in the fields for a long time. Therefore, we can speculate that the 2 together caused the bilateral femoral neck stress fracture in this patient, which can also be considered a type of insufficiency fracture. The patient should have been diagnosed with a left tension femoral neck fracture and a right displaced femoral neck fracture at the first visit. However, due to the lack of attention to the left femoral neck edema and abnormal signals indicated by the right hip MRI during the first treatment, no further MRI examination of the contralateral hip was performed, resulting in the missed diagnosis of left tension femoral neck fracture. Subsequently, during the rehabilitation period after the first THA, the patient was strengthened with muscle and pace exercises, which resulted in greater compression and load on the contralateral hip joint. The final result was that the left tension femoral neck fracture gradually developed into a displaced fracture. In this case, if abnormal edema signals in the left hip had been identified during the first hospitalization, early weight-bearing exercise would have been reduced after the right THA, and only muscle and nonweight-bearing training would have been performed. At the same time, intensifying the anti-osteoporotic therapy in this patient and regularly reviewing the progression of the left femoral neck nondisplaced fracture could have been one way to avoid a catastrophic outcome of the left femoral neck. Therefore, we recommend the following treatment options for patients with femoral neck stress fractures without a history of trauma  in patients with hip fractures without a history of trauma, further investigations on bone metabolism, osteoporosis and hip MRI are required to avoid underdiagnosis of occult fractures. (2) Hip fractures among different ages, fracture types and etiologies require individualized treatment options. In elderly patients, we recommend hip replacement to avoid the possibility of failure after internal fixation and the need for reoperation. (3) It is necessary to carry out corresponding basic treatment and regular review according to the etiology of patients with femoral neck stress fractures after surgery.For patients who complain of hip pain but deny a history of trauma, we should be concerned about the presence of a hip fracture even if the patient\u2019s radiograph does not report a positive result. The most sensitive method is bilateral MRI examination of the hip. We recommend a protocol for the management of patients with stress fractures of the femoral neck without a history of trauma. Stress fractures of the femoral neck require early diagnosis and proper treatment, and the necessary etiological treatment is indispensable.Conceptualization: Li Zhang.Investigation: Zhanglu Fang, Jianhua Cao.Visualization: Xun Wang.Writing \u2013 original draft: Zhanglu Fang, Xun Wang.Writing \u2013 review & editing: Li Zhang."}
{"text": "Radiofrequency echographic multi-spectrometry (REMS) is an ultrasound technique that has been recently introduced in the medical field to detect osteoporosis and fracture risk at axial sites. The use of sonography to visualize the region of interest (ROI) of the hip neck provides the opportunity to identify occult fractures. A 91-year-old woman with persistent right leg pain was referred to rheumatologist due to a known history of arthritis and osteoporosis. She was able to walk using a crutch, although experiencing an antalgic gait. The patient had recently fallen on her right side from standing height. During the visualization of the ROI of the right femoral neck using REMS, an abrupt break of the femoral cortex suspected to be a fracture was seen; therefore, the measurement of the femoral neck was performed on the left side. The T-score had value of \u22122.9 SD and the fragility score was 86.7. Due to unclear signs of a fracture after an X-ray of the hip, a computed tomography (CT) exam of the hip was performed, which revealed a femoral neck fracture. Occult fractures of the femoral neck are challenging to diagnose and require numerous radiologic exams. The use of ultrasound as a method to measure bone density allows the simultaneous diagnosis of osteoporosis and detection of fractures."}