Add ArgoNT-1b model for promoter prediction

README.md

@@ -1,3 +1,62 @@
----
-license: cc-by-nc-sa-4.0
----
+---
+license: cc-by-nc-sa-4.0
+widget:
+- text: AAAACATAATAATTTGCCGACTTACTCACCCTGTGATTAATCTATTTTCACTGTGTAGTAAGTAGAGAGTGTTACTTACTACAGTATCTATTTTTGTTTGGATGTTTGCCGTGGACAAGTGCTAACTGTCAAAACCCGTTTTGACCTTAAACCCAGCAATAATAATAATGTAAAACTCCATTGGGCAGTGCAACCTACTCCTCACATATTATATTATAATTCCTAAACCTTGATCAGTTAAATTAATAGCTCTGTTCCCTGTGGCTTTATATAAACACCATGGTTGTCAGCAGTTCAGCA
+tags:
+- DNA
+- biology
+- genomics
+---
+# Plant foundation DNA large language models
+
+The plant DNA large language models (LLMs) contain a series of foundation models based on different model architectures, which are pre-trained on various plant reference genomes.  
+All the models have a comparable model size between 90 MB and 150 MB, BPE tokenizer is used for tokenization and 8000 tokens are included in the vocabulary.  
+
+
+**Developed by:** zhangtaolab
+
+### Model Sources
+
+- **Repository:** [Plant DNA LLMs](https://github.com/zhangtaolab/plant_DNA_LLMs)
+- **Manuscript:** [Versatile applications of foundation DNA large language models in plant genomes]() 
+
+### Architecture
+
+The model is trained based on the InstaDeepAI/agro-nucleotide-transformer-1b model.
+
+This model is fine-tuned for predicting active core promoters.
+
+### How to use
+
+Install the runtime library first:
+```bash
+pip install transformers
+```
+
+Here is a simple code for inference:
+```python
+from transformers import AutoModelForSequenceClassification, AutoTokenizer, pipeline
+
+model_name = 'agront-1b-promoter'
+# load model and tokenizer
+model = AutoModelForSequenceClassification.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
+tokenizer = AutoTokenizer.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
+
+# inference
+sequences = ['TTACTAAATTTATAACGATTTTTTATCTAACTTTAGCTCATCAATCTTTACCGTGTCAAAATTTAGTGCCAAGAAGCAGACATGGCCCGATGATCTTTTACCCTGTTTTCATAGCTCGCGAGCCGCGACCTGTGTCCAACCTCAACGGTCACTGCAGTCCCAGCACCTCAGCAGCCTGCGCCTGCCATACCCCCTCCCCCACCCACCCACACACACCATCCGGGCCCACGGTGGGACCCAGATGTCATGCGCTGTACGGGCGAGCAACTAGCCCCCACCTCTTCCCAAGAGGCAAAACCT',
+             'GACCTAATGATTAACCAAGGAAAAATGCAAGGATTTGACAAAAATATAGAAGCCAATGCTAGGCGCCTAAGTGAATGGATATGAAACAAAAAGCGAGCAGGCTGTCTATATATGGACAATTAGTTGCATTAATATAGTAGTTTATAATTGCAAGCATGGCACTACATCACAACACCTAAAAGACATGCCGTGATGCTAGAACAGCCATTGAATAAATTAGAAAGAAAGGTTGTGGTTAATTAGTTAACGACCAATCGAGCCTACTAGTATAAATTGTACCTCGTTGTTATGAAGTAATTC']
+pipe = pipeline('text-classification', model=model, tokenizer=tokenizer,
+                trust_remote_code=True, top_k=None)
+results = pipe(sequences)
+print(results)
+
+```
+
+
+### Training data
+We use EsmForSequenceClassification to fine-tune the model.  
+Detailed training procedure can be found in our manuscript.
+
+
+#### Hardware
+Model was trained on a NVIDIA GTX4090 GPU (24 GB).

config.json

@@ -0,0 +1,37 @@
+{
+  "_name_or_path": "AgroNT-1b",
+  "architectures": [
+    "EsmForSequenceClassification"
+  ],
+  "attention_probs_dropout_prob": 0.0,
+  "emb_layer_norm_before": false,
+  "esmfold_config": null,
+  "hidden_dropout_prob": 0.0,
+  "hidden_size": 1500,
+  "id2label": {
+    "0": "Not promoter",
+    "1": "Core promoter"
+  },
+  "initializer_range": 0.02,
+  "intermediate_size": 5120,
+  "is_folding_model": false,
+  "label2id": {
+    "Not promoter": 0,
+    "Core promoter": 1
+  },
+  "layer_norm_eps": 1e-12,
+  "mask_token_id": 2,
+  "max_position_embeddings": 1026,
+  "model_type": "esm",
+  "num_attention_heads": 20,
+  "num_hidden_layers": 40,
+  "pad_token_id": 1,
+  "position_embedding_type": "absolute",
+  "tie_word_embeddings": false,
+  "token_dropout": false,
+  "torch_dtype": "float32",
+  "transformers_version": "4.39.1",
+  "use_cache": false,
+  "vocab_list": null,
+  "vocab_size": 4105
+}

esm_config.py

@@ -0,0 +1,379 @@
+# coding=utf-8
+# Copyright 2022 Meta and The HuggingFace Inc. team. All rights reserved.
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#     http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+""" ESM model configuration"""
+
+from dataclasses import asdict, dataclass
+from typing import Optional
+
+from transformers import PretrainedConfig, logging
+
+logger = logging.get_logger(__name__)
+
+# TODO Update this
+ESM_PRETRAINED_CONFIG_ARCHIVE_MAP = {
+    "facebook/esm-1b": "https://huggingface.co/facebook/esm-1b/resolve/main/config.json",
+    # See all ESM models at https://huggingface.co/models?filter=esm
+}
+
+
+class EsmConfig(PretrainedConfig):
+    r"""
+    This is the configuration class to store the configuration of a [`ESMModel`]. It is used to instantiate a ESM model
+    according to the specified arguments, defining the model architecture. Instantiating a configuration with the
+    defaults will yield a similar configuration to that of the ESM
+    [facebook/esm-1b](https://huggingface.co/facebook/esm-1b) architecture.
+
+    Configuration objects inherit from [`PretrainedConfig`] and can be used to control the model outputs. Read the
+    documentation from [`PretrainedConfig`] for more information.
+
+
+    Args:
+        vocab_size (`int`, *optional*):
+            Vocabulary size of the ESM model. Defines the number of different tokens that can be represented by the
+            `inputs_ids` passed when calling [`ESMModel`].
+        mask_token_id (`int`, *optional*):
+            The index of the mask token in the vocabulary. This must be included in the config because of the
+            "mask-dropout" scaling trick, which will scale the inputs depending on the number of masked tokens.
+        pad_token_id (`int`, *optional*):
+            The index of the padding token in the vocabulary. This must be included in the config because certain parts
+            of the ESM code use this instead of the attention mask.
+        hidden_size (`int`, *optional*, defaults to 768):
+            Dimensionality of the encoder layers and the pooler layer.
+        num_hidden_layers (`int`, *optional*, defaults to 12):
+            Number of hidden layers in the Transformer encoder.
+        num_attention_heads (`int`, *optional*, defaults to 12):
+            Number of attention heads for each attention layer in the Transformer encoder.
+        intermediate_size (`int`, *optional*, defaults to 3072):
+            Dimensionality of the "intermediate" (often named feed-forward) layer in the Transformer encoder.
+        hidden_dropout_prob (`float`, *optional*, defaults to 0.1):
+            The dropout probability for all fully connected layers in the embeddings, encoder, and pooler.
+        attention_probs_dropout_prob (`float`, *optional*, defaults to 0.1):
+            The dropout ratio for the attention probabilities.
+        max_position_embeddings (`int`, *optional*, defaults to 1026):
+            The maximum sequence length that this model might ever be used with. Typically set this to something large
+            just in case (e.g., 512 or 1024 or 2048).
+        initializer_range (`float`, *optional*, defaults to 0.02):
+            The standard deviation of the truncated_normal_initializer for initializing all weight matrices.
+        layer_norm_eps (`float`, *optional*, defaults to 1e-12):
+            The epsilon used by the layer normalization layers.
+        position_embedding_type (`str`, *optional*, defaults to `"absolute"`):
+            Type of position embedding. Choose one of `"absolute"`, `"relative_key"`, `"relative_key_query", "rotary"`.
+            For positional embeddings use `"absolute"`. For more information on `"relative_key"`, please refer to
+            [Self-Attention with Relative Position Representations (Shaw et al.)](https://arxiv.org/abs/1803.02155).
+            For more information on `"relative_key_query"`, please refer to *Method 4* in [Improve Transformer Models
+            with Better Relative Position Embeddings (Huang et al.)](https://arxiv.org/abs/2009.13658).
+        is_decoder (`bool`, *optional*, defaults to `False`):
+            Whether the model is used as a decoder or not. If `False`, the model is used as an encoder.
+        use_cache (`bool`, *optional*, defaults to `True`):
+            Whether or not the model should return the last key/values attentions (not used by all models). Only
+            relevant if `config.is_decoder=True`.
+        emb_layer_norm_before (`bool`, *optional*):
+            Whether to apply layer normalization after embeddings but before the main stem of the network.
+        token_dropout (`bool`, defaults to `False`):
+            When this is enabled, masked tokens are treated as if they had been dropped out by input dropout.
+
+    Examples:
+
+    ```python
+    >>> from transformers import EsmModel, EsmConfig
+
+    >>> # Initializing a ESM facebook/esm-1b style configuration >>> configuration = EsmConfig()
+
+    >>> # Initializing a model from the configuration >>> model = ESMModel(configuration)
+
+    >>> # Accessing the model configuration >>> configuration = model.config
+    ```"""
+    model_type = "esm"
+
+    def __init__(
+        self,
+        vocab_size=None,
+        mask_token_id=None,
+        pad_token_id=None,
+        hidden_size=768,
+        num_hidden_layers=12,
+        num_attention_heads=12,
+        intermediate_size=3072,
+        hidden_dropout_prob=0.1,
+        attention_probs_dropout_prob=0.1,
+        max_position_embeddings=1026,
+        initializer_range=0.02,
+        layer_norm_eps=1e-12,
+        position_embedding_type="absolute",
+        use_cache=True,
+        emb_layer_norm_before=None,
+        token_dropout=False,
+        is_folding_model=False,
+        esmfold_config=None,
+        vocab_list=None,
+        add_bias_fnn=True,
+        **kwargs,
+    ):
+        super().__init__(
+            pad_token_id=pad_token_id, mask_token_id=mask_token_id, **kwargs
+        )
+
+        self.vocab_size = vocab_size
+        self.hidden_size = hidden_size
+        self.num_hidden_layers = num_hidden_layers
+        self.num_attention_heads = num_attention_heads
+        self.intermediate_size = intermediate_size
+        self.hidden_dropout_prob = hidden_dropout_prob
+        self.attention_probs_dropout_prob = attention_probs_dropout_prob
+        self.max_position_embeddings = max_position_embeddings
+        self.initializer_range = initializer_range
+        self.layer_norm_eps = layer_norm_eps
+        self.position_embedding_type = position_embedding_type
+        self.use_cache = use_cache
+        self.emb_layer_norm_before = emb_layer_norm_before
+        self.token_dropout = token_dropout
+        self.is_folding_model = is_folding_model
+        # Arguments needed for Dalmatian
+        self.add_bias_fnn = add_bias_fnn
+        if is_folding_model:
+            if esmfold_config is None:
+                logger.info(
+                    "No esmfold_config supplied for folding model, using default values."
+                )
+                esmfold_config = EsmFoldConfig()
+            elif isinstance(esmfold_config, dict):
+                esmfold_config = EsmFoldConfig(**esmfold_config)
+            self.esmfold_config = esmfold_config
+            if vocab_list is None:
+                logger.warning(
+                    "No vocab_list supplied for folding model, assuming the ESM-2 vocabulary!"
+                )
+                self.vocab_list = get_default_vocab_list()
+            else:
+                self.vocab_list = vocab_list
+        else:
+            self.esmfold_config = None
+            self.vocab_list = None
+        if self.esmfold_config is not None and getattr(
+            self.esmfold_config, "use_esm_attn_map", False
+        ):
+            raise ValueError(
+                "The HuggingFace port of ESMFold does not support use_esm_attn_map at this time!"
+            )
+
+    def to_dict(self):
+        """
+        Serializes this instance to a Python dictionary. Override the default [`~PretrainedConfig.to_dict`].
+
+        Returns:
+            `Dict[str, any]`: Dictionary of all the attributes that make up this configuration instance,
+        """
+        output = super().to_dict()
+        if isinstance(self.esmfold_config, EsmFoldConfig):
+            output["esmfold_config"] = self.esmfold_config.to_dict()
+        return output
+
+
+@dataclass
+class EsmFoldConfig:
+    esm_type: str = None
+    fp16_esm: bool = True
+    use_esm_attn_map: bool = False
+    esm_ablate_pairwise: bool = False
+    esm_ablate_sequence: bool = False
+    esm_input_dropout: float = 0
+
+    embed_aa: bool = True
+    bypass_lm: bool = False
+
+    lddt_head_hid_dim: int = 128
+    trunk: "TrunkConfig" = None
+
+    def __post_init__(self):
+        if self.trunk is None:
+            self.trunk = TrunkConfig()
+        elif isinstance(self.trunk, dict):
+            self.trunk = TrunkConfig(**self.trunk)
+
+    def to_dict(self):
+        """
+        Serializes this instance to a Python dictionary. Override the default [`~PretrainedConfig.to_dict`].
+
+        Returns:
+            `Dict[str, any]`: Dictionary of all the attributes that make up this configuration instance,
+        """
+        output = asdict(self)
+        output["trunk"] = self.trunk.to_dict()
+        return output
+
+
+@dataclass
+class TrunkConfig:
+    num_blocks: int = 48
+    sequence_state_dim: int = 1024
+    pairwise_state_dim: int = 128
+    sequence_head_width: int = 32
+    pairwise_head_width: int = 32
+    position_bins: int = 32
+    dropout: float = 0
+    layer_drop: float = 0
+    cpu_grad_checkpoint: bool = False
+    max_recycles: int = 4
+    chunk_size: Optional[int] = 128
+    structure_module: "StructureModuleConfig" = None
+
+    def __post_init__(self):
+        if self.structure_module is None:
+            self.structure_module = StructureModuleConfig()
+        elif isinstance(self.structure_module, dict):
+            self.structure_module = StructureModuleConfig(**self.structure_module)
+
+        if self.max_recycles <= 0:
+            raise ValueError(
+                f"`max_recycles` should be positive, got {self.max_recycles}."
+            )
+        if self.sequence_state_dim % self.sequence_state_dim != 0:
+            raise ValueError(
+                "`sequence_state_dim` should be a round multiple of `sequence_state_dim`, got"
+                f" {self.sequence_state_dim} and {self.sequence_state_dim}."
+            )
+        if self.pairwise_state_dim % self.pairwise_state_dim != 0:
+            raise ValueError(
+                "`pairwise_state_dim` should be a round multiple of `pairwise_state_dim`, got"
+                f" {self.pairwise_state_dim} and {self.pairwise_state_dim}."
+            )
+
+        sequence_num_heads = self.sequence_state_dim // self.sequence_head_width
+        pairwise_num_heads = self.pairwise_state_dim // self.pairwise_head_width
+
+        if self.sequence_state_dim != sequence_num_heads * self.sequence_head_width:
+            raise ValueError(
+                "`sequence_state_dim` should be equal to `sequence_num_heads * sequence_head_width, got"
+                f" {self.sequence_state_dim} != {sequence_num_heads} * {self.sequence_head_width}."
+            )
+        if self.pairwise_state_dim != pairwise_num_heads * self.pairwise_head_width:
+            raise ValueError(
+                "`pairwise_state_dim` should be equal to `pairwise_num_heads * pairwise_head_width, got"
+                f" {self.pairwise_state_dim} != {pairwise_num_heads} * {self.pairwise_head_width}."
+            )
+        if self.pairwise_state_dim % 2 != 0:
+            raise ValueError(
+                f"`pairwise_state_dim` should be even, got {self.pairwise_state_dim}."
+            )
+
+        if self.dropout >= 0.4:
+            raise ValueError(
+                f"`dropout` should not be greater than 0.4, got {self.dropout}."
+            )
+
+    def to_dict(self):
+        """
+        Serializes this instance to a Python dictionary. Override the default [`~PretrainedConfig.to_dict`].
+
+        Returns:
+            `Dict[str, any]`: Dictionary of all the attributes that make up this configuration instance,
+        """
+        output = asdict(self)
+        output["structure_module"] = self.structure_module.to_dict()
+        return output
+
+
+@dataclass
+class StructureModuleConfig:
+    """
+    Args:
+        sequence_dim:
+            Single representation channel dimension
+        pairwise_dim:
+            Pair representation channel dimension
+        ipa_dim:
+            IPA hidden channel dimension
+        resnet_dim:
+            Angle resnet (Alg. 23 lines 11-14) hidden channel dimension
+        num_heads_ipa:
+            Number of IPA heads
+        num_qk_points:
+            Number of query/key points to generate during IPA
+        num_v_points:
+            Number of value points to generate during IPA
+        dropout_rate:
+            Dropout rate used throughout the layer
+        num_blocks:
+            Number of structure module blocks
+        num_transition_layers:
+            Number of layers in the single representation transition (Alg. 23 lines 8-9)
+        num_resnet_blocks:
+            Number of blocks in the angle resnet
+        num_angles:
+            Number of angles to generate in the angle resnet
+        trans_scale_factor:
+            Scale of single representation transition hidden dimension
+        epsilon:
+            Small number used in angle resnet normalization
+        inf:
+            Large number used for attention masking
+    """
+
+    sequence_dim: int = 384
+    pairwise_dim: int = 128
+    ipa_dim: int = 16
+    resnet_dim: int = 128
+    num_heads_ipa: int = 12
+    num_qk_points: int = 4
+    num_v_points: int = 8
+    dropout_rate: float = 0.1
+    num_blocks: int = 8
+    num_transition_layers: int = 1
+    num_resnet_blocks: int = 2
+    num_angles: int = 7
+    trans_scale_factor: int = 10
+    epsilon: float = 1e-8
+    inf: float = 1e5
+
+    def to_dict(self):
+        return asdict(self)
+
+
+def get_default_vocab_list():
+    return (
+        "<cls>",
+        "<pad>",
+        "<eos>",
+        "<unk>",
+        "L",
+        "A",
+        "G",
+        "V",
+        "S",
+        "E",
+        "R",
+        "T",
+        "I",
+        "D",
+        "P",
+        "K",
+        "Q",
+        "N",
+        "F",
+        "Y",
+        "M",
+        "H",
+        "W",
+        "C",
+        "X",
+        "B",
+        "U",
+        "Z",
+        "O",
+        ".",
+        "-",
+        "<null_1>",
+        "<mask>",
+    )

model.safetensors

@@ -0,0 +1,3 @@
+version https://git-lfs.github.com/spec/v1
+oid sha256:93fb586a67e477a48e533f0cf4d76ea014b6564d2c1ba5d1012a5fdae4d23f3b
+size 3940475180

modeling_esm.py

@@ -0,0 +1,1446 @@
+# coding=utf-8
+# Copyright 2022 Meta and The HuggingFace Inc. team. All rights reserved.
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#     http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+""" PyTorch ESM model."""
+
+import math
+from typing import List, Optional, Tuple, Union
+
+import torch
+import torch.utils.checkpoint
+from torch import nn
+from torch.nn import BCEWithLogitsLoss, CrossEntropyLoss, MSELoss, SiLU
+from transformers.file_utils import (
+    add_code_sample_docstrings,
+    add_start_docstrings,
+    add_start_docstrings_to_model_forward,
+)
+from transformers.modeling_outputs import (
+    BaseModelOutputWithPastAndCrossAttentions,
+    BaseModelOutputWithPoolingAndCrossAttentions,
+    MaskedLMOutput,
+    SequenceClassifierOutput,
+    TokenClassifierOutput,
+)
+from transformers.modeling_utils import (
+    PreTrainedModel,
+    find_pruneable_heads_and_indices,
+    prune_linear_layer,
+)
+from transformers.utils import logging
+
+from .esm_config import EsmConfig
+
+logger = logging.get_logger(__name__)
+
+_CHECKPOINT_FOR_DOC = "facebook/esm2_t6_8M_UR50D"
+_CONFIG_FOR_DOC = "EsmConfig"
+
+ESM_PRETRAINED_MODEL_ARCHIVE_LIST = [
+    "facebook/esm2_t6_8M_UR50D",
+    "facebook/esm2_t12_35M_UR50D",
+    # This is not a complete list of all ESM models!
+    # See all ESM models at https://huggingface.co/models?filter=esm
+]
+
+
+def rotate_half(x):
+    x1, x2 = x.chunk(2, dim=-1)
+    return torch.cat((-x2, x1), dim=-1)
+
+
+def apply_rotary_pos_emb(x, cos, sin):
+    cos = cos[:, :, : x.shape[-2], :]
+    sin = sin[:, :, : x.shape[-2], :]
+
+    return (x * cos) + (rotate_half(x) * sin)
+
+
+def gelu(x):
+    """
+    This is the gelu implementation from the original ESM repo. Using F.gelu yields subtly wrong results.
+    """
+    return x * 0.5 * (1.0 + torch.erf(x / math.sqrt(2.0)))
+
+
+def symmetrize(x):
+    "Make layer symmetric in final two dimensions, used for contact prediction."
+    return x + x.transpose(-1, -2)
+
+
+def average_product_correct(x):
+    "Perform average product correct, used for contact prediction."
+    a1 = x.sum(-1, keepdims=True)
+    a2 = x.sum(-2, keepdims=True)
+    a12 = x.sum((-1, -2), keepdims=True)
+
+    avg = a1 * a2
+    avg.div_(a12)  # in-place to reduce memory
+    normalized = x - avg
+    return normalized
+
+
+class RotaryEmbedding(torch.nn.Module):
+    """
+    Rotary position embeddings based on those in
+    [RoFormer](https://huggingface.co/docs/transformers/model_doc/roformer). Query and keys are transformed by rotation
+    matrices which depend on their relative positions.
+    """
+
+    def __init__(self, dim: int):
+        super().__init__()
+        # Generate and save the inverse frequency buffer (non trainable)
+        inv_freq = 1.0 / (10000 ** (torch.arange(0, dim, 2).float() / dim))
+        inv_freq = inv_freq
+        self.register_buffer("inv_freq", inv_freq)
+
+        self._seq_len_cached = None
+        self._cos_cached = None
+        self._sin_cached = None
+
+    def _update_cos_sin_tables(self, x, seq_dimension=2):
+        seq_len = x.shape[seq_dimension]
+
+        # Reset the tables if the sequence length has changed,
+        # or if we're on a new device (possibly due to tracing for instance)
+        if seq_len != self._seq_len_cached or self._cos_cached.device != x.device:
+            self._seq_len_cached = seq_len
+            t = torch.arange(x.shape[seq_dimension], device=x.device).type_as(
+                self.inv_freq
+            )
+            freqs = torch.outer(t, self.inv_freq)
+            emb = torch.cat((freqs, freqs), dim=-1).to(x.device)
+
+            self._cos_cached = emb.cos()[None, None, :, :]
+            self._sin_cached = emb.sin()[None, None, :, :]
+
+        return self._cos_cached, self._sin_cached
+
+    def forward(
+        self, q: torch.Tensor, k: torch.Tensor
+    ) -> Tuple[torch.Tensor, torch.Tensor]:
+        self._cos_cached, self._sin_cached = self._update_cos_sin_tables(
+            k, seq_dimension=-2
+        )
+
+        return (
+            apply_rotary_pos_emb(q, self._cos_cached, self._sin_cached),
+            apply_rotary_pos_emb(k, self._cos_cached, self._sin_cached),
+        )
+
+
+class EsmContactPredictionHead(nn.Module):
+    """Performs symmetrization, apc, and computes a logistic regression on the output features"""
+
+    def __init__(
+        self,
+        in_features: int,
+        bias=True,
+        eos_idx: int = 2,
+    ):
+        super().__init__()
+        self.in_features = in_features
+        self.eos_idx = eos_idx
+        self.regression = nn.Linear(in_features, 1, bias)
+        self.activation = nn.Sigmoid()
+
+    def forward(self, tokens, attentions):
+        # remove eos token attentions
+        eos_mask = tokens.ne(self.eos_idx).to(attentions)
+        eos_mask = eos_mask.unsqueeze(1) * eos_mask.unsqueeze(2)
+        attentions = attentions * eos_mask[:, None, None, :, :]
+        attentions = attentions[..., :-1, :-1]
+        # remove cls token attentions
+        attentions = attentions[..., 1:, 1:]
+        batch_size, layers, heads, seqlen, _ = attentions.size()
+        attentions = attentions.view(batch_size, layers * heads, seqlen, seqlen)
+
+        # features: batch x channels x tokens x tokens (symmetric)
+        attentions = attentions.to(
+            self.regression.weight.device
+        )  # attentions always float32, may need to convert to float16
+        attentions = average_product_correct(symmetrize(attentions))
+        attentions = attentions.permute(0, 2, 3, 1)
+        return self.activation(self.regression(attentions).squeeze(3))
+
+
+class EsmEmbeddings(nn.Module):
+    """
+    Same as BertEmbeddings with a tiny tweak for positional embeddings indexing.
+    """
+
+    def __init__(self, config):
+        super().__init__()
+        self.word_embeddings = nn.Embedding(
+            config.vocab_size, config.hidden_size, padding_idx=config.pad_token_id
+        )
+
+        if config.emb_layer_norm_before:
+            self.layer_norm = nn.LayerNorm(
+                config.hidden_size, eps=config.layer_norm_eps
+            )
+        else:
+            self.layer_norm = None
+        self.dropout = nn.Dropout(config.hidden_dropout_prob)
+        # position_ids (1, len position emb) is contiguous in memory and exported when serialized
+        self.position_embedding_type = getattr(
+            config, "position_embedding_type", "absolute"
+        )
+        self.register_buffer(
+            "position_ids",
+            torch.arange(config.max_position_embeddings).expand((1, -1)),
+            persistent=False,
+        )
+
+        self.padding_idx = config.pad_token_id
+        self.position_embeddings = nn.Embedding(
+            config.max_position_embeddings,
+            config.hidden_size,
+            padding_idx=self.padding_idx,
+        )
+        self.token_dropout = config.token_dropout
+        self.mask_token_id = config.mask_token_id
+
+    def forward(
+        self,
+        input_ids=None,
+        attention_mask=None,
+        position_ids=None,
+        inputs_embeds=None,
+        past_key_values_length=0,
+    ):
+        if position_ids is None:
+            if input_ids is not None:
+                # Create the position ids from the input token ids. Any padded tokens remain padded.
+                position_ids = create_position_ids_from_input_ids(
+                    input_ids, self.padding_idx, past_key_values_length
+                )
+            else:
+                position_ids = self.create_position_ids_from_inputs_embeds(
+                    inputs_embeds
+                )
+
+        if inputs_embeds is None:
+            inputs_embeds = self.word_embeddings(input_ids)
+
+        # Note that if we want to support ESM-1 (not 1b!) in future then we need to support an
+        # embedding_scale factor here.
+        embeddings = inputs_embeds
+
+        # Matt: ESM has the option to handle masking in MLM in a slightly unusual way. If the token_dropout
+        # flag is False then it is handled in the same was as BERT/RoBERTa. If it is set to True, however,
+        # masked tokens are treated as if they were selected for input dropout and zeroed out.
+        # This "mask-dropout" is compensated for when masked tokens are not present, by scaling embeddings by
+        # a factor of (fraction of unmasked tokens during training) / (fraction of unmasked tokens in sample).
+        # This is analogous to the way that dropout layers scale down outputs during evaluation when not
+        # actually dropping out values (or, equivalently, scale up their un-dropped outputs in training).
+        if self.token_dropout:
+            embeddings.masked_fill_(
+                (input_ids == self.mask_token_id).unsqueeze(-1), 0.0
+            )
+            mask_ratio_train = (
+                0.15 * 0.8
+            )  # Hardcoded as the ratio used in all ESM model training runs
+            src_lengths = attention_mask.sum(-1)
+            mask_ratio_observed = (input_ids == self.mask_token_id).sum(
+                -1
+            ).float() / src_lengths
+            embeddings = (
+                embeddings
+                * (1 - mask_ratio_train)
+                / (1 - mask_ratio_observed)[:, None, None]
+            ).to(embeddings.dtype)
+
+        if self.position_embedding_type == "absolute":
+            position_embeddings = self.position_embeddings(position_ids)
+            embeddings += position_embeddings
+
+        if self.layer_norm is not None:
+            embeddings = self.layer_norm(embeddings)
+        if attention_mask is not None:
+            embeddings = (embeddings * attention_mask.unsqueeze(-1)).to(
+                embeddings.dtype
+            )
+        # Matt: I think this line was copied incorrectly from BERT, disabling it for now.
+        # embeddings = self.dropout(embeddings)
+        return embeddings
+
+    def create_position_ids_from_inputs_embeds(self, inputs_embeds):
+        """
+        We are provided embeddings directly. We cannot infer which are padded so just generate sequential position ids.
+
+        Args:
+            inputs_embeds: torch.Tensor
+
+        Returns: torch.Tensor
+        """
+        input_shape = inputs_embeds.size()[:-1]
+        sequence_length = input_shape[1]
+
+        position_ids = torch.arange(
+            self.padding_idx + 1,
+            sequence_length + self.padding_idx + 1,
+            dtype=torch.long,
+            device=inputs_embeds.device,
+        )
+        return position_ids.unsqueeze(0).expand(input_shape)
+
+
+class EsmSelfAttention(nn.Module):
+    def __init__(self, config, position_embedding_type=None):
+        super().__init__()
+        if config.hidden_size % config.num_attention_heads != 0 and not hasattr(
+            config, "embedding_size"
+        ):
+            raise ValueError(
+                f"The hidden size ({config.hidden_size}) is not a multiple of the number of attention "
+                f"heads ({config.num_attention_heads})"
+            )
+
+        self.num_attention_heads = config.num_attention_heads
+        self.attention_head_size = int(config.hidden_size / config.num_attention_heads)
+        self.all_head_size = self.num_attention_heads * self.attention_head_size
+
+        self.query = nn.Linear(config.hidden_size, self.all_head_size)
+        self.key = nn.Linear(config.hidden_size, self.all_head_size)
+        self.value = nn.Linear(config.hidden_size, self.all_head_size)
+
+        self.dropout = nn.Dropout(config.attention_probs_dropout_prob)
+        self.position_embedding_type = position_embedding_type or getattr(
+            config, "position_embedding_type", "absolute"
+        )
+        self.rotary_embeddings = None
+        if (
+            self.position_embedding_type == "relative_key"
+            or self.position_embedding_type == "relative_key_query"
+        ):
+            self.max_position_embeddings = config.max_position_embeddings
+            self.distance_embedding = nn.Embedding(
+                2 * config.max_position_embeddings - 1, self.attention_head_size
+            )
+        elif self.position_embedding_type == "rotary":
+            self.rotary_embeddings = RotaryEmbedding(dim=self.attention_head_size)
+
+        self.is_decoder = config.is_decoder
+
+    def transpose_for_scores(self, x: torch.Tensor) -> torch.Tensor:
+        new_x_shape = x.size()[:-1] + (
+            self.num_attention_heads,
+            self.attention_head_size,
+        )
+        x = x.view(new_x_shape)
+        return x.permute(0, 2, 1, 3)
+
+    def forward(
+        self,
+        hidden_states: torch.Tensor,
+        attention_mask: Optional[torch.FloatTensor] = None,
+        head_mask: Optional[torch.FloatTensor] = None,
+        encoder_hidden_states: Optional[torch.FloatTensor] = None,
+        encoder_attention_mask: Optional[torch.FloatTensor] = None,
+        past_key_value: Optional[Tuple[Tuple[torch.FloatTensor]]] = None,
+        output_attentions: Optional[bool] = False,
+    ) -> Tuple[torch.Tensor]:
+        mixed_query_layer = self.query(hidden_states)
+
+        # If this is instantiated as a cross-attention module, the keys
+        # and values come from an encoder; the attention mask needs to be
+        # such that the encoder's padding tokens are not attended to.
+        is_cross_attention = encoder_hidden_states is not None
+
+        if is_cross_attention and past_key_value is not None:
+            # reuse k,v, cross_attentions
+            key_layer = past_key_value[0]
+            value_layer = past_key_value[1]
+            attention_mask = encoder_attention_mask
+        elif is_cross_attention:
+            key_layer = self.transpose_for_scores(self.key(encoder_hidden_states))
+            value_layer = self.transpose_for_scores(self.value(encoder_hidden_states))
+            attention_mask = encoder_attention_mask
+        elif past_key_value is not None:
+            key_layer = self.transpose_for_scores(self.key(hidden_states))
+            value_layer = self.transpose_for_scores(self.value(hidden_states))
+            key_layer = torch.cat([past_key_value[0], key_layer], dim=2)
+            value_layer = torch.cat([past_key_value[1], value_layer], dim=2)
+        else:
+            key_layer = self.transpose_for_scores(self.key(hidden_states))
+            value_layer = self.transpose_for_scores(self.value(hidden_states))
+
+        query_layer = self.transpose_for_scores(mixed_query_layer)
+
+        # Matt: Our BERT model (which this code was derived from) scales attention logits down by sqrt(head_dim).
+        # ESM scales the query down by the same factor instead. Modulo numerical stability these are equivalent,
+        # but not when rotary embeddings get involved. Therefore, we scale the query here to match the original
+        # ESM code and fix rotary embeddings.
+        query_layer = query_layer * self.attention_head_size**-0.5
+
+        if self.is_decoder:
+            # if cross_attention save Tuple(torch.Tensor, torch.Tensor) of all cross attention key/value_states.
+            # Further calls to cross_attention layer can then reuse all cross-attention
+            # key/value_states (first "if" case)
+            # if uni-directional self-attention (decoder) save Tuple(torch.Tensor, torch.Tensor) of
+            # all previous decoder key/value_states. Further calls to uni-directional self-attention
+            # can concat previous decoder key/value_states to current projected key/value_states (third "elif" case)
+            # if encoder bi-directional self-attention `past_key_value` is always `None`
+            past_key_value = (key_layer, value_layer)
+
+        if self.position_embedding_type == "rotary":
+            query_layer, key_layer = self.rotary_embeddings(query_layer, key_layer)
+
+        # Take the dot product between "query" and "key" to get the raw attention scores.
+        attention_scores = torch.matmul(query_layer, key_layer.transpose(-1, -2))
+
+        if (
+            self.position_embedding_type == "relative_key"
+            or self.position_embedding_type == "relative_key_query"
+        ):
+            seq_length = hidden_states.size()[1]
+            position_ids_l = torch.arange(
+                seq_length, dtype=torch.long, device=hidden_states.device
+            ).view(-1, 1)
+            position_ids_r = torch.arange(
+                seq_length, dtype=torch.long, device=hidden_states.device
+            ).view(1, -1)
+            distance = position_ids_l - position_ids_r
+            positional_embedding = self.distance_embedding(
+                distance + self.max_position_embeddings - 1
+            )
+            positional_embedding = positional_embedding.to(
+                dtype=query_layer.dtype
+            )  # fp16 compatibility
+
+            if self.position_embedding_type == "relative_key":
+                relative_position_scores = torch.einsum(
+                    "bhld,lrd->bhlr", query_layer, positional_embedding
+                )
+                attention_scores = attention_scores + relative_position_scores
+            elif self.position_embedding_type == "relative_key_query":
+                relative_position_scores_query = torch.einsum(
+                    "bhld,lrd->bhlr", query_layer, positional_embedding
+                )
+                relative_position_scores_key = torch.einsum(
+                    "bhrd,lrd->bhlr", key_layer, positional_embedding
+                )
+                attention_scores = (
+                    attention_scores
+                    + relative_position_scores_query
+                    + relative_position_scores_key
+                )
+
+        if attention_mask is not None:
+            # Apply the attention mask is (precomputed for all layers in EsmModel forward() function)
+            attention_scores = attention_scores + attention_mask
+
+        # Normalize the attention scores to probabilities.
+        attention_probs = nn.functional.softmax(attention_scores, dim=-1)
+
+        # This is actually dropping out entire tokens to attend to, which might
+        # seem a bit unusual, but is taken from the original Transformer paper.
+        attention_probs = self.dropout(attention_probs)
+
+        # Mask heads if we want to
+        if head_mask is not None:
+            attention_probs = attention_probs * head_mask
+
+        context_layer = torch.matmul(attention_probs, value_layer)
+
+        context_layer = context_layer.permute(0, 2, 1, 3).contiguous()
+        new_context_layer_shape = context_layer.size()[:-2] + (self.all_head_size,)
+        context_layer = context_layer.view(new_context_layer_shape)
+
+        outputs = (
+            (context_layer, attention_probs) if output_attentions else (context_layer,)
+        )
+
+        if self.is_decoder:
+            outputs = outputs + (past_key_value,)
+        return outputs
+
+
+class EsmSelfOutput(nn.Module):
+    def __init__(self, config):
+        super().__init__()
+        self.dense = nn.Linear(config.hidden_size, config.hidden_size)
+        self.dropout = nn.Dropout(config.hidden_dropout_prob)
+
+    def forward(self, hidden_states, input_tensor):
+        hidden_states = self.dense(hidden_states)
+        hidden_states = self.dropout(hidden_states)
+        hidden_states += input_tensor
+        return hidden_states
+
+
+class EsmAttention(nn.Module):
+    def __init__(self, config):
+        super().__init__()
+        self.self = EsmSelfAttention(config)
+        self.output = EsmSelfOutput(config)
+        self.pruned_heads = set()
+        self.LayerNorm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps)
+
+    def prune_heads(self, heads):
+        if len(heads) == 0:
+            return
+        heads, index = find_pruneable_heads_and_indices(
+            heads,
+            self.self.num_attention_heads,
+            self.self.attention_head_size,
+            self.pruned_heads,
+        )
+
+        # Prune linear layers
+        self.self.query = prune_linear_layer(self.self.query, index)
+        self.self.key = prune_linear_layer(self.self.key, index)
+        self.self.value = prune_linear_layer(self.self.value, index)
+        self.output.dense = prune_linear_layer(self.output.dense, index, dim=1)
+
+        # Update hyper params and store pruned heads
+        self.self.num_attention_heads = self.self.num_attention_heads - len(heads)
+        self.self.all_head_size = (
+            self.self.attention_head_size * self.self.num_attention_heads
+        )
+        self.pruned_heads = self.pruned_heads.union(heads)
+
+    def forward(
+        self,
+        hidden_states,
+        attention_mask=None,
+        head_mask=None,
+        encoder_hidden_states=None,
+        encoder_attention_mask=None,
+        past_key_value=None,
+        output_attentions=False,
+    ):
+        hidden_states_ln = self.LayerNorm(hidden_states)
+        self_outputs = self.self(
+            hidden_states_ln,
+            attention_mask,
+            head_mask,
+            encoder_hidden_states,
+            encoder_attention_mask,
+            past_key_value,
+            output_attentions,
+        )
+        attention_output = self.output(self_outputs[0], hidden_states)
+        outputs = (attention_output,) + self_outputs[
+            1:
+        ]  # add attentions if we output them
+        return outputs
+
+
+class EsmIntermediate(nn.Module):
+    def __init__(self, config):
+        super().__init__()
+
+        self.dense = nn.Linear(
+            config.hidden_size,
+            int(config.intermediate_size * 2),
+            bias=config.add_bias_fnn,
+        )
+        self.activation_fn = SiLU()
+
+    def forward(self, hidden_states: torch.Tensor) -> torch.Tensor:
+        hidden_states = self.dense(hidden_states)
+
+        # GLU
+        x1, x2 = hidden_states.split(int(hidden_states.size(-1) / 2), -1)
+        hidden_states = self.activation_fn(x1) * x2
+
+        return hidden_states
+
+
+class EsmOutput(nn.Module):
+    def __init__(self, config):
+        super().__init__()
+        self.dense = nn.Linear(
+            config.intermediate_size, config.hidden_size, bias=config.add_bias_fnn
+        )
+        self.dropout = nn.Dropout(config.hidden_dropout_prob)
+
+    def forward(self, hidden_states, input_tensor):
+        hidden_states = self.dense(hidden_states)
+        hidden_states = self.dropout(hidden_states)
+        hidden_states += input_tensor
+        return hidden_states
+
+
+class EsmLayer(nn.Module):
+    def __init__(self, config):
+        super().__init__()
+        self.chunk_size_feed_forward = config.chunk_size_feed_forward
+        self.seq_len_dim = 1
+        self.attention = EsmAttention(config)
+        self.is_decoder = config.is_decoder
+        self.add_cross_attention = config.add_cross_attention
+        if self.add_cross_attention:
+            if not self.is_decoder:
+                raise RuntimeError(
+                    f"{self} should be used as a decoder model if cross attention is added"
+                )
+            self.crossattention = EsmAttention(config)
+        self.intermediate = EsmIntermediate(config)
+        self.output = EsmOutput(config)
+        self.LayerNorm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps)
+
+    def forward(
+        self,
+        hidden_states,
+        attention_mask=None,
+        head_mask=None,
+        encoder_hidden_states=None,
+        encoder_attention_mask=None,
+        past_key_value=None,
+        output_attentions=False,
+    ):
+        # decoder uni-directional self-attention cached key/values tuple is at positions 1,2
+        self_attn_past_key_value = (
+            past_key_value[:2] if past_key_value is not None else None
+        )
+        self_attention_outputs = self.attention(
+            hidden_states,
+            attention_mask,
+            head_mask,
+            output_attentions=output_attentions,
+            past_key_value=self_attn_past_key_value,
+        )
+        attention_output = self_attention_outputs[0]
+
+        # if decoder, the last output is tuple of self-attn cache
+        if self.is_decoder:
+            outputs = self_attention_outputs[1:-1]
+            present_key_value = self_attention_outputs[-1]
+        else:
+            outputs = self_attention_outputs[
+                1:
+            ]  # add self attentions if we output attention weights
+
+        cross_attn_present_key_value = None
+        if self.is_decoder and encoder_hidden_states is not None:
+            if not hasattr(self, "crossattention"):
+                raise AttributeError(
+                    f"If `encoder_hidden_states` are passed, {self} has to be instantiated"
+                    " with cross-attention layers by setting `config.add_cross_attention=True`"
+                )
+
+            # cross_attn cached key/values tuple is at positions 3,4 of past_key_value tuple
+            cross_attn_past_key_value = (
+                past_key_value[-2:] if past_key_value is not None else None
+            )
+            cross_attention_outputs = self.crossattention(
+                attention_output,
+                attention_mask,
+                head_mask,
+                encoder_hidden_states,
+                encoder_attention_mask,
+                cross_attn_past_key_value,
+                output_attentions,
+            )
+            attention_output = cross_attention_outputs[0]
+            outputs = (
+                outputs + cross_attention_outputs[1:-1]
+            )  # add cross attentions if we output attention weights
+
+            # add cross-attn cache to positions 3,4 of present_key_value tuple
+            cross_attn_present_key_value = cross_attention_outputs[-1]
+            present_key_value = present_key_value + cross_attn_present_key_value
+
+        layer_output = self.feed_forward_chunk(attention_output)
+
+        outputs = (layer_output,) + outputs
+
+        # if decoder, return the attn key/values as the last output
+        if self.is_decoder:
+            outputs = outputs + (present_key_value,)
+        return outputs
+
+    def feed_forward_chunk(self, attention_output):
+        attention_output_ln = self.LayerNorm(attention_output)
+        intermediate_output = self.intermediate(attention_output_ln)
+        layer_output = self.output(intermediate_output, attention_output)
+        return layer_output
+
+
+class EsmEncoder(nn.Module):
+    def __init__(self, config):
+        super().__init__()
+        self.config = config
+        self.layer = nn.ModuleList(
+            [EsmLayer(config) for _ in range(config.num_hidden_layers)]
+        )
+        self.emb_layer_norm_after = nn.LayerNorm(
+            config.hidden_size, eps=config.layer_norm_eps
+        )
+        self.gradient_checkpointing = False
+
+    def forward(
+        self,
+        hidden_states,
+        attention_mask=None,
+        head_mask=None,
+        encoder_hidden_states=None,
+        encoder_attention_mask=None,
+        past_key_values=None,
+        use_cache=None,
+        output_attentions=False,
+        output_hidden_states=False,
+        return_dict=True,
+    ):
+        if self.gradient_checkpointing and self.training:
+            if use_cache:
+                logger.warning_once(
+                    "`use_cache=True` is incompatible with `config.gradient_checkpointing=True`. Setting "
+                    "`use_cache=False`..."
+                )
+                use_cache = False
+        all_hidden_states = () if output_hidden_states else None
+        all_self_attentions = () if output_attentions else None
+        all_cross_attentions = (
+            () if output_attentions and self.config.add_cross_attention else None
+        )
+
+        next_decoder_cache = () if use_cache else None
+        for i, layer_module in enumerate(self.layer):
+            if output_hidden_states:
+                all_hidden_states = all_hidden_states + (hidden_states,)
+
+            layer_head_mask = head_mask[i] if head_mask is not None else None
+            past_key_value = past_key_values[i] if past_key_values is not None else None
+
+            if self.gradient_checkpointing and self.training:
+
+                def create_custom_forward(module):
+                    def custom_forward(*inputs):
+                        return module(*inputs, past_key_value, output_attentions)
+
+                    return custom_forward
+
+                layer_outputs = torch.utils.checkpoint.checkpoint(
+                    create_custom_forward(layer_module),
+                    hidden_states,
+                    attention_mask,
+                    layer_head_mask,
+                    encoder_hidden_states,
+                    encoder_attention_mask,
+                )
+            else:
+                layer_outputs = layer_module(
+                    hidden_states,
+                    attention_mask,
+                    layer_head_mask,
+                    encoder_hidden_states,
+                    encoder_attention_mask,
+                    past_key_value,
+                    output_attentions,
+                )
+
+            hidden_states = layer_outputs[0]
+            if use_cache:
+                next_decoder_cache += (layer_outputs[-1],)
+            if output_attentions:
+                all_self_attentions = all_self_attentions + (layer_outputs[1],)
+                if self.config.add_cross_attention:
+                    all_cross_attentions = all_cross_attentions + (layer_outputs[2],)
+
+        if self.emb_layer_norm_after:
+            hidden_states = self.emb_layer_norm_after(hidden_states)
+
+        if output_hidden_states:
+            all_hidden_states = all_hidden_states + (hidden_states,)
+
+        if not return_dict:
+            return tuple(
+                v
+                for v in [
+                    hidden_states,
+                    next_decoder_cache,
+                    all_hidden_states,
+                    all_self_attentions,
+                    all_cross_attentions,
+                ]
+                if v is not None
+            )
+        return BaseModelOutputWithPastAndCrossAttentions(
+            last_hidden_state=hidden_states,
+            past_key_values=next_decoder_cache,
+            hidden_states=all_hidden_states,
+            attentions=all_self_attentions,
+            cross_attentions=all_cross_attentions,
+        )
+
+
+# Copied from transformers.models.bert.modeling_bert.BertPooler
+class EsmPooler(nn.Module):
+    def __init__(self, config):
+        super().__init__()
+        self.dense = nn.Linear(config.hidden_size, config.hidden_size)
+        self.activation = nn.Tanh()
+
+    def forward(self, hidden_states: torch.Tensor) -> torch.Tensor:
+        # We "pool" the model by simply taking the hidden state corresponding
+        # to the first token.
+        first_token_tensor = hidden_states[:, 0]
+        pooled_output = self.dense(first_token_tensor)
+        pooled_output = self.activation(pooled_output)
+        return pooled_output
+
+
+class EsmPreTrainedModel(PreTrainedModel):
+    """
+    An abstract class to handle weights initialization and a simple interface for downloading and loading pretrained
+    models.
+    """
+
+    config_class = EsmConfig
+    base_model_prefix = "esm"
+    _no_split_modules = ["EsmLayer", "EsmFoldTriangularSelfAttentionBlock"]
+
+    # Copied from transformers.models.bert.modeling_bert.BertPreTrainedModel._init_weights
+    def _init_weights(self, module):
+        """Initialize the weights"""
+        if isinstance(module, nn.Linear):
+            # Slightly different from the TF version which uses truncated_normal for initialization
+            # cf https://github.com/pytorch/pytorch/pull/5617
+            module.weight.data.normal_(mean=0.0, std=self.config.initializer_range)
+            if module.bias is not None:
+                module.bias.data.zero_()
+        elif isinstance(module, nn.Embedding):
+            module.weight.data.normal_(mean=0.0, std=self.config.initializer_range)
+            if module.padding_idx is not None:
+                module.weight.data[module.padding_idx].zero_()
+        elif isinstance(module, nn.LayerNorm):
+            module.bias.data.zero_()
+            module.weight.data.fill_(1.0)
+
+
+ESM_START_DOCSTRING = r"""
+
+    This model inherits from [`PreTrainedModel`]. Check the superclass documentation for the generic methods the
+    library implements for all its model (such as downloading or saving, resizing the input embeddings, pruning heads
+    etc.)
+
+    This model is also a PyTorch [torch.nn.Module](https://pytorch.org/docs/stable/nn.html#torch.nn.Module) subclass.
+    Use it as a regular PyTorch Module and refer to the PyTorch documentation for all matter related to general usage
+    and behavior.
+
+    Parameters:
+        config ([`EsmConfig`]): Model configuration class with all the parameters of the
+            model. Initializing with a config file does not load the weights associated with the model, only the
+            configuration. Check out the [`~PreTrainedModel.from_pretrained`] method to load the model weights.
+"""
+
+ESM_INPUTS_DOCSTRING = r"""
+    Args:
+        input_ids (`torch.LongTensor` of shape `({0})`):
+            Indices of input sequence tokens in the vocabulary.
+
+            Indices can be obtained using [`AutoTokenizer`]. See [`PreTrainedTokenizer.encode`] and
+            [`PreTrainedTokenizer.__call__`] for details.
+
+            [What are input IDs?](../glossary#input-ids)
+        attention_mask (`torch.FloatTensor` of shape `({0})`, *optional*):
+            Mask to avoid performing attention on padding token indices. Mask values selected in `[0, 1]`:
+
+            - 1 for tokens that are **not masked**,
+            - 0 for tokens that are **masked**.
+
+            [What are attention masks?](../glossary#attention-mask)
+        position_ids (`torch.LongTensor` of shape `({0})`, *optional*):
+            Indices of positions of each input sequence tokens in the position embeddings. Selected in the range `[0,
+            config.max_position_embeddings - 1]`.
+
+            [What are position IDs?](../glossary#position-ids)
+        head_mask (`torch.FloatTensor` of shape `(num_heads,)` or `(num_layers, num_heads)`, *optional*):
+            Mask to nullify selected heads of the self-attention modules. Mask values selected in `[0, 1]`:
+
+            - 1 indicates the head is **not masked**,
+            - 0 indicates the head is **masked**.
+
+        inputs_embeds (`torch.FloatTensor` of shape `({0}, hidden_size)`, *optional*):
+            Optionally, instead of passing `input_ids` you can choose to directly pass an embedded representation. This
+            is useful if you want more control over how to convert `input_ids` indices into associated vectors than the
+            model's internal embedding lookup matrix.
+        output_attentions (`bool`, *optional*):
+            Whether or not to return the attentions tensors of all attention layers. See `attentions` under returned
+            tensors for more detail.
+        output_hidden_states (`bool`, *optional*):
+            Whether or not to return the hidden states of all layers. See `hidden_states` under returned tensors for
+            more detail.
+        return_dict (`bool`, *optional*):
+            Whether or not to return a [`~file_utils.ModelOutput`] instead of a plain tuple.
+"""
+
+
+@add_start_docstrings(
+    "The bare ESM Model transformer outputting raw hidden-states without any specific head on top.",
+    ESM_START_DOCSTRING,
+)
+class EsmModel(EsmPreTrainedModel):
+    """
+
+    The model can behave as an encoder (with only self-attention) as well as a decoder, in which case a layer of
+    cross-attention is added between the self-attention layers, following the architecture described in [Attention is
+    all you need](https://arxiv.org/abs/1706.03762) by Ashish Vaswani, Noam Shazeer, Niki Parmar, Jakob Uszkoreit,
+    Llion Jones, Aidan N. Gomez, Lukasz Kaiser and Illia Polosukhin.
+
+    To behave as an decoder the model needs to be initialized with the `is_decoder` argument of the configuration set
+    to `True`. To be used in a Seq2Seq model, the model needs to initialized with both `is_decoder` argument and
+    `add_cross_attention` set to `True`; an `encoder_hidden_states` is then expected as an input to the forward pass.
+    """
+
+    supports_gradient_checkpointing = False
+
+    def __init__(self, config, add_pooling_layer=True):
+        super().__init__(config)
+        self.config = config
+
+        self.embeddings = EsmEmbeddings(config)
+        self.encoder = EsmEncoder(config)
+
+        self.pooler = EsmPooler(config) if add_pooling_layer else None
+
+        self.contact_head = EsmContactPredictionHead(
+            in_features=config.num_hidden_layers * config.num_attention_heads, bias=True
+        )
+
+        # Initialize weights and apply final processing
+        self.post_init()
+
+    def _set_gradient_checkpointing(self, module, value=False):
+        if isinstance(module, EsmEncoder):
+            module.gradient_checkpointing = value
+
+    def get_input_embeddings(self):
+        return self.embeddings.word_embeddings
+
+    def set_input_embeddings(self, value):
+        self.embeddings.word_embeddings = value
+
+    def _prune_heads(self, heads_to_prune):
+        """
+        Prunes heads of the model. heads_to_prune: dict of {layer_num: list of heads to prune in this layer} See base
+        class PreTrainedModel
+        """
+        for layer, heads in heads_to_prune.items():
+            self.encoder.layer[layer].attention.prune_heads(heads)
+
+    @add_start_docstrings_to_model_forward(
+        ESM_INPUTS_DOCSTRING.format("(batch_size, sequence_length)")
+    )
+    @add_code_sample_docstrings(
+        checkpoint=_CHECKPOINT_FOR_DOC,
+        output_type=BaseModelOutputWithPoolingAndCrossAttentions,
+        config_class=_CONFIG_FOR_DOC,
+    )
+    def forward(
+        self,
+        input_ids: Optional[torch.Tensor] = None,
+        attention_mask: Optional[torch.Tensor] = None,
+        position_ids: Optional[torch.Tensor] = None,
+        head_mask: Optional[torch.Tensor] = None,
+        inputs_embeds: Optional[torch.Tensor] = None,
+        encoder_hidden_states: Optional[torch.Tensor] = None,
+        encoder_attention_mask: Optional[torch.Tensor] = None,
+        past_key_values: Optional[List[torch.FloatTensor]] = None,
+        use_cache: Optional[bool] = None,
+        output_attentions: Optional[bool] = None,
+        output_hidden_states: Optional[bool] = None,
+        return_dict: Optional[bool] = None,
+    ) -> Union[Tuple[torch.Tensor], BaseModelOutputWithPoolingAndCrossAttentions]:
+        r"""
+        encoder_hidden_states  (`torch.FloatTensor` of shape `(batch_size, sequence_length, hidden_size)`, *optional*):
+            Sequence of hidden-states at the output of the last layer of the encoder. Used in the cross-attention if
+            the model is configured as a decoder.
+        encoder_attention_mask (`torch.FloatTensor` of shape `(batch_size, sequence_length)`, *optional*):
+            Mask to avoid performing attention on the padding token indices of the encoder input. This mask is used in
+            the cross-attention if the model is configured as a decoder. Mask values selected in `[0, 1]`:
+
+            - 1 for tokens that are **not masked**,
+            - 0 for tokens that are **masked**.
+        past_key_values (`tuple(tuple(torch.FloatTensor))` of length `config.n_layers` with each tuple having 4 tensors of shape `(batch_size, num_heads, sequence_length - 1, embed_size_per_head)`):
+            Contains precomputed key and value hidden states of the attention blocks. Can be used to speed up decoding.
+
+            If `past_key_values` are used, the user can optionally input only the last `decoder_input_ids` (those that
+            don't have their past key value states given to this model) of shape `(batch_size, 1)` instead of all
+            `decoder_input_ids` of shape `(batch_size, sequence_length)`.
+        use_cache (`bool`, *optional*):
+            If set to `True`, `past_key_values` key value states are returned and can be used to speed up decoding (see
+            `past_key_values`).
+        """
+        output_attentions = (
+            output_attentions
+            if output_attentions is not None
+            else self.config.output_attentions
+        )
+        output_hidden_states = (
+            output_hidden_states
+            if output_hidden_states is not None
+            else self.config.output_hidden_states
+        )
+        return_dict = (
+            return_dict if return_dict is not None else self.config.use_return_dict
+        )
+
+        if self.config.is_decoder:
+            use_cache = use_cache if use_cache is not None else self.config.use_cache
+        else:
+            use_cache = False
+
+        if input_ids is not None and inputs_embeds is not None:
+            raise ValueError(
+                "You cannot specify both input_ids and inputs_embeds at the same time"
+            )
+        elif input_ids is not None:
+            input_shape = input_ids.size()
+        elif inputs_embeds is not None:
+            input_shape = inputs_embeds.size()[:-1]
+        else:
+            raise ValueError("You have to specify either input_ids or inputs_embeds")
+
+        batch_size, seq_length = input_shape
+        device = input_ids.device if input_ids is not None else inputs_embeds.device
+
+        # past_key_values_length
+        past_key_values_length = (
+            past_key_values[0][0].shape[2] if past_key_values is not None else 0
+        )
+
+        if attention_mask is None:
+            attention_mask = torch.ones(
+                ((batch_size, seq_length + past_key_values_length)), device=device
+            )
+
+        # We can provide a self-attention mask of dimensions [batch_size, from_seq_length, to_seq_length]
+        # ourselves in which case we just need to make it broadcastable to all heads.
+        extended_attention_mask: torch.Tensor = self.get_extended_attention_mask(
+            attention_mask, input_shape
+        )
+
+        # If a 2D or 3D attention mask is provided for the cross-attention
+        # we need to make broadcastable to [batch_size, num_heads, seq_length, seq_length]
+        if self.config.is_decoder and encoder_hidden_states is not None:
+            (
+                encoder_batch_size,
+                encoder_sequence_length,
+                _,
+            ) = encoder_hidden_states.size()
+            encoder_hidden_shape = (encoder_batch_size, encoder_sequence_length)
+            if encoder_attention_mask is None:
+                encoder_attention_mask = torch.ones(encoder_hidden_shape, device=device)
+            encoder_extended_attention_mask = self.invert_attention_mask(
+                encoder_attention_mask
+            )
+        else:
+            encoder_extended_attention_mask = None
+
+        # Prepare head mask if needed
+        # 1.0 in head_mask indicate we keep the head
+        # attention_probs has shape bsz x n_heads x N x N
+        # input head_mask has shape [num_heads] or [num_hidden_layers x num_heads]
+        # and head_mask is converted to shape [num_hidden_layers x batch x num_heads x seq_length x seq_length]
+        head_mask = self.get_head_mask(head_mask, self.config.num_hidden_layers)
+
+        embedding_output = self.embeddings(
+            input_ids=input_ids,
+            position_ids=position_ids,
+            attention_mask=attention_mask,
+            inputs_embeds=inputs_embeds,
+            past_key_values_length=past_key_values_length,
+        )
+        encoder_outputs = self.encoder(
+            embedding_output,
+            attention_mask=extended_attention_mask,
+            head_mask=head_mask,
+            encoder_hidden_states=encoder_hidden_states,
+            encoder_attention_mask=encoder_extended_attention_mask,
+            past_key_values=past_key_values,
+            use_cache=use_cache,
+            output_attentions=output_attentions,
+            output_hidden_states=output_hidden_states,
+            return_dict=return_dict,
+        )
+        sequence_output = encoder_outputs[0]
+        pooled_output = (
+            self.pooler(sequence_output) if self.pooler is not None else None
+        )
+
+        if not return_dict:
+            return (sequence_output, pooled_output) + encoder_outputs[1:]
+
+        return BaseModelOutputWithPoolingAndCrossAttentions(
+            last_hidden_state=sequence_output,
+            pooler_output=pooled_output,
+            past_key_values=encoder_outputs.past_key_values,
+            hidden_states=encoder_outputs.hidden_states,
+            attentions=encoder_outputs.attentions,
+            cross_attentions=encoder_outputs.cross_attentions,
+        )
+
+    def predict_contacts(self, tokens, attention_mask):
+        attns = self(
+            tokens,
+            attention_mask=attention_mask,
+            return_dict=True,
+            output_attentions=True,
+        ).attentions
+        attns = torch.stack(attns, dim=1)  # Matches the original model layout
+        # In the original model, attentions for padding tokens are completely zeroed out.
+        # This makes no difference most of the time because the other tokens won't attend to them,
+        # but it does for the contact prediction task, which takes attentions as input,
+        # so we have to mimic that here.
+        attns *= attention_mask.unsqueeze(1).unsqueeze(2).unsqueeze(3)
+        attns *= attention_mask.unsqueeze(1).unsqueeze(2).unsqueeze(4)
+        return self.contact_head(tokens, attns)
+
+
+@add_start_docstrings(
+    """ESM Model with a `language modeling` head on top.""", ESM_START_DOCSTRING
+)
+class EsmForMaskedLM(EsmPreTrainedModel):
+    _tied_weights_keys = ["lm_head.decoder.weight"]
+
+    def __init__(self, config):
+        super().__init__(config)
+
+        if config.is_decoder:
+            logger.warning(
+                "If you want to use `EsmForMaskedLM` make sure `config.is_decoder=False` for "
+                "bi-directional self-attention."
+            )
+
+        self.esm = EsmModel(config, add_pooling_layer=False)
+        self.lm_head = EsmLMHead(config)
+
+        self.init_weights()
+
+    def get_output_embeddings(self):
+        return self.lm_head.decoder
+
+    def set_output_embeddings(self, new_embeddings):
+        self.lm_head.decoder = new_embeddings
+
+    @add_start_docstrings_to_model_forward(
+        ESM_INPUTS_DOCSTRING.format("batch_size, sequence_length")
+    )
+    @add_code_sample_docstrings(
+        checkpoint=_CHECKPOINT_FOR_DOC,
+        output_type=MaskedLMOutput,
+        config_class=_CONFIG_FOR_DOC,
+        mask="<mask>",
+    )
+    def forward(
+        self,
+        input_ids: Optional[torch.LongTensor] = None,
+        attention_mask: Optional[torch.Tensor] = None,
+        position_ids: Optional[torch.LongTensor] = None,
+        head_mask: Optional[torch.Tensor] = None,
+        inputs_embeds: Optional[torch.FloatTensor] = None,
+        encoder_hidden_states: Optional[torch.FloatTensor] = None,
+        encoder_attention_mask: Optional[torch.Tensor] = None,
+        labels: Optional[torch.LongTensor] = None,
+        output_attentions: Optional[bool] = None,
+        output_hidden_states: Optional[bool] = None,
+        return_dict: Optional[bool] = None,
+    ) -> Union[Tuple, MaskedLMOutput]:
+        r"""
+        labels (`torch.LongTensor` of shape `(batch_size, sequence_length)`, *optional*):
+            Labels for computing the masked language modeling loss. Indices should be in `[-100, 0, ...,
+            config.vocab_size]` (see `input_ids` docstring) Tokens with indices set to `-100` are ignored (masked), the
+            loss is only computed for the tokens with labels in `[0, ..., config.vocab_size]`
+        kwargs (`Dict[str, any]`, optional, defaults to *{}*):
+            Used to hide legacy arguments that have been deprecated.
+        """
+        return_dict = (
+            return_dict if return_dict is not None else self.config.use_return_dict
+        )
+
+        outputs = self.esm(
+            input_ids,
+            attention_mask=attention_mask,
+            position_ids=position_ids,
+            head_mask=head_mask,
+            inputs_embeds=inputs_embeds,
+            encoder_hidden_states=encoder_hidden_states,
+            encoder_attention_mask=encoder_attention_mask,
+            output_attentions=output_attentions,
+            output_hidden_states=output_hidden_states,
+            return_dict=return_dict,
+        )
+        sequence_output = outputs[0]
+        prediction_scores = self.lm_head(sequence_output)
+
+        masked_lm_loss = None
+        if labels is not None:
+            loss_fct = CrossEntropyLoss()
+
+            labels = labels.to(prediction_scores.device)
+            masked_lm_loss = loss_fct(
+                prediction_scores.view(-1, self.config.vocab_size), labels.view(-1)
+            )
+
+        if not return_dict:
+            output = (prediction_scores,) + outputs[2:]
+            return (
+                ((masked_lm_loss,) + output) if masked_lm_loss is not None else output
+            )
+
+        return MaskedLMOutput(
+            loss=masked_lm_loss,
+            logits=prediction_scores,
+            hidden_states=outputs.hidden_states,
+            attentions=outputs.attentions,
+        )
+
+    def predict_contacts(self, tokens, attention_mask):
+        return self.esm.predict_contacts(tokens, attention_mask=attention_mask)
+
+
+class EsmLMHead(nn.Module):
+    """ESM Head for masked language modeling."""
+
+    def __init__(self, config):
+        super().__init__()
+        self.dense = nn.Linear(config.hidden_size, config.hidden_size)
+        self.layer_norm = nn.LayerNorm(config.hidden_size, eps=config.layer_norm_eps)
+
+        self.decoder = nn.Linear(config.hidden_size, config.vocab_size, bias=False)
+        self.bias = nn.Parameter(torch.zeros(config.vocab_size))
+
+    def forward(self, features, **kwargs):
+        x = self.dense(features)
+        x = gelu(x)
+        x = self.layer_norm(x)
+
+        # project back to size of vocabulary with bias
+        x = self.decoder(x) + self.bias
+        return x
+
+
+@add_start_docstrings(
+    """
+    ESM Model transformer with a sequence classification/regression head on top (a linear layer on top of the pooled
+    output) e.g. for GLUE tasks.
+    """,
+    ESM_START_DOCSTRING,
+)
+class EsmForSequenceClassification(EsmPreTrainedModel):
+    def __init__(self, config):
+        super().__init__(config)
+        self.num_labels = config.num_labels
+        self.config = config
+
+        self.esm = EsmModel(config, add_pooling_layer=False)
+        self.classifier = EsmClassificationHead(config)
+
+        self.init_weights()
+
+    @add_start_docstrings_to_model_forward(
+        ESM_INPUTS_DOCSTRING.format("batch_size, sequence_length")
+    )
+    @add_code_sample_docstrings(
+        checkpoint=_CHECKPOINT_FOR_DOC,
+        output_type=SequenceClassifierOutput,
+        config_class=_CONFIG_FOR_DOC,
+    )
+    def forward(
+        self,
+        input_ids: Optional[torch.LongTensor] = None,
+        attention_mask: Optional[torch.Tensor] = None,
+        position_ids: Optional[torch.LongTensor] = None,
+        head_mask: Optional[torch.Tensor] = None,
+        inputs_embeds: Optional[torch.FloatTensor] = None,
+        labels: Optional[torch.LongTensor] = None,
+        output_attentions: Optional[bool] = None,
+        output_hidden_states: Optional[bool] = None,
+        return_dict: Optional[bool] = None,
+    ) -> Union[Tuple, SequenceClassifierOutput]:
+        r"""
+        labels (`torch.LongTensor` of shape `(batch_size,)`, *optional*):
+            Labels for computing the sequence classification/regression loss. Indices should be in `[0, ...,
+            config.num_labels - 1]`. If `config.num_labels == 1` a regression loss is computed (Mean-Square loss), If
+            `config.num_labels > 1` a classification loss is computed (Cross-Entropy).
+        """
+        return_dict = (
+            return_dict if return_dict is not None else self.config.use_return_dict
+        )
+
+        outputs = self.esm(
+            input_ids,
+            attention_mask=attention_mask,
+            position_ids=position_ids,
+            head_mask=head_mask,
+            inputs_embeds=inputs_embeds,
+            output_attentions=output_attentions,
+            output_hidden_states=output_hidden_states,
+            return_dict=return_dict,
+        )
+        sequence_output = outputs[0]
+        logits = self.classifier(sequence_output)
+
+        loss = None
+        if labels is not None:
+            labels = labels.to(logits.device)
+
+            if self.config.problem_type is None:
+                if self.num_labels == 1:
+                    self.config.problem_type = "regression"
+                elif self.num_labels > 1 and (
+                    labels.dtype == torch.long or labels.dtype == torch.int
+                ):
+                    self.config.problem_type = "single_label_classification"
+                else:
+                    self.config.problem_type = "multi_label_classification"
+
+            if self.config.problem_type == "regression":
+                loss_fct = MSELoss()
+                if self.num_labels == 1:
+                    loss = loss_fct(logits.squeeze(), labels.squeeze())
+                else:
+                    loss = loss_fct(logits, labels)
+            elif self.config.problem_type == "single_label_classification":
+                loss_fct = CrossEntropyLoss()
+                loss = loss_fct(logits.view(-1, self.num_labels), labels.view(-1))
+            elif self.config.problem_type == "multi_label_classification":
+                loss_fct = BCEWithLogitsLoss()
+                loss = loss_fct(logits, labels)
+
+        if not return_dict:
+            output = (logits,) + outputs[2:]
+            return ((loss,) + output) if loss is not None else output
+
+        return SequenceClassifierOutput(
+            loss=loss,
+            logits=logits,
+            hidden_states=outputs.hidden_states,
+            attentions=outputs.attentions,
+        )
+
+
+@add_start_docstrings(
+    """
+    ESM Model with a token classification head on top (a linear layer on top of the hidden-states output) e.g. for
+    Named-Entity-Recognition (NER) tasks.
+    """,
+    ESM_START_DOCSTRING,
+)
+class EsmForTokenClassification(EsmPreTrainedModel):
+    def __init__(self, config):
+        super().__init__(config)
+        self.num_labels = config.num_labels
+
+        self.esm = EsmModel(config, add_pooling_layer=False)
+        self.dropout = nn.Dropout(config.hidden_dropout_prob)
+        self.classifier = nn.Linear(config.hidden_size, config.num_labels)
+
+        self.init_weights()
+
+    @add_start_docstrings_to_model_forward(
+        ESM_INPUTS_DOCSTRING.format("batch_size, sequence_length")
+    )
+    @add_code_sample_docstrings(
+        checkpoint=_CHECKPOINT_FOR_DOC,
+        output_type=TokenClassifierOutput,
+        config_class=_CONFIG_FOR_DOC,
+    )
+    def forward(
+        self,
+        input_ids: Optional[torch.LongTensor] = None,
+        attention_mask: Optional[torch.Tensor] = None,
+        position_ids: Optional[torch.LongTensor] = None,
+        head_mask: Optional[torch.Tensor] = None,
+        inputs_embeds: Optional[torch.FloatTensor] = None,
+        labels: Optional[torch.LongTensor] = None,
+        output_attentions: Optional[bool] = None,
+        output_hidden_states: Optional[bool] = None,
+        return_dict: Optional[bool] = None,
+    ) -> Union[Tuple, TokenClassifierOutput]:
+        r"""
+        labels (`torch.LongTensor` of shape `(batch_size, sequence_length)`, *optional*):
+            Labels for computing the token classification loss. Indices should be in `[0, ..., config.num_labels - 1]`.
+        """
+        return_dict = (
+            return_dict if return_dict is not None else self.config.use_return_dict
+        )
+
+        outputs = self.esm(
+            input_ids,
+            attention_mask=attention_mask,
+            position_ids=position_ids,
+            head_mask=head_mask,
+            inputs_embeds=inputs_embeds,
+            output_attentions=output_attentions,
+            output_hidden_states=output_hidden_states,
+            return_dict=return_dict,
+        )
+
+        sequence_output = outputs[0]
+
+        sequence_output = self.dropout(sequence_output)
+        logits = self.classifier(sequence_output)
+
+        loss = None
+        if labels is not None:
+            loss_fct = CrossEntropyLoss()
+
+            labels = labels.to(logits.device)
+            loss = loss_fct(logits.view(-1, self.num_labels), labels.view(-1))
+
+        if not return_dict:
+            output = (logits,) + outputs[2:]
+            return ((loss,) + output) if loss is not None else output
+
+        return TokenClassifierOutput(
+            loss=loss,
+            logits=logits,
+            hidden_states=outputs.hidden_states,
+            attentions=outputs.attentions,
+        )
+
+
+class EsmClassificationHead(nn.Module):
+    """Head for sentence-level classification tasks."""
+
+    def __init__(self, config):
+        super().__init__()
+        self.dense = nn.Linear(config.hidden_size, config.hidden_size)
+        self.dropout = nn.Dropout(config.hidden_dropout_prob)
+        self.out_proj = nn.Linear(config.hidden_size, config.num_labels)
+
+    def forward(self, features, **kwargs):
+        x = features[:, 0, :]  # take <s> token (equiv. to [CLS])
+        x = self.dropout(x)
+        x = self.dense(x)
+        x = torch.tanh(x)
+        x = self.dropout(x)
+        x = self.out_proj(x)
+        return x
+
+
+def create_position_ids_from_input_ids(
+    input_ids, padding_idx, past_key_values_length=0
+):
+    """
+    Replace non-padding symbols with their position numbers. Position numbers begin at padding_idx+1. Padding symbols
+    are ignored. This is modified from fairseq's `utils.make_positions`.
+
+    Args:
+        x: torch.Tensor x:
+
+    Returns: torch.Tensor
+    """
+    # The series of casts and type-conversions here are carefully balanced to both work with ONNX export and XLA.
+    mask = input_ids.ne(padding_idx).int()
+    incremental_indices = (
+        torch.cumsum(mask, dim=1).type_as(mask) + past_key_values_length
+    ) * mask
+    return incremental_indices.long() + padding_idx

special_tokens_map.json

@@ -0,0 +1,6 @@
+{
+  "cls_token": "<cls>",
+  "mask_token": "<mask>",
+  "pad_token": "<pad>",
+  "unk_token": "<unk>"
+}

tokenizer_config.json

@@ -0,0 +1,44 @@
+{
+  "added_tokens_decoder": {
+    "0": {
+      "content": "<unk>",
+      "lstrip": false,
+      "normalized": false,
+      "rstrip": false,
+      "single_word": false,
+      "special": true
+    },
+    "1": {
+      "content": "<pad>",
+      "lstrip": false,
+      "normalized": false,
+      "rstrip": false,
+      "single_word": false,
+      "special": true
+    },
+    "2": {
+      "content": "<mask>",
+      "lstrip": false,
+      "normalized": false,
+      "rstrip": false,
+      "single_word": false,
+      "special": true
+    },
+    "3": {
+      "content": "<cls>",
+      "lstrip": false,
+      "normalized": false,
+      "rstrip": false,
+      "single_word": false,
+      "special": true
+    }
+  },
+  "clean_up_tokenization_spaces": true,
+  "cls_token": "<cls>",
+  "eos_token": null,
+  "mask_token": "<mask>",
+  "model_max_length": 512,
+  "pad_token": "<pad>",
+  "tokenizer_class": "EsmTokenizer",
+  "unk_token": "<unk>"
+}

vocab.txt

@@ -0,0 +1,4107 @@
+<unk>
+<pad>
+<mask>
+<cls>
+AAAAAA
+AAAAAT
+AAAAAC
+AAAAAG
+AAAATA
+AAAATT
+AAAATC
+AAAATG
+AAAACA
+AAAACT
+AAAACC
+AAAACG
+AAAAGA
+AAAAGT
+AAAAGC
+AAAAGG
+AAATAA
+AAATAT
+AAATAC
+AAATAG
+AAATTA
+AAATTT
+AAATTC
+AAATTG
+AAATCA
+AAATCT
+AAATCC
+AAATCG
+AAATGA
+AAATGT
+AAATGC
+AAATGG
+AAACAA
+AAACAT
+AAACAC
+AAACAG
+AAACTA
+AAACTT
+AAACTC
+AAACTG
+AAACCA
+AAACCT
+AAACCC
+AAACCG
+AAACGA
+AAACGT
+AAACGC
+AAACGG
+AAAGAA
+AAAGAT
+AAAGAC
+AAAGAG
+AAAGTA
+AAAGTT
+AAAGTC
+AAAGTG
+AAAGCA
+AAAGCT
+AAAGCC
+AAAGCG
+AAAGGA
+AAAGGT
+AAAGGC
+AAAGGG
+AATAAA
+AATAAT
+AATAAC
+AATAAG
+AATATA
+AATATT
+AATATC
+AATATG
+AATACA
+AATACT
+AATACC
+AATACG
+AATAGA
+AATAGT
+AATAGC
+AATAGG
+AATTAA
+AATTAT
+AATTAC
+AATTAG
+AATTTA
+AATTTT
+AATTTC
+AATTTG
+AATTCA
+AATTCT
+AATTCC
+AATTCG
+AATTGA
+AATTGT
+AATTGC
+AATTGG
+AATCAA
+AATCAT
+AATCAC
+AATCAG
+AATCTA
+AATCTT
+AATCTC
+AATCTG
+AATCCA
+AATCCT
+AATCCC
+AATCCG
+AATCGA
+AATCGT
+AATCGC
+AATCGG
+AATGAA
+AATGAT
+AATGAC
+AATGAG
+AATGTA
+AATGTT
+AATGTC
+AATGTG
+AATGCA
+AATGCT
+AATGCC
+AATGCG
+AATGGA
+AATGGT
+AATGGC
+AATGGG
+AACAAA
+AACAAT
+AACAAC
+AACAAG
+AACATA
+AACATT
+AACATC
+AACATG
+AACACA
+AACACT
+AACACC
+AACACG
+AACAGA
+AACAGT
+AACAGC
+AACAGG
+AACTAA
+AACTAT
+AACTAC
+AACTAG
+AACTTA
+AACTTT
+AACTTC
+AACTTG
+AACTCA
+AACTCT
+AACTCC
+AACTCG
+AACTGA
+AACTGT
+AACTGC
+AACTGG
+AACCAA
+AACCAT
+AACCAC
+AACCAG
+AACCTA
+AACCTT
+AACCTC
+AACCTG
+AACCCA
+AACCCT
+AACCCC
+AACCCG
+AACCGA
+AACCGT
+AACCGC
+AACCGG
+AACGAA
+AACGAT
+AACGAC
+AACGAG
+AACGTA
+AACGTT
+AACGTC
+AACGTG
+AACGCA
+AACGCT
+AACGCC
+AACGCG
+AACGGA
+AACGGT
+AACGGC
+AACGGG
+AAGAAA
+AAGAAT
+AAGAAC
+AAGAAG
+AAGATA
+AAGATT
+AAGATC
+AAGATG
+AAGACA
+AAGACT
+AAGACC
+AAGACG
+AAGAGA
+AAGAGT
+AAGAGC
+AAGAGG
+AAGTAA
+AAGTAT
+AAGTAC
+AAGTAG
+AAGTTA
+AAGTTT
+AAGTTC
+AAGTTG
+AAGTCA
+AAGTCT
+AAGTCC
+AAGTCG
+AAGTGA
+AAGTGT
+AAGTGC
+AAGTGG
+AAGCAA
+AAGCAT
+AAGCAC
+AAGCAG
+AAGCTA
+AAGCTT
+AAGCTC
+AAGCTG
+AAGCCA
+AAGCCT
+AAGCCC
+AAGCCG
+AAGCGA
+AAGCGT
+AAGCGC
+AAGCGG
+AAGGAA
+AAGGAT
+AAGGAC
+AAGGAG
+AAGGTA
+AAGGTT
+AAGGTC
+AAGGTG
+AAGGCA
+AAGGCT
+AAGGCC
+AAGGCG
+AAGGGA
+AAGGGT
+AAGGGC
+AAGGGG
+ATAAAA
+ATAAAT
+ATAAAC
+ATAAAG
+ATAATA
+ATAATT
+ATAATC
+ATAATG
+ATAACA
+ATAACT
+ATAACC
+ATAACG
+ATAAGA
+ATAAGT
+ATAAGC
+ATAAGG
+ATATAA
+ATATAT
+ATATAC
+ATATAG
+ATATTA
+ATATTT
+ATATTC
+ATATTG
+ATATCA
+ATATCT
+ATATCC
+ATATCG
+ATATGA
+ATATGT
+ATATGC
+ATATGG
+ATACAA
+ATACAT
+ATACAC
+ATACAG
+ATACTA
+ATACTT
+ATACTC
+ATACTG
+ATACCA
+ATACCT
+ATACCC
+ATACCG
+ATACGA
+ATACGT
+ATACGC
+ATACGG
+ATAGAA
+ATAGAT
+ATAGAC
+ATAGAG
+ATAGTA
+ATAGTT
+ATAGTC
+ATAGTG
+ATAGCA
+ATAGCT
+ATAGCC
+ATAGCG
+ATAGGA
+ATAGGT
+ATAGGC
+ATAGGG
+ATTAAA
+ATTAAT
+ATTAAC
+ATTAAG
+ATTATA
+ATTATT
+ATTATC
+ATTATG
+ATTACA
+ATTACT
+ATTACC
+ATTACG
+ATTAGA
+ATTAGT
+ATTAGC
+ATTAGG
+ATTTAA
+ATTTAT
+ATTTAC
+ATTTAG
+ATTTTA
+ATTTTT
+ATTTTC
+ATTTTG
+ATTTCA
+ATTTCT
+ATTTCC
+ATTTCG
+ATTTGA
+ATTTGT
+ATTTGC
+ATTTGG
+ATTCAA
+ATTCAT
+ATTCAC
+ATTCAG
+ATTCTA
+ATTCTT
+ATTCTC
+ATTCTG
+ATTCCA
+ATTCCT
+ATTCCC
+ATTCCG
+ATTCGA
+ATTCGT
+ATTCGC
+ATTCGG
+ATTGAA
+ATTGAT
+ATTGAC
+ATTGAG
+ATTGTA
+ATTGTT
+ATTGTC
+ATTGTG
+ATTGCA
+ATTGCT
+ATTGCC
+ATTGCG
+ATTGGA
+ATTGGT
+ATTGGC
+ATTGGG
+ATCAAA
+ATCAAT
+ATCAAC
+ATCAAG
+ATCATA
+ATCATT
+ATCATC
+ATCATG
+ATCACA
+ATCACT
+ATCACC
+ATCACG
+ATCAGA
+ATCAGT
+ATCAGC
+ATCAGG
+ATCTAA
+ATCTAT
+ATCTAC
+ATCTAG
+ATCTTA
+ATCTTT
+ATCTTC
+ATCTTG
+ATCTCA
+ATCTCT
+ATCTCC
+ATCTCG
+ATCTGA
+ATCTGT
+ATCTGC
+ATCTGG
+ATCCAA
+ATCCAT
+ATCCAC
+ATCCAG
+ATCCTA
+ATCCTT
+ATCCTC
+ATCCTG
+ATCCCA
+ATCCCT
+ATCCCC
+ATCCCG
+ATCCGA
+ATCCGT
+ATCCGC
+ATCCGG
+ATCGAA
+ATCGAT
+ATCGAC
+ATCGAG
+ATCGTA
+ATCGTT
+ATCGTC
+ATCGTG
+ATCGCA
+ATCGCT
+ATCGCC
+ATCGCG
+ATCGGA
+ATCGGT
+ATCGGC
+ATCGGG
+ATGAAA
+ATGAAT
+ATGAAC
+ATGAAG
+ATGATA
+ATGATT
+ATGATC
+ATGATG
+ATGACA
+ATGACT
+ATGACC
+ATGACG
+ATGAGA
+ATGAGT
+ATGAGC
+ATGAGG
+ATGTAA
+ATGTAT
+ATGTAC
+ATGTAG
+ATGTTA
+ATGTTT
+ATGTTC
+ATGTTG
+ATGTCA
+ATGTCT
+ATGTCC
+ATGTCG
+ATGTGA
+ATGTGT
+ATGTGC
+ATGTGG
+ATGCAA
+ATGCAT
+ATGCAC
+ATGCAG
+ATGCTA
+ATGCTT
+ATGCTC
+ATGCTG
+ATGCCA
+ATGCCT
+ATGCCC
+ATGCCG
+ATGCGA
+ATGCGT
+ATGCGC
+ATGCGG
+ATGGAA
+ATGGAT
+ATGGAC
+ATGGAG
+ATGGTA
+ATGGTT
+ATGGTC
+ATGGTG
+ATGGCA
+ATGGCT
+ATGGCC
+ATGGCG
+ATGGGA
+ATGGGT
+ATGGGC
+ATGGGG
+ACAAAA
+ACAAAT
+ACAAAC
+ACAAAG
+ACAATA
+ACAATT
+ACAATC
+ACAATG
+ACAACA
+ACAACT
+ACAACC
+ACAACG
+ACAAGA
+ACAAGT
+ACAAGC
+ACAAGG
+ACATAA
+ACATAT
+ACATAC
+ACATAG
+ACATTA
+ACATTT
+ACATTC
+ACATTG
+ACATCA
+ACATCT
+ACATCC
+ACATCG
+ACATGA
+ACATGT
+ACATGC
+ACATGG
+ACACAA
+ACACAT
+ACACAC
+ACACAG
+ACACTA
+ACACTT
+ACACTC
+ACACTG
+ACACCA
+ACACCT
+ACACCC
+ACACCG
+ACACGA
+ACACGT
+ACACGC
+ACACGG
+ACAGAA
+ACAGAT
+ACAGAC
+ACAGAG
+ACAGTA
+ACAGTT
+ACAGTC
+ACAGTG
+ACAGCA
+ACAGCT
+ACAGCC
+ACAGCG
+ACAGGA
+ACAGGT
+ACAGGC
+ACAGGG
+ACTAAA
+ACTAAT
+ACTAAC
+ACTAAG
+ACTATA
+ACTATT
+ACTATC
+ACTATG
+ACTACA
+ACTACT
+ACTACC
+ACTACG
+ACTAGA
+ACTAGT
+ACTAGC
+ACTAGG
+ACTTAA
+ACTTAT
+ACTTAC
+ACTTAG
+ACTTTA
+ACTTTT
+ACTTTC
+ACTTTG
+ACTTCA
+ACTTCT
+ACTTCC
+ACTTCG
+ACTTGA
+ACTTGT
+ACTTGC
+ACTTGG
+ACTCAA
+ACTCAT
+ACTCAC
+ACTCAG
+ACTCTA
+ACTCTT
+ACTCTC
+ACTCTG
+ACTCCA
+ACTCCT
+ACTCCC
+ACTCCG
+ACTCGA
+ACTCGT
+ACTCGC
+ACTCGG
+ACTGAA
+ACTGAT
+ACTGAC
+ACTGAG
+ACTGTA
+ACTGTT
+ACTGTC
+ACTGTG
+ACTGCA
+ACTGCT
+ACTGCC
+ACTGCG
+ACTGGA
+ACTGGT
+ACTGGC
+ACTGGG
+ACCAAA
+ACCAAT
+ACCAAC
+ACCAAG
+ACCATA
+ACCATT
+ACCATC
+ACCATG
+ACCACA
+ACCACT
+ACCACC
+ACCACG
+ACCAGA
+ACCAGT
+ACCAGC
+ACCAGG
+ACCTAA
+ACCTAT
+ACCTAC
+ACCTAG
+ACCTTA
+ACCTTT
+ACCTTC
+ACCTTG
+ACCTCA
+ACCTCT
+ACCTCC
+ACCTCG
+ACCTGA
+ACCTGT
+ACCTGC
+ACCTGG
+ACCCAA
+ACCCAT
+ACCCAC
+ACCCAG
+ACCCTA
+ACCCTT
+ACCCTC
+ACCCTG
+ACCCCA
+ACCCCT
+ACCCCC
+ACCCCG
+ACCCGA
+ACCCGT
+ACCCGC
+ACCCGG
+ACCGAA
+ACCGAT
+ACCGAC
+ACCGAG
+ACCGTA
+ACCGTT
+ACCGTC
+ACCGTG
+ACCGCA
+ACCGCT
+ACCGCC
+ACCGCG
+ACCGGA
+ACCGGT
+ACCGGC
+ACCGGG
+ACGAAA
+ACGAAT
+ACGAAC
+ACGAAG
+ACGATA
+ACGATT
+ACGATC
+ACGATG
+ACGACA
+ACGACT
+ACGACC
+ACGACG
+ACGAGA
+ACGAGT
+ACGAGC
+ACGAGG
+ACGTAA
+ACGTAT
+ACGTAC
+ACGTAG
+ACGTTA
+ACGTTT
+ACGTTC
+ACGTTG
+ACGTCA
+ACGTCT
+ACGTCC
+ACGTCG
+ACGTGA
+ACGTGT
+ACGTGC
+ACGTGG
+ACGCAA
+ACGCAT
+ACGCAC
+ACGCAG
+ACGCTA
+ACGCTT
+ACGCTC
+ACGCTG
+ACGCCA
+ACGCCT
+ACGCCC
+ACGCCG
+ACGCGA
+ACGCGT
+ACGCGC
+ACGCGG
+ACGGAA
+ACGGAT
+ACGGAC
+ACGGAG
+ACGGTA
+ACGGTT
+ACGGTC
+ACGGTG
+ACGGCA
+ACGGCT
+ACGGCC
+ACGGCG
+ACGGGA
+ACGGGT
+ACGGGC
+ACGGGG
+AGAAAA
+AGAAAT
+AGAAAC
+AGAAAG
+AGAATA
+AGAATT
+AGAATC
+AGAATG
+AGAACA
+AGAACT
+AGAACC
+AGAACG
+AGAAGA
+AGAAGT
+AGAAGC
+AGAAGG
+AGATAA
+AGATAT
+AGATAC
+AGATAG
+AGATTA
+AGATTT
+AGATTC
+AGATTG
+AGATCA
+AGATCT
+AGATCC
+AGATCG
+AGATGA
+AGATGT
+AGATGC
+AGATGG
+AGACAA
+AGACAT
+AGACAC
+AGACAG
+AGACTA
+AGACTT
+AGACTC
+AGACTG
+AGACCA
+AGACCT
+AGACCC
+AGACCG
+AGACGA
+AGACGT
+AGACGC
+AGACGG
+AGAGAA
+AGAGAT
+AGAGAC
+AGAGAG
+AGAGTA
+AGAGTT
+AGAGTC
+AGAGTG
+AGAGCA
+AGAGCT
+AGAGCC
+AGAGCG
+AGAGGA
+AGAGGT
+AGAGGC
+AGAGGG
+AGTAAA
+AGTAAT
+AGTAAC
+AGTAAG
+AGTATA
+AGTATT
+AGTATC
+AGTATG
+AGTACA
+AGTACT
+AGTACC
+AGTACG
+AGTAGA
+AGTAGT
+AGTAGC
+AGTAGG
+AGTTAA
+AGTTAT
+AGTTAC
+AGTTAG
+AGTTTA
+AGTTTT
+AGTTTC
+AGTTTG
+AGTTCA
+AGTTCT
+AGTTCC
+AGTTCG
+AGTTGA
+AGTTGT
+AGTTGC
+AGTTGG
+AGTCAA
+AGTCAT
+AGTCAC
+AGTCAG
+AGTCTA
+AGTCTT
+AGTCTC
+AGTCTG
+AGTCCA
+AGTCCT
+AGTCCC
+AGTCCG
+AGTCGA
+AGTCGT
+AGTCGC
+AGTCGG
+AGTGAA
+AGTGAT
+AGTGAC
+AGTGAG
+AGTGTA
+AGTGTT
+AGTGTC
+AGTGTG
+AGTGCA
+AGTGCT
+AGTGCC
+AGTGCG
+AGTGGA
+AGTGGT
+AGTGGC
+AGTGGG
+AGCAAA
+AGCAAT
+AGCAAC
+AGCAAG
+AGCATA
+AGCATT
+AGCATC
+AGCATG
+AGCACA
+AGCACT
+AGCACC
+AGCACG
+AGCAGA
+AGCAGT
+AGCAGC
+AGCAGG
+AGCTAA
+AGCTAT
+AGCTAC
+AGCTAG
+AGCTTA
+AGCTTT
+AGCTTC
+AGCTTG
+AGCTCA
+AGCTCT
+AGCTCC
+AGCTCG
+AGCTGA
+AGCTGT
+AGCTGC
+AGCTGG
+AGCCAA
+AGCCAT
+AGCCAC
+AGCCAG
+AGCCTA
+AGCCTT
+AGCCTC
+AGCCTG
+AGCCCA
+AGCCCT
+AGCCCC
+AGCCCG
+AGCCGA
+AGCCGT
+AGCCGC
+AGCCGG
+AGCGAA
+AGCGAT
+AGCGAC
+AGCGAG
+AGCGTA
+AGCGTT
+AGCGTC
+AGCGTG
+AGCGCA
+AGCGCT
+AGCGCC
+AGCGCG
+AGCGGA
+AGCGGT
+AGCGGC
+AGCGGG
+AGGAAA
+AGGAAT
+AGGAAC
+AGGAAG
+AGGATA
+AGGATT
+AGGATC
+AGGATG
+AGGACA
+AGGACT
+AGGACC
+AGGACG
+AGGAGA
+AGGAGT
+AGGAGC
+AGGAGG
+AGGTAA
+AGGTAT
+AGGTAC
+AGGTAG
+AGGTTA
+AGGTTT
+AGGTTC
+AGGTTG
+AGGTCA
+AGGTCT
+AGGTCC
+AGGTCG
+AGGTGA
+AGGTGT
+AGGTGC
+AGGTGG
+AGGCAA
+AGGCAT
+AGGCAC
+AGGCAG
+AGGCTA
+AGGCTT
+AGGCTC
+AGGCTG
+AGGCCA
+AGGCCT
+AGGCCC
+AGGCCG
+AGGCGA
+AGGCGT
+AGGCGC
+AGGCGG
+AGGGAA
+AGGGAT
+AGGGAC
+AGGGAG
+AGGGTA
+AGGGTT
+AGGGTC
+AGGGTG
+AGGGCA
+AGGGCT
+AGGGCC
+AGGGCG
+AGGGGA
+AGGGGT
+AGGGGC
+AGGGGG
+TAAAAA
+TAAAAT
+TAAAAC
+TAAAAG
+TAAATA
+TAAATT
+TAAATC
+TAAATG
+TAAACA
+TAAACT
+TAAACC
+TAAACG
+TAAAGA
+TAAAGT
+TAAAGC
+TAAAGG
+TAATAA
+TAATAT
+TAATAC
+TAATAG
+TAATTA
+TAATTT
+TAATTC
+TAATTG
+TAATCA
+TAATCT
+TAATCC
+TAATCG
+TAATGA
+TAATGT
+TAATGC
+TAATGG
+TAACAA
+TAACAT
+TAACAC
+TAACAG
+TAACTA
+TAACTT
+TAACTC
+TAACTG
+TAACCA
+TAACCT
+TAACCC
+TAACCG
+TAACGA
+TAACGT
+TAACGC
+TAACGG
+TAAGAA
+TAAGAT
+TAAGAC
+TAAGAG
+TAAGTA
+TAAGTT
+TAAGTC
+TAAGTG
+TAAGCA
+TAAGCT
+TAAGCC
+TAAGCG
+TAAGGA
+TAAGGT
+TAAGGC
+TAAGGG
+TATAAA
+TATAAT
+TATAAC
+TATAAG
+TATATA
+TATATT
+TATATC
+TATATG
+TATACA
+TATACT
+TATACC
+TATACG
+TATAGA
+TATAGT
+TATAGC
+TATAGG
+TATTAA
+TATTAT
+TATTAC
+TATTAG
+TATTTA
+TATTTT
+TATTTC
+TATTTG
+TATTCA
+TATTCT
+TATTCC
+TATTCG
+TATTGA
+TATTGT
+TATTGC
+TATTGG
+TATCAA
+TATCAT
+TATCAC
+TATCAG
+TATCTA
+TATCTT
+TATCTC
+TATCTG
+TATCCA
+TATCCT
+TATCCC
+TATCCG
+TATCGA
+TATCGT
+TATCGC
+TATCGG
+TATGAA
+TATGAT
+TATGAC
+TATGAG
+TATGTA
+TATGTT
+TATGTC
+TATGTG
+TATGCA
+TATGCT
+TATGCC
+TATGCG
+TATGGA
+TATGGT
+TATGGC
+TATGGG
+TACAAA
+TACAAT
+TACAAC
+TACAAG
+TACATA
+TACATT
+TACATC
+TACATG
+TACACA
+TACACT
+TACACC
+TACACG
+TACAGA
+TACAGT
+TACAGC
+TACAGG
+TACTAA
+TACTAT
+TACTAC
+TACTAG
+TACTTA
+TACTTT
+TACTTC
+TACTTG
+TACTCA
+TACTCT
+TACTCC
+TACTCG
+TACTGA
+TACTGT
+TACTGC
+TACTGG
+TACCAA
+TACCAT
+TACCAC
+TACCAG
+TACCTA
+TACCTT
+TACCTC
+TACCTG
+TACCCA
+TACCCT
+TACCCC
+TACCCG
+TACCGA
+TACCGT
+TACCGC
+TACCGG
+TACGAA
+TACGAT
+TACGAC
+TACGAG
+TACGTA
+TACGTT
+TACGTC
+TACGTG
+TACGCA
+TACGCT
+TACGCC
+TACGCG
+TACGGA
+TACGGT
+TACGGC
+TACGGG
+TAGAAA
+TAGAAT
+TAGAAC
+TAGAAG
+TAGATA
+TAGATT
+TAGATC
+TAGATG
+TAGACA
+TAGACT
+TAGACC
+TAGACG
+TAGAGA
+TAGAGT
+TAGAGC
+TAGAGG
+TAGTAA
+TAGTAT
+TAGTAC
+TAGTAG
+TAGTTA
+TAGTTT
+TAGTTC
+TAGTTG
+TAGTCA
+TAGTCT
+TAGTCC
+TAGTCG
+TAGTGA
+TAGTGT
+TAGTGC
+TAGTGG
+TAGCAA
+TAGCAT
+TAGCAC
+TAGCAG
+TAGCTA
+TAGCTT
+TAGCTC
+TAGCTG
+TAGCCA
+TAGCCT
+TAGCCC
+TAGCCG
+TAGCGA
+TAGCGT
+TAGCGC
+TAGCGG
+TAGGAA
+TAGGAT
+TAGGAC
+TAGGAG
+TAGGTA
+TAGGTT
+TAGGTC
+TAGGTG
+TAGGCA
+TAGGCT
+TAGGCC
+TAGGCG
+TAGGGA
+TAGGGT
+TAGGGC
+TAGGGG
+TTAAAA
+TTAAAT
+TTAAAC
+TTAAAG
+TTAATA
+TTAATT
+TTAATC
+TTAATG
+TTAACA
+TTAACT
+TTAACC
+TTAACG
+TTAAGA
+TTAAGT
+TTAAGC
+TTAAGG
+TTATAA
+TTATAT
+TTATAC
+TTATAG
+TTATTA
+TTATTT
+TTATTC
+TTATTG
+TTATCA
+TTATCT
+TTATCC
+TTATCG
+TTATGA
+TTATGT
+TTATGC
+TTATGG
+TTACAA
+TTACAT
+TTACAC
+TTACAG
+TTACTA
+TTACTT
+TTACTC
+TTACTG
+TTACCA
+TTACCT
+TTACCC
+TTACCG
+TTACGA
+TTACGT
+TTACGC
+TTACGG
+TTAGAA
+TTAGAT
+TTAGAC
+TTAGAG
+TTAGTA
+TTAGTT
+TTAGTC
+TTAGTG
+TTAGCA
+TTAGCT
+TTAGCC
+TTAGCG
+TTAGGA
+TTAGGT
+TTAGGC
+TTAGGG
+TTTAAA
+TTTAAT
+TTTAAC
+TTTAAG
+TTTATA
+TTTATT
+TTTATC
+TTTATG
+TTTACA
+TTTACT
+TTTACC
+TTTACG
+TTTAGA
+TTTAGT
+TTTAGC
+TTTAGG
+TTTTAA
+TTTTAT
+TTTTAC
+TTTTAG
+TTTTTA
+TTTTTT
+TTTTTC
+TTTTTG
+TTTTCA
+TTTTCT
+TTTTCC
+TTTTCG
+TTTTGA
+TTTTGT
+TTTTGC
+TTTTGG
+TTTCAA
+TTTCAT
+TTTCAC
+TTTCAG
+TTTCTA
+TTTCTT
+TTTCTC
+TTTCTG
+TTTCCA
+TTTCCT
+TTTCCC
+TTTCCG
+TTTCGA
+TTTCGT
+TTTCGC
+TTTCGG
+TTTGAA
+TTTGAT
+TTTGAC
+TTTGAG
+TTTGTA
+TTTGTT
+TTTGTC
+TTTGTG
+TTTGCA
+TTTGCT
+TTTGCC
+TTTGCG
+TTTGGA
+TTTGGT
+TTTGGC
+TTTGGG
+TTCAAA
+TTCAAT
+TTCAAC
+TTCAAG
+TTCATA
+TTCATT
+TTCATC
+TTCATG
+TTCACA
+TTCACT
+TTCACC
+TTCACG
+TTCAGA
+TTCAGT
+TTCAGC
+TTCAGG
+TTCTAA
+TTCTAT
+TTCTAC
+TTCTAG
+TTCTTA
+TTCTTT
+TTCTTC
+TTCTTG
+TTCTCA
+TTCTCT
+TTCTCC
+TTCTCG
+TTCTGA
+TTCTGT
+TTCTGC
+TTCTGG
+TTCCAA
+TTCCAT
+TTCCAC
+TTCCAG
+TTCCTA
+TTCCTT
+TTCCTC
+TTCCTG
+TTCCCA
+TTCCCT
+TTCCCC
+TTCCCG
+TTCCGA
+TTCCGT
+TTCCGC
+TTCCGG
+TTCGAA
+TTCGAT
+TTCGAC
+TTCGAG
+TTCGTA
+TTCGTT
+TTCGTC
+TTCGTG
+TTCGCA
+TTCGCT
+TTCGCC
+TTCGCG
+TTCGGA
+TTCGGT
+TTCGGC
+TTCGGG
+TTGAAA
+TTGAAT
+TTGAAC
+TTGAAG
+TTGATA
+TTGATT
+TTGATC
+TTGATG
+TTGACA
+TTGACT
+TTGACC
+TTGACG
+TTGAGA
+TTGAGT
+TTGAGC
+TTGAGG
+TTGTAA
+TTGTAT
+TTGTAC
+TTGTAG
+TTGTTA
+TTGTTT
+TTGTTC
+TTGTTG
+TTGTCA
+TTGTCT
+TTGTCC
+TTGTCG
+TTGTGA
+TTGTGT
+TTGTGC
+TTGTGG
+TTGCAA
+TTGCAT
+TTGCAC
+TTGCAG
+TTGCTA
+TTGCTT
+TTGCTC
+TTGCTG
+TTGCCA
+TTGCCT
+TTGCCC
+TTGCCG
+TTGCGA
+TTGCGT
+TTGCGC
+TTGCGG
+TTGGAA
+TTGGAT
+TTGGAC
+TTGGAG
+TTGGTA
+TTGGTT
+TTGGTC
+TTGGTG
+TTGGCA
+TTGGCT
+TTGGCC
+TTGGCG
+TTGGGA
+TTGGGT
+TTGGGC
+TTGGGG
+TCAAAA
+TCAAAT
+TCAAAC
+TCAAAG
+TCAATA
+TCAATT
+TCAATC
+TCAATG
+TCAACA
+TCAACT
+TCAACC
+TCAACG
+TCAAGA
+TCAAGT
+TCAAGC
+TCAAGG
+TCATAA
+TCATAT
+TCATAC
+TCATAG
+TCATTA
+TCATTT
+TCATTC
+TCATTG
+TCATCA
+TCATCT
+TCATCC
+TCATCG
+TCATGA
+TCATGT
+TCATGC
+TCATGG
+TCACAA
+TCACAT
+TCACAC
+TCACAG
+TCACTA
+TCACTT
+TCACTC
+TCACTG
+TCACCA
+TCACCT
+TCACCC
+TCACCG
+TCACGA
+TCACGT
+TCACGC
+TCACGG
+TCAGAA
+TCAGAT
+TCAGAC
+TCAGAG
+TCAGTA
+TCAGTT
+TCAGTC
+TCAGTG
+TCAGCA
+TCAGCT
+TCAGCC
+TCAGCG
+TCAGGA
+TCAGGT
+TCAGGC
+TCAGGG
+TCTAAA
+TCTAAT
+TCTAAC
+TCTAAG
+TCTATA
+TCTATT
+TCTATC
+TCTATG
+TCTACA
+TCTACT
+TCTACC
+TCTACG
+TCTAGA
+TCTAGT
+TCTAGC
+TCTAGG
+TCTTAA
+TCTTAT
+TCTTAC
+TCTTAG
+TCTTTA
+TCTTTT
+TCTTTC
+TCTTTG
+TCTTCA
+TCTTCT
+TCTTCC
+TCTTCG
+TCTTGA
+TCTTGT
+TCTTGC
+TCTTGG
+TCTCAA
+TCTCAT
+TCTCAC
+TCTCAG
+TCTCTA
+TCTCTT
+TCTCTC
+TCTCTG
+TCTCCA
+TCTCCT
+TCTCCC
+TCTCCG
+TCTCGA
+TCTCGT
+TCTCGC
+TCTCGG
+TCTGAA
+TCTGAT
+TCTGAC
+TCTGAG
+TCTGTA
+TCTGTT
+TCTGTC
+TCTGTG
+TCTGCA
+TCTGCT
+TCTGCC
+TCTGCG
+TCTGGA
+TCTGGT
+TCTGGC
+TCTGGG
+TCCAAA
+TCCAAT
+TCCAAC
+TCCAAG
+TCCATA
+TCCATT
+TCCATC
+TCCATG
+TCCACA
+TCCACT
+TCCACC
+TCCACG
+TCCAGA
+TCCAGT
+TCCAGC
+TCCAGG
+TCCTAA
+TCCTAT
+TCCTAC
+TCCTAG
+TCCTTA
+TCCTTT
+TCCTTC
+TCCTTG
+TCCTCA
+TCCTCT
+TCCTCC
+TCCTCG
+TCCTGA
+TCCTGT
+TCCTGC
+TCCTGG
+TCCCAA
+TCCCAT
+TCCCAC
+TCCCAG
+TCCCTA
+TCCCTT
+TCCCTC
+TCCCTG
+TCCCCA
+TCCCCT
+TCCCCC
+TCCCCG
+TCCCGA
+TCCCGT
+TCCCGC
+TCCCGG
+TCCGAA
+TCCGAT
+TCCGAC
+TCCGAG
+TCCGTA
+TCCGTT
+TCCGTC
+TCCGTG
+TCCGCA
+TCCGCT
+TCCGCC
+TCCGCG
+TCCGGA
+TCCGGT
+TCCGGC
+TCCGGG
+TCGAAA
+TCGAAT
+TCGAAC
+TCGAAG
+TCGATA
+TCGATT
+TCGATC
+TCGATG
+TCGACA
+TCGACT
+TCGACC
+TCGACG
+TCGAGA
+TCGAGT
+TCGAGC
+TCGAGG
+TCGTAA
+TCGTAT
+TCGTAC
+TCGTAG
+TCGTTA
+TCGTTT
+TCGTTC
+TCGTTG
+TCGTCA
+TCGTCT
+TCGTCC
+TCGTCG
+TCGTGA
+TCGTGT
+TCGTGC
+TCGTGG
+TCGCAA
+TCGCAT
+TCGCAC
+TCGCAG
+TCGCTA
+TCGCTT
+TCGCTC
+TCGCTG
+TCGCCA
+TCGCCT
+TCGCCC
+TCGCCG
+TCGCGA
+TCGCGT
+TCGCGC
+TCGCGG
+TCGGAA
+TCGGAT
+TCGGAC
+TCGGAG
+TCGGTA
+TCGGTT
+TCGGTC
+TCGGTG
+TCGGCA
+TCGGCT
+TCGGCC
+TCGGCG
+TCGGGA
+TCGGGT
+TCGGGC
+TCGGGG
+TGAAAA
+TGAAAT
+TGAAAC
+TGAAAG
+TGAATA
+TGAATT
+TGAATC
+TGAATG
+TGAACA
+TGAACT
+TGAACC
+TGAACG
+TGAAGA
+TGAAGT
+TGAAGC
+TGAAGG
+TGATAA
+TGATAT
+TGATAC
+TGATAG
+TGATTA
+TGATTT
+TGATTC
+TGATTG
+TGATCA
+TGATCT
+TGATCC
+TGATCG
+TGATGA
+TGATGT
+TGATGC
+TGATGG
+TGACAA
+TGACAT
+TGACAC
+TGACAG
+TGACTA
+TGACTT
+TGACTC
+TGACTG
+TGACCA
+TGACCT
+TGACCC
+TGACCG
+TGACGA
+TGACGT
+TGACGC
+TGACGG
+TGAGAA
+TGAGAT
+TGAGAC
+TGAGAG
+TGAGTA
+TGAGTT
+TGAGTC
+TGAGTG
+TGAGCA
+TGAGCT
+TGAGCC
+TGAGCG
+TGAGGA
+TGAGGT
+TGAGGC
+TGAGGG
+TGTAAA
+TGTAAT
+TGTAAC
+TGTAAG
+TGTATA
+TGTATT
+TGTATC
+TGTATG
+TGTACA
+TGTACT
+TGTACC
+TGTACG
+TGTAGA
+TGTAGT
+TGTAGC
+TGTAGG
+TGTTAA
+TGTTAT
+TGTTAC
+TGTTAG
+TGTTTA
+TGTTTT
+TGTTTC
+TGTTTG
+TGTTCA
+TGTTCT
+TGTTCC
+TGTTCG
+TGTTGA
+TGTTGT
+TGTTGC
+TGTTGG
+TGTCAA
+TGTCAT
+TGTCAC
+TGTCAG
+TGTCTA
+TGTCTT
+TGTCTC
+TGTCTG
+TGTCCA
+TGTCCT
+TGTCCC
+TGTCCG
+TGTCGA
+TGTCGT
+TGTCGC
+TGTCGG
+TGTGAA
+TGTGAT
+TGTGAC
+TGTGAG
+TGTGTA
+TGTGTT
+TGTGTC
+TGTGTG
+TGTGCA
+TGTGCT
+TGTGCC
+TGTGCG
+TGTGGA
+TGTGGT
+TGTGGC
+TGTGGG
+TGCAAA
+TGCAAT
+TGCAAC
+TGCAAG
+TGCATA
+TGCATT
+TGCATC
+TGCATG
+TGCACA
+TGCACT
+TGCACC
+TGCACG
+TGCAGA
+TGCAGT
+TGCAGC
+TGCAGG
+TGCTAA
+TGCTAT
+TGCTAC
+TGCTAG
+TGCTTA
+TGCTTT
+TGCTTC
+TGCTTG
+TGCTCA
+TGCTCT
+TGCTCC
+TGCTCG
+TGCTGA
+TGCTGT
+TGCTGC
+TGCTGG
+TGCCAA
+TGCCAT
+TGCCAC
+TGCCAG
+TGCCTA
+TGCCTT
+TGCCTC
+TGCCTG
+TGCCCA
+TGCCCT
+TGCCCC
+TGCCCG
+TGCCGA
+TGCCGT
+TGCCGC
+TGCCGG
+TGCGAA
+TGCGAT
+TGCGAC
+TGCGAG
+TGCGTA
+TGCGTT
+TGCGTC
+TGCGTG
+TGCGCA
+TGCGCT
+TGCGCC
+TGCGCG
+TGCGGA
+TGCGGT
+TGCGGC
+TGCGGG
+TGGAAA
+TGGAAT
+TGGAAC
+TGGAAG
+TGGATA
+TGGATT
+TGGATC
+TGGATG
+TGGACA
+TGGACT
+TGGACC
+TGGACG
+TGGAGA
+TGGAGT
+TGGAGC
+TGGAGG
+TGGTAA
+TGGTAT
+TGGTAC
+TGGTAG
+TGGTTA
+TGGTTT
+TGGTTC
+TGGTTG
+TGGTCA
+TGGTCT
+TGGTCC
+TGGTCG
+TGGTGA
+TGGTGT
+TGGTGC
+TGGTGG
+TGGCAA
+TGGCAT
+TGGCAC
+TGGCAG
+TGGCTA
+TGGCTT
+TGGCTC
+TGGCTG
+TGGCCA
+TGGCCT
+TGGCCC
+TGGCCG
+TGGCGA
+TGGCGT
+TGGCGC
+TGGCGG
+TGGGAA
+TGGGAT
+TGGGAC
+TGGGAG
+TGGGTA
+TGGGTT
+TGGGTC
+TGGGTG
+TGGGCA
+TGGGCT
+TGGGCC
+TGGGCG
+TGGGGA
+TGGGGT
+TGGGGC
+TGGGGG
+CAAAAA
+CAAAAT
+CAAAAC
+CAAAAG
+CAAATA
+CAAATT
+CAAATC
+CAAATG
+CAAACA
+CAAACT
+CAAACC
+CAAACG
+CAAAGA
+CAAAGT
+CAAAGC
+CAAAGG
+CAATAA
+CAATAT
+CAATAC
+CAATAG
+CAATTA
+CAATTT
+CAATTC
+CAATTG
+CAATCA
+CAATCT
+CAATCC
+CAATCG
+CAATGA
+CAATGT
+CAATGC
+CAATGG
+CAACAA
+CAACAT
+CAACAC
+CAACAG
+CAACTA
+CAACTT
+CAACTC
+CAACTG
+CAACCA
+CAACCT
+CAACCC
+CAACCG
+CAACGA
+CAACGT
+CAACGC
+CAACGG
+CAAGAA
+CAAGAT
+CAAGAC
+CAAGAG
+CAAGTA
+CAAGTT
+CAAGTC
+CAAGTG
+CAAGCA
+CAAGCT
+CAAGCC
+CAAGCG
+CAAGGA
+CAAGGT
+CAAGGC
+CAAGGG
+CATAAA
+CATAAT
+CATAAC
+CATAAG
+CATATA
+CATATT
+CATATC
+CATATG
+CATACA
+CATACT
+CATACC
+CATACG
+CATAGA
+CATAGT
+CATAGC
+CATAGG
+CATTAA
+CATTAT
+CATTAC
+CATTAG
+CATTTA
+CATTTT
+CATTTC
+CATTTG
+CATTCA
+CATTCT
+CATTCC
+CATTCG
+CATTGA
+CATTGT
+CATTGC
+CATTGG
+CATCAA
+CATCAT
+CATCAC
+CATCAG
+CATCTA
+CATCTT
+CATCTC
+CATCTG
+CATCCA
+CATCCT
+CATCCC
+CATCCG
+CATCGA
+CATCGT
+CATCGC
+CATCGG
+CATGAA
+CATGAT
+CATGAC
+CATGAG
+CATGTA
+CATGTT
+CATGTC
+CATGTG
+CATGCA
+CATGCT
+CATGCC
+CATGCG
+CATGGA
+CATGGT
+CATGGC
+CATGGG
+CACAAA
+CACAAT
+CACAAC
+CACAAG
+CACATA
+CACATT
+CACATC
+CACATG
+CACACA
+CACACT
+CACACC
+CACACG
+CACAGA
+CACAGT
+CACAGC
+CACAGG
+CACTAA
+CACTAT
+CACTAC
+CACTAG
+CACTTA
+CACTTT
+CACTTC
+CACTTG
+CACTCA
+CACTCT
+CACTCC
+CACTCG
+CACTGA
+CACTGT
+CACTGC
+CACTGG
+CACCAA
+CACCAT
+CACCAC
+CACCAG
+CACCTA
+CACCTT
+CACCTC
+CACCTG
+CACCCA
+CACCCT
+CACCCC
+CACCCG
+CACCGA
+CACCGT
+CACCGC
+CACCGG
+CACGAA
+CACGAT
+CACGAC
+CACGAG
+CACGTA
+CACGTT
+CACGTC
+CACGTG
+CACGCA
+CACGCT
+CACGCC
+CACGCG
+CACGGA
+CACGGT
+CACGGC
+CACGGG
+CAGAAA
+CAGAAT
+CAGAAC
+CAGAAG
+CAGATA
+CAGATT
+CAGATC
+CAGATG
+CAGACA
+CAGACT
+CAGACC
+CAGACG
+CAGAGA
+CAGAGT
+CAGAGC
+CAGAGG
+CAGTAA
+CAGTAT
+CAGTAC
+CAGTAG
+CAGTTA
+CAGTTT
+CAGTTC
+CAGTTG
+CAGTCA
+CAGTCT
+CAGTCC
+CAGTCG
+CAGTGA
+CAGTGT
+CAGTGC
+CAGTGG
+CAGCAA
+CAGCAT
+CAGCAC
+CAGCAG
+CAGCTA
+CAGCTT
+CAGCTC
+CAGCTG
+CAGCCA
+CAGCCT
+CAGCCC
+CAGCCG
+CAGCGA
+CAGCGT
+CAGCGC
+CAGCGG
+CAGGAA
+CAGGAT
+CAGGAC
+CAGGAG
+CAGGTA
+CAGGTT
+CAGGTC
+CAGGTG
+CAGGCA
+CAGGCT
+CAGGCC
+CAGGCG
+CAGGGA
+CAGGGT
+CAGGGC
+CAGGGG
+CTAAAA
+CTAAAT
+CTAAAC
+CTAAAG
+CTAATA
+CTAATT
+CTAATC
+CTAATG
+CTAACA
+CTAACT
+CTAACC
+CTAACG
+CTAAGA
+CTAAGT
+CTAAGC
+CTAAGG
+CTATAA
+CTATAT
+CTATAC
+CTATAG
+CTATTA
+CTATTT
+CTATTC
+CTATTG
+CTATCA
+CTATCT
+CTATCC
+CTATCG
+CTATGA
+CTATGT
+CTATGC
+CTATGG
+CTACAA
+CTACAT
+CTACAC
+CTACAG
+CTACTA
+CTACTT
+CTACTC
+CTACTG
+CTACCA
+CTACCT
+CTACCC
+CTACCG
+CTACGA
+CTACGT
+CTACGC
+CTACGG
+CTAGAA
+CTAGAT
+CTAGAC
+CTAGAG
+CTAGTA
+CTAGTT
+CTAGTC
+CTAGTG
+CTAGCA
+CTAGCT
+CTAGCC
+CTAGCG
+CTAGGA
+CTAGGT
+CTAGGC
+CTAGGG
+CTTAAA
+CTTAAT
+CTTAAC
+CTTAAG
+CTTATA
+CTTATT
+CTTATC
+CTTATG
+CTTACA
+CTTACT
+CTTACC
+CTTACG
+CTTAGA
+CTTAGT
+CTTAGC
+CTTAGG
+CTTTAA
+CTTTAT
+CTTTAC
+CTTTAG
+CTTTTA
+CTTTTT
+CTTTTC
+CTTTTG
+CTTTCA
+CTTTCT
+CTTTCC
+CTTTCG
+CTTTGA
+CTTTGT
+CTTTGC
+CTTTGG
+CTTCAA
+CTTCAT
+CTTCAC
+CTTCAG
+CTTCTA
+CTTCTT
+CTTCTC
+CTTCTG
+CTTCCA
+CTTCCT
+CTTCCC
+CTTCCG
+CTTCGA
+CTTCGT
+CTTCGC
+CTTCGG
+CTTGAA
+CTTGAT
+CTTGAC
+CTTGAG
+CTTGTA
+CTTGTT
+CTTGTC
+CTTGTG
+CTTGCA
+CTTGCT
+CTTGCC
+CTTGCG
+CTTGGA
+CTTGGT
+CTTGGC
+CTTGGG
+CTCAAA
+CTCAAT
+CTCAAC
+CTCAAG
+CTCATA
+CTCATT
+CTCATC
+CTCATG
+CTCACA
+CTCACT
+CTCACC
+CTCACG
+CTCAGA
+CTCAGT
+CTCAGC
+CTCAGG
+CTCTAA
+CTCTAT
+CTCTAC
+CTCTAG
+CTCTTA
+CTCTTT
+CTCTTC
+CTCTTG
+CTCTCA
+CTCTCT
+CTCTCC
+CTCTCG
+CTCTGA
+CTCTGT
+CTCTGC
+CTCTGG
+CTCCAA
+CTCCAT
+CTCCAC
+CTCCAG
+CTCCTA
+CTCCTT
+CTCCTC
+CTCCTG
+CTCCCA
+CTCCCT
+CTCCCC
+CTCCCG
+CTCCGA
+CTCCGT
+CTCCGC
+CTCCGG
+CTCGAA
+CTCGAT
+CTCGAC
+CTCGAG
+CTCGTA
+CTCGTT
+CTCGTC
+CTCGTG
+CTCGCA
+CTCGCT
+CTCGCC
+CTCGCG
+CTCGGA
+CTCGGT
+CTCGGC
+CTCGGG
+CTGAAA
+CTGAAT
+CTGAAC
+CTGAAG
+CTGATA
+CTGATT
+CTGATC
+CTGATG
+CTGACA
+CTGACT
+CTGACC
+CTGACG
+CTGAGA
+CTGAGT
+CTGAGC
+CTGAGG
+CTGTAA
+CTGTAT
+CTGTAC
+CTGTAG
+CTGTTA
+CTGTTT
+CTGTTC
+CTGTTG
+CTGTCA
+CTGTCT
+CTGTCC
+CTGTCG
+CTGTGA
+CTGTGT
+CTGTGC
+CTGTGG
+CTGCAA
+CTGCAT
+CTGCAC
+CTGCAG
+CTGCTA
+CTGCTT
+CTGCTC
+CTGCTG
+CTGCCA
+CTGCCT
+CTGCCC
+CTGCCG
+CTGCGA
+CTGCGT
+CTGCGC
+CTGCGG
+CTGGAA
+CTGGAT
+CTGGAC
+CTGGAG
+CTGGTA
+CTGGTT
+CTGGTC
+CTGGTG
+CTGGCA
+CTGGCT
+CTGGCC
+CTGGCG
+CTGGGA
+CTGGGT
+CTGGGC
+CTGGGG
+CCAAAA
+CCAAAT
+CCAAAC
+CCAAAG
+CCAATA
+CCAATT
+CCAATC
+CCAATG
+CCAACA
+CCAACT
+CCAACC
+CCAACG
+CCAAGA
+CCAAGT
+CCAAGC
+CCAAGG
+CCATAA
+CCATAT
+CCATAC
+CCATAG
+CCATTA
+CCATTT
+CCATTC
+CCATTG
+CCATCA
+CCATCT
+CCATCC
+CCATCG
+CCATGA
+CCATGT
+CCATGC
+CCATGG
+CCACAA
+CCACAT
+CCACAC
+CCACAG
+CCACTA
+CCACTT
+CCACTC
+CCACTG
+CCACCA
+CCACCT
+CCACCC
+CCACCG
+CCACGA
+CCACGT
+CCACGC
+CCACGG
+CCAGAA
+CCAGAT
+CCAGAC
+CCAGAG
+CCAGTA
+CCAGTT
+CCAGTC
+CCAGTG
+CCAGCA
+CCAGCT
+CCAGCC
+CCAGCG
+CCAGGA
+CCAGGT
+CCAGGC
+CCAGGG
+CCTAAA
+CCTAAT
+CCTAAC
+CCTAAG
+CCTATA
+CCTATT
+CCTATC
+CCTATG
+CCTACA
+CCTACT
+CCTACC
+CCTACG
+CCTAGA
+CCTAGT
+CCTAGC
+CCTAGG
+CCTTAA
+CCTTAT
+CCTTAC
+CCTTAG
+CCTTTA
+CCTTTT
+CCTTTC
+CCTTTG
+CCTTCA
+CCTTCT
+CCTTCC
+CCTTCG
+CCTTGA
+CCTTGT
+CCTTGC
+CCTTGG
+CCTCAA
+CCTCAT
+CCTCAC
+CCTCAG
+CCTCTA
+CCTCTT
+CCTCTC
+CCTCTG
+CCTCCA
+CCTCCT
+CCTCCC
+CCTCCG
+CCTCGA
+CCTCGT
+CCTCGC
+CCTCGG
+CCTGAA
+CCTGAT
+CCTGAC
+CCTGAG
+CCTGTA
+CCTGTT
+CCTGTC
+CCTGTG
+CCTGCA
+CCTGCT
+CCTGCC
+CCTGCG
+CCTGGA
+CCTGGT
+CCTGGC
+CCTGGG
+CCCAAA
+CCCAAT
+CCCAAC
+CCCAAG
+CCCATA
+CCCATT
+CCCATC
+CCCATG
+CCCACA
+CCCACT
+CCCACC
+CCCACG
+CCCAGA
+CCCAGT
+CCCAGC
+CCCAGG
+CCCTAA
+CCCTAT
+CCCTAC
+CCCTAG
+CCCTTA
+CCCTTT
+CCCTTC
+CCCTTG
+CCCTCA
+CCCTCT
+CCCTCC
+CCCTCG
+CCCTGA
+CCCTGT
+CCCTGC
+CCCTGG
+CCCCAA
+CCCCAT
+CCCCAC
+CCCCAG
+CCCCTA
+CCCCTT
+CCCCTC
+CCCCTG
+CCCCCA
+CCCCCT
+CCCCCC
+CCCCCG
+CCCCGA
+CCCCGT
+CCCCGC
+CCCCGG
+CCCGAA
+CCCGAT
+CCCGAC
+CCCGAG
+CCCGTA
+CCCGTT
+CCCGTC
+CCCGTG
+CCCGCA
+CCCGCT
+CCCGCC
+CCCGCG
+CCCGGA
+CCCGGT
+CCCGGC
+CCCGGG
+CCGAAA
+CCGAAT
+CCGAAC
+CCGAAG
+CCGATA
+CCGATT
+CCGATC
+CCGATG
+CCGACA
+CCGACT
+CCGACC
+CCGACG
+CCGAGA
+CCGAGT
+CCGAGC
+CCGAGG
+CCGTAA
+CCGTAT
+CCGTAC
+CCGTAG
+CCGTTA
+CCGTTT
+CCGTTC
+CCGTTG
+CCGTCA
+CCGTCT
+CCGTCC
+CCGTCG
+CCGTGA
+CCGTGT
+CCGTGC
+CCGTGG
+CCGCAA
+CCGCAT
+CCGCAC
+CCGCAG
+CCGCTA
+CCGCTT
+CCGCTC
+CCGCTG
+CCGCCA
+CCGCCT
+CCGCCC
+CCGCCG
+CCGCGA
+CCGCGT
+CCGCGC
+CCGCGG
+CCGGAA
+CCGGAT
+CCGGAC
+CCGGAG
+CCGGTA
+CCGGTT
+CCGGTC
+CCGGTG
+CCGGCA
+CCGGCT
+CCGGCC
+CCGGCG
+CCGGGA
+CCGGGT
+CCGGGC
+CCGGGG
+CGAAAA
+CGAAAT
+CGAAAC
+CGAAAG
+CGAATA
+CGAATT
+CGAATC
+CGAATG
+CGAACA
+CGAACT
+CGAACC
+CGAACG
+CGAAGA
+CGAAGT
+CGAAGC
+CGAAGG
+CGATAA
+CGATAT
+CGATAC
+CGATAG
+CGATTA
+CGATTT
+CGATTC
+CGATTG
+CGATCA
+CGATCT
+CGATCC
+CGATCG
+CGATGA
+CGATGT
+CGATGC
+CGATGG
+CGACAA
+CGACAT
+CGACAC
+CGACAG
+CGACTA
+CGACTT
+CGACTC
+CGACTG
+CGACCA
+CGACCT
+CGACCC
+CGACCG
+CGACGA
+CGACGT
+CGACGC
+CGACGG
+CGAGAA
+CGAGAT
+CGAGAC
+CGAGAG
+CGAGTA
+CGAGTT
+CGAGTC
+CGAGTG
+CGAGCA
+CGAGCT
+CGAGCC
+CGAGCG
+CGAGGA
+CGAGGT
+CGAGGC
+CGAGGG
+CGTAAA
+CGTAAT
+CGTAAC
+CGTAAG
+CGTATA
+CGTATT
+CGTATC
+CGTATG
+CGTACA
+CGTACT
+CGTACC
+CGTACG
+CGTAGA
+CGTAGT
+CGTAGC
+CGTAGG
+CGTTAA
+CGTTAT
+CGTTAC
+CGTTAG
+CGTTTA
+CGTTTT
+CGTTTC
+CGTTTG
+CGTTCA
+CGTTCT
+CGTTCC
+CGTTCG
+CGTTGA
+CGTTGT
+CGTTGC
+CGTTGG
+CGTCAA
+CGTCAT
+CGTCAC
+CGTCAG
+CGTCTA
+CGTCTT
+CGTCTC
+CGTCTG
+CGTCCA
+CGTCCT
+CGTCCC
+CGTCCG
+CGTCGA
+CGTCGT
+CGTCGC
+CGTCGG
+CGTGAA
+CGTGAT
+CGTGAC
+CGTGAG
+CGTGTA
+CGTGTT
+CGTGTC
+CGTGTG
+CGTGCA
+CGTGCT
+CGTGCC
+CGTGCG
+CGTGGA
+CGTGGT
+CGTGGC
+CGTGGG
+CGCAAA
+CGCAAT
+CGCAAC
+CGCAAG
+CGCATA
+CGCATT
+CGCATC
+CGCATG
+CGCACA
+CGCACT
+CGCACC
+CGCACG
+CGCAGA
+CGCAGT
+CGCAGC
+CGCAGG
+CGCTAA
+CGCTAT
+CGCTAC
+CGCTAG
+CGCTTA
+CGCTTT
+CGCTTC
+CGCTTG
+CGCTCA
+CGCTCT
+CGCTCC
+CGCTCG
+CGCTGA
+CGCTGT
+CGCTGC
+CGCTGG
+CGCCAA
+CGCCAT
+CGCCAC
+CGCCAG
+CGCCTA
+CGCCTT
+CGCCTC
+CGCCTG
+CGCCCA
+CGCCCT
+CGCCCC
+CGCCCG
+CGCCGA
+CGCCGT
+CGCCGC
+CGCCGG
+CGCGAA
+CGCGAT
+CGCGAC
+CGCGAG
+CGCGTA
+CGCGTT
+CGCGTC
+CGCGTG
+CGCGCA
+CGCGCT
+CGCGCC
+CGCGCG
+CGCGGA
+CGCGGT
+CGCGGC
+CGCGGG
+CGGAAA
+CGGAAT
+CGGAAC
+CGGAAG
+CGGATA
+CGGATT
+CGGATC
+CGGATG
+CGGACA
+CGGACT
+CGGACC
+CGGACG
+CGGAGA
+CGGAGT
+CGGAGC
+CGGAGG
+CGGTAA
+CGGTAT
+CGGTAC
+CGGTAG
+CGGTTA
+CGGTTT
+CGGTTC
+CGGTTG
+CGGTCA
+CGGTCT
+CGGTCC
+CGGTCG
+CGGTGA
+CGGTGT
+CGGTGC
+CGGTGG
+CGGCAA
+CGGCAT
+CGGCAC
+CGGCAG
+CGGCTA
+CGGCTT
+CGGCTC
+CGGCTG
+CGGCCA
+CGGCCT
+CGGCCC
+CGGCCG
+CGGCGA
+CGGCGT
+CGGCGC
+CGGCGG
+CGGGAA
+CGGGAT
+CGGGAC
+CGGGAG
+CGGGTA
+CGGGTT
+CGGGTC
+CGGGTG
+CGGGCA
+CGGGCT
+CGGGCC
+CGGGCG
+CGGGGA
+CGGGGT
+CGGGGC
+CGGGGG
+GAAAAA
+GAAAAT
+GAAAAC
+GAAAAG
+GAAATA
+GAAATT
+GAAATC
+GAAATG
+GAAACA
+GAAACT
+GAAACC
+GAAACG
+GAAAGA
+GAAAGT
+GAAAGC
+GAAAGG
+GAATAA
+GAATAT
+GAATAC
+GAATAG
+GAATTA
+GAATTT
+GAATTC
+GAATTG
+GAATCA
+GAATCT
+GAATCC
+GAATCG
+GAATGA
+GAATGT
+GAATGC
+GAATGG
+GAACAA
+GAACAT
+GAACAC
+GAACAG
+GAACTA
+GAACTT
+GAACTC
+GAACTG
+GAACCA
+GAACCT
+GAACCC
+GAACCG
+GAACGA
+GAACGT
+GAACGC
+GAACGG
+GAAGAA
+GAAGAT
+GAAGAC
+GAAGAG
+GAAGTA
+GAAGTT
+GAAGTC
+GAAGTG
+GAAGCA
+GAAGCT
+GAAGCC
+GAAGCG
+GAAGGA
+GAAGGT
+GAAGGC
+GAAGGG
+GATAAA
+GATAAT
+GATAAC
+GATAAG
+GATATA
+GATATT
+GATATC
+GATATG
+GATACA
+GATACT
+GATACC
+GATACG
+GATAGA
+GATAGT
+GATAGC
+GATAGG
+GATTAA
+GATTAT
+GATTAC
+GATTAG
+GATTTA
+GATTTT
+GATTTC
+GATTTG
+GATTCA
+GATTCT
+GATTCC
+GATTCG
+GATTGA
+GATTGT
+GATTGC
+GATTGG
+GATCAA
+GATCAT
+GATCAC
+GATCAG
+GATCTA
+GATCTT
+GATCTC
+GATCTG
+GATCCA
+GATCCT
+GATCCC
+GATCCG
+GATCGA
+GATCGT
+GATCGC
+GATCGG
+GATGAA
+GATGAT
+GATGAC
+GATGAG
+GATGTA
+GATGTT
+GATGTC
+GATGTG
+GATGCA
+GATGCT
+GATGCC
+GATGCG
+GATGGA
+GATGGT
+GATGGC
+GATGGG
+GACAAA
+GACAAT
+GACAAC
+GACAAG
+GACATA
+GACATT
+GACATC
+GACATG
+GACACA
+GACACT
+GACACC
+GACACG
+GACAGA
+GACAGT
+GACAGC
+GACAGG
+GACTAA
+GACTAT
+GACTAC
+GACTAG
+GACTTA
+GACTTT
+GACTTC
+GACTTG
+GACTCA
+GACTCT
+GACTCC
+GACTCG
+GACTGA
+GACTGT
+GACTGC
+GACTGG
+GACCAA
+GACCAT
+GACCAC
+GACCAG
+GACCTA
+GACCTT
+GACCTC
+GACCTG
+GACCCA
+GACCCT
+GACCCC
+GACCCG
+GACCGA
+GACCGT
+GACCGC
+GACCGG
+GACGAA
+GACGAT
+GACGAC
+GACGAG
+GACGTA
+GACGTT
+GACGTC
+GACGTG
+GACGCA
+GACGCT
+GACGCC
+GACGCG
+GACGGA
+GACGGT
+GACGGC
+GACGGG
+GAGAAA
+GAGAAT
+GAGAAC
+GAGAAG
+GAGATA
+GAGATT
+GAGATC
+GAGATG
+GAGACA
+GAGACT
+GAGACC
+GAGACG
+GAGAGA
+GAGAGT
+GAGAGC
+GAGAGG
+GAGTAA
+GAGTAT
+GAGTAC
+GAGTAG
+GAGTTA
+GAGTTT
+GAGTTC
+GAGTTG
+GAGTCA
+GAGTCT
+GAGTCC
+GAGTCG
+GAGTGA
+GAGTGT
+GAGTGC
+GAGTGG
+GAGCAA
+GAGCAT
+GAGCAC
+GAGCAG
+GAGCTA
+GAGCTT
+GAGCTC
+GAGCTG
+GAGCCA
+GAGCCT
+GAGCCC
+GAGCCG
+GAGCGA
+GAGCGT
+GAGCGC
+GAGCGG
+GAGGAA
+GAGGAT
+GAGGAC
+GAGGAG
+GAGGTA
+GAGGTT
+GAGGTC
+GAGGTG
+GAGGCA
+GAGGCT
+GAGGCC
+GAGGCG
+GAGGGA
+GAGGGT
+GAGGGC
+GAGGGG
+GTAAAA
+GTAAAT
+GTAAAC
+GTAAAG
+GTAATA
+GTAATT
+GTAATC
+GTAATG
+GTAACA
+GTAACT
+GTAACC
+GTAACG
+GTAAGA
+GTAAGT
+GTAAGC
+GTAAGG
+GTATAA
+GTATAT
+GTATAC
+GTATAG
+GTATTA
+GTATTT
+GTATTC
+GTATTG
+GTATCA
+GTATCT
+GTATCC
+GTATCG
+GTATGA
+GTATGT
+GTATGC
+GTATGG
+GTACAA
+GTACAT
+GTACAC
+GTACAG
+GTACTA
+GTACTT
+GTACTC
+GTACTG
+GTACCA
+GTACCT
+GTACCC
+GTACCG
+GTACGA
+GTACGT
+GTACGC
+GTACGG
+GTAGAA
+GTAGAT
+GTAGAC
+GTAGAG
+GTAGTA
+GTAGTT
+GTAGTC
+GTAGTG
+GTAGCA
+GTAGCT
+GTAGCC
+GTAGCG
+GTAGGA
+GTAGGT
+GTAGGC
+GTAGGG
+GTTAAA
+GTTAAT
+GTTAAC
+GTTAAG
+GTTATA
+GTTATT
+GTTATC
+GTTATG
+GTTACA
+GTTACT
+GTTACC
+GTTACG
+GTTAGA
+GTTAGT
+GTTAGC
+GTTAGG
+GTTTAA
+GTTTAT
+GTTTAC
+GTTTAG
+GTTTTA
+GTTTTT
+GTTTTC
+GTTTTG
+GTTTCA
+GTTTCT
+GTTTCC
+GTTTCG
+GTTTGA
+GTTTGT
+GTTTGC
+GTTTGG
+GTTCAA
+GTTCAT
+GTTCAC
+GTTCAG
+GTTCTA
+GTTCTT
+GTTCTC
+GTTCTG
+GTTCCA
+GTTCCT
+GTTCCC
+GTTCCG
+GTTCGA
+GTTCGT
+GTTCGC
+GTTCGG
+GTTGAA
+GTTGAT
+GTTGAC
+GTTGAG
+GTTGTA
+GTTGTT
+GTTGTC
+GTTGTG
+GTTGCA
+GTTGCT
+GTTGCC
+GTTGCG
+GTTGGA
+GTTGGT
+GTTGGC
+GTTGGG
+GTCAAA
+GTCAAT
+GTCAAC
+GTCAAG
+GTCATA
+GTCATT
+GTCATC
+GTCATG
+GTCACA
+GTCACT
+GTCACC
+GTCACG
+GTCAGA
+GTCAGT
+GTCAGC
+GTCAGG
+GTCTAA
+GTCTAT
+GTCTAC
+GTCTAG
+GTCTTA
+GTCTTT
+GTCTTC
+GTCTTG
+GTCTCA
+GTCTCT
+GTCTCC
+GTCTCG
+GTCTGA
+GTCTGT
+GTCTGC
+GTCTGG
+GTCCAA
+GTCCAT
+GTCCAC
+GTCCAG
+GTCCTA
+GTCCTT
+GTCCTC
+GTCCTG
+GTCCCA
+GTCCCT
+GTCCCC
+GTCCCG
+GTCCGA
+GTCCGT
+GTCCGC
+GTCCGG
+GTCGAA
+GTCGAT
+GTCGAC
+GTCGAG
+GTCGTA
+GTCGTT
+GTCGTC
+GTCGTG
+GTCGCA
+GTCGCT
+GTCGCC
+GTCGCG
+GTCGGA
+GTCGGT
+GTCGGC
+GTCGGG
+GTGAAA
+GTGAAT
+GTGAAC
+GTGAAG
+GTGATA
+GTGATT
+GTGATC
+GTGATG
+GTGACA
+GTGACT
+GTGACC
+GTGACG
+GTGAGA
+GTGAGT
+GTGAGC
+GTGAGG
+GTGTAA
+GTGTAT
+GTGTAC
+GTGTAG
+GTGTTA
+GTGTTT
+GTGTTC
+GTGTTG
+GTGTCA
+GTGTCT
+GTGTCC
+GTGTCG
+GTGTGA
+GTGTGT
+GTGTGC
+GTGTGG
+GTGCAA
+GTGCAT
+GTGCAC
+GTGCAG
+GTGCTA
+GTGCTT
+GTGCTC
+GTGCTG
+GTGCCA
+GTGCCT
+GTGCCC
+GTGCCG
+GTGCGA
+GTGCGT
+GTGCGC
+GTGCGG
+GTGGAA
+GTGGAT
+GTGGAC
+GTGGAG
+GTGGTA
+GTGGTT
+GTGGTC
+GTGGTG
+GTGGCA
+GTGGCT
+GTGGCC
+GTGGCG
+GTGGGA
+GTGGGT
+GTGGGC
+GTGGGG
+GCAAAA
+GCAAAT
+GCAAAC
+GCAAAG
+GCAATA
+GCAATT
+GCAATC
+GCAATG
+GCAACA
+GCAACT
+GCAACC
+GCAACG
+GCAAGA
+GCAAGT
+GCAAGC
+GCAAGG
+GCATAA
+GCATAT
+GCATAC
+GCATAG
+GCATTA
+GCATTT
+GCATTC
+GCATTG
+GCATCA
+GCATCT
+GCATCC
+GCATCG
+GCATGA
+GCATGT
+GCATGC
+GCATGG
+GCACAA
+GCACAT
+GCACAC
+GCACAG
+GCACTA
+GCACTT
+GCACTC
+GCACTG
+GCACCA
+GCACCT
+GCACCC
+GCACCG
+GCACGA
+GCACGT
+GCACGC
+GCACGG
+GCAGAA
+GCAGAT
+GCAGAC
+GCAGAG
+GCAGTA
+GCAGTT
+GCAGTC
+GCAGTG
+GCAGCA
+GCAGCT
+GCAGCC
+GCAGCG
+GCAGGA
+GCAGGT
+GCAGGC
+GCAGGG
+GCTAAA
+GCTAAT
+GCTAAC
+GCTAAG
+GCTATA
+GCTATT
+GCTATC
+GCTATG
+GCTACA
+GCTACT
+GCTACC
+GCTACG
+GCTAGA
+GCTAGT
+GCTAGC
+GCTAGG
+GCTTAA
+GCTTAT
+GCTTAC
+GCTTAG
+GCTTTA
+GCTTTT
+GCTTTC
+GCTTTG
+GCTTCA
+GCTTCT
+GCTTCC
+GCTTCG
+GCTTGA
+GCTTGT
+GCTTGC
+GCTTGG
+GCTCAA
+GCTCAT
+GCTCAC
+GCTCAG
+GCTCTA
+GCTCTT
+GCTCTC
+GCTCTG
+GCTCCA
+GCTCCT
+GCTCCC
+GCTCCG
+GCTCGA
+GCTCGT
+GCTCGC
+GCTCGG
+GCTGAA
+GCTGAT
+GCTGAC
+GCTGAG
+GCTGTA
+GCTGTT
+GCTGTC
+GCTGTG
+GCTGCA
+GCTGCT
+GCTGCC
+GCTGCG
+GCTGGA
+GCTGGT
+GCTGGC
+GCTGGG
+GCCAAA
+GCCAAT
+GCCAAC
+GCCAAG
+GCCATA
+GCCATT
+GCCATC
+GCCATG
+GCCACA
+GCCACT
+GCCACC
+GCCACG
+GCCAGA
+GCCAGT
+GCCAGC
+GCCAGG
+GCCTAA
+GCCTAT
+GCCTAC
+GCCTAG
+GCCTTA
+GCCTTT
+GCCTTC
+GCCTTG
+GCCTCA
+GCCTCT
+GCCTCC
+GCCTCG
+GCCTGA
+GCCTGT
+GCCTGC
+GCCTGG
+GCCCAA
+GCCCAT
+GCCCAC
+GCCCAG
+GCCCTA
+GCCCTT
+GCCCTC
+GCCCTG
+GCCCCA
+GCCCCT
+GCCCCC
+GCCCCG
+GCCCGA
+GCCCGT
+GCCCGC
+GCCCGG
+GCCGAA
+GCCGAT
+GCCGAC
+GCCGAG
+GCCGTA
+GCCGTT
+GCCGTC
+GCCGTG
+GCCGCA
+GCCGCT
+GCCGCC
+GCCGCG
+GCCGGA
+GCCGGT
+GCCGGC
+GCCGGG
+GCGAAA
+GCGAAT
+GCGAAC
+GCGAAG
+GCGATA
+GCGATT
+GCGATC
+GCGATG
+GCGACA
+GCGACT
+GCGACC
+GCGACG
+GCGAGA
+GCGAGT
+GCGAGC
+GCGAGG
+GCGTAA
+GCGTAT
+GCGTAC
+GCGTAG
+GCGTTA
+GCGTTT
+GCGTTC
+GCGTTG
+GCGTCA
+GCGTCT
+GCGTCC
+GCGTCG
+GCGTGA
+GCGTGT
+GCGTGC
+GCGTGG
+GCGCAA
+GCGCAT
+GCGCAC
+GCGCAG
+GCGCTA
+GCGCTT
+GCGCTC
+GCGCTG
+GCGCCA
+GCGCCT
+GCGCCC
+GCGCCG
+GCGCGA
+GCGCGT
+GCGCGC
+GCGCGG
+GCGGAA
+GCGGAT
+GCGGAC
+GCGGAG
+GCGGTA
+GCGGTT
+GCGGTC
+GCGGTG
+GCGGCA
+GCGGCT
+GCGGCC
+GCGGCG
+GCGGGA
+GCGGGT
+GCGGGC
+GCGGGG
+GGAAAA
+GGAAAT
+GGAAAC
+GGAAAG
+GGAATA
+GGAATT
+GGAATC
+GGAATG
+GGAACA
+GGAACT
+GGAACC
+GGAACG
+GGAAGA
+GGAAGT
+GGAAGC
+GGAAGG
+GGATAA
+GGATAT
+GGATAC
+GGATAG
+GGATTA
+GGATTT
+GGATTC
+GGATTG
+GGATCA
+GGATCT
+GGATCC
+GGATCG
+GGATGA
+GGATGT
+GGATGC
+GGATGG
+GGACAA
+GGACAT
+GGACAC
+GGACAG
+GGACTA
+GGACTT
+GGACTC
+GGACTG
+GGACCA
+GGACCT
+GGACCC
+GGACCG
+GGACGA
+GGACGT
+GGACGC
+GGACGG
+GGAGAA
+GGAGAT
+GGAGAC
+GGAGAG
+GGAGTA
+GGAGTT
+GGAGTC
+GGAGTG
+GGAGCA
+GGAGCT
+GGAGCC
+GGAGCG
+GGAGGA
+GGAGGT
+GGAGGC
+GGAGGG
+GGTAAA
+GGTAAT
+GGTAAC
+GGTAAG
+GGTATA
+GGTATT
+GGTATC
+GGTATG
+GGTACA
+GGTACT
+GGTACC
+GGTACG
+GGTAGA
+GGTAGT
+GGTAGC
+GGTAGG
+GGTTAA
+GGTTAT
+GGTTAC
+GGTTAG
+GGTTTA
+GGTTTT
+GGTTTC
+GGTTTG
+GGTTCA
+GGTTCT
+GGTTCC
+GGTTCG
+GGTTGA
+GGTTGT
+GGTTGC
+GGTTGG
+GGTCAA
+GGTCAT
+GGTCAC
+GGTCAG
+GGTCTA
+GGTCTT
+GGTCTC
+GGTCTG
+GGTCCA
+GGTCCT
+GGTCCC
+GGTCCG
+GGTCGA
+GGTCGT
+GGTCGC
+GGTCGG
+GGTGAA
+GGTGAT
+GGTGAC
+GGTGAG
+GGTGTA
+GGTGTT
+GGTGTC
+GGTGTG
+GGTGCA
+GGTGCT
+GGTGCC
+GGTGCG
+GGTGGA
+GGTGGT
+GGTGGC
+GGTGGG
+GGCAAA
+GGCAAT
+GGCAAC
+GGCAAG
+GGCATA
+GGCATT
+GGCATC
+GGCATG
+GGCACA
+GGCACT
+GGCACC
+GGCACG
+GGCAGA
+GGCAGT
+GGCAGC
+GGCAGG
+GGCTAA
+GGCTAT
+GGCTAC
+GGCTAG
+GGCTTA
+GGCTTT
+GGCTTC
+GGCTTG
+GGCTCA
+GGCTCT
+GGCTCC
+GGCTCG
+GGCTGA
+GGCTGT
+GGCTGC
+GGCTGG
+GGCCAA
+GGCCAT
+GGCCAC
+GGCCAG
+GGCCTA
+GGCCTT
+GGCCTC
+GGCCTG
+GGCCCA
+GGCCCT
+GGCCCC
+GGCCCG
+GGCCGA
+GGCCGT
+GGCCGC
+GGCCGG
+GGCGAA
+GGCGAT
+GGCGAC
+GGCGAG
+GGCGTA
+GGCGTT
+GGCGTC
+GGCGTG
+GGCGCA
+GGCGCT
+GGCGCC
+GGCGCG
+GGCGGA
+GGCGGT
+GGCGGC
+GGCGGG
+GGGAAA
+GGGAAT
+GGGAAC
+GGGAAG
+GGGATA
+GGGATT
+GGGATC
+GGGATG
+GGGACA
+GGGACT
+GGGACC
+GGGACG
+GGGAGA
+GGGAGT
+GGGAGC
+GGGAGG
+GGGTAA
+GGGTAT
+GGGTAC
+GGGTAG
+GGGTTA
+GGGTTT
+GGGTTC
+GGGTTG
+GGGTCA
+GGGTCT
+GGGTCC
+GGGTCG
+GGGTGA
+GGGTGT
+GGGTGC
+GGGTGG
+GGGCAA
+GGGCAT
+GGGCAC
+GGGCAG
+GGGCTA
+GGGCTT
+GGGCTC
+GGGCTG
+GGGCCA
+GGGCCT
+GGGCCC
+GGGCCG
+GGGCGA
+GGGCGT
+GGGCGC
+GGGCGG
+GGGGAA
+GGGGAT
+GGGGAC
+GGGGAG
+GGGGTA
+GGGGTT
+GGGGTC
+GGGGTG
+GGGGCA
+GGGGCT
+GGGGCC
+GGGGCG
+GGGGGA
+GGGGGT
+GGGGGC
+GGGGGG
+A
+T
+C
+G
+N
+<eos>
+<bos>