Spaces:
Sleeping
Sleeping
| import os | |
| import tiger | |
| import cas9on | |
| import cas9off | |
| import pandas as pd | |
| import streamlit as st | |
| from pygenomeviz import GenomeViz | |
| import numpy as np | |
| from pathlib import Path | |
| # title and documentation | |
| st.markdown(Path('crisprTool.md').read_text(), unsafe_allow_html=True) | |
| st.divider() | |
| CRISPR_MODELS = ['Cas9', 'Cas12', 'Cas13d'] | |
| selected_model = st.selectbox('Select CRISPR model:', CRISPR_MODELS, key='selected_model') | |
| cas9on_path = 'cas9_model/on-cla.h5' | |
| def convert_df(df): | |
| # IMPORTANT: Cache the conversion to prevent computation on every rerun | |
| return df.to_csv().encode('utf-8') | |
| def mode_change_callback(): | |
| if st.session_state.mode in {tiger.RUN_MODES['all'], tiger.RUN_MODES['titration']}: # TODO: support titration | |
| st.session_state.check_off_targets = False | |
| st.session_state.disable_off_target_checkbox = True | |
| else: | |
| st.session_state.disable_off_target_checkbox = False | |
| def progress_update(update_text, percent_complete): | |
| with progress.container(): | |
| st.write(update_text) | |
| st.progress(percent_complete / 100) | |
| def initiate_run(): | |
| # initialize state variables | |
| st.session_state.transcripts = None | |
| st.session_state.input_error = None | |
| st.session_state.on_target = None | |
| st.session_state.titration = None | |
| st.session_state.off_target = None | |
| # initialize transcript DataFrame | |
| transcripts = pd.DataFrame(columns=[tiger.ID_COL, tiger.SEQ_COL]) | |
| # manual entry | |
| if st.session_state.entry_method == ENTRY_METHODS['manual']: | |
| transcripts = pd.DataFrame({ | |
| tiger.ID_COL: ['ManualEntry'], | |
| tiger.SEQ_COL: [st.session_state.manual_entry] | |
| }).set_index(tiger.ID_COL) | |
| # fasta file upload | |
| elif st.session_state.entry_method == ENTRY_METHODS['fasta']: | |
| if st.session_state.fasta_entry is not None: | |
| fasta_path = st.session_state.fasta_entry.name | |
| with open(fasta_path, 'w') as f: | |
| f.write(st.session_state.fasta_entry.getvalue().decode('utf-8')) | |
| transcripts = tiger.load_transcripts([fasta_path], enforce_unique_ids=False) | |
| os.remove(fasta_path) | |
| # convert to upper case as used by tokenizer | |
| transcripts[tiger.SEQ_COL] = transcripts[tiger.SEQ_COL].apply(lambda s: s.upper().replace('U', 'T')) | |
| # ensure all transcripts have unique identifiers | |
| if transcripts.index.has_duplicates: | |
| st.session_state.input_error = "Duplicate transcript ID's detected in fasta file" | |
| # ensure all transcripts only contain nucleotides A, C, G, T, and wildcard N | |
| elif not all(transcripts[tiger.SEQ_COL].apply(lambda s: set(s).issubset(tiger.NUCLEOTIDE_TOKENS.keys()))): | |
| st.session_state.input_error = 'Transcript(s) must only contain upper or lower case A, C, G, and Ts or Us' | |
| # ensure all transcripts satisfy length requirements | |
| elif any(transcripts[tiger.SEQ_COL].apply(lambda s: len(s) < tiger.TARGET_LEN)): | |
| st.session_state.input_error = 'Transcript(s) must be at least {:d} bases.'.format(tiger.TARGET_LEN) | |
| # run model if we have any transcripts | |
| elif len(transcripts) > 0: | |
| st.session_state.transcripts = transcripts | |
| # Check if the selected model is Cas9 | |
| if selected_model == 'Cas9': | |
| # Use a radio button to select enzymes, making sure only one can be selected at a time | |
| target_selection = st.radio( | |
| "Select either on-target or off-target:", | |
| ('on-target', 'off-target'), | |
| key='target_selection' | |
| ) | |
| if target_selection == 'on-target': | |
| # Gene symbol entry | |
| gene_symbol = st.text_input('Enter a Gene Symbol:', key='gene_symbol') | |
| # Prediction button | |
| predict_button = st.button('Predict on-target') | |
| # Process predictions | |
| if predict_button and gene_symbol: | |
| predictions, gene_sequence = cas9on.process_gene(gene_symbol, cas9on_path) | |
| sorted_predictions = sorted(predictions, key=lambda x: x[-1], reverse=True)[:10] | |
| st.session_state['on_target_results'] = sorted_predictions | |
| if 'on_target_results' in st.session_state and st.session_state['on_target_results']: | |
| df = pd.DataFrame(st.session_state['on_target_results'], | |
| columns=["Gene ID", "Start Pos", "End Pos", "Strand", "gRNA", "Prediction"]) | |
| # Pass the gene_sequence to the function | |
| genbank_file_path = f"{gene_symbol}_crispr_targets.gb" | |
| cas9on.generate_genbank_file_from_df(df, gene_sequence, gene_symbol, genbank_file_path) | |
| st.write('Top on-target predictions:') | |
| st.dataframe(df) | |
| # Initialize GenomeViz | |
| gv = GenomeViz() | |
| genome_size = max( | |
| df["End Pos"]) # Assuming the max end position approximates the genome size for visualization purposes | |
| track = gv.add_feature_track("CRISPR Targets", genome_size) | |
| for _, row in df.iterrows(): | |
| start, end, strand = row["Start Pos"], row["End Pos"], row["Strand"] | |
| label = row["gRNA"] | |
| track.add_feature(start, end, strand, label=label) | |
| # Save and display the visualization | |
| fig = gv.plotfig() | |
| st.pyplot(fig) | |
| # After the GenomeViz plot, include the download button | |
| with open(genbank_file_path, "rb") as file: | |
| btn = st.download_button( | |
| label="Download GenBank file", | |
| data=file, | |
| file_name=genbank_file_path, | |
| mime="application/octet-stream" | |
| ) | |
| os.remove(genbank_file_path) | |
| elif target_selection == 'off-target': | |
| ENTRY_METHODS = dict( | |
| manual='Manual entry of target sequence', | |
| txt="txt file upload" | |
| ) | |
| if __name__ == '__main__': | |
| # app initialization for Cas9 off-target | |
| if 'target_sequence' not in st.session_state: | |
| st.session_state.target_sequence = None | |
| if 'input_error' not in st.session_state: | |
| st.session_state.input_error = None | |
| if 'off_target_results' not in st.session_state: | |
| st.session_state.off_target_results = None | |
| # target sequence entry | |
| st.selectbox( | |
| label='How would you like to provide target sequences?', | |
| options=ENTRY_METHODS.values(), | |
| key='entry_method', | |
| disabled=st.session_state.target_sequence is not None | |
| ) | |
| if st.session_state.entry_method == ENTRY_METHODS['manual']: | |
| st.text_input( | |
| label='Enter on/off sequences:', | |
| key='manual_entry', | |
| placeholder='Enter on/off sequences like:GGGTGGGGGGAGTTTGCTCCAGG,AGGTGGGGTGA_TTTGCTCCAGG', | |
| disabled=st.session_state.target_sequence is not None | |
| ) | |
| elif st.session_state.entry_method == ENTRY_METHODS['txt']: | |
| st.file_uploader( | |
| label='Upload a txt file:', | |
| key='txt_entry', | |
| disabled=st.session_state.target_sequence is not None | |
| ) | |
| # prediction button | |
| if st.button('Predict off-target'): | |
| if st.session_state.entry_method == ENTRY_METHODS['manual']: | |
| user_input = st.session_state.manual_entry | |
| if user_input: # Check if user_input is not empty | |
| predictions = cas9off.process_input_and_predict(user_input, input_type='manual') | |
| elif st.session_state.entry_method == ENTRY_METHODS['txt']: | |
| uploaded_file = st.session_state.txt_entry | |
| if uploaded_file is not None: | |
| # Read the uploaded file content | |
| file_content = uploaded_file.getvalue().decode("utf-8") | |
| predictions = cas9off.process_input_and_predict(file_content, input_type='manual') | |
| st.session_state.off_target_results = predictions | |
| else: | |
| predictions = None | |
| progress = st.empty() | |
| # input error display | |
| error = st.empty() | |
| if st.session_state.input_error is not None: | |
| error.error(st.session_state.input_error, icon="🚨") | |
| else: | |
| error.empty() | |
| # off-target results display | |
| off_target_results = st.empty() | |
| if st.session_state.off_target_results is not None: | |
| with off_target_results.container(): | |
| if len(st.session_state.off_target_results) > 0: | |
| st.write('Off-target predictions:', st.session_state.off_target_results) | |
| st.download_button( | |
| label='Download off-target predictions', | |
| data=convert_df(st.session_state.off_target_results), | |
| file_name='off_target_results.csv', | |
| mime='text/csv' | |
| ) | |
| else: | |
| st.write('No significant off-target effects detected!') | |
| else: | |
| off_target_results.empty() | |
| # running the CRISPR-Net model for off-target predictions | |
| if st.session_state.target_sequence is not None: | |
| st.session_state.off_target_results = cas9off.predict_off_targets( | |
| target_sequence=st.session_state.target_sequence, | |
| status_update_fn=progress_update | |
| ) | |
| st.session_state.target_sequence = None | |
| st.experimental_rerun() | |
| elif selected_model == 'Cas12': | |
| # Placeholder for Cas12 model loading | |
| # TODO: Implement Cas12 model loading logic | |
| raise NotImplementedError("Cas12 model loading not implemented yet.") | |
| elif selected_model == 'Cas13d': | |
| ENTRY_METHODS = dict( | |
| manual='Manual entry of single transcript', | |
| fasta="Fasta file upload (supports multiple transcripts if they have unique ID's)" | |
| ) | |
| if __name__ == '__main__': | |
| # app initialization | |
| if 'mode' not in st.session_state: | |
| st.session_state.mode = tiger.RUN_MODES['all'] | |
| st.session_state.disable_off_target_checkbox = True | |
| if 'entry_method' not in st.session_state: | |
| st.session_state.entry_method = ENTRY_METHODS['manual'] | |
| if 'transcripts' not in st.session_state: | |
| st.session_state.transcripts = None | |
| if 'input_error' not in st.session_state: | |
| st.session_state.input_error = None | |
| if 'on_target' not in st.session_state: | |
| st.session_state.on_target = None | |
| if 'titration' not in st.session_state: | |
| st.session_state.titration = None | |
| if 'off_target' not in st.session_state: | |
| st.session_state.off_target = None | |
| # mode selection | |
| col1, col2 = st.columns([0.65, 0.35]) | |
| with col1: | |
| st.radio( | |
| label='What do you want to predict?', | |
| options=tuple(tiger.RUN_MODES.values()), | |
| key='mode', | |
| on_change=mode_change_callback, | |
| disabled=st.session_state.transcripts is not None, | |
| ) | |
| with col2: | |
| st.checkbox( | |
| label='Find off-target effects (slow)', | |
| key='check_off_targets', | |
| disabled=st.session_state.disable_off_target_checkbox or st.session_state.transcripts is not None | |
| ) | |
| # transcript entry | |
| st.selectbox( | |
| label='How would you like to provide transcript(s) of interest?', | |
| options=ENTRY_METHODS.values(), | |
| key='entry_method', | |
| disabled=st.session_state.transcripts is not None | |
| ) | |
| if st.session_state.entry_method == ENTRY_METHODS['manual']: | |
| st.text_input( | |
| label='Enter a target transcript:', | |
| key='manual_entry', | |
| placeholder='Upper or lower case', | |
| disabled=st.session_state.transcripts is not None | |
| ) | |
| elif st.session_state.entry_method == ENTRY_METHODS['fasta']: | |
| st.file_uploader( | |
| label='Upload a fasta file:', | |
| key='fasta_entry', | |
| disabled=st.session_state.transcripts is not None | |
| ) | |
| # let's go! | |
| st.button(label='Get predictions!', on_click=initiate_run, disabled=st.session_state.transcripts is not None) | |
| progress = st.empty() | |
| # input error | |
| error = st.empty() | |
| if st.session_state.input_error is not None: | |
| error.error(st.session_state.input_error, icon="🚨") | |
| else: | |
| error.empty() | |
| # on-target results | |
| on_target_results = st.empty() | |
| if st.session_state.on_target is not None: | |
| with on_target_results.container(): | |
| st.write('On-target predictions:', st.session_state.on_target) | |
| st.download_button( | |
| label='Download on-target predictions', | |
| data=convert_df(st.session_state.on_target), | |
| file_name='on_target.csv', | |
| mime='text/csv' | |
| ) | |
| else: | |
| on_target_results.empty() | |
| # titration results | |
| titration_results = st.empty() | |
| if st.session_state.titration is not None: | |
| with titration_results.container(): | |
| st.write('Titration predictions:', st.session_state.titration) | |
| st.download_button( | |
| label='Download titration predictions', | |
| data=convert_df(st.session_state.titration), | |
| file_name='titration.csv', | |
| mime='text/csv' | |
| ) | |
| else: | |
| titration_results.empty() | |
| # off-target results | |
| off_target_results = st.empty() | |
| if st.session_state.off_target is not None: | |
| with off_target_results.container(): | |
| if len(st.session_state.off_target) > 0: | |
| st.write('Off-target predictions:', st.session_state.off_target) | |
| st.download_button( | |
| label='Download off-target predictions', | |
| data=convert_df(st.session_state.off_target), | |
| file_name='off_target.csv', | |
| mime='text/csv' | |
| ) | |
| else: | |
| st.write('We did not find any off-target effects!') | |
| else: | |
| off_target_results.empty() | |
| # keep trying to run model until we clear inputs (streamlit UI changes can induce race-condition reruns) | |
| if st.session_state.transcripts is not None: | |
| st.session_state.on_target, st.session_state.titration, st.session_state.off_target = tiger.tiger_exhibit( | |
| transcripts=st.session_state.transcripts, | |
| mode={v: k for k, v in tiger.RUN_MODES.items()}[st.session_state.mode], | |
| check_off_targets=st.session_state.check_off_targets, | |
| status_update_fn=progress_update | |
| ) | |
| st.session_state.transcripts = None | |
| st.experimental_rerun() | |