|
--- |
|
tags: |
|
- pytorch_model_hub_mixin |
|
- model_hub_mixin |
|
license: gpl-3.0 |
|
--- |
|
|
|
This model has been pushed to the Hub using the [PytorchModelHubMixin](https://huggingface.co/docs/huggingface_hub/package_reference/mixins#huggingface_hub.PyTorchModelHubMixin) integration: |
|
- Library: [More Information Needed] |
|
- Docs: [More Information Needed] |
|
|
|
## Steps to run model |
|
- First install [transforna](https://github.com/gitHBDX/TransfoRNA/tree/master) |
|
- Example code: |
|
``` |
|
from transforna import GeneEmbeddModel,RnaTokenizer |
|
import torch |
|
model_name = 'Seq-Struct' |
|
model_path = f"HBDX/{model_name}-TransfoRNA" |
|
|
|
#load model and tokenizer |
|
model = GeneEmbeddModel.from_pretrained(model_path) |
|
model.eval() |
|
|
|
#init tokenizer. Tokenizer will automatically get secondary structure of sequence using Vienna RNA package |
|
tokenizer = RnaTokenizer.from_pretrained(model_path,model_name=model_name) |
|
output = tokenizer(['AAAGTCGGAGGTTCGAAGACGATCAGATAC','TTTTCGGAACTGAGGCCATGATTAAGAGGG']) |
|
|
|
#inference |
|
#gene_embedds and second input embedds are the latent space representation of the input sequence and the second input respectively. |
|
#In this case, the second input would be the secondary structure of the sequence |
|
gene_embedd, second_input_embedd, activations,attn_scores_first,attn_scores_second = \ |
|
model(output['input_ids']) |
|
|
|
|
|
#get sub class labels |
|
sub_class_labels = model.convert_ids_to_labels(activations) |
|
|
|
#get major class labels |
|
major_class_labels = model.convert_subclass_to_majorclass(sub_class_labels) |
|
|
|
``` |
|
|
|
|