Spaces:
Running
Running
import argparse | |
import os | |
import gzip | |
import pickle | |
import numpy as np | |
import pandas as pd | |
import tensorflow as tf | |
from Bio import SeqIO | |
# column names | |
ID_COL = 'Transcript ID' | |
SEQ_COL = 'Transcript Sequence' | |
TARGET_COL = 'Target Sequence' | |
GUIDE_COL = 'Guide Sequence' | |
MM_COL = 'Number of Mismatches' | |
SCORE_COL = 'Guide Score' | |
# nucleotide tokens | |
NUCLEOTIDE_TOKENS = dict(zip(['A', 'C', 'G', 'T', 'N'], [0, 1, 2, 3, 255])) | |
NUCLEOTIDE_COMPLEMENT = dict(zip(['A', 'C', 'G', 'T'], ['T', 'G', 'C', 'A'])) | |
# model hyper-parameters | |
GUIDE_LEN = 23 | |
CONTEXT_5P = 3 | |
CONTEXT_3P = 0 | |
TARGET_LEN = CONTEXT_5P + GUIDE_LEN + CONTEXT_3P | |
UNIT_INTERVAL_MAP = 'sigmoid' | |
# reference transcript files | |
REFERENCE_TRANSCRIPTS = ('gencode.v19.pc_transcripts.fa.gz', 'gencode.v19.lncRNA_transcripts.fa.gz') | |
# application configuration | |
BATCH_SIZE_COMPUTE = 500 | |
BATCH_SIZE_SCAN = 20 | |
BATCH_SIZE_TRANSCRIPTS = 50 | |
NUM_TOP_GUIDES = 10 | |
NUM_MISMATCHES = 3 | |
RUN_MODES = dict( | |
all='All on-target guides per transcript', | |
top_guides='Top {:d} guides per transcript'.format(NUM_TOP_GUIDES), | |
titration='Top {:d} guides per transcript & their titration candidates'.format(NUM_TOP_GUIDES) | |
) | |
# configure GPUs | |
for gpu in tf.config.list_physical_devices('GPU'): | |
tf.config.experimental.set_memory_growth(gpu, enable=True) | |
if len(tf.config.list_physical_devices('GPU')) > 0: | |
tf.config.experimental.set_visible_devices(tf.config.list_physical_devices('GPU')[0], 'GPU') | |
def load_transcripts(fasta_files: list, enforce_unique_ids: bool = True): | |
# load all transcripts from fasta files into a DataFrame | |
transcripts = pd.DataFrame() | |
for file in fasta_files: | |
try: | |
if os.path.splitext(file)[1] == '.gz': | |
with gzip.open(file, 'rt') as f: | |
df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(f, 'fasta')], columns=[ID_COL, SEQ_COL]) | |
else: | |
df = pd.DataFrame([(t.id, str(t.seq)) for t in SeqIO.parse(file, 'fasta')], columns=[ID_COL, SEQ_COL]) | |
except Exception as e: | |
print(e, 'while loading', file) | |
continue | |
transcripts = pd.concat([transcripts, df]) | |
# set index | |
transcripts[ID_COL] = transcripts[ID_COL].apply(lambda s: s.split('|')[0]) | |
transcripts.set_index(ID_COL, inplace=True) | |
if enforce_unique_ids: | |
assert not transcripts.index.has_duplicates, "duplicate transcript ID's detected in fasta file" | |
return transcripts | |
def sequence_complement(sequence: list): | |
return [''.join([NUCLEOTIDE_COMPLEMENT[nt] for nt in list(seq)]) for seq in sequence] | |
def one_hot_encode_sequence(sequence: list, add_context_padding: bool = False): | |
# stack list of sequences into a tensor | |
sequence = tf.ragged.stack([tf.constant(list(seq)) for seq in sequence], axis=0) | |
# tokenize sequence | |
nucleotide_table = tf.lookup.StaticVocabularyTable( | |
initializer=tf.lookup.KeyValueTensorInitializer( | |
keys=tf.constant(list(NUCLEOTIDE_TOKENS.keys()), dtype=tf.string), | |
values=tf.constant(list(NUCLEOTIDE_TOKENS.values()), dtype=tf.int64)), | |
num_oov_buckets=1) | |
sequence = tf.RaggedTensor.from_row_splits(values=nucleotide_table.lookup(sequence.values), | |
row_splits=sequence.row_splits).to_tensor(255) | |
# add context padding if requested | |
if add_context_padding: | |
pad_5p = 255 * tf.ones([sequence.shape[0], CONTEXT_5P], dtype=sequence.dtype) | |
pad_3p = 255 * tf.ones([sequence.shape[0], CONTEXT_3P], dtype=sequence.dtype) | |
sequence = tf.concat([pad_5p, sequence, pad_3p], axis=1) | |
# one-hot encode | |
sequence = tf.one_hot(sequence, depth=4, dtype=tf.float16) | |
return sequence | |
def process_data(transcript_seq: str): | |
# convert to upper case | |
transcript_seq = transcript_seq.upper() | |
# get all target sites | |
target_seq = [transcript_seq[i: i + TARGET_LEN] for i in range(len(transcript_seq) - TARGET_LEN + 1)] | |
# prepare guide sequences | |
guide_seq = sequence_complement([seq[CONTEXT_5P:len(seq) - CONTEXT_3P] for seq in target_seq]) | |
# model inputs | |
model_inputs = tf.concat([ | |
tf.reshape(one_hot_encode_sequence(target_seq, add_context_padding=False), [len(target_seq), -1]), | |
tf.reshape(one_hot_encode_sequence(guide_seq, add_context_padding=True), [len(guide_seq), -1]), | |
], axis=-1) | |
return target_seq, guide_seq, model_inputs | |
def calibrate_predictions(predictions: np.array, num_mismatches: np.array, params: pd.DataFrame = None): | |
if params is None: | |
params = pd.read_pickle('calibration_params.pkl') | |
correction = np.squeeze(params.set_index('num_mismatches').loc[num_mismatches, 'slope'].to_numpy()) | |
return correction * predictions | |
def score_predictions(predictions: np.array, params: pd.DataFrame = None): | |
if params is None: | |
params = pd.read_pickle('scoring_params.pkl') | |
if UNIT_INTERVAL_MAP == 'sigmoid': | |
params = params.iloc[0] | |
return 1 - 1 / (1 + np.exp(params['a'] * predictions + params['b'])) | |
elif UNIT_INTERVAL_MAP == 'min-max': | |
return 1 - (predictions - params['a']) / (params['b'] - params['a']) | |
elif UNIT_INTERVAL_MAP == 'exp-lin-exp': | |
# regime indices | |
active_saturation = predictions < params['a'] | |
linear_regime = (params['a'] <= predictions) & (predictions <= params['c']) | |
inactive_saturation = params['c'] < predictions | |
# linear regime | |
slope = (params['d'] - params['b']) / (params['c'] - params['a']) | |
intercept = -params['a'] * slope + params['b'] | |
predictions[linear_regime] = slope * predictions[linear_regime] + intercept | |
# active saturation regime | |
alpha = slope / params['b'] | |
beta = alpha * params['a'] - np.log(params['b']) | |
predictions[active_saturation] = np.exp(alpha * predictions[active_saturation] - beta) | |
# inactive saturation regime | |
alpha = slope / (1 - params['d']) | |
beta = -alpha * params['c'] - np.log(1 - params['d']) | |
predictions[inactive_saturation] = 1 - np.exp(-alpha * predictions[inactive_saturation] - beta) | |
return 1 - predictions | |
else: | |
raise NotImplementedError | |
def get_on_target_predictions(transcripts: pd.DataFrame, model: tf.keras.Model, status_update_fn=None): | |
# loop over transcripts | |
predictions = pd.DataFrame() | |
for i, (index, row) in enumerate(transcripts.iterrows()): | |
# parse transcript sequence | |
target_seq, guide_seq, model_inputs = process_data(row[SEQ_COL]) | |
# get predictions | |
lfc_estimate = model.predict(model_inputs, batch_size=BATCH_SIZE_COMPUTE, verbose=False)[:, 0] | |
lfc_estimate = calibrate_predictions(lfc_estimate, num_mismatches=np.zeros_like(lfc_estimate)) | |
scores = score_predictions(lfc_estimate) | |
predictions = pd.concat([predictions, pd.DataFrame({ | |
ID_COL: [index] * len(scores), | |
TARGET_COL: target_seq, | |
GUIDE_COL: guide_seq, | |
SCORE_COL: scores})]) | |
# progress update | |
percent_complete = 100 * min((i + 1) / len(transcripts), 1) | |
update_text = 'Evaluating on-target guides for each transcript: {:.2f}%'.format(percent_complete) | |
print('\r' + update_text, end='') | |
if status_update_fn is not None: | |
status_update_fn(update_text, percent_complete) | |
print('') | |
return predictions | |
def top_guides_per_transcript(predictions: pd.DataFrame): | |
# select and sort top guides for each transcript | |
top_guides = pd.DataFrame() | |
for transcript in predictions[ID_COL].unique(): | |
df = predictions.loc[predictions[ID_COL] == transcript] | |
df = df.sort_values(SCORE_COL, ascending=False).reset_index(drop=True).iloc[:NUM_TOP_GUIDES] | |
top_guides = pd.concat([top_guides, df]) | |
return top_guides.reset_index(drop=True) | |
def get_titration_candidates(top_guide_predictions: pd.DataFrame): | |
# generate a table of all titration candidates | |
titration_candidates = pd.DataFrame() | |
for _, row in top_guide_predictions.iterrows(): | |
for i in range(len(row[GUIDE_COL])): | |
nt = row[GUIDE_COL][i] | |
for mutation in set(NUCLEOTIDE_TOKENS.keys()) - {nt, 'N'}: | |
sm_guide = list(row[GUIDE_COL]) | |
sm_guide[i] = mutation | |
sm_guide = ''.join(sm_guide) | |
assert row[GUIDE_COL] != sm_guide | |
titration_candidates = pd.concat([titration_candidates, pd.DataFrame({ | |
ID_COL: [row[ID_COL]], | |
TARGET_COL: [row[TARGET_COL]], | |
GUIDE_COL: [sm_guide], | |
MM_COL: [1] | |
})]) | |
return titration_candidates | |
def find_off_targets(top_guides: pd.DataFrame, status_update_fn=None): | |
# load reference transcripts | |
reference_transcripts = load_transcripts([os.path.join('transcripts', f) for f in REFERENCE_TRANSCRIPTS]) | |
# one-hot encode guides to form a filter | |
guide_filter = one_hot_encode_sequence(sequence_complement(top_guides[GUIDE_COL]), add_context_padding=False) | |
guide_filter = tf.transpose(guide_filter, [1, 2, 0]) | |
# loop over transcripts in batches | |
i = 0 | |
off_targets = pd.DataFrame() | |
while i < len(reference_transcripts): | |
# select batch | |
df_batch = reference_transcripts.iloc[i:min(i + BATCH_SIZE_SCAN, len(reference_transcripts))] | |
i += BATCH_SIZE_SCAN | |
# find locations of off-targets | |
transcripts = one_hot_encode_sequence(df_batch[SEQ_COL].values.tolist(), add_context_padding=False) | |
num_mismatches = GUIDE_LEN - tf.nn.conv1d(transcripts, guide_filter, stride=1, padding='SAME') | |
loc_off_targets = tf.where(tf.round(num_mismatches) <= NUM_MISMATCHES).numpy() | |
# off-targets discovered | |
if len(loc_off_targets) > 0: | |
# log off-targets | |
dict_off_targets = pd.DataFrame({ | |
'On-target ' + ID_COL: top_guides.iloc[loc_off_targets[:, 2]][ID_COL], | |
GUIDE_COL: top_guides.iloc[loc_off_targets[:, 2]][GUIDE_COL], | |
'Off-target ' + ID_COL: df_batch.index.values[loc_off_targets[:, 0]], | |
'Guide Midpoint': loc_off_targets[:, 1], | |
SEQ_COL: df_batch[SEQ_COL].values[loc_off_targets[:, 0]], | |
MM_COL: tf.gather_nd(num_mismatches, loc_off_targets).numpy().astype(int), | |
}).to_dict('records') | |
# trim transcripts to targets | |
for row in dict_off_targets: | |
start_location = row['Guide Midpoint'] - (GUIDE_LEN // 2) | |
del row['Guide Midpoint'] | |
target = row[SEQ_COL] | |
del row[SEQ_COL] | |
if start_location < CONTEXT_5P: | |
target = target[0:GUIDE_LEN + CONTEXT_3P] | |
target = 'N' * (TARGET_LEN - len(target)) + target | |
elif start_location + GUIDE_LEN + CONTEXT_3P > len(target): | |
target = target[start_location - CONTEXT_5P:] | |
target = target + 'N' * (TARGET_LEN - len(target)) | |
else: | |
target = target[start_location - CONTEXT_5P:start_location + GUIDE_LEN + CONTEXT_3P] | |
if row[MM_COL] == 0 and 'N' not in target: | |
assert row[GUIDE_COL] == sequence_complement([target[CONTEXT_5P:TARGET_LEN - CONTEXT_3P]])[0] | |
row[TARGET_COL] = target | |
# append new off-targets | |
off_targets = pd.concat([off_targets, pd.DataFrame(dict_off_targets)]) | |
# progress update | |
percent_complete = 100 * min((i + 1) / len(reference_transcripts), 1) | |
update_text = 'Scanning for off-targets: {:.2f}%'.format(percent_complete) | |
print('\r' + update_text, end='') | |
if status_update_fn is not None: | |
status_update_fn(update_text, percent_complete) | |
print('') | |
return off_targets | |
def predict_off_target(off_targets: pd.DataFrame, model: tf.keras.Model): | |
if len(off_targets) == 0: | |
return pd.DataFrame() | |
# compute off-target predictions | |
model_inputs = tf.concat([ | |
tf.reshape(one_hot_encode_sequence(off_targets[TARGET_COL], add_context_padding=False), [len(off_targets), -1]), | |
tf.reshape(one_hot_encode_sequence(off_targets[GUIDE_COL], add_context_padding=True), [len(off_targets), -1]), | |
], axis=-1) | |
lfc_estimate = model.predict(model_inputs, batch_size=BATCH_SIZE_COMPUTE, verbose=False)[:, 0] | |
lfc_estimate = calibrate_predictions(lfc_estimate, off_targets['Number of Mismatches'].to_numpy()) | |
off_targets[SCORE_COL] = score_predictions(lfc_estimate) | |
return off_targets.reset_index(drop=True) | |
def tiger_exhibit(transcripts: pd.DataFrame, mode: str, check_off_targets: bool, status_update_fn=None): | |
# load model | |
if os.path.exists('model'): | |
tiger = tf.keras.models.load_model('model') | |
else: | |
print('no saved model!') | |
exit() | |
# evaluate all on-target guides per transcript | |
on_target_predictions = get_on_target_predictions(transcripts, tiger, status_update_fn) | |
# initialize other outputs | |
titration_predictions = off_target_predictions = None | |
if mode == 'all' and not check_off_targets: | |
off_target_candidates = None | |
elif mode == 'top_guides': | |
on_target_predictions = top_guides_per_transcript(on_target_predictions) | |
off_target_candidates = on_target_predictions | |
elif mode == 'titration': | |
on_target_predictions = top_guides_per_transcript(on_target_predictions) | |
titration_candidates = get_titration_candidates(on_target_predictions) | |
titration_predictions = predict_off_target(titration_candidates, model=tiger) | |
off_target_candidates = pd.concat([on_target_predictions, titration_predictions]) | |
else: | |
raise NotImplementedError | |
# check off-target effects for top guides | |
if check_off_targets and off_target_candidates is not None: | |
off_target_candidates = find_off_targets(off_target_candidates, status_update_fn) | |
off_target_predictions = predict_off_target(off_target_candidates, model=tiger) | |
if len(off_target_predictions) > 0: | |
off_target_predictions = off_target_predictions.sort_values(SCORE_COL, ascending=False) | |
off_target_predictions = off_target_predictions.reset_index(drop=True) | |
# finalize tables | |
for df in [on_target_predictions, titration_predictions, off_target_predictions]: | |
if df is not None and len(df) > 0: | |
for col in df.columns: | |
if ID_COL in col and set(df[col].unique()) == {'ManualEntry'}: | |
del df[col] | |
df[GUIDE_COL] = df[GUIDE_COL].apply(lambda s: s[::-1]) # reverse guide sequences | |
df[TARGET_COL] = df[TARGET_COL].apply(lambda seq: seq[CONTEXT_5P:len(seq) - CONTEXT_3P]) # remove context | |
return on_target_predictions, titration_predictions, off_target_predictions | |
if __name__ == '__main__': | |
# common arguments | |
parser = argparse.ArgumentParser() | |
parser.add_argument('--mode', type=str, default='titration') | |
parser.add_argument('--check_off_targets', action='store_true', default=False) | |
parser.add_argument('--fasta_path', type=str, default=None) | |
args = parser.parse_args() | |
# check for any existing results | |
if os.path.exists('on_target.csv') or os.path.exists('titration.csv') or os.path.exists('off_target.csv'): | |
raise FileExistsError('please rename or delete existing results') | |
# load transcripts from a directory of fasta files | |
if args.fasta_path is not None and os.path.exists(args.fasta_path): | |
df_transcripts = load_transcripts([os.path.join(args.fasta_path, f) for f in os.listdir(args.fasta_path)]) | |
# otherwise consider simple test case with first 50 nucleotides from EIF3B-003's CDS | |
else: | |
df_transcripts = pd.DataFrame({ | |
ID_COL: ['ManualEntry'], | |
SEQ_COL: ['ATGCAGGACGCGGAGAACGTGGCGGTGCCCGAGGCGGCCGAGGAGCGCGC']}) | |
df_transcripts.set_index(ID_COL, inplace=True) | |
# process in batches | |
batch = 0 | |
num_batches = len(df_transcripts) // BATCH_SIZE_TRANSCRIPTS | |
num_batches += (len(df_transcripts) % BATCH_SIZE_TRANSCRIPTS > 0) | |
for idx in range(0, len(df_transcripts), BATCH_SIZE_TRANSCRIPTS): | |
batch += 1 | |
print('Batch {:d} of {:d}'.format(batch, num_batches)) | |
# run batch | |
idx_stop = min(idx + BATCH_SIZE_TRANSCRIPTS, len(df_transcripts)) | |
df_on_target, df_titration, df_off_target = tiger_exhibit( | |
transcripts=df_transcripts[idx:idx_stop], | |
mode=args.mode, | |
check_off_targets=args.check_off_targets | |
) | |
# save batch results | |
df_on_target.to_csv('on_target.csv', header=batch == 1, index=False, mode='a') | |
if df_titration is not None: | |
df_titration.to_csv('titration.csv', header=batch == 1, index=False, mode='a') | |
if df_off_target is not None: | |
df_off_target.to_csv('off_target.csv', header=batch == 1, index=False, mode='a') | |
# clear session to prevent memory blow up | |
tf.keras.backend.clear_session() | |