Datasets:

conceptofmind

/

minipile_embeddings_bf16

like 0

The Largest Planet In Solar System Our solar system has eight planets with a lot many of planetoids, also referred to as dwarf planets. The most significant feature that allows us to call something as planet is that it has gravitational force, is big enough in size and orbits in the same plane. The largest planet in the solar system is Jupiter. As per Roman mythology Jupiter is named as the ruler of gods. Planets Here is a list of planets in order of their distance from the sun, the closest from the sun being on the top: Jupiter is the largest planet in the solar system. Though the volume of the largest planet is 1400 times of earth, its mass is only 318 times. It means that its density is nearly one fourth of earth, indicating that the planet must comprise of gases and not rocks and metals which are found on earth and other inner planets. Jupiter – comparative size with other planets Some interesting facts about the biggest planet: Jupiter Distance from Sun: Nearly 466 million miles. Diameter: 85,788 miles. It could contain more than 12 Earths or all other planets in the solar system within it. Composition: A giant ball comprising of mainly helium and hydrogen. Length of the Day: 9 hours, 55 minutes in Earth time (the duration of one rotation). Length of a Year: 12 Earth years (the duration of one orbit around the sun). Visited by: Pioneer 11, Viking, Galileo, Cassini and others. Jupiter’s Spot This biggest planet is characterized by a big red spot, called Jupiter’s Great Red Spot. In fact, this red spot is a massive storm which Jupiter has continued to bear since more than four hundred years. Three times the size of our earth, this red spot is the largest and most violent storm known to the universe. The winds of this storm can reach speeds of up to 270 miles per hour. Jupiter – largest planet in the solar system Being gaseous, Jupiter’s atmosphere is comparable to an ocean of gases. The currents taking place in the gases are like winds on earth and the cause of Jupiter’s constantly changing swirls. The winds are very colorful but we do not know the precise reason for that. Some attribute those colors to the fast speeds at which the planet rotate while others believe that it is due internal heat created in the planet. Scientific explanation that the colorful atmosphere is created due presence of phosphorus and sulfur in planet’s atmosphere sounds more convincing. Rings on Jupiter Jupiter’s Ring As a consequence of Voyager’s visit to outer planets of our solar system we realized that all planets containing gases have rings and Jupiter is no exception, though the rings in case of the largest planet in solar system are very thin and thus less visible.

Aerobraking Aerobraking is a spaceflight maneuver that reduces the high point of an elliptical orbit (apoapsis) by flying the vehicle through the atmosphere at the low point of the orbit (periapsis). The resulting drag slows the spacecraft. Aerobraking is used when a spacecraft requires a low orbit after arriving at a body with an atmosphere, and it requires less fuel than does the direct use of a rocket engine. Method When an interplanetary vehicle arrives at its destination, it must change its velocity to remain in the vicinity of that body. When a low, near-circular orbit around a body with substantial gravity (as is required for many scientific studies) is needed, the total required velocity changes can be on the order of several kilometers per second. If done by direct propulsion, the rocket equation dictates that a large fraction of the spacecraft mass must be fuel. This in turn means the spacecraft is limited to a relatively small science payload and/or the use of a very large and expensive launcher. Provided the target body has an atmosphere, aerobraking can be used to reduce fuel requirements. The use of a relatively small burn allows the spacecraft to be captured into a very elongated elliptic orbit. Aerobraking is then used to circularize the orbit. If the atmosphere is thick enough, a single pass through it can be sufficient to slow a spacecraft as needed. However, aerobraking is typically done with many orbital passes through a higher altitude, and therefore thinner region of the atmosphere. This is done to reduce the effect of frictional heating, and because unpredictable turbulence effects, atmospheric composition, and temperature make it difficult to accurately predict the decrease in speed that will result from any single pass. When aerobraking is done in this way, there is sufficient time after each pass to measure the change in velocity and make any necessary corrections for the next pass. Achieving the final orbit using this method takes a long time (e.g., over six months when arriving at Mars), and may require several hundred passes through the atmosphere of the planet or moon. After the last aerobraking pass, the spacecraft must be given more kinetic energy via rocket engines in order to raise the periapsis above the atmosphere. The kinetic energy dissipated by aerobraking is converted to heat, meaning that a spacecraft using the technique needs to be capable of dissipating this heat. The spacecraft must also have sufficient surface area and structural strength to produce and survive the required drag, but the temperatures and pressures associated with aerobraking are not as severe as those of atmospheric reentry or aerocapture. Simulations of the Mars Reconnaissance Orbiter aerobraking use a force limit of 0.35 N per square meter with a spacecraft cross section of about 37 m², equate to a maximum drag force of about 7.4 N, and a maximum expected temperature as 170 °C. The force density (i.e. pressure), roughly 0.2 N per square meter, that was exerted on the Mars Observer during aerobraking is comparable to the aerodynamic resistance of moving at 0.6 m/s (2.16 km/h) at sea level on Earth, approximately the amount experienced when walking slowly. Related methods Aerocapture is a related but more extreme method in which no initial orbit-injection burn is performed. Instead, the spacecraft plunges deeply into the atmosphere without an initial insertion burn, and emerges from this single pass in the atmosphere with an apoapsis near that of the desired orbit. Several small correction burns are then used to raise the periapsis and perform final adjustments. This method was originally planned for the Mars Odyssey orbiter, but the significant design impacts proved too costly. Another related technique is that of aerogravity assist, in which the spacecraft flies through the upper atmosphere and utilises aerodynamic lift instead of drag at the point of closest approach. If correctly oriented, this can increase the deflection angle above that of a pure gravity assist, resulting in a larger delta-v. Spacecraft missions Although the theory of aerobraking is well developed, utilising the technique is difficult because a very detailed knowledge of the character of the target planet's atmosphere is needed in order to plan the maneuver correctly. Currently, the deceleration is monitored during each maneuver and plans are modified accordingly. Since no spacecraft can yet aerobrake safely on its own, this requires constant attention from both human controllers and the Deep Space Network. This is particularly true near the end of the process, when the drag passes are relatively close together (only about 2 hours apart for Mars). NASA has used aerobraking four times to modify a spacecraft's orbit to one with lower energy, reduced apoapsis altitude, and smaller orbit. On 19 March 1991, aerobraking was demonstrated by the Hiten spacecraft. This was the first aerobraking maneuver by a deep space probe. Hiten (a.k.a. MUSES-A) was launched by the Institute of Space and Astronautical Science (ISAS) of Japan. Hiten flew by the Earth at an altitude of 125.5 km over the Pacific at 11.0 km/s. Atmospheric drag lowered the velocity by 1.712 m/s and the apogee altitude by 8665 km. Another aerobraking maneuver was conducted on 30 March. In May 1993, aerobraking was used during the extended Venusian mission of the Magellan spacecraft. It was used to circularize the orbit of the spacecraft in order to increase the precision of the measurement of the gravity field. The entire gravity field was mapped from the circular orbit during a 243-day cycle of the extended mission. During the termination phase of the mission, a "windmill experiment" was performed: Atmospheric molecular pressure exerts a torque via the windmill-sail-like oriented solar cell wings, the necessary counter-torque to keep the probe from spinning is measured. In 1997, the Mars Global Surveyor (MGS) orbiter was the first spacecraft to use aerobraking as the main planned technique of orbit adjustment. The MGS used the data gathered from the Magellan mission to Venus to plan its aerobraking technique. The spacecraft used its solar panels as "wings" to control its passage through the tenuous upper atmosphere of Mars and lower the apoapsis of its orbit over the course of many months. Unfortunately, a structural failure shortly after launch severely damaged one of the MGS's solar panels and necessitated a higher aerobraking altitude (and hence one third the force) than originally planned, significantly extending the time required to attain the desired orbit. More recently, aerobraking was used by the Mars Odyssey and Mars Reconnaissance Orbiter spacecraft, in both cases without incident. In 2014, an aerobraking experiment was successfully performed on a test basis near the end of the mission of the ESA probe Venus Express. In 2017–2018, the ESA ExoMars Trace Gas Orbiter performed aerobraking at Mars to reduce the apocentre of the orbit, being the first operational aerobraking for a European mission. Aerobraking in fiction In Robert A. Heinlein's 1948 novel Space Cadet, aerobraking is used to save fuel while slowing the spacecraft Aes Triplex for an unplanned extended mission and landing on Venus, during a transit from the Asteroid Belt to Earth. The spacecraft Cosmonaut Alexei Leonov in Arthur C. Clarke's novel 2010: Odyssey Two and its film adaptation uses aerobraking in the upper layers of Jupiter's atmosphere to establish itself at the Lagrangian point of the Jupiter – Io system. In the 2004 TV series Space Odyssey: Voyage to the Planets the crew of the international spacecraft Pegasus perform an aerobraking manoeuvre in Jupiter's upper atmosphere to slow them down enough to enter Jovian orbit. In the fourth episode of Stargate Universe, the Ancient ship Destiny suffers an almost complete loss of power and must use aerobraking to change course. The episode ends in a cliffhanger with Destiny headed directly toward a star. In the space simulation sandbox game Kerbal Space Program, this is a common method of reducing a craft's orbital speed. It is sometimes humorously referred to as "aerobreaking", because the high drag sometimes causes large crafts to split in several parts. In Kim Stanley Robinson's Mars trilogy, the Ares spaceship carrying the first hundred humans to arrive on Mars uses aerobraking to enter into orbit around the planet. Later in the books, as an effort to thicken the atmosphere scientists bring an asteroid into aerobraking in order to vaporize it and release its contents into the atmosphere. In the 2014 film Interstellar, astronaut pilot Cooper uses aerobraking to save fuel and slow the spacecraft Ranger upon exiting the wormhole to arrive in orbit above the first planet. Aerodynamic braking Aerodynamic braking is a method used in landing aircraft to assist the wheel brakes in stopping the plane. It is often used for short runway landings or when conditions are wet, icy or slippery. Aerodynamic braking is performed immediately after the rear wheels (main mounts) touch down, but before the nose wheel drops. The pilot begins to pull back on the stick, applying elevator pressure to hold the nose high. The nose-high attitude exposes more of the craft's surface-area to the flow of air, which produces greater drag, helping to slow the plane. The raised elevators also cause air to push down on the rear of the craft, forcing the rear wheels harder against the ground, which aids the wheel brakes by helping to prevent skidding. The pilot will usually continue to hold back on the stick even after the elevators lose their authority, and the nose wheel drops, to keep added pressure on the rear wheels. Aerodynamic braking is a common braking technique during landing, which can also help to protect the wheel brakes and tires from excess wear, or from locking up and sending the craft sliding out of control. It is often used by private pilots, commercial planes, fighter aircraft, and was used by the Space Shuttles during landings. See also Aerocapture Boost-glide Lithobraking Notes References JPL aerobraking report for MGS An Explanation of How Aerobraking Works (PDF) Hoffman, S. (August 20–22, 1984). A comparison of aerobraking and aerocapture vehicles for interplanetary missions. AIAA and AAS, Astrodynamics Conference. Seattle, Washington: American Institute of Aeronautics and Astronautics. pp. 25 p.. Retrieved 2007-07-31. Category:Spacecraft propulsion Category:Spaceflight Category:Atmospheric entry

1. Field of the Invention This invention relates to a novel additive composition for automotive fuels, both gasoline and diesel, and to a method for using the composition. 2. The State of the Art The fuels which are contemplated for use in the fuel compositions of the present invention are normally liquid hydrocarbon fuels in the gasoline boiling range, including hydrocarbon base fuels. The term “petroleum distillate fuel” also is used to describe the fuels which can be utilized in the fuel compositions of the present invention and which have the above characteristic boiling points. The term, however, is not intended to be restricted to straight-run distillate fractions. The distillate fuel can be straight-run distillate fuel, catalytically or thermally cracked (including hydro cracked) distillate fuel, or a mixture of straight-run distillate fuel, naphthas and the like with cracked distillate stocks. Also, the base fuels used in the formation of the fuel compositions of the present invention can be treated in accordance with well-known commercial methods, such as acid or caustic treatment, hydrogenation, solvent refining, clay treatment, etc. Gasolines are supplied in a number of different grades depending on the type of service for which they are intended. The gasolines utilized in the present invention include those designed as motor and aviation gasolines. Motor gasolines include those defined by ASTM specification D-439-73 and are composed of a mixture of various types of hydrocarbons including aromatics, olefins, paraffins, isoparaffins, napthenes and occasionally diolefins. Motor gasolines normally have a boiling range within the limits of about 70° F. to 450° F. while aviation gasolines have narrower boiling ranges, usually within the limits of about 100° F. to 330° F. This invention also contemplates the use of diesel fuels. Diesel engines have been employed as engines for over-the-road vehicles because of relatively low fuel costs and improved mileage. However, because of their operating characteristics, diesel engines discharge a larger amount of carbon black particles or very fine condensate particles or agglomerates thereof as compared to the gasoline engine. These particles or condensates are sometimes referred to as “diesel soot”, and the emission of such particles or soot results in pollution and is undesirable. Moreover, diesel soot has been observed to be rich in condensed, polynuclear hydrocarbons, and some of these have been recognized as carcinogenic. Accordingly, particulate traps or filters have been designed for use with diesel engines that are capable of collecting carbon black and condensate particles. Conventionally, the particulate traps or filters have been composed of a heat-resistant filter element which is formed of porous ceramic or metal fiber and an electric heater for heating and igniting carbon particulates collected by the filter element. The heater is required because the temperatures of the diesel exhaust gas under normal operating conditions are insufficient to burn off the accumulated soot collected in the filter or trap. Generally, temperatures of about 450° C. to 600° C. are required, and the heater provides the necessary increase of the exhaust temperature in order to ignite the particles collected in the trap and to regenerate the trap. Otherwise, there is an accumulation of carbon black, and the trap is eventually plugged causing operational problems due to exhaust back pressure buildup. The above-described heated traps do not provide a complete solution to the problem because the temperature of the exhaust gases is lower than the ignition temperature of carbon particulates while the vehicle runs under normal conditions, and the heat generated by the electric heater is withdrawn by the flowing exhaust gases when the volume of flowing exhaust gases is large. Alternatively, higher temperatures in the trap can be achieved by periodically enriching the air/fuel mixture burned in the diesel engine thereby producing a higher exhaust gas temperature. However, such higher temperatures can cause run-away regeneration leading to high localized temperatures which can damage the trap. It also has been suggested that the particle build-up in the traps can be controlled by lowering the ignition temperature of the particulates so that the particles begin burning at the lowest possible temperatures. One method of lowering the ignition temperature involves the addition of a combustion improver to the exhaust particulate, and the most practical way to effect the addition of the combustion improver to the exhaust particulate is by adding the combustion improver to the fuel. Copper compounds have been suggested as combustion improvers for fuels including diesel fuels. The U.S. Environmental Protection Agency (EPA) as of the early 1990s estimated that the average sulfur content of on-highway diesel fuel is approximately 0.25% by weight and had required this level be reduced to no more than 0.05% by weight by Oct. 1, 1993. The EPA also required that this diesel fuel have a minimum cetane index specification of 40 (or meet a maximum aromatics level of 35%). The objective of this rule was to reduce sulfate particulate and carbonaceous and organic particulate emissions. See, Federal Register, Vol. 55, No. 162, Aug. 21, 1990, pp. 34120-34151. Low-sulfur diesel fuels and technology for meeting these emission requirements have not yet been commercially implemented. One approach to meeting these requirements was to provide a low-sulfur diesel fuel additive that could be effectively used in a low-sulfur diesel fuel environment to reduce the ignition temperatures of soot that is collected in the particulate traps of diesel engines. Various patents, such as U.S. Pat. No. 5,344,467, U.S. Pat. No. 4,340,369, and U.S. Pat. No. 5,376,154, disclosure metal complexes of difunctional organic compounds, including alkali metal salts of difunctional arylsulfonic acids, as fuel additives. Sodium and potassium are the salts of preference. The complex is present in the fuel to provide of up 0.5% by weight of metal (that is, up to 5000 ppm of fuel). The use of alkali earth metal salts of didodecyl benzensulfonic acid for fuel additives is disclosed in U.S. Pat. No. 5,133,900 and U.S. Pat. No. 4,169,564. U.S. Pat. No. 4,781,730 discloses an alkali metal salt of the reaction product of a polybasic acid and a specified polyhydroxyalkanolamine. Suitable polybasic acids include didodecyl benzenesulfonic acid. Suitable alkali metals are disclosed as including lithium, although the example describes only the use of sodium salts. U.S. Pat. No. 6,017,369 discloses diesel fuel composition comprising a solution of ethanol, an alkyl ester of a fatty acid, a stabilizing additive selected from the group consisting of (a) a mixture comprising two different ethoxylated fatty alcohols, a cetane booster, and a demulsifier and (b) the reaction product of (1) a mixture of an ethoxylated alcohol and an amide and (2) an ethoxylated fatty acid, and optionally a cosolvent such as naphtha or kerosene. The cetane booster may be t-butyl peroxide. T-butyl peroxide is disclosed in various literature references as a conventional ignition improver or a cetane booster. U.S. Pat. No. 4,668,247 describes a fuel composition for harnessing the hydrogen energy of a hydrocarbon fuel, comprising 10-90% of a liposoluble organometallic lithium salt and 90-10% of a vehicle oil.

Multi-center and multi-national collaborations are generating genomic, clinical and epidemiological datasets on ever increasing scales across global populations. Early examples include the international HapMap project and ongoing efforts include the 1000 Genomes Project, the genotyping and sequencing of whole populations or significant numbers of national of certain countries. The new initiatives include the UK10K project (<http://www.uk10k.org>), which aims to sequence thousands of genomes in Britain to identify rare variants and produce a sequence variation resource for future studies, the Qatar Genome Project, which will map the genomes of a large group of Qataris to chart a road map for future treatment through personalized medicine, and the Estonian Genome Project, which aims to generate data from 70% of Estonia\'s population. As a result of the broad sharing and analysis of these datasets, we are gaining new knowledge that is shedding novel insights into human history and health, such as the patho-biology of some of the world\'s most intractable diseases, and strategies for improving the efficacy and safety of treatments for several global diseases. Open sharing of data (with public access either directly or via data access committee, depending on the consent conditions) is thus extremely important for fully exploiting results and advancing research. However, to maximize the benefits for the world populations in terms of improved treatments for genetic disorders that access to genomic data can facilitate, while minimizing the risks of broad genomic data sharing, analysis and interpretation, it is important to recognize some challenges. The major impediments to global data sharing are protection of participants and technical challenges in accessing data from disparate sources. Here we highlight three issues; first, because human genomic, clinical and epidemiological data can contain very sensitive information at the individual and population levels, there is a need for both rigorous institutional ethical review and the implementation of an informed consent process that protects participants, but at the same time provides flexibility to use the data for broader research. To ensure continued participants\' protection, data is usually anonymized. However, if accompanied by enough demographic or phenotypic data, anonymization is not always 100% effective. In addition, many projects that have been undertaken did not include broad consent for data sharing and access. In some of these cases selected aspects of the data may still be shareable, but only if it is made publicly accessible via some means. In most cases, data sits behind data access committees and once access is granted, raw or processed files are made available. However, some computational experience is usually required to be able to use the data, namely to mine it or perform meta-analysis. Further, in most cases technological infrastructure is needed to permit access to specific segments of a dataset. The Global Alliance for Genomics and Health (G4GH: <http://genomicsandhealth.org/>) initiative is developing Application Programming Interfaces (APIs) that will address these types of requirements and in turn facilitate data sharing across federated resources. These APIs will, for example, enable researchers to compare variants from different studies or simply to query different sources to determine whether a variant is present in the dataset or not, without revealing everything about the data. If more or different data is required to complete the analysis, further requests are made to the data access committees. The work of the GA4GH will pioneer a way to enable more global sharing of publicly accessible genomic data. As part of the G4GH, the Genomic Data Working Group (<http://genomicsandhealth.org/our-work/working-groups>) focuses on data representation, storage, and analysis, including working with platform development partners and industry leaders to develop standards that will facilitate interoperability. It works closely with the G4GH Regulatory and Ethics Working Group to ensure that any data access or sharing complies with ethical consent associated with the datasets. Second, the global effort to use genomic approaches to solve human health problems needs to be more equitable in terms of inclusiveness of ancestrally diverse study populations. Given what is known about the existence of population specific disease genetic variants and the value of trans-ethnic mapping for discovery, replication and fine-mapping, it is a scientific imperative that genomics becomes more globally diverse. Currently, over 90% of all GWAS focused on people of European ancestry, leaving the promise of genomic science unlikely to be realized in a timely and efficient manner for all human populations. With the funding of major international initiatives, such as the Human Heredity and Health in Africa (H3Africa)[1](#fn0010){ref-type="fn"} and the establishment of the Mexico National Institute of Genomic Medicine (INMEGEN), the global community is beginning to address this problem. With over \$70 M multiple year commitment from the NIH and the Wellcome Trust, H3Africa is creating and supporting a pan-continental network of labs, bioinformatics and biorepository facilities that are applying leading-edge genomic and epidemiologic approaches to study the genetic and environmental bases of disease susceptibility and drug responses in Africans. H3Africa is already changing the landscape of genomic research in Africa.^1^ INMEGEN was established by the Mexican congress in 2004 as a means of finding new strategies to tackle common diseases. This effort which includes the construction of a haplotype map of the Mexican populations and the development of large genetic epidemiology projects for the study of common diseases and biomarker discovery is beginning to provide novel insights into the history and health of the Mexican people. We strongly advocate for the expansion of these global efforts in low resourced nations with the goal of establishing state-of-the-art genomic infrastructure and training. We envision that this goal can be achieved by first understanding the political, economic and scientific expertise needed across national and international interest groups including local government agencies, private biomedical funding agencies, healthcare providers, biotechnology companies and advocacy groups among others. Second, trusted partnership with the strongest ethics and privacy requirements must be developed. Third, these partnerships must acknowledge and be willing to work to overcome the challenges of some its members such that these global arrangements are not perceived simply as a way to make valuable genomic and clinical data available to scientists in the industrialized nations. If concerns are addressed properly, it is indeed possible that these global collaborations will ensure the full participation of ancestrally diverse populations in genomic science as scientists and study participants with the ultimate goal of avoiding the exacerbation of current inequities in health and lack of diversity in biomedical research. Lastly, we advocate for global data and knowledge sharing policies that recognize the strengths and challenges of scientists in different economic and cultural settings. The process of generating genetic epidemiology datasets usually requires costly investment of time and effort on the part of several scientists. In this regard, it is important to derive as much benefit as possible, in terms of publications and training of students in genomics and other aspects of biomedical research. However, this should not be at the expense of global data sharing. To ensure that the efforts of scientists generating the original data are adequately recognized, it is important that they have the necessary infrastructure and scientific capacity to take a timely advantage of the data that they have generated. Achieving this goal may be problematic for young or new investigators to the field of genomics and in general for scientists from developing countries who do not have access to extensive resources available to some researchers in the developed world. This highlights the need to accelerate the training of these investigators and to equip them with the infrastructure required through injection of funds such as those provided within the H3Africa and other similar initiatives. Lack of access to skills and infrastructure would lengthen the time for researchers to achieve their research objectives, and if their data becomes publicly accessible too soon, they will lose the opportunity to be first to publish on the data. Processing of large volumes of genomic data, for example, will take much longer where computing resources are limited, and even transferring the data from the site of generation (e.g. sequencing centers) to the site of analysis is a major challenge in developing countries due to poor internet connectivity. This can be addressed by publication embargo policy that recognizes these limitations by providing relatively long time to publish their papers before making the datasets publicly available. A recent example is the data sharing policy of the H3Africa initiative available at [www.h3africa.org](http://www.h3africa.org){#ir0040}. The H3Africa consortium data sharing and access policy provides for an extended time period for analysis prior to submission to public repositories. Concessions by funding agencies that take into account available resources of groups they fund will be important for protecting the interests of these groups, but ultimately, the data should be shared to enable others to benefit from the data and to use it for the advancement of science, economy and health of global populations. In all, data sharing across national and institutional boundaries is good for science and for the creation of "global good". However, sharing has to be done ethically and fairly with a clear process of community engagement when appropriate and a robust process of obtaining individual informed consent for both primary and secondary uses of generated data. The views in this article are those of the authors and do not represent those of their institutions. The authors declare no conflicts of interests. Rotimi C., et al. H3Africa Consortium. Research capacity. Enabling the genomic revolution in Africa. Science. 2014 Jun 20;344(6190):1346-8.

List of Danish monarchs This is a list of Danish monarchs, that is, the kings and queens regnant of Denmark. This includes: The Kingdom of Denmark (up to 1397) Personal union of Denmark and Norway (1380–1397) The Kalmar Union (1397–1536) Union of Denmark, Norway and Sweden (1397–1523) Union of Denmark and Norway (1523–1536) The Kingdom of Denmark-Norway (1536–1814) The Kingdom of Denmark (1814–present) Iceland (since the union between Denmark and Norway in 1380; independent kingdom in a personal union with Denmark 1918–1944; a sovereign republic since 1944) Greenland (since the union between Denmark and Norway in 1380; effective Danish control began in 1721; integrated into the Danish realm in 1953; internal home rule introduced 1979; self-determination assumed in 2009; Greenland has two out of 179 seats in the Danish parliament Folketinget) Faroe Islands (since the union between Denmark and Norway in 1380; County of Denmark 1816–1948; internal home rule introduced 1948; The Faroe Islands have two out of 179 seats in the Danish parliament Folketinget) The house of Oldenburg held the Danish Crown between 1448 and 1863, when it passed to the house of Schleswig-Holstein-Sonderburg-Glücksburg, a cadet branch of the same house, patrilineally descended from King Christian III of Denmark. The kingdom had been elective (although the eldest son or brother of the previous king was usually elected) until 1660, when it became hereditary and absolutist. Until 1864 Denmark was also united in a personal union with the duchies of Holstein and Saxe-Lauenburg (1814–1864), and in a political and personal union with the Duchy of Schleswig. Pre House of Knýtlinga Danish monarchs The exact date of origin of the Kingdom of Denmark is not established, but names of Danish kings begins to emerge in foreign sources from the 8th century and onwards. Danish and Nordic legendary stories, chronicles and sagas often have accounts of Danish kings and dynasties stretching further back in time than the 7th century, but the historicity of the content and interpretations of these stories are often put to doubt. Chochilaicus—see Hugleik and Hygelac— 515 AD, mentioned by Gregory of Tours (538–594). Hugleik, according to the written sources, suffered a defeat in 515 during a naval expedition to the Frankish Empire. Hugleik is the first Danish king mentioned in European sources. Ongendus (Angantyr): Saint Willibrord wrote about when he visited the Danes, at the time ruled by Ongendus. Harald, named as former king in relating 9th-century events, perhaps model for legendary Harald Wartooth. Related to the Frisian king Redbad II who in 754 had to flee to "the land of the Danes" where King Harald reigned ("Daniae Regi Heraldi"). Sigfred: 770s–790s Gudfred: 804–810, mentioned as Danish king in the Treaty of Heiligen 811. Hemming: 810–811/812 The Treaty of Heiligen was signed in 811 between the Danish King Hemming and Charlemagne. Sigfred, nephew of Gudfred, and Anulo (Anlaufr), grandson or nephew of Harald, fought for the throne and both were killed, perhaps model for the legendary Sigurd Hring: Harald Klak and his brothers Ragnfrid and Hemming Halfdansson: 812–813 and again from 819/827. From 826 he and his household lived in exile with the Frankish emperor Louis the Pious, he was baptized by the bishop of Mainz in Ingelheim am Rhein. The last reference of Harald in the written sources are in the Annals of Fulda which records his execution for treason in 852. Sons of Gudfred: 814–820s Horik I: (814) 827–854, King of the Danes (at first ruling jointly with his unnamed brothers). The Frankish annals mention Horik on numerous occasions during the next couple of decades. Horik II: 854–860s. He is believed to have been the immediate successor of Horik I, but the annals are silent about the name of the Danish king for a few years after the disaster of 854. In 857, Horik II allowed Rorik to occupy the part of the kingdom between the sea and the Eider. Horik II was still alive in 864, when a letter was addressed to him by Pope Nicholas I. Late 9th century kings Bagsecg: Halfdan: 871–877 Sigfred: It is generally assumed that he was the immediate successor of Horik II, although that is not certain. His year of succession is unknown, but it was between 864 (when Horik II was still king) and his first appearance as king in the Frankish annals in 873. Sigifrid was baptized in 882. Gudfred: 880s Heiligo (Halga): 890s (?), described by Adam of Bremen as the immediate predecessor of the House of Olof. The "House of Olaf": late 9th century and early 10th century. This dynasty is described by Adam of Bremen, and members of this dynasty are commemorated by the two Sigtrygg Runestones, which represent contemporary evidence that the House of Olaf controlled at least part of Denmark. Olof the Brash, said by Adam to have been a Swede who defeated Heiligo and took the crown. Gyrd and Gnupa, sons and joint successors of Olof, according to Adam. Gnupa is named by Widukind of Corvey as leader of the Danes in 934, and appears on the Sigtrygg Runestones. Sigtrygg, son of Gnupa, memorialized on the Sigtrygg Runestones, presumably dating from shortly after 934. Semi-legendary kings Ragnar Lodbrok, a legendary king probably in the 9th century, only appears in sagas and late histories, and these accounts are wildly inconsistent. He may be a composite character, a chimera of several historical kings and Vikings. Sigurd Snake-in-the-Eye (da: Sigurd Orm-i-øje or Snogeøje). Mentioned by late Chronicon Roskildense and Ragnarssona þáttr. Said to be king of Zealand and Scania, and son of Ragnar Lodbrok. He may be inspired by late 9th century King Sigfred (above). Harthacnut (Hardeknud). According to the sagas he is son of Sigurd Snake-in-the-Eye, but some historians identify him with Adam's Hardegon, Svein's son, who invaded Denmark from Northmannia and supplanted the House of Olof. He may have ruled only part of Denmark, as Adam places the commencement of his long reign between 909 and 915, while the House of Olof was still ruling at least part of Denmark as late as 934. He was father of Gorm the Old. List of monarchs of Denmark House of Gorm (c. 936–1042) House of Fairhair (1042–1047) House of Estridsen (1047–1375) House of Bjelbo (1376–1387) House of Estridsen (1376–1412) House of Pomerania (1397–1439) House of Palatinate-Neumarkt (1440–1448) House of Oldenburg (1448–1863) |- | 28 September 144821 May 1481() | | | February 1426Oldenburgeldest son of Dietrich, Count of Oldenburg and Helvig of Schauenburg | Dorothea of Brandenburg28 October 1449Church of Our Ladyfive children | 21 May 1481Copenhagen Castleaged 55 |- | (Hans)21 May 148120 February 1513() | | | 2 February 1455Aalborghus Castlethird son of Christian I and Dorothea of Brandenburg | Christina of Saxony6 September 1478Copenhagenfive children | 20 February 1513Aalborghus Castleaged 58 |- | 22 July 151320 January 1523()(deposed) | | | 1 July 1481Nyborg Castlesecond son of John and Christina of Saxony | Isabella of Austria12 August 1515Copenhagensix children | 25 January 1559Kalundborg Castleaged 77 |- | 13 April 152310 April 1533() | | | 7 October 1471Haderslevhus Castlefourth son of Christian I and Dorothea of Brandenburg | (1) Anna of Brandenburg10 April 1502Stendaltwo children(2) Sophie of Pomerania9 October 1518Kiel Castlesix children | 10 April 1533Gottorp Castleaged 61 |- |align="center" colspan="6"| Interregnum (1533–1534) |- | 4 July 15341 January 1559() | | | 12 August 1503Gottorp Castleonly son of Frederick I and Anna of Brandenburg | Dorothea of Saxe-Lauenburg29 October 1525Lauenburg Castlefive children | 1 January 1559Koldinghus Castleaged 55 |- | 1 January 15594 April 1588() | | | 1 July 1534Haderslevhus Castleeldest son of Christian III and Dorothea of Saxe-Lauenburg | Sophie of Mecklenburg-Güstrow20 July 1572Copenhageneight children | 4 April 1588Antvorskov Castleaged 53 |- | 4 April 158828 February 1648() | | | 12 April 1577Frederiksborg Palaceeldest son of Frederick II and Sophie of Mecklenburg-Güstrow | (1) Anne Catherine of Brandenburg27 November 1597Haderslevhus Castleseven children(2) Kirsten Munk31 December 1615Copenhagentwelve children | 28 February 1648Rosenborg Castleaged 70 |- | 28 February 16489 February 1670() | | | 18 March 1609Haderslevhus Castlethird son of Christian IV and Anne Catherine of Brandenburg | Sophie Amalie of Brunswick-Lüneburg1 October 1643Glücksburg Castleeight children | 9 February 1670Copenhagen Castleaged 60 |- | 9 February 167025 August 1699() | | | 15 April 1646Duborg Castleeldest son of Frederick III and Sophie Amalie of Brunswick-Lüneburg | Charlotte Amalie of Hesse-Kassel25 June 1667Nykøbing Castleeight children | 25 August 1699Copenhagen Castleaged 53 |- | 25 August 169912 October 1730() | | | 11 October 1671Copenhagen Castleeldest son of Christian V and Charlotte Amalie of Hesse-Kassel | (1) Louise of Mecklenburg-Güstrow5 December 1695Copenhagenfive children(2) Elisabeth Helene von Vieregg6 September 1703one son(3) Anne Sophie Reventlow4 April 1721Copenhagenthree children | 12 October 1730Odense Palaceaged 59 |- | 12 October 17306 August 1746() | | | 30 November 1699Copenhagen Castlesecond son of Frederick IV and Louise of Mecklenburg-Güstrow | Sophia Magdalene of Brandenburg-Kulmbach7 August 1721Pretzsch Castlethree children | 6 August 1746Hirschholm Palaceaged 46 |- | 6 August 174614 January 1766() | | | 31 March 1723Copenhagen Castleonly son of Christian VI and Sophia Magdalene of Brandenburg-Kulmbach | (1) Louise of Great Britain11 December 1743Altonafive children(2) Juliana Maria of Brunswick-Wolfenbüttel8 July 1752Frederiksborg Palaceone son | 14 January 1766Christiansborg Palaceaged 42 |- | 14 January 176613 March 1808() | | | 29 January 1749Christiansborg Palacesecond son of Frederick V and Louise of Great Britain | Caroline Matilda of Great Britain8 November 1766Christiansborg Palacetwo children | 13 March 1808Rendsburgaged 59 |- | 13 March 18083 December 1839() | | | 28 January 1768Christiansborg Palaceonly son of Christian VII and Caroline Matilda of Great Britain | Marie Sophie of Hesse-Kassel31 July 1790Gottorp Castleeight children | 3 December 1839Amalienborg Palaceaged 71 |- | Christian Frederick3 December 183920 January 1848() | | | 18 September 1786Christiansborg Palaceeldest son of Frederick, Hereditary Prince of Denmark and Sophia Frederica of Mecklenburg-Schwerin | (1) Charlotte Frederica of Mecklenburg-Schwerin21 June 1806Ludwigslust Castletwo sons(2) Caroline Amalie of Schleswig-Holstein-Sonderburg-Augustenburg22 May 1815Augustenborg Palaceno issue | 20 January 1848Amalienborg Palaceaged 61 |- | Frederik Carl Christian20 January 184815 November 1863() | | | 6 October 1808Amalienborg Palacesecond son of Christian VIII and Charlotte Frederica of Mecklenburg-Schwerin | (1) Vilhelmine Marie of Denmark1 November 1828Christiansborg Palaceno issue(2) Caroline of Mecklenburg10 June 1841Neustrelitzno issue(3) Louise Rasmussen7 August 1850Frederiksborg Palaceno issue | 15 November 1863Glücksburg Castleaged 55 |} House of Schleswig-Holstein-Sonderburg-Glücksburg (since 1863) |- | 15 November 186329 January 1906() | | | 8 April 1818Gottorf Castlefourth son of Friedrich Wilhelm, Duke of Schleswig-Holstein-Sonderburg-Glücksburg and Princess Louise Caroline of Hesse-Kassel | Louise of Hesse-Kassel26 May 1842Amalienborg Palacesix children | 29 January 1906Amalienborg Palaceaged 87 | Great-grandson of King Frederick V and male-line descendant of King Christian III | |- | Christian Frederik Vilhelm Carl 29 January 190614 May 1912() | | | 3 June 1843Yellow Palaceeldest son of Christian IX and Louise of Hesse-Kassel | Louise of Sweden28 July 1869Stockholmeight children | 14 May 1912Jungfernstieg, Hamburgaged 68 | Son of King Christian IX | |- | Christian Carl Frederik Albert Alexander Vilhelm 14 May 191220 April 1947() | | | 26 September 1870Charlottenlund Palaceeldest son of Frederick VIII and Louise of Sweden | Alexandrine of Mecklenburg-Schwerin26 April 1898Cannestwo sons | 20 April 1947Amalienborg Palaceaged 76 | Son of King Frederick VIII | |- | Christian Frederik Franz Michael Carl Valdemar Georg 20 April 194714 January 1972() | | | 11 March 1899Sorgenfri Palaceeldest son of Christian X and Alexandrine of Mecklenburg-Schwerin | Ingrid of Sweden24 May 1935Storkyrkan Cathedral, Stockholmthree daughters | 14 January 1972Amalienborg Palaceaged 72 | Son of King Christian X | |- | Margrethe Alexandrine Þórhildur Ingrid 14 January 1972Present() | | | 16 April 1940Amalienborg Palaceeldest daughter of Frederick IX and Ingrid of Sweden | Henri de Laborde de Monpezat10 June 1967Holmen Church, Copenhagentwo sons | IncumbentAge | Daughter of King Frederick IX | |} Timeline of Danish monarchs See also Danish monarchs' family tree Line of succession to the Danish throne List of Danish royal consorts Coronation of the Danish monarch Style of the Danish sovereign Danish Orders of Chivalry Lists of office-holders Footnotes Further reading "Royal Lineage" Royal Family – The Monarchy in Denmark. "Kongerækken" Kongehuset. Monarchs Denmark

Q: Send data to a method and check it one by one I got a challenge to make a Ulam Spiral in Java, but before the Ulam Spiral is created, the user should put in 2 numbers. Those 2 numbers should be checked so they aren't a prime number. As long as one of the numbers that are written is a prime number, then the program should restart and ask for 2 new numbers. The getInput method is asking the user for 2 numbers. After that those numbers are written, the isPrime method should be called and one number at a time should be checked if it's a prime. If the first number checked isn't a prime, then the second number should be checked, if that also isn't a prime, then the next method should be called. What I don't understand is the isPrime method I have. It checks the number, but how do I make so if the first isn't a prime, then check the next number and as long as none of them are prime, then we are fine. I could make that the isPrime method takes in both numbers and they are checked, but I was not allowed to do that, I must check one number at a time. Here you see my getInput and isPrime method. And yes, I know that isPrime(firstNumber); isPrime(secondsNumber); in my main method is weird and it shouldn't be like that, should it? is it a better way? public class UlamSpiral { private static int firstNumber, secondNumber; private static Scanner scanner = new Scanner(System.in); private static boolean flag = false; public static void main(String[] args) { getInput(); isPrime(firstNumber); isPrime(secondsNumber); } public static void getInput() { System.out.println("Enter two non-prime numbers"); firstNumber = scanner.nextInt(); secondNumber = scanner.nextInt(); } public static boolean isPrime(int num) { for(int i = 2; i <= num / 2; ++i) { // Condition for non-prime number. if(num % i == 0) { flag = true; break; } } if (!flag) System.out.println(num + " Atleast one of the numbers are a prime number."); return true; } EDIT: 1. This is what I have now, but it won't work correctly. When the program starts and I write in 2 prime numbers like 3, 5, then it tells me one of the numbers are prime and restart the program. Seconds time, if I write in 3, 4, then the program continues even if 3 is a prime number. public static void main(String[] args) { getInput(); if(isPrime(firstNumber) || isPrime(secondNumber)){ System.out.println("Atleast one of the numbers are a prime number."); getInput(); } else { isMax(firstNumber, secondNumber); } public static void getInput() { System.out.println("Enter two non-prime numbers"); firstNumber = scanner.nextInt(); secondNumber = scanner.nextInt(); } public static boolean isPrime(int num) { boolean flag = true; for (int i = 2; i <= num / 2; ++i) { // Condition for non-prime number. if (num % i == 0) { flag = false; break; } } return flag; } Output: Enter two non-prime numbers 3 5 Atleast one of the numbers are a prime number. Enter two non-prime numbers 3 4 Process finished with exit code 0 A: Take the printing out of isPrime method and have it after both the numbers are checked. Refactor the code as below: public class UlamSpiral { private static int firstNumber, secondNumber; private static Scanner scanner = new Scanner(System.in); public static void main(String[] args) { getInput(); if(isPrime(firstNumber) || isPrime(secondNumber)){ System.out.println("Atleast one of the numbers are a prime number."); } else { //scenario when none are prime } } public static void getInput() { System.out.println("Enter two non-prime numbers"); firstNumber = scanner.nextInt(); secondNumber = scanner.nextInt(); } public static boolean isPrime(int num) { boolean flag = false; for(int i = 2; i <= num / 2; ++i) { // Condition for non-prime number. if(num % i == 0) { flag = true; break; } } return flag; } }

Introduction ============ In our bodies, the intestinal environment provides a shelter for an enormous number of microorganisms; bacteria comprise up to 60% of the dry mass of feces. Other types of intestinal microorganisms include fungi, archaea and viruses. Compared with that of bacteria, the incidence of pathogenic fungi infections is relatively low; therefore, we might easily undervalue their potential threat to our health. In fact, several studies have identified that the gut fungal microbiota also exert important functions in the gut \[[@goz028-B1], [@goz028-B2]\]. In contrast to the commensal bacterial community, the fungal community is unstable and prone to higher variability in the gut \[[@goz028-B3]\]. Whereas recent studies have found that the fungal microbiota is more stable than originally thought, it is significantly altered in certain intestinal diseases, such as inflammatory bowel disease (IBD) \[[@goz028-B4], [@goz028-B5]\]. In the gastrointestinal tract of healthy individuals, only a small number of fungal species, including *Candida*, *Saccharomyces* and *Aspergillus*, colonize and grow steadily \[[@goz028-B6]\]. Dysbiosis of the gut bacteria has been studied for several decades and this specific term describes a perturbed condition involving alterations in the gut flora that can be both result from and cause various pathologies \[[@goz028-B9]\]. The gastrointestinal tract is the longest visceral cavity in the body, with a length of approximately 16 feet and a massive absorptive area due to its microvilli \[[@goz028-B10]\]. As it is in direct contact with food-derived antigens, the commensal gut microbiota and potential invasive pathogens that enter through the diet, the gut immune system has developed sophisticated mechanisms for sensing pathogenic and non-pathogenic microorganisms and for initiating an immediate response under threats from pathogens \[[@goz028-B1]\]. The gut immune system is necessary for homeostasis maintenance in the gut microenvironment, as it maintains a delicate balance among bacteria, fungi and the gut epithelium. The recognition of fungal pathogens and initiation of the subsequent antifungal immune responses in the gut are mostly mediated by members of the C-type lectin receptor (CLR) family. CLRs play critical roles in gastrointestinal antifungal immunity by serving as pattern-recognition receptors (PRRs). Some key members include Dectin-1, Dectin-2, Dectin-3 and Mincle. These CLRs recognize pathogen-associated molecular patterns (PAMPs) expressed on certain fungal cell walls and induce innate and adaptive immune responses \[[@goz028-B11]\]. IBD is a common and complex intestinal disease that is clearly associated with intestinal dysbiosis \[[@goz028-B12], [@goz028-B13]\]. IBD has two main clinical manifestations: Crohn's disease (CD) and ulcerative colitis (UC) \[[@goz028-B14]\]. Both bacteria and fungi can perturb harmonious host--microbe symbiosis and immune homeostasis. Therefore, CLRs, as innate immune receptors, may play vital roles in IBD progression. There is also a link between cancer and the gut microbiota \[[@goz028-B15]\]. Since cancer susceptibility and severity are associated with inflammation \[[@goz028-B16]\], there may be a relationship between oncogenesis, tumor progression and antifungal immunity \[[@goz028-B17]\] because the antifungal immunity is mainly mediated by CLRs. The central roles that CLRs play in promoting immunity to fungal pathogens are also shared with other PRRs such as Toll-like receptors (TLRs) \[[@goz028-B18]\], suggesting that it may be possible to target some of these receptors, such as Toll-like receptor 1 or Toll-like receptor 9, to induce more efficient immune responses. The collaborations between CLRs and other PRRs might form the basis for new combinative approaches for fighting gastrointestinal disorders and related diseases. Mucosal immunity to the gut microbiota ====================================== The gastrointestinal microbiota plays a critical role in shaping host immunity. In return, the host immune system uses a variety of mechanisms to maintain a harmonious symbiosis \[[@goz028-B21]\]. This process involves the induction of protective immune responses to pathogens as well as the regulatory immunity required for ongoing tolerance of resident microbiota during homeostasis and the immune responses during dysbiosis \[[@goz028-B8], [@goz028-B22]\]. Our knowledge about mucosal immunity to the gastrointestinal microbiota mostly came from work performed under conditions of pathogen infection, while the functions of the immune system and the microbiota during homeostasis or dysbiosis remain unclear. In this section, we discuss the regulatory roles of the gastrointestinal immune system in the maintenance of homeostasis with a focus on the fungal community. Alterations in the intestinal mycobiota may also be associated with the susceptibility and severity of various diseases. Beneficial fungi and pathogenic fungi can be identified in the gastrointestinal tract during homeostasis and dysbiosis. The beneficial fungi are usually defined as harmless commensals living in the gut and the appropriate proportion of the beneficial fungi remains stable to maintain a delicate balance. In contrast, pathogenic fungi are found to be increasing in many diseases and influence the progression of the disease. *Saccharomyces cerevisiae* is thought to be beneficial to gut microbial ecology and has probiotic effects, while, if co-morbidities are present, *S. cerevisiae* may give rise to the increasing incidence of *Saccharomyces* fungemia \[[@goz028-B6]\]. This example suggests that the pathogenic fungi and beneficial ones can interconvert into each other. Many factors could contribute to fungal dysbiosis, including use of antibiotics, diet and genetic factors. Compared with intestinal fungal infections, which are relatively rare, fungal dysbiosis occurs more frequently in the gastrointestinal tract. For example, *Candida albicans* is a well-known commensal in the gut of healthy individuals; however, it can also be pathogenic in the gastrointestinal tract. A shift from a normal commensal state to a dangerous pathogen state can be caused by antibiotic use. One study found that treatment with oral antibiotics can lead to overgrowth of *Candida* populations in the gut of people and mice \[[@goz028-B23]\]. Furthermore, the symbiosis between bacteria and fungi may also affect how the host immune responses control fungal colonization and growth. Mice colonized with *Bacteroides thetaiotamicron* are more resistant to the colonization of *C.* *albicans* than the germ-free mice via production of anti-microbial peptide LL-37 \[[@goz028-B24]\]. PRRs are often activated during infection; however, CLRs also exert their important host-protective functions during dysbiosis. *C. albicans* is a common commensal microbiota in the gut. Dectin-2 knockout mice were more susceptible to *C.* *albicans*, indicating the role of Dectin-2 in recognizing the yeast in its commensal state and in suppressing the overgrowth of this potentially pathogenic microorganism \[[@goz028-B25]\]. Our understanding of normal fungal diversity and alterations therein based on diet or other environmental factors is still at an early stage. Nevertheless, an increasing number of studies suggest that the diversity in the intestinal fungal microbiota is skewed in many diseases such as autism, obesity and asthma \[[@goz028-B26]\]. During homeostasis, commensal fungi exert many of their physiological effects in the gastrointestinal tract by facilitating nutrient absorption and digestion via production of enzymes and vitamins. A study found that *Bacteroides thetaiotaomicron*, a prominent member of the gastrointestinal microbiota, uses yeast mannan as its food source via a selfish mechanism, indicating an additional way in which the fungal microbiota could participate in gastrointestinal physiology \[[@goz028-B27]\]. Since CLRs are mainly expressed on the immune cells in the lamina propria, fungal molecules rarely reach CLRs during homeostasis due to the normal regeneration capability and integrity of the mucosal surface epithelium. Structure and activation of CLRs ================================ CLRs are the main PRRs that mediate the antifungal immune responses in the gut. They can be differentiated from other PRRs by the C-type lectin domain in their extracellular region ([Figure 1](#goz028-F1){ref-type="fig"}). The PAMPs that CLRs recognize are the carbohydrates on the pathogen surface \[[@goz028-B28]\]. The intestinal mucosal barrier is the first line of defense in the protection of our gut against infection \[[@goz028-B4]\]. However, many factors can damage this barrier, which can then allow invasion by intestinal pathogens, such as a lack of or over activation of certain immune responses due to disruption of the gut flora \[[@goz028-B29]\]. Furthermore, microfold cells (M cells) are an important contributing factor because they serve as a portal, through which the pathogen can cross the barrier to induce subsequent immune responses in the intestinal phagocytes of the lamina propria \[[@goz028-B30]\]. During this process, CLRs play various important roles of mediating immune recognition and response. {#goz028-F1} Dectin-1 -------- Dectin-1 is primarily expressed by myeloid cells and serves as the predominant PRR for mediating antifungal immunity in the gut. β-glucans are the major PAMPs present within the fungal cell walls that are recognized by Dectin-1. Dectin-1 expression was first identified in dendritic cells (DCs) and it was later shown to be widely expressed in various cell types, including monocytes, macrophages and neutrophils \[[@goz028-B31]\]. Dectin-1 is a 28-kDa type II membrane protein. An extracellular C-type lectin-like domain is connected by a stalk to a transmembrane region and this stalk contains a special region. The length of the stalk varies to facilitate β-glucan recognition and a longer length induces better binding efficiency. This region is defined as the carbohydrate-recognition domain (CRD). Trp221 and His223 are the two crucial residues for β-glucan binding. The Dectin-1 cytoplasmic tail contains an immunoreceptor tyrosine-based activation motif (ITAM)-like motif, which is involved in the activation of intracellular signaling. In contrast to classical CLRs, Dectin-1 is atypical due to its metal-ion-independent carbohydrate recognition \[[@goz028-B32], [@goz028-B33]\]. Upon ligand binding, Dectin-1 is a tyrosine phosphorylated by Src kinase. This phosphorylation leads to docking and activation of the tandem SH2-domain-containing protein spleen tyrosine kinase (Syk). Through the PKCδ- caspase recruitment domain family, member-9 (CARD9)--B-cell lymophoma-10 (Bcl-10)--mucosa-associated lymphoid tissue lymphoma translocation protein 1 (MALT1) axis, nuclear factor-κB (NF-κB) is finally activated, inducing an intracellular signaling cascade that mediates various cell-specific responses, such as reductions in the levels of various cytokines and chemokines, the respiratory burst and phagocytosis-mediated ligand uptake. The induction of adaptive immune responses, particularly the T helper 1 (Th1) and T helper 17 (Th17) cell responses, is also directed by Dectin-1. Furthermore, Dectin-1 collaborates with other PRRs, such as Toll-like receptor 4 (TLR4) and Dectin-2 \[[@goz028-B34], [@goz028-B35]\]. As discussed above, β-glucan recognition by Dectin-1 is the start of phagocytosis and the initiation of protective immune responses. The immunological potency of β-glucans comes from their molecular mass, spatial stereoscopic structure and degree of branching \[[@goz028-B36]\]. The natural 3D structure of β-glucans depends on these three characteristics. β-Glucan species of longer lengths cannot form a crystal lattice in complex with Dectin-1 \[[@goz028-B37]\]. However, if the length of the β-glucan is too short (less than 10- or 11-mer), the binding will be weak. Furthermore, Dectin-1 oligomerization also increases the affinity for β-glucans. Additionally, whether the binding affinity of Dectin-1 is related to the type of β-glucan remains unclear \[[@goz028-B38]\]. The triple helix conformation of β-glucan enhances its biological functions related to its antitumor activity \[[@goz028-B39]\]. DCs and macrophages are activated and initiate phagocytosis after recognition of β-glucan by Dectin-1. However, if the β-glucan is fragmented, DCs and macrophages cannot be activated \[[@goz028-B40]\]. Dectin-2 -------- Dectin-2 is a C-type lectin-like receptor that is expressed in myeloid cells and it is mainly expressed on DCs, monocytes and macrophages. Unlike Dectin-1, which recognizes β-glucans, Dectin-2 is a PRR that binds mannose and its CRD contains a glutamic acid-proline-asparagine (EPN) motif, which is Ca^2+^-dependent. Unlike Dectin-1, which recruits and activates Syk directly, Dectin-2 interacts with an Fc receptor γ subunit (FcRγ) on the cell surface that contains a Syk-interacting immunotyrosine activation motif. A range of signaling pathways is initiated that ultimately lead to NF-κB activation, which then promotes the production of various cytokines and mediates the subsequent innate and adaptive immune responses. Furthermore, Dectin-2 and other CLRs (including Dectin-3) can functionally collaborate. Dectin-2 and Dectin-3 interact in a heterodimeric form to mediate the defense against fungal infection \[[@goz028-B41], [@goz028-B42]\]. Mincle ------ Mincle is a member of the Dectin-2 family of CLRs and it is mainly expressed on activated macrophages. Mincle was first discovered to be an important player in gastrointestinal anti-microbial immunity based on its ability to bind a variety of PAMPs derived from pathogenic fungal microbiota, including α-mannose, lipidic species and some endogenous self-ligands, such as Sin3A-associated protein 130 (SAP130), which is a product of dead cells. Dectin-2 is a type II transmembrane protein with a short cytoplasmic tail and its extracellular domain is responsible for ligand binding. Like that of Dectin-2, Mincle-dependent signaling also occurs via FcRγ culminating in a pathway involving Syk and the CARD9--Bcl-10--MALT1 complex to activate NF-κB, which then leads to several pro-inflammatory responses and adaptive immune responses against pathogens \[[@goz028-B43], [@goz028-B44]\]. Dectin-3 -------- Unlike the other three receptors mentioned above, the characteristics and functions of Dectin-3 remain obscure. Dectin-3, known also as *Mcl/Clecsf8/Clec4d*, is a myeloid cell-specific CLR family member. The PAMPs it recognizes are mainly mycobacterial trehalose 6, 6-dimycolate (TDM) as well as α-mannans that exist in the fungal cell wall. Unlike Dectin-1, which contains an ITAM in its cytoplasmic region, Dectin-3 has no signaling motif in its cytoplasmic domains; instead, it signals downstream via the ITAM-containing adaptor molecule FcRγ. The CRD of Dectin-3 is Ca2^+^-independent for carbohydrate recognition. Dectin-3 may use a signaling pathway similar to those of the other three CLRs to mediate intestinal antifungal immunity. More studies are required to gain more detailed and precise information about its structure and activation \[[@goz028-B42], [@goz028-B45], [@goz028-B46]\]. CLRs-mediated immune recognition of the gut MICROBIOTA ====================================================== Recognition of invading pathogens by the host is the first step and a key stage in initiating an effective immune response after gastrointestinal fungal infection \[[@goz028-B47]\]. Efficient immune recognition of microorganisms initiates the crosstalk between the host and gut microbiota. And this process in turn helps to maintain gastrointestinal homeostasis via tolerance of the normal commensal microorganisms. CLRs play key roles in immunity to fungal pathogens in the gut microbiota. These receptors bind to almost all the pathogenic fungi found in the gut. The recognition specificity of the CLRs is largely based on different carbohydrate structures expressed by different fungal species as well as various morphological forms of the same organism \[[@goz028-B48]\]. Different fungal PAMPs can be exposed because the morphological forms of the gut fungi are constantly alternating between the yeast and hyphae state \[[@goz028-B49]\]. For example, the cell wall of *C.* *albicans* mainly contains carbohydrate polymers and glycoproteins. The components of the cell wall comprise mainly chitin, β-1, 3- and β-1, 6-glucans and O- and N-linked mannan. In *C.* *albicans*, the β-1, 3- and β-1, 6-glucans are shielded by mannoproteins, while, in the budding yeast and hyphae forms, they are expressed on the surface of the cell wall. In contrast, the cell wall of *Aspergillus* predominantly contains chitin, α-glucans, β-1, 3-glucans and β-1, 4-glucans, and galactomannans \[[@goz028-B50]\]. As shown in [Table 1](#goz028-T1){ref-type="table"}, different CLRs recognize and bind to the various PAMPs expressed on the fungi and mediate the downstream immune responses. Dectin-1, as discussed above, is the primary CLR in the gut that recognizes β-1, 3-glucan chains. Therefore, both *C.* *albicans* and *Aspergillus fumigates* can be recognized by Dectin-1. Dectin-1 can only recognize particulate β-glucans to induce cytokines and initiate internalization of the fungus \[[@goz028-B50]\]. A recent study found that, upon infection, Dectin-1 can modulate interleukin-1 receptor-associated kinase 1 (Irak1) and receptor-interacting protein 2 (Rip2), which are the key adaptor proteins in the TLR and Nod-like receptor signaling pathways, respectively \[[@goz028-B51]\]. This finding indicates that *A. fumigatus* recognition by Dectin-1 may involve interplay with other PRRs in the gut. Human primary myeloid DCs can also interact with *A. fumigates* via Dectin-1 \[[@goz028-B52]\]. As Dectin-2 recognizes mannans, the mycobiota that Dectin-2 recognizes are *C. albicans*, *Candida glabrata* and *Cryptococcus neoformans* \[[@goz028-B53]\]. Dectin-2 can cooperate with Dectin-3 by forming heterodimers to recognize *C.* *albicans* \[[@goz028-B45]\]. Dectin-2 is also involved in *A. fumigatus* recognition and its expression is restricted to macrophages \[[@goz028-B54]\]. A recent study found that Dectin-2 participates in the recognition of *Pneumocystis*, which is a potential gut pathogen \[[@goz028-B55]\]. *Cryptococcus* *neoformans* is a yeast-type opportunistic fungal pathogen that is normally associated with the respiratory system and can damage the central nervous system. Dectin-2 also participates in *C. neoformans* recognition and mediates the antifungal immunity against this pathogen \[[@goz028-B56]\]. Although the binding ligand for Mincle in the gastrointestinal fungi remains unclear, Mincle recognizes *C. albicans* and mediates the macrophage-dependent immune response via TNF-α production \[[@goz028-B57]\]. It is interesting that Mincle recognizes not only fungi, but also *Mycobacterium* via the TDM glycolipid (also known as cord factor) cell-wall component \[[@goz028-B58]\]. ###### C-type lectin receptors and their respective PAMPs and microbiota involved in gastrointestinal immunity CLR Ligand(s) PAMP Microbiota References ------------------------------------------------- ------------------- --------------- ---------------------- ---------------------------------- Dectin-1 β-1, 3-glucan β-1, 3-glucan *Candida albicans* \[[@goz028-B50]\] *Aspergillus fumigatus* Dectin-2 α-mannan α-mannan *Candida albicans* \[[@goz028-B45], [@goz028-B53]\] *Candida glabrata* *Cryptococcus neoformans Aspergillus fumigatus* Dectin-3 α-mannose α-mannose *Candida tropicalis* \[[@goz028-B46], [@goz028-B62]\] mycobacterial trehalose6, 6-dimycolate Mincle Glyceroglycolipid α-mannose *Candida albicans* \[[@goz028-B57]\] mannosyl fatty acids α-mannose CLR, C-type lectin receptor; PAMP, pathogen-associated molecular pattern. Mincle is also associated with recognition of other bacteria such as *Listeria monocytogenes*, *Klebsiella pneumonia*, *Streptococcus pneumonia*, *Pneumocystis pneumonia* and *Escherichia coli*, and all of these microorganisms are thought to be associated with CD \[[@goz028-B59]\]. These clues indicate that we may pay more attention to the possible relationship between Mincle and the pathogenesis of IBD \[[@goz028-B60]\]. Furthermore, Mincle can recognize various lipid components released from both host cells and microorganisms released upon cell death \[[@goz028-B44], [@goz028-B61]\]. In relation to Dectin-3, we found that the development of dextran sulfate sodium (DSS)-induced colitis can be promoted by Dectin-3 deficiency in mouse models challenged with *Candida tropicalis* \[[@goz028-B46]\], supporting its role in fungal recognition in the gut. A recent study also found that Dectin-3 expression is involved in the antifungal immune response by plasmacytoid DCs to *C. neoformans* infection *in vitro* \[[@goz028-B62]\]. Another study compared the responses to pulmonary *cryptococcal* infection between Dectin-3 knockout mice and wild-type mice, and found that the murine immune responses to *C. neoformans* infection did not necessarily require Dectin-3 \[[@goz028-B63]\]. Dectin-3 can also recognize TDM and induce Mincle expression upon *Mycobacterium* infection via CARD9--Bcl-10--MALT1-dependent NF-κB activation and the increased Mincle expression can enhance the ability of host innate immune system to sense *Mycobacterium* infection \[[@goz028-B64]\]. CLRs-mediated immune response against the gut microbiota ======================================================== As discussed above, CLRs are the key PRRs in the intestinal microenvironment that mediate antifungal immunity. Both the innate and adaptive immune responses are induced and modulated by these receptors to resist infection and maintain homeostasis of the gut microbiota. The CLR-mediated innate immune responses mainly include fungal binding and phagocytosis, induction of antifungal effector mechanisms and the production of a variety of soluble mediators, such as cytokines, chemokines and inflammatory lipids \[[@goz028-B65]\]. The expression of these soluble mediators can contribute to the host adaptive immunity, which mainly involves direction and modulation of the Th1, Th2, Th17 and regulatory T cell (Treg) responses \[[@goz028-B48]\] ([Figure 2](#goz028-F2){ref-type="fig"}). {#goz028-F2} It is commonly accepted that the intestinal mucosal barrier is indispensable for protection against invasion of pathogens from the gut microbiota and for limiting their overgrowth or translocation \[[@goz028-B21]\]. The intestinal mucosa barrier not only serves as a mechanical defense barrier, but it also contains many types of mucin glycoproteins, anti-microbial peptides and secreted immunoglobulins (sIgA and IgG), all of which are involved in protecting the gastrointestinal mucosa of the host. Furthermore, M cells, which are located on the gut-associated lymphoid tissue of Peyer\'s patches and the mucosa-associated lymphoid tissue of other parts of the gastrointestinal tract lacking mucin, can serve as a portal. Pathogens, particularly *C. albicans*, can cross the barrier through this portal \[[@goz028-B66]\]. As discussed above, CLRs expressed on myeloid cells recognize pathogens in the gut and mediate the downstream immune responses. Many pro-inflammatory cytokines and chemokines, such as IL-1α/β, IL-6, G-CSF, GM-CSF, TNF-a, IL-8 and CCL20, can be produced following *C. albicans* recognition by epithelial cells \[[@goz028-B67]\]. One study found that sIgA delivery via M cells depends on Dectin-1 along with the Siglec-5 receptor, suggesting a role for Dectin-1 in the first line of defense in the gut immune response \[[@goz028-B68]\]. More recently, Dectin-3 deficiency was found to promote the development of colitis induced by severe damage to colon epithelial cells and impaired tissue repair in DSS-induced colitis models, indicating that CLRs may have additional roles in protecting the intestinal mucosa \[[@goz028-B46]\]. Intestinal epithelial cells (IECs) appear to be able to recruit lymphoid and myeloid cells to the mucosal layer \[[@goz028-B69]\], but whether this activity is related to CLRs remains unclear. The intestinal phagocytes, which are mainly located in the lamina propria, play the central role in the innate immune response against invasive pathogens once they cross the intestinal mucosal barrier \[[@goz028-B65], [@goz028-B70]\]. Phagocytes include macrophages, DCs, lymphoid cells, leukocytes and mast cells. These immune cells participate in the response to the pathogenic microorganisms and contribute to the tolerance of the normal intestinal flora. As discussed above, after being recognized by CLRs expressed on phagocytes, invasive microorganisms are internalized via the actin-dependent process of phagocytosis \[[@goz028-B71]\]. In DCs, Dectin-1 triggers phagocytosis via its cytoplasmic ITAM-like motif in a process that requires Syk \[[@goz028-B72]\]. After phagosome maturation, oxidative and non-oxidative mechanisms are used synergistically by phagocytes to kill internalized or extracellular fungi. The oxidative mechanisms include the respiratory burst and reactive nitrogen intermediates; the non-oxidative mechanism mainly depends on the production of anti-microbial peptides (AMPs), hydrolases and nutrient limitation \[[@goz028-B65]\]. Different phagocytes have various abilities to kill fungi or to limit their growth, depending on the specific fungal species. For example, neutrophils are the main cells that kill *C. albicans*, while DCs are more potent against *Histoplasma capsulatum* \[[@goz028-B73], [@goz028-B74]\]. Upon recognition of pathogens by CLRs, Syk/CARD9 induction activates NF-κB signaling, ultimately leading to the secretion of pro-inflammatory cytokines, including GM-CSF, TNF, MIP-2, IL-2, IL-10, IL-6, IL-23 and IL-1β. This signaling network initiates the differentiation of naïve T cells into Th cell lineages, including Th1, Th2, Th17 and Tregs, which are critical for antifungal immunity. Antigen presentation by the antigen-presenting cells (mainly DCs) to T cells normally occurs in the lamina propria \[[@goz028-B66]\] and Th17 differentiation is mainly promoted by induction of IL-1β, IL-6 and IL-23, which drives IL-17 and IL-22 production \[[@goz028-B75]\]. Neutrophil recruitment, epithelial AMP production and mucosal antifungal protection can also be driven by these cytokines \[[@goz028-B65]\]. However, aberrant Th17 responses may cause unexpected pathogenic hyper-inflammatory disorders that can also be tightly controlled by IL-1β production that is induced due to Dectin-1 activation \[[@goz028-B76]\]. The Th1 response, which depends on IL-12p70 and can also be triggered via a Dectin-1-directed Syk-Raf1 cooperative signaling pathway, can be shifted to a Th2 cell response by inhibition of the Raf1 or IRF1 signaling pathways \[[@goz028-B11]\]. Cooperation between the Dectin-1-induced signaling pathways is essential for the Th cell response that shapes the antifungal adaptive immune response. Unlike Dectin-1, which is capable of self-activation, Dectin-2 is activated via its association with FcRγ. Dectin-2 expressed on DCs recognizes fungal hyphae \[[@goz028-B77]\] (which consists mainly of α-mannoses) to promote NF-κB activation via Syk recruitment and subsequent activation of the CARD9--Bcl-10--MALT1 complex. The cytokines induced through this process, including IL-6, IL-23, IL-12 and IL-1β, lead to the induction of Th17 responses. A range of pro-inflammatory cytokines, including TNF, IL-6 and IL-23, as well as several anti-inflammatory cytokines, such as IL-2 and IL-10, can also be induced by Dectin-2 to promote Th17 responses \[[@goz028-B74], [@goz028-B78]\]. Depending on the DC subset and specific ligands, different signaling pathways can be activated via Mincle's association with FcRγ (similar to Dectin-2) to mediate the adaptive antifungal immune response. In human DCs, Mincle triggers the Syk-dependent CARD9--BCL-10--MALT1 complex pathway, which then results in phosphoinositide 3-kinase (PI3K)- and PKB (protein-kinase B)-dependent activation of the E3 ubiquitin ligase. The activation of the E3 ubiquitin ligase will suppress IL-12p70 production to skew Th cell differentiation in favor of Th2 cell responses \[[@goz028-B79]\]. Furthermore, Treg cells can help regulate the immune response during intestinal infection. In mouse models, the numbers of CD4^+^CD25^+^ cells and Foxp3 Tregs in the mesenteric lymph nodes (mLNs) and stomachs of infected mice are dramatically increased during intestinal *C.* *albicans* infection. CLR-mediated T cell differentiation towards Tregs also plays important roles in homeostasis in the intestinal environment \[[@goz028-B66]\]. CLRs-mediated antifungal immunity and related diseases ====================================================== The prevalence of IBD is expanding globally, now affecting over 1 million individuals in the USA and over 2.5 million individuals in Europe, as well as a significantly increased number of people in Asia, South America and the Middle East \[[@goz028-B80], [@goz028-B81]\]. IBD pathogenesis has a genetic basis and involves the immune responses activated by various environmental factors \[[@goz028-B14]\]. In the pathogenesis of IBD, immune tolerance can be reduced by the microbes, which can then result in activation of inappropriate pathways intended to protect the host against pathogen invasion \[[@goz028-B82]\]. Most studies on microbe in the gut focus on the analysis of bacteria \[[@goz028-B83]\]. Recently, the role of fungi has also attracted our attention. By using ITS2 sequencing, the fungal community in the feces of 235 patients with IBD was identified. There is a skew in the fungal microbiota of the IBD patients, with an increased *Basidiomycota/Ascomycota* ratio, a decreased proportion of *S.* *cerevisiae* and an increased proportion of *C. albicans* compared with the microbiota of healthy subjects. It is interesting that, in the gut environment of IBD, fungal growth is favored over bacteria growth \[[@goz028-B12]\]. However, after a prolonged antifungal drug treatment, mice have more severe colitis and a significant change in composition of their fungal microbiota \[[@goz028-B86]\]. Recently, studies found that the gastrointestinal microbiota and the interplay between the host immune system and the gut flora may be associated with IBD onset and exacerbation \[[@goz028-B87]\]. A polymorphic variant of Dectin-1 is related to IBD severity in patients \[[@goz028-B8]\]. Moreover, mice lacking Dectin-1 are more susceptible to colitis. *Candida* *tropicalis* contribute to a more severe colitis pathology in mice with Dectin-1 deficiency than wild-type mice. An increased production of IL-17 and IFN-γ by T cells along with increased TNF-α, IL-23p19, IL-17a and defensins detected from the colons of Dectin-1^--/--^ mice. The observation of the increased production of inflammatory mediators along with the more severe colitis in Dectin-1^--/--^ mice suggests an inability of Dectin-1 deficiency to activate effective immune responses to a specific pathogen, which promotes the inflammation and leads to more severe colitis \[[@goz028-B88]\]. This research suggests a role played by fungi to stimulate immune responses in the gut through Dectin-1 in the pathology of IBD. It is more interesting that Dectin-1 is also involved in aggravating inflammation despite its protective role against fungi pathogen. A lack of Dectin-1 signaling can facilitate the growth and expansion of *Lactobacilli*, which exerts protective effects during colitis. However, which role will Dectin-1 play depends on the situation of the gut microbiota. Overall, Dectin-1 can serve as a double-edged sword with a positive effect of protecting the host against the infection as well as a negative effect of hindering the expansion of beneficial bacteria \[[@goz028-B89], [@goz028-B90]\]. Besides Dectin-1, Dectin-3 was also involved in the pathogenesis of IBD. Mice lacking Dectin-3 are more susceptible to colitis and have higher fungal burden in the gut. Furthermore, supplemental of *C. tropicalis* promoted the pathogenesis of colitis in Dectin-3-deficiency mice \[[@goz028-B46], [@goz028-B91]\]. Cancer is associated with changes in the interactions between the gut microbiota, intestinal epithelium and host immune system \[[@goz028-B92]\]. Colorectal carcinogenesis can be affected by the gut flora through various mechanisms including specific alterations in the composition of gut microbiota and by-products that target IECs \[[@goz028-B93]\]. A study characterizing the mycobiotic signatures of 131 subjects, which were divided into polyp and colorectal-cancer (CRC) groups, along with a healthy control population for observing the fungal dysbiosis, found decreased fungal diversity. An increased *Ascomycota/Basidiomycota* ratio along with an increased growth of *Trichosporon* and *Malassezia* was also recognized. This alteration indicates that fungal dysbiosis and its related immune responses may be involved in polyp and CRC pathogenesis \[[@goz028-B94]\]. In patients with colorectal adenoma, there is also a change in the fungal microbiota structure at different stages of adenoma \[[@goz028-B95]\]. Recently, CARD9 deficiency was found to induce myeloid cell differentiation into myeloid-derived suppressor cells with increased *C. tropicalis*, which finally promotes the progression of colon cancer \[[@goz028-B96], [@goz028-B97]\]. Although the role of fungi in the pathogenesis of CRC gradually came into view, how CLRs participate in this process remains unclear to us. One study found that Dectin-1 expression is up-regulated in hepatic fibrosis and liver cancer, and Dectin-1 protects against inflammation-induced oncogenesis by suppressing TLR4 signaling \[[@goz028-B18]\]. Furthermore, Dectin-1 expressed on DCs and macrophages is critical in the recognition of and signaling by tumor cells \[[@goz028-B98]\]. In summary, CLRs are the predominant PRRs involved in recognition of the mycobiota and regulation of gastrointestinal immunity. Important roles can be played by CLRs in the development and progression of gastrointestinal illness, and much could be gained by exploring therapeutic approaches for mycobiota-related diseases. Future outlook ============== In this review, we reflected on recent studies on the roles of CLRs in the gastrointestinal environment and how CLRs interact with the immune system, as well as on diseases related to these processes. The harmonious symbiosis, which is maintained between commensal microorganisms and the host, is critical for good health. Maintenance of this relationship requires CLRs acting as PRRs to recognize potential pathogens to mediate innate and adaptive immune responses, which promote health and ameliorate disease. Future studies will provide more insight into how CLRs are involved in various diseases and how to exploit the interactions between the commensal fungal populations and immune responses in the gut to treat related diseases, including IBD and colon cancer. Furthermore, it remains unclear whether and how host immune responses, which are essential for protecting against serious life-threatening fungal infections, are related to disease progression. More work is needed to elucidate the relationship between the immune system and infectious challenges and to understand what strategies can be devised to treat the related diseases. Authors' contributions ====================== T.T.W., S.N.S. and Y.Y.H. provided the idea and designed the work; T.H.L. wrote and revised the paper; L.L. polished the English language and revised the paper. All authors reviewed and approved the final manuscript. Funding ======= This work is supported by grants from the National Natural Science Foundation of China (81572354 and 81772542 to T.W.) and the Natural Science Foundation of Jiangsu Province in China (BK20161400 to T.W.). The authors are sincerely grateful to Yu-Chen Pan, Dan Li, Jiao-Jiao Zhao and Dong-Ya Zhang for their generous instructions. Conflicts of interest ===================== None declared.

As Always I try to make my blog cater for peeps that are just looking for concise answers, so if you scroll down there is a TL DR section below. If you are curious of my thoughts then keep reading. My knowledge of keypresses consisted of the brief summary of “you press a key and you can make something happen”. Turns out there is a bit more to it. Keypresses have three different trigger points. I’m going to put my naive understanding of them first, then what MDN says cause that is the best source of truth out there in my opinion. I also used StackOverflow. First you have keydown My understanding of a Keydown is the action of when the button is pressed, so as the key is pressed down you can set an action or trigger something from that point. Unlike the keypress event, the keydown event is fired for all keys, regardless of whether they produce a character value. from MDN To sum keydown: Keydown will trigger for all keys pressed(odd ones being ctrl, shift. delete..etc). If you press any key thats a keydown. Second you have keyup My understanding of a key up is the “release” action of the keydown action. So you can set an action upon lifting your key from a pressed state. The keydown and keyup events provide a code indicating which key is pressed, while keypress indicates which character was entered. For example, a lowercase “a” will be reported as 65 by keydown and keyup , but as 97 by keypress . An uppercase “A” is reported as 65 by all events. from MDN To sum up keyup:. It trigger upon the release of a pressed key. Don’t worry MDN can be intimidating at times. It took me a while, but they are saying a keyup will trigger with a value of what key was pressed. Also, I think MDN has already moved on tooo.. Thirdly the keypress My understanding: Keypress is the full action of just typing a key. so hit a key and let go and you have yourself a keypress buddy. The keypress event is fired when a key that produces a character value is pressed down. Examples of keys that produce a character value are alphabetic, numeric, and punctuation keys. Examples of keys that don’t produce a character value are modifier keys such as Alt , Shift , Ctrl , or Meta From MDN Ok, so my understanding of a keypress was a bit off. It appears to be including all chars that set a value and not other keys like shift, control, alt…etc that don’t produce a character. According to MDN it appears that the keypress is deprecated so you would just need to be aware of that when using keypress. I never in my life thought that someone could complicate a key press, but here we are 2020 virus is out. Try to stay inside guys ok. TL DR The onKeyDown event is triggered when the user presses a key. The onKeyUp event is triggered when the user releases a key. The onKeyPress event is triggered when the user presses & releases a key ( onKeyDown followed by onKeyUp ). from stackoverflow In my defence I’m not as technical as MDN, my theory was around more towards what the stackoverflow post said. I’ll leave you with that guys I really hope that this helps you out and helps you know that there is a bit more to a keypress than meets the eye. On a side note. I got some positive comments on my previous post. Thanks so much for the support I’ll continue posting my findings and sharing the knowledge to help myself and others. I was so chuffed in fact i made a live sample of some javaScript and keypresses right here enjoy.

Delirium: The Nurse's Role in Prevention, Diagnosis, and Treatment. Delirium is an acute change in mental status typically caused by a medical condition. Delirium complicates care, increases safety risks, and has a negative impact on patient outcome. By identifying mental status changes early, the nurse is in a strategic position to prevent delirium in 30%-40% of at-risk patients. An interdisciplinary team approach can prevent, diagnose, and treat delirium to improve safety, reduce cost of care, and optimize patient outcomes.

The photorefractive effect involves light-induced charge redistribution in a nonlinear optical material to produce internal electric fields which by virtue of the optical nonlinearity, produce local changes in the index of refraction such that dynamic, erasable holograms are formed which diffract light. The photorefractive effect is achieved by exposing the material to an optical intensity pattern consisting of bright and dark regions, such as formed by interfering two coherent laser writing beams of the same polarization. Mobile charge generated in the material migrates under the influence of diffusion and drift processes to form internal space charge electric fields which create refractive index variations due to the electrooptic effect. These variations in refractive index in the photorefractive material are known as index gratings. The index gratings diffract light and are useful for a variety of applications, including storage of holographic images, diffractive optical elements, and photorefractive two-beam coupling. Inorganic crystals exhibiting the photorefractive effect are well known in the art as described in Gunter and Huignard, "Photorefractive Materials and Their Applications", Vols. I and II ("Topics in Applied Physics", Vols. 61 and 62) (Springer, Berlin, Heidelberg, 1988). Inorganic photorefractive crystals have been fabricated into optical articles for the transmission and control (change in phase, intensity, or direction of propagation) of electromagnetic radiation, as well as for holographic image and data storage. However, it is technically difficult to fabricate such crystals into desired large area samples or thin-layered devices such as optical wave guides or multiple-layer stacks. Further, it is difficult to dope crystalline material with large concentrations of dopants in order to achieve desired property improvements, such as increase in the speed and/or magnitude of the photorefractive effect, because dopants are often excluded from the crystals during growth. Certain polymeric photorefractive materials have been described by Ducharme et al., U.S. Pat. No. 5,064,264, and Schildkraut et al., U.S. Pat. No. 4,999,809. These polymeric materials can be fabricated into thin-layered devices such as optical waveguides and multilayer stacks. Further, they can be readily doped with materials to improve a photorefractive effect. Schildkraut describes a photorefractive device having a layer of material comprising a sensitizer, a charge transporting layer, a binder, and an organic molecular dipole, which has been poled in an electric field at elevated temperatures so that the alignment of the molecular dipoles remains for long times at ambient temperatures. Although the material is shown to have light-induced changes in measured properties, Schildkraut does not show the formation of a photorefractive grating to demonstrate a photorefractive device. Ducharme et al. describe photorefractive materials comprising a polymer, a nonlinear optical chromophore, a charge transport agent, and optionally a charge generator. Although these materials are useful in certain applications, there still is a desire in the industry for a photorefractive process having longer characteristic decay time of diffraction efficiency. It is therefore an object of the present invention to provide an improved process for photorefractive index grating formation. Other objects and advantages will be apparent from the following disclosure.

Sunday, 22 September 2013 Virtual gardens illuminate real-world attitudes about nature Researchers have long struggled to design surveys that collect detailed and informative data without introducing bias through the use of loaded, confusing, or restrictive wording. A team of French researchers has come up with a novel solution to this problem: Toss out the surveys altogether, and replace them with a virtual computer program that allows respondents to express their thoughts and preferences in actions rather than in words. This is the idea behind Virtual Garden, a program that allows users to select from 95 different features in order to create their ideal garden. The features fall within seven different categories: animals, flowers, lawn and cover, sport and playing, trees and bushes, water, and other. The program keeps track of each item that is added and adjusted, and calculates biodiversity as biotic features are introduced into the virtual habitat. Users are able to view the garden from multiple angles and even take a virtual stroll through the area in order to evaluate their progress and determine whether further manipulations need to be made to the environment. Far from being merely a nerdy new version of The Sims, the program was designed to assess which features people most want to experience when they visit public gardens. Further, an analysis of the virtual habitats could help clarify the role that biodiversity has in driving humans' overwhelmingly positive responses to green spaces--particularly those located in otherwise urban areas. Finally, by collecting basic social, economic, and demographic information about each program user, the program's developers can also assess whether habitat preferences are influenced by age, education, income, and general interest in the natural environment. The research team responsible for Virtual Garden trialled the program among 732 Parisian hospital patients. Each individual was given a 30-minute time limit for designing the garden, though the average length of time required was only 19.2 minutes. Gardens typically contained approximately 24 different features--9 "objects" (such as ponds), 5 animals, 8 flowers, and 5 woody species (trees or bushes). Overall, users included fewer biotic features than were expected by chance. Animals were particularly underrepresented, with nearly a third of gardens containing no animals at all, and almost another third containing fewer than 5 animal species. Larger animals--especially mammals and herptiles--were not very popular; the least preferred species overall were foxes and chimpanzees. Ladybugs, peacocks, and great tits, on the other hand, were the most preferred. The most popular species were generally those that are common in Parisian gardens, suggesting that patients tended to populate their virtual gardens with species that are most familiar to them. Several demographic and socioeconomic factors influenced garden design. For example, men included fewer animals and flowers than women; younger patients included more non-native species; and people who showed a greater interest in conservation and nature activities tended to create gardens with higher biodiveristy. Interestingly, plant richness was higher in gardens created by people who grew up in more rural areas, again suggesting that familiarity with species is an important driver of habitat preferences. The Virtual Garden trial produced two main results. First, it suggests that computer programs may be a useful way to collect data from people without accidentally introducing bias into a study. Such programs are likely to be particularly useful in situations where researchers need to address or describe situations that are highly visual in nature--such as habitat structure, the aesthetics of which can greatly influence respondents' attitudes and opinions. Second, the patterns reported here get us one step closer to understanding city-dwellers' complex and often contradictory responses to green spaces. There is particularly strong evidence of an "extinction-of-experience" process, whereby people judge biodiversity and aesthetics according to what they have previously experienced, rather than what may be natural, healthy, and/or desirable in a given environment. The creators of the Virtual Garden hope that conservationists and managers can use their program to collect and compare data from across a wide geographic range, and, therefore, to improve our "understanding of the role culture and living context...play in people's relations with biodiversity." This could not only help save threatened species, but also improve the well-being of people by increasing and improving human-nature interactions even in the most urban of environments. 1 comment: Your blog article is very nice thank you for share this information students are getting certificates for their academic life now colleges are taken taken by the additional courses after completing that courses. Who is the "Anthrophysist"? I am a biologist who studies the ways in which anthropogenic disturbance impacts animals (especially birds). I hope that the results of my work, and the work of other researchers like me, can help humans learn how to coexist more peacefully with wildlife. I am also interested in the role that nature has played in shaping human cultures around the world and over the centuries. Although this blog will predominantly focus on scientific research, I hope to occasionally profile some anthropological work as well, in order to better highlight the interconnectedness of humans ("anthro") and nature ("physis").

Introduction {#sec1-1} ============ The recent World Health Organization (WHO) report and other studies suggest dental caries to be a major public health problem in most of the developing countries, affecting 60-90% of the school children in spite of the declining trends in the most developed countries.\[[@ref1][@ref2]\] The decline in dental caries among children in highly developed countries started to emerge around 1970 and the percentages of caries free children in different age categories have increased since then. This was mainly attributed to the increased use of fluorides from all sources, especially toothpastes.\[[@ref3][@ref4]\] On the other hand, certain developing countries, have reported an increase in dental caries\[[@ref1][@ref4]\] The economic, social and political changes in the developing world have had a significant impact on diet and nutrition, with a shift from traditional to a more westernized life-style. This is attributed to increased availability and consumption of refined sugars. There are few resources for curative/restorative intervention and no infrastructure upon which to base large-scale prevention measures. Dental caries is, therefore potentially of major public health significance in developing countries, and the need to focus on its prevention is a matter of urgency.\[[@ref4][@ref5]\] India is one among the 25 nations around the globe, showing increasing trends in dental caries and it exists as a smoldering disease that has ingressed its tentacles deep into those regions where there are inadequate resources of dental treatment, lack of public health awareness and motivation and increase in the utilization of refined carbohydrates.\[[@ref6]\] National oral health survey and fluoride mapping in India,\[[@ref7]\] found the prevalence of dental caries among 12 and 15-year-old children to be 53.8% and 63.1% respectively. A recent study among school going children in an endemic fluoride area in Andhra Pradesh found the prevalence of dental caries among 12 and 15-year-old children to be 55.3% and 57.3%. Prevalence of dental fluorosis was 73% among 12 years and 70.1% among 15 years children.\[[@ref8]\] Dental caries and dental fluorosis are two dental diseases among the school children in endemic fluoride areas. Around 17 states in India are endemic to dental fluorosis.\[[@ref9]\] Many laboratory, clinical and dental public health researchers after more than 70 years of research have concluded that, fluoride is a double--edged weapon, where its deficiency increases the risk for dental caries and excess consumption in the first 5-10 years of life increases the risk for dental fluorosis.\[[@ref10]\] The fluoride produces a dose-dependent effect on the dentition. However, this is not confined to increased caries resistance. Fluoride causes various disorders, together called as fluorosis, if accumulated above certain levels in the body. According to a WHO report "It may not be possible to achieve effective fluoride based caries prevention without some degree of dental fluorosis." Public health administrators must seek to maximize caries reduction, whereas minimizing dental fluorosis.\[[@ref11]\] The literature on the relation between fluoride concentration in drinking water with dental caries is conflicting. Some studies reveal an inverse relation\[[@ref12][@ref13]\] while others found no relation\[[@ref14]\] or a positive association.\[[@ref15][@ref16]\] Nalgonda District in Andhra Pradesh is an endemic fluoride area with fluoride concentration in drinking water ranging from below optimum to optimum and above optimum levels. The district has 1155 revenue villages with 3,359 habitations out of which, 1,122 habitations were identified as fluoride affected.\[[@ref17]\] The sparse literature on the relation between dental caries, dental fluorosis with fluoride concentration in drinking water among the school going children in Nalgonda district prompted us for the present study to assess dental caries and dental fluorosis prevalence among 12 and 15-years-old school children in Nalgonda district, Andhra Pradesh, India. Subjects and Methods {#sec1-2} ==================== This cross-sectional study was conducted among 12 and 15-year-old school children in Nalgonda district, Andhra Pradesh, India. The study was conducted over a period of 8 months from July 2009 to February 2010. Before the start of the main study, a pilot study was conducted on a convenient sample (*n* = 100) of school children. The pilot study found the prevalence of dental caries to be 30%. Based on this, the desired sample size was estimated to be 1613 with 95% confidence level and a design effect of five using Master software (Biostatistics Resource and Training Center, Christian Medical College, Vellore). Two stage cluster sampling was used for selection of study participants to the study. Nalgonda district has 59 mandals (administrative divisions) and the district was divided into four zones (North, South, East and West). All the mandals in these zones were listed and five mandals from each of these zones were selected in the first stage. All the government higher secondary schools in these selected mandals were listed. Using this as the sampling frame, one school from each of these 20 mandals was selected using lottery method of simple random sampling. The selected schools were listed and permission to conduct the study in these schools was obtained from the District Education Officer, Nalgonda and concerned head masters. The schedule for conducting the study among these children was prepared and sent to the concerned head masters well in advance. On the day of clinical examination, the list of all grade VI and IX children was procured and the details related to their date of birth were checked. All children from grade VI and IX fulfilling the following inclusion and exclusion criteria were examined in the study. Inclusion criteria {#sec2-1} ------------------ Children aged 12 years and 15 years (those who completed 12 years and 15 years on the day of examination)School children who were lifelong residents in that region and who were using one source of drinking water from birth to at least 10 years of their lifeChildren with all permanent teeth, except third molars, with at least more than 50% of the crown erupted. Exclusion criteria {#sec2-2} ------------------ Children aged less or more than 12 years as well as those aged more or less than 15 yearsMigrated children from some other place or who were not the permanent residents of the area concerned.Children with a history of drinking water from more than one source in the initial 10 years of their lifeChildren with orthodontic brackets were excluded as this hindered diagnosis of enamel defectsChildren with severe extrinsic stains on their teeth in whom assessing fluorosis was not possible. Ethical clearance for the study was obtained from the Institutional ethics committee, Sri Sai College of Dental Surgery, Vikarabad. A pre-designed structured questionnaire was used to collect the desired information such as oral hygiene practices, diet, sugar exposure, source of drinking water etc., The questionnaire had 15 close ended questions with multiple options to collect information on these aspects. Questionnaire was filled by the investigator by means of face to face interview to avoid misinterpretation of questions and to ensure uniformity in data collection. One trained and calibrated examiner conducted the clinical examination of the selected children using a mouth mirror and community periodontal index probe. The Kappa co-efficient value for intra-examiner reliability was found to be 0.88 for decayed missing filled teeth (DMFT) and 0.81 for dental fluorosis. The agreement was substantial to almost perfect, according to the scale of Landis and Koch.\[[@ref18]\] The clinical examination was carried in the school premises under natural day light on the plastic chair after obtaining informed consent from the children and their parents. Participants were made to sit on a chair in an upright position using wall as the head rest, whenever necessary. Dental caries was assessed using Dentition status and treatment needs and dental fluorosis using Dental fluorosis index (WHO oral health surveys).\[[@ref19]\] The first child in the school was requested to obtain 500 ml of water from the source from which children consumed water. The investigator/assistant accompanied the child at the time of collection of water sample. The other samples in the school were collected only when the source of drinking water differed among the children. All the water bottles collected from each school were coded and sent to laboratory for estimation of fluoride concentration. The code written on the water bottle was entered on all the data collection sheets of the children who consumed water from the respective source. This ensured the collection of water samples from all the sources from where the eligible children consumed water during their childhood. The estimation of fluoride concentration in the drinking water was done at "National Institute of Nutrition (Indian Council of Medical Research) Hyderabad using Orion 720 A fluoride meter, coupled with ion specific electrode. The data was entered onto a personal computer and statistical analysis was done using the statistical package for the social sciences. Inc. version 16, (Chicago, USA). The children were classified into four categories based on the fluoride concentration in the drinking water. This was done at the time of statistical analysis. This ensured that the investigator was not aware about the fluoride concentration in the area at the time when the clinical examination of the children was performed. The four categories were low fluoride area (fluoride concentration \<0.7 ppm), medium (0.7-1.2 ppm), high (1.2-4 ppm) and very high fluoride area (4-6.28 ppm). Mean and standard deviation were used to express the quantitative data, while the qualitative data was presented in frequencies and percentages. Kruskal walley\'s test was used to compare the difference in the mean DMFT between different categories. The prevalence of dental caries and dental fluorosis was compared using Pearson\'s Chi-square test. Spearman\'s rho was used to correlate fluoride concentration with dental caries and dental fluorosis. The statistical significance was fixed at 0.05. The autoclaved set of instruments was used for oral examination of the children. The methodology employed in the study is diagrammatically depicted in [Annexure 1](#App1){ref-type="app"}. Results {#sec1-3} ======= A total of 1875 school children were examined in the present study. The gender distribution of the study population in different fluoride areas is denoted in [Table 1](#T1){ref-type="table"}. ###### Age and gender distribution of the study population in different fluoride areas  Dental caries prevalence {#sec2-3} ------------------------ The overall prevalence of dental caries among the school children was 43.4% (813/1875). The prevalence of dental caries was significantly higher among females (50.4% \[492/977\] compared with males (35.8% \[321/898\]). The prevalence was more among 15-years-old children (46.7% \[444/951\] compared with 12 years children (39.9% \[369/924\]). The prevalence of dental caries among children in low fluoride areas was 60.5% \[300/496\] followed by very high fluoride area (54.8% \[201/367\]), high fluoride area (32.4% \[293/904\]) and medium fluoride area (17.6% \[19/108\]). The difference in the prevalence of dental caries between different fluoride areas was statistically significant. These results were true even when the comparison was made separately among 12 and 15 years old children \[[Table 2](#T2){ref-type="table"}\]. ###### Prevalence of dental caries among 12 and 15 years old school children in different fluoride areas  Dental fluorosis prevalence {#sec2-4} --------------------------- The prevalence of dental fluorosis was 76.8%. There was no statistically significant difference in the prevalence of dental fluorosis between 12 and 15-years-old children. There were no gender differences in the prevalence of dental fluorosis. The prevalence of dental fluorosis significantly increased with increasing fluoride concentration. The prevalence of dental fluorosis in very high, high, medium and low fluoride areas was 100% (367/367), 96.6% (873/904), 47.2% (51/108) and 29.8% (148/496) respectively. These results were true even when a separate comparison was made between different fluoride areas among 12 and 15-year-old children \[[Table 3](#T3){ref-type="table"}\]. ###### Prevalence of dental fluorosis among 12 and 15 years old school children in different fluoride areas  Correlation between fluoride concentrations in water and dental caries, dental fluorosis {#sec2-5} ---------------------------------------------------------------------------------------- The mean DMFT score was lowest in the medium fluoride area (0.22 \[0.49\]). The mean DMFT score in high fluoride area, very high fluoride area and low fluoride area was 0.46 (0.82), 0.92 (1.02) and 1.18 (1.13) respectively. The difference in the mean DMFT score between different fluoride areas was statistically significant \[*P* \< 0.01, [Table 4](#T4){ref-type="table"}\]. A negative correlation (Spearman\'s *P* = −0.18) was noted between fluoride concentration in drinking water and mean DMFT score. A positive correlation (Spearman\'s *P* = 0.92) was observed between dental fluorosis index score and fluoride concentration. There was no statistically significant difference in relation to dietary habits, oral hygiene aids used, frequency of brushing and frequency of sugar consumption among the school children in different fluoride areas. ###### Correlation between fluoride concentration in drinking water with mean DMFT and fluorosis  Discussion {#sec1-4} ========== The scanty published literature on the prevalence of dental caries and fluorosis among school children in endemic fluoride areas, which provide the best opportunity in assessing the relation between increasing fluoride concentration on both these diseases prompted us to undertake the present study. The study was conducted among 12 and 15-year-old school children in Nalgonda district, Andhra Pradesh, India. The WHO in its manual on basic oral surveys (1994)\[[@ref19]\] has specified 5, 12, 15, 35-44 and 65-74 years as index age groups for assessing the oral health status. Among these, 12 years is considered the global monitoring age for international comparison of dental caries and 15 years represent the other adolescent age group. Moreover, these are the two age groups for obtaining a reliable sample from the school system. This prompted us in the selection of 12 and 15-years-old school children as the study participants in the present study. The prevalence of dental caries was least in medium fluoride area followed by high fluoride area. The prevalence was highest in low fluoride area followed by very high fluoride areas. The mean DMFT value was also least in medium fluoride area. The highest mean DMFT was noted among children in low fluoride area followed by very high fluoride area and high fluoride area in the descending order. This clearly suggests that fluoride in drinking water offer maximum protection against dental caries at optimal concentration which ranges from 0.7 to 1.2 parts per million (ppm) according to previously published literature.\[[@ref8]\] The fluoride concentration below optimal as well as above optimal was found to be harmful. A study by Shekar *et al*.\[[@ref8]\] among 12 and 15-years-old children in Nalgonda district, Andhra Pradesh found the prevalence of dental caries to be highest in areas where the concentration of fluoride in drinking water was less than 0.7 ppm followed by areas with fluoride concentration of 4.1 ppm and above. The results of the present study were consistent with the findings of this study. Murray JJ (2003)\[[@ref20]\] quoted a study by Torell and Ericsson assessing the use of fluorides in different forms for caries prevention. The study found the frequent exposure to low concentration fluoride solution to be more protective than infrequent exposure to high concentration fluorides. The continuous exposure of the teeth to water containing optimum and slightly above optimum levels of fluoride may facilitate remineralization of incipient carious lesions through topical effect. The optimum fluoride concentration though may result in milder forms of dental fluorosis will not alter the surface texture of the teeth at these concentrations. The fluoride concentrations above 4 ppm may result in severe dental fluorosis which manifest as confluent pitting.\[[@ref20]\] The alteration in the surface texture favors food retention and plaque accumulation, which in turn may increase the risk for dental caries in areas where the concentration of fluoride is above 4 ppm. The lack of protective benefit and pitting caused by severe dental fluorosis explain the high caries prevalence in low and very high fluoride areas respectively. Reddy and Tewari.\[[@ref21]\] conducted a study among 1750 school children in the age group 12-17 years in Bhatinda district of Punjab, India. The prevalence of dental caries in areas with the fluoride concentrations of 0.3, 1.1, 2, 3.4, 5.4 and 10.4 ppm was 89.0, 61.2, 54.7, 72.8 73.6 and 85.5% respectively. The study found highest caries prevalence in low fluoride areas (0.3 ppm) and very high fluoride areas (10.4 ppm). The results of our study were consistent with the findings of this study and others.\[[@ref15][@ref22][@ref23][@ref24][@ref25][@ref26][@ref27][@ref28]\] We found a higher prevalence of dental caries among females compared with males. In the absence of dietary differences, the higher caries prevalence among females is attributed to early eruption of teeth among females and thereby longer exposure to deleterious oral environment.\[[@ref29]\] The body surface area among males is more than that for females. Due to greater physical activity, boys consume more water than compared to girls. The frequent water consumption results in frequent exposure of teeth to fluoridated water and higher level of protection among boys compared to girls. A study by Singh and Singh\[[@ref30]\] among school going children in Patna found the prevalence to be high in female children (52.6%) than males (50.2%). The results of our study were in agreement with this study and others.\[[@ref31]\] The irreversible nature of the disease and longer exposure of teeth to deleterious oral environment may explain the higher caries prevalence of caries among 15 years group compared to 12 years group. National oral health survey and fluoride mapping in India\[[@ref7]\] found the overall prevalence of dental caries to be increasing with increasing age. Our results were consistent with the results of national oral health survey in India. The overall prevalence of dental caries among 12 and 15-year-old children in the present study was significantly less compared to prevalence noted in National oral health survey in India for these age groups. Our study was conducted in an endemic fluoride belt and hence, the less caries experience among children in our study compared to data at national level may be attributed to protective action of fluoride in drinking water. The increasing prevalence and severity of dental fluorosis with increasing fluoride concentration may be explained by the fact that dental fluorosis is a developmental defect which occur because of exposure to water containing high fluoride concentrations. This relation between water fluoride concentration and severity of dental fluorosis is dose dependent with increasing concentration leading to higher risk.\[[@ref32]\] A positive correlation between fluoride concentration and dental fluorosis indexscore was found in many epidemiological studies in the past.\[[@ref25][@ref33][@ref34]\] our results were consistent with all these studies. Dental fluorosis is a developmental defect affecting the teeth before calcification (before 10 years of age). The exposure to higher fluoride concentrations after the calcification (which is complete by 10 years of age for all permanent teeth except third molars) might not increase the severity of dental fluorosis. This explains the lack of age and gender predilection for dental fluorosis in the present study. Chandrashekar and Anuradha\[[@ref35]\] in their study on the prevalence of dental fluorosis in rural areas of Davangere, India found no age predilection for dental fluorosis. Our results were in agreement with this study and others.\[[@ref36]\] The number of children in medium fluoride areas in the present study was significantly less compared to other categories. The fluoride categories were made at the time of statistical analysis based on fluoride concentration in drinking water and not at the time of selection of study participants. This clearly suggests that the optimal fluoride areas are less in number even in an endemic fluoride belt. Many areas were having either below optimal fluoride concentration or above optimal levels. This might have resulted in less number of children in medium fluoride areas. The finding highlights the need for a comprehensive fluoride mapping in endemic fluoride belts and remedial actions based on fluoride concentrations in water. The less number of children in medium fluoride area compared to others might have influenced the difference between different fluoride areas to some extent, which needs to be further evaluated in future studies. Summary and Conclusion {#sec1-5} ====================== The present study found high caries prevalence in low and high fluoride areas with fluoride concentrations lesser than 0.7 ppm and higher than 4 ppm. The medium fluoride area with optimum fluoride concentration (0.7-1.2 ppm) had the lowest caries prevalence. The prevalence of caries was more among females compared to males. 15-years-old children had more caries prevalence than 12 years. There was a positive correlation between fluoride concentration and prevalence of dental fluorosis with no age and gender predilection. The results strongly support the findings of previous studies conducted in endemic fluoride areas that increase in the fluoride concentration above optimal levels does not offer additional benefits in caries prevention. But, instead, increase the risk for dental fluorosis. A defluoridation plant was installed in Nalgonda by National Environmental Engineering and Research Institute, Nagpur. This community defluoridation technique is popularly known among dental fraternity in India as Nalgonda technique of defluoridation. The defluoridation plant is presently abandoned due to lack of maintenance. This reflects the negligent attitude among the policy makers towards dental diseases. The results of this study and previously conducted studies highlight the immediate need for defluoridation at least in areas with fluoride concentration above 2 ppm. Here, dental fluorosis is a major public health problem than dental caries as the prevalence is almost 100%. The high caries prevalence in low fluoride areas call for water fluoridation and or other alternate strategies for caries prevention. The running and maintenance of defluoridation plants is more expensive than the fluoridation plants. Determined efforts with public private partnership can translate these idealistic goals into realistic ones. The professional organizations such as Dental Council of India and Indian Dental Association should strongly support water fluoridation in low fluoride areas and defluoridation in high fluoride areas to combat two dental diseases related to fluoride concentrations in drinking water. I would like to thank the Principal and management of Sri Sai College of Dental Surgery for their continuous support and encouragement for undertaking this project. We thank the District Education Officer, Nalgonda, The Head masters of the schools concerned and the participants for their kind co-operation. **Source of Support:** Nil. **Conflict of Interest:** None declared. 

1. Introduction {#sec1} =============== Malaria is one of the major infectious diseases particularly in tropical countries. It is caused by the protozoan parasite of genus*Plasmodium* and transmitted by the female*Anopheles* mosquito \[[@B1]\]. So far, only 5 of the 170 species of this parasite have been found which are the cause of disease in humans. They consist of*Plasmodium falciparum*,*Plasmodium knowlesi*,*Plasmodium ovale*,*Plasmodium vivax*, and*Plasmodium malariae* \[[@B2]\]. *Plasmodium falciparum* is the most dangerous of all and can even lead to death. The latest released statistics by December 2014 showed 198 million cases of malaria in 2013 comprised of estimated 584,000 deaths. Malaria mortality rates have fallen by 47% globally since 2000 and by 54% in the WHO African Region \[[@B3]\]. Since the 17th century, the bark of the*Cinchona* tree which was the source of quinine had been the first effective western treatment for*malaria* \[[@B4]\]. However, chloroquine replaced it from the 1940s, although quinine is still used under certain circumstances \[[@B5]\]. The resistance against antimalaria drugs is a drawback of standard drugs like chloroquine, sulphadoxine-pyrimethamine, and even artemisinin. The search for new herbal drugs is of prime importance \[[@B6]\]. Cinnamon consists of cinnamaldehyde compounds, volatile oils, tannins, mucilage, limonene, and safrole that possesses antibacterial, antiseptic, antiviral, and antifungal properties \[[@B7]\]. Senhaji et al. in 2005 tested different extracts of cinnamon like the aqueous, hexane, methanol, and ethanol on gram positive and negative bacteria as well as yeast,*Leishmania*, and*Toxoplasma* with positive results \[[@B8]\]. More recently, Nkanwen and colleagues in 2013 tested the bark of cinnamon for antiplasmodial activity and found that it had an inhibitory effect on*Plasmodium falciparum* enoyl-ACP reductase enzyme \[[@B9]\]. Metabonomics is the recent omics that studies simultaneously all the metabolites and small molecules in biological fluids, cells, and tissues. It uses high throughput technology like ^1^H Nuclear Magnetic Resonance (^1^HNMR) and Liquid Chromatography Mass Spectrometry (LC-MS). It plays the most important role in direct observation of the physiological status of an organism or the cell and is a faster and more affordable way of testing drugs and their mechanism of action \[[@B10]\]. Earlier studies have reported antiplasmodial effect of cinnamon extract and its result on one of its enzymes. It was decided to study the metabolome of*Plasmodium falciparum* after exposure to cinnamon extract by ^1^HNMR spectroscopy. 2. Materials and Methods {#sec2} ======================== 2.1. Preparation of Cinnamon Extract {#sec2.1} ------------------------------------ *Cinnamomum cassia* obtained from Mumbai, India, were ground into a fine powder. 50 grams of cinnamon powder was dissolved in 500 mL of distilled water and boiled for 3 hours and then filtered through a gauze. The obtained extract was concentrated into an oily extract using a rotary machine and then lyophilized to 12.48 grams of cinnamon powder. 2.2. *Plasmodium falciparum* Culture {#sec2.2} ------------------------------------ Strains of 3D7 provided by the late Dr. Walliker were cultured using the method of Trager and Jensen. Briefly, the parasites were cultured in 7 mL RPMI 1640 medium with 5% serum, 10% hematocrit, hypoxanthine, and gentamicin (complete medium) in 75 mL flasks. The medium was changed every 48 h and flasks were incubated at 37°C with 5% CO~2~, 5% O~2~, and 90% N~2~ \[[@B13]\]. Large-scale cultivation of*Plasmodium falciparum* for metabonomics was carried out by the method modified by Radfar et al. with 24 h changes of 75 mL of complete medium enriched with 5% albumax and 0.5% hematocrit. Daily monitoring of the culture assisted in increasing its parasitemia to 60% and the IC50 dose of cinnamon extract. Cultures grown without drugs were used as negative controls. After 48 hours, they were harvested by centrifugation at 800 g for 5 min \[[@B14]\]. 2.3. IC50 Determination {#sec2.3} ----------------------- Parasites reaching 5% were then diluted to reduce the parasitemia to 0.5%, and the haematocrit was adjusted to 1.5%. This suspension was then added (100 *μ*L per well) to microplates predosed with 90 *μ*L of different concentration of cinnamon or artemisinin and incubated for 48 hours at 37°C in mixed gas of 5% CO~2~, 5% O~2~, and 90% N~2~; after that thin smears were prepared from each well, stained with giemsa stain for determination of percentage of parasitemia and IC50 detected by microscopy \[[@B12]\]. 2.4. Isolation of Parasites {#sec2.4} --------------------------- Parasites were isolated by adding 40 times the volume of 0.02% saponin in phosphate buffered saline (PBS) on ice for 30 min and then centrifuged at 4,000 g for 20 min at 4°C. The cells were washed three times with 1XPBS and pellet collected by centrifugation in the above conditions and final centrifugation was carried out at 14,000 g for 5 min at 4°C; the cells were counted in a hemocytometer and stored at −20°C \[[@B15]\]. 2.5. Preparation of Parasite Extract {#sec2.5} ------------------------------------ The samples containing parasites sonicated in a sonifier (Soniprep 150) at 9 KHz for 5 min in pulse were then centrifuged at 10000 g for 10 min, and the pellet dissolved in 200 *μ*L of 1.8 mM cold perchloric acid and pH adjusted by addition of 5.4 M KOH to 6.8 and kept on ice for 60 min to precipitate the acid. The parasite extract was then centrifuged for 10 min at 10,000 g and the pH once again adjusted to 6.8 and lyophilized \[[@B15]\]. 2.6. Preparation of Sample for ^1^HNMR {#sec2.6} -------------------------------------- 1 mL of D~2~O and 0.01% TSP was added to the lyophilized powder and spectroscopy was performed using 2-dimensional NOESY (Nuclear Overhauser Spectroscopy) conditions \[[@B16]\]. 2.7. Computational Analysis {#sec2.7} --------------------------- The spectra from ^1^HNMR were Fourier transformed by Mestrec software. To obtain regression values, the variables of the signal intensities and chemical shifts were integrated and were inserted into the Excel file. Normal intensities were used for further analysis with MATLAB. 2.8. Partial Linear Square (PLS) {#sec2.8} -------------------------------- PLS is a supervised method to obtain a model using regression in multivariate techniques via linear combination of original variables in which *X* is the normal intensities from the ^1^HNMR spectra and the *Y* matrix comprises 0 for cinnamon treated and 1 for controls. Orthogonal signal correction (OSC) filters removed noise from the spectrum; only one factor was removed and PLS was applied after OSC \[[@B17]\]. 2.9. Identification of Metabolites {#sec2.9} ---------------------------------- Metabolites corresponding to these resonances were then identified using chemical shift assignments of spectra of differentiating metabolites of sera based on comparison with chemical shifts of metabolites in Human Metabolite Database Data Bank (HMDB) (<http://www.hmdb.ca/metabolites>) \[[@B18]\] and in other published data. Analysis of metabolite cycles was carried out using Metaboanalyst software (<http://www.metaboanalyst.ca>) \[[@B19]\]. 3. Results {#sec3} ========== The lyophilized cinnamon was redissolved in RPMI medium and tested on 5%*Plasmodium falciparum* and IC50 of 1.25 mg/mL was obtained with significance *p* \< 0.001 ([Figure 1](#fig1){ref-type="fig"}). Parasite extract obtained from large-scale cultivation of*Plasmodium falciparum* was analyzed by ^1^HNMR. The spectra of the cinnamon treated*Pasmodium falciparum* and controls were superimposed in [Figure 2](#fig2){ref-type="fig"}. The chemical shifts (ppm) of the spectra were converted into figures and then analyzed using OSC-PLS in MATLAB. [Figure 3](#fig3){ref-type="fig"} shows complete separation of the two groups of samples. [Figure 4](#fig4){ref-type="fig"} shows differentiating metabolites between the two groups. [Figure 5](#fig5){ref-type="fig"} depicts the biplot showing both the score plot and loading plot. The outliers indicate the most significant differentiating metabolites which are detected from their numbers. The metabolites were identified from their chemical shifts using HMDB ([Table 1](#tab1){ref-type="table"}). The metabolites were entered into the Metaboanalyst database and differentiating metabolic cycles were recognized ([Figure 6](#fig6){ref-type="fig"}). 4. Discussion {#sec4} ============= Cinnamon has IC50 of 1.25 mg/mL on*Plasmodium falciparum in vitro* with IC50 of 1.25 mg/mL obtained with significance *p* \< 0.001. The altered metabolites comprise succinic acid, glutathione, L-aspartic acid, beta-alanine, and 2-methylbutyryl glycine ([Table 1](#tab1){ref-type="table"}). The most significant biochemical pathways which have changed are discussed below ([Figure 6](#fig6){ref-type="fig"}). The alanine, aspartame, and glutamate pathway which is one of the amino acid cycles is the first one to be affected. L-Aspartic and succinic acids are the metabolites which take part in it. There are very early reports about the ability of the parasite to fix carbon dioxide and then synthesize alanine, aspartame, and glutamate. But amino acid uptake by the parasite from the infected erythrocytes is confirmed \[[@B20]\]. When culturing*Plasmodium falciparum in vitro* seven amino acids have to be supplied exogenously; they are isoleucine, methionine, cysteine, glutamate, glutamine, proline, and tyrosine \[[@B21]\]. Proteases act on amino acids especially aspartic proteases, as probable drug targets till a few years ago \[[@B22]\]. It is seen that cinnamon affects the parasite\'s amino acid biosynthesis essential for its survival. The second most important pathway affected is pantothenate and coenzyme A biosynthesis associated directly with the tricarboxylic acid (TCA) cycle. Pantothenate is a precursor of the fundamental enzyme cofactor coenzyme A (CoA). Reports have shown that infected human erythrocytes exhibit higher coenzyme A biosynthesis than uninfected ones. It is important for growth of the intraerythrocytic stage of human malaria. Human erythrocytes are capable of complete synthesis of pantothenate and CoA unlike rat and avian erythrocytes \[[@B23]\]. Cinnamon affects this cycle which is imperative in TCA and requires the carriage of carbons within the cell and entry of pyruvate to the tricarboxylic acid (TCA) cycle. It was thought that*Plasmodium falciparum* utilized glucose in an unconventional manner, but further work by metabolic approaches has proved that both asexual and sexual blood stages utilize a conventional TCA cycle to catabolize glucose and glutamine \[[@B24], [@B25]\]. The next important cycle to be affected is lysine biosynthesis which has been reported in the parasite,*Plasmodium falciparum*. Lysine is generally implicated in posttranslational modifications and is also involved in diverse cellular functions. High throughput technology has identified 421 acetylation sites in 230 proteins in the human malaria parasite*Plasmodium falciparum* during its active proliferation in erythrocytes. Lysine-acetylated proteins are distributed in the nucleus, cytoplasm, mitochondrion, and apicoplast \[[@B26]\]. There are also reports of histone lysine methylation, regulated by methyltransferases and demethylases, which play an important role in chromatin structure and gene expression in a wide range of eukaryotic organisms. The SET-domain protein methyltransferase superfamily includes all but one of the proteins known to methylate histones on lysine. Histone methylation is important in the regulation of chromatin and gene expression. Bioinformatic analysis has shown that nine SET-domain-containing genes were found in the malaria parasite*Plasmodium falciparum* and its sibling species. Most SET-domain genes and histone methyl-lysine marks displayed dynamic changes during the parasite asexual erythrocytic cycle, suggesting that they constitute an important epigenetic mechanism of gene regulation in malaria parasites \[[@B27]\]. They are considered as recent targets for designing of antimalarial drugs and cinnamon extract affects them \[[@B28]\]. Glutathione metabolism is the last and most important cycle which has shown a change in the metabolome of*Plasmodium falciparum* to cinnamon. It is reported that*Plasmodium falciparum* employs a complex thioredoxin and glutathione system based on the thioredoxin reductase/thioredoxin and glutathione reductase/glutathione couples.*Plasmodium falciparum* thioredoxin reductase reduces thioredoxin and a range of low molecular weight compounds, while glutathione reductase is highly specific for its substrate glutathione disulfide. Since*Plasmodium* spp. lack catalase and a classical glutathione peroxidase, their redox balance depends on a complex set of five peroxiredoxins differentially located in the cytosol, apicoplast, mitochondria, and nucleus with partially overlapping substrate preferences. Moreover,*P. falciparum* employs a set of members belonging to the thioredoxin superfamily such as three thioredoxins, two thioredoxin-like proteins, a dithiol and three monocysteine glutaredoxins, and a redox-active plasmoredoxin with largely redundant functions. It is seen that glutathione metabolism is disturbed by the cinnamon extract. It can be concluded that cinnamon has an inhibitory effect on*Plasmodium falciparum in vitro* with IC50 of 1.25 mg/mL with significance of *p* \< 0.001. The altered metabolites are succinic acid, glutathione, L-aspartic acid, beta-alanine, and 2-methylbutyryl glycine and the main metabolic cycles affected were alanine, aspartate, and glutamate pathway, pantothenate and coenzyme A biosynthesis, lysine biosynthesis, and glutathione metabolism, all of which are important as drug targets. The authors wish to acknowledge the Central Instrument Laboratory, Isfahan University, Isfahan, for carrying out the ^1^HNMR tests. Conflict of Interests ===================== The authors declare that there is no conflict of interests regarding the publication of this paper. {#fig1} {#fig2} {#fig3} {#fig4} {#fig5} {#fig6} ###### Differentiating metabolites identified by their chemical shifts using HMDB. Differentiating metabolites HMDB ----------------------------- ----------- Succinic acid HMDB00254 Glutathione HMDB00121 L-Aspartic acid HMDB00191 Beta-alanine HMDB00056 2-Methylbutyryl glycine HMDB00339 [^1]: Academic Editor: Sukla Biswas

Quick Links How would you like to share? Microglia are the housekeepers of the brain, gobbling up foreign bodies and protecting neurons from damage. In culture, these cells are well known for ingesting globs of amyloid-β, and in Alzheimer disease they surround amyloid deposits. One could be forgiven for assuming that microglia have a profound effect on the growth or clearance of senile plaques. But as reported in the October 18 Nature Neuroscience online, researchers in Germany have almost completely banished microglia from the brains of APP transgenic mice, and to their surprise they found absolutely no change in plaque size or number. “We expected that something would happen, and we were not biased either way, but nothing happened. The plaques just didn’t care whether microglia were around or not,” said Mathias Jucker, University of Tubingen, and co-leader of the study together with Frank Heppner, Charite-Universitaetsmedizin, Berlin. “My interpretation is that in the normal pathogenesis of amyloid formation in transgenic mice, microglia do not play any role,” Jucker told ARF. The findings may come as a surprise, given indications that microglia can be recruited to tackle Aβ deposits (see Boissonneault et al., 2009; ARF related news story on El Khoury et al., 2007), but it gets at the fundamental question of whether resident microglia in the brain have any effect on plaque dynamics—a heavily debated issue, according to Terrence Town, University of California, Los Angeles. “This is an elegant study. I think that it definitively tells us that microglia are not important in clearance or formation of amyloid plaques,” Town told ARF, though he emphasized also that the work does not rule out the possibility that peripheral macrophages might be involved in plaque turnover or that brain microglia could be spurred into action. “While CNS resident microglia may not be able to influence plaque progression in the absence of further manipulation, that does not mean that if we devise a therapeutic or genetic strategy to manipulate these cells that that would not have an effect on plaques,” he said. To ablate microglia from the brain, Jucker, Heppner, and colleagues made use of mice engineered to produce the “suicide” thymidine kinase from herpes simplex virus (HSVTK). The kinase converts some antiviral drugs, such as ganciclovir (GCV), into toxic nucleotide analogs that insinuate into growing DNA and kill dividing cells. Joint first authors Stefan Grathwohl and Roland Kälin crossed HSVTK mice with two AD mouse models—the APP/PS1 mouse, which has aggressive plaque pathology, and the APP23 mouse, which develops plaques more slowly. The HSVTK was driven by the CD11b promoter. This promoter restricts kinase expression to cells of the myeloid lineage including brain microglia, but the researchers generated chimeric mice carrying congenic wild-type bone marrow to keep peripheral myeloid cells alive. This ensured that only resident brain microglia were ablated in the crosses. Grathwohl and colleagues used two different GCV treatments to ablate brain microglia in the APP/PS1-TK mice. Given orally at five months to the chimeric mice, GCV led to a 30 percent reduction in microglia in the neocortex. The morphology or number of Aβ plaques did not change as a consequence. Using a micropump to deliver GCV directly into brain ventricles (for the ventricle infusions, APP/PS1-TK mice were not bone marrow chimeric), the researchers achieved a 90 percent reduction in brain microglia over two to four weeks. Again, they found no change in plaque dynamics. The researchers also adjusted the timing of the microglial decimation to before or after plaques emerged. “It didn’t matter whether we depleted the microglia first or whether we had amyloid depositing mice with plaques and then depleted the microglia; the plaques just didn’t care whether they had microglia or not,” said Jucker. It also didn’t matter which mouse model the researchers used. With the less aggressive APP23 crosses, the researchers also achieved about 95 percent ablation of brain microglia after pumping GCV into brain ventricles of 17- or 24-month-old mice. They found no change in congophilic-positive plaque load or the number and morphology of amyloid-associated dystrophic neurites. The latter observation argues against activated microglia being involved in neuronal damage. “This was a very carefully designed study. They used multiple approaches, two different mouse models of Alzheimer’s, and I think the results are compelling,” said Town. One major limitation to the study is the length of observation. Because GCV eventually becomes toxic, the researchers were only able to follow its effects for up to four weeks, leaving open the question of whether a longer microglial depletion would have some effect on plaques. “That’s a fair criticism,” said Jucker but he added that studies of microglial infiltration into the brain have seen effects within two weeks (see ARF related news story on Simard et al., 2006) and that plaques can pop up literally overnight (see ARF related news story on Meyer-Luehmann et al., 2008), “so I have trouble to believe that after, say, 16 weeks we would see anything different,” he said, though he is planning to investigate longer times. Town thinks that the researchers tried their best to see a positive effect. “The time points they chose to administer GCV tended to be during the initiation phase of Aβ deposition, so you would expect that if any phase of amyloidosis would be sensitive to this kind of manipulation, it would be then,” he said. “This is a very exciting study that gives us a lot of thought for what is really going on in the brain with amyloid, and I think we will be busy discussing this for a long time,” suggested Tony Wyss-Coray, Stanford University, California, who also wondered if resident microglia can be induced to attack amyloid. “The study shows that if you don’t do anything, then microglia are not involved in plaque turnover. But that doesn’t exclude that they could be clearing amyloid in human brains,” he suggested. Jucker said he doubts that happens in the absence of some other initiating event. “This goes back almost 20 years to the studies of Henryk Wisniewski,” said Jucker. Wisniewski found Aβ fibrils in brain microglia of AD patients only if the patients had also suffered a stroke (see Wisniewski et al., 1991), suggesting that some additional event was necessary to goad microglia into gobbling up Aβ. What that event might be in humans is unclear, though inflammatory responses aid microglia clearance of Aβ in transgenic mice (see, e.g., Wyss-Coray et al., 2001). And just recently, Pritam Das and colleagues at the Mayo Clinic, Jacksonville, Florida, reported that they can induce massive gliosis and suppression of Aβ deposition by administering the pro-inflammatory cytokine interleukin-6 (IL-6) to transgenic animals (see Chakrabarty et al., 2009). “We are excited about that because it shows that inflammation does not promote more amyloid or more Aβ, which was the hypothesis for a long time,” said Das. Immunotherapy is currently an active therapeutic strategy and that might stimulate microglia, as well. In vitro, too, microglia are well known for phagocytosing Aβ. Gary Landreth’s group at Case Western Reserve University in Cleveland, Ohio, have identified specific receptors that mediate microglial responses to Aβ (see ARF related news story on Reed-Geaghan et al., 2009). “That would, of course, create hope that one could try to find the right receptor or target to activate these cells. If it is true that they are not doing anything in the brain, but they do in cell culture, they are targets I would want to pursue,” suggested Wyss-Coray. If it is true that microglia are normally oblivious to amyloid plaques, then why do they surround them? “My own theory is that they are making a glial scar,” suggested Das. “The microglia surround the plaques, and astrocytes come on top and cordon off the area, essentially protecting the rest of the brain. If the microglia cannot remove plaques, it makes sense that they would try to protect the rest of the brain from damage.” Though ablation of microglia did not result in neurodegeneration, noted Jucker, he did agree with Das’s speculation. Perhaps the next step is to question the role of the astrocytes, suggested Wyss-Coray. “A number of people, including us, have shown that astrocytes can degrade amyloid.” (See Wyss-Coray et al., 2003.) However, given their specialized role in modulating neurotransmission, ablating astrocytes without having catastrophic effects on the mice might be a tall order.—Tom Fagan Comments The demonstration by Grathwohl et al. that substantial depletion of microglia has no consequences for Aβ deposition is indeed intriguing. However, this finding must be taken in context of a good deal of data indicating that microglia do participate in the sequelae of events occurring in AD and in APP transgenic models, much of which come from studies enlisting elegant gene- or cell-ablation approaches such as those applied here. For instance, genetic ablation of Toll-like receptor 2 (Richard et al., 2008) or CCR2 (El Khoury et al., 2007) exacerbates plaque deposition. More importantly, many hypotheses about the roles of microglia in AD involve events downstream of amyloidogenesis, such as synaptic dysregulation or frank neurotoxicity. The sole parameter assessed in this paper that has any possible link to such downstream events was APP staining in dystrophic neurites. But no compelling claims had ever been made for a connection between microglial actions and these structures; the APP staining is likely a consequence of the transgene itself. It would be more relevant to survey markers of synapse integrity and function, as well as tau phosphorylation. Indeed, several lines of investigation indicate that microglia play tonic roles in normal synapse formation, modulation, and removal (Bessis et al., 2007; Wake et al., 2009). If this is the case, it is difficult to imagine that their activation in AD does not impact synaptic function in some way. There is also compelling evidence that one consequence of FAD mutations is dependent upon microglia; namely, microglia expressing mutant forms of presenilin-1 alter the fate of neural progenitor cells (Choi et al., 2008). Relatedly, it would certainly be important to characterize the behavioral profile of mice manipulated in the manner of Grathwohl et al.

Justification: The species has a relatively large distribution area and the habitat of the species is not affected significantly by human activity, therefore it is assessed as Least Concern (LC). This species has also been assessed at the regional level as:EU27 regional assessment: Least Concern (LC) at the level of the 27 member states of the European Union.European regional assessment: Least Concern (LC). According to AnimalBase, the species inhabits rocks and rock rubble in forests (not too dark), in trees, on calcareous substrate or on meadows with bare rocks showing through. It can be found above the timberline, up to 2,700 m asl. In France it is also found in dense populations in dry and sunny meadows devoid of rocks. In Britain it is usually in unshaded habitats. It is a potential threat to this species if the rocks are destroyed by quarrying, by road construction or by other reasons. According to AnimalBase (2010) in central Europe it threatened by habitat destruction in forest management, and in Britain by changes of land use. However the total destruction of the whole habitat is not very likely, therefore this threat is mostly hypothetical. Several sub-populations inhabit protected areas. The species is of Lower Concern in Austria, decreasing (4R) in Bavaria outside the Alps and Lower Concern in Germany (Reischütz 2007, Falkner et al. 2002). No conservation actions are currently required.

Étienne Brûlé Étienne Brulé (; c. 1592 – c. June 1633) was the first European explorer to journey beyond the St. Lawrence River into what is now known as Canada. He spent much of his early adult life among the Hurons, and mastered their language and culture. Brûlé became an interpreter and guide for Samuel de Champlain, who later sent Brûlé on a number of exploratory missions, among which he is thought to have preceded Champlain to the Great Lakes, reuniting with him upon Champlain's first arrival at Lake Huron. Among his many travels were explorations of Georgian Bay and Lake Huron, as well as the Humber and Ottawa Rivers. In 1629, during the Anglo-French War, he escaped after being captured by the Seneca tribe. Brûlé was killed by the Bear tribe of the Huron people, who believed he had betrayed them to the Seneca. Early life in France Brûlé was born c. 1592 in Paris, France. He came to Canada when he was only 16 years old, in 1608. Brûlé has not left any recollection or description of his early life, his life among the indigenous peoples, or of his expeditions. Therefore, his existence has been viewed through the works of others, including Champlain, Sagard, and Brébeuf. Life in New France Champlain wrote of a youth who had been living in New France since 1608, and whom many believe to have been young Brûlé. In June 1610, Brûlé told Champlain that he wished to go and live with the Algonquins and learn their language as well as better understand their customs and habits. Champlain made the arrangement to do so and in return, the chief Iroquet (an Algonquin leader of the Petite nation who wintered his people near Huronia), requested that Champlain take Savignon, a young Huron, with him to teach him the customs and habits of the French. Champlain instructed Brûlé to learn the Huron language, explore the country, establish good relations with all first nations, and report back in one year's time with all that he had learned. On June 13, 1611, Champlain returned to visit Brûlé, who astonishingly had done all that Champlain had asked of him. Brûlé was dressed as though he was one of the indigenous people and was extremely pleased with the way he was treated and all that he had learned. Champlain requested that Brûlé continue to live among the Indigenous peoples so that he could fully master everything, and Brûlé agreed. For four years, Champlain had had no connection or communication with Brûlé who, it is thought, was then the first European to see Great Lakes. In 1615, they met again at Huronia. There, Brûlé informed Champlain of his adventures and explorations through North America. Brûlé explained that he was joined by another French interpreter by the name of Grenolle. He reported that they had travelled along the north shore of what they called la mer douce (the calm sea), now known as Lake Huron, and went as far as the great rapids of Sault Ste. Marie where Lake Superior enters Lake Huron. In 1615, Brûlé asked permission from Champlain to join 12 Huron warriors on their mission to see the Andaste (Susquehannock) people, allies of the Hurons, to ask them for their support during an expedition Champlain was planning. Champlain ordered the party to travel west of the Seneca country because they needed to arrive there quickly and the only way to do so was by crossing over enemy territory. This proved to be dangerous but semi-successful for Brûlé did reach the Andastes; however, he arrived at the meeting place Champlain chose two days too late to assist Champlain and the Hurons, who had been defeated by the Iroquois. Brûlé probably visited four of the five Great Lakes—Lake Huron, Lake Superior, Lake Erie, Lake Ontario—and may have also seen Lake Michigan. Brûlé was more than likely the first white European to complete these expeditions across North America. In these expeditions he visited places such as the Ottawa River, Mattawa River, Lake Nipissing, and the French River to Georgian Bay. From Georgian Bay, Brûlé was able to cut into Lake Huron. He paddled up the St. Marys River and portaged into Lake Superior. He journeyed through Lake Simcoe and portaged through what is now Toronto to Lake Ontario. From Lake Ontario Brûlé was able to travel in Upstate New York and explore Pennsylvania and cross down the Susquehanna River to Chesapeake Bay. It is also said that it is very probable that Brûlé was one of the first Europeans to stand along the shores of Lake Erie and Lake Michigan. He had spent months visiting indigenous peoples that lived along Lake Erie between the Niagara and Detroit Rivers, but because he left no writings of his own, almost nothing identifiable is known about the tribes he visited, many of which would be obliterated a few decades later in the Beaver Wars (in contrast, Joseph de La Roche Daillon, who conducted a missionary journey among the tribes of Western New York in 1627, kept meticulous notes of his journeys; it is de La Roche's writings that serve as the primary history of pre-Beaver Wars native occupation of Western New York). Champlain and the Jesuits often spoke out against Brûlé's adoption of Huron customs, as well as his association with the fur traders, who were beyond the control of the colonial government. Brûlé returned to Quebec in 1618, but Champlain advised him to continue his explorations among the Hurons. Brûlé was later confined in Quebec for a year, where he taught the Jesuits the natives' language. In 1629, Brûlé betrayed the colony of New France. David Kirke and his brothers, English merchants of Huguenot extraction, paid 100 pistoles to Brûlé and three of his companions to pilot their ships up the St. Lawrence river and "undoubtedly gave information as to the desperate state of Quebec's garrison" that emboldened the Kirkes to attack it. (See main article: Surrender of Quebec) After 1629, Brûlé continued to live with the Natives, acting as an interpreter in their dealings with the French traders. Though the circumstances of his death are unclear, the prevailing view is that he was captured by the Seneca Iroquois in battle and left for dead by his Huron group. He managed to escape death by torture, but when he returned home, the Hurons did not believe his story and suspected him of trading with the Senecas. Treated as an enemy, Brûlé was stabbed to death, his body was dismembered, and his remains were consumed by the villagers in 1633. He died at Toanche, on the Penetanguishene peninsula, Ontario. See also Timeline of Quebec history Timeline of Ottawa history Timeline of Toronto history Coureurs des bois Samuel de Champlain École secondaire Étienne-Brûlé French colonization of the Americas Etienne Brule Park References Further reading Douglas, Gail (2003). Étienne Brûlé: The Mysterious Life and Times of An Early Canadian Legend, Canmore, Alberta: Altitude Publishing Canada, 141 p. () Baker, Daniel ed. Explorers and Discoverers of the World. Detroit: Gale Research, 1993 Cranston, James Herbert (1949). Etienne Brulé, Immortal Scoundrel, Toronto : The Ryerson Press, 144 p. Woods, Shirley E., Jr. "Ottawa: The Capital of Canada" Doubleday, 1980., p 9. David Hackett Fischer. Champlain's Dream. New York: Simon and Schuster, 2008. Grace Morrison. Étienne Brûlé. Markham: Fitzhenry and Whiteside, 1989. Gervais Carpin. Le Réseau du Canada. Québec : Presses de L'Université de Paris-Sorbonne, 1999. James Herbert Cranston. Étienne Brûlé : Immortal Scoundrel. Toronto : The Ryerson Press, 1949. Serge Bouchard, Marie Christine Lévesque (2014) Ils ont couru l'Amérique : De remarquables oubliés Tome 2 (chapitre 1), Lux Éditeur Donald H. Kent, "The Myth of Etienne Brulé," Pennsylvania History 43 (1976): p 291–306. Richard J. McCracken, "Susquehannocks, Brule and Carantouannais: A Continuing Research Problem," The Bulletin. Journal of the New York State Archaeological Association, no. 91 (1985), pp. 39–51. Category:1590s births Category:1633 deaths Category:People from Champigny-sur-Marne Category:People of New France Category:Explorers of Canada Category:French explorers Category:17th-century explorers Category:People of pre-statehood Michigan Category:People of pre-statehood Minnesota Category:People of pre-statehood Wisconsin Category:French torture victims Category:First Nations history in Ontario Category:First Nations history in Quebec Category:Persons of National Historic Significance (Canada)

Background {#Sec1} ========== The economically important grass tribe Triticeae Dumort. consists of approximately 360 species and several subspecies in 20-30 genera. Triticeae taxa occur in temperate and dry regions of the World and harbour the important cereals bread wheat (*Triticum aestivum*), barley (*Hordeum vulgare*), rye (*Secale cereale*) and their wild relatives \[[@CR1], [@CR2]\]. Yet there is no good understanding of the relationships among Triticeae taxa, although a multitude of molecular phylogenies have been produced \[[@CR3]--[@CR11]\]. The acceptance levels of taxa vary greatly among authors on the genus-level and below (for recent reviews see \[[@CR1], [@CR12], [@CR13]\]). One important reason is the complex mode of evolution within Triticeae. The majority of species are allopolyploids and many of them likely have originated repeatedly, involving genetically different parent species \[[@CR14]--[@CR19]\]. Bread wheat is the most prominent polyploid and evolved via consecutive hybridizations of three diploids and thereby combines three related genomes (named **A**, **B** and **D**) \[[@CR7], [@CR20]\]. In Triticeae and many other crops such genomes were defined through cytogenetic characterization of chromosomes together with the analysis of their pairing behaviour in interspecific and intergeneric crosses (for reviews see \[[@CR1], [@CR12], [@CR21]\]). It is assumed that diploid species and monogenomic taxa are the basic units within Triticeae and that the heterogenomic polyploids form a second level of taxonomic entities \[[@CR22], [@CR23]\]. Triticeae are known to have low barriers against hybridization, which result in mixed or even recombinant phylogenetic signals from nuclear data \[[@CR10], [@CR20]\]. In contrast, phylogenetic analyses of plastid sequences provide clear information on maternal lineages, as organelles are mostly uniparentally inherited and non-recombining in angiosperms \[[@CR24]\], although chloroplast capture \[[@CR25]\] can result in deviating phylogenetic hypotheses. Yet, plastid sequence data is limited for Triticeae. Studies based on a tribe-wide taxon sampling are rare and focused on single or few plastid markers \[[@CR9], [@CR26]--[@CR28]\]. To date, the number of whole plastid genome sequences is increasing \[[@CR29]--[@CR34]\], however, entire chloroplast genomes are mainly available for the domesticated taxa and their closest relatives. These previous studies provide only limited insight in the maternal phylogeny of Triticeae, as only one to few accessions per taxon were included and often support values for the taxonomic units are low \[[@CR26], [@CR28], [@CR35]\]. Here we present phylogenetic analyses of chloroplast sequences based on a comprehensive set of monogenomic Triticeae species plus allopolyploid representatives of the wheat group (i.e. taxa belonging to the genera *Aegilops* and *Triticum*). For each species we included multiple individuals to sample part of the intraspecific variation. We performed a target-enrichment and next-generation sequencing (NGS) approach that, among nuclear loci (which will be published elsewhere), targeted the chloroplast *ndh*F gene. Since chloroplasts occur in high copy number in the plant cell, they represent a large fraction of the off-target reads when sequencing reduced complexity libraries, which can be used to assemble almost complete chloroplast genomes \[[@CR36]\]. Our dataset was complemented by chloroplast genomes stored in the GenBank database. Multispecies coalescent (MSC) analyses based on *trn*K-*mat*K, *rbc*L and *ndh*F were used for dating of the major splits within the evolution of the tribe and to reconsider the monophyly of the Triticeae chloroplast lineages. Methods {#Sec2} ======= Plant materials {#Sec3} --------------- Aiming at a good representation of taxa for phylogenetic inference we analysed 194 individuals representing approximately 53 species belonging to 15 genera (depending on taxonomic treatment applied) of the grass tribe Triticeae and included *Bromus* and *Brachypodium* accessions as outgroup taxa (Table [1](#Tab1){ref-type="table"}, Additional file [1](#MOESM1){ref-type="media"}: Table S1). The accessions were acquired from the International Center for Agricultural Research in the Dry Areas (ICARDA), the seed bank of the Leibniz Institute of Plant Genetics and Crop Research (IPK), the National Small Grain Collection of the US Department of Agriculture (USDA), the Czech Crop Research Institute, and the Laboratory of Plant Genetics (Kyoto University). Additional seed material was collected during field trips. Multiple accessions per species and intra-specific entities were selected if possible. All materials were grown from seed and identified based on morphological characters if an inflorescence was produced. Plant material obtained from germplasm repositories that was found to be in conflict with its taxonomic affiliation was only included in the analyses if the taxon could be unequivocally determined. Vouchers of the morphologically identified materials (Additional file [1](#MOESM1){ref-type="media"}: Table S1) were deposited in the herbarium of IPK (GAT).Table 1Overview of Triticeae and outgroup taxa consideredSpeciesGenomePloidy (N)Distribution area*Aegilops bicornis* Jaub. & SpachS\*2× (4)SE Mediterranean*Aegilops biuncialis* Vis.UM4× (4)SW-SE Europe, N Africa, SW Asia*Aegilops columnaris* Zhuk.UM4× (2)SW Asia*Aegilops comosa* Sm.M2× (4)Balkans*Aegilops crassa* Boiss.DM/DDM4× (1)/6× (2)SW Asia*Aegilops cylindrica* HostDC4× (2)SE Europe, W Asia*Aegilops geniculata* RothMU4× (3)E Europe, W Asia, Macaronesia*Aegilops juvenalis* EigDMU6× (2)SW Asia,*Aegilops kotschyi* Boiss.S\*U4× (1)SW Asia, NE Africa*Aegilops longissima* Schweinf. & Muschl.S\*2× (5)E Mediterranean*Aegilops markgrafii* (Greuter) K. HammerC2× (5)NE Mediterranean*Aegilops neglecta* Req. ex Bertol.UM/UMN4× (2)/6× (2)Mediterranean to SW Asia*Aegilops peregrina* (Hack.) Maire & WeillerSU4× (1)SW Asia, N Africa*Aegilops searsii* Feldman & KislevS\*2× (5)E Mediterranean*Aegilops sharonensis* EigS\*2× (1)Israel, Lebanon*Aegilops speltoides* TauschS2× (6)E Mediterranean*Aegilops tauschii* Coss.D2× (4)SW--C Asia*Aegilops triuncialis* L.UC4× (2)Mediterranean to SW Asia*Aegilops umbellulata* Zhuk.U2× (3)SE Europe, SW Asia*Aegilops uniaristata* Vis.N2× (3)SE Europe*Aegilops ventricosa* TauschDN4× (2)SW Europe, N Africa*Agropyron cristatum* (L.) Gaertn.P2× (2)/4× (4)S Europe, NECW Asia*Amblyopyrum muticum* (Boiss.) EigT2× (6)Turkey*Australopyrum retrofractum* (Vickery) A. LöveW2× (4)SE Australia*Dasypyrum villosum* (L.) P. CandargyV2× (5)SW--SE Europe, Caucasus*Eremopyrum bonaepartis* (Spreng.) NevskiFt/Xe/FtXe2×/4× (5)SE--E Europe, WC Asia*Eremopyrum triticeum* (Gaertn.) NevskiFt2× (3)SE--E Europe, WC Asia*Henrardia persica* (Boiss.) C.E. Hubb.O2× (4)SE Europe, SW Asia*Heteranthelium piliferum* Hochst. ex Jaub. & SpachQ2× (4)SE Europe, SW Asia*Hordeum bulbosum* L.I4× (1)Mediterranean to C Asia*Hordeum marinum* Huds.Xa2× (1)Mediterranean*Hordeum murinum* L.Xu2× (1)Mediterranean to C Asia*Hordeum pubiflorum* Hook. f.I2× (1)S Argentina*Hordeum vulgare* L.H2× (2)SW Asia*Psathyrostachys juncea* (Fisch.) NevskiNs2× (6)E Europe, NC Asia*Pseudoroegneria cognata* (Hack.) A. LöveSt6× (1)SW Asia, West Himalaya*Pseudoroegneria spicata* (Pursh) A. LöveSt2× (2)/6× (1)NW of Northern America*Pseudoroegneria stipifolia* (Czern. ex Nevski) A. LöveSt2× (1)/4×(2)E Europe, N Caucasus*Pseudoroegneria strigosa* (M. Bieb.) A. LöveSt2× (2)/6× (2)Balkans, Crimea*Pseudoroegneria tauri* (Boiss. & Balansa) A. LöveSt2× (5)E Mediterranean, S Caucasus*Secale cereale* L.R2× (4)Turkey*Secale strictum* C. PreslR2× (4)S Europe, SW Asia, N Africa*Taeniatherum caput-medusae* (L.) NevskiTa2× (6)S Europe, SW Asia, N Africa*Thinopyrum distichum* (Thunb.) A. LöveE4× (2)S Africa*Thinopyrum* spp*.* LöveE6× (1)/8× (2)SE Europe, SW Asia, N Africa*Triticum aestivum* L.BAD6× (6)Caucasus, Iran*Triticum monococcum* L.A2× (10)Turkey*Triticum timopheevii* (Zhuk.) Zhuk.GA4× (7)SW Asia*Triticum turgidum* L.BA4× (10)Lebanon*Triticum urartu* Thumanjan ex GandilyanA2× (5)E Mediterranean, Caucasus*Triticum zhukovskyyi* Menabde & EriczjanGAA6× (1)Caucasus*Brachypodium distachyon* (L.) P. Beauv.4× (1)S Europe, SW Asia, N Africa*Brachypodium pinnatum* L.) P. Beauv.4× (1)Europe, NCW Asia, NE Africa*Bromus inermis* Leyss.4× (1)SW Asia, Caucasus*Bromus tectorum* L.4× (1)Europe, SW Asia, N AfricaThe genome, determined ploidy levels, number of included accessions (N), and the main native distribution for all taxa sequenced in this study is given. The genomes names of allopolyploid *Aegilops* taxa are follwing Kilian et al. \[[@CR74]\] and Li et al. \[[@CR84]\] for S\*. Genome denominations for *Hordeum* follow Blattner \[[@CR107]\], and Bernhardt \[[@CR12]\] for the remaining taxa. Different seed banks adopt different taxonomic treatments that may vary in the number of (sub)species recognized. More comprehensive information about the used accessions, including the species names used in the donor seed bank and the country of origin is provided in Additional file [1](#MOESM1){ref-type="media"}: Table S1 Laboratory work {#Sec4} --------------- Flow-cytometric measurements were conducted to determine the ploidy level for all accessions. All analyses followed the protocol of Doležel et al. \[[@CR37]\] on a CyFlow Space flow cytometer (Partec). At least 7500 nuclei were counted. Only measurements with a coefficient of variation (CV) for sample and standard peak \<4% were accepted. Samples that recurrently produced CV values \>4% were repeated in Galbraith's buffer containing 1% polyvinylpyrrolidon (vol/vol) and 0.1% Triton X-100 (vol/vol). At least three measurements per species were carried out. If only a single accession of a species could be retrieved from a seed bank, its ploidy level was estimated three times. Samples of the same species were processed on at least two different days to account for instrument drifts. Genomic DNA was extracted either from 10 mg silica-dried leaves using the DNeasy Plant Mini Kit (Qiagen) or from 5 g of freeze-dried leaves using the cetyltrimethyl-ammonium bromide (CTAB) method \[[@CR38]\]. DNA quantifications were done using the Qubit dsDNA BR Assay (Life Technologies) or the Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) on a Tecan Infinite 200 microplate reader according to the manufactures instructions. The LE220 Focused-Ultrasonicator (Covaris) was used to shear 3 μg genomic DNA in 130 μl TE buffer for every sample into fragments having an average length of 400 bp with the following settings: instantaneous ultrasonic power (PIP) 450 W, duty factor (df) 30%, cycles per burst (cpb) 200. The treatment was applied for 100 s. The sheared DNA was used in a sequence-capture approach (SureSelect^XT^ Target Enrichment for Illumina Paired-End Sequencing, Agilent Technologies) targeting at 450 nuclear single-copy loci aiming for 0.01--0.02% of a Triticeae genome. Baits complementary to chloroplast *ndh*F based on 628 bp of available *Hordeum vulgare, Aegilops tauschii*, *Pseudoroegneria spicata, Triticum urartu* (identical to EF115541.1, JQ754651.1, KJ174105.1 and AF056180.1, respectively) and 2073 bp of *Brachypodium distachyon* (identical to AF251451.1) sequences were designed as well. The pairwise sequence identity was larger then 99% among Triticeae taxa and 96% when comparing the Triticeae taxa with *Brachypodium*. Baits were designed to cover the entire 2073 bp of *ndh*F as well as each polymorphism between the reference sequences at least five times. After the enrichment procedure all samples were barcoded and pooled (following \[[@CR39], [@CR40]\]) at equimolar ratios. Capture libraries were sequenced on the Illumina HiSeq 2000 or MiSeq. The flowcells were loaded aiming for a sequencing coverage of at least 40X. Data assembly {#Sec5} ------------- We used the captured *ndh*F and the off-target read fraction (i.e. reads for which no capture probes were designed in the target-enrichment experiment) to assemble whole chloroplast genomes. G[eneious]{.smallcaps} versions R8--R10 (Biomatters Ltd.) were used for quality control and downstream analyses. Read pairs were set with an average insert size of 300 bp and bases with an error probability above 5% were trimmed. Chloroplast genomes were assembled in a two-step procedure consisting of (1) the generating of a species-specific reference sequences followed by (2) the creation of individual-based chloroplast assemblies. In the first step we assembled species-specific chloroplast sequences by combining reads of multiple accessions of a single species. This increased the coverage for a species-specific chloroplast genome compared to the usage of data of an individual sample only. In a few cases single accessions were found to contribute a large amount of variation to these assemblies. These accessions were excluded from species-specific assemblies (Additional file [1](#MOESM1){ref-type="media"}: Table S1). The reads were either mapped to GenBank sequences of conspecific or closely related taxa (for *Aegilops*, *Hordeum* and *Triticum* species), or to *Hordeum vulgare* (EF115541), a well-studied basal organism in Triticeae, for taxa lacking conspecific chloroplast genomes in GenBank. One inverted repeat was cleaved off the GenBank sequences as no sequence variation has been found between the inverted repeats of the same chloroplast genome. A careful comparison of Triticeae chloroplast genomes available in GenBank showed a large amount of insertions and deletions (indels) among the sequences from single species. In case several chloroplast genomes per species were retrieved from GenBank, those were aligned and an annotated consensus was created as reference to check for intraspecific indels. Then a stringent read mapping approach was used that considered only reads with mates mapping in proper distance according to the insert size (±50%). This was done to avoid the inclusion of chimerical Illumina reads, which have been reported to occur frequently \[[@CR41]\]. All read mappings were performed using the G[eneious]{.smallcaps} mapper with five iterations, allowing at maximum 15% of mismatches per read and a maximum gap size of 1000 bp to encompass large deletions. The assembly results were compared and manually checked for inconsistencies (i.e. indels the assembler was unable to resolve). Consensus sequences were called using the 50% majority rule. Up to five rounds of mapping and inspection were performed, each time using the contig obtained previously. In the second step, for each sequenced individual chloroplast sequences were assembled by mapping all reads to their species-specific consensus sequence generated in step (1). Read mappings were performed using the G[eneious]{.smallcaps} mapper with five iterations, allowing at maximum 10% of mismatches per read and a maximum gap size of 100 bp. The assembly results were manually checked for inconsistencies. No global coverage threshold was applied as the read coverage for single accessions were relatively low. However, single nucleotide polymorphisms (SNPs) compared to the reference covered by a single read were masked. Finally consensus sequences were called using the 'Highest Quality' option, which is able to resolve conflicts between reads because it takes the relative residue quality into account. 'N' were called for positions without coverage. Whole chloroplast sequences with more than 50% missing data were excluded from further analyses. A multiple sequence alignment of the whole chloroplast genomes generated in step (2) plus a set of GenBank-derived sequences (Additional file [1](#MOESM1){ref-type="media"}: Table S1) was generated using M[afft]{.smallcaps} 7 (<http://mafft.cbrc.jp/alignment/software>; accessed in November 2016; \[[@CR42]\]) applying the auto algorithm in combination with the 'nwildcard' option. The alignment was manually curated. The sequences generated in the scope of this study were annotated by comparing them to the annotations of the GenBank accession number KJ592713 \[[@CR43]\] in G[eneious]{.smallcaps}. All sequences were submitted to GenBank (accession numbers KX591961-KX592154 and KY635999-KY636181). The number of parsimony-informative positions was inferred using PAUP\* 4.0b10 \[[@CR44]\]. Phylogenetic analyses {#Sec6} --------------------- We performed a Bayesian phylogenetic analysis for *ndh*F, as the sequence of this locus could be retrieved for all individuals without any missing data. First, unique *ndh*F haplotypes were identified using TCS 1.2.1 \[[@CR45]\]. The best-suited model of sequence evolution was identified on the data matrix of unique haplotypes with [j]{.smallcaps}M[odel]{.smallcaps}T[est]{.smallcaps} 2.1.4 \[[@CR46]\] using the default parameters. The Bayesian information criterion (BIC; \[[@CR47]\]) was selected for model choice because of its high accuracy \[[@CR46]\] and its tendency to favour simpler models than the Akaike information criterion (AIC; \[[@CR48]\]). Bayesian inference (BI) was performed in M[r]{.smallcaps}B[ayes]{.smallcaps} 3.2.6 \[[@CR49]\] using the model inferred by [j]{.smallcaps}M[odel]{.smallcaps}T[est]{.smallcaps}. BI consisted of four independent analyses each running for 20 million generations and sampling a tree every 1000 generations. BI of the whole chloroplast genome alignment were run with M[r]{.smallcaps}B[ayes]{.smallcaps} 3.2.6 on the CIPRES (Cyberinfrastructure for Phylogenetic Research) Science Gateway 3.3 \[[@CR50]\] for two datasets: (1) the complete alignment and (2) one alignment with positions having more than 50% of missing data being masked in G[eneious]{.smallcaps} version R10. The best-fitting models of sequence evolution were estimated by making the Monte Carlo Markov chain (MCMC) sampling across all substitution models (\[[@CR51]\]; 'lset nst = mixed'). For each dataset we performed three analyses, testing the impact of different rate settings, i.e. (1) a gamma-distributed rate variation, (2) a proportion of invariable sites and (3) with both combined to be able to identify the best-suited substitution model by comparing the posterior probabilities with AIC through MCMC (AICM; \[[@CR52]\]), which is less computing intensive though not as accurate as the application of Bayes factors \[[@CR53]\], in T[racer]{.smallcaps}. Each analysis was performed with two independent Metropolis coupled MCMC analyses each with four sequentially heated chains (temperature set to 0.05) until the standard deviation of split frequencies reached 0.009, a maximum of 10 million generations or the maximum runtime of CIPRES. Trees were sampled every 500 generations. For all Bayesian analyses conducted *Brachypodium distachyon* (EU325680) was set as outgroup and the convergence of the runs was assessed in T[racer]{.smallcaps} v. 1.6 \[[@CR54]\]. A consensus tree was computed after deleting a burn-in of the first 25% of trees. Additionally, a Bayes factor (BF; \[[@CR55]\]) analysis was carried out for the *ndh*F dataset to further evaluate the monophyly of Triticeae chloroplasts. Mean marginal log-likelihoods were computed using the stepping-stone sampling \[[@CR56]\] in M[r]{.smallcaps}B[ayes]{.smallcaps} 3.2.6 \[[@CR49]\] for monophyletic and polyphyletic relationships of Triticeae and the substitution model as identified in [j]{.smallcaps}M[odel]{.smallcaps}T[est]{.smallcaps}. Each analysis consisted of two million generations with four independent runs of four parallel chains. The BF was evaluated using ten as a cut-off value \[[@CR57]\]. Estimating divergence times using *trn*K-*mat*K, *rbc*L and *ndh*F {#Sec7} ------------------------------------------------------------------ We inferred a calibrated phylogeny for the three plastid loci *trn*K-*mat*K, *rbc*L and *ndh*F. First, we tested the robustness of the calibration of the most recent common ancestor (MRCA) of *Brachypodium* and Triticeae when increasing the sampling for Triticeae from 12 to 37 species compared to Marcussen et al. \[[@CR20]\]. For this a Bayesian coalescence analysis based on *trn*K-*mat*K, *rbc*L and *ndh*F for the subfamily Pooideae was performed. The same GenBank sequences were assembled to form a contiguous sequence as described and used in Marcussen et al. \[[@CR20]\]. This set of GenBank accessions was complemented with sequences assembled in this study whenever additional taxa or more sequence information from a certain taxon could be added. Following Marcussen et al. \[[@CR20]\] we restricted ourselves to one sequence per species. We used the species-specific sequences from step (1) of the sequence assembly procedure, over the selection of a single accession per taxon, comparable to Pelser et al. \[[@CR58]\]. This allowed us to employ all phylogenetic information available for a taxon and to overcome stretches of missing data. Conspecific sequences used for consensus inference showed 99.96 -- 100% of identical sites. The best partitioning schemes and DNA substitutions models were inferred with P[artition]{.smallcaps}F[inder]{.smallcaps} \[[@CR59], [@CR60]\] comparing all possible partitioning schemes. The analysis was carried out using the combination of age priors for analyses 2, 4, 6, 10 and 17 as published in Marcussen et al. \[[@CR20]\] in B[east]{.smallcaps} 2.4.1 \[[@CR61]\]. For each setting one replicate was performed. Priors on the root age were estimated as stem node ('use originate'). We found the divergence time of *Brachypodium* and Triticeae as inferred by Marcussen et al. \[[@CR20]\] to be robust. Second, we performed a multispecies coalescent (MSC) analysis using it as the secondary calibration point in million years ago (Ma) as normally distributed priors for the root of *Brachypodium*-Triticeae (mean 44.44 Ma ± 3.53) on *trn*K-*mat*K, *rbc*L and *ndh*F for all Triticeae accessions. We excluded gene sequences of *trn*K-*mat*K and *rbc*L if they showed more than 50% of missing data and sequences of all polyploid wheat accessions. Sequences of *Zea mays*, *Oryza sativa*, *Brachypodium distachyon* and two *Bromus* species were included as outgroup taxa. The taxa *Triticum monococcum* and *T. boeoticum*, *Secale cereale* and *S. vavilovii*, *Pseudoroegneria tauri* and *Ps*. *libanotica*, *Taeniatherum caput-medusae* and *Tae*. *crinitum*, *Agropyron cristatum* and *Agr. cimmericum* were each subsumed under the same species name (Additional file [1](#MOESM1){ref-type="media"}: Table S1), as no pronounced genetic variation were detected in the analysis of whole chloroplast sequences. Hereby we were following existing taxonomic treatments, which already unify these taxa under a single species name (see, e.g. \[[@CR62]\]). We performed MSC analyses for a dataset including *Psathyrostachys* and another one without it to evaluate the impact of this taxon on divergence times. Monophyly of Triticeae was not enforced for either analysis as suggested by the Bayes Factor analysis. For each dataset, first, the best partitioning schemes and DNA substitution models were inferred with P[artition]{.smallcaps}F[inder]{.smallcaps} searching all partitioning schemes. The analysis was run with the substitution models being linked, the Yule species tree prior, as well as the piecewise linear and constant root population model. Since the rate constancy was systematically rejected for all loci by the likelihood-ratio test \[[@CR63]\], an uncorrelated lognormal clock model (\[[@CR64]\]; uniform ucld.mean: min 0, max 0.01) was used. Trees were sampled every 5000 generations. Four independent analyses were performed and each was run for 600 million generations. All MSC analyses were run using the B[eagle]{.smallcaps} library \[[@CR65]\]. Effective sample sizes (ESS) and convergence of the analyses were assessed using T[racer]{.smallcaps} v. 1.6 \[[@CR54]\]. An appropriate burn-in was estimated from each trace file, and the four analyses were combined with L[og]{.smallcaps}C[ombiner]{.smallcaps} as part of the B[east]{.smallcaps} package. Then a maximum clade credibility (MCC) tree was summarised with T[ree]{.smallcaps}A[nnotator]{.smallcaps} and visualized with F[ig]{.smallcaps}T[ree]{.smallcaps} 1.4.2 \[[@CR66]\]. Results {#Sec8} ======= Ploidy levels {#Sec9} ------------- Flow cytometric measurements were performed for all accessions to be able to distinguish between different ploidy levels for accessions of the same species (Additional file [1](#MOESM1){ref-type="media"}: Table S1). We identified di- and tetraploid accession for *Agropyron cristatum, Eremopyrum bonaepartis, Pseudoroegneria stipifolia and Ps. strigosa*, and detected tetra- and hexaploid cytotypes for *Aegilops crassa* and *Ae. neglecta*. Flow cytometric measurements were used as additional information to confirm species affiliations \[[@CR67]\]. For example, comparing of the genome sizes measured for the diploid species *Thinopyrum bessarabicum* and *Th. elongatum* to the data from the Kew Angiosperm DNA C-values database revealed that the analysed accessions actually represent polyploids instead of diploids. For more information on problematic material from seed banks see Additional file [1](#MOESM1){ref-type="media"}: Table S1. Sequence assembly {#Sec10} ----------------- The target-enrichment protocol and Illumina sequencing were applied to 194 accessions, covering 53 species of 15 genera (dependent on the applied classificatory system) and three outgroup species (i.e. *Bromus* and *Brachypodium*, Table [1](#Tab1){ref-type="table"}, Additional file [1](#MOESM1){ref-type="media"}: Table S1). Whole chloroplast genomes were assembled in a two-step procedure via (1) an intermediate step of generating a species-specific reference if there was none available in GenBank and (2) the assembly of the chloroplast of each accession via read mapping to sequences from step (1). The average coverage of the chloroplast genome varies largely between single samples and depends mainly on the actual sequencing depth. Between approximately 50% and 90% of the reads mapping to the chloroplast mapped to *ndh*F (Additional file [2](#MOESM2){ref-type="media"}: Table S2), which was included in the bait design. Thus, the *ndh*F gene could be assembled for all accession without missing data. We identified 64 unique haplotypes when comparing the *ndh*F gene data plus the sequences downloaded from GenBank (Additional file [1](#MOESM1){ref-type="media"}: Table S1). The alignment of these 64 haplotypes had a total length of 2232 bp with 186 (8.3%) parsimony-informative sites. The entire alignment of whole chloroplast genome sequences comprised 222 sequences, 39 of them were downloaded from GenBank. This alignment ranged from *psb*A in the large single-copy region to partial *ndh*H in the small single-copy region and had a total length of 123,531 bp. It had 9064 (7.3%) parsimony-informative positions. The data matrix included 9.3% of missing data ('N'). These randomly distributed stretches of missing data occur in the alignment in regions where the sequencing coverage was insufficient. Additionally the matrix revealed 7.5% of gaps due to length variation between taxa. In several cases taxa showed long indels in intergenic regions, thus the same 900 bp deletion was found between *rpl*23 and *ndh*B in *Pseudoroegneria*, *Thinopyrum* and *Dasypyrum.* Many short indels (3--40 bp) were found in introns of coding genes (e.g. *ysf3*) and intergenic spacers. A variant of this alignment, having regions with 50% of missing data being removed, had a total length of 114,788 bp. In this case 8717 (7.6%) positions of the alignment were parsimony informative, while 9.2% of the characters were constituted by N's and 0.8% of gaps. Alignment masking mainly excluded regions of length variation due to short repeat motives in intergenic regions. With only few substitutions per chloroplast intraspecific variation was generally very low. The alignment revealed insertions unique to some GenBank sequences whose true occurrence could not be confirmed by our data: no reads from our analysed individuals mapped to these insertions. Moreover, BLAST searches of these regions returned mitochondrial and/or nuclear genomic data as best hit (e.g. KC912690, KC912692, KC912693, KC912694) indicating assembly artefacts. Those GenBank sequences were excluded from further analyses (Additional file [1](#MOESM1){ref-type="media"}: Table S1). Phylogenetic analyses {#Sec11} --------------------- We performed a BI analysis on the set of 64 unique *ndh*F haplotypes with the model of sequences substitution set to GTR + G \[[@CR68], [@CR69]\], as identified by [j]{.smallcaps}M[odel]{.smallcaps}T[est]{.smallcaps}. The phylogenetic tree obtained from *ndh*F (Fig. [1](#Fig1){ref-type="fig"}) shows Triticeae to be paraphyletic, as the lineage of *Psathyrostachys* appears to have diverged before the lineage of *Bromus*, although the position of *Bromus* is with a posterior probability (pp) of 0.88 not well supported. The branch lengths for the *Bromus* group are considerably longer compared to *Psathyrostachys*. The topology shows that individuals of most species and/or genera form monophyletic groups. However, *Eremopyrum bonaepartis* is polyphyletic, as the diploid plastid type of *E. bonaepartis* groups as sister to *Henrardia persica*, while the haplotypes of all tetraploid *E. bonaepartis* and diploid *E. triticeum* form a clade with *Agropyron cristatum*. A common maternal ancestor can be hypothesized for *Agropyron*, *Australopyrum*, *Eremopyrum* and *Henrardia* as these taxa form a well supported clade, which is sister to the clade of *Hordeum* species. The clades formed by the genera *Heteranthelium*, *Secale* and *Taeniatherum* are placed on a polytomy together with a clade formed by taxa having a **B**, **G** or **S** genome \[i.e. *Aegilops speltoides* (**S**) and all polyploid *Triticum* taxa (**B**/**G**)\], the clade of taxa with an **E**, **St** or **V** genome (i.e. *Thinopyrum*, *Pseudoroegneria* and *Dasypyrum*), and the clade of all remaining *Aegilops*, *Amblyopyrum* and diploid *Triticum* taxa. *Pseudoroegneria* appears paraphyletic, as *Dasypyrum* and *Thinopyrum* haplotypes group within this clade. The backbone of this clade represents a polytomy. Notably the placement of the otherwise monophyletic *Dasypyrum* is not supported. Several different haplotypes can be distinguished for various species of *Pseudoroegneria* itself (e.g. *Ps. spicata*, *Ps. strigosa*, *Ps. tauri*, *Ps. stipifolia*). Furthermore, the two **A**-genome species *Triticum urartu* and *T. monococcum* are monophyletic. Also all **D**-genome species (i.e. *Ae. tauschii*, *Ae. cylindrica* and *Ae. ventricosa*) form a clade. Both genomic groups are located on a polytomy together with the remaining *Aegilops* species and *Amblyopyrum*. *Aegilops crassa* and *Ae. juvenalis* (**D'**) group apart from the other **D** taxa and show a *ndh*F haplotype with less nucleotide differences to **S\*** than to **D** chloroplast lineages (i.e. one SNP difference to **S\*** vs. three and five SNPs to **D**). All diploid and polyploid **S\*** species sequenced in the scope of this study share the same *ndh*F haplotype. *Aegilops comosa* (**M**) and *Ae. uniaristata* (**N**) are sister species. All **U**-genome taxa fall into the same clade together with *Aegilops geniculata* (**M°**) and *Amblyopyrum muticum* (**T**). *Aegilops triuncialis* accessions possess **U** as well as **C** haplotypes.Fig. 1Phylogenetic tree derived from 2232 bp of the chloroplast locus *ndh*F and Bayesian inference. The multiple sequence alignment consisted of 64 unique haplotypes that originated from 194 accessions sequenced in the scope of this study and 41 sequences retrieved from GenBank. *Brachypodium distachyon* was set as outgroup taxon. Posterior probabilities (pp) for the main clades are depicted next to the nodes if they were higher then 0.75. Each unique haplotype is named with a distinctive identifier. For detailed information which accession possesses which haplotype and species synonyms see Additional file [1](#MOESM1){ref-type="media"}: Table S1. The ploidy level is indicated behind taxon labels. If there are multiple accessions per taxon sharing the same haplotype, the number of accessions is provided behind the taxon label. Single accessions grouping apart from other accessions of their taxon are marked with an *asterisk*. To the right the genomic groups are shown*. Arrows* with support values indicate the nodes they refer to Sometimes, single accessions of a species group within the otherwise monophyletic clade of another species. Thus, the accession AE_1831 of *Aegilops markgrafii* (**C**) falls into the clade of *Amblyopyrum muticum* (**T**) while KP_2012_119 of *Aegilops biuncialis* (**U**) falls within *Ae. geniculata* (**M°**). The accession AE_586 of *Aegilops neglecta* (**U**) groups together with *Ae. markgrafii* (**C**). Further, intraspecific variation within *ndh*F was found in several cases, for example, for *Aegilops comosa*, *Ae. speltoides, Amblyopyrum muticum*, and *Dasypyrum villosum.* With a score of 36.4, BF strongly favours Triticeae chloroplasts as paraphyletic (Additional file [3](#MOESM3){ref-type="media"}: Table S3) when *Psathyrostachys* is included in the analysis. As the resolution of the phylogenetic tree from the *ndh*F dataset is not sufficient to distinguish between more recently diverged taxa, the whole chloroplast genome dataset was phylogenetically analysed by BI using an alignment of the entire chloroplast genomes and a variant of it were positions having more then 50% of missing data have been masked. In both cases M[r]{.smallcaps}B[ayes]{.smallcaps} revealed a *gtrsubmodel* in combination with gamma-distributed rate variations as best-suited substitution model. The topologies (Fig. [2](#Fig2){ref-type="fig"}, Additional file [4](#MOESM4){ref-type="media"}: Figure S1) returned from both analyses are mainly congruent to each other and to the *ndh*F tree. However, nodes of deep splits supported moderately for the complete plastid data matrix show higher support in the dataset where low-covered regions have been masked. This is, for example, the case for the split of the ancestor of *Bromus.* The branch length differences between *Bromus* and *Psathyrostachys* are in agreement with the *ndh*F tree. In contrast to the *ndh*F dataset, the whole chloroplast phylogenies are able to provide a hypothesis of the relationships between all major genomic groups. They suggest that the **E**, **St**, and **V** clade (i.e. *Thinopyrum*, *Pseudoroegneria* and *Dasypyrum*) diverged before *Heteranthelium*, which in turn split before *Secale* and *Taeniatherum. Pseudoroegneria spicata* forms its own clade that diverged first from *Dasypyrum* and the remaining taxa within this clade. However, the *Dasypyrum* chloroplast genomes are characterized by rather long branches compared to other taxa in this clade. Furthermore, *Dasypyrum* comprises two well-differentiated haplotypes. *Aegilops speltoides* and the polyploid wheat species form three groups: (1) most *Ae. speltoides* accession form a clade of their own (**S**), (2) some *Ae. speltoides* accessions group together with *Triticum timopheevii*, *T. zhukovskyi* and the artificially synthesized wheat *T. kiharae* (**G**) and (3) all accessions of *T. turgidum* and *T. aestivum* share the same haplotype (**B**). The not supported placement of one *Ae. speltoides* accession (PI_48721) close to the **S** group, shifts to a supported position in the **G** group when regions with an high extent of missing data were masked. Additionally, the usage of entire chloroplast genomes resolves that diploid *Triticum* species (**A**) diverged before the **D**-genome taxa and the remaining *Aegilops* species and *Amblyopyrum*. The phylogeny also indicates that **D'** is closely related but distinct from **D**. Further, **M°**, **T** and **U** taxa form a clade, that diverged before the split of taxa having a **C**, **N**, **M** or **S\*** genome. Within this clade the sister species relationship of *Aegilops comosa* and *Ae. uniaristata* is confirmed. *Aegilops comosa* (**M**) groups distinct from the other **M°** plastid type. The species *Ae. searsii*, *Ae. bicornis*, *Ae. longissima*, *Ae. sharonensis* form a clade together with the polyploid *Ae. kotschyi* and *Ae. peregrina* (**S\***) indicating only very little sequence variation. Concordant to the *ndh*F tree, one sequence each of *Ae. markgrafii* (AE_1831), *Ae. biuncialis* (KP_2012_119) and *Ae. neglecta* (AE_586) group apart from the other sequences of their respective taxon.Fig. 2Phylogenetic tree derived from an alignment of whole genome chloroplast sequences via Bayesian phylogenetic inference. The multiple sequence alignment comprised 183 genomes assembled in the present study and 39 genomes that were downloaded from GenBank. *Brachypodium distachyon* was defined as outgroup taxon. The tree shown corresponds to an analysis based on the complete alignment of 123,531 base pairs (bp). Clades were collapsed into triangles to reflect the main groupings. The area of the *triangles* reflects the genetic variation contained in a certain clade. Posterior probabilities (pp) for the main clades are depicted next to the nodes if they were higher then 0.75. Support values of a second Bayesian phylogenetic analysis based on 114,788 bp of whole chloroplast genomes, where alignment positions with more than 50% of missing data were masked, are shown below the values of the corresponding nodes in the complete chloroplast analysis if the values differed between analyses. Ploidy levels are provided in brackets after the taxon labels. Single accessions grouping apart from other accessions of their taxon are highlighted with an *asterisk*. To the *right* the genomic groups are indicated. The *red circle* represents the secondary calibration point from Marcussen et al. \[[@CR20]\] used for node calibrations in multispecies coalescent analyses (MSC). Major nodes are shown in *blue* and their estimated ages in million years are given in the *box*. Two age values for the same node correspond to the analysis with (first value) and without the inclusion of *Psathyrostachys* (second value). For more information on the results of the MSC analyses see Additional file [5](#MOESM5){ref-type="media"}: Figure S2 and Additional file [6](#MOESM6){ref-type="media"}: Figure S3. For the full representation of the tree showing the grouping of all single accessions see Additional file [4](#MOESM4){ref-type="media"}: Figure S1. For species synonyms see Additional file [1](#MOESM1){ref-type="media"}: Table S1. Arrows with support values indicate the nodes they refer to Ages of clades {#Sec12} -------------- Divergence times were estimated based of *trn*K-*mat*K, *rbc*L and *ndh*F sequences for each accession included in the study and using an uncorrelated lognormal clock model and a secondary calibration on the MRCA of *Brachypodium distachyon* and Triticeae in \*BEAST. Different ages for the split of Triticeae and *Bromus* were obtained depending on the in- or exclusion of the genus *Psathyrostachys*. Including *Psathyrostachys*, Triticeae are paraphyletic and the ages are slightly older but with larger and overlapping 95% highest-posterior densities (HPD) compared to the dataset that does not comprise *Psathyrostachys* (Additional file [5](#MOESM5){ref-type="media"}: Figure S2, Additional file [6](#MOESM6){ref-type="media"}: Figure S3). In the analysis including *Psathyrostachys* the most recent common ancestor (MRCA) of Triticeae and *Bromus* occurred approximately 19.44 Ma (95% HPD = 12.66-27.20). The split of *Bromus* and the remaining Triticeae (termed "core Triticeae") occurred approximately 15.77 Ma (95% HPD = 9.38-22.75). The age of this split does not seem affected by the absence of *Psathyrostachys* (15.41 Ma, 95% HPD = 10.72-20.83). However, the MRCA of the core Triticeae occurred approximately 12.17 Ma (95% HPD = 7.65-17.44) including *Psathyrostachys* and nearly 2.5 million years later (9.68 Ma, 95% HPD = 7.42-12.21) in the analysis omitting this early diverging lineage. The MRCA of *Aegilops*, *Triticum* and *Amblyopyrum* (plus *Taeniatherum*) occurred around 4.14 Ma (95% HPD = 2.48-6.44) including *Psathyrostachys* and 3.38 Ma (95% HPD = 2.35-4.47), when omitting it. Discussion {#Sec13} ========== Plant materials {#Sec14} --------------- The analysed accessions were mainly acquired from several seed banks (i.e. ICARDA, IPK, USDA, the Czech Crop Research Institute) but additional material was collected during field trips. Multiple accessions per species and intra-specific entities were selected to be able to detect intraspecific genetic variability. The performance of genome size measurements allowed the distinction of ploidy level differences for accessions of the same species. Our finding of different ploidy levels within *Agropyron cristatum*, *Eremopyrum bonaepartis*, *Pseudoroegneria strigosa, Aegilops crassa* and *Ae. neglecta* are in agreement with previous work \[[@CR70]--[@CR74]\]. For the first time we report the occurrence of different ploidy levels for *Pseudoroegneria stipifolia*. Few accessions have been found having unexpected genome sizes, like in *Thinopyrum*. Concerns about the condition of seed bank material have been raised in other studies and are related to the fact that it is often maintained under conditions that permit open pollination over several rounds of seed replication \[[@CR75], [@CR76]\]. As Triticeae show species-specific genome sizes \[[@CR67], [@CR77], [@CR78]\] the performance of flow cytometric measurements is a good strategy to detect problematic material, especially in the case of perennial Triticeae where inflorescences for morphological species determination cannot always be obtained within the timeframe of a research project. Also in this study, a few selected accessions needed to be excluded due to deviations in genome size or morphological characters. However, the vast majority of the material did not reveal any peculiarities and samples directly collected in the wild always grouped with other samples of the same species. Sequence assembly {#Sec15} ----------------- In this study we assembled the chloroplast *ndh*F gene and complete chloroplast genomes using for the latter off-target sequence reads of a target-enrichment approach and NGS sequencing for a comprehensive set of Triticeae taxa. The *ndh*F gene could be assembled for 194 accessions representing 53 Triticeae and three outgroup species without missing data, as it was included in the bait design for sequence enrichment. We obtained a set of 183 whole chloroplast genome sequences that provide new plastid genomes of 36 Triticeae species out of 15 genera for which so far no such sequence was available. From these data we estimated the maternal relationships within Triticeae. In previous studies off-target reads have been successfully analysed in diverse organism groups \[[@CR36], [@CR79]--[@CR82]\]. Because the chloroplast occurs in high copy number in the cells, it constitutes the main fraction of off-target reads in target-enrichment approaches in plants. Therefore the majority of reads identified as chloroplast DNA originated most probably from this genome and not from parts that were transferred from the chloroplast to the nuclear genome, which should be rare in off-target reads. The pooling of samples from multiple conspecific individuals allowed us to overcome the low coverage for individual samples and to assemble chloroplast genomes to be used as taxon-specific reference for the assembly of individual chloroplast genomes for accessions for which no conspecific reference was available in GenBank. Stretches of missing data remain in the final individual-based assemblies of the plastid genomes. As these stretches occur randomly along the chromosome, they do not influence the detection of structural differences (indels) between chloroplast genomes of species and/or genera. Generally, indels and base substitutions occur mostly in spacer regions of the Triticeae chloroplast genomes. An increase in sequencing depth may have allowed assembling the chloroplast genomes of all individuals without any missing data. However, the comparison of accessions sequenced with different depths shows that overall higher sequencing coverage will not guarantee a complete chloroplast sequence, as off-target regions are randomly (or not) retained during the enrichment process. The most problematic part in assembling the reads was to reach confidence about the detected indel positions, as the short read length of 2 × 100 bp of the Illumina platform did not always cover such regions completely. The whole genome sequences we provide were carefully checked manually and compared to available sequences in GenBank. Comparable to other studies (e.g. \[[@CR32], [@CR43]\]) we were not able to confirm all parts of GenBank-derived sequences obtained from whole-genome shotgun sequencing. It might be that they contain some non-identified assembly errors. With the now available longer Illumina paired-end reads of 2 × 250 bp these problems should become less severe in future studies. Finally, the topologies validated our assembly procedure, as previously published GenBank sequences always grouped in their respective clades irrespective of the small differences found. Maternal phylogeny of Triticeae {#Sec16} ------------------------------- In this work we aimed for a molecular phylogeny of the chloroplast lineages in Triticeae. The results from *ndh*F and whole chloroplast genome phylogenetic analyses are mainly in agreement with hypotheses previously published for groups within the tribe \[[@CR9], [@CR26], [@CR83]\] and with respect to the domesticated wheats and their close relatives \[[@CR30], [@CR31], [@CR84]\]. Compared to these latter publications a better understanding was obtained, particularly because of the comprehensive taxon sampling, the usage of whole chloroplast genomes, and the inclusion of multiple individuals per species. The tribe Triticeae is generally accepted to be monophyletic \[[@CR22], [@CR23], [@CR85]--[@CR87]\] with *Bromus*, the only genus in the tribe Bromeae, being the sistergroup to all Triticeae \[[@CR88], [@CR89]\]. However, based on our data, but also previously published chloroplast data \[[@CR26], [@CR35], [@CR90]\], the monophyly of Triticeae was either rejected or not supported. As morphology \[[@CR23]\] and also phylogenies based on nuclear data place *Psathyrostachys* at the base of Triticeae close to *Hordeum* (\[[@CR10]\]; own unpublished data), we see two possibilities to explain the chloroplast phylogeny. Thus, either *Psathyrostachys* obtained the chloroplast of a close and nowadays extinct relative belonging to the ancestral Triticeae-Bromeae gene pool, or vice versa an ancestor belonging to the *Bromus* stem group obtained a chloroplast from early Triticeae. In any case, a chloroplast phylogeny including *Bromus* and *Psathyrostachys* might not reflect Triticeae relationships very well, at least for its basal groups, and will also influence the outcome of molecular dating approaches (see below). The retrieved chloroplast phylogeny indicates a common maternal ancestor for the genera *Australopyrum*, *Eremopyrum*, *Agropyron* and *Henrardia*, with *Eremopyrum*, *Agropyron* and *Henrardia* currently having overlapping distribution areas in southern Europe and western Asia. The monogenomic genus *Australopyrum* (**W**) and all allopolyploid taxa possessing a **W** genome (*Stenostachys* - **HW**, *Anthosachne* - **StYW**, *Connorochloa* -- **StYHW**; taxa not sampled) are endemic to dry and temperate Australasia \[[@CR91]\]. This supports speciation in allopatry after long-distance dispersal of an *Australopyrum* progenitor and likely recurrent formation of allopolyploid taxa involving numerous other Triticeae species in Australasia. A sister relationship between the species of *Agropyron* and *Eremopyrum* has also been proposed by other studies. However, when *Eremopyrum bonaepartis* was included, *Eremopyrum* became polyphyletic with the diploid cytotype being sister to *Henrardia*. This is in agreement with earlier findings \[[@CR10], [@CR92], [@CR93]\]. Similar to Mason-Gamer \[[@CR83]\] we found that *Pseudoroegneria*, *Dasypyrum* and *Thinopyrum* form a monophyletic clade indicating that they belong to the same maternal lineage. A sister relationship of *Pseudoroegneria* and *Dasypyrum* has been proposed recently by Escobar et al. \[[@CR10]\] based on nuclear data. In our dataset *Dasypyrum* groups however within *Pseudoroegneria*. Within *Dasypyrum*, accessions from Bulgaria and Italy cluster together, while material from Turkey and Greece form another sub-clade. Hence, this pattern may indicate some recent local differentiation. The polyphyletic grouping of *Thinopyrum* within this clade can be explained either by incomplete lineage sorting (ILS) or because *Thinopyrum* repeatedly captured different plastid types of *Pseudoroegneria.* A close relationship to the *Aegilops*-*Triticum*-*Amblyopyrum* group has been reported for *Thinopyrum* based on nuclear data \[[@CR3], [@CR83], [@CR93]--[@CR95]\]. This incongruence might be explained by the fact that *Thinopyrum*, but also *Dasypyrum* and *Pseudoroegneria* are outcrossing taxa \[[@CR10], [@CR96]\], which seems to increase the chance of chloroplast capture via hybridization and back-crossing \[[@CR25]\]. Moreover, most taxa have overlapping distribution areas in the Caucasus region, also facilitating hybridization. Our results revealed no major sequence variation among chloroplast genomes of *Secale strictum* and *S. cereale*/*S. vavilovii*. This points to an only recent diversification within this genus. It is well known that the species of *Triticum*, *Aegilops* and *Amblyopyrum muticum* are closely related and of rather recent origin \[[@CR7], [@CR10], [@CR20], [@CR26]\]. To date, there is no general agreement on how taxa within this species complex are related to each other, even at the diploid level. There is an on-going dispute if *Aegilops* and *Triticum* should be merged into one genus, and if *Amblyopyrum muticum* should be included into *Aegilops* \[[@CR74], [@CR84], [@CR97]--[@CR99]\]. In agreement with Bordbar et al. \[[@CR9]\], the chloroplast phylogeny revealed that *Am. muticum* possesses a chloroplast genome similar to the **M** and **U** genome groups, although based on nuclear data *Am. muticum* appears to be sister to all *Aegilops* and *Triticum* species \[[@CR7]\]. The *Aegilops*-like chloroplast genome of *Am. muticum* might be explained by the existence of a common ancestor and therefore a chloroplast genome already shared before divergence of these lineages. Alternatively, it may indicate that it captured the chloroplast from one of these species or their MRCA, which is geographically possible, as distribution areas overlap in Turkey and Armenia. Polyploid *Triticum* species and *Aegilops speltoides* formed a clade supporting that *Ae. speltoides* is the maternal donor of polyploid wheat genomes. The relationships within this clade corroborate the hypothesis that two different *Ae. speltoides* lineages were involved in their formation \[[@CR30], [@CR74], [@CR100], [@CR101]\]. The direct maternal donor for *Triticum timopheevii* and *T. zhukovskyi* (**G**) could be identified, as they share the chloroplast haplotype of three *Ae. speltoides* accessions originating from Iraq and Syria. However the donor remains uncertain for *Triticum turgidum* and *T. aestivum* (**B**), indicating that either our sampling of *Ae. speltoides* was not sufficient to cover the species diversity or pointing to a nowadays extinct donor lineage. Alternatively, Gornicki et al. \[[@CR30]\] suggested, that tetraploidisation within this clade predates the one of *T. timopheevii*. All taxa of the genus *Triticum* s.str. Fall into one clade together with *Aegilops* and *Amblyopyrum*. *Triticum* taxa that were elevated to species rank by Dorofeev et al. \[[@CR102]\] could not be distinguished on the basis of their chloroplast haplotypes, which supports the taxonomic treatment of van Slageren \[[@CR97]\] subsuming them under the same species name (Additional file [1](#MOESM1){ref-type="media"}: Table S1). Based on chloroplast data and supported by the findings of Petersen et al. \[[@CR7]\] and Li et al. \[[@CR84]\], *Ae. speltoides* (**S**) appears to be the species that diverged earliest from all other *Aegilops* species. Generally the wheat group is characterized by short branch lengths and plastid haplotypes shared by multiple species. This is most probably due to the only recent divergence of these species. Chloroplast capture as indicator of hybridization events {#Sec17} -------------------------------------------------------- The exchange of chloroplasts among closely related plant species has been reported in diverse plant groups and the effect of hybridization on Triticeae taxa is a matter of discussion. For example, a homoploid hybrid origin of the **D**-genome lineage involving the **A**- and **B**-genome lineages is the subject of a recent dispute \[[@CR20], [@CR84], [@CR98], [@CR99]\]. However, our and previous studies \[[@CR30], [@CR31], [@CR84]\] revealed three independent but closely related chloroplast lineages with plastids of the **A**-genome lineage being more closely related to the ones of the **D** genome, which can be explained by consecutive divergence. Hence, if such a hybridization event occurred it only affected the nuclear genome. Although recent publications agree that the detection of hybridization events depends mainly on taxon sampling \[[@CR19]\], so far all postulated hypotheses for Triticeae are based on a limited choice of taxa. In our study, three possible cases of ancient chloroplast captures were identified, i.e. for (1) *Bromus*/*Psathyrostachys*, (2) *Thinopyrum* and (3) *Amblyopyrum*, as the chloroplast phylogeny looks considerably different from phylogenies retrieved from nuclear data \[[@CR7], [@CR83]\]. More recent events of chloroplast captures were identified for single accessions of the species *Aegilops biuncialis*, *Ae. markgrafii*, *Ae. neglecta* and *Ae. triuncialis* that grouped within clades of other closely related species. We assume such hybridization events to occur frequently between various taxa of the wheat group due to incomplete reproductive isolation among these young species. Ages of clades {#Sec18} -------------- To obtain dated phylogenies of Triticeae we used the split of *Brachypodium* and Triticeae as secondary calibration point \[[@CR20]\] based on *trn*K-*mat*K, *rbc*L and *ndh*F sequences. Pros and cons of using chloroplast data for the estimation of divergence times were already discussed by Middleton et al. \[[@CR31]\] who argued that splits of chloroplast lineages might be older than the respective species, resulting in overestimated taxon ages for medium-aged and young clades. For dating in Triticeae we see an additional concern using chloroplast data. Due to mostly low substitution rates in plastid genomes \[[@CR103]\] also underestimation of ages is possible in young clades, as fixation of mutations occur as a stochastic process \[[@CR30], [@CR104], [@CR105]\] that might be slower than species diversification. In these cases already well-diverged taxa might still possess very similar or identical chloroplast haplotypes \[[@CR106]\], resulting in lower age estimations in comparison to nuclear data. This might be the case for many nodes of our tree, although the divergence times retrieved for the main splits are generally about 1 million years older than the ones obtained by Middleton et al. \[[@CR31]\]. Our analyses suggest the occurrence of a MRCA for the *Aegilops*/*Triticum* group at approximately 4 Ma, while divergence times of this complex were proposed to date back to approximately 3 Ma \[[@CR31]\] or 6.55 Ma based on a dataset of five nuclear and one plastid gene \[[@CR20]\]. Another critical topic regarding chloroplast-based dating in Triticeae results from the chloroplast data of *Psathyrostachys*. Our results support the hypothesis that the chloroplast of either *P. juncea* or a *Bromus* ancestor was obtained through chloroplast capture from a taxon belonging the *Bromus*/Triticeae stem lineage, resulting in *P. juncea* clearly falling outside the otherwise monophyletic Triticeae. We strongly favour an event of chloroplast capture over ILS as the cause for the observed relationships. The pronounced sequence variation between *Bromus*, *Psathyrostachys* and the remaining Triticeae for entire chloroplast genomes is best explained by strong and independent sequence divergence of *Bromus* and *Psathyrostachys* compared to the remaining Triticeae. Moreover, in case ILS represents the reason for the observed relationships our coalescent-analyses should have returned the same age for the MRCA of Triticeae-Bromeae with and without the inclusion of *Psathyrostachys*. However, we obtained age estimations that differed by approximately 4 million years. As the direction of chloroplast capture remains unknown, we estimate the MRCA of all Triticeae to an age of between 10 and 19 million years. When comparing in- vs. exclusion of *P. juncea* the age estimations for all clades are robust, as they fall generally within the 95% HPD (Additional file: 5: Figure S2, Additional file [6](#MOESM6){ref-type="media"}: Figure S3). Conclusions {#Sec19} =========== We assembled chloroplast sequence data of a large set of monogenomic Triticeae and polyploid wheats by combining on- as well as off-target reads of a sequence-capture approach coupled with Illumina sequencing. This approach allowed us to produce a set of 183 Triticeae chloroplast genomes. These sequences provide new plastid genomes for 39 Triticeae, two *Bromus* and one *Brachypodium* species. Moreover, the data was used to estimate the most comprehensive hypothesis of relationships among Triticeae chloroplast lineages to date. We infer that an early event of chloroplast capture was involved in the evolution of *Psathyrostachys* or *Bromus*. Either *Psathyrostachys* or *Bromus* obtained a chloroplast from a taxon closely related to a common ancestor of the Triticeae-Bromeae lineage that diverged approximately 19.44 Ma, as the *Psathyrostachys* chloroplast haplotype groups at a deeper node than *Bromus* in our whole-genome phylogeny. We can, however, not safely determine the direction of chloroplast exchange in this case, as this would need the inclusion of much more Bromeae species. We identified taxa that share the same maternal lineage (e.g. *Agropyron*, *Eremopyrum* and *Heteranthelium*; *Pseudoroegneria* and *Dasypyrum*). Conflicts to nuclear phylogenies (i.e. the grouping of *Thinopyrum*, *Amblyopyrum*) likely indicate old events of chloroplast introgression, while some cases of pronounced intraspecific variation could be attributed to recent events of hybridization, as foreign chloroplast types grouped within otherwise monophyletic species groups (i.e. *Ae. biuncialis* and *Ae. markgrafii*, *Ae. neglecta*). As plastids are maternally inherited in these grasses, they provide supplementary information to nuclear data. For example, the plastid data indicate the polyphyly of *Eremopyrum*. Moreover, the possession of an *Aegilops*-like chloroplast type of *Amblyopyrum* might reject a taxonomic treatment completely separate from *Aegilops*. Hence, plastid data can facilitate understanding Triticeae evolution, which in turn is crucial on the way to a robust taxonomic system for the entire tribe of Triticeae. However, plastid phylogenies will never be able to infer all hybridization events involved in speciation, e.g. when nuclear genomes got introgressed while chloroplast lineages remains unaffected. Additional files ================ {#Sec20} Additional file 1: Table S1.Accessions considered in the study. Overview of the material considered in this study. For all materials, the GenBank identifier, the accession and species name as used in this study (Species) as well as their species synonyms used in the donor seed banks or in the NCBI GenBank (Material source/Reference) are provided. The genome symbol, and the country of origin, where the material was originally collected are given. The ploidy level measured in the scope of this study and the information if a herbarium voucher could be deposited in the herbarium of IPK Gatersleben (GAT) is given. Genomic formulas of tetraploids and hexploids are given as "female x male parent". The genomes of *Aegilops* taxa follow Kilian et al. \[[@CR74]\] and Li et al. \[[@CR84]\]. Genome denominations for *Hordeum* follow Blattner \[[@CR107]\] and Bernhardt \[[@CR12]\] for the remaining taxa. (XLS 84 kb) Additional file 2: Table S2.Read numbers mapping to the complete chloroplast sequences and *ndh*F. Number of reads mapping and mean coverage for the entire chloroplast genome and *ndh*F after the removal of duplicated reads. Also the proportions of all reads mapping to the chloroplast that mapped to *ndh*F are given. (XLS 66 kb) Additional file 3: Table S3.Marginal likelihoods and Bayes factor evaluation of Triticeae chloroplast relationships. Stepping-stone estimates of marginal likelihoods calculated with M[r]{.smallcaps}B[ayes]{.smallcaps} 3.2.6 on the *ndh*F dataset and Bayes factor estimated as 2(H~1~-H~2~), where H~1~ enforces monophyly and H~2~ enforces polyphyly of Triticeae chloroplasts. BF~12~ \< −10 indicates strong support for model 2. (DOC 27 kb) Additional file 4: Figure S1.Full representation of the Bayesian phylogenetic tree based on whole chloroplast genome sequences. The multiple sequence alignment comprised 183 genomes assembled in the present study and 39 genomes that were downloaded from GenBank. *Brachypodium distachyon* was used as outgroup taxon. The tree shown is based on the complete alignment of 123,531 base pairs (bp). Posterior probabilities (pp) for the main clades are depicted next to the nodes if they were higher then 0.75. Support values of a second Bayesian analysis based on 114,788 bp of whole chloroplast genomes were alignment positions with more than 50% of missing data were masked are shown below the values of the corresponding nodes in the complete chloroplast analysis if the values differed between analyses. For clades comprising multiple taxa, the taxon affiliation of single accession is indicated by the same symbols behind accession and taxon name (e.g. ';", \*). The ploidy level is provided in brackets after the taxon label. Single accessions grouping apart from other accessions of their taxon are shown in bold. To the right the genomic groups are indicated. The red circle represents the secondary calibration point from Marcussen et al. \[[@CR20]\] used for node calibrations in multispecies coalescent analyses (MSC). Major nodes are shown in blue. Their estimated ages in million years are given in the box. Two age values for the same node correspond to the analysis with *Psathyrostachys* (first value) and without it (second value). For more information on the results of the MSC analyses see Additional file [5](#MOESM5){ref-type="media"}: Figure S2 and Additional file [6](#MOESM6){ref-type="media"}: Figure S3. For the full representation of the tree showing the grouping of all single accessions see Additional file [4](#MOESM4){ref-type="media"}: Figure S1. For species synonyms see Additional file [1](#MOESM1){ref-type="media"}: Table S1. Arrows with support values indicate the nodes they refer to. (PDF 555 kb) Additional file 5: Figure S2.Calibrated species trees based on *trn*K-*mat*K, *rbc*L, and *ndh*F including *Psathyrostachys*. Calibrated multispecies coalescent derived from three chloroplast loci t*rn*K-*mat*K, *rbc*L and *ndh*F of all Triticeae accessions (excluding polyploid wheats). Sequences of *Brachypodium distachyon*, *Oryza sativa* and *Zea mays* were included as outgroups. Posterior probability values are given for all nodes. Divergence time estimates were inferred using the secondary calibration points from Marcussen et al. \[[@CR20]\] for the *Brachypodium*-Triticeae split (mean 44.44 million years ago). Node bars indicate the age range with 95% interval of the highest probability density. For the analysis *Triticum monococcum* and *T. boeoticum*, *Secale cereale* and *S. vavilovii*, *Pseudoroegneria tauri* and *Ps*. *libanotica*, *Taeniatherum caput-medusae* and *Tae*. *crinitum*, *Agropyron cristatum* and *Agr. cimmericum* were each subsumed under a single species name (Additional file [1](#MOESM1){ref-type="media"}: Table S1). (JPEG 1085 kb) Additional file 6: Figure S3.Calibrated species trees based on *trn*K-*mat*K, *rbc*L, and *ndh*F omitting *Psathyrostachys*. Calibrated multispecies coalescent derived from three chloroplast loci t*rn*K-*mat*K, *rbc*L and *ndh*F considering all genomic Triticeae groups covered in the study but omitting *Psathyrostachys* and polyploid wheats. Sequences of *Brachypodium distachyon*, *Oryza sativa* and *Zea mays* were included as outgroups. Posterior probability values are given for all nodes. Divergence time estimates were inferred using the secondary calibration points from Marcussen et al. \[[@CR20]\] for the *Brachypodium*-Triticeae split (mean 44.44 million years ago). Node bars indicate the age range with 95% interval of the highest probability density. For the analysis *Triticum monococcum* and *T. boeoticum*, *Secale cereale* and *S. vavilovii*, *Pseudoroegneria tauri* and *Ps*. *libanotica*, *Taeniatherum caput-medusae* and *Tae*. *crinitum*, *Agropyron cristatum* and *Agr. cimmericum* were each subsumed under a single species name (Additional file [1](#MOESM1){ref-type="media"}: Table S1). (JPEG 1082 kb) **Electronic supplementary material** The online version of this article (doi:10.1186/s12862-017-0989-9) contains supplementary material, which is available to authorized users. We like to thank E-M Willing and K Schneeberger for designing the *ndh*F baits, R Brandt for performing the Illumina sequencing, and C Koch and B Wedemeier for technical assistance. We are grateful for seeds obtained from ICARDA, IPK, USDA, the Czech Crop Research Institute, and the Kyoto University Laboratory of Plant Genetics. We also thank JM Saarela and two anonymous reviewers for helpful comments on earlier versions of the manuscript. Funding {#FPar2} ======= This work was supported by the German Research Foundation (DFG) \[BL462/10\]. Availability of data and materials {#FPar3} ================================== All sequences were submitted to GenBank (accession numbers KX591961-KX592154, KY635999-KY636181). The datasets supporting the results of this article are available on Dryad Digital Repository through doi:10.5061/dryad.25743. Authors' contributions {#FPar1} ====================== NB, FRB, BK designed the study. BK provided data or materials. NB performed the experiments. NB and JB analysed the data. NB and FRB wrote the initial manuscript. All authors contributed to and approved the final version. Competing interests {#FPar4} =================== The authors declare that they have no competing interests. Consent for publication {#FPar5} ======================= Not applicable. Ethics approval and consent to participate {#FPar6} ========================================== Not applicable. Publisher's Note {#FPar7} ================ Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Placental transfer of Zidovudine in first trimester of pregnancy. Zidovudine is one of the most common antiretroviral drugs used to prevent vertical transmission of human immunodeficiency virus. However, it is not recommended for use in the first trimester of pregnancy because of reservations about its potential teratogenicity during the organogenesis phase. The objective of this study was to investigate the placental transfer of zidovudine in the first trimester of human pregnancy. Twenty-six pregnant women were given 2 oral doses of zidovudine (200 mg) before first trimester surgical termination of pregnancy. Maternal blood, fetal tissue, and coelomic and amniotic fluid were collected for drug analysis. Zidovudine was detected in all samples of maternal serum and fetal tissue but present in only 7 samples of amniotic and coelomic fluid. Zidovudine concentration in fetal tissue was similar to that of maternal serum. The median fetal/maternal ratio was 0.92 and was not associated with gestational age (r = 0.03, P = .89). Zidovudine crossed the first trimester human placenta readily and achieved the level of maternal serum rapidly. Patients who choose to take zidovudine in first trimester of pregnancy should be counseled about the potential fetal effects.

Typically, a fuel cell has a cell stack formed by a number of power generation cells stacked together. With reference to FIGS. 17 to 19, a prior art power generation cell will be described. As shown in FIG. 17, a power generation cell 12 includes a pair of upper and lower frames 13, 14 and an electrode structure 15 between the frames 13, 14. The electrode structure 15 is formed by a solid electrolyte membrane 16, an electrode catalyst layer 17 on the anode side, and an electrode catalyst layer 18 on the cathode side. The anode-side electrode catalyst layer 17 is laid on the upper surface of the electrolyte membrane 16, and the cathode-side electrode catalyst layer 18 is laid on the lower surface of the solid electrolyte membrane 16. A first gas diffusion layer 19 is laid on the upper surface of the electrode layer 17, and a second gas diffusion layer 20 is laid on the lower surface of the electrode layer 18. Further, a first gas passage forming member 21 is laid on the upper surface of the first gas diffusion layer 19, and a second gas passage forming member 22 is laid on the lower surface of the second gas diffusion layer 20. A flat plate-like separator 23 is joined to the upper surface of the first gas passage forming member 21, and a flat plate-like separator 24 is joined to the lower surface of the second gas passage forming member 22. FIG. 18 is an enlarged perspective view showing a part of the first and second gas passage forming members 21, 22. As shown in FIG. 18, the gas passage forming member 21 (22) is made of a metal lath plate, which has a great number of hexagonal ring portions 21a (22a) arranged alternately. Each ring portion 21a (22a) has a through hole 21b (22b). The ring portions 21a (22a) and the through holes 21b (22b) form gas passages 21c (22c) that meander in a complex manner. Fuel gas (oxidation gas) flows through gas passages 21c (22c) as indicated by arrows. As shown in FIG. 17, the frames 13, 14 form a supply passage G1 and a discharge passage G2 for fuel gas. The fuel gas supply passage G1 is used for supplying hydrogen gas, which serves as fuel gas, to the gas passages 21c of the first gas passage forming member 21. The fuel gas discharge passage G2 is used for discharging fuel gas that has passed through the gas passages 21c of the first gas passage forming member 21, or fuel off-gas, to the outside. Also, the frames 13, 14 form a supply passage and a discharge passage for oxidation gas. The oxidation gas supply passage is located at a position corresponding to the back side of the sheet of FIG. 17, and is used for supplying air serving as oxidation gas to the gas passages of the second gas passage forming member 22. The oxidation gas discharge passage is located at a position corresponding to the front side of the sheet of FIG. 17, and is used for discharging oxidation gas that has passed through the gas passages of the second gas passage forming member 22, or oxidation off-gas, to the outside. As indicated by arrow P in FIG. 17, hydrogen gas is supplied from a hydrogen gas supply source to the first gas passage forming member 21 via the supply passage G1. The air is fed from an air supply source to the second gas passage forming member 22. This causes an electrochemical reaction in each power generation cell to generate power. Since humidifiers (not shown) humidify the hydrogen gas and the oxidation gas, the gases each contain humidifying water (water vapor). The aforementioned electrochemical reaction also produces water in the electrode layer 18 at the cathode side, the gas diffusion layer 20, and the second gas passage forming member 22. The generated water and the humidifying water form water droplets W1 in a portion of the power generation cell 12 at the cathode side. The oxidation off-gas flowing in the gas passage 22a of the gas passage forming member 22 sends the water droplets W1 to the exterior via the discharge passage. Some of the generated water seeps as seepage water through the solid electrolyte membrane 16 and flows into the electrode layer 17 at the anode side, the gas diffusion layer 19, and the gas passage 21c of the first gas passage forming member 21. The seepage water and the humidifying water form water droplets W in a portion of the power generation cell 12 at the anode side. The oxidation off-gas flowing in the gas passage 21c of the gas passage forming member 21 introduces the water droplets W to the exterior through the discharge passage G2. Patent Document 1 discloses a power generation cell for a fuel cell having the structure shown in FIG. 17. FIG. 19 is a partial cross-sectional view showing a fuel cell disclosed in Patent Document 2. As illustrated in FIG. 19, the fuel cell has a cathode 49 and a separator 50 that are arranged in a stacked manner. The separator 50 includes a plurality of projections 50a projecting toward the cathode 49. The separator 50 and the cathode 49 form gas passages 52. A deformed member 51 is arranged around each of the projections 50a. Two ends of the deformed member 51 are bent toward the corresponding projection 50a in such a manner as to form obtuse angles R with respect to the cathode 49. As a result, each adjacent pair of walls determining the cross-sectional area of each gas passage 52 form an obtuse angle. This makes it difficult for water droplets to be accumulated in corners of the gas passages 52, thus improving drainage performance of the separator 50. Patent Document 1: Japanese Laid-Open Patent Publication No. 2007-87768 Patent Document 2: Japanese Laid-Open Patent Publication No. 2008-21523

Cyclone Oswald Tropical Cyclone Oswald in 2013 passed over parts of Queensland and New South Wales, Australia over a number of days, causing widespread impact including severe storms, flooding, and water spouts. Coastal regions of Queensland were the most impacted with Mundubbera, Eidsvold, Gayndah and Bundaberg in the Wide Bay–Burnett hit severely. In many places the rainfall total for January set new records. Across the affected region, damage from severe weather and flooding amounted to at least A$2.4 billion. 7,500 residents of Bundaberg and patients at the Bundaberg Hospital were evacuated. Houses were completely washed away and parts of Bundaberg's sewage network were destroyed. Cuts to transport links including damage to numerous bridges, communication interruptions, electrical blackouts and water supply problems were experienced across wide areas. Several swiftwater rescues had to be undertaken. Meteorological history On 17 January, the Australian Bureau of Meteorology's Tropical Cyclone Warning Centres and the United States Joint Typhoon Warning Center (JTWC) started to monitor a tropical low that had developed within a marginal environment for further development over the Gulf of Carpentaria. Over the next two days, the cyclone slightly developed further before the system made landfall to the southwest of Borroloola early on 19 January, where the possibility for further development became stifled. By 20 January, the system completed a clockwise loop before re-emerging into the Gulf of Carpentaria. Once back over water, the system quickly organised and strengthened into Tropical Cyclone Oswald early on 21 January. At the same time, the JTWC began monitoring the system as Tropical Cyclone 11P. Radar imagery from Mornington Island depicted a well-defined low-level circulation with defined banding features wrapping into the centre. Situated in a very moist air mass and over the warm waters of the Gulf, some intensification was expected before Oswald struck the Cape York Peninsula. Approximately 12 hours after being named, the storm made its second landfall north of Kowanyama with winds of 65 km/h (40 mph) and the final advisory was issued by the TCWC in Brisbane. Although over land, the system was able to maintain a defined circulation and gradually reorganised as it moved southwestward. By 23 January, deep convection redeveloped over the circulation and a strong monsoonal flow became established to its north. A high pressure system over New Zealand blocked the low pressure system from moving east, away from the Queensland coast, allowing the low to move slowly along the Queensland coast also causing it to stall near Rockhampton and in southern Queensland; feeding moist air from the Coral Sea into the low which resulted in a large area of convective activity with associated heavy rainfall and a low pressure trough over New South Wales allowed the low to move south into the Tasman Sea. Favourable upper-level conditions and ample moisture allowed the system to maintain its identity despite remaining over land for a prolonged period of time. By 30 January, the system had travelled more than and its remnants passed south of Sydney in New South Wales, emerging into the Tasman Sea. Preparations Queensland As a precautionary measure, on 25 January Queensland Premier Campbell Newman ordered the pre-emptive release of water from Wivenhoe Dam to increase the dam's flood mitigation capacity. Releases from North Pine Dam were also made. New South Wales Due to the threat of heavy rains from Oswald, flood warnings were issued for much of northern New South Wales. By 28 January, moderate and major flood warnings were in place for the Bellinger, Kallang, Macleay, Manning, Nambucca, and Tweed Rivers, as well as Camden Haven, the Clarence Valley (including the Orara River), and Hastings. Severe weather warnings were also in place for much of the state, indicating the threat of heavy rains, destructive winds, and dangerous seas. Hundreds of travellers were stranded at Sydney Airport as flights were cancelled due to dangerous winds. Floods and severe weather Queensland Rainfall was initially the heaviest around Tully where approximately of rain fell, with falling over 48 hours. The town of Ingham was completely cut off due to high waters. Residents in the town were advised to stock up on emergency supplies as the Herbert River rose rapidly after of rain fell in the town in just three hours. A brief tornado or waterspout with winds of touched down near Hay Point. On the afternoon of 26 January, three separate tornadoes tore through the Bundaberg Region. At approximately 1:00 pm, the first tornado struck the town of Bargara, which brought down power lines, tore off roofs and smashed windows. At 3:30 pm, the town of Burnett Heads was battered by a second tornado, and soon after a third tornado struck Coonarr, south of Bargara. The tornadoes injured at least 17 people and damaged 150 properties. Weather conditions favoured tornadic activity because of strong low-level winds which were feeding into the low pressure system. The Burnett River reached a new recorded height of on 29 January. More than 7,500 residents of Bundaberg were forced to evacuate from about 2,000 homes as the river's waters rose. 130 patients were evacuated from the Bundaberg Hospital to hospitals in Brisbane. Staff and resources from the Department of Health, Queensland Ambulance Service, Australian Defence Force, CareFlight (now LifeFlight) and Royal Flying Doctor Service, including several aircraft, were used to transport patients. As of 29 January, the floods had claimed the lives of four people, including a three-year-old boy who died after being crushed by a falling tree at Gordon Park. On 28 January, the body of a man who was swept away by floodwaters the day before was pulled from Oxley Creek, while the bodies of two others – a 27-year-old man and an 81-year-old man – were also recovered in Gympie and Burnett Heads respectively. At Gympie flood waters from the Mary River swamped around 100 business and 25 residents. In Maryborough about 50 businesses and 150 homes were inundated as waters from the Mary River rose. In Mundubbera the Burnett River peaked at 22.9 m at 1 am on 28 January. 100 homes and businesses were inundated in the town with about the same number flooded in the surrounding area. In Gayndah, 60 homes and 12 businesses were flooded. A landslide severed the Burnett Highway between Gayndah and Mundubbera. Kumbarilla, Kogan and Tara west of Dalby were completely isolated after the new A$4.6 million Wilkie Creek Bridge on Dalby-Kogan road was submerged by rising creek levels as the Moonie Highway flooded. About 40 houses were flooded in the Darling Downs town of Warwick. Unlike the flooding which occurred in January 2011 at Ipswich and Brisbane, the flooding there was caused by the natural flooding of the creek system rather than deliberate dam releases. Waters in Laidley in the Lockyer Valley reached an all-time high with the main street in the town inundated. At Waterford in Logan City, the Logan River reached a peak of 9 m at midnight on 28 January. Flood waters were slow to recede along the river. A mudslide hit three houses in Logan City. During 29 January, Brisbane's main water treatment plant at Mount Crosby was shut down after the high levels of sediment and silt in the Brisbane River caused record turbidity levels, which resulted in Seqwater and Queensland Premier, Campbell Newman urging residents to conserve water and to only use it for "drinking, cooking and bathing". Water supplies in some suburbs of Brisbane were expected to run out during 30 January, after an increase in consumption. The Gold Coast Desalination Plant was engaged from standby mode to supplement supplies with of water a day. New South Wales An estimated 41,000 people were temporarily isolated by flooding in New South Wales. In the Tweed Valley the Tweed River peaked at on 28 January, the highest level recorded in 30 years. In Grafton the Clarence River peaked a new record height of . Records for the river height in Grafton go back to 1839. The city's levee was credited with preventing more severe flooding. Despite that, around 1,500 people who lived closed to the Clarence River were asked to evacuate on the night of 28 January. Maclean was spared flooding from the Clarence River due to the town's levee. The Clarence Valley was not as fortunate, with many properties cut off and without power. The area was officially declared a disaster zone, as was the Tweed Shire. Minor flooding and road closures were experienced in the Hunter Valley. Impact In many affected areas the flooding would have been worse had the weather prior to the heavy rains not been so dry. In the 24 hours to 5 am on 27 January the Queensland State Emergency Service logged more than 800 requests for assistance. An exclusion zone was set up by police in Bundaberg North because damaged buildings and infrastructure posed significant safety risks. It wasn't until 2 February before limited access was granted for around 1,000 residents. By 28 January, nearly a quarter of households in South East Queensland (around 300,000 homes and businesses) experienced power interruptions including 88,000 in Brisbane, 32,000 on the Sunshine Coast, 28,000 in Moreton Bay area and 28,000 on the Gold Coast. About 2,000 powerlines were brought down by storms. More premises lost power in this storm event than in the January 2011 floods. By 9pm 31 January approximately 5,300 premises were still without power. The main coastal fibre-optic cable was cut near Colosseum causing widespread disruptions. This was followed by further damage to the alternate cable north of Harlin late on 26 January, resulting in widespread failures of mobile, landline, ATM, EFTPOS, broadband services and the 000 Emergency response number. The result of both of Telstra's major communications routes in Queensland being cut was that the towns of Mackay, Freshwater, Cairns, Rockhampton, Mount Morgan, Townsville, Mount Isa and Gladstone were almost completely isolated from communications technology. Telstra services were largely restored within 24 hours of the incident. Power outages resulted in disruptions to a number of Optus phone services. The rail network in South East Queensland was heavily impacted by the storms, with inner city Brisbane lines particularly affected. The Bruce Highway, Bruxner Highway, Carnarvon Highway and Pacific Highway were all closed for some time. The Gwydir Highway was cut because of a landslide west of Grafton. Some coal production in Central Queensland had been impacted because of transport disruptions. The Port of Gladstone suspended ship loading on 26 January due to poor weather, however loading resumed the following day. Alumina and liquified natural gas production in the state experienced minor impacts with operations returning to normal levels shortly after the wild weather had passed. On the evening of 26 January, Awoonga Dam reached a new record water height level of . The citrus industry in the Wide Bay–Burnett region was hit hard with losses totalling hundreds of millions of dollars, higher than the cost of the 2011 floods. In Moreton Bay, seagrass beds are expected to endure greater damage than from the 2011 floods, when is some place 80% of the seafloor vegetation was lost. Sediment flows from the Brisbane River were expected to be much higher in this flood, placing the bay's dugong population at risk. Aftermath Impacts Campbell Newman launched the Red Cross Flood Appeal on 28 January. The state government donated $1 million to begin the appeal. By 4 February only $6 million had been raised for the flood appeal. Concerns were raised over the low figure as emergency payments alone would need funding of between $15 million to $25 million. Government of Queensland disaster assistance was being offered in 21 local government areas shortly after the floods. The new Community Recovery Minister is David Crisafulli whose local government responsibilities were expanded to deal with flood recovery. Plans for relocation rather than re-building as well as the construction of new dams and levees were put forward soon after the floods. On 1 February Deputy Commissioner of Police, Brett Pointing APM, was appointed to oversee the recovery activities in the Bundaberg and North Burnett Regions. On 3 February it was announced that Colonel Don Cousins AM, CSC would oversee recovery activities in North Queensland with Brigadier Bill Mellor, DSC, AM responsible for southern Queensland. On 8 February it was announced the state and federal governments had reached an agreement concerning funding to avenge public infrastructure. The arrangement which also includes sporting, recreational and community facilities, means that infrastructure can be rebuilt to a higher standard so that it may withstand future disasters. Around 28,000 claims for insurance were lodged in Queensland. In February 2013, more flash flooding occurred throughout Queensland and New South Wales, further impacting the damage already created from Cyclone Oswald the previous month, resulting in one death, and the need for some evacuations. See also 2010–11 Queensland floods 2012–13 Australian region cyclone season Cyclone Tasha Floods in Australia March 2010 Queensland floods References External links Flooding along the Fitzroy River: NASA Earth Observatory Australia floods Category:2013 in Australia Category:Floods in Australia Category:Floods in New South Wales Category:History of Queensland Category:History of Gold Coast, Queensland Category:History of Brisbane Category:Queensland floods Category:Weather events in Australia Oswald Oswald Category:2012–13 Australian region cyclone season Category:2013 disasters in Australia

Email DOES THE GLOVE FIT? WHAT SCIENTISTS ARE OVERLOOKING Corrosive acid. Radioactive waste. Mutagenic agents. Handling hazardous materials is all in a day’s work for many scientists and researchers. But despite the potential risks associated with these substances, too many workers overlook a key piece of equipment meant to protect them: the humble hand glove. “I asked a room full of scientists, ‘How many of you were trained on how to select or pick out a glove?’” says Carolina Krevolin, senior category manager, Scientific Gloves at Kimberly-Clark Professional*. “Not one of them raised their hand.” The only thing separating scientists’ hands from the often toxic materials they work with is the glove. But proper glove fit isn’t always addressed in academic or professional settings. “I have a doctorate in chemistry, and no one ever discussed proper glove use with us,” Krevolin recalls. “A lot of the time, when I was an undergraduate, we didn’t even wear gloves in the laboratory.” Not Too Big, Not Too Small; Gloves Sized Just Right According to Krevolin, one of the most important questions scientists, and others who work with hazardous materials, should be asking themselves is, “Does the glove fit?” Gloves that are too small run the risk of ripping, exposing researchers to contamination. If a glove is too large, leaving unnecessary wiggle room, it can inhibit dexterity—once again making the wearer vulnerable to health risks. Krevolin notes that a perfect fit adheres without shrinking, molds itself to the hand’s natural shape and gives the wearer’s fingers maximum mobility. But hands come in all shapes and sizes. Therefore, to ensure safety, Krevolin stresses that wearers identify both the proper glove size and the appropriate glove length for the situation. For instance, a medical office professional could use a 9.5-inch, medium-size glove. But someone with a similarly sized hand working more directly with potentially harmful substances would want to use a 12-inch glove to cover the wrist while conducting lab work or a 16-inch glove while working in an anaerobic container. Latex and Nitrile and Polyisoprene—Oh My! Glove material is another key consideration. Latex is one of the most recognizable material types, but gloves made from nitrile can ensure an even greater level of safety in some situations. Since latex reverts to its original shape once it’s removed, it can be nearly impossible to spot pin-size holes. “[But] with nitrile you will see a tear in the glove,” Krevolin explains. “It is designed so that you can see where you are at risk of being contaminated.” Latex originates in the liquid of rubber trees found in areas like Thailand and Malaysia. Allergies to latex proteins are common, making nitrile gloves a popular alternative because they are made from the nonallergenic, synthetic byproduct of oil and latex. Professionals who work in some health care environments must also be sure that their gloves have been approved by the Food and Drug Administration (FDA). Indeed, medical exam gloves are subject to a battery of rigorous trials before they can be deemed medical-grade and sold with the word “exam” on the box. According to Krevolin, the FDA has several requirements before a glove can be sold. For instance, a glove needs to meet the FDA's minimum requirements for pinholes (AQL 2.5), which is the minimum pinhole level the manufacturer must meet to be considered a medical glove. If it does not, the FDA can put a hold on those gloves until the problem is fixed. Implementing Best Practices Given how entrenched researchers can be in their work, Krevolin acknowledges it can be difficult for them to find the time to stay on top of the best practices for glove use. But Kimberly-Clark Professional’s* APEX program serves as an instructional course for customers using Kimberly-Clark Professional* gloves in their facilities. APEX, which stands for ‘Alignment’ ‘Project Management’ ‘Engagement’ and ‘Exceptional Workplaces’ is a complimentary program where users are appropriately fitted with new gloves, trained on any relevant materials and given the opportunity to raise questions or concerns they may have about switching to new gloves. “Believe it or not, the glove business is a very drama-filled business,” Krevolin shares. “When it comes to your hands, people tend to be very particular about what they use.”

A 3D visual effect may be created by a projector system by operating the projector to deliver left and right images representing different viewpoints to a viewer (observer) who is wearing special 3D viewing eyeglasses. For example, the viewer may wear polarized eyeglasses having polarizing filters (e.g. linearly polarized eyeglasses or circularly polarized eyeglasses). In such case the left and right images are each polarized so that they can be seen by the intended eye but not the other eye when wearing the polarized eyeglasses. In other display technologies, the user may wear spectral filtration eyeglasses to view different left and right images. In such case the projector is operated to provide spectrally filtered light to the viewer so that the left eye is presented with light in a first set of spectral bands (providing a left image) and the right eye is presented with light in a complementary, second set of spectral bands (providing a right image). In each case the human visual system of the viewer combines and interprets the left and right images to perceive a single 3D image having the illusion of depth. Some 3D projector systems use a globally controlled polarizer mounted in front of a projector. For example, FIG. 1 shows a front-view projector system 20 having a projector 22 and a reflective screen 24 which reflects the light from projector 22 toward a viewing area in front of screen 24. A polarizer 26 is positioned in the light path between projector 22 and screen 24. Polarizer 26 is controllable to alternate between two opposite polarization states in synchronization with the display of left and right images L, R by the projector. Other 3D projector systems may use an optical element to modulate the polarization of light emitted from a projector so that left and right images are alternately displayed to a viewer. In 3D projector systems such as those described above, a design objective is to minimize crosstalk between left and right channels. Crosstalk occurs if one eye sees some residue of the image intended for the other eye. Typically, to minimize crosstalk for 3D projector systems, left and right images are alternately displayed such that the entire screen is made to appear and disappear to each eye of the viewer during each cycle. When a left image is presented to the left eye, a blank screen is presented to the right eye, and vice versa. Flickering and viewer eye fatigue may result if the refresh rate to each eye is below a flicker fusion threshold. 3D viewing is more prone to flickering than 2D viewing because the 3D refresh rate is half of the 2D refresh rate. For example, if a cinema projector is capable of displaying images at a maximum frame rate of 48 fps, then for 3D viewing the frame rate is 24 fps for each eye, which may be below the flicker fusion threshold. The flicker fusion threshold is variable from person to person and also depends on factors such as amount of modulation, intensity, image size (field of view) and brightness. FIG. 2 shows the use of a polarizer switching between opposite left and right polarization states P1, P2 for two projector subframe images I1, I2, respectively, to generate different images to the left and right eyes of the viewer. The numbers within each image represent the light intensity. In the illustrated example, the vertical polarizer state P1 directs all the light from image I1 toward the left eye while blocking all light to the right eye. The horizontal polarizer state P2 directs all the light from image I2 toward the right eye while blocking all light to the left eye. The resulting subframe images shown to each of the left and right eyes are L1, R1 for the first subframe and L2, R2 for the second subframe. The human visual system of the viewer combines the light from the two subsequent frames for each eye so that the viewer sees time-integrated left and right eye images LTI, RTI. As illustrated by FIG. 2, there is some reduction in the image intensity of time-integrated images LTI, RTI, from target images LTARGET, RTARGET. Also, as can be appreciated by comparing subframe images L1 to L2, and R1 to R2, the large differences in image intensity between subsequent frames for each eye may cause flicker and viewer eye fatigue. Patent literature describing technology in the general field of this invention includes: US20090040402 “Liquid crystal projector and control method for liquid crystal projector” (SONY CORP; 12 Feb. 2009); U.S. Pat. No. 7,190,518 “Systems for and methods of three dimensional viewing” (3ALITY INC; 13 Mar. 2007); JP2006301549 “Display method and display device” (EBARA J; Nov. 2, 2006); US20050105610 “Temporal smoothing apparatus and method for synthesizing intermediate image” (SAMSUNG ELECTRONICS CO LTD; 19 May 2005); US20060203339 “Systems for three-dimensional viewing and projection” (3ALITY INC; 14 Sep. 2006); U.S. Pat. No. 7,705,935 “Stereoscopic display system” (ECRANS POLAIRES INC; 27 Apr. 2010); U.S. Pat. No. 7,646,537 “High-resolution field sequential autostereoscopic display” (SAMSUNG ELECTRONICS CO LTD; 12 Jan. 2010); U.S. Pat. No. 6,111,598 “System and method for producing and displaying spectrally-multiplexed images of 3D imagery for use in flicker-free stereoscopic viewing thereof” (REVEO INC; 29 Aug. 2000); U.S. Pat. No. 5,548,427 “Switchable holographic apparatus” (SHARP K K; 20 Aug. 1996); US20080303962 “Liquid crystal projector and a method of controlling the same” (SONY CORP; 11 Dec. 2008); and JP9113862 “Stereoscopic video display device” (MITSUBISHI ELECTRIC CORP; 2 May 1997). The foregoing examples of the related art and limitations related thereto are intended to be illustrative and not exclusive. Other limitations of the related art will become apparent to those of skill in the art upon a reading of the specification and a study of the drawings.

Product category In the mathematical field of category theory, the product of two categories C and D, denoted and called a product category, is an extension of the concept of the Cartesian product of two sets. Product categories are used to define bifunctors and multifunctors. Definition The product category has: as objects: pairs of objects , where A is an object of C and B of D; as arrows from to : pairs of arrows , where is an arrow of C and is an arrow of D; as composition, component-wise composition from the contributing categories: ; as identities, pairs of identities from the contributing categories: 1(A, B) = (1A, 1B). Relation to other categorical concepts For small categories, this is the same as the action on objects of the categorical product in the category Cat. A functor whose domain is a product category is known as a bifunctor. An important example is the Hom functor, which has the product of the opposite of some category with the original category as domain: Hom : Cop × C → Set. Generalization to several arguments Just as the binary Cartesian product is readily generalized to an n-ary Cartesian product, binary product of two categories can be generalized, completely analogously, to a product of n categories. The product operation on categories is commutative and associative, up to isomorphism, and so this generalization brings nothing new from a theoretical point of view. References Definition 1.6.5 in Category:Category theory

9. GPL Advantages and Disadvantages A common reason to use the GPL is when modifying or extending the gcc compiler. This is particularly apt when working with one-off specialty CPUs in environments where all software costs are likely to be considered overhead, with minimal expectations that others will use the resulting compiler. The GPL is also attractive to small companies selling CDs in an environment where "buy-low, sell-high" may still give the end-user a very inexpensive product. It is also attractive to companies that expect to survive by providing various forms of technical support, including documentation, for the GPLed intellectual property world. A less publicized and unintended use of the GPL is that it is very favorable to large companies that want to undercut software companies. In other words, the GPL is well suited for use as a marketing weapon, potentially reducing overall economic benefit and contributing to monopolistic behavior. The GPL can present a real problem for those wishing to commercialize and profit from software. For example, the GPL adds to the difficulty a graduate student will have in directly forming a company to commercialize his research results, or the difficulty a student will have in joining a company on the assumption that a promising research project will be commercialized. For those who must work with statically-linked implementations of multiple software standards, the GPL is often a poor license, because it precludes using proprietary implementations of the standards. The GPL thus minimizes the number of programs that can be built using a GPLed standard. The GPL was intended to not provide a mechanism to develop a standard on which one engineers proprietary products. (This does not apply to Linux applications because they do not statically link, rather they use a trap-based API.) The GPL attempts to make programmers contribute to an evolving suite of programs, then to compete in the distribution and support of this suite. This situation is unrealistic for many required core system standards, which may be applied in widely varying environments which require commercial customization or integration with legacy standards under existing (non-GPL) licenses. Real-time systems are often statically linked, so the GPL and LGPL are definitely considered potential problems by many embedded systems companies. The GPL is an attempt to keep efforts, regardless of demand, at the research and development stages. This maximizes the benefits to researchers and developers, at an unknown cost to those who would benefit from wider distribution. The GPL was designed to keep research results from transitioning to proprietary products. This step is often assumed to be the last step in the traditional technology transfer pipeline and it is usually difficult enough under the best of circumstances; the GPL was intended to make it impossible.

Fitting a number of rectangular die on a round wafer typically has a single goal—arranging the die so that as many die as possible can be placed on a single wafer. The die are arranged on the wafer during an exposure process, such as photolithography, and a typical exposure process will use a mask or “reticle”. The reticle will often have 1, 2, or more die, and a reticle is typically exposed or processed at a single time, so that all of the die in the reticle are exposed at one time. The wafer can then be moved to a next location and the group of dies in the reticle are exposed again. Through trial and error or mathematical algorithm, a determination can be made as to how many dies can be placed on a wafer, and the number of good dies. The number of “good” dies on wafer includes all the dies, excluding those dies that are exposed but will never be fully operational because they are incomplete (e.g., they are only partially on the wafer) and/or they are fatally flawed (e.g., they are located on a beveled edge of the wafer). It is understood that a good die may be incomplete or fatally flawed for other reasons, such as a wafer defect or particle—but a good die has the potential to be a full and functional die. The present disclosure provides a method for optimizing die placement that goes beyond simply finding the greatest number of good die per wafer. The present disclosure considers other factors, including processing time and peripheral die yield.

Hepatitis B virus genome variability and disease progression: the impact of pre-core mutants and HBV genotypes. The hepatitis B virus (HBV), a member of the Hepadnaviridae family, is prone to mutations due to its asymmetric replication via reverse transcription of an RNA intermediate. The estimated mutation rate of the hepadnavirus genome is 2 x 10(4) base substitutions/site/year. This mutation rate is approximately 100 times higher than that of other DNA viruses but between 100 and 1000 times lower than that of RNA viruses. Analyses of both naturally occurring viral variants and in vitro mutagenesis studies have identified some mutations that have a role in viral latency, pathogenesis of liver disease, immune escape, and resistance to antiviral therapy.

Q: Why did Luffy ring the bell 16 times? I'm confused as to why Luffy rung the bell 16 times. A navy member said it's a declaration of war whereas a pirate said it's about the change of an era. Can someone please explain what exactly is the reason behind it?? A: The bell is called the Ox-Bell. What does the ringing of the bell signify? The ringing of the bell signifies the end of one year and the beginning of another. It is rung eight times to give thanks for the old year, and another eight times to welcome the new year. If it is rung twice, it signifies some sort of disaster or distress. How others interpreted 16 rings: Lieutenant Commander Brandnew of the Marines analyzed it as a declaration of war, and Killer of the Kid Pirates interpreted the meaning of it as the end of one era and the beginning of another. The real reason behind it: Luffy's ringing of the bell was only a distraction, along with his other actions, so nobody in the world outside of the Straw Hat Pirates would notice the real message; in the picture of Luffy after ringing the Ox Bell, a mark is seen on his arm that reads 3D2Y with the 3D crossed out, representing the amount of time the crew would be separated.

Successful extraction of DNA from plant tissues generally has been most successful from freshly field-collected tissue placed into either liquid nitrogen or, more commonly, into silica gel desiccant. When possible, the samples are then stored frozen in ultracold liquid nitrogen tanks or in boxes containing additional silica gel at −20°C to −80°C. Subsequent nucleic acid extractions most commonly have involved either some form of a cetyltrimethylammonium bromide (CTAB)--based technique ([@bib7]) or use of a QIAGEN DNeasy kit (QIAGEN, Venlo, The Netherlands). However, previous research has also shown success with an alternative genomic DNA extraction method using Whatman FTA PlantSaver Cards (Whatman, Maidstone, United Kingdom), with effectiveness for agricultural plant species, entomology, mycology, and other food sciences ([@bib14]; [@bib12]; [@bib1]; [@bib4]; [@bib6]). Nevertheless, remarkably little research has been done to test the effectiveness of this extraction method on non-agricultural plant species. Additionally, it has been shown that methods employing DNeasy kits and/or CTAB-based methods may not be optimal for all plant genera and families because inhibitors can be coprecipitated with the DNA ([@bib5]; [@bib1]). Therefore, it is proposed that alternative extraction methods, such as use of the FTA cards, be tested as to whether they are more effective for some plant genera. To help gain a better understanding of the potential uses and limitations of FTA card extraction, this study assessed FTA card--extracted DNA quality in terms of concentration, spectral absorption, degree of fragmentation, and amplification and sequencing ability on a wide phylogenetic range of non-agricultural species. The data collected using these methods helped to indicate which plant species may be most compatible with the FTA card extraction method. Both successful and failed extractions provided valuable insights into the potential advantages and limitations of this alternative extraction method. MATERIALS AND METHODS ===================== Collection ---------- Samples from 15 phylogenetically diverse taxa possessing varying leaf characteristics were collected from the following vascular plant families: Apocynaceae, Aquifoliaceae, Asteraceae, Cactaceae, Cyperaceae, Fabaceae, Lamiaceae, Magnoliaceae, Oleaceae, Oxalidaceae, Poaceae, Typhaceae, Vitaceae, Pinaceae, and Aspleniaceae ([Table 1](#tbl1){ref-type="table"}). Collection of samples was completed on the morning of 23 June 2015, alongside a gravel utility road, sloping hillsides, and free-standing trees in Suitland, Maryland, USA. Voucher specimens for each species were deposited in the National Museum of Natural History's Herbarium (US), the University of Illinois at Urbana-Champaign Plant Biology Herbarium (ILL), and the Chicago Botanic Garden (CHIC). ###### Species sampled in this study. All specimens were collected in Camp Springs, Maryland, USA (GPS coordinates 38°50′40.4″N, 76°56′17.4″W). Triplicate vouchers were made for deposit at the National Museum of Natural History's Herbarium (US), the University of Illinois at Urbana-Champaign Plant Biology Herbarium (ILL), and the Chicago Botanic Garden (CHIC). Samples are organized alphabetically by family name. Family Genus/Species (Common name) Voucher no. ---------------- ---------------------------------------------------------------------------- ---------------- Aquifoliaceae *Ilex glabra* (L.) A. Gray (inkberry) *C. Siegel 11* Asclepiadaceae *Asclepias syriaca* L. (common milkweed) *C. Siegel 10* Aspleniaceae *Asplenium platyneuron* (L.) Britton, Sterns & Poggenb. (ebony spleenwort) *C. Siegel 6* Asteraceae *Ratibida pinnata* (Vent.) Barnhart (pinnate prairie coneflower) *C. Siegel 8* Cactaceae *Opuntia* cf. *laevis* J. M. Coult. (prickly pear) *C. Siegel 15* Cyperaceae *Carex lurida* Wahlenb. (shallow sedge) *C. Siegel 3* Fabaceae *Albizia julibrissin* Durazz. (silktree) *C. Siegel 7* Lamiaceae *Monarda fistulosa* L. (wild bergamot) *C. Siegel 1* Magnoliaceae *Magnolia virginiana* L. (sweetbay magnolia) *C. Siegel 12* Oxalidaceae *Oxalis dillenii* Jacq. (wood sorrel) *C. Siegel 13* Pinaceae *Pinus virginiana* Mill. (Virginia pine) *C. Siegel 5* Poaceae *Dichanthelium commutatum* (Schult.) Gould (panicgrass) *C. Siegel 14* Simaroubaceae *Ailanthus altissima* (Mill.) Swingle *C. Siegel 9* Typhaceae *Typha angustifolia* L. (narrowleaf cattail) *C. Siegel 2* Vitaceae *Ampelopsis glandulosa* (Wall.) Momiy. (Amur peppervine) *C. Siegel 4* Samples were preserved using Whatman FTA PlantSaver Cards and in silica gel (Flower Drying Type A silica with indicator; AGM Container Controls, Tucson, Arizona, USA). Samples were applied to the FTA cards directly in the field, then stored at room temperature. To make the plant print, a ceramic pestle was used like a hammer to smash the leaf tissue onto the card paper ([Fig. 1](#fig1){ref-type="fig"}). Enough plant prints were made for seven replicate extractions to be performed for each species. {#fig1} Additionally, 2--3 in^2^ of leaf tissue were collected into individual silica gel--containing bags to be extracted later, using the CTAB-based technique on the AutoGen DNA isolation system (AutoGen, Holliston, Massachusetts, USA). Bags were stored in a plastic box containing additional silica gel at room temperature prior to extraction and then moved to a −20°C freezer for long-term storage. Extraction ---------- ### FTA card extraction After collecting the samples on the FTA cards, small punched disks were removed from the sample cards followed by a series of washes on the disks. The protocol used was closely modeled after the method outlined in [@bib1], with a modified disk size and centrifugation added after the incubation period to reduce bubbles. Eight disks, 2.0 mm in diameter, were used in this study so as to have a comparable total disk surface area to that found in [@bib1]. Additionally, the protocol of Adugna et al. called for centrifugation only after the addition of TE in the last step of the protocol. In our study, plates were centrifuged at 6200 rpm for 2 min at 4°C in between each purification wash. Using the 2.0-mm-diameter Harris Micro Punch and Mat (Whatman), 56 disks were removed from each specimen's plant-pressed FTA card. A 96-well, Square V-Bottom 2-mL Assay Block (Costar, Corning Inc., Corning, New York, USA) was used with eight punched disks placed in each well. The disks were only added to the innermost wells (rows 3--10 out of 12) of the plates for more effective and cleaner transfer from one plate to another. Disk punches were taken from the leaves' darker print areas on the cards, which were presumed to contain the most concentrated residue. Once disks had been collected from each plant, a series of washes were employed according to the manufacturer's protocol. First, 400 μL of FTA purification reagent was added to each well. The plate of samples was then covered with Microseal 'F' foil seals (Bio-Rad, Hercules, California, USA) to reduce contamination, vortexed, and incubated at room temperature for 4 min before centrifugation at 6200 rpm for 2 min at 4°C. The supernatant was removed and the plates were then centrifuged a second time before the foil was removed. The FTA purification reagent wash was repeated once, followed by two low TE buffer washes. After completing the four washes, the remaining supernatant was removed. The samples were left to dry at room temperature for 20 min. The disks were then transferred to a new plate and centrifuged to separate them from as much remaining supernatant as possible. Any punches not in the new plate were manually transferred using cleaned forceps. Finally, 80 μL of TE was added to the plate containing the washed disks. The plate was centrifuged at 6200 rpm for 1 min and then incubated for 5 min at 95°C. The paper disks were left in the sample wells with the TE and eluted DNA. ### CTAB-based extraction For each replicate, a 1.0-cm^2^-sized piece of dried and shredded leaf tissue was added to a 2.0-mL tube containing 2.3-mm-diameter zirconia-silica beads and 1.0-mm-diameter glass beads (BioSpec, Bartlesville, Oklahoma, USA). The tissue was then macerated using the TissueLyser (QIAGEN) at 30 Hz for 30 s before 400 μL of CTAB, warmed to 65°C, was added. The Cactaceae samples produced a viscous gel, so 75 μL of 20 mg/mL Proteinase K and 500 μL of CTAB were added to further clean the sample. All samples were incubated overnight in a rotary incubator at 65°C and 150 rpm. The resulting lysate solutions were centrifuged at 13,000 rpm for 5 min and 300 μL of supernatant was transferred to each well of a 96-well AutoGen plate. DNA extraction was completed using the automated DNA isolation system AutoGenprep 965 (AutoGen) as outlined by the manufacturer's protocol, and the final pellets were resuspended in 80 μL of TE buffer. Quantification and quality assessment ------------------------------------- To assess the quality of the extractions generated with the two techniques, 260/280 nm absorbance ratios and fluorometric determinations of DNA concentration were performed using a Synergy HT Microplate Reader (BioTek, Winooski, Vermont, USA). The Quant-iT Broad-Range dsDNA Assay Kit (Invitrogen, Waltham, Massachusetts, USA) was used with the Synergy Microplate Reader according to the manufacturer's protocol ([Fig. 2](#fig2){ref-type="fig"}). The DNA size range and degree of fragmentation were determined using gel electrophoresis ([Fig. 3](#fig3){ref-type="fig"}). The samples (10 μL) were run alongside a HiLo DNA size standard (Minnesota Molecular, Minneapolis, Minnesota, USA) on a 1.5% SeaKem Agarose LE gel in 1× SB ([@bib3]). The loading dye used to prepare these electrophoretic separations contained a 1:1000 dilution of Gel Red fluorescent nucleic acid stain (Biotium, Fremont, California, USA). {#fig2} {#fig3} PCR amplification and DNA sequencing ------------------------------------ To compare the amplification success of DNA extracted with the two methods, a portion of the low-copy nuclear gene *At103*, the nuclear ribosomal intergenic spacer (ITS), and the plastid ribulose-bisphosphate-dismutase large subunit (*rbcL*) were amplified. Each amplification reaction contained 2.5 μL of FTA card--extracted sample or 2.5 μL of 1:50 diluted CTAB-extracted sample. The *At103* region was amplified with forward primer CTTCAAGCCMAAGTTCATCTTCTA and reverse primer TTGGCAATCCATTGAGGTACATNGTM ([@bib11]), and the ITS region was amplified with primers ITS5a (CCTTATCATTTAGAGGAAGGAG) and ITS4 (CAGGAGACTTGTACACGGTCCAG; [@bib10]). For these primer pairs, the PCR program used was: 95°C for 4 min; four cycles at 95°C for 45 s, 57°C for 30 s, 72°C for 1.5 min; four cycles at 95°C for 45 s, 54°C for 30 s, 72°C for 1.5 min; 35 cycles at 95°C for 45 s, 52°C for 30 s; 72°C for 1.5 min; and a final extension at 72°C for 10 min. For *rbcL*, PCR was conducted with forward primer ATGTCACCACAAACAGAGACTAAAGC and reverse primer GTAAAATCAAGTCCACCRCG ([@bib10]) using the following thermal cycler protocol: 95°C for 3 min; 34 cycles at 94°C for 30 s, 55°C for 45 s, 72°C for 2 min; and a final extension at 72°C for 5 min. Success of the PCR was assessed by gel electrophoresis. Two successful replicates for each marker and species were chosen for sequencing. These products were enzyme-treated with ExoSAP-IT (Affymetrix, Santa Clara, California, USA) to remove unincorporated primer and deoxynucleotide triphosphates (dNTP) prior to being used as template for cycle sequencing with BigDye Terminator version 3.1 Ready Reaction Mix (Thermo Fisher Scientific, Grand Island, New York, USA). The resulting Sanger sequencing fragments were purified through Sephadex G-50 and analyzed on an ABI 3730xl automated capillary sequencer (Life Technologies, Carlsbad, California, USA). Chromatograms were analyzed using Geneious 9.0.5 (Biomatters, Auckland, New Zealand), and successful sequences were submitted to GenBank ([Table 2](#tbl2){ref-type="table"}). ###### Results of DNA amplifications and sequencing.[^a^](#tblfn1){ref-type="table-fn"} Family Marker Extracted using CTAB method Extracted using FTA method ---------------- --------- ----------------------------- ---------------------------- ------- ---------- --- --- ------- ---------- Aquifoliaceae *At103* 0 7 0 No 0 7 0 KX394243 ITS 0 0 **7** KX352749 0 0 **7** KX352750 *rbcL* 4 0 **3** --- 0 7 0 KX702293 Asclepiadaceae *At103* 4 2 **1** No 7 0 0 No ITS 0 7 0 KX352744 0 7 0 KX352745 *rbcL* 0 0 **7** KX702286 0 0 **7** KX702287 Aspleniaceae *At103* 6 0 **1** KX394240 7 0 0 --- ITS 0 5 **2** No 1 1 **5** No *rbcL* 0 0 **7** KX702288 2 0 **5** KX702289 Asteraceae *At103* 2 5 0 No 3 1 **3** No ITS 0 0 **7** KX352753 0 0 **7** KX352754 *rbcL* 0 0 **7** KX702303 0 5 **2** KX702304 Cactaceae *At103* 0 7 0 KX394245 0 0 **7** KX394246 ITS 0 7 0 KX352751 1 6 0 KX352752 *rbcL* 1 0 **6** KX702298 0 7 0 KX702299 Cyperaceae *At103* 7 0 0 --- 6 0 **1** No ITS 1 1 **5** No 0 0 **7** KX352746 *rbcL* 0 6 **1** KX702290 0 2 **5** KX702291 Fabaceae *At103* 0 7 0 KX394236 0 7 0 KX394237 ITS 0 6 **1** No 0 7 0 No *rbcL* 0 2 **5** KX702282 0 1 **6** KX702283 Lamiaceae *At103* 0 0 **7** KX394244 6 1 0 No ITS 1 4 **2** No 7 0 0 --- *rbcL* 0 7 0 KX702296 4 0 **3** KX702297 Magnoliaceae *At103* 7 0 0 --- 5 2 0 No ITS 0 7 0 --- 0 7 0 --- *rbcL* 0 5 **2** KX702295 0 7 0 KX702294 Oxalidaceae *At103* 0 7 0 KX394247 1 5 **1** KX394248 ITS 0 0 **7** No 0 1 **6** No *rbcL* 0 4 **3** KX702300 1 6 0 KX702301 Pinaceae *At103* 0 7 0 No 7 0 0 --- ITS 0 5 **2** No 7 0 0 --- *rbcL* 0 0 **7** KX702302 7 0 0 --- Poaceae *At103* 0 7 0 KX394241 3 3 **1** KX394242 ITS 0 7 0 KX352747 0 7 0 KX352748 *rbcL* 0 4 **3** No 2 5 0 KX702292 Simaroubaceae *At103* 3 4 0 KX394234 0 0 **7** KX394235 ITS 2 3 **2** No 0 7 0 KX352741 *rbcL* 3 0 **4** KX702280 0 7 0 KX702281 Typhaceae *At103* 0 0 **7** KX394249 3 0 **4** KX394250 ITS 0 6 **1** No 0 7 0 No *rbcL* 0 4 **3** KX702305 2 1 **4** No Vitaceae *At103* 0 0 **7** KX394238 4 0 **3** KX394239 ITS 1 1 **5** KX352742 0 5 **2** KX352743 *rbcL* 0 0 **7** KX702284 4 3 0 KX702285 Families are listed alphabetically with the number of replicates (out of a total of seven) that showed no bands, multiple bands, or one band. The number of replicates that were successfully amplified with a single band are provided in boldface. Plant samples were amplified with three different primer pairs: ITS, *rbcL*, and *At103*. --- = PCR was not successful and, as a result, sequencing was not performed; No = sequencing was performed on an amplicon, but was not successful. GenBank accession numbers are provided for amplicons for which PCR and sequencing were successful. RESULTS ======= Quantification and quality assessment ------------------------------------- Spectrophotometric estimations of nucleic acid concentrations of CTAB-extracted samples were considerably higher than those of FTA card--extracted samples ([Fig. 2A](#fig2){ref-type="fig"}). However, there was not a substantial difference in average detected concentration among the 15 sampled species. Although the CTAB-extracted samples were much more concentrated, the CTAB sample concentration values were more variable than those of the FTA card--extracted samples. FTA card samples had an average standard error for concentration of 7.81 ng/μL while that of the CTAB-extracted samples was 37.96 ng/μL. The average 260/280 absorbance ratio was closer to 1.8 for CTAB-extracted samples compared to those for FTA card--extracted samples ([Fig. 2B](#fig2){ref-type="fig"}). The FTA card--extracted, amplified samples also had 260/280 ratios that were indicative of lower quality. Quant-iT fluorometry showed that the CTAB-extracted samples contained large, but highly variable concentrations of DNA, while the DNA extracted with the FTA cards was relatively undetectable with this method ([Fig. 2C](#fig2){ref-type="fig"}). Like the spectrophotometric measurements, there were no substantial differences in average concentration among the 15 sampled species. Because spectrophotometry does not discriminate between RNA and DNA as effectively as the fluorometric method, the greater quantities of DNA estimated by the spectral absorbance values ([Fig. 2A](#fig2){ref-type="fig"} vs. [Fig. 2C](#fig2){ref-type="fig"}) might be an artifact of the copurified RNA with the DNA in the samples. Gel separations of the samples indicate that all of these total genomic DNA extracts contained unfragmented, high-molecular-weight DNA, except for the Typhaceae samples extracted with the FTA card method ([Fig. 3](#fig3){ref-type="fig"}). PCR amplification and DNA sequencing ------------------------------------ CTAB and FTA card samples for all families were generally successful in amplification of *At103*, ITS, and *rbcL* ([Table 2](#tbl2){ref-type="table"}). Despite the differences seen in the appearance of each plant print on the FTA cards ([Fig. 1](#fig1){ref-type="fig"}), all but the conifer *Pinus virginiana* could be successfully amplified with at least one primer pair ([Table 2](#tbl2){ref-type="table"}). The *rbcL* amplicons were the most amenable to cycle sequencing, resulting in high-quality chromatograms for at least one CTAB and/or FTA card sample of each species ([Table 2](#tbl2){ref-type="table"}). The *At103* marker most readily amplified and sequenced for families Aquifoliaceae, Aspleniaceae, Cactaceae, Fabaceae, Lamiaceae, Oxalidaceae, Poaceae, Simaroubaceae, Typhaceae, and Vitaceae. The most successful families for amplification and sequencing with the ITS5a/ITS4 primers were Aquifoliaceae, Asclepiadaceae, Asteraceae, Cactaceae, Cyperaceae, Poaceae, Simaroubaceae, and Vitaceae. These results indicated that, even if the leaf did not create a dark chlorophyll print, amplifiable DNA was captured by the FTA card. DISCUSSION ========== The FTA card method could have great utility in the study of non-agricultural plant phylogenetics and population genetics, as it addresses some shortcomings of the CTAB-based technique, including facility of collection and transportation. During field collection, kilogram quantities of silica would not need to be transported to preserve specimens for CTAB-based extraction methods, allowing more specimens to be collected. While collection permits are usually required for sampling plants, a U.S. Department of Agriculture Animal and Plant Health Inspection Service (USDA-APHIS) permit is not necessary for acquiring the actual plant tissue embedded on an FTA card, because the material cannot be propagated, as would whole-rooted plants, rhizomes, and seeds (V. Funk, personal communication). Additionally, because the FTA card embedding procedure may destroy RNA from viruses ([@bib9]), biosafety issues may not arise when transporting plant tissues between states and between countries. The FTA cards are more compactly stored and do not require refrigeration. Finally, the FTA card--extraction method requires less laboratory expertise and fewer hazardous chemicals such as CTAB, chloroform, and phenol ([@bib14]; [@bib12]; [@bib6]). The FTA card and CTAB extraction methods both exhibited varying levels of success. CTAB-extracted samples contained higher concentrations of DNA as estimated by their A260/A280 absorbance ratios. Between replicates of the same species there was greater variation in concentration among those extracted with the CTAB-based vs. the FTA card methods. This inconsistent quantity of DNA recovered from the CTAB procedure may have been an artifact of the AutoGen instrument, as has been previously reported ([@bib13]). The increased concentrations of DNA detected in the CTAB-extracted samples is a major consideration in determining the overall utility of the two methods. The differences in DNA concentration for CTAB- and FTA card--extracted samples could have been due to the differences in amount of leaf tissue originally used for extraction. Approximately 1 cm^2^ of leaf tissue was used for each CTAB-extracted sample, while for FTA card--extracted samples the amount of DNA produced depended on the concentration and amount of fluid transferred from the leaves to the card. The total genomic DNA gels ([Fig. 3](#fig3){ref-type="fig"}) indicated that the FTA card--extracted samples contained a less-fragmented DNA when compared to the CTAB-extracted samples. In contrast to the FTA card--extracted DNA, it was observed that RNA and/or degraded DNA could easily be detected in gel separations of the CTAB-extracted DNA.The amount of PCR product generated was approximately correlated with the concentration of the DNA extract used. Although many of the amplification success rates were similar between the two extraction methods, the CTAB-extracted samples on average amplified more consistently ([Table 2](#tbl2){ref-type="table"}). Only the Cactaceae, Cyperaceae, and Simaroubaceae species were amplified more successfully with the FTA card--extracted samples. In addition to the conifer and fern species, the families of the species that successfully amplified and sequenced were distributed evenly throughout the Angiosperm Phylogeny Group (APG) III phylogeny for flowering plants ([@bib2]; [Tables 1](#tbl1){ref-type="table"}, [2](#tbl2){ref-type="table"}). In summary, this study provided a more comprehensive understanding of the strengths and weaknesses of using Whatman FTA cards for non-agricultural species. Although the FTA card--extracted samples had a substantially lower concentration of DNA, the method is a good alternative for field collection if well-optimized primer pairs are being used that can amplify low concentrations of template DNA. The previous success of FTA cards with large sample sizes in agricultural studies indicates that it could be a suitable method for studies in plant population genetics and conservation biology that require the analysis of hundreds to thousands of samples ([@bib1]; [@bib6]). The FTA card method may work better for some families than for others. For example, we believe the FTA card method may work well for those families and genera phylogenetically related to and/or physiologically similar to the Cactaceae and Pinaceae. Finally, while FTA cards have been used previously for extracting insect nucleic acids for RNA-Seq next-generation sequencing studies ([@bib8]), future work should focus on whether plant DNA and/or RNA extracted with the FTA cards could be used for some next-generation sequencing techniques (i.e., RNA-Seq, and possibly RAD-Seq, Genotyping by Sequencing \[GBS\], and targeted enrichment; [@bib15]). By increasing the number and size of punches produced from the cards, FTA card--extracted samples might provide enough material suitable for the latter DNA-based next-generation sequencing methods. [^1]: The study could not have been completed without the field expertise of Dr. Carol Kelloff. The authors would also like to thank Gabriel Johnson of the Smithsonian Institution and Juannan Zhou of the University of Maryland, who provided invaluable insights and mentorship throughout the research process. Laboratory and computer work were conducted in and with the support of the Laboratories of Analytic Biology facilities of the Smithsonian National Museum of Natural History. [^2]: These authors contributed equally to this work.

Note: Because some of the information in this article may be outdated, it has been archived. In the mid-1980’s scientists began to extol the promises of gene-therapy. Conceptually (and if you consider the world only at the sub-microscopic level), gene therapy is a logical, straightforward solution to genetic disease: if a gene seems to be causing a disease, then to cure the disease scientists must remove the “bad” gene, and substitute or add a “good” gene. The reality is much more complex. Though more than three hundred gene therapy protocols, involving more than four thousand patients, have been approved for human trials in the United States, gene therapy has yet to fulfill its promise of curing any genetic disease. Researchers propose that this new polymer is as effective as viruses for gene therapy. Part of the polymer, which has been tested in mice with ovarian cancer, is pictured here. Credit: Jordan Green - MIT Jesse died because of a gene therapy experiment. Jesse: gene therapy gone wrong On September 17th, 1999, eighteen-year-old Jesse Gelsinger died as a result of his voluntary participation in a gene-therapy experiment, becoming the first known human victim of this technology. Jesse’s experience illuminates important elements in gene therapy that should make government agencies, scientists, and the public take the need to regulate and oversee this technology very seriously. Jesse had a rare genetic disease, known as ornithine transcarbamylase (OTC) deficiency, which affected his ability to rid his body of ammonia, a usual, but toxic, breakdown product of protein. Half of children with OTC die in their first month of life, and half die before their fifth birthday. Jesse had a mild form of the disease because some of his enzymes were functioning normally. He was therefore able to control the disease with diet and drugs, though he needed to take 32 pills a day. Ironically, Jesse would not have benefited from the experiment. The therapy was intended to help babies with a rare genetic disease. The experimental protocol for which Jesse volunteered had no chance of providing him, or any of the other volunteers, with any benefit. It was designed only to test the safety of a treatment that would be used on babies with the fatal form of OTC. The scientists who designed the protocol at the University of Pennsylvania’s Institute for Gene Therapy, Dr. James Wilson and Dr. Mark Batshaw, believed that OTC could be surmounted with gene therapy. They hoped to infuse babies who had OTC with genes that would help them produce the missing enzymes. In order to get these genes into the patient’s cells, Dr. Wilson developed a weakened cold virus (known as adenovirus) which was designed to enter the cells as any virus would, but, instead of delivering disease, it was supposed to deliver the corrective OTC gene. Wilson and Batshaw hoped that the infusion of adenovirus and corrective genes could be used to reduce infant fatalities by controlling the high levels of ammonia in babies with OTC immediately after birth. Wilson and Batshaw worked together to develop the OTC protocol and, in 1995, they submitted it to the National Institute of Health’s (NIH) Recombinant DNA Advisory Committee (RAC) and the Food and Drug Administration (FDA) for review and approval, as is required for all human experiments involving gene therapy. Doctors did not foresee serious side effects or fatality. Jesse was deemed eligible for the study and assigned to the final test subject group—the group that would receive the highest dose of adenovirus. At the time, the researchers believed that in the worst case, the trial might result in an inflamed liver. On September 13, 1999 Dr. Raper injected 30 milliliters of the adenovirus with the corrective OTC gene into Jesse’s bloodstream. According to the physicians, Jesse’s severe immune system reaction led to multiple-organ-system failure and he died on September 17th, 1999, four days after the gene-therapy injection. The safety of gene therapy Human gene therapy trials raise the questions: Some test animals died before human trials. How safe must an experiment be before it is ethical to try it on humans? Prior to the human protocol, Batshaw and Wilson had done animal studies to help prove that OTC gene therapy was ready for human trial. They cited more than 20 experiments on mice to prove the efficacy of the treatment, and 12 safety studies in mice, Rhesus monkeys and baboons [several Rhesus monkeys died after intense immune system reactions like Jesse’s to high doses of adenovirus]. Some reviewers were concerned but the FDA approved the trials. Is the review process efficient? The mandatory review of human gene therapy experiments by the FDA and RAC is supposed to add another level of precaution. However, critics of this process have often stated that the current regulatory framework — review by the NIH’s RAC and approval by the FDA — creates an ineffectual review process. When Wilson and Batshaw first presented their protocol for review by the RAC, both of the RAC scientists reviewing the protocol had reservations about approving it. However, continued negotiations between the federal reviewers (including RAC and FDA officials) and the University of Pennsylvania scientists resulted in approval of the protocol. Following the report of Jesse Gelsinger’s death, and subsequent revelations of six other deaths in gene therapy experiments in New York and Massachusetts, the National Institute of Health (NIH) RAC convened a three-day public inquiry into Jesse’s death, the conduct of gene therapy research, and the safety of using adenovirus. The FDA argued that After Jesse’s death, problems were found with the trial process. Jesse’s liver was not functioning well enough at the time of the infusion of adenovirus, and he should not have been eligible for the study. Pennsylvania scientists had violated FDA regulations by failing to report information about patients who had experienced serious side effects that could have ended the trial. The informed consent document that Jesse signed deviated from the one approved by the agency when it reviewed the protocol (the new consent form had made no mention of the severe immune system responses to adenovirus that led to the deaths of the monkeys). On January 21, 2000, the FDA indefinitely shut down human gene therapy experiments at the University of Pennsylvania. The trials will remain “on-hold” until the Institute responds formally to the FDA’s report, and convinces the FDA that it can properly follow the federal rules designed to ensure the safety of study volunteers. Since the news of Jesse’s death was first brought to the attention of government regulators and the public in September 1999, further evidence of serious risks to patient safety in other gene therapy experiments has come to light. The NIH received 691 reports of “serious adverse events” in gene therapy experiments. Though the current regulatory structure requires researchers to promptly notify the NIH as problems arise, 652 of these reports had never been presented to the NIH. At least two gene therapy experiments reported patient deaths. Though in both cases researchers decided that the deaths were not related to the gene therapy treatment, their reports indicate that, in fact, researchers cannot conclusively say what caused some of the patient deaths. Corporate interests in gene therapy In addition to questions of safety, the massive amount of corporate interest in the development of gene therapy technology raises questions that can only be addressed with diligence. Intense commercial interest in gene therapy may create conflicts between business decisions and medical decisions. In the case of the gene therapy trial that led to Jesse’s death: Concerns about conflict of interest were raised. Dr. James Wilson, the head of the Institute for Gene Therapy at the University of Pennsylvania, also owns a private company called Genovo Inc, which he founded in 1992. Genovo has the rights to any discoveries made by Wilson at his University of Pennsylvania lab. Through this arrangement, Genovo has access to Wilson’s discoveries, at the same time minimizing its business risks as the company can let the lab run the clinical trials prior to deciding to invest. The NIH, further reduced Genovo’s risk and maximized the company’s benefits by funding the OTC trial in which Jesse took part. Genovo also has a financial stake in the adenovirus variation Wilson developed and tested on Jesse in the human gene therapy trial, which would have been very marketable if it had been successful. In addition, BIOGEN, a Cambridge-based biotechnology company, has paid Genovo thirty-seven million dollars since 1995 for the right to eventually market any liver and lung related therapies developed by Genovo. Genovo shares the money from BIOGEN with Dr. Wilson’s Institute at U. Penn, and in fact the Biogen money accounts for twenty percent of the Institute’s budget. The Genovo-Biogen deal (which is up for renewal this year) calls for Genovo to make progress in moving gene therapy towards a marketable product. Willing and able volunteers People with genetic disorders are vulnerable to medical scams or promises. The intense corporate interest in human gene therapy becomes even more disturbing when considered in conjunction with the fact that people are literally lining up to be test subjects for clinical trials. Gene therapy gives promise to people who are desperately searching for hope. It is a technology marketed as a cure for genetic disease — diseases that often lead to suffering which is entirely unjustifiable. If a friend or a family member had a genetic disease, and you watched him or her suffer without respite or chance of cure, wouldn’t you jump at any opportunity to end that? This scenario raises serious concerns since it puts a most vulnerable and well-meaning group of people at serious risk without adequate protections. Initially, Wilson and Batshaw believed that the protocol should be tried on infants with severe OTC, as the therapy was designed specifically for these babies. But Arthur Caplan, the resident bioethics expert at the University of Pennsylvania disagreed. He stated that it would be unethical to experiment with sick babies because the parents of dying infants are too stressed to be able to give informed consent. Consequently, Wilson and Batshaw decided to use stable adults for the protocol-men like Jesse who had the disease but were surviving with drugs and diet, and women who carry the gene linked to OTC. This shift from dying infants to stable adults meant that people who were living with their disease and benefiting from conventional treatments were put at risk in situations which would not produce any benefit for them. Some participants had been coerced into the gene therapy trial. The NIH/RAC hearings after Jesse’s death also made public the fact that some of the volunteers for this study were recruited in a coercive manner — using internet sites and newsletters which detailed the promise of the therapy if it worked and which stressed the need for human subjects. This type of information, placed where it would be seen by a population sensitive to the problems of living with a genetic disease, raises further issues about getting truly informed, voluntary subjects for human experimentation. Conclusion: Gene therapy trial procedures and the review process need to be reevaluated. Conclusion Human gene therapy experimentation raises many issues. The promise of the technology is represented as very great and the reality of it is very dangerous. Human gene therapy must be seriously and cautiously evaluated. Without increased and more effective oversight, Jesse’s death could be the first of many in gene therapy. Though Jesse’s participation in the human trial did not provide him or the infants with OTC with any benefit, it did perhaps lead to something even more important in this field. Jesse’s death has forced researchers and government officials to reappraise the current framework and structure of gene therapy research, to reexamine informed consent procedures, and to take public responsibility for their actions. Actionbioscience.org Editor’s Update: In early October 2002, the U.S. Food and Drug Administration (FDA) halted several gene therapy trials in the U.S. after a boy in France developed a leukemia-like disease almost three years after undergoing gene therapy. The boy was one of four who were given the therapy for a rare immune system disorder. The FDA did not cancel another 150 or so gene therapy trials because these trials targeted disorders other than severe combined immunodeficiency. (Source: FDA’s Division of Cellular and Gene Therapies and Los Angeles Times) Sophia M. Kolehmainen, J.D., is the Director of Programs for the Council for Responsible Genetics and an editorial board member of their bimonthly newsletter, GeneWatch. She has authored articles on the social, ethical, and legal implications of human and agricultural genetics, and is licensed to practice law in Massachusetts. http://www.gene-watch.org/programs/privacy/insurance.html 5/6/09: No longer available.5/6/09: Sophia M. Kolehmainen, J.D., is now the Deputy Director of The Cedar Tree Foundation. http://www.cedartreefound.org/staff.html Public information on gene therapy Read a book Altered Fates : Gene Therapy and the Retooling of Human Life by Jeff Lyon, Peter Gorner (contributor), [W.W. Norton & Co., 1996]. Lyon and Gorner, a pair of Chicago Tribune reporters, present the science, scientists, and ethics of a technology that may have a greater impact on humanity’s fate than nuclear weapons: genetic manipulation. They reveal the possibility of curing thousands of inherited diseases in addition to viral ones, such as AIDS. educatorresources Teaching Resources from the Northwest Association for Biomedical Research (NWABR) The Northwest Association for Biomedical Research (NWABR) strengthens public trust in research through education and dialogue. Its diverse membership spans academic, industry, non-profit research institutes, health care, and voluntary health organizations. Through membership and extensive education programs, it fosters a shared commitment to the ethical conduct of research and ensures the vitality of the life sciences community. Ethics Primer The Ethics Primer provides engaging, interactive, and classroom-friendly lesson ideas for integrating ethical issues into a science classroom. It also provides basic background on ethics as a discipline, with straightforward descriptions of major ethical theories. Several decision-making frameworks are included to help students apply reasoned analysis to ethical issues. http://www.nwabr.org/curriculum/ethics-primerIntroductory Bioinformatics: Genetic Testing The curriculum unit explores how bioinformatics is applied to genetic testing. Students are also introduced to principles-based bioethics in order to support their thoughtful consideration of the many social and ethical implications of genetic testing. Throughout the unit, students are presented with a number of career options in which the tools of bioinformatics are used. http://www.nwabr.org/curriculum/introductory-bioinformatics-genetic-testingBioethics 101 Bioethics 101 provides a systematic, five-lesson introductory course to support educators in incorporating bioethics into the classroom through the use of sequential, day-to-day lesson plans. This curriculum is designed to help science teachers in guiding their students to analyze issues using scientific facts, ethical principles, and reasoned judgment. http://www.nwabr.org/curriculum/bioethics-101For the Greater Good The “For the Greater Good” series is composed of five featured articles. Each article portrays one author’s personal stories of people and animals whose lives have been improved or saved by medical breakthroughs made possible by animal research. The Curriculum Guide includes a 5-lesson unit outlining the use of models in both science and ethics, and provides resources for exploring the use of animals in research. http://www.nwabr.org/curriculum/greater-goodHIV Vaccines Our HIV Vaccine Curriculum Unit focuses on engaging students in considering the elements of a vaccine trial. Students explore the life cycle and structure of HIV, different vaccine types, ethical issues related to research studies with human participants, and global contexts of vaccine trials. http://www.nwabr.org/curriculum/hiv-vaccines The Dolan DNA Learning Center Case Studies in Genetic Screening The following is a simplified simulation of genetic screening for four specific mutations and a suggested format for exploring the different ethical issues that might result from such genetic testing. This activity is appropriate for advanced and AP biology students after some explanation and study of DNA biotechnology techniques, specifically restriction enzyme digests, gel electrophoresis, blotting, hybridization with probes, and autoradiography. http://www.accessexcellence.org/AE/AEPC/WWC/1992/gen_screen2.php

Liquid crystal display (LCD) devices are well known and are useful in a number of applications where light weight, low power and a flat panel displays are desired. Typically, these devices comprise a pair of sheet-like, glass substrate elements, or "half-cells," overlying one another with liquid crystal material confined between the glass substrates. The substrates are sealed at their periphery with a sealant to form the cell or device. Transparent electrodes are generally applied to the interior surface of the substrates to allow the application of an electric field at various points on the substrates thereby forming addressable pixel areas on the display. Examples of useful liquid crystal materials are twisted nematic, super twisted nematic and ferroelectric liquid crystal mixtures. It is desirable to manufacture large area displays of relatively light weight for use in portable devices such as computers, overhead projectors and the like. Certain organic, polymeric substrates are much lighter than glass and are therefore preferred for use over glass in large area, lightweight displays. However, these substrates tend to be more flexible than glass and must be separated by a dense population of spacers to maintain uniform separation between the closely spaced half cells forming the LCD device. This problem is even more severe with surface stabilized ferroelectric liquid crystal displays which require a nominal 2 .mu.m spacing controlled to within 0.1 .mu.m for good results to produce a uniform electric field at low voltages and show uniform contrast across the entire display area. This uniform spacing is required to provide precise control of the shallow cavity containing the liquid crystal material. Means for achieving the required spacing uniformity include using either precisely dimensioned, short-length polymeric fibers or spheres as in U.S. Pat. No 4,501,471 or spacing members made of photoresist material bonded to the substrate as in U.S. Pat. No. 4,720,173. Each of these methods has deficiencies. Fiber and spheroidal spacing particles are not easily placed uniformly on the substrate to maintain even spacing over the entire area and fibers may overlap to increase the spacer height. Moreover, when the device flexes or is otherwise physically stressed, the spacers may shift or migrate to cause starved areas in the display cell. Bonded structural members must be precisely positioned on each substrate with exactly the same height, a feat that is difficult given the dimensions and tolerances required for effective liquid crystal displays. If members have different chemical composition from the substrate, differential thermal expansion may occur, which causes possible fracture of the bond at the interface and shifting of the spacing member. Many of these deficiencies were addressed by imparting polymeric substrates with a microstructure comprising uniform height ridges to maintain uniform cell gaps as disclosed in U.S. Pat. No. 5,268,782 (Wenz), which is incorporated herein by reference. The microstructured substrate disclosed by Wenz provided spacers that would not shift or fracture because the microstructure was physically and chemically integral with the substrate. Therefore, no bonding was required between the spacers and the substrate with which they were integral. In addition, the fabrication of the microstructured substrate could be controlled well within a 0.1 .mu.m or less tolerance even over large areas (tens and hundreds of square centimeters), making it possible to construct large area, light weight displays while preserving uniform contrast across the display. One primary difficulty with the Wenz approach is that all currently available thermoplastic polymer materials suitable for the formation of the microstructured ridges and having the desired optical properties tend to be soluble in or to absorb either the liquid crystal mixtures or alignment layer solvents during processing, operation, and storage of the devices. Such reactions with the substrate polymer adversely affect the optical properties of the substrate, which may cause problems ranging from aberrations in the LCD to failure of the device. To prevent interactions between the LCD material and the spacing members, the microstructured surface may be coated with a thin layer (about 500 to 2000 Angstrom) of silicon dioxide by vacuum deposition prior to contact with the liquid crystal or alignment layer materials. While the silicon dioxide layer provides an adequate barrier as deposited, formation of a complete LCD requires exposure of the substrate to elevated temperatures during, for example, alignment layer processing, storage, and post-fill annealing. Exposure to these elevated temperatures causes the silicon dioxide coating to fracture, particularly at high stress points, due to the large difference in coefficients of thermal expansion between the silicon dioxide coating and the polymer substrate. The fractures in the silicon dioxide layer provide areas of contact between the liquid crystal and the substrate. This may result in absorption of the liquid crystal by the substrate at these fracture points, causing local swelling of the substrate. The local swelling leads to failure of the display due to the uncontrolled optical retardation and disruption of the uniform spacing gap caused by the absorbed liquid crystal in the substrate. Polymers that are impervious to liquid crystal mixtures and to alignment layer solvents may also be applied to the spacer members to form a barrier. These polymers can be chosen or formulated to have coefficients of thermal expansion that closely match that of the substrate polymer. Polymer coatings may be applied over the microstructured substrates disclosed by Wenz using methods such as coating and subsequent cross-linking of a thin liquid resin, or evaporation coating of a polymer layer, over the existing microstructure. However, such polymer coating methods are inadequate to simultaneously provide the required protection of the substrate and the required level of cell gap uniformity between the microstructured ridges. Thin coatings (&lt;0.1 .mu.m) do not provide an adequate barrier, whereas thicker coatings (&gt;0.1 .mu.m) do not replicate the microstructure within tolerances and thus cause display non-uniformities. Another shortcoming with the Wenz approach is that it is not transferable to glass substrates or to substrates other than those that can be imparted with the microstructure. For such substrates, less reliable spacer means, such as fibers, glass beads, and photoresist ribs would need to be employed. A major driving force for the advancement of electronic display technology is the ability to provide larger displays having higher resolution. Such advances cannot be made without the development of substrate materials and materials combinations that may be adapted to large area display applications and allow precise control of sub-micrometer dimensions.

Trifluoroacetyl chloride is a known commercially useful compound that can be used to synthesize important industrial products. For example, it can be hydrolyzed according to known techniques to obtain trifluoroacetic acid which then can be used either as a dimerization catalyst of unsaturated aliphatic hydrocarbons in the production of pharmaceutical products or as the active ingredient in pesticide formulations. It is known that trifluoroacetyl chloride can be synthesized by noncatalytic processes. French Pat. No. 2,226,380 describes the synthesis of trifluoroacetyl chloride by subjecting 1,1-dichlorotrifluoroethane and oxygen in the gaseous phase to ultraviolet radiation. This process requires extensive safety measures to avoid the danger of explosion, highly complex photochemical equipment, and large amounts of light and caloric energy. In addition to these drawbacks, the process produces a relatively low yield of trifluoroacetyl chloride. French Pat. No. 1,385,111 discloses a process for photochemical chlorination of pure liquid fluoral at about -30.degree. C. in the presence of ultraviolet light. This method cannot be used commercially because fluoral polymerizes so rapidly that storage of this material is difficult. Also, the process of the French patent does not provide a satisfactory reaction rate or a sufficiently high yield. It is also known that trifluoracetyl chloride can be synthesized catalytically from compounds other than fluoral. For example, French Pat. No. 2,038,257 describes the catalytic oxidation of 1,1,1-trichlorotrifluoroethane with sulfur trioxide. This process has two disadvantages; the use of toxic catalysts with a mercuric sulfate base and the formation of a troublesome sulfuryl chloride byproduct. French Pat. No. 2,169,221 relates to a process for preparing trifluoroacetic acid, one step of which consists of catalytically transforming trifluoroacetyl fluoride into trifluoroacetyl chloride in the presence of carbon tetrachloride, chloroform, or trichlorofluoro methane. This method has the disadvantage of inevitably forming byproducts such as, for example, trichlorofluoro methane when carbon tetrachloride is used.

1. Introduction {#sec1-life-07-00040} =============== Although the Earth is the only body known to host life, the number of stars and planets in the Universe encourages us to believe that life appeared elsewhere. The discovery of life arising independently elsewhere would have important consequences for science and, indeed, for humanity. In particular, it would permit better understanding of the origin of life on an Earth whose early geological record has been lost due to crustal recycling and plate tectonics. This quest, the basis of astrobiology \[[@B1-life-07-00040]\], is thus one of the most important objectives in the exploration of the Universe. Astrobiology gathers together scientists from various domains, from astronomers to biologists via geologists, through chemists, physicists and philosophers. Due to this very wide and interdisciplinary coverage, and due to the fundamental nature of the discoveries in this domain, astrobiologists are often requested to communicate with the general public through conferences, interviews, or training courses. However, discussing extraterrestrial life with people not directly involved in the domain can rapidly become challenging, largely due to the influence of science fiction in films, books or on the internet upon popular culture. Questions about UFOs, the Roswell Incident and other conspiracy theories are common during these kinds of discourses. It is, therefore, necessary to replace astrobiology in a rigorous scientific framework and to find a simple way to explain the difference between looking for microbial life and looking for extraterrestrial intelligence, without neglecting the possibility of the latter. Here, we present a simple statistical approach permitting us to put into perspective this astrobiological challenge. Based on the Darwinian theory of evolution, it is logical to suppose that the first life was simple microbial life. From this, to reach the stage of intelligent organisms, several consecutive important stages are needed, such as the evolution of photosynthesis, the development of nucleus- and mitochondria-like structures, multicellularity, etc. many stages that require particular environmental conditions. Implicitly, it is thus easy to conceive that simple microbial life would be statistically more common in the Universe than any type of advanced extraterrestrial intelligence. Consequently, considering that inhabited bodies are distributed randomly in space in the Universe, it is implied that highly sophisticated forms of life are statistically further from the Earth than microbial forms of life. On the other hand, if the probability of finding extraterrestrial life and intelligence increases with the distance from the Earth, the number of detectable biosignatures decreases due to technical limitations. This competition between probability and detectability constitutes the main challenge in astrobiology. In this study, we attempt to illustrate this fact using a statistical approach based on our knowledge of the Milky Way, the Solar System and the evolution of life on Earth. We propose an equation permitting us to obtain the order of magnitude of the probability of life at different stages of evolution and the distance between Earth and the associated bodies in our galaxy. The consequences on the detection of the associated biosignatures are then discussed. This approach allows us to easily explain why it is very improbable that we will be able to detect a signal of extraterrestrial intelligence while, at the same time, it is justified to send space probes dedicated to the search for microbial life in the Solar System. This approach is also an effective way in which to tackle other subjects and notions with general public, among them the vastness of the Universe, the distances in astronomy, the definition of life, and space exploration. 2. General Overview and Probabilistic Concept {#sec2-life-07-00040} ============================================= 2.1. On the Conditions Required for Life to Appear {#sec2dot1-life-07-00040} -------------------------------------------------- There are many definitions of life (see R. Popa, 2004, for a discussion of more than 100 definitions \[[@B2-life-07-00040]\]), but the one we use here is the following. Schematically, a living system can be defined as a self-replicating open system capable of (Darwinian) evolution \[[@B3-life-07-00040],[@B4-life-07-00040]\]. However, when searching for life elsewhere in the Universe, scientists must focus their investigations on detectable forms of life, i.e., life forms that are not too different to us. For chemical and physical reasons (tetravalence, hybridisation, bond energy, etc.), it can be considered that only carbon permits the formation of molecules complex and varied enough to constitute living systems. It is thus generally admitted that most forms of life would be based on organic chemistry and comprised of the elements C, H, N and O, as well as P and S \[[@B5-life-07-00040]\]. Before evolution may occur, life must appear. The first hypothesis suggesting the origin of life as a complexification of chemical molecules in the atmosphere of the primitive Earth was proposed by Alexander Oparin in 1924 and then reinforced by the famous experiment of Stanley Miller and Harold Urey in 1953, the latter experiment obtaining amino acids from a gas mixture traversed by an electric arc to simulate lightning \[[@B6-life-07-00040],[@B7-life-07-00040]\]. Since then, it has been shown that the compositions and concentrations of the gases used were not perfectly relevant to the primitive Earth and that the production of amino acids by this method would have been less efficient. Nevertheless, this particular experiment is the basis of prebiotic chemistry and of exobiology in general. Organic molecules may also form near sea floor hot springs by Fisher-Tropsch reactions \[[@B8-life-07-00040]\]. Finally, many molecules have been detected in space \[[@B9-life-07-00040]\] and laboratory experiments have shown that a large variety of organic molecules can be formed in ice \[[@B10-life-07-00040],[@B11-life-07-00040]\]. They are also found in comets, as recently shown by the Rosetta mission \[[@B12-life-07-00040]\], and in meteorites \[[@B13-life-07-00040]\]. The Murchison meteorite contains several thousands of different organic molecules, in particular 70 amino acids of which 8 are proteinogenic \[[@B14-life-07-00040]\]. That so many pivotal organic molecules exist and survive in space has given credence to the Panspermia hypothesis, and further fuels postulation that life may be able to undergo transport through space on scales larger than that of a single planet \[[@B15-life-07-00040]\]. Chemists considered that the first 'living systems' were formed on Earth by a suite of chemical reactions involving these different molecules. For these reactions to occur, liquid water played a key role, in particular due to its exceptional properties, for instance of allowing for the stability of key chemical bonds to create and maintain chiral macrostructures while favouring the breakup of other bonds to permit chemical interchange \[[@B5-life-07-00040],[@B16-life-07-00040],[@B17-life-07-00040]\]. Indeed, all known living organisms on Earth are assemblages of carbon molecules containing liquid water. Prebiotic chemistry experimentation and modelling is continuously increasing our understanding of the reactions leading to the formation of the building blocks of life: nucleic acids and bases, amino acids, and lipids \[[@B18-life-07-00040]\]. In particular, present studies in this domain now focus their investigations on the reaction of organic molecules in liquid water in contact with mineral surfaces sensu lato, in what is commonly called the primordial soup (see e.g., \[[@B17-life-07-00040],[@B19-life-07-00040]\]). The energy source needed for the reactions to occur could have been light from the Sun, a geological heat source (thermal gradient associated with hydrothermal systems, and stemming from the heat flux of the cooling Earth), radioactivity (now-extinct radionuclides responsible for much heat flux on the early Earth), or another, unknown, cause. Considering all of the above, one can conclude that a rocky body hosting liquid water that can be sown with organic molecules by meteoritic input and/or Fischer-Tropch type reactions, and where these products can be reprocessed in chemical reactors in a presence of a source of energy, is needed for life to appear and to develop. These conditions may appear to be relatively strict but are in reality common in the Universe. Moreover, they apply to life forms with which we are familiar (i.e., Terrestrial life) and thus for life as we seek it. Note, however, that astrobiologists do not exclude the possibility of unexpected types of life \[[@B20-life-07-00040]\]. 2.2. On the Probability of the Occurrence of Extraterrestrial Life {#sec2dot2-life-07-00040} ------------------------------------------------------------------ The statistical approach is the best way to estimate the probability of extraterrestrial life. Thus, Frank Drake tried to estimate the number of civilisations in the Milky Way capable of emitting a detectable sign into space, and willing to communicate, using his now-famous equation \[[@B21-life-07-00040]\]. The Drake equation is the product of several probabilistic terms, most of them difficult to evaluate \[[@B22-life-07-00040]\]. Depending on the specificities of the approach, the number of extant intelligent civilisations capable of communication in the Milky Way may be lower than one, meaning that the existence of intelligent life forms is very unlikely and that the number of extraterrestrial civilisations is lower than the number of galaxies in the Universe; alternatively, it may be of the order of several tens of thousands. Many studies attempting to solve this equation have been published, some with specific focus on particular terms of the equation or the use of new approaches based on different mathematical models (e.g., \[[@B23-life-07-00040],[@B24-life-07-00040],[@B25-life-07-00040],[@B26-life-07-00040],[@B27-life-07-00040],[@B28-life-07-00040],[@B29-life-07-00040]\]). The Ozma project (1960) and the Frank Drake study (1961) are at the origin of the Search for Extra-Terrestrial Intelligence (SETI) programme looking for intelligent signals using, in particular, the Arecibo telescope to collect data for the seti\@home project (<http://setiathome.berkeley.edu/>). Nevertheless, in astrobiology, the search for extraterrestrial life is not limited to intelligent civilisations. On the contrary, research in this domain mostly focuses on microbial life, particularly with respect to the Solar System. Thus, S. Seager undertook a broader approach to investigate the detectability of life on exoplanets located in the habitable zone of their star \[[@B30-life-07-00040],[@B31-life-07-00040]\]. In her study, the author attempted to calculate the number of planets upon which life emerged and developed sufficiently to change the atmosphere by the emission of biogases, yet still near enough to be detected from the Earth. More recently, D. Waltham estimated the probability of reaching more or less evolved life on habitable Earth-like exoplanets \[[@B32-life-07-00040]\]. Note, however, that it is theoretically possible for microbial life to appear even if the host body is not globally habitable \[[@B33-life-07-00040]\]. At the microbial scale, recent exploration of the Solar System has shown that environments compatible with the existence of life may be relatively common in the Universe and it is widely believed that life may have appeared on other bodies in the Solar System, for example below the icy crust of the moons of Saturn and Jupiter, or on Mars \[[@B34-life-07-00040],[@B35-life-07-00040],[@B36-life-07-00040]\]. Detecting potential remains or traces of life will be one of the aims of in situ investigations of the Martian surface made by the future ESA/Roscosmos ExoMars 2020 rover, and by the NASA Mars 2020 mission. If life appeared on a solid body other than the Earth in the Solar System, this should mean that life is very common in the Universe, statistically leading to a strong increase in the number of potential civilisations estimated by the Drake equation. Concomitantly, the absence of traces of life on another 'habitable' body in the Solar System does not mean that life is unique to the Earth, but it does mean that it is potentially rarer in the Universe. Here, we extend the statistical approach used by F. Drake, S. Seager and D. Waltham \[[@B21-life-07-00040],[@B30-life-07-00040],[@B31-life-07-00040],[@B32-life-07-00040]\] to the concept of life in general in order to include the search for past or present microbial life in the Solar System. 2.3. The More Complex, the Less Probable {#sec2dot3-life-07-00040} ---------------------------------------- Defining the complexity of an organism is not obvious. Indeed complex, self-organising structures and organisms do not require complex mechanisms of formation \[[@B37-life-07-00040]\], nor should simple structures and organisms be the expected results of simpler processes. Darwinian evolution is a continuous process that leads equally to the diversity of life, as well as to its complexity. However, for general public outreach, it is useful to illustrate the complexity of life by using particular forms of life that are representative of chronological stages of evolution. We choose : (1) microbial life forms similar to unicellular prokaryotes, (2) macroscopic multicellular organisms as defined by J. Kasting \[[@B38-life-07-00040]\], i.e., similar to those of the Ediacaran biota, and (3) intelligent forms of life (civilisations). Throughout this study, after each calculated term, the stage of evolution to which that term applies will be indicated in brackets by $\left( Mic. \right)$, $\left( Mac. \right)$ and $\left( Civ. \right)$ respectively. The global approach to estimate the probability of extraterrestrial life consists of solving an equation composed of several terms that are: (i) a number of particular stars or planets of interest in our galaxy or in the Universe, (ii) a proportion of these stars or planets meeting particular criteria, or (iii) a probability that a particular event occurred, such as the appearance of life. With increasing astronomical knowledge, it is now possible to make a reasonable estimation of the value of the numerical and proportional terms regarding other stars and exoplanets. The Solar System can also be used as a model to estimate some proportional terms related to bodies too small to be observed in other stellar systems. 3. Equations for Life in the Universe {#sec3-life-07-00040} ===================================== 3.1. Probability Equation for Life in the Universe {#sec3dot1-life-07-00040} -------------------------------------------------- We define the proportion of bodies presently hosting one of the three stages of life $P_{Life}$ as a product of different terms:$$P_{Life} = p_{S} \times p_{B} \times p_{C} \times p_{L} \times p_{R} \times p_{P}$$ with:$p_{S}$: the proportion of stellar systems having a star compatible with the occurrence of the considered stage of life.$p_{B}$: the proportion of these stellar systems having at least one rocky body located at a distance from the star compatible with the considered stage of life, i.e., within its habitable zone.$p_{C}$: the proportion of these bodies compatible with the emergence of life.$p_{L}$: the probability that life appeared on these bodies.$p_{R}$: the probability that life reached the considered evolutionary stage on these bodies.$p_{P}$: the probability that life at this evolutionary stage is still active on these bodies. This is equivalent to the probability of co-existence occurrence of this stage of life on several bodies simultaneously. The resolution of Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}) is fully dependent on the considered evolutionary stage of life (microbial, complex, or intelligent); the values attributed to the different terms are not the same for intelligent forms of life and for microbial life. 3.2. Converting Probabilities into Distances {#sec3dot2-life-07-00040} -------------------------------------------- There are about 200 billion stars in the Milky Way. The number $N_{Life}$ of bodies in our galaxy hosting the considered stage of life is given by:$$N_{Life} = P_{Life} \times 200 \times 10^{9}$$ Using the value of $N_{Life}$ given by Equation ([2](#FD2-life-07-00040){ref-type="disp-formula"}), it is possible to deduce the average distance $D_{Life}$ between two of the considered bodies. The Milky Way is a flattened disk approximately 100,000 light years (ly) in diameter and 6000 ly in thickness. Its volume is thus equal to:$$V_{M.W.} = 4.7 \times 10^{13}{ly}^{3}$$ The average distance $D_{Life}$ between two potentially inhabited planets is therefore:$$D_{Life} = \sqrt[3]{\frac{V_{M.W.}}{N_{Life}}}$$ It is important to note that this distance may vary due to the inhomogeneity of the galaxy. Indeed, the density of stars is, for instance, higher in the arms of the galaxy and globally increases with the decreasing radial distance from the centre of the galaxy. The distance $D_{Life}$ would thus be lower in these parts of the galaxy and most of the habitable planets are expected to be located in the inner Galaxy \[[@B39-life-07-00040]\]. On the other hand, our Solar System is located at an average distance from the centre of the Milky Way, in the arm of Orion. The distance given by Equation ([4](#FD4-life-07-00040){ref-type="disp-formula"}) can thus be considered as representative of the average distance between the Earth and other considered inhabited planets. In the following, the values of $P_{Life}$, $N_{Life}$ and $D_{Life}$ are estimated for the three considered stages of life. 4. Solving the Equations {#sec4-life-07-00040} ======================== 4.1. Astronomical Terms {#sec4dot1-life-07-00040} ----------------------- The three first terms in Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}) are representative of astronomical parameters. They can be estimated with a relatively good accuracy based on our knowledge of the Universe and data coming from various telescopes. $p_{s}$ is the proportion of stellar systems having a star compatible with the occurrence of the considered stage of life. The essential requirements of prokaryote-like unicellular life are relatively simple; this kind of life form does not require as much energy or nutrients as macroscopic multicellular organisms in order to flourish. While being broadly globally distributed on Earth, certain strains of microbes can also develop patchily, for instance in ecological niches at the sub-millimetre scale \[[@B33-life-07-00040]\]. Therefore, it is expected that prokaryote-like life could develop at the surface or subsurface of planets or satellites. Most stars are thought to have at least one planet \[[@B40-life-07-00040]\], and many planets are thought to have satellite(s) \[[@B41-life-07-00040]\]. Even if the presence of extraterrestrial life is not probable around massive blue giants due to their very short lifetime, exoplanets have been found around them \[[@B42-life-07-00040]\] and these systems can thus potentially host habitable niches without requiring that life had the time to appear. Thus, we can consider that more or less all stellar systems have bodies compatible with prokaryote-like unicellular life and $p_{S}\left( Mic. \right)$ can be approximated to 100%. In contrast to this, multicellular macroscopic organisms only appeared on Earth after several billion years of evolution, and only after the rise of atmospheric oxygen in the Great Oxygenation Event \[[@B43-life-07-00040],[@B44-life-07-00040]\], implying that photosynthetic organisms played a key role in the rise of multicellularity. Using a restrictive approach, it is thus possible to consider that multicellular macroscopic organisms may only develop under the influence of a star small enough to be stable for several billions of years, but large enough to produce the energy required, i.e., 'Sun-like stars' \[[@B45-life-07-00040]\]. This is ever truer for extraterrestrial civilisations. In the Milky Way, with the proportion of 'Sun-like stars' being around 10%, it is possible to set $p_{S}\left( Mac. \right) = p_{S}\left( Civ. \right) = 10\%$. $p_{B}$ is the proportion of previous stellar systems having at least a rocky body located at a distance from the star compatible with the considered stage of life. To be habitable at the global scale, a planet must be located in the habitable zone of its star, i.e., where the liquid water can be stable at the surface \[[@B46-life-07-00040],[@B47-life-07-00040]\]. Petigura et al., howed that about 22% of Sun-like stars would have a planet located in the habitable zone \[[@B45-life-07-00040]\]. The term $p_{B}$ for macroscopic life and intelligent civilisations can thus be set $p_{B}\left( Mac. \right) = p_{B}\left( Civ. \right) = 22\%$. In contrast, for unicellular prokaryote-like organisms that can develop in ecological niches in subsurface of any rocky body (planets or icy moons) where there is liquid water, the concept of a habitable zone around a star being restricted to bodies with stable liquid water at the surface is no longer valid. The habitable zone becomes so vastly extended that $p_{B}\left( Mic. \right)$ can be set at $p_{B}\left( Mic. \right) = 100\%$. $p_{C}$ is the proportion of the previous bodies compatible with the emergence of life. In the Solar System, the smallest body upon which life may have appeared is Enceladus, a moon of Saturn \[[@B36-life-07-00040]\]. There are 8 planets and 19 moons larger than or equal in size to Enceladus in the Solar System and six of them (the Earth, Mars, Enceladus, Europa, Ganymede, and Titan) have, or had, environmental conditions compatible with the emergence of life, i.e., 22% of them. Using the Solar System as an example, we can set $p_{C}\left( Mic. \right) = 22\%$. The planets located in the habitable zone of their star are not necessarily compatible with complex life. In particular, atmospheric evolution would play a key role in the habitability of a planet through time. For instance, a planet could lose its atmosphere with the consequence that liquid water would no longer be stable at its surface (similar to Mars), or a planet may have environmental conditions that are incompatible with the emergence of life (Venus, for instance). The observation of exoplanets located in the habitable zone of their star is still relatively limited and the proportion of planets located in the habitable zone of Sun-like stars that are truly habitable is difficult to determine. However, of the confirmed exoplanets located in the habitable zone of their star, only 'mesoplanets', i.e., planets where the temperature at the surface is potentially between 0 and 50 °C, are compatible with complex life. Our knowledge about surface properties of exoplanets is very limited, however, following [https://fr.wikipedia.org/wiki/Liste_d'exoplanètes_potentiellement_habitables](https://fr.wikipedia.org/wiki/Liste_d’exoplanètes_potentiellement_habitables), we can roughly estimate this proportion to be 75%. The terms $p_{C}\left( Mac. \right)$ and $p_{c}\left( Civ. \right)$ can thus be set to 75%. This term appears to be higher for macroscopic multicellular life and extraterrestrial civilisations than for prokaryote-like organisms but this can be explained by the fact that it applies to planets located in the habitable zone in the case of complex and intelligent life, while for it applies to any rocky bodies in the case of prokaryotic life. 4.2. Empirical Terms {#sec4dot2-life-07-00040} -------------------- The main problem of astrobiology is the fact that the only known life is life on Earth. This unique example engenders the biggest challenge of our approach, which is to estimate the order of magnitude of the probabilistic terms related to life itself corresponding to the last three terms in Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}). What is the probability for life to appear on a habitable planet? What is the probability that life evolves into macroscopic multicellular organisms? And into intelligent organisms? C. Maccone described Darwinian Evolution as an exponential growth of evolution with time, leading to an increase in the probability of extraterrestrial civilisations with time \[[@B26-life-07-00040],[@B27-life-07-00040],[@B28-life-07-00040],[@B29-life-07-00040]\]. In the present model, less mathematically developed than that of C. Maccone, we also based our approach on the fact that, with increasing time, there is more possibility for life to evolve. Using life on Earth as a reference, we thus considered that the probability to reach each of the three considered stages of evolution is inversely proportional to the ratio of the time they spent to appear on Earth over the time in which they could have appeared. This approach, which consists in considering that the time span between when conditions are required for an event to occur and the moment when it effectively occurs provides a metric of the probability of this event, has been used before to evaluate the probability of abiogenesis based on the history of life on Earth and has been discussed by Spiegel and Turner (2012) \[[@B48-life-07-00040]\]. Similarly, we also considered that the probability of coexistence of a given stage of evolution corresponds to the ratio of the time it would have been present on the Earth over the total existing time of the Earth. This approach is illustrated in [Figure 1](#life-07-00040-f001){ref-type="fig"}. In order to estimate probability using this method, several examples would normally be required. Indeed, our approach amounts to saying that life on Earth is the paragon of life in the Universe, which is extremely hypothetical, and even optimistic. Furthermore, if the chemical processes leading to abiogenesis can be considered as relatively 'simple', evolution of life is very sensitive to the environment and the different stages of evolution considered in this study are the consequences of very specific properties and events that occurred during the history of the Earth such as the formation of the Moon, plate tectonics, major extinction events, etc. Our approach thus demands more speculation as the stage of evolution increases. In any case, it is an easy way to obtain orders of magnitudes that can be discussed later. $p_{L}$ is the probability that life appeared on the bodies where the considered stage of life could appear. For habitable planets, if we look at the Earth, we could be tempted to set the probability of appearance of life to 100%. However, as explained by C.S. Cockell, a habitable planet does not necessarily mean an inhabited planet \[[@B49-life-07-00040],[@B50-life-07-00040]\]. The proportion $p_{L}$ of habitable planets where life indeed appeared is thus not necessarily equal to 100%. If we look at the Solar System, there is presently only one planet in the habitable zone and it was inhabited about 300 million years after its formation 4.543 Ga ago. It is also well established that there was surface liquid water 4.3 Ga ago \[[@B51-life-07-00040]\]. Moreover, it was showed that the Earth will remain in the habitable zone of the Sun for a further 1 billion years \[[@B52-life-07-00040]\]. Ergo, life appeared after 300 million years during the total 5.3 billion years of Earth habitability, i.e., approximately at 6% of that duration. Using our approach, since the probability of occurrence of that event is considered to be inversely proportional to the time it took to occur, we consider that the probability of appearance of life of any type on a habitable planet is $p_{L}\left( Mac. \right) = p_{L}\left( Civ. \right) = 94\%$. Due to our approach itself, the rapid appearance of life on Earth leads to this very high value of $p_{L}$ for habitable planets. However, and as stated previously by \[[@B48-life-07-00040]\], the rapid appearance of life on Earth does not necessarily mean that the same process of abiogenesis occurred with equal rapidity elsewhere. For prokaryote-like life potentially inhabiting ecological niches, life on Earth cannot be used as a model since, even it is chemically plausible, we do not know if life actually appeared, for example in the deep sea of Europa. It is thus preferable to advocate a conservative view saying that out of the six bodies of the Solar System where life could have appeared, it only appeared on the Earth; we thus set $p_{L}\left( Mic. \right) =$ 17%. $p_{R}$ is the probability that life reached the considered stage on the considered bodies. For prokaryote-like life it is thus 100% (if life emerged, it emerged as prokaryotic life, as per our model) and $p_{R}\left( Mic. \right) = 100\%$. On Earth, the first occurrence of proposed macroscopic multicellular life has been described from 2.1 Ga old black shales in Gabon \[[@B53-life-07-00040]\]. This is debated but we can consider that multicellular life began to undeniably proliferate during the Ediacaran, 600 Ma ago, i.e., after 3.8 billion years out of the 5.3 billion years of Earth's habitability, i.e., approximately after 72% of that duration. Following the same reasoning as above, we can thus set $p_{R}\left( Mac. \right) = 28\%$. Finally, Homo sapiens, which developed the first intelligent civilisation on Earth, appeared 200 000 years ago, i.e., after 4.3 billion years out of the 5.3 billion years of Earth's habitability, i.e., approximately at 81% of that duration. Following the same reasoning as above, we can thus set $p_{R}\left( Civ. \right) = 19\%$. $p_{P}$ is the probability that the considered life is still presently active on the bodies in question. As stated previously, it is equivalent to the probability of life having reached a given stage of evolution on two bodies simultaneously. Prokaryotes are known to be very resistant and to have a very great capacity for adaptation to environmental stresses at both the local and regional scale. Only a global change affecting the whole considered body, both at the surface and in the subsurface, would lead to the disappearance of prokaryote-like unicellular life. We can thus consider that microbial life could survive until the end of the life of the stellar system in which they developed. On Earth they would then have been present during about 9 billion years over the estimated 10 billion years of life time of the Solar System, before the Sun becomes a Red Giant. We can thus set $p_{P}\left( Mic. \right) = 90\%$. Similarly, since it appeared on Earth, macroscopic multicellular life never completely disappears despite catastrophic events, but rather changes its distribution, mode and faunal hierarchy \[[@B54-life-07-00040],[@B55-life-07-00040]\]. If we consider that macroscopic life will remain on the Earth until it remains habitable at its surface, for another further 1 billion years, the Earth's surface would have been inhabited by macroscopic multicellular life during about 1.6 billion years out of the 10 billion year lifetime of the Solar System. We can thus set $p_{P}\left( Mac. \right) = 16\%$. The duration of a civilisation is difficult to evaluate. If we decide to be very conservative (or even pessimistic) and state that humanity might disappear today, from the emergence of Homo sapiens, it would have existed during 2 × $10^{- 3}$% of the life time of the Solar System. We can thus set $p_{P}\left( Civ. \right) = 0.002\%$. 4.3. Results {#sec4dot3-life-07-00040} ------------ ### 4.3.1. Prokaryote-Like Unicellular Life {#sec4dot3dot1-life-07-00040} From Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}), the proportion of stellar system hosting prokaryote-like unicellular life is given by:$$P_{Life}\left( Mic. \right) = 1 \times 1 \times 0.22 \times 0.17 \times 1 \times 0.9 = 3.37\%$$ The corresponding number of bodies inhabited by prokaryote-like unicellular life in the Milky Way is estimated using Equations ([2](#FD2-life-07-00040){ref-type="disp-formula"}) and ([5](#FD5-life-07-00040){ref-type="disp-formula"}):$$N_{Life}\left( Mic. \right) = 6.73 \times 10^{9}$$ The associated average distance between two stellar systems inhabited by prokaryote-like unicellular life is given by Equations ([4](#FD4-life-07-00040){ref-type="disp-formula"}) and ([6](#FD6-life-07-00040){ref-type="disp-formula"}): $$D_{Life}\left( Mic. \right) = 19{ly}$$ ### 4.3.2. Macroscopic Multicellular Life {#sec4dot3dot2-life-07-00040} From Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}), the proportion of stellar systems hosting macroscopic multicellular life is given by:$$P_{Life}\left( Mac. \right) = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 0.28 \times 0.16 = 0.07\%$$ The corresponding number of planets inhabited by macroscopic multicellular life in the Milky Way is estimated from Equations ([2](#FD2-life-07-00040){ref-type="disp-formula"}) to ([8](#FD8-life-07-00040){ref-type="disp-formula"}):$$N_{Life}\left( Mac. \right) = 1.39 \times 10^{8}$$ Equations ([4](#FD4-life-07-00040){ref-type="disp-formula"}) and ([9](#FD9-life-07-00040){ref-type="disp-formula"}) permit us to deduce the average distance between two planets inhabited by macroscopic multicellular life:$$D_{Life}\left( Mac. \right) = 70{ly}$$ ### 4.3.3. Intelligent Civilisations {#sec4dot3dot3-life-07-00040} Finally, the proportion of stellar systems hosting intelligent civilisations is given by:$$P_{Life}\left( Civ. \right) = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 0.19 \times 0.00002 = 6 \times 10^{- 6}\%$$ Thus, after Equations ([2](#FD2-life-07-00040){ref-type="disp-formula"}) and ([11](#FD11-life-07-00040){ref-type="disp-formula"}), the estimated number of present civilisations in our galaxy is:$$N_{Life}\left( Civ. \right) = {11,788}$$ This number is in the upper estimate of the value found by solving the Drake equation. However, in our model we considered intelligent civilisation to be approximated as 'humanity since the appearance of *Homo sapiens*', whereas the Drake equation considered 'humanity since its ability to communicate by radio signal'. We made this calculation only for the Milky Way but there are ≈350 billion galaxies in the Universe, each containing approximately the same number of stars. The number of intelligent civilisations in the Universe could thus reach several thousand billion. Using Equations ([4](#FD4-life-07-00040){ref-type="disp-formula"}) and ([12](#FD12-life-07-00040){ref-type="disp-formula"}), it is possible to deduce the average distance between two intelligent civilisations in the Milky Way, that is to say the average distance from the Earth:$$D_{Life}\left( Civ. \right) = 1586{ly}$$ ### 4.3.4. Considering Past Life {#sec4dot3dot4-life-07-00040} Multicellular organisms may disappear but their traces may survive until the end of the life of the stellar system in which they developed. On Earth these traces would therefore have been present and available for detection over about 5.6 billion years out of the estimated 10 billion year lifetime of the Solar System. We can thus set $p_{P}\left( Mac. \right)_{Past} = 56\%$. The proportion of stellar systems hosting past macroscopic multicellular life is then given by:$$P_{Life}\left( Mac. \right)_{Past} = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 0.28 \times 0.56 = 0.24\%$$ The corresponding number of planets in the Milky Way from Equations ([2](#FD2-life-07-00040){ref-type="disp-formula"}) to ([14](#FD14-life-07-00040){ref-type="disp-formula"}) is:$$N_{Life}\left( Mac. \right)_{Past} = 4.86 \times 10^{8}$$ Equations ([4](#FD4-life-07-00040){ref-type="disp-formula"}) and ([15](#FD15-life-07-00040){ref-type="disp-formula"}) permit us to deduce the average distance between two planets that are or have been inhabited by macroscopic multicellular life: $$D_{Life}\left( Mac. \right)_{Past} = 46{ly}$$ Similarly, civilisations could have also disappeared. On Earth these traces would then have been present during about 5 billion years over the estimated 10 billion years of life time of the Solar System. The probability that past traces of civilisation exist around a star is then given by setting $p_{P}\left( Civ. \right)_{past} = 0.5$ in Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}). This leads to:$$P_{Life}\left( Civ. \right)_{Past} = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 0.19 \times 0.5 = 0.15\%$$ Equations ([2](#FD2-life-07-00040){ref-type="disp-formula"}) and ([17](#FD17-life-07-00040){ref-type="disp-formula"}) lead to the estimated number of past civilisations in our galaxy:$$N_{Life}\left( Civ. \right)_{Past} = 2.95 \times 10^{8}$$ Traces of past civilisations could thus be present relatively 'close' to the Solar System since the average distance between two past civilisations is, using Equations ([4](#FD4-life-07-00040){ref-type="disp-formula"}) and ([18](#FD18-life-07-00040){ref-type="disp-formula"}):$$D_{Life}\left( Civ. \right)_{Past} = 54{ly}$$ This value is very low meaning that, potentially, traces of more or less developed past civilisations could be common in the Milky Way. 4.4. Summary {#sec4dot4-life-07-00040} ------------ The results of Equations ([5](#FD5-life-07-00040){ref-type="disp-formula"})--([19](#FD19-life-07-00040){ref-type="disp-formula"}) are compiled in [Table 1](#life-07-00040-t001){ref-type="table"}. Of course, these values must be considered with caution and not as 'true' values. The key point here is to compare the order of magnitude of the different probabilities. The probability that there is prokaryote-like life around a star is about 48 times higher than the probability that there is active macroscopic multicellular life and 571,000 times higher than the probability that there is an active civilisation. On the contrary, the probability of finding relics of a past civilisation on an exoplanet is only 23 times lower than the probability to find microbial life. This is intuitively sensible from what we know of the terrestrial fossil records of bacteria versus the fossil records of animals, versus the archaeological records of humans. [Figure 2](#life-07-00040-f002){ref-type="fig"} describes the schematic evolution of life on a habitable planet from its origin to the disappearance of its stellar system. The green arrows emphasise that, for life of a higher evolutionary stage, the timescale for which it exists decreases dramatically. On the other hand, the yellow arrows show that the duration of existence of the associated traces of past life could, in all cases, potentially exist for a long time. 5. On the Detection of Extraterrestrial Life {#sec5-life-07-00040} ============================================ The search for life in the Universe is driven by the detection of biosignatures. Biosignatures are either more or less obvious depending on the life form that produces these signatures. For example, life is axiomatic on Earth because of the full range that exists from simple microbial to complex intelligent life, and their plethora of activities at the global scale. On the contrary, given the inclement habitable conditions, potential life on Mars would be prokaryote-like and would not have evolved sufficiently to have left a global signature, for example atmospheric oxygen produced by photosynthetisers \[[@B33-life-07-00040],[@B56-life-07-00040]\]. Finally, biosignatures associated with past traces of life can be altered or even destroyed with time, in particular those associated with microbial life, which have been vastly reduced following the rise of the benthic biome at the Cambrian Explosion of animal life. The techniques involved in the detection of biosignatures are thus all the more 'sophisticated' since they are concerned with detecting primitive life forms. The use of sophisticated, lab-based equipment is increasingly necessary to demonstrate the biogenicity of fossilised traces of microbial life. Importantly, with increasing distance from the Earth the number of techniques that can be used for biosignature detection rapidly decreases and, for those that are compatible with planetary exploration, their resolution and capabilities are generally decreased. These technical limitations have important consequences on the detection of extraterrestrial life. 5.1. Search for Extraterrestrial Prokaryote-Like Life {#sec5dot1-life-07-00040} ----------------------------------------------------- While the probability that prokaryote-like life exists elsewhere in the Milky Way is very high, microbes, particularly the most primitive chemosynthetic forms, are associated with subtle biosignatures. The search for extraterrestrial microbial life outside the Solar System is limited to life forms that have evolved enough to change the atmosphere of the planet in order to be detected by spectroscopy. The simultaneous presence of gases forming an unstable mixture (H~2~O, O~2~, O~3~, CH~4~, N~2~O, etc.) may be a good indicator of life \[[@B57-life-07-00040]\]. In particular, large amounts of O~2~ and O~3~ can be considered as a signature of oxygenic photosynthetic activity \[[@B58-life-07-00040]\] noting, at the same time, that small amounts of these gases can be produced abiotically \[[@B59-life-07-00040]\]. The probability of such a kind of life is therefore that of an intermediate stage between microbial unicellular and macroscopic multicellular life ([Figure 2](#life-07-00040-f002){ref-type="fig"}). The appearance of oxygenic photosynthetic life capable of changing the whole atmosphere of a planet sufficiently to be detected from the Earth requires that the surface of the planet is habitable, i.e., a planet located in the traditional habitable zone. It is then necessary to recalculate the different terms in Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}). The first terms $p_{S}$, $p_{B}$, $p_{C}$ and $p_{L}$ in Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}) are the same for surface photosynthetic microbial life and macroscopic multicellular life, i.e., 10%, 22%, 75% and 94% respectively. Although it probably appeared much earlier \[[@B60-life-07-00040],[@B61-life-07-00040]\], oxygenic photosynthetic life of Earth induced detectable changes in the atmosphere about 2.4 Ga ago with the Great Oxygenation Event, i.e., after 1.9 billion years out of the 5.3 billion years of Earth's habitability, i.e., approximately at 36% of that duration. Following the same reasoning as before, we can thus set $p_{R}\left( Mic. \right)_{Photo} = 64\%$. Similarly, if we consider that surface photosynthetic microbial life will remain on the Earth until it is no longer habitable at its surface, we can estimate $p_{P}\left( Mac. \right)_{Photo} = 34\%$. The proportion of stellar systems potentially hosting detectable photosynthetic life is then:$$P_{Life}\left( Mic. \right)_{Photo} = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 0.64 \times 0.34 = 0.34\%$$ The corresponding number of planets is:$$N_{Life}\left( Mic. \right)_{Photo} = 6.75 \times 10^{8}$$ Using this value, we can deduce the corresponding average distance $D_{Life}\left( Mic. \right)_{Photo}$:$$D_{Life}\left( Mic. \right)_{Photo} = 41{ly}$$ At this distance, it is possible to detect putatively biologically produced gases in the atmosphere of an exoplanet \[[@B62-life-07-00040]\]. If we look for microbes that are only detectable by in situ exploration, our investigations are limited to the Solar System. Of particular interest are the icy moons of Jupiter and Saturn, and the Martian subsurface. The proportion of stellar systems statistically inhabited by prokaryote-like life, given by Equation ([5](#FD5-life-07-00040){ref-type="disp-formula"}), is equal to 3.37%. This value can also be seen as the probability for a stellar system to host life. Since life appeared on Earth, it is thus necessary to consider the probability of a second origin of life in the same stellar system, corresponding to the square of Equation ([5](#FD5-life-07-00040){ref-type="disp-formula"}). The probability that life appeared on another body in the Solar System is thus only $P_{Life}\left( Mic. \right)_{SS} = 0.11\%$. This probability is relatively low. Moreover, if it exists, active life is expected to be present below the icy crust of the moons of Jupiter and Saturn, or several hundred meters deep in the subsurface of Mars \[[@B63-life-07-00040]\]. The exploration of the interior of these bodies to search for microbial life is very complicated and will not be possible in the near future. Presently, the investigations focus on the search for past traces of microbial life at the Martian surface. The existence of prokaryote-like microfossils on the surface of Mars necessarily presupposes the presence of microbial life at its surface in the past. This restriction modifies the value of $p_{C}$ (the proportion of the considered bodies compatible with the emergence of life at their surface). The conditions necessary for the emergence of life on the Martian surface were present during the Noachian \[[@B56-life-07-00040],[@B63-life-07-00040]\]. The first terms $p_{S}$, $p_{B}$, $p_{C}$ and $p_{L}$ in Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}) are the same for surface microbial life and macroscopic multicellular life, i.e., 10%, 22%, 75% and 94% respectively and $p_{R}\left( Mic. \right)_{Surf} = 100\%$, as previously determined for microbial life. On Earth, traces of prokaryote-like life would have been present during about 9.5 billion years over the estimated 10 billion year lifetime of the Solar System. We can thus set $p_{P}\left( Mic. \right)_{Surf} = 95\%$. As for potential active microbial life in the subsurface of icy moons, we therefore need to consider the probability for a second appearance of life in the Solar System. Consequently, the probability that there are microfossils at the surface of Mars is given by:$$P_{Life}\left( Mic \right)_{Mars - Past - Surf.} = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 1 \times 0.95 \times 0.337 = 0.05\%$$ This probability is not very high but can justify the launch of instruments dedicated to the search for traces of past prokaryote-like life on Mars surface. 5.2. Search for Macroscopic Multicellular Life {#sec5dot2-life-07-00040} ---------------------------------------------- Planets potentially inhabited by macroscopic multicellular life could be very common in the Milky Way. However, their distance from the Earth could be large: 70 ly as estimated by Equation ([10](#FD10-life-07-00040){ref-type="disp-formula"}). At this distance, direct observation is totally impossible and the only way to detect this kind of life is to search for modifications of the atmosphere of the planet using IR spectroscopy. The presence of forests (i.e., photosynthesising vegetation on exposed land masses) could also be confirmed using IR spectroscopy by the vegetation's Red Edge due to chlorophyll \[[@B64-life-07-00040]\], even if this signature is not unambiguous \[[@B65-life-07-00040]\] and if this kind of surface feature would be even more challenging to detect than atmospheric signatures. On Earth, we know that vegetation has covered much of the exposed landmass for approximately 400 Ma, since the Devonian, i.e., after 4.1 billion years over the 5.3 billion years of Earth habitability, i.e., after approximately 77% of that duration. Following the same reasoning as before, we can thus set $p_{R}\left( Mac. \right)_{Veg} = 23\%$. Similarly, $p_{P}\left( Mac. \right)_{Veg} = 14\%$. The proportion of stellar systems hosting vegetation is then:$$P_{Life}\left( Mac. \right)_{Veg} = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 0.23 \times 0.14 = 0.05\%$$ The corresponding number of planets inhabited by vegetation in the Milky Way is, from Equations ([2](#FD2-life-07-00040){ref-type="disp-formula"}) to ([24](#FD24-life-07-00040){ref-type="disp-formula"}):$$N_{Life}\left( Mac. \right)_{Veg} = 10 \times 10^{7}$$ Equations ([4](#FD4-life-07-00040){ref-type="disp-formula"}) and ([25](#FD25-life-07-00040){ref-type="disp-formula"}) permit us to estimate the average distance between two planets whose exposed crust is colonised by vegetation:$$D_{Life}\left( Mac. \right)_{Photo} = 78{ly}$$ Direct imaging of exoplanets will be needed to detect surface signatures like vegetation's Red Edge. Limited direct imaging of the surfaces of nearby rocky planets may be possible with the James Webb Space Telescope. However, even if the distance of 78 ly given by Equation ([26](#FD26-life-07-00040){ref-type="disp-formula"}) is reasonable for detection, it is probable that more powerful telescopes would be needed to really open the door to such observations. 5.3. Search for Extraterrestrial Civilisations {#sec5dot3-life-07-00040} ---------------------------------------------- Equation ([13](#FD13-life-07-00040){ref-type="disp-formula"}) results in an average distance between two extant extraterrestrial civilisations of 1586 ly. At this distance, the only detectable biosignature would be a radio signal, as previously envisaged by Cocconi and Morrison in 1959 \[[@B66-life-07-00040]\] and independently by F. Drake in 1965 \[[@B21-life-07-00040]\], or an optical signal, as proposed by Schwartz and Towne in 1961 \[[@B67-life-07-00040]\]. In order to be detected, intelligent life must thus have reached a higher echelon of evolution within 'intelligent life', corresponding to space communicating life. SETI research is now looking for signals in a large part of the electromagnetic spectrum, from gamma ray to radiowave. Moreover, the detection of exoplanets and the possibility to analyse their atmospheres permit envisaging the detection of new indirect 'technomarkers' associated with extraterrestrial civilisations not necessarily capable of and/or willing to communicating in space, such as pollutant molecules in atmospheres \[[@B68-life-07-00040]\], or in the aberration of light curves due to megastructures \[[@B69-life-07-00040]\]. Finally, recent works also envisaged the detection of life as we do not know it, thus increasing of the potential biosignatures associated with extraterrestrial life \[[@B70-life-07-00040]\]. The proportion of stellar systems inhabited by detectable civilisations is thus lower than the number previously calculated, since the terms $p_{R}$ and $p_{P}$ were determined by considering a definition of intelligent life from the appearance of *Homo sapiens*, and not from the appearance of radio communication. On Earth, intelligent life has been able to communicate at distance for only 100 years. With respect to the age of the Earth, the difference in time between the appearance of *Homo sapiens* and the 19th century is too small to change the term $p_{R}$ significantly. On the other hand, with respect to the timescale of human evolution up to the modern day, the time taken for an intelligent civilisation to be able to communicate in space strongly decreases the term $p_{p}$ giving the probability of simultaneity. Taking a pessimistic standpoint, we can set $p_{p}\left( Civ. \right)_{Com.} = 1 \times 10^{- 6}\%$ and finally the proportion of stellar systems hosting extant intelligent civilisations able to communicate by radio signal at the same time is:$$P_{Life}\left( Civ. \right)_{Com} = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 0.19 \times 0.00000001 = 2.9 \times 10^{- 9}\%$$ Following Equations ([2](#FD2-life-07-00040){ref-type="disp-formula"}) and ([27](#FD27-life-07-00040){ref-type="disp-formula"}), the associated number of civilisations in the Milky Way is thus:$$N_{Life}\left( Civ. \right)_{Com} = 6$$ The average distance between two civilisations able to communicate in the Milky Way is then given by Equation ([4](#FD4-life-07-00040){ref-type="disp-formula"}) and ([28](#FD28-life-07-00040){ref-type="disp-formula"}):$$D_{Life}\left( Civ. \right)_{Com} = {19,979}{ly}$$ This distance is very large. With signal travelling at the speed of light, it would take 39,958 years for a civilisation to receive an answer from another civilisation, a time frame much greater than the 100 years of duration of the radio communicating civilisation considered in the model. Thus, the probability to detect a radio-signal is very low and if one is detected one day it is possible that the emitting civilisation has since disappeared. This result could explain the Fermi paradox: even if the probability of the existence of extraterrestrial civilisations is relatively high, due to the distance between them, it is more or less impossible for them to communicate with one another. Using our model, an intelligent civilisation must be able to communicate in space for at least about 8937 years to have a chance to receive an answer from another civilisation; $D_{Life}\left( Civ. \right)_{Com}$ would then be approximately equal to 4468.5 ly. 5.4. Search for Past Extraterrestrial Civilisations {#sec5dot4-life-07-00040} --------------------------------------------------- Even if traces of past civilisations could be relatively common in the Milky Way, as indicated by Equation ([18](#FD18-life-07-00040){ref-type="disp-formula"}), unless they reached a high stage of evolution associated with large signatures such as those described in \[[@B71-life-07-00040]\], the only way to detect such relics would be in situ exploration, which is totally incompatible with the distance of 54 ly given by Equation ([19](#FD19-life-07-00040){ref-type="disp-formula"}). We have thus to consider the biosignatures associated with self-destructive civilisations envisaged by \[[@B71-life-07-00040]\] (e.g., nuclear detonation, stellar pollution or total planetary destruction). Indeed, some of these biosignatures may remain and be detectable by spectroscopic techniques for more than 100,000 years. In this case we can set $p_{p}\left( Civ. \right)_{S - D} = 1 \times 10^{- 3}\%$ and finally the proportion of stellar systems presently hosting detectable remains of self-destructive civilisations is:$$P_{Life}\left( Civ. \right)_{S - D} = 0.1 \times 0.22 \times 0.75 \times 0.94 \times 0.19 \times 0.00001 = 2.9 \times 10^{- 6}\%$$ Following Equations ([2](#FD2-life-07-00040){ref-type="disp-formula"}) and ([30](#FD30-life-07-00040){ref-type="disp-formula"}), the associated number of self-destructive civilisations in the Milky Way is thus:$$N_{Life}\left( Civ. \right)_{S - D} = 5894$$ The average distance between signature of self-destructive civilisations in the Milky Way is then given by Equations ([4](#FD4-life-07-00040){ref-type="disp-formula"}) and ([28](#FD28-life-07-00040){ref-type="disp-formula"}):$$D_{Life}\left( Civ. \right)_{S - D} = 1998{ly}$$ This distance is relatively large but some of the biosignatures described in \[[@B71-life-07-00040]\] could be detected. 5.5. Summary {#sec5dot5-life-07-00040} ------------ The results of Equations ([20](#FD20-life-07-00040){ref-type="disp-formula"})--([32](#FD32-life-07-00040){ref-type="disp-formula"}) are reported in [Table 2](#life-07-00040-t002){ref-type="table"}. Once again, these values must be treated with caution but they provide an indication of the type of extraterrestrial life that could be detected, its frequency, and the limitations engendered by the available detection techniques. 6. From Complex Modeling to General Public Outreach {#sec6-life-07-00040} =================================================== 6.1. Describing Important Astronomical Notions {#sec6dot1-life-07-00040} ---------------------------------------------- When engaging with general public, it is first necessary to illustrate astronomical distances. An effective way of so doing is to use a model at scale. For instance, using a tennis ball as the Sun, it is possible to represent both the size of the planets and their distances from the Sun as displayed in [Table 3](#life-07-00040-t003){ref-type="table"}. It is shown that, at this scale, Earth corresponds to a dot of half a millimetre located 7 meters from the Sun. More interestingly, it is shown that at this scale the closest star from the Sun (Proxima Centauri) corresponds to a 9 mm sphere located 1977 km far from the Sun, i.e., the distance from Algiers to Dublin or from Chicago to Miami. Thus, even if the distance between each planet of the Solar System appears high, they are very small in comparison with the distance separating stellar systems. This has a strong consequence on the exploration of space using in situ probes. Indeed, the order of magnitude of the speed of present spacecraft is about 20 km·s^−1^. At that speed, taking a straight line, and in the best trajectory configuration, it requires 5 h and 30 min to reach the Moon, 45 days for Mars, 1 year for Jupiter, 6 years and 326 days for Neptune and 67,272 years for Proxima Centauri. This short demonstration clearly illustrates that the in situ exploration of extraterrestrial bodies by humans is presently limited to the Solar System. The notion of spacetime is also very important. The speed of light in vacuum *c* is constant and equal to approximately 300,000 km·s^−1^. By constant, one means that the simple velocity vector addition formula does not apply: whatever the referential frame, the speed of light remains the same. The only way to explain this phenomenon is to introduce the notion of time dilatation, expressed by Albert Einstein. This time dilatation is associated with a contraction of lengths and an increase of energy in such a way that no body with mass can approach the speed of light. Moreover, any electromagnetic wave, including light as well as radio waves, cannot exceed the speed of light. At minimum, to reach the Earth, a radio message would require 1.3 s from the Moon, 4 min 20 s from Mars, 35 min from Jupiter, 4 h from Neptune and finally 4 years, 88 days, 16 h 40 min from Proxima Centauri. Since the speed of light is constant, it is useful to define the light-year unit corresponding to the distance travelled by light in vacuum in one year (365.25 days). It is approximately equal to 10,000 billion km. Proxima Centauri is thus 4.243 ly from the Sun. 6.2. Introducing the Probabilistic Approach {#sec6dot2-life-07-00040} ------------------------------------------- The initial goal of this paper was to illustrate the challenge of astrobiology to general public. The model outlined previously is too complex to be described in its entirety and is above all very speculative. However, it permits the introduction of notions pertaining to the origin of life and evolution, the major dichotomy existing between microbial and macroscopic multicellular life in terms of habitability requirements, life detection methods and their limits for space exploration due to technical limitation and/or astronomical distances. At the centre of this reflection is the fact that life is characterised by evolutionary processes, starting from auto-replicating organic molecules and finishing by becoming intelligent life (even artificial intelligence). It is now accepted that the theory of spontaneous generation is totally obsolete. Thus, it is possible to explain that, to reach the stage of intelligent organisms, life must necessarily pass through important stages that are development of cells (compartmentalisation), photosynthesis (metabolism), and multi-cellularity (complexity). Implicitly, this chronology implies that the further advanced an organism is from the origin of life, the less it is probable in the Universe. 6.3. From Intelligent to Microbial E.T. {#sec6dot3-life-07-00040} --------------------------------------- It is obvious that the general public is more interested by extraterrestrial intelligence than by extraterrestrial microbes. When approaching the notion of extraterrestrial life with the public, it is thus better to start with 'intelligence'. Firstly, it is important to say that science considers extraterrestrial intelligence as a possibility. One can highlight the Pioneer Plaque and the Voyager Golden Record. One may focus on two ideas: that (i) the more life is evolved, the less it is probable in the Universe, and (ii) that to reach the stage of intelligent life, it is necessary that the surface of the planet upon which it developed was located in the habitable zone of its star for several billion years. Consequently, from these ideas, we can state that, if they exist, intelligent civilisations are certainly very rare in the Universe, and statistically far from each other. The only way to detect them is thus to search for a radio or light signal, as hypothesised by Frank Drake and developed by the SETI institute with the Arecibo radiotelescope. However, using Drake's equation, or Equation ([27](#FD27-life-07-00040){ref-type="disp-formula"}) herein, we can hope that there are presently circa six intelligent civilisations in the Milky Way and, since there are approximately 350 billion galaxies, several hundred billion intelligent civilisations in the Universe. Assuming that these civilisations are homogeneously spread within our galaxy means that they are separated by approx. 20,000 ly (Equation ([29](#FD29-life-07-00040){ref-type="disp-formula"})). Taking into account Einstein's special relativity as described above, this means that physical contact between these civilisations is virtually impossible. Moreover, this also means that a message send into space will require 20,000 years to reach a planet inhabited by intelligent E.T. life and that this message would receive an answer not less than 40,000 years after it was sent. Over such a timescale, it is possible that the civilisation which sent the initial message would have disappeared before the answer arrives. Exchange with an extraterrestrial civilisation using radio communication is thus also very unlikely. On the other hand, the number of civilisations in the Milky Way reaches about 12,000 when considering intelligent civilisations not sufficiently developed to communicate in space, and more than several tens of millions when considering past civilisations (Equations ([11](#FD11-life-07-00040){ref-type="disp-formula"}) and ([17](#FD17-life-07-00040){ref-type="disp-formula"})). This means that planets inhabited by 'primitive' civilisations could exist at distances of only 1,586 ly (Equation [13](#FD13-life-07-00040){ref-type="disp-formula"}) and that traces of past civilisations could be present at only 54 ly (Equation ([19](#FD19-life-07-00040){ref-type="disp-formula"})), i.e., over 'human timescales'. However, the associated biosignatures would require in situ exploration to be detected, and they are too distant to be examined during human lifetimes. Even if less probable, a solution may be to detect past self-destructing civilisations due to the potentially long time duration for which their detectable remnants may endure \[[@B71-life-07-00040]\]. It is therefore necessary to consider what we can detect from Earth. We can now study the atmosphere of an exoplanet and attempt to detect the spectral signature of life's activity at its surface (biologically produced gases, for instance). Using our model, we obtained an average distance between the Earth and a planet inhabited by photosynthetic life of 41 ly, and of 78 ly for a planet colonised by vegetation (Equations ([22](#FD22-life-07-00040){ref-type="disp-formula"}) and ([26](#FD26-life-07-00040){ref-type="disp-formula"})). These distances are compatible with present and near-future instruments such as the Kepler or PLATO space telescopes. Microbial life does not have the same habitability requirement to develop. The notion of the traditional habitable zone is not applicable in this case, since habitable environments where microbial life may exist at depths of several kilometres in the ocean or in the crust. This means that the subsurface of Mars and the icy moons of Jupiter and Saturn could be inhabited. The problem in this case is that exploring these subsurface environments requires the kind of deep drilling very difficult to make in the near future. Finally, it is also possible to look for past traces of life at the surface of Mars. This is the aim of the future ESA-Roscosmos mission ExoMars 2020 and NASA Mars 2020 mission. Indeed, during the Noachian (≈3.5 Ga ago), the surface of Mars was habitable, with the presence of liquid water demonstrated by numerous previous missions. So life may have appeared and developed in certain particular areas at the surface before disappearing and/or migrating into the deep aquifer. Plate tectonics appears to have been very limited on Mars, and non-existent at present. We can thus expect that, if microbes were present at the surface of Mars several billion years ago, their remains would have been preserved from tectonic metamorphism and that microfossils could still be found at the surface. By analogy, we can expect to find structures relatively similar to those found in Archaean terrestrial rocks: micrometric cells of simple morphology (coccoidal, rod-shaped, filamentous) made of kerogen (insoluble carbonaceous matter). The difficulty is that, even on Earth using laboratory equipment, demonstrating the biotic origin of these structures is very challenging. It requires complementary geological, mineralogical and elemental evidence obtained using a wide range of techniques, including high-resolution and sophisticated instrumentation currently incompatible with the very limited payloads of in situ space probes. The NASA Mars 2020 mission therefore has the explicit objective of caching samples in preparation for a future sample return mission in order to analyse them in terrestrial laboratories around 2035. [Figure 3](#life-07-00040-f003){ref-type="fig"} shows the distribution of the number of biosignature detection techniques available and the increasing probability of extraterrestrial life versus its distance from the Earth. Note that the probability of extraterrestrial life and the stage of evolution that can be reached versus the distance from the Earth follow a similar evolution. The strong decrease observed in the number of available techniques is due to the impossibility of carrying out in situ exploration outside the Solar System. [Figure 3](#life-07-00040-f003){ref-type="fig"} permits us to illustrate how the concept of detectability constitutes the main challenge for proving the existence of the extraterrestrial life. While it is technically possible to detect microbial life in the Solar System, the probability of existence of this life is very low. On the other hand, if the probability of existence of evolved life out of the Solar system is very high, the detection techniques available to identify these biosignatures are very limited. The limiting criterion for the detection of extraterrestrial life is thus the low probability of the existence of such life at short distances and the restricted number of available detection techniques far from the Earth. Finally, [Figure 3](#life-07-00040-f003){ref-type="fig"} explains the fact that, in our study, photosynthetic life appears to be the form of life that is the most probable to be detected; the average distance from the Earth being statistically compatible with the associated detection techniques ([Table 2](#life-07-00040-t002){ref-type="table"}). 6.4. Testing the Approach with Teachers {#sec6dot4-life-07-00040} --------------------------------------- In the framework of the Maison Pour La Science, in Orléans, France, the Exobiology team of the CBM has organised 2 days of training courses about exobiology for teachers from primary schools and secondary schools (the French 'collège'). During these two days, all the aspects of the domain of astrobiology were tackled, from prebiotic chemistry, Earth-life evolution, the conditions of the primitive Earth, micropalaeontology, space instrumentation, exploration and search for extraterrestrial life. The aim of the training course is to give to the teachers a general background on the subject and to present them with easy tasks and projects that can be performed at school with their students (aged 6--15). For the courses concerning the search for extraterrestrial life, we used the approach proposed in [Section 6.1](#sec6dot1-life-07-00040){ref-type="sec"}, [Section 6.2](#sec6dot2-life-07-00040){ref-type="sec"} and [Section 6.3](#sec6dot3-life-07-00040){ref-type="sec"} of this paper. Then, in order to illustrate the consequences of the different points we proposed a task in which the students have at their disposal: \(i\) an information sheet containing practical information (the speed of light, the definition of a lightyear, the size of the Milky Way, the speed of present spacecraft and the different ingredients necessary for life); \(ii\) several information sheets describing different celestial bodies (the Moon, Mars, Enceladus, Gliese 667 Cc, Kepler-438b, and a fictional planet X28-42), types of mission (rover, sample return, satellite, optical telescope, and radiotelescope), and types of life (microfossils, microbes, photosynthetic organisms, complex multicellular organisms, ruins of a past intelligent civilisation, and a present extraterrestrial civilisation able of telecommunication). Each celestial body is described by its distance from the Earth, its surface temperature and pressure, and its habitability conditions. For the fictional planet X28-42, fictional values and complementary information are used (e.g., it is located at 20,000 ly from the Earth and has an intelligent civilisation at its surface, which has been capable of telecommunication for more than 10,000 years). Each type of mission is described, including the types of biosignatures that can be detected with that mission, and the distance of detection is given. Additionally, for each stage of life, the minimal requirement for its appearance and preservation is given, as well as its size, the associated biosignatures and the probability of its existence in the Milky Way (from very likely to almost zero). Finally, using this information, the students must complete a chart in which, for each body, they must identify the usable types of mission, the possible traces of life, the required type of mission, and the detectable traces of life (corresponding to the result of the three first parameters). They have then to make a conclusion for each body. In our exercise, it was concluded (i) that microfossils could be detected at the surface of Mars but that it will probably require a sample return mission, (ii) that we could detect photosynthetic life by analysing the atmosphere of Kepler-438b, and (iii) that the detection of traces of life is not possible on any of the other bodies, either for technical and/or astronomical reasons or because life could not appear. For instance, life is not possible on the Moon, and the exploration of Enceladus' subsurface ocean is not possible at present. Moreover, despite the fact that photosynthetic life is implied on Gliese 667Cc, within its fictitious construct in the task, the planet does not transit in front of its star, and therefore the signal of oxygenic gases will not be remotely detected. Finally, the radio signal coming from X28-42 will arrive on the Earth in no less than 10,000 years, making its detection on human timescales unfeasible. The reception from the teachers on the approach and on the exercise was very high. The survey filled by the participants at the end of the 2 days gave a satisfaction rate of 95%. 7. Conclusions {#sec7-life-07-00040} ============== We have used a more or less empirical statistical approach to evaluate the probability of the existence of extraterrestrial life as a function of its stage of evolution. The results permit determination of the order of magnitude of the distance separating these forms of life from the Earth. Depending on this distance, we discussed the potential of detectable biosignatures. Finally, we have shown that the more extraterrestrial life has evolved, the greater its likely distance from the Earth, and thus the lower the possibility of its detection. Consequently, if extraterrestrial civilisations are possible, we could only detect them at present if they are able to communicate in space using a radio or a light signal. Similarly, even if the probability of microbial life in other stellar systems is relatively high, we could only detect it on habitable planets if it has reached a sufficient stage of evolution to release gases that modify the atmosphere of the planet. Finally, even if we are now able to make in situ investigations on several potentially inhabited bodies of the Solar System, these investigations are still limited to surface exploration. The only current target on which we can search for extra-terrestrial life is thus Mars. Despite these apparently discouraging conclusions for the possibility to detect extraterrestrial life, this study also demonstrates that life is probably common in the Universe. Moreover, even if the probability to detect extraterrestrial intelligence is close to zero, the probability to detect photosynthetic life on exoplanets is not at all negligible. The probability to find active microbial life on a body other than Earth in the Solar System is also high enough to justify future projects involving investigation of the icy moons of Saturn and Jupiter, as well as the present and future missions to Mars. The approach outlined herein has been used to simply and successfully explain the challenge of astrobiology to the general public, in particular during a two day training course for teachers, and appeared to be very useful and well-understood. We thank the CNES for funding. We thank Allain-Gérald Faux and his colleagues from the Maison Pour La Science, Orléans, and Arnaud Lepot for their help and participation to the training course on Astrobiology organized at CBM since 2016. We thank the reviewers for their useful comments. Frédéric Foucher proposed the model and wrote the paper. Keyron Hickman-Lewis, André Brack, and Frances Westall contributed in the reflection and discussion about the model and in the the writing of the paper. The authors declare no conflict of interest. {#life-07-00040-f001} {#life-07-00040-f002} {#life-07-00040-f003} life-07-00040-t001_Table 1 ###### Values of the different parameters pi used for the solving of Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}), for the different 'stages' of life considered (see main text). $P_{Life}$ is the probability that a stellar system hosts the associated traces of life and $N_{Life}$ is the corresponding number of bodies in the Milky Way. Finally, $D_{Life}$ is the average distance in light years between two of these bodies (i.e., average distance from the Earth). Type of Life $\mathbf{\mathbf{p}_{\mathbf{S}}}$ $\mathbf{\mathbf{p}_{\mathbf{B}}}$ $\mathbf{\mathbf{p}_{\mathbf{C}}}$ $\mathbf{\mathbf{p}_{\mathbf{L}}}$ $\mathbf{\mathbf{p}_{\mathbf{R}}}$ $\mathbf{\mathbf{p}_{\mathbf{P}}}$ $\mathbf{\mathbf{p}_{\mathbf{Life}}}$ (%) $\mathbf{\mathbf{N}_{\mathbf{Life}}}$ $\mathbf{\mathbf{D}_{\mathbf{Life}}}$ (ly) ------------------------------------- ------------------------------------ ------------------------------------ ------------------------------------ ------------------------------------ ------------------------------------ ------------------------------------ ------------------------------------------- --------------------------------------- -------------------------------------------- Prokaryote-like life 1.00 1.00 0.22 0.17 1.00 0.90 3.36% 6.73 × 10^9^ 19 Macroscopic multicellular life 0.10 0.22 0.75 0.94 0.28 0.16 0.07% 1.39 × 10^8^ 70 Present civilisation 0.10 0.22 0.75 0.94 0.19 0.00002 0.000006% 11,788 1586 Past macroscopic multicellular life 0.10 0.22 0.75 0.94 0.28 0.56 0.24% 4.86 × 10^8^ 46 Past civilisation 0.10 0.22 0.75 0.94 0.19 0.50 0.15% 2.95 × 10^8^ 54 life-07-00040-t002_Table 2 ###### Values of the different parameters $p_{i}$ used for the solving of Equation ([1](#FD1-life-07-00040){ref-type="disp-formula"}), for the different kinds of life considered, taking into account their detectability from the Earth or by using in situ investigation (see main text). $P_{Life}$ is the probability that a stellar system or the considered body hosts the considered traces of extra-terrestrial life. Finally, $N_{Life}$ is the corresponding number of bodies in the Milky Way and $D_{Life}$ is the average distance in light years between these bodies (i.e., average distance from the Earth). Type of Life $\mathbf{\mathbf{p}_{\mathbf{S}}}$ $\mathbf{\mathbf{p}_{\mathbf{B}}}$ *$\mathbf{\mathbf{p}_{\mathbf{C}}}$* $\mathbf{\mathbf{p}_{\mathbf{L}}}$ $\mathbf{\mathbf{p}_{\mathbf{R}}}$ $\mathbf{\mathbf{p}_{\mathbf{P}}}$ $\mathbf{\mathbf{p}_{\mathbf{Life}}^{2\mathbf{nd}}}$ $\mathbf{\mathbf{p}_{\mathbf{Life}}}$ (%) $\mathbf{\mathbf{N}_{\mathbf{Life}}}$ $\mathbf{\mathbf{D}_{\mathbf{Life}}}$ (ly) ------------------------- ------------------------------------ ------------------------------------ -------------------------------------- ------------------------------------ ------------------------------------ ------------------------------------ ------------------------------------------------------ ------------------------------------------- --------------------------------------- -------------------------------------------- Extant extraterrestrial radio-communicating 0.10 0.22 0.75 0.94 0.19 1 × 10^8^ N.A. 2.9 $\times 10^{- 9}\%$ 6 19,979 life Past extraterrestrial self-destructing 0.10 0.22 0.75 0.94 0.19 1 × 10^5^ N.A. 2.9 × 10^−6^% 5894 1998 civilisation Vegetation 0.10 0.22 0.75 0.94 0.23 0.14 N.A. 0.05% 10 × 10^7^ 78 Photosynthetic life 0.10 0.22 0.75 0.94 0.64 0.34 N.A. 0.34% 6.75 × 10^8^ 41 Extraterrestrial microbial life 1.00 1.00 0.22 0.17 1.00 0.90 0.337 0.11% N.A. N.A. in the Solar System Microfossils on Mars 1.00 0.22 0.75 0.94 1.00 0.95 0.337 0.05% N.A. N.A. life-07-00040-t003_Table 3 ###### Illustrating the astronomical distances using a tennis ball to represent the Sun. If the Sun Had the Size of True Distance If the Sun Had the Size of ------------------ ----------- ---------------------------- -------------------- ---------------------------- Sun 1,395,200 65 0 0.0 Mercury 4900 0.23 58,000,000 2.7 Venus 12,000 0.56 108,000,000 5.0 The Earth 12,800 0.60 150,000,000 7.0 The Moon 3474 0.16 150,000,000 7.0 Mars 6800 0.32 228,000,000 10.6 Jupiter 140,000 6.52 780,000,000 36.3 Saturn 120,000 5.59 1,430,000,000 66.6 Uranus 52,000 2.42 2,880,000,000 134.2 Neptune 50,000 2.33 4,497,000,000 209.5 Proxima Centauri 200,000 9.32 42,430,000,000,000 1977 km

Processes for the production of microporous films are well known in the art. For example, U.S. Pat. No. 3,870,593 (which is incorporated herein by reference) describes a process wherein a microporous film is produced by: (1) dispersing finely divided particles of a non-hygroscopic inorganic salt such as calcium carbonate in a polymer; (2) forming a film from the polymer; and (3) stretching the film to provide microporosity. Methods of making composites of a microporous film and a nonwoven fabric are also known in the art. Such composites have been prepared by, for example, extrusion-coating a polymer film onto a nonwoven fabric. Prepared films and fabrics have also been bonded directly by a variety of means, including adhesive, thermal, and ultrasonic bonding. It may also be desirable to stretch microporous film/fabric composites, however, stretching has its drawbacks. For instance, for microporous films, typical positive effects of stretching include higher vapor breathability and improved surface aesthetics. Vapor breathability (or water vapor transmission ratexe2x80x94xe2x80x9cWVTRxe2x80x9d) can be estimated by laboratory test methods, and is a function of the size and frequency of micropores in the film. Additional stretching of an already microporous film is known to increase the size of existing pores and create new pores. Therefore, highly stretched microporous films and microporous film/fabric composites generally have higher vapor breathability as compared to similar materials which have been stretched to a lesser degree. Likewise, surface feel and drapability are known to be improved by stretching processes. Films and fabrics, when combined with one another, tend to be more stiff and harsh than either of the individual components alone. Stretching such composites tends to break down the rigid structure, thereby providing a softer surface feel and improved drapability. On the other hand, stretching microporous film/fabric composites can result in decreased bond strength and increased pinholing. Stretching improves the softness and drapability by destroying the connection between film and fabric. This results in decreased bond strength in the laminate. Stretching can also cause undesirable damage to the laminate, such as pinholing, tearing, or shredding of the film, the fabric, or the composite as a whole. The bonding of a film and fabric may be carefully controlled to avoid creating other functional and aesthetic problems. For example, in the case of extrusion coating a polyethylene film onto a spunbond polypropylene web, process conditions such as melt temperature and nip pressure determine the intrusion of the fibers into the film structure. At the maximum level of intrusion, the film and fabric essentially mold together and become one. Such a laminate, however, acquires the worst properties of the two components and tends to be both rigid and fragile. At the minimum level of intrusion, however, the film and fabric have little or no bond, and therefore tend to delaminate. Too much bond strength is also known to limit the amount of stretching which may be performed due to pinhole formation. Simply stated, if the bond between film and fabric is too large, the stretched film will sometimes fracture prior to delaminating, leaving a pinhole. Rather than bonding a microporous film to a fabric, it is also possible to first bond a non-porous film to a fabric, and then stretch the resulting composite in order to render the film microporous. Previous attempts to first bond and then stretch film/fabric composites, such as that disclosed in U.S. Pat. No. 5,910,225 (which is incorporated herein by reference) have been only partially successful due to damage to the composite by the stretching process. Damage includes, but is not limited to, pinholes, tears, and other functional and aesthetic defects. U.S. Pat. No. 6,066,221 describes a method of providing increased bonding between a film and nonwoven by applying lanes of hot air to the surface of laminates in the machine direction. Although this zoned hot air knife treatment increases the structural integrity of the laminate, stretching of the treated laminate results in debonding of the film and nonwoven. U.S. Pat. No. 6,248,195 is another example of a bonding technique that is unable to prevent debonding of the film and nonwoven during post-stretching. Schmitz teaches that heated fluid or air can be used to bond webs at localized points forming a broken lane in the machine direction of the film. U.S. Pat. No. 5,424,025 describes zone stretching of a film in the machine direction through the use of interpenetrating male and female rolls. Variations in the depth of engagement by the male roll creates an alternating pattern of heavy and lightly stretched sections. U.S. Pat. No. 6,013,151 (which is incorporated herein by reference) teaches that a film/nonwoven fabric laminate can be made microporous and breathable upon incremental stretching at high speeds. The resulting microporous laminates have a high water vapor transmission rate (WVTR). It has been found that a flat film/nonwoven laminate can be incrementally stretched more uniformly than an embossed film/nonwoven laminate. More uniform stretching provides higher WVTR and fewer pinholes. There is a continuing need for improvements in the performance and appearance of composites of polymer films and nonwoven fabrics. In particular, improvements are desired for producing microporous film/fabric composites with higher breathability, while avoiding pin holes and other functional and aesthetic defects. The present invention relates to film/fabric composites and methods of producing the same which exhibit improved physical and aesthetic properties. A fabric structure is laminated to a film in a novel manner and then stretched so as to produce a breathable composite satisfactory for many end uses as a liquid barrier having high water vapor permeability. The film and fabric layers are bonded in lanes running in the machine direction. The composite then passes through a special stretching device designed so that all of the web except the highly bonded lanes are stretched. This invention is suitable for hygiene applications, such as producing diaper backsheets, which require composites that do not delaminate, provide high WVTR (water vapor transmission rate), and are soft and cloth-like. This invention is able to utilize the positive aspects described above and avoid the negative after effects. The fabric is attached to the film with two levels of bond strength. The majority of the bond may be extremely weak, thereby allowing the majority of the composite to be stretched to the maximum degree, thus obtaining the desired high WVTR readings and aesthetic properties (e.g., surface softness and drapability). Since there are zones where the bond is high, the total material will not be subject to delamination. The areas where the bond is high are not stretched or are only partially stretched and, therefore, the product will not suffer the problem of pinholes which are caused by stretching areas tightly bonded. The films and fabrics described here can be composited in many different ways including, but not limited to, extrusion coating, adhesive lamination, and thermal point bonding. The composite once formed is then subjected to stretching using a variety of techniques including, but not limited to, CD intermeshing ring rolls. The process of stretching highly-filled thermoplastic polymer films using techniques such as ring rolls is known in the art. One example of this method is described in U.S. Pat. No. 4,350,655. The film/fabric composite may be made, for example, by first attaching a fabric to a film during production of that film. The fabric can be bonded to the film at the nip point in a cast operation via extrusion coating. Other methods of bonding before or after the cast station nip include hot melt adhesive and thermal or ultrasonic point bonding. Any of these three methods, as well as many other methods not mentioned but well known in the art, can be used in accordance with the process described herein. The only requirement on bonding technique is that the locations where the fabric is highly bonded to the film can be avoided during the stretching process. One method that meets the above criteria is where increased bonding in certain regions of the composite is accomplished by a sonic sealer that thermally bonds fabric to film in lanes running in the machine direction. The sealer can be located anywhere after the cast station nip point. In either case, the increased bonding results in lanes where the fabric cannot be delaminated from the fabric with less than 150 grams per linear inch of peeling force. The other criteria of avoiding or reducing stretching activation can be accomplished by using CD intermeshing ring rolls with spaces where the bonding lanes fall.

USS Petrita (1846) USS Petrita was a steamer that served in the United States Navy from 1846 to 1848. She saw service in the Mexican War. Petrita was a small, swift, screw steamer built in the United States and in Mexican service when the Mexican War broke out in 1846. She was one of two steamers and various other vessels in the Grijalva River at the town of Frontera when a U.S. Navy squadron commanded by Commodore Matthew C. Perry surprised Mexican forces there and captured her along with the other Mexican vessels. She was added to the American squadron. Early the next morning, Perry sailed farther up the Grijalva River to attack the town of San Juan Bautista. At 9:00 a.m. the squadron passed the abandoned Fort Acacchappa, where it stopped long enough to spike the guns. It was noon when Perrys squadron arrived at San Juan Bautista, where it captured five more Mexican vessels and bombarded the town. Unable to garrison the town because of a lack of men, Perry withdrew to Antón Lizardo, an island just south of Veracruz, Mexico. Petrita was inactive for the remainder of 1846 and the first part of 1847 due to a coal shortage and violent storms called “northers” which occur during the winter months. On 7 March 1847, Commodore David Conner and General Winfield Scott made a reconnaissance of Veracruz in Petrita. She ran close to the Castle of San Juan de Ulúa and was straddled by gunfire, but sustained no damage. The Siege of Veracruz began two days later. Petrita later participated in the amphibious assault on Veracruz. Commodore Conners plan was to have his large warships tow landing craft from Anton Lizardo to Isla de Sacrificios, a distance of a few miles (kilometers). Small steamers would then pick up the tow and run the landing craft in to shore. The sloop-of-war transferred her tow to Petrita, and Petrita towed them in safely. By 10:00 p.m., more than 10,000 American troops had landed, and the operation was a complete success. Suffering from engine defects, Petrita was inactive for the remainder of the Mexican War. She was lost off Alvarado, Mexico before 6 March 1848. All hands were saved. References Category:Steamships of the United States Navy Category:Mexican–American War ships of the United States Category:1846 ships Category:Maritime incidents in 1848

Epigenetic Regulator Signatures in Regenerative Capacity. Regeneration is the process by which body parts lost as a result of injury are replaced, as observed in certain animal species. The root of regenerative differences between organisms is still not very well understood; if regeneration merely recycles developmental pathways in the adult form, why can some animals regrow organs whereas others cannot? In the regulation of the regeneration process as well as other biological phenomena, epigenetics plays an essential role. This review aims to demonstrate the role of epigenetic regulators in determining regenerative capacity. In this review, we discuss the basis of regenerative differences between organisms. In addition, we present the current knowledge on the role of epigenetic regulation in regeneration, including DNA methylation, histone modification, lysine methylation, lysine methyltransferases, and the SET1 family. An improved understanding of the regeneration process and the epigenetic regulation thereof through the study of regeneration in highly regenerative species will help in the field of regenerative medicine in future.

It is well known in the art that the properties of lubricating oils for internal combustion engines can be improved by the addition of molybdenum-containing materials having anti-wear and/or friction-reducing properties. Anti-wear materials prevent or slow down the wear that occurs between metal surfaces which are in close rubbing contact, particularly in the boundary lubrication regime where metal to metal contact occurs. They are known to work by forming a permanent film on the surface metal which protects it from wear phenomena which would otherwise lead to removal of metal, loss of performance and eventual welding together of metal parts. Friction-reducing materials act by reducing the friction between metal surfaces when they rub together, resulting in improved fuel economy. They are known to give benefit in both the hydrodynamic and boundary lubrication regimes. These molybdenum-containing materials typically contain a source of active sulphur. In Column 1, line 53 to Column 2, line 2 of US-A-4,692,256 it is stated: "It has been considered essential that organic molybdenum compounds useful as lubricant additives should contain sulfur atoms in the molecules of the compounds. That is, it has been considered that the lubricating performance can be obtained by the formation of molybdenum disulfide on the lubricating surface by molybdenum and sulfur contained in the molecules. However, the present inventors have assumed that active sulfur atoms contained in the molecules may have undesirable effects in view of the metal corrosion and have made an earnest study in order to overcome the contraction. As a result, it has surprisingly been found that although the product obtained by the reaction between a molybdenum compound and an amino compound has no substantial performance when used alone as a lubricant additive, it exhibits extremely satisfactory lubricating performance when combined with a sulfur-containing compound". Examples of such sulphur-containing compounds are said in Column 4, lines 11 to 19 to include sulphurised fatty acids, sulphurised oils and fats, sulphurised olefins, disulphide compound such as dibenzyl sulphide, dithiocarbamate such as butylphenyl thiocarbamate disulphide, phosphorous- and sulphur-containing compounds such as tetraalkylthioperoxy phosphate, molybdenum dithiocarbamate, molybdenum dithiophosphate and zinc dithiophosphate. US-A-4,266,945 discloses, as extreme-pressure and friction modifying additives in lubricants and fuels, molybdenum-containing compositions substantially free of Group IA and IIA metals which are prepared by reacting, at a temperature up to about 200.degree. C., a mixture comprising (A) at least one acid of molybdenum, or salt thereof; (B) at least one phenol, or condensation product of said phenol and at least one lower aidehyde; and (C) at least one compound selected from the group consisting of (1) amines having the formula R.sup.1 (R.sup.2)NH wherein R.sup.1 is an aliphatic hydrocarbon-based radical and R.sup.2 is hydrogen or an aliphatic hydrocarbon-based radical; (2) condensation products of said amines with at least one lower aidehyde; and (3) salts of (1) or (2). The molybdenum-containing compositions may be used in conjunction with at least one compound containing active sulphur, e.g. a sulphurised olefin, a sulphurised mercaptan, a sulphurised phenol, or a dialkyl xanthate or carbamate. The reagent (B) can be a phenol. The term "phenol" is defined as a compound containing a hydroxyl group bound directly to an aromatic ring and is said to include compounds having more than one hydroxyl group bound to an aromatic ring, and also alkylalkenyl phenols. No other phenols are mentioned. Preferred are phenols containing at least one alkyl substituent containing about 3 to 100 and especially about 6 to 20 carbon atoms, with monoalkylphenols being particularly preferred. A reference to US-A-4,266,945 can be found in Column 1, lines 30 to 34 of US-A-4,466,901 which discloses a lubricating oil anti-friction additive composition prepared by reacting a phenolic compound, with a molybdenum compound, an amine compound and sulphur or a sulphur-yielding compound. In Column 1, lines 52 to 56 of US-A-4,466,901, it is stated that molybdenum compounds produced by prior art methods including that of US-A-4,266,945 potentially suffer from either economic inefficiencies or from changing product requirements, i.e. they do not meet current environmental standards. Furthermore, in Column 2, lines 4 to 10, it is stated that whilst these molybdenum compounds can improve the characteristics of lubricating oils, they suffer the additional drawbacks in that they are often uneconomical or difficult to prepare, cannot be prepared in a batch process, and may or may not have sufficient amounts of sulphur incorporated within the additive to benefit fully from the molybdenum contained therein. SU-A-1143767 discloses a lubricating composition containing (a) 1.5 to 1.53% w 2-mercaptobenzothiazole (anti-wear and anti-scuff additive), (b) 0.201 to 0.204% w p-hydroxyphenylene diamine (antioxidant additive), (c) 0.5 to 2% w molybdenyl chloride of the formula MoO.sub.2 Cl.sub.2.HL where HL is salicylaldehyde/2,4,6-trimethyl- aniline or salicylaldehyde/tert-butylamine (each of these being a Schiff base and therefore containing the group CH.dbd.N--), and (d) the balance being a synthetic oil based on an ester of pentaerythritol and C.sub.5 -C.sub.9 aliphatic acids. Test data in the Table in Columns 5 and 6 of SU-A-1143767 (particularly the results for Composition 2 compared with those for Compositions 3 to 6) show that the anti-wear and anti-scuff properties of a lubricating composition containing components (a), (b) and (d) were enhanced by the addition of the molybdenyl chloride (c). There is no test data on any lubricating compositions containing components (c) and (d) only and therefore there is no suggestion of any anti-wear or friction-reducing capabilities of the molybdenyl chloride (c) per se. SU-A-1054406 discloses a lubricating composition with improved lubricity containing, as anti-wear additive, 0.05 to 0.25% w molybdenyl chloride bis(salicylaldehyde anilinate), 0.45 to 2.25% w thioglycolic acid, and the balance being a synthetic oil based on an ester of pentaerythritol and C.sub.5 -C.sub.9 aliphatic acids. The composition is referred to in SU-A-143767 discussed above where it is mentioned that the use of molybdenyl chloride bis(salicylaldehyde anilinate) is problematic since it can only be incorporated into the synthetic oil after it has first been dissolved in thioglycolic acid, which leads to the formation of sediment in the oil during long-term operation. It has now surprisingly been found possible to prepare molybdenum-containing complexes from carboxylic compounds, being free of active sulphur, which show advantageous friction-reducing properties.

Ambohimanga Ambohimanga is a hill and traditional fortified royal settlement (rova) in Madagascar, located approximately northeast of the capital city of Antananarivo. The hill and the rova that stands on top are considered the most significant symbol of the cultural identity of the Merina people and the most important and best-preserved monument of the precolonial Merina Kingdom. The walled historic village includes residences and burial sites of several key monarchs. The site, one of the twelve sacred hills of Imerina, is associated with strong feelings of national identity and has maintained its spiritual and sacred character both in ritual practice and the popular imagination for at least four hundred years. It remains a place of worship to which pilgrims come from Madagascar and elsewhere. The site has been politically important since the early 18th century, when King Andriamasinavalona (1675–1710) divided the Kingdom of Imerina into four quadrants and assigned his son Andriantsimitoviaminiandriana to govern the northeastern quadrant, Avaradrano, from its newly designated capital at Ambohimanga. The division of Imerina led to 77 years of civil war, during which time the successive rulers of Avaradrano led military campaigns to expand their territory while undertaking modifications to the defenses at Ambohimanga to better protect it against attacks. The war was ended from Ambohimanga by King Andrianampoinimerina, who successfully undertook negotiations and military campaigns that reunited Imerina under his rule by 1793. Upon capturing the historic capital of Imerina at Antananarivo, Andrianampoinimerina shifted his royal court and all political functions back to its original locus at Antananarivo's royal compound and declared the two cities of equal importance, with Ambohimanga as the kingdom's spiritual capital. He and later rulers in his line continued to conduct royal rituals at the site and regularly inhabited and remodeled Ambohimanga until French colonization of the kingdom and the exile of the royal family in 1897. The significance of historical events here and the presence of royal tombs have given the hill a sacred character that is further enhanced at Ambohimanga by the burial sites of several Vazimba, the island's earliest inhabitants. The royal compound on the hilltop is surrounded by a complex system of defensive ditches and stone walls and is accessed by 14 gateways, of which many were sealed by stone disc barriers. The gateways and construction of buildings within the compound are arranged according to two overlaid cosmological systems that value the four cardinal points radiating from a unifying center, and attach sacred importance to the northeastern direction. The complex inside the wall is subdivided into three smaller rova. Mahandrihono, the largest compound, was established between 1710 and 1730 by King Andriambelomasina; it remains largely intact and contains the royal tombs, house of King Andrianampoinimerina, summer palace of Queen Ranavalona II, and sites that figured in key royal rituals such as the sacrificial zebu pen, royal bath and main courtyard. Original buildings no longer remain in the compound of Bevato, established before 1710 by Andriamborona, and the Nanjakana compound, built for King Andrianjafy in the late 19th century. The hill and its royal fortified city were added to the list of UNESCO World Heritage Sites in 2001 and represent Madagascar's only cultural site following the destruction by fire in 1995 of its historic sister city, the Rova of Antananarivo, shortly before the latter's intended inscription to the list. Numerous governmental and civil society organizations support the conservation of Ambohimanga by restoring damaged features and preventing further degradation. Etymology The name Ambohimanga is a noun-adjective compound in the standard Malagasy language composed of two parts: ambohi, meaning "hill", and manga, which can mean "sacred", "blue", "beautiful" or "good". The earliest known name for the hill was Tsimadilo. It was renamed Ambohitrakanga ("hill of the guinea fowls") around 1700 by a dethroned prince named Andriamborona who, according to oral history, was the first to settle on the hilltop with his family. The hill received its current name from King Andriamasinavalona in the early 18th century. History Madagascar's central highlands, including the area around Ambohimanga, were first inhabited between 200 BCE–300 CE by the island's earliest settlers, the Vazimba, who appear to have arrived by pirogue from southeastern Borneo to establish simple villages in the island's dense forests. By the 15th century the Merina ethnic group from the southeastern coast had gradually migrated into the central highlands where they established hilltop villages interspersed among the existing Vazimba settlements, which were ruled by local kings. The tombs of at least four Vazimba are located on or around Ambohimanga hill and are sites of pilgrimage, including the tombs of Ingorikelisahiloza, Andriantsidonina, Ramomba and Kotosarotra. In the mid-16th century the disparate Merina principalities were united as the Kingdom of Imerina under the rule of King Andriamanelo (1540–1575), who initiated military campaigns to expel or assimilate the Vazimba population. Conflict with the Vazimba led Andriamanelo to fortify his hill town using earthen walls, stone gateways and deep defensive trenches. This fortified town model, called a rova, was propagated by the noble class throughout Imerina until French colonization of Madagascar in 1895. The earliest settlement at the height of Ambohimanga was most likely established in the 15th century, coinciding with the arrival of the Merina in the highlands. Rice paddies took the place of the original valley forests by the 16th century, and the growing population near the valleys around Ambohimanga became known by the clan name Tantsaha ("people of the cultivated land"). According to oral history, however, the first to settle the site of the Ambohimanga rova was Andriamborona, the dethroned prince of the highland territory of Imamo, who relocated to the then-unpopulated hilltop in around 1700 accompanied by his nephew, his wife, and his mother, Ratompobe. Merina king Andriamasinavalona (1675–1710), who reigned over Imerina from his royal compound in Antananarivo, noticed a bonfire lit by the family on the southern face of the hill 24 kilometers away. The visibility of the site from his capital led Andriamasinavalona to desire Ambohimanga as a residence for his son, Andriantsimitoviaminiandriana. Andriamborona and his family agreed to shift three times to different parts of the hill, including the future site of the royal compound of Bevato, in response to consecutive requests from the king. For a short time he and the prince lived in neighboring houses at Bevato before Andriamborona and his family finally left the hill for the distant highland village of Ambatolampy, where he lived the rest of his life; the king retrieved their bodies for burial at Ambohimanga. In 1710, Andriamasinavalona divided the Kingdom of Imerina into four quadrants, which were given to his four favorite sons to rule. Andriantsimitoviaminiandriana received the eastern quadrant, Avaradrano, and transformed his rova at Ambohimanga into its capital. As the first king of Avaradrano (1710–1730), Andriantsimitoviaminiandriana also built the site's defensive walls and its first set of seven gates. Rather than rule their respective territories peacefully as Andriamasinavalona had intended, his four sons began a series of wars to seize control of neighboring territory, causing famine and suffering among the peasant population of Imerina. Andriantsimitoviaminiandriana spent much of his reign strengthening the authority of his governance at Ambohimanga and attracting residents to settle in the surrounding villages while battling his brothers to increase the land under his control. He was succeeded by his adopted son, Andriambelomasina (1730–1770), who continued to rule Avaradrano from Ambohimanga in the Mahandrihono compound he built beside the original compound of Besakana. Andriambelomasina significantly expanded Ambohimanga and strengthened its defenses, enabling him to successfully repel an attack against the rova by a band of Sakalava warriors employed by his chief rival, the ruler of Antananarivo. He named as his successor his eldest son, Andrianjafy (1770–1787), and designated his grandson Andrianampoinimerina to follow Andrianjafy in the order of succession. Andrianjafy, a weak and unjust ruler, maintained his capital at Ambohimanga where he built a new private compound called Nanjakana, but often resided in the nearby village of Ilafy. Andrianampoinimerina dethroned Andrianjafy in a violent conflict that ended in 1787. The king then used Ambohimanga as a launching point for a successful campaign to bring the twelve sacred hills of Imerina under his rule, including the hill city of Antananarivo, thereby reuniting the four quadrants of the divided Kingdom of Imerina under his sovereignty and putting an end to 77 years of civil war. To consolidate support for his rule, Andrianampoinimerina mobilized representatives of the numerous noble castes to participate in the most extensive effort yet to expand and fortify Ambohimanga. He ordered the construction of new city walls, gates and defensive trenches, as well as a rosewood palace called Mahandrihono, which he had built in the traditional style. Following the conquest of Antananarivo in 1793, Andrianampoinimerina shifted the political capital of Imerina from Ambohimanga to its original site at Antananarivo, while pronouncing Ambohimanga the kingdom's spiritual capital. Important traditional rituals continued to be held at Ambohimanga, and Andrianampoinimerina regularly stayed in its Mahandrihono palace. His son, Radama I, inhabited Ambohimanga's Nanjakana compound as a youth before relocating to Antananarivo, and visited Ambohimanga frequently after the move. Radama's widow and successor, Ranavalona I, renovated the Mahandrihono compound and moved several buildings from the sister rova at Antananarivo to Ambohimanga. She also forbade swine at Ambohimanga due to their association with Europeans, who had propagated pork as a food source in the decade prior. Subsequent queens made their own mark on the site, including the reconstruction of Nanjakana by Rasoherina, and Ranavalona II's addition of two large pavilions to the Mahandrihono compound that reflected a syncretism of traditional and Western architectural styles. Throughout much of the 19th century and particularly under the reign of Queen Ranavalona I (1828–1861), Ambohimanga was forbidden to visiting foreigners, contributing to its mystique as a "forbidden city". This status remained until 1897 when the French colonial administration transferred all the relics and significant belongings of the royal family from Ambohimanga to Antananarivo to break the spirit of resistance and ethnic identity that these symbols inspired in the Malagasy people, particularly in the highlands. In the early 20th century, the area was further changed when the French removed the sacred forests remaining on the neighboring hilltops in the early 20th century. The city nonetheless retains its symbolic significance in Imerina to this day. Layout Ambohimanga is located in the central highlands of Madagascar, approximately northeast of the capital city of Antananarivo. The hill rises steeply approximately 450 feet from the surrounding terrain on its eastern side and gradually slopes downward toward the west. The royal city of the same name, situated at the peak of the hill, has panoramic views of the surrounding hills and valleys, and is surrounded on the hill's slopes and the valley floor by the houses of residents of Ambohimanga village. The terraced rice paddies that cover the hillsides to the north and south of the royal city were created in the 17th and 18th centuries to provide a staple food source to the inhabitants of the hill and its surrounding villages. The crest of Ambohimanga is higher than the surrounding hills and others among the traditionally designated twelve sacred hills of Imerina, symbolically indicative of the site's political significance relative to other similar hill towns. This elevation also offered an excellent vantage point for surveying the surrounding areas for advancing enemy troops. Rising from among the surrounding valleys and terraced rice paddies, the hill is topped with a forest that was exempted from the widespread deforestation of the highlands due to its sacred nature. The UNESCO World Heritage Site encompassing the hill and the royal city at its peak extends over a surface area of 59 hectares, with a buffer zone of 425 hectares. Symbolism The layout of Ambohimanga's three compounds and the structures within them followed a traditional design established by the earliest Merina highland settlers by the 15th century. According to custom, a rova could only be established by an andriana (noble). Its foundation was built to raise the rova higher than the surrounding buildings outside its walls. Contained within the rova was at least one lapa (royal palace or residence) as well as the fasana (tomb) of one or more of the site's founders and family members. It also enclosed a kianja (courtyard) marked by a vatomasina (sacred stone) that elevated the sovereign above the people for the delivery of kabary (royal speeches or decrees). The sovereign's lodgings typically stood in the northern part of the rova, while the spouse or spouses lived in the southern part. At Ambohimanga, as in other rova sites, the cardinal and vertical layout of these various traditional components embodies two cosmological notions of space that coexisted in traditional Imerina. The older system governed sociopolitical order and was based on the concept of the four cardinal points radiating from a unifying center. A more recent system introduced through the astrology of seafaring Arabs governed the spiritual order and placed special significance on the northeast. The sacred eastern portions of Ambohimanga contained structures associated with the veneration of the ancestors, including the royal tombs, basins of holy water used in royal rituals, and numerous Ficus and Draceana trees, which were symbolic of royalty. The northern portion of the site is the location of a courtyard where royal judgments were handed down from atop a prominent granite boulder, in line with the Malagasy association between the northern cardinal point, masculinity, and political power. The houses of the royal wives were formerly located in the southern portion of the site, a cardinal point traditionally associated with femininity and spiritual power. These competing cosmological systems are also reflected in the placement of the city's main gates at cardinal points, as well as the northeastern gates reserved for use by the sovereign and dedicated to their role in sacred rituals. The orientation and placement of many structures within Ambohimanga were copied from Ambohimanga's older twin city, the rova at Antananarivo, which likewise embodies both traditional notions of space. The placement of the city of Ambohimanga relative to Antananarivo also reflects these systems. Centrally located Antananarivo is the nation's political capital today, and Ambohimanga to its northeast is regarded as the spiritual capital. Between these two systems, that of the political order predominates in the layout of Ambohimanga, and the sacredness of the city was historically more explicitly associated with its role as a political rather than an astrological center. The forbidding of foreigners from the site in the 19th century, for instance, was enacted to preserve the sanctity of the social and political order, rather than the religious order. By respecting these systems of symbolism, successive rulers sought to ensure the benediction of the ancestors, strengthen the legitimacy of their rule and ensure the protection and stability of their kingdom. However, adherence to cardinal division and symbolism of space is weaker at Ambohimanga than its embodiment of the significance of vertical space and elevation as an indicator of rank. The site of each new compound within the royal city was selected less for its cardinal direction than for the extent to which it was located on higher ground than the compound that predated it. Fortifications A series of protective trenches (hadivory) and stone walls, typical of fortified royal cities in Imerina since the 15th century, surround the village of Ambohimanga. The trenches vary in depth to a maximum of . The oldest trenches at the site, called Mazavatokana, are located behind the modern-day rova and appear to predate the reign of the hill's first known king, Andriantsimitoviaminiandriana; local tradition maintains that they were dug in the early 16th century on the command of King Andrianjaka, who may have used the site as a launching point for military offensives in his war against the Vazimba. Andriantsimitoviaminiandriana was the first to systematically establish a network of defenses around the hilltop settlement. This first king of Ambohimanga dug trenches around his Bevato compound, which was initially only accessible through a gateway he named Ambavahadikely. The settlement was expanded by the construction of trenches bordering a second adjoining space to the northeast with two additional access points named Ampanidinamporona and Ambavahaditsiombiomby, the latter a natural gateway formed by two boulders. This latter entrance was most likely used to access the space even before the formal establishment of a royal city there, and is therefore considered by archaeologists to be the oldest gateway at the site. After the establishment of the rova, this entrance was reserved for use by the sovereign, a reflection of the spiritual significance of the northeastern direction and its association with the ancestors, whose benediction and hasina provided the basis for the sovereign's power and legitimacy. It was also used to bring sacrificial cattle into the compound. Andriantsimitoviaminiandriana then expanded toward the west to a series of natural defenses, including stony cliffs and steep forested slopes that obviated the need to dig defensive trenches, and he constructed several additional gates that he named Ambavahadimahazaza, Andranomboahangy and Ambavahadiantandranomasina. Andrianampoinimerina expanded the trenches around the city using fanampoana labor. During his reign, a trench was dug that entirely encircles the hill, and a series of trenches was dug alongside existing ones to further protect the city against enemies. The current defensive wall was reconstructed around 1830 during the reign of Queen Ranavalona I. An estimated sixteen million egg whites were mixed with lime to produce the whitewash for the compound's exterior and interior walls. Until French colonization in 1897 and at least as early as the reign of Radama I, foreigners and non-residents were not allowed to enter the royal city without authorization from the sovereign. The royal compound can be accessed through fourteen stone gateways in total. In addition to the inner seven gateways constructed by Andriantsimitoviaminiandriana in the early 18th century, there exists an exterior wall and second set of seven gates that were built before 1794 during the reign of Andrianampoinimerina, an act that symbolically marked the completion of the king's reunification of Imerina. The largest and principal gate is also the most well-preserved and is known as Ambatomitsangana ("standing stone"). Every morning and evening, a team of twenty soldiers would work together to roll into place an enormous stone disk, 4.5 meters in diameter and 30 cm thick, weighing about 12 tons, to open or seal off the doorway. This form of gate (vavahady in the Malagasy language), typical of most walled royal villages of Imerina built between 1525 and 1897, protected the villagers from marauders.The gateway is topped by an observation post. The second main entrance, called Andakana, is situated in the western wall. Its stone disk is also intact, and the path leading to it is paved with cut stones. Both Ambatomitsangana and Andakana were considered the gateways of the living; cadavers could not be transported through them, and passage was denied to anyone who had recently come into contact with the dead. A northern gateway called Miandrivahiny retains its well-preserved stone disk and was one of two entrances used whenever it was necessary to transport corpses in or out of the site; the second gateway for corpses was called Amboara. The stone disk at the southern Andranomatsatso gateway is also in good condition. This gateway, as well as Antsolatra and Ampitsaharana, were primarily used as lookout points. In the late 18th century Andrianampoinimerina replaced the Ambavahadiantandranomasina gate with another made of wood instead of stone and renamed it Ambavahadimasina. He and his successors shaved a small piece of wood from this lintel to light the sacred hearth fire that played a ritual role in the traditional circumcision ceremony. The red soil inside the gate and a series of wooden boards that paneled the approach to the gate were both considered sacred, and soldiers or others who anticipated a voyage away from Imerina would take handfuls of the soil and pieces of the wooden boards with them before departing in the belief that it would ensure their safe return. Several large stones are set in the ground near gates or at points outside the walls of Ambohimanga. Rulers would stand atop these stones, each identified by distinct names, to deliver speeches to the public. To the south were the stones called Ambatomasina and Ambatomenaloha, while Ambatorangotina was situated to the northwest. The latter stone was of particular importance: here the twelve leaders of the Ambatofotsy clan first declared their rejection of Andrianjafy's rule and their allegiance to his nephew, Andrianampoinimerina. Upon taking the throne, Andrianampoinimerina used this site to first declare new laws and decrees that would later be announced throughout the kingdom. This was also the main site at Ambohimanga for dispensing justice. After Andrianampoinimerina's succession to the throne, he sacrificed a black zebu whose mother had died, named Lemainty ("black one"), with repeated spear thrusts; after its death, the animal was cut into pieces and buried on the site. Lemainty was thereafter regularly invoked in royal speeches and decrees to allude to the fate of those who misguidedly sought to forsake the protection of their guardian, the sovereign, and his laws. Natural features Two sanctified, stone-covered springs nearby feed a stream that is believed to hold powers of purification and flows through the buffer zone surrounding the royal city. Their water was used to form the sacred lake of Amparihy, artificially created by at least the 18th century to provide water to fill two ceremonial pools constructed within the Ambohimanga compound. Oral history attributes the creation of the lake to Andrianampoinimerina. He reportedly engaged the labor of surrounding villagers to dig the lake at the site of the spring-fed swamp at the base of the hill. Before initially filling the lake with water carried in baked earthen jars from the sacred sites of Alasora, Antsahatsiroa and Anosibe, the lake's creation was sanctified by sacrificing zebu at the site; Andrianampoinimerina is also said to have thrown pearls and silver rings into the lake to inaugurate it. The forest at Ambohimanga benefited from customary protection and today represents the largest of the last remaining fragments of primary forest that formerly covered the highlands. It contains a representative assortment of native tree and plant species, in particular the endemic tree zahana (phyllarthron madagascariensis) and a variety of indigenous medicinal plants, many possessing traditional or spiritual importance. Examples include the native bush Anthocleista, traditionally believed to attract lightning and often planted in clusters beside villages; the Dracaena plant, traditionally used for hedges and planted at sacred sites in valleys or other natural features where people would come to communicate with ancestral spirits; and the Phyllarthron vine, which was planted in sacred thickets and harvested for its wood, which was traditionally used to fashion handles for diverse tools. The recent and growing presence of two foreign species (golden bamboo and lantana) threaten the integrity of the site's ecosystem. The local management authority is currently engaged in activities to eradicate the encroaching vegetation. Villages The villages surrounding the royal city date back to at least the 16th century, when the valleys around Ambohimanga hill were first transformed into rice paddies. Following the establishment of a royal city on the hilltop, successive rulers put in place regulations to govern the development of these villages and manage the subjects inhabiting them. Under Andrianampoinimerina, quotas established a set number of houses for members of influential clans in designated neighborhoods around the hill. This king also established rules to improve sanitation, including standards of cleanliness in domestic courtyards and the quarantine of people suffering from certain illnesses. Ranavalona I specified the physical characteristics of newly constructed houses, including their size and decorative features. In 1862 Radama II gave permission to a group of Christians to negotiate with Tsimahafotsy elders to construct the village's first church, but the Tsimahafotsy initially rejected the request. The king's successor, Queen Rasoherina, later requested the Christians not to gather indoors for services at Ambohimanga in honor of the sanctity of the ancestors. The court was Christianized by Ranavalona II in 1869, and a small chapel was built outside the city's eastern gate, but a permanent church at Ambohimanga was not built until 1883. Following a fire that occurred in 1870 during a visit of Ranavalona II to Ambohimanga, the queen decreed that houses in the village could be constructed in brick, a material previously reserved for tomb and wall construction. A series of ancestral fady (taboos) decreed by Andrianampoinimerina continue to apply in the village, and include prohibitions against corn, pumpkins, pigs, onions, hedgehogs and snails; the use of reeds for cooking; and the cutting or collecting of wood from the sacred forests on the hill. Compounds Each of the three compounds built within the rova by successive Merina rulers bears distinct architectural styles that reflect the dramatic changes experienced in Imerina over the reign of the 19th century Kingdom of Madagascar, which saw the arrival and rapid expansion of European influence at the royal court. The site contains a blend of traditional Merina and European styles and construction methods. The predominant architectural features and layout of the royal city follow the traditional model of rova construction that predominated in the Highlands from the 15th century. Following tradition, the homes of the living are constructed of wood and vegetation (living materials), while the tombs of the dead are built in stone (cold, inert material). The selection of specific wood and plant materials used in construction, each of which were imbued with distinct symbolic meaning, reflected traditional social norms and spiritual beliefs. Since 1996, many of the buildings have undergone restoration using traditional materials and construction practices appropriate to the era in which the buildings were first erected. Bevato compound The earliest of the royal compounds at Ambohimanga, Bevato ("many stones", also called Fidasiana-Bevato), was first established by Andriamborona, who built houses there for himself and his family in the late 17th century. It was inhabited by Andriantsimitoviaminiandriana from 1710 to 1730, during which time he expanded the compound on three occasions. The compound was originally surrounded by a low rock wall that was replaced under Andriambelomasina by a wooden palisade. Ranavalona I expanded the compound toward the west by relocating a small house containing the royal idol Rafantaka; further westward expansion was completed under Ranavalona II. Under Ranavalona I and her successors, Besakana served as the residence of the sovereign's relatives during their visits to Ambohimanga. All buildings on the compound were destroyed by the French, who constructed a school on the site (Ecole Officiel), later followed by the Ambohimanga town hall (Tranompokonolona), which was razed after Madagascar regained independence. Andriamborona, the first inhabitant of the hill, built a tomb for his mother in Bevato. When the king asked him to relocate, Andriamborona agreed to move both his houses and his mother's tomb. In acknowledgement of this consideration, the king marked the site of the tomb with a large stone and nearby he built the first royal residence at the rova as his home. The stone was thereafter considered sacred: Andrianampoinimerina was enthroned while standing atop this stone, and slaves were brought there to swear allegiance to their masters. It was used in the ritual sacrifice of volavita zebu during the Fandroana Malagasy New Year (a festival also known as the "royal bath"). Sovereigns traveling on horseback would stand upon it to aid in mounting or dismounting, and after the Christianization of the court under Ranavalona II in 1869, religious services took place here. The royal tombs were relocated to the Mahandrihono compound under Ranavalona I to expand the courtyard. According to the Tantara ny Andriana eto Madagasikara transcription of Merina oral histories, the first house built by Andriantsimitoviaminiandriana was called Bevato. It was located at the southern extreme of the compound and housed the king and his wives. Andriambelomasina built and occupied a second house, called Manatsaralehibe ("large and great"). This house was highly venerated by Andrianampoinimerina: escaped convicts who managed to reach the building were pardoned, and this was the only historic house in the compound that Ranavalona I did not remove. According to a second source, the two oldest houses in the compound were called Mahitsielafanjaka ("one who is upright rules long") and Manatsarakely ("small and great"). These were reportedly built by either Andriamborona or Andriantsimitoviaminiandriana in the early 18th century and were occupied by Andriantsimitoviaminiandriana and his 12 wives. Another account states that Manatsarakely was inhabited by Andrianjafy and later by the wives of Andrianampoinimerina; this house and Mahitsielafanjaka were renovated under Ranavalona I using wood from the region of Sihanaka to repanel the walls. Oral history credits Andrianampoinimerina with the construction of a second pair of houses in the compound. Beginning with his reign, Bevato became the second most important compound after Mahandrihono and enclosed four houses for royal wives and their servants. He also kept the royal idol Ifantaka here in a small house surrounded by a wooden palisade, which remained until the Christian convert Ranavalona II symbolically destroyed the royal idols in a bonfire in 1869. After removing the historic Tsararay in the Mahandrihono compound, Andrianampoinimerina built a new house with the same name in the Bevato compound. Tsararay was the residence of his wives when they would make the journey to Ambohimanga. The Bevato compound in Antananarivo was likewise reserved for the sovereign's wives under the reign of Andrianampoinimerina, but featured many more houses to enable each wife her own residence. When wives would travel to Ambohimanga they were obliged to share the houses, and those who preferred not to share typically stayed at the houses of villagers beyond the city walls. Ranavalona I planted a pair of royal fig trees at the far end of the Bevato compound and stood between them when addressing the public. These were later complemented by additional fig trees planted all around the courtyard by Ranavalona II and jacarandas planted by the French during the colonial period. The figs that shade the esplanade are believed to be imbued with hasina enhanced by the bones and skulls of sacrificed zebu and special marking stones that pilgrims from across Madagascar, Mauritius, Reunion and Comoros have come to place around them. Pilgrims gather in this courtyard to celebrate the Fandroana ceremony, during which time the sovereign historically engaged in a ritual bath to wash away the sins of the nation and restore order and harmony to society. Today, pilgrims celebrate by offering sacrifices or prayers to honor, appease or commune with their ancestors. While Bevato was the location of larger gatherings and royal festivals, royal edicts and public judgments were handed down in the sacred courtyard (kianja) of Ambarangotina at the base of the hill leading to the Bevato compound. From the kianja sovereigns delivered kabary to announce new laws and decrees and administer justice. The sovereign would stand atop the kianja's vatomasina (a large granite boulder), which is surrounded by a brick half-wall and accessed by a set of steps. Mahandrihono compound The compound Mahandrihono ("knows how to wait") is the most expansive and well-preserved of the rova structures at Ambohimanga. It lies to the east of the central courtyard and sits at a higher elevation than Bevato, symbolically representing its greater political significance. It was first established by Andriambelomasina in the early 18th century during the reign of his father, Andriantsimitoviaminiandriana. Andriambelomasina surrounded the compound with a stone wall and within it built three houses as residences for his children—two twin houses (tranokambana) set side by side named Mahandry ("knows how to wait") and Tsararay ("has a good father"), and a third named Manandraimanjaka ("has a father who rules")—taking pains to illustrate through the names of these houses that he had no intention of usurping his father. When Andriantsimitoviaminiandriana eventually died, Andriambelomasina entombed him behind the twin houses. In Andrianampoinimerina's time this compound corresponded with the Mahandrihono compound at the rova in Antananarivo, being reserved for the king alone with his residence positioned beside the tombs of the ancestors. Andrianampoinimerina removed the twin houses to build his much larger Mahandrihono residence, which was decorated with silver birds and chains. He also expanded the compound and added a second enclosure of voafotsy wood (replaced annually) around the exterior of the stone walls. Mandraimanjaka was removed and in its place Andrianampoinimerina built a house with a small tower, which he named Manjakamiadana ("where it is good to rule"), designating it as the residence for the royal sampy (idol) called Imanjakatsiroa and the guardians assigned to protect it. Two other idols were kept nearby: Ifantaka, kept in a house in the Bevato compound, and Kelimalaza, guarded in its house at the Ambohimanga neighborhood of Ambohimirary. Under Radama I, the stone wall was reinforced with palisades that enclosed three houses, two of which were twin houses like those that Andriambelomasina had built. Ranavalona I enlarged the compound's courtyard and expanded Manjakamiadana. She constructed the stone walls that currently enclose the compound, as well as its two stone gateways. Ranavalona II re-added palisades to the compound's stone walls. She demolished Manjakamiadana and in its place constructed two hybrid Malagasy-European pavilions using wood from the historic and spiritually significant Masoandro house, which had been removed from the royal compound of Antananarivo by Ranavalona I. French general Joseph Gallieni used these European-influenced buildings as his summer residence in the early years of the French colonial period. In 2013, Andrianampoinimerina's original house, the reconstructed tombs, and the two royal pavilions are preserved in the compound, which also includes a watchtower, a pen for sacrificial zebu, and two pools constructed during the reign of Ranavalona I. Mahandrihono palace Among the buildings extant at the royal city during the time of King Andrianampoinimerina (1787–1810), only the original Mahandrihono palace remains intact. The Mahandrihono palace, which served as the home of Andrianampoinimerina before he relocated the political capital of Imerina to Antananarivo, has been preserved in its original state since construction, excepting the replacement of the original roof thatch with wooden shingles. The simple wooden structure is constructed in the traditional style of the aristocracy of Imerina: the walls are made of solid rosewood and topped by a peaked roof that is supported by 10-meter central rosewood pillar, much like the one that had originally supported the roof of the Rova Manjakamiadana of Antananarivo before it was destroyed by fire in 1995. The roof horns (tandrotrano) formed at each end of the roof peak by the crossing of the gable beams were originally silver-plated, and a silver eagle was affixed in the middle of the roof peak. Silver ornaments were also hung from the corners of the roof in the interior of the house. The building's name is inscribed on a white marble plaque affixed to an exterior wall near one of the building's two entrances. This house contains a number of items that belonged to Andrianampoinimerina, including weapons, drums, talismans and a bed raised on stilts. During Andrianampoinimerina's time, his wives were allowed to visit this building but not allowed to sleep there overnight. The site is highly sacred: Queen Rasoherina and her successors often sat on the stepping stone at its threshold to address their audience, and many pilgrims come here to connect with the spirits of Andrianampoinimerina and his ancestors. Visitors are asked to enter the house by stepping in with their right foot and exiting backwards, according to custom, in order to show respect for the spirit of Andrianampoinimerina. Royal pavilions Two ornate palace buildings were built of rosewood in this compound in 1871 on the former site of the Manjakamiadana royal idol residence. The first and larger of the two, Fandriampahalemana, features a room for receiving visitors and a large salon on the ground floor, and the bedrooms of Queen Ranavalona II and her serving lady on the second floor. The original European furnishings have been preserved, and the many gifts given by foreign dignitaries to the queen are on display here. The queen's bedroom is considered a sacred place and many visitors come on pilgrimage to pray to her spirit. The second, smaller pavilion is known as the Tranofitaratra ("house of glass") and was constructed in 1862 under the orders of Ranavalona II. The queen would gather her ministers for counsel in this building, and the large windows on all four sides of the building provided a view of the countryside below, enabling the queen to ascertain the security of her surroundings. The glass used in the construction was imported by an Englishman named Parrett in 1862. Royal tombs The compound originally housed twelve royal tombs constructed in the style of Merina nobles, with a stone crypt topped by a small, windowless wooden house (tranomasina) indicative of aristocratic rank. The peaks of these tombs were aligned from north to south. Sovereigns originally buried in the four largest tombs, situated to the north of the others, included Andriantsimitoviaminiandriana, Andriambelomasina, Andriampoinimerina, Ranavalona I and Ranavalona II, while the wives and relatives of sovereigns were buried in the smaller tombs. According to oral histories, at its 19th-century peak the Ambohimanga compound contained 12 tombs. The tranomasina were destroyed in March 1897 by French authorities who removed the bodies of the sovereigns interred here and relocated them to the royal tombs at the Rova of Antananarivo. The rich collection of funerary objects enclosed within the tombs was also removed for display in the Manjakamiadana palace on the Antananarivo rova grounds, which the Colonial Authority transformed into an ethnological museum. This was done in an effort to desanctify the city of Ambohimanga and break the spirit of the Menalamba resistance fighters who had been rebelling against French colonization for the past year, break popular belief in the power of the royal ancestors, and relegate Malagasy sovereignty under the Merina rulers to a relic of an unenlightened past. A French garrison was housed within the royal city and military buildings were erected on top of the stone tomb foundations. A kitchen and military canteen were built on top of the tombs of Andrianampoinimerina and Andriamasinavalona. By 1904, the military buildings were likewise demolished, leaving the stone tomb foundations intact. The desecration of the two most sacred sites of Merina royalty represented a calculated political move intended to establish the political and cultural superiority of the French colonial power. In the popular view, the link between Ambohimanga and the ancestors (Andrianampoinimerina in particular) rendered the royal city an even more potent symbol and source of legitimate power than the capital of Antananarivo, which was seen as having become a locus of corrupt politics and deviance from ancestral tradition. Believing that the presence of the ancestors within the tombs sanctified the earth upon which the rova was built, Menalamba resistance fighters would come to Ambohimanga to collect handfuls of dirt from the base of the tombs to carry with them in their offensives against the French; the French authority intended by the removal of the sovereigns' bodies from the tombs to undermine the fighters' confidence and solidarity. Although the tombs were desecrated and the Menalamba fighters were ultimately defeated, Ambohimanga has retained its sacred character. The royal tombs were reconstructed in 2008 by the government of Madagascar under the Ravalomanana administration. During the 1995 fire that destroyed the tombs and other structures at the Rova of Antananarivo, the lamba-wrapped remains of only one sovereign—Ranavalona III—could be saved from the flames. The queen has since been re-interred in the royal tombs at Ambohimanga. Other features Two large basins have been carved from the stone foundation of the compound. Both constructed under Ranavalona I, one was a pool built in honor of the wives of soldiers of the ennobled Hova Tsimahafotsy clan of Ambohimanga, while the other was built for the wives of members of the elite military corps known as "the 500". The pools were strictly forbidden for public bathing or drinking and contained fish from Lake Itasy and specially consecrated water. Ranavalona I and her successors Radama I and Rasoherina used the larger royal pool for ritual purification during the annual fandroana new year festival. Sacred zebu were kept in a sunken cattle pen (fahimasina) to the west of the kianja courtyard before sacrifice at royal events such as circumcisions and the fandroana festival. Only the two most highly prized types of zebu were kept here: black zebu with white markings on the forehead, called volavita, and entirely reddish-brown zebu, called malaza. In this way, the cattle were made to walk from the west toward the east (the direction of the ancestors and sanctity) before being slaughtered. Another large pen for sacrificial zebu was located to the northeast of this courtyard before being filled in by the French Colonial Authority in the late 19th century. Nanjakana compound The Nanjakana compound is the most highly elevated of the three compounds in the rova at Ambohimanga. Located to the northeast of Mahandrinoro, this compound is believed to have been first constructed by Andrianjafy in the late eighteenth century. To the north of the compound is a stone esplanade that offers a clear view of the surrounding areas where Andrianampoinimerina reportedly came to reflect on his military strategy for bringing Imerina under his control. During the 1861 funeral of Queen Ranavalona I held in the Nanjakana compound, a spark accidentally ignited a nearby barrel of gunpowder destined for use in the ceremony, causing an explosion and fire that killed a number of bystanders and destroyed three of the compound's historic royal residences. During the reign of Andrianampoinimerina, Nanjakana enclosed five houses that served as residences for his children. The house called Nanjakana ("place of royalty") was built by Andriambelomasina and renovated by Andrianampoinimerina, who moved it into the compound and lived in it before succeeding to the throne. He renovated it for use by his son, Radama I, who slept here during visits to Ambohimanga after succeeding his father as King of Madagascar. According to oral history, a large stone near the Nanjakana house was used as a seat by Andriambelomasina and Andrianampoinimerina when reflecting on governance decisions. Andrianampoinimerina added a two-story house called Manambitana ("favored by fate") that was the largest of all the traditional houses at Ambohimanga. The king's children slept on the upper floor during visits to the royal city, while the ground floor housed such royal property as palanquins and storage chests. This house was destroyed in the 1861 fire and was reconstructed under Rasoherina, who used it as a residence. After removing the historic Manandraimanjaka house from the Mahandrihono compound, Andrianampoinimerina built a new house with the same name in the Nanjakana compound. This was likewise destroyed in the 1861 fire, and was later rebuilt by Ranavalona II. Also destroyed in the fire was a house called Fohiloha ("short") that Ranavalona I had relocated from the royal compound in Antananarivo to the Nanjakana compound at Ambohimanga in 1845; Fohiloha was later rebuilt by Rasoherina. Other buildings that Ranavalona I moved from the rova at Antananarivo to the Nanjakana compound at Ambohimanga included Kelisoa ("beautiful little one") and Manantsara. Conservation and management A popular tourist destination, Ambohimanga received 97,847 visitors in 2011. Visitors to the World Heritage Site are charged a fee (10,000 ariary for foreigners and 400 ariary for locals), which is largely used to pay for the preservation of the site. The commune of Ambohimanga Rova is a small but thriving rural village that lives on agriculture and services provided to tourists and pilgrims who visit the royal city. Multilingual tour guides can be hired at the site to provide detailed descriptions of its features and history. Photographs are permitted outdoors but prohibited inside the historic buildings. Tourism has been negatively affected at the site as a consequence of the 2009 Malagasy political crisis; management of the site has also been hampered by political instability and reduced revenues since 2009. The extent of the area currently classified a World Heritage Site was under restricted access and protection during the imperial era and has been under some form of legal recognition and protection since French colonization, having been incorporated into the Colony Domains Service in 1897 and the National Inventory in 1939. It has since benefited from legal municipal protection and two national laws (passed in 1982 and 1983) protecting sites of historical and national interest. The Office of the Cultural Site of Ambohimanga (OSCAR), created by the Ministry of Culture, has managed the site and its entrance fees and state subventions since 2006, when a five-year management plan was developed for implementation by the group's 30 employees. These management and conservation activities are conducted in cooperation with the local population within the Rural Commune of Ambohimanga Rova. The Village Committee, comprising representatives of all the adjacent quarters and the local community, are also involved in the protection of the site. Conservation of Ambohimanga is further supported by a private association, Mamelomaso, which has also been active in campaigning for awareness and protection of cultural heritage and has contributed to the preservation of numerous other sites of cultural and historic significance in the highlands. In addition to helping replant the Ambohimanga woodlands, Mamelomaso has contributed to the restoration of the stones around the source of the spring, erected informational plaques around the hill, and paved a number of footpaths within the site. UNESCO contributed special financial support to restore historic structures at Ambohimanga threatened by exceptionally heavy rainfall and landslides. Ambohimanga has been viewed by many Merina since the late 19th century as the embodiment of an ideal social order blessed by the ancestors. The significance attached to the site in Imerina increased further when its sister rova in Antananarivo was destroyed by fire in 1995, contributing to a sense that Ambohimanga was the last remaining physical link to this sanctified past. A small intellectual elite among the Tsimahafotsy clan of Ambohimanga and the nobles (andriana) believe that only Ambohimanga possesses the ancestral benediction (hasina) to serve as the national capital and imbue national leaders with the legitimacy and wisdom needed to rightly govern the country. The descendants of the andriana have consequently been key in promoting and protecting Ambohimanga, such as by playing a significant role in successfully lobbying UNESCO to list Ambohimanga as a World Heritage Site. Despite these measures, the conservation of Ambohimanga is challenged by human and natural factors. The rapidly growing but relatively impoverished population around Ambohimanga occasionally engages in illegal harvesting of plants and trees from the surrounding forests, threatening the integrity of the natural environment. The forests and wooden structures on the site are also susceptible to fire. Following the 1995 destruction by fire of Ambohimanga's sister rova at Antananarivo, widely believed to have been a politically motivated arson, rumors have circulated that Ambohimanga could suffer a similar fate. Cyclone Giovanna, which passed over Madagascar in February 2012, caused considerable damage at the site. The wooden shingles of Andrianampoinimerina's house were torn off by the wind, exposing the historic objects inside to damage from the elements. The wooden fence surrounding the Mahandrihono compound was also badly damaged. Worst affected are the plants and trees at the site. Large swaths of endemic medicinal plants and trees in the forest were destroyed. Many of the sacred trees shading the royal city were uprooted, including sacred fig trees around the Fidasiana courtyard and inside the zebu pen. Two of the uprooted trees were of particular symbolic significance, having served as physical anchors for certain royal rituals since the 17th century. Shortly after the storm, OSCAR unveiled plans to plant a substitute fig for the uprooted one that had shaded the sacred stone in the Fidasiana courtyard. Most of the historic jacarandas planted over a century ago under French colonial rule were also destroyed. The extent of damage to the site has prompted traditionalists to demand renewed respect for the sanctity of the site by requesting adherence to traditional taboos put in place by Merina monarchs. These include banning pigs at the site, as well as the consumption of pork, tobacco, alcohol and cannabis on the grounds of the royal city. See also List of World Heritage Sites in Madagascar Notes References External links UNESCO World Heritage Site information Category:Antananarivo Province Category:Archaeological sites in Madagascar Category:History of Madagascar Category:World Heritage Sites in Madagascar Category:Hills of Africa Category:Landforms of Madagascar

Antimicrobial activity of commonly used antibiotics and DNA fingerprint analysis of Pseudomonas aeruginosa obtained from clinical isolates and unchlorinated drinking water in Korea, 2010. Pseudomonas aeruginosa exists in various environments, and can cause mild or serious infections resulting in a wide range of symptoms. In this study, we collected bacterial isolates from hospitalized patients and unchlorinated drinking water, in Korea, 2010. The water-borne and clinical isolates were compared using colony morphology, antimicrobial susceptibility testing, and random amplification of polymorphic DNA analysis. We first compared morphological features of the water-borne and clinical isolates. The clearest difference in colony morphology was colony shape; five water-borne isolate colonies (83%) had a smooth, circular morphology, while nine (75%) clinical isolate colonies had a rough, irregular morphology. Minimum inhibitory concentrations analyses were performed to determine antimicrobial resistant patterns; using ceftazidime, gentamicin, tigecycline, chloramphenicol, meropenem, and tobramycin according to Clinical and Laboratory Standard Institute (CLSI, 2009) methodology. All waterborne isolates were not resistant to gentamicin, tobramycin, and meropenem. The clinical isolates were resistant to every antibiotic except chloramphenicol. Genotyping was performed using the repetitive extragenic palindromic polymerase-chain-reaction. The DNA fingerprinting patterns did not reveal genetic similarity between the water-borne and clinical P. aeruginosa isolates. On the contrary, they showed that genetically distinct populations have been established in each of these environments. We have revealed significant morphological, clinical and genetic differences between water-borne and clinical isolates of the same bacterial species.

Hydrogen sulfide One of the most foul-smelling substances is hydrogen sulfide (H 2 S), which has a characteristic rotten-egg odor. This gas is produced by the anaerobic (oxygen-free) breakdown of organic matter by bacteria; it is a common component of “sewer gas.” But this gas does not cause disease; rather, when molecules of this substance enter your nose, they can attack the central nervous system. Exposure to even small amounts can be fatal. The health effects of hydrogen sulfide depend on the amount inhaled and for how long. Exposure to low concentrations (less than 50 parts per million (ppm)) can produce irritation of the nose and throat and lead to loss of appetite and headache. Higher concentrations (50–150 ppm) can cause eye irritation, coughing, and loss of smell. If the amount of inhaled hydrogen sulfide is larger than 200 ppm, damage to the eyes can occur, along with accumulation of fluid in the lungs. Beyond 700 ppm, most people lose consciousness, and some die. The bottom line… Your sense of smell often alerts you to potential danger. Bad smells can serve as a warning that something is amiss. If it smells bad, it is probably bad for you. More often than not, the nose knows. What’s that smell? Thinking of a recent or past experience with a bad smell, what chemicals do you think caused that bad smell? Do you think they were harmful? How would you find out?

This beautiful photo from the Hubble Legacy Archive offers a striking look at the Trapezium, four closely packed stars found inside the Orion nebula, some 1,500 light-years away. Lurking inside that image might be our nearest black hole neighbor. The question of which black hole is the closest to Earth is surprisingly tricky to answer. V4641 Sgr might be just 1,600 light-years away, or it might equally possibly be more like 24,000 light-years away. We've got a better sense of the location of V404 Cygni, which is just 7,800 light-years away. Considering we're a little under 30,000 light-years from the supermassive black hole at the center of the Milky Way, those black holes are certainly in the cosmic vicinity, but they're not exactly super close. That's why the Trapezium is so intriguing. Something about the stars' movements just isn't right, and the most likely explanation is a hidden black hole. NASA explains this possible secret of the Trapezium: Gathered within a region about 1.5 light-years in radius, they dominate the core of the dense Orion Nebula Star Cluster. Ultraviolet ionizing radiation from the Trapezium stars, mostly from the brightest star Theta-1 Orionis C powers the complex star forming region's entire visible glow. About three million years old, the Orion Nebula Cluster was even more compact in its younger years and a recent dynamical study indicates that runaway stellar collisions at an earlier age may have formed a black hole with more than 100 times the mass of the Sun. The presence of a black hole within the cluster could explain the observed high velocities of the Trapezium stars. The Orion Nebula's distance of some 1500 light-years would make it the closest known black hole to planet Earth. It's an intriguing thought, but then it's entirely possible that a black hole — or several black holes, for that matter — are much, much closer to our solar system than 1,500 light-years. That's rather the trouble with black holes: you don't generally find them unless you already have a pretty damn good idea where they are in the first place. I believe the astrophysics geniuses over at Red Dwarf once cut to heart of just this very issue.

Abstract This guide1 will help you think through when it makes sense to try to “control for other things” when estimating treatment effects using experimental data. We focus on the big ideas and provide examples in R. 1 What is covariate adjustment? “Covariates” are baseline characteristics of your experimental subjects. When you run an experiment, you are primarily interested in collecting data on outcome variables that your intervention may affect, e.g. expenditure decisions, attitudes toward democracy, or contributions for a public good in a lab experiment. But it’s also a good idea to collect data on baseline characteristics of subjects before treatment assignment occurs, e.g. gender, level of education, or ethnic group. If you do this you can explore how treatment effects vary with these characteristics (see 10 Things to Know About Heterogeneous Treatment Effects). But doing this also lets you perform covariate adjustment. Covariate adjustment is another name for controlling for baseline variables when estimating treatment effects. Often this is done to improve precision. Subjects’ outcomes are likely to have some correlation with variables that can be measured before random assignment. Accounting for variables like gender will allow you to set aside the variation in outcomes that is predicted by these baseline variables, so that you can isolate the effect of treatment on outcomes with greater precision and power. Covariate adjustment can be a cheaper route to improved precision than increasing the number of subjects in the experiment. Partly for that reason, researchers often collect extensive data on covariates before random assignment. Pre-tests (measures that are analogous to the outcome variable but are restricted to time periods before random assignment) may be especially valuable for predicting outcomes, and baseline surveys can ask subjects about other background characteristics. 2 Controlling for covariates at the design stage (blocking) The best way to control for covariates is to use block randomization to do it at the design stage even before you start your experiment. Block randomization enables you to create treatment and control groups that are balanced on certain covariates. For example, you might expect that gender and income help predict the outcome variable. Block randomization can ensure that the treatment and control groups have equal proportions of female/high-income, female/low-income, male/high-income, and male/low-income populations. When the blocking variables help predict outcomes, blocking improves precision by preventing chance correlations between treatment assignment and baseline covariates. For more information on blocking and how to implement it in R, see 10 Things You Need to Know About Randomization. The precision gains from blocking (relative to covariate adjustment without blocking) tend to be greatest when sample sizes are small.2 When blocking is done to improve precision, estimated standard errors should take the blocking into account. (Otherwise, the SEs will tend to be conservative because they won’t give you credit for the precision improvement that blocking achieved.) One simple and commonly used method is to regress the outcome on the treatment assignment dummy variable as well as block dummies. When the probability of assignment to treatment is constant across blocks, including the block dummies in the regression doesn’t change the estimated treatment effect, but tends to give a more accurate estimate of the SE.3 If the probability of assignment to treatment varies by block, then you need to control for these unequal probabilities in order to get unbiased estimates of average treatment effects. 10 Things You Need to Know About Randomization discusses ways to do this. 3 How to do it in a regression Sometimes you do not have the opportunity to implement a blocked experimental design (for example, if you join a project after random assignment occurs) or you would prefer to simplify your randomization scheme to reduce opportunities for administrative error. You can still adjust for covariates on the back end by using multiple regression. Remember that in a bivariate regression—when you regress your outcome on just your treatment indicator—the coefficient on treatment is just a difference-in-means. This simple method gives an unbiased estimate of the average treatment effect (ATE). When we add baseline covariates that are correlated with outcomes to the model, the coefficient on treatment is an approximately unbiased estimate of the ATE that tends to be more precise than bivariate regression. To adjust for covariates through multiple regression, use the model: \[Y_i = \alpha + \beta Z_i + \gamma X_i + \epsilon_i\] where \(Y_i\) is the outcome variable, \(Z_i\) is the treatment indicator, and \(X_i\) is a vector of one or more covariates. The remainder \(\epsilon_i\) is your disturbance term—the leftover unexplained noise. When the treatment and control groups are of unequal size, the precision gains from covariate adjustment may be greater if you include interactions between treatment and the covariates (see this blog post for more discussion). For ease of interpretation, recenter the covariates to have zero mean: 4 Why to do it It isn’t absolutely necessary to control for covariates when estimating the average treatment effect in an RCT that assigns every subject the same probability of receiving the treatment. The unadjusted treatment–control difference in mean outcomes is an unbiased estimator of the ATE. However, covariate adjustment tends to improve precision if the covariates are good predictors of the outcome.4 In large samples, random assignment tends to produce treatment and control groups with similar baseline characteristics. Still, by the “luck of the draw,” one group may be slightly more educated, or one group may have slightly higher voting rates in previous elections, or one group may be slightly older on average. For this reason, the estimated ATE is subject to “sampling variability,” meaning you’ll get estimates of the ATE that were produced by an unbiased method but happened to miss the mark.5 A high sampling variability contributes to noise (imprecision), not bias. Controlling for these covariates tends to improve precision if the covariates are predictive of potential outcomes. Take a look at the following example, which is loosely based on the Giné and Mansuri experiment on female voting behavior in Pakistan.6 In this experiment, the authors randomized an information campaign to women in Pakistan to study its effects on their turnout behavior, the independence of their candidate choice, and their political knowledge. They carried out a baseline survey which provided them with several covariates. The following code imitates this experiment by creating fake data for four of the covariates they collect: whether the woman owns an identification card, whether the woman has formal schooling, the woman’s age, and whether the woman has access to TV. It also creates two potential outcomes (the outcomes that would occur if she were assigned to treatment and if not) for a measure of the extent to which a woman’s choice of candidate was independent of the opinions of the men in her family. The potential outcomes are correlated with all four covariates, and the built-in “true” treatment effect on the independence measure here is 1. To figure out whether our estimator is biased or not, we simulate 10,000 replications of our experiment. On each replication, we randomly assign treatment and then regress the observed outcome \(Y\) on the treatment indicator \(Z\), with and without controlling for covariates. Thus, we are simulating two methods (unadjusted and covariate-adjusted) for estimating the ATE. To estimate the bias of each method, we take the difference between the average of the 10,000 simulated estimates and the “true” treatment effect. Both methods—with and without covariates—yield the true treatment effect of 1 on average. When we ran the regression without covariates, our estimated ATE averaged 1.0008 across the 10,000 replications, and with covariates, it averaged 1.0003. Notice that the regression-adjusted estimate is essentially unbiased even though our regression model is misspecified—we control for age linearly when the true data generating process involves the log of age.7 The real gains come in the precision of our estimates. The standard error (the standard deviation of the sampling distribution) of our estimated ATE when we ignore covariates is 0.121. When we include covariates in the model, our estimate becomes a bit tighter: the standard error is 0.093. Because our covariates were prognostic of our outcome, including them in the regression explained some noise in our data so that we could tighten our estimate of ATE. 5 When will it help? When is adjusting for covariates most likely to improve precision? Covariate adjustment will be most helpful when your covariates are strongly predictive (or “prognostic”) of your outcomes. Covariate adjustment essentially enables you to make use of information about relationships between baseline characteristics and your outcome so that you can better identify the relationship between treatment and the outcome. But if the baseline characteristics are only weakly correlated with the outcome, covariate adjustment won’t do you much good. The covariates you will want to adjust for are the ones that are strongly correlated with outcomes. The following graph demonstrates the relationship between how prognostic your covariate is and the gains you get from adjusting for it. On the x-axis is the sample size, and on the y-axis is the root mean squared error (RMSE), the square root of the average squared difference between the estimator and the true ATE. We want our RMSE to be small, and covariate adjustment should help us reduce it. The black line shows the RMSE when we don’t adjust for a covariate. The red line shows the RMSE when we adjust for a highly prognostic covariate (the correlation between the covariate and the outcome is 0.9). You can see that the red line is always below the black line, which is to say that the RMSE is lower when you adjust for a prognostic covariate. The orange line represents the RMSE when we adjust for a moderately prognostic covariate (the correlation between the covariate and the outcome is 0.5). We still are getting gains in precision relative to the black line, but not nearly as much as we did with the red line. Finally, the yellow line shows what happens if you control for a covariate that is not at all predictive of the outcome. The yellow line is almost identical to the black line. You received no improvement in precision by controlling for a non-prognostic covariate; in fact, you paid a slight penalty because you wasted a degree of freedom, which is especially costly when the sample size is small. This exercise demonstrates that you’ll get the most gains in precision by controlling for covariates that strongly predict outcomes. How can you know which covariates are likely to be prognostic before launching your experiment? Prior experiments or even observational studies can offer guidance about which baseline characteristics best predict outcomes. 6 Control for prognostic covariates regardless of whether they show imbalances Covariates should generally be chosen on the basis of their expected ability to help predict outcomes, regardless of whether they show “imbalances” (i.e., regardless of whether there are any noteworthy differences between the treatment group and control group in average values or other aspects of covariate distributions). There are two reasons for this recommendation: Frequentist statistical inference (standard errors, confidence intervals, p-values, etc.) assumes that the analysis follows a pre-specified strategy. Choosing covariates on the basis of observed imbalances makes it more difficult to obtain inferences that reflect your actual strategy. For example, suppose you choose not to control for gender because the treatment and control groups have similar gender composition, but you would have controlled for gender if there’d been a noticeable imbalance. Typical methods for estimating standard errors will incorrectly assume that you’d never control for gender no matter how much imbalance you saw. Adjusting for a highly prognostic covariate tends to improve precision, as we explained above. To receive due credit for this precision improvement, you should adjust for the covariate even if there’s no imbalance. For example, suppose gender is highly correlated with your outcome, but it happens that the treatment group and control group have exactly the same gender composition. In this case, the unadjusted estimate of the ATE will be exactly the same as the adjusted estimate from a regression of the outcome on treatment and gender, but their standard errors will differ. The SE of the unadjusted estimate tends to be larger because it assumes that even if the treatment and control groups had very different gender compositions, you’d still use the unadjusted treatment–control difference in mean outcomes (which would likely be far from the true ATE in that case). If you pre-specify that you’ll adjust for gender regardless of how much or how little imbalance you see, you’ll tend to get smaller SEs, tighter confidence intervals, and more powerful significance tests. Assuming that random assignment was implemented correctly, should examination of imbalances play any role in choosing which covariates to adjust for? Here’s a sampling of views: Mutz, Pemantle, and Pham (2016) argue that, unless there is differential attrition, the practice of selecting covariates on the basis of observed imbalances is “not only unnecessary” but “not even helpful … and may in fact be damaging,” because it invalidates confidence intervals, worsens precision (relative to pre-specified adjustment for prognostic covariates), and opens the door to fishing.8 Permutt (1990), using theory and simulations to study specific scenarios, finds that when a balance test is used to decide whether to adjust for a covariate, the significance test for the treatment effect is conservative (i.e., it has a true Type I error probability below its nominal level). He writes, “Greater power can be achieved by always adjusting for a covariate that is highly correlated with the response regardless of its distribution between groups.” However, he doesn’t completely rule out considering observed imbalances: “Choosing covariates on the basis of the difference between the means in the treatment and control groups is not irrational. After all, some type I errors may be more serious than others. Reporting a significant difference in outcome which can be explained away as the effect of a covariate may be a more embarrassing error than reporting one that happens to go away on replication but without an easy explanation. Similar considerations may apply to type II errors. A positive result that depends on adjustment for a covariate may be seen as less convincing than a positive two-sample test anyway, so that the error of failing to draw such a positive conclusion may be less serious. These justifications, however, come from outside the formal theory of testing hypotheses.”9 Altman (2005) writes, “It seems far preferable to choose which variables to adjust for without regard to the actual data set to hand.” He recommends controlling for highly prognostic covariates, as well as any that were used in blocking. However, he also discusses a dilemma: “In practice, imbalance may arise when the possible need for adjustment has not been anticipated. What should the researchers do? They might choose to ignore the imbalance; as noted, this would be entirely proper. The difficulty then is one of credibility. Readers of their paper (including reviewers and editors) may question whether the observed finding has been influenced by the unequal distribution of one or more baseline covariates. It is still possible, and arguably advisable, to carry out an adjusted analysis, but now with the explicit acknowledgment that this is an exploratory rather than definitive analysis, and that the unadjusted analysis should be taken as the primary one. Obviously, if the simple and adjusted analyses yield substantially the same result, then there is no difficulty of interpretation. This will usually be the case. However, if the results of the two analyses differ, then there is a real problem. The existence of such a discrepancy must cast some doubt on the veracity of the overall (unadjusted) result. The situation is similar to the difficulties of interpretation that arise with unplanned subgroup comparisons. One suggestion in such circumstances is to try to mimic what would have been done if the problem had been anticipated, namely to adjust not for variables that are observed to be unbalanced, but for all variables that would have been identified in advance as prognostic. An independent source could be used to identify such variables. Alternatively, the trial data could be used to determine which variables are prognostic. This strategy too could be prespecified in the study protocol. Because this analysis would be performed conditionally on the observed imbalance, it does not remove bias and thus cannot be considered fully satisfactory.”10 Tukey (1991) notes that observed imbalances may justify adjustment as a robustness check: Although “most statisticians” would accept an analysis of a randomized clinical trial that doesn’t adjust for covariates, “Some clinicians, and some statisticians it would seem, would like to be more sceptical, (perhaps as a supplemental analysis) asking for an analysis that takes account of observed imbalances in these recorded covariates. Feeling more secure about the results of such an analysis is indeed appropriate, since the degree of protection against either the consequences of inadequate randomization or the (random) occurrence of an unusual randomization is considerably increased by adjustment. Greater security, rather than increased precision … will often be the basic reason for covariance adjustment in a randomized trial. … The main purpose of allowing [adjusting] for covariates in a randomized trial is defensive: to make it clear that analysis has met its scientific obligations.”11 Some statisticians argue that our inferences should be conditional on a measure of covariate imbalance—in other words, when assessing the bias, variance, and mean squared error of a point estimate or the coverage probability of a confidence interval, instead of considering all possible randomizations, it may be more relevant to consider only those randomizations that would yield a covariate imbalance similar to the one we observe. From this perspective, observed imbalances may be relevant to the choice of estimator.12 Lin, Green, and Coppock (2016) write: “Covariates should generally be chosen on the basis of their expected ability to help predict outcomes, regardless of whether they appear well-balanced or imbalanced across treatment arms. But there may be occasions when the covariate list specified in the PAP [pre-analysis plan] omitted a potentially important covariate (due to either an oversight or the need to keep the list short when N is small) with a nontrivial imbalance. Protection against ex post bias (conditional on the observed imbalance) is then a legitimate concern.” However, they recommend that if observed imbalances are allowed to influence the choice of covariates, “the balance checks and decisions about adjustment should be finalized before we see unblinded outcome data,” “the direction of the observed imbalance (e.g., whether the treatment group or the control group appears more advantaged at baseline) should not be allowed to influence decisions about adjustment,” and the originally pre-specified estimator should “always be reported and labeled as such, even if alternative estimates are also reported.”13 7 When not to do it It is a bad idea to adjust for covariates when you think those covariates could have been influenced by your treatment. This is one of the reasons that many covariates are collected from baseline surveys; sometimes covariates that are collected from surveys after intervention could reflect the effects of the treatment rather than underlying characteristics of the subject. Adjusting for covariates that are affected by the treatment—“post-treatment” covariates—can cause bias. Suppose, for example, that Giné and Mansuri had collected data on how many political rallies a woman attended after receiving the treatment. In estimating the treatment effect on independence of political choice, you may be tempted to include this variable as a covariate in your regression. But including this variable, even if it strongly predicts the outcome, may distort the estimated effect of the treatment. Let’s create this fake variable, which is correlated (like the outcome measure) with baseline covariates and also with treatment. Here, by construction, the treatment effect on number of political rallies attended is 2. When we included the rallies variable as a covariate, the estimated average treatment effect on independence of candidate choice averaged 0.54 across the 10,000 replications. Recall that the true treatment effect on this outcome is 1. This is severe bias, all because we controlled for a post-treatment covariate!14 This bias results from the fact that the covariate is correlated with treatment. Just because you should not adjust for post-treatment covariates does not mean you cannot collect covariate data post-treatment, but you must exercise caution. Some measures could be collected post-treatment but are unlikely to be affected by treatment (e.g., age and gender). Be careful about measures that may be subject to evaluation-driven effects, though: for example, treated women may be more acutely aware of the expectation of political participation and may retrospectively report that they were more politically active than they actually were several years prior. 8 Concerns about small-sample bias In small samples, regression adjustment may produce a biased estimate of the average treatment effect.15 Some simulations have suggested that this bias tends to be negligible when the number of randomly assigned units is greater than twenty.16 If you’re working with a small sample, you may want to use an unbiased covariate adjustment method such as post-stratification (splitting the sample into subgroups based on the values of one or more baseline covariates, computing the treatment–control difference in mean outcomes for each subgroup, and taking a weighted average of these subgroup-specific treatment effect estimates, with weights proportional to sample size).17 9 How to make your covariate adjustment decisions transparent In the interests of transparency, if you adjust for covariates, pre-specify your models and report both unadjusted and covariate-adjusted estimates. The simulations above have demonstrated that results may change slightly or not-so-slightly depending on which covariates you choose to include in your model. We’ve highlighted some rules of thumb here: include only pre-treatment covariates that are predictive of outcomes. Deciding which covariates to include, though, is often a subjective rather than an objective enterprise, so another rule of thumb is to be totally transparent about your covariate decisions. Always include the simplest model—the simple regression of outcome on treatment without controlling for covariates—in your paper or appendix to supplement the findings of your model including covariates. Another way to minimize your readers’ concern that you went fishing for the particular combination of covariates that gave results favorable to your hypotheses is to pre-specify your models in a pre-analysis plan.18 This gives you the opportunity to explain before you see the findings which pre-treatment covariates you expect to be predictive of the outcome. You can even write these regressions out in R using fake data, as done here, so that when your results from the field arrive, all you need to do is run your code on the real data. These efforts are a useful way of binding your own hands as a researcher and improving your credibility. 10 Covariates can help you investigate the integrity of the random assignment Sometimes it is unclear whether random assignment actually occurred (or whether it occurred using the procedure that the researcher envisions). For example, when scholars analyze naturally occurring random assignments (e.g., those conducted by a government agency), it is useful to assess statistically whether the degree of imbalance between the treatment and control groups is within the expected margin of error. One statistical test is to regress treatment assignment on all of the covariates and calculate the F-statistic. The significance of this statistic can be assessed by simulating a large number of random assignments and for each one calculating the F-statistic; the resulting distribution can be used to calculate the p-value of the observed F-statistic. For example, if 10,000 simulations are conducted, and just 30 simulations generate an F-statistic larger than what one actually obtained from the data, the p-value is 0.003, which suggests that the observed level of imbalance is highly unusual. In such cases, one may wish to investigate the randomization procedure more closely. Originating author: Lindsay Dolan. Revisions: Don Green and Winston Lin, 1 Nov 2016. The guide is a live document and subject to updating by EGAP members at any time; contributors listed are not responsible for subsequent edits. Thanks to Macartan Humphreys and Diana Mutz for helpful discussions.↩ See, e.g., pages 217–219 of Miriam Bruhn and David McKenzie (2009), “In Pursuit of Balance: Randomization in Practice in Development Field Experiments,” American Economic Journal: Applied Economics 1 (4): 200–232.↩ A brief review of bias and precision: Imagine replicating the experiment many times (without changing the experimental sample and conditions, but re-doing random assignment each time). An unbiased estimator may overestimate or underestimate the ATE on any given replication, but its expected value (the average over all possible replications) will equal the true ATE. We usually prefer unbiased or approximately unbiased estimators, but we also value precision (which is formally defined as the inverse of the variance). Imagine you’re throwing a dart at a dartboard. If you hit the center of the dartboard on average but your shots are often far from the mark, you have an unbiased but imprecise estimator. If you hit close to the center every time, your estimator is more precise. A researcher may choose to accept a small bias in return for a large improvement in precision. One possible criterion for evaluating estimators is the mean squared error, which equals the variance plus the square of the bias. See, e.g., Sharon Lohr (2010), Sampling: Design and Analysis, 2nd ed., pp. 31–32.↩ “Sampling variability” refers to the spread of estimates that will be produced just because of the different random assignments that could have been drawn. When the luck of the draw of random assignment produces a treatment group with more As and a control group with more Bs, it is more difficult to separate background characteristics (A and B) from treatment assignment as the predictor of the observed outcomes.↩ The estimated bias is \(-\) 0.459 with a margin of error (at the 95% confidence level) of 0.002.↩ David A. Freedman (2008), “On Regression Adjustments in Experiments with Several Treatments,” Annals of Applied Statistics 2: 176–196. See also Winston Lin’s blog posts (part I and part II) discussing his response to Freedman.↩

Q: Constructing a non-rotating skyhook with a rotating one There are two proposed versions of the skyhook concept: rotating (also known as a rotovator) and non-rotating. They're both meant to reduce the speed a launch vehicle needs to achieve to deliver a payload to orbit. From what I've read so far, it seems that the rotating skyhook requires less mass to achieve the same effect, while the non-rotating skyhook is easier to dock with (and has some other advantages outlined here). Would it be practical to construct a rotating skyhook first (less mass to launch into orbit), then use that to help launch the materials for a non-rotating skyhook? I haven't seen this suggested anywhere else: most of the sources I've read favour one over the other. A: Rotating skyhooks are generally designed to operate from lower altitudes than fixed, to reduce the tether length. This means both that fuel will be being expended to transfer construction materials between the two, and that they will be in different orbits. All orbits around a single body have two intersecting points in the ground track, but normally are different in altitudes which avoids collisions. Since both of these skyhooks are longer then the difference in altitude this makes collision avoidance a problem. It is certainly possible with careful planning but will increase costs. Most designs for both assume an equatorial orbit, but since that guarantees collision one (presumably the rotating one) would need to be inclined and accept the costs of plane change both in earth relative motion for launched cargo and skyhook to skyhook transfer. Note also that failure to avoid collision probably triggers kessler cascade so everybody on earth will want to have input possibly leading to bike shedding. Also relevant is that using a skyhook for bulk mass movement is not free, lifting a mass up the structure drags the rest of the structure down and fuel will need to be expended to bring it back up. This fuel burn can be more efficient than the classical final stage of a chemical rocket, but is still a system cost that means building a rotating skyhook does not automatically make building a fixed skyhook or full space elevator free. A lot of the very hypothetical assumptions around these structures assume building a rotating sky hook is for allowing access to asteroid or lunar resources, and that these resources would in turn be used to sustain and/or expand the skyhook/space elevator capability. So the concept of stepping up the lifting capability is often assumed, but generally not directly as 'build rotation skyhook->build stationary skyhook->build space elevator' but instead use the resources made accessible through each step.

Q: Can a nuclear bomb be used as the power source for a laser beam My previous post "Using nuclear bombs to detect near earth orbit objects" asked about using nuclear devices to detect Earth directed asteroids and low albedo comets. Now I want to explore a method of deflecting them using lasers. Assume we can, by (light, x or gamma rays), actually detect the incoming object on a timescale long enough to attempt to deflect it successfully. Also assume that the NEO does not simply absorb the radation, as a comet might. I don't need much (or anything really) in the answer by way of calculations, my question is simply: Is it in principle possible to convert the energy of a nuclear blast, at any appreciable efficiency level, into the production of an intense laser beam? This intense beam may then be directed at the NEO, possibly producing a deflection in it's path towards Earth. I acknowledge that this process may be considered impossible, as placing delicate equipment near a nuclear blast is generally not recommended for the completion of any project. But in defence of the merits of the question, two points: As far as I remember, the base of the tower used in the Trinity device in New Mexico did not undergo as much damage as was originally expected. The Project Orion spaceship design of the early 1960's proposed using very small nuclear devices. The calculations involved indicated that the vehicle would not be damaged by the estimated number ( in the order of hundreds) of nuclear blasts required to achieve orbit. To sum up my question, can the radiation output of a nuclear device be used, even in principle, as the power source for a laser beam (the laser beam being tuned to whatever frequency is deemed most efficient for deflection purposes.) A: Project Excalibur The idea of a nuclear pumped X-ray laser was one which was investigated in detail in the Reagan "Star Wars" program of the 1980s, backed by one Edward Teller. Tests were carried out by surrounding the nuke with bundles of rods to create a one-pass laser. Apparently it was nowhere near efficient enough to be used in a military context. [That latter fact was reported at the time but is not mentioned in the wiki article]

Q: How to draw random numbers in a circle and a square? I want to visualize the the Algorithm of the Polar method from two perspectives (bird's-eye and frog's eye view). To draw the first step of the method I need random number of the uniform distribution in a square and a circle. I've already been able to plot the circle in a square, but how to plot random numbers (z1) inside of this construct? require (plotrix) require (grid) z1 = runif (100) plot (c(-1,1), c(-1,1), type="n", asp=1) rect(-1,-1,1,1) draw.circle (0,0,1) And how to change the perspective? A: You can do without 'rejecting' any points. The following R function needs 3*n random numbers and will generate n randomly chosen points in a circle of radius r: randp <- function(n = 1, r = 1) { if (n < 1 || r < 0) return(c()) x <- rnorm(n) y <- rnorm(n) r <- r * sqrt(runif(n)/(x^2 + y^2)) if (n == 1) U <- c(x, y) else U <- cbind(r*x, r*y) return(U) } A: To plot points, you need both x and y coordinates. ...But since your square is from -1 to 1, you also need to scale the points (or change the square): x = runif(100, min=-1, max=1) y = runif(100, min=-1, max=1) points(x,y) UPDATE Here's a function that generates random numbers on a circle. It uses rejection to discard points outside the circle. It uses an (in my opinion) interesting way to do so: It generates a batch of numbers, rejects some and then generates some more until enough values are available. This is typically much more efficient than generating one number at a time... UPDATE AGAIN I improved the speed by not appending the new batch until the end. Also added speed comparisons. rndCircle <- function(n = 100, r=1) { scale <- 1.15 # Generate 15% more values than requested m <- matrix(0, 0, 2, dimnames=list(NULL, c('x','y'))) lst <- list(m) nMore <- n while (nMore > 0) { #cat("nMore=", nMore, "\n") # uncomment to see how many iterations are needed m <- matrix(runif(floor(nMore*scale)*2, min=-1, max=1), ncol=2) m <- m[rowSums(m*m) <= 1, , drop=FALSE] nMore <- nMore - nrow(m) lst[[length(lst)+1L]] <- m } # Combine and truncate to desired length do.call(rbind, lst)[seq_len(n),]*r } # Measure performance set.seed(42); system.time( rndCircle(1e6) ) # 0.19 # Compare to @Hans Werner's solution set.seed(42); system.time( randp(1e6) ) # 0.26

In 1575 a great number of people from the Netherlands immigrated to Hamburg and brought much prosperity to the city. In the 19th century emigration to the USA began. Hamburg was the transitional stop for emigrants from the Northern German coastal countries as well as from Eastern European countries. + <br> Emigration and Immigration + In 1575 a great number of people from the Netherlands immigrated to Hamburg and brought much prosperity to the city. In the 19th century emigration to the USA began. Hamburg was the transitional stop for emigrants from the Northern German coastal countries as well as from Eastern European countries. + <br> − By 1850 Hamburg became next to Bremen the most important emigration port in Europe. Read all about emigrating through Hamburg by clicking on https://wiki.familysearch.org/en/Germany_Emigration_and_Immigration + By 1850 Hamburg became next to Bremen the most important emigration port in Europe. Read all about emigrating through Hamburg by clicking on [[Germany_Emigration_and_Immigration|Germany Emigration and Immigration]] − A very important tool in tracing German immigrants can be the Hamburg Passenger List. Study how to use this resource by clicking here: https://wiki.familysearch.org/en/Hamburg_Passenger_Lists + A very important tool in tracing German immigrants can be the Hamburg Passenger Lists, which cover the years 1850-1934. Study how to use this resource by clicking here: [[Hamburg_Passenger_Lists|Hamburg Passenger Lists]] − <br> + <br> − Emigrants could have remained in Hamburg for a while. There was a Meldepflicht (obligation to register) in force since 1833 (mainly for non-Hamburgers), but became not mandatory until 1892. Foreigners and servants were registered and those in need of passports. Such records are available through the Family History Library Catalog under Place Search (Hamburg), Naturalization and citizenship (Heimatbücher 1826-1864), Population (Meldeprotokolle für Fremde 1868-1889) and Immigration (Reisepasskontrolle 1851-1929). + Emigrants could have remained in Hamburg for a while. There was a Meldepflicht (obligation to register) in force since 1833 (mainly for non-Hamburgers), but it&nbsp;was not mandatory until 1892. Foreigners and servants were registered and those in need of passports. Some of these records are available through the Family History Library Catalog under Place Search (Hamburg), Naturalization and citizenship (Heimatbücher 1826-1864), Population (Meldeprotokolle für Fremde 1868-1889) and Immigration (Reisepassprotokolle 1851-1929). − <br> + <br> Schutzverwandtschaft (17th century-1811,1837-1864) Schutzverwandtschaft (17th century-1811,1837-1864) − To receive the privilege of&nbsp; becoming a citizen (usually not full-status)&nbsp;in Hamburg required consent through the city council. People had to swear alligence, pay a yearly fee, report all suspicious actívities and could not transfer their privileges to their children. + To receive the privilege of&nbsp; becoming a citizen (usually not full-status)&nbsp;in Hamburg required consent through the city council. People had to swear alliegiance, pay a yearly fee, and report all suspicious actívities. They could not transfer their privileges to their children. The records are found in the State Archive Hamburg. Key words are Bürgerbücher, Bürgerprotokolle&nbsp;(1596-1902) as well as &nbsp;Heimatscheinprotokolle (1826-1872). The records are found in the State Archive Hamburg. Key words are Bürgerbücher, Bürgerprotokolle&nbsp;(1596-1902) as well as &nbsp;Heimatscheinprotokolle (1826-1872). Revision as of 19:15, 6 August 2012 In 1575 a great number of people from the Netherlands immigrated to Hamburg and brought much prosperity to the city. In the 19th century emigration to the USA began. Hamburg was the transitional stop for emigrants from the Northern German coastal countries as well as from Eastern European countries. By 1850 Hamburg became next to Bremen the most important emigration port in Europe. Read all about emigrating through Hamburg by clicking on Germany Emigration and Immigration A very important tool in tracing German immigrants can be the Hamburg Passenger Lists, which cover the years 1850-1934. Study how to use this resource by clicking here: Hamburg Passenger Lists Emigrants could have remained in Hamburg for a while. There was a Meldepflicht (obligation to register) in force since 1833 (mainly for non-Hamburgers), but it was not mandatory until 1892. Foreigners and servants were registered and those in need of passports. Some of these records are available through the Family History Library Catalog under Place Search (Hamburg), Naturalization and citizenship (Heimatbücher 1826-1864), Population (Meldeprotokolle für Fremde 1868-1889) and Immigration (Reisepassprotokolle 1851-1929). Schutzverwandtschaft (17th century-1811,1837-1864) To receive the privilege of becoming a citizen (usually not full-status) in Hamburg required consent through the city council. People had to swear alliegiance, pay a yearly fee, and report all suspicious actívities. They could not transfer their privileges to their children. The records are found in the State Archive Hamburg. Key words are Bürgerbücher, Bürgerprotokolle (1596-1902) as well as Heimatscheinprotokolle (1826-1872).

1. Field of the Invention This invention concerns internal combustion engines, and more particularly relates to the starting of such engines without a conventionally employed storage battery or other energy source. 2. Description of the Prior Art Internal combustion engines operate on the principle that a liquid fuel, when ignited and combusted in a cylinder equipped with a reciprocating piston, generates a large volume of gas which pushes the piston toward the opposite extremity of the cylinder. In order to start the engine, fuel must be within the cylinder while the piston is at its outer-most point of travel within the cylinder, often referred to as Top Dead Center of the "power stroke", and means must be provided for igniting or "firing" the fuel. In engines having a multiplicity of cylinders whose pistons cooperatively engage a crankshaft, the sequence of firing of the cylinders is important in the starting and continued operation of the engine. Before the advent of storage batteries, internal combustion engines such as those on automotive vehicles were started by hand-cranking. The crank was geared so as to rotate the crankshaft. When manually rotated, the crankshaft performs the several sequential steps involved in the normal running of the engine, namely: feeding fuel to the cylinders, producing properly staged movement of the pistons, and supplying a magneto-generated spark to appropriate cylinders by way of a "distributor" switching device. However, the manual cranking of an engine is difficult even with relatively small engines, and almost impossible with high horsepower engines employed in modern vehicles. Internal combustion engines, as on automotive vehicles, can be extremely difficult to start in cold weather or after long standing, even when the engine is equipped with a heavy duty storage battery and starter motor adapted to rotate the crankshaft. Various expedients have been proposed for starting internal combustion devices. For example, explosive devices have been disclosed in U.S. Pat. No. 1,877,936 and elsewhere. Modifications involving the delivery to the cylinders of a highly volatile starting fuel such as dimethyl ether is disclosed in U.S. Pat. Nos. 2,053,321; 3,494,340; 3,661,133; 5,119,775 and 5,195,477. U.S. Pat. No. 2,348,621 concerns an engine starting system equipped with means driven independently of the normal engine timing for effecting intake and exhaust in the engine cylinders and for timing the ignition means. The equipment required is of complex construction, and cannot be feasibly retrofitted onto engines of ordinary design. Also, a storage battery and accompanying starter motor are still necessary components of this system. It is accordingly an object of the present invention to provide a method for starting an internal combustion engine. It is a further object of this invention to provide a method as in the foregoing object which does not require use of a storage battery, starter motor or other energy source such as a flywheel or external means of cranking the engine. It is another object of the present invention to provide manually operable apparatus for accomplishing the aforesaid method for starting an internal combustion engine. It is a still further object of this invention to provide apparatus of the aforesaid nature which is easily installable upon and compatible with internal combustion engines of conventional design. These objects and other objects and advantages of the invention will be apparent from the following description.

The most commonly used club in a typical golf bag is the putter. Approximately one-third to one half of a golfer's strokes on the golf course are taken using a putter. The design of golf putters varies widely. Putter heads can be manufactured having different weighting characteristics, sizes, shapes and colors. Putter heads have progressed from a simple blade-shaped design to more sophisticated designs such as mallet-type putter heads which can include particular weight distributions to improve performance. It is well known that weight distribution in a putter head can affect the moment of inertia of the putter head. As used herein, the moment of inertia is defined as the tendency of the putter head to rotate about its center of gravity when impacting a golf ball at locations spaced from the center of gravity. If the putter head is more resistant to twisting upon an off-center impact with the ball, there is a higher likelihood that the ball will move toward the intended target. Thus, a higher moment of inertia translates into greater forgiveness for off-center ball-striking, e.g. increased directional control of the ball. Further, decreasing the tendency of the putter head to twist on impact causes a more direct transfer of energy between the movement of the putter head and movement of the ball, resulting in better distance control while putting. In addition, the weight distribution of a putter head can impact the spin of the ball following contact with the face of the putter. Generally, a putter head that provides the ball with a certain amount of topspin while reducing the likelihood of sidespin or skidding along the surface of the green is desired. Traditionally, putter heads have been formed entirely of metal, such as stainless steel or other alloys. Current putter heads can include face inserts formed from materials that are different than the remainder of the putter head. However, achieving the precise weight and balance, along with a high moment of inertia to provide a more optimal loft and a truer roll of the ball following impact has historically been difficult, if not elusive. Accordingly, the need exists to provide a putter head having improved weighting and balance characteristics for a more consistent putting stroke and improved loft and roll of the ball after impact. A further need exists to provide a putter head having a high moment of inertia for to maintain a truer roll and decreased twisting of the putter head upon impact with the ball. Another need exists to provide a putter that is easy to use and cost-efficient to manufacture.

Renewable energy resources such as wind, solar, and hydroelectricity are alternative energy sources to traditional fossil energy. In some instances, the shortcomings of renewable energy include their variability and intermittent power generation. As such, energy storage devices such as batteries, flywheels, and supercapacitors have been used to ensure delivery of continuous and stable energy supplies.

Lambda Telescopii λ Telescopii, Latinized as Lambda Telescopii, is a solitary, white-hued star in the southern constellation of Telescopium. It is visible to the naked eye as a faint point of light with an apparent magnitude of +4.87. This body is located approximately 610 light years from the Sun based on parallax. At that distance, the visual magnitude of the star is diminished by an extinction of 0.18 due to interstellar dust. This is a late B- or early A-type main-sequence star that is generating energy through core hydrogen fusion. The star is 268 million years old with a relatively high rate of spin, showing a projected rotational velocity of 110. It has a higher than solar metallicity – the abundance of elements more massive than Helium. The star is radiating 350 times the Sun's luminosity from its photosphere at an effective temperature of 10,139 K. References Category:B-type main-sequence stars Category:A-type main-sequence stars Telescopii, Lambda Category:Telescopium (constellation) Category:Durchmusterung objects 175510 093148 7314

Dizziness Dizziness refers to any sensation of unsteadiness. A person experiencing it might feel weak, faint, or woozy. It is often accompanied by a feeling of movement, either one of spinning or floating, despite the lack of any actual movement. Dizziness is a symptom of many conditions, a few of them serious but the majority, minor. What Causes Dizziness? When the body’s balance and sensory systems transmit false signals to the brain, it incorrectly interprets a sense of movement, resulting in dizziness. These signals originate in the inner ear, eyes, or sensory nerves, and are affected by conditions such as low blood pressure, anemia, dehydration, heart disorders, bleeding, and medications (e.g. beta blockers or nitroglycerin). A person may feel lightheadedness or faint. Vertigo – a false perception of motion – is another common experience. Dizziness may be accompanied by confusion, disorientation, nausea, or vomiting. Some of the more common conditions that can cause dizziness include high blood pressure, hypotension (a lack of blood to the head when getting up from a lying position), hyperventilation, heart conditions, and endocrine system disorders such as diabetes, Thyroid disease, and Addison’s disease. How is Dizziness Treated? It is important to evaluate the condition that is causing dizziness, keeping in mind that it’s a symptom rather than a disease. A thorough physical exam and a series of diagnostic tests may be needed to determine the exact cause. Treatment could involve medication, surgery, physical or occupational therapy, or vestibular rehabilitation. Sometimes, successful treatment entails making a few simple lifestyle changes.

Q: Is there a way to make atom move faster without heating them? The more heat you add the faster the atom will move. This is something that is common knowledge. My question is it possible to make the atoms in let's say a gas move faster without adding heat of a large volume of heat? A: If you take a bottle of gas and carry it with you on a supersonic plane, then the molecules will go much faster without the temperature changing. If you let pressurized gas flow through a well-designed nozzle (De Laval nozzle), the gas will accelerate to supersonic velocity (i.e., faster than the original thermal speed of the molecules) while the temperature of the gas decreases. Note that the temperature of high-speed gases is a tricky subject; a thermomemeter moving along with the gas stream will sense a lower temperature than a stationary thermometer. The former measures the static temperature, while the latter measures the recovery temperature (depends on the shape of the thermometer probe). There is also the stagnation temperature, which represents the energy of the molecules regardless of whether it is due to thermal (random) motion or due to the kinetic energy of a gas jet. So, with the gas bottle on a plane, the static temperature doesn't change, but the stagnation temperature increases for an observer who stays on the ground. Gas flowing through a nozzle (assuming that the nozzle is thermally insulated) does not change in stagnation temperature, but its static temperature drops.

Qinling Pandas Giant pandas are black and white– most of the time. A subspecies of giant panda that lives in China’s Qinling Mountains has tan and brown fur. The different color is due to a genetic mutation. Scientists think that this mutation might be prominent in this group because the pandas are isolated up in the mountains, and the smaller gene pool leads to uncommon traits being concentrated. In addition to having brown fur, Qinling pandas differ from their black and white cousins in a couple ways. Qinling pandas are usually smaller than regular giant pandas, and their eye spots are located just below their eyes, rather than all around their eyes.

Q: Understanding Sieve of Eratosthenes in Python I've found an example code in python that gives out all prime numbers upto n but I simply don't get it, Why does it does what it does? I've read the wikipedia article about the Sieve of Eratosthenes but simply have no idea about how this works. pp = 2 ps = [pp] lim = raw_input("Generate prime numbers up to what number? : ") while pp < int(lim): pp += 1 for a in ps: if pp%a==0: break else: ps.append(pp) print set(ps) An explanation of how the loop works would be appreciated. EDIT - Figured out that the code's all wrong for it denotes 25 as a prime and through more intensive searching found that this ain't no sieve, can someone show an generator which utilizes the sieves in python and explain it A: Since no one has yet to show a true sieve or explain it, I will try. The basic method is to start counting at 2 and eliminate 2*2 and all higher multiples of 2 (ie 4, 6, 8...) since none of them can be prime. 3 survived the first round so it is prime and now we eliminate 3*3 and all higher multiples of 3 (ie 9, 12, 15...). 4 was eliminated, 5 survived etc. The squaring of each prime is an optimization that makes use of the fact that all smaller multiples of each new prime will have been eliminated in previous rounds. Only the prime numbers will be left as you count and eliminate non-primes using this process. Here is a very simple version, notice it does not use modulo division or roots: def primes(n): # Sieve of Eratosthenes prime, sieve = [], set() for q in xrange(2, n+1): if q not in sieve: prime.append(q) sieve.update(range(q*q, n+1, q)) return prime >>> primes(100) [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47, 53, 59, 61, 67, 71, 73 79, 83, 89, 97] The simple approach above is surprisingly fast but does not make use of the fact that primes can be only odd numbers. Here is a generator based version that is faster than any other I have found but hits a Python memory limit at n = 10**8 on my machine. def pgen(n): # Fastest Eratosthenes generator yield 2 sieve = set() for q in xrange(3, n+1, 2): if q not in sieve: yield q sieve.update(range(q*q, n+1, q+q)) >>> timeit('n in pgen(n)', setup="from __main__ import pgen; n=10**6", number=10) 5.987867565927445 Here is a slightly slower but much more memory efficient generator version: def pgen(maxnum): # Sieve of Eratosthenes generator yield 2 np_f = {} for q in xrange(3, maxnum+1, 2): f = np_f.pop(q, None) if f: while f != np_f.setdefault(q+f, f): q += f else: yield q np = q*q if np < maxnum: np_f[np] = q+q >>> timeit('n in pgen(n)', setup="from __main__ import pgen; n=10**6", number=10) 7.420101730225724 >>> list(pgen(10)) [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47] To test if a number is prime just do: >>> 539 in pgen(539) False >>> 541 in pgen(541) True Here are some hints as to how this more memory efficient version works. It uses a dict to store only the bare minimum of information, the next non-prime numbers (as keys) along with their factors (as values). As each non-prime is found in the dict, it is removed and the next non-prime key is added with the same factor value. A: That code is an attempt at using trial division to produce a sequence of primes. To correct it: pp = 2 ps = [pp] lim = raw_input("Generate prime numbers up to what number? : ") while pp < int(lim): pp += 1 for a in ps: if pp%a==0: break else: # unindent ps.append(pp) # this To make it much more efficient (in fact, optimal) trial division: pp = 2 ps = [pp] lim = raw_input("Generate prime numbers up to what number? : ") while pp < int(lim): pp += 1 for a in ps: if a*a > pp: # stop ps.append(pp) # early break if pp%a==0: break

BIAS & the Quality of Data To separate good information from bad stick to the ABCs of forensic investigators: Assume nothing; Believe, no one; and Check everything. For people issues there is also a D: Dollars are usually a signpost to the root of an issue Evidence - called here data - as discussed in Bias Aware Thinking, is made up of an assortment of objects, information, testimony, indeed any sort of clue that supports or challenges a claim, theory, or argument. Data, of course, can be fraudulent, erroneous, incomplete, or the whole truth of the matter. Guidance to determine the quality of this data can often be found by an awareness of bias. When a self-interested group has made use of some data and the findings appear to be self-serving then the conclusions would generally be examined for bias. It is usual in those cases that supportive aspects of the matter were considered and other facts were either ignored or downplayed. But when one agrees with a certain conclusion the existence of biases in the data supporting it will rarely be questioned. As data quality is a major piece in solving The Bias Puzzle the merit of all data should established as far as possible or practical. This is no easy matter as the quality data can be misinterpreted when being used. So the unconditional rule is to examine data skeptically, whether one agrees with its conclusions or not. Perhaps the best way to evaluate the quality of data is to solicit input from diverse sources; especially from those whose brains function differently from one's own (see Step #10 in Bias Management). That is why most legal systems have juries of more than one person and information is presented by a prosecution and a defense each with (in many jurisdictions) their own experts. An analogy of how data can be biased is shown in sliding tile puzzle graphics below. There are eight facts represented by numbers 1 to 8; but the logical arrangement, or conclusion, from those facts can be different - only one of which would represent a truth. The bias would be in the determination of the appropriate arrangement - "sequential line-by-line" or "circular". both arrangements of the tiles seem logical but only one can represent the truth

All relevant data are within the paper. Introduction {#sec001} ============ Biological soil crusts (BSCs) are ecological pioneers and play very important ecological functions in the desert ecosystem. Because of their drought and cold resistance, they are widely distributed in arid and semi-arid regions. They can fix sands by aggregating surface soil \[[@pone.0134447.ref001],[@pone.0134447.ref002]\], change soil nutrient cycling \[[@pone.0134447.ref003]\], accumulate soil nutrients \[[@pone.0134447.ref004],[@pone.0134447.ref005]\], improve the soil micro-structure \[[@pone.0134447.ref006]\], and lay the foundation for ecosystem development \[[@pone.0134447.ref007],[@pone.0134447.ref008]\]. BSCs can be divided into cyanobacteria crusts, lichen crusts, and moss crusts according to the dominating species \[[@pone.0134447.ref009]\], and the successional order is cyanobacteria crusts, followed by lichen crusts and moss crusts \[[@pone.0134447.ref010]\], with moss crusts being the advanced stage under favorable site conditions \[[@pone.0134447.ref011],[@pone.0134447.ref012]\]. Mosses are poikilohydric plants that are physiologically drought tolerant. During drought, mosses lose water and become dry, and when the soil water and air humidity increases, they rapidly absorb moisture to restore normal physiological metabolic activities. Moss crusts facilitate the colonization and growth of vascular plants in some arid ecosystems due to their soil stabilization and fertility effects \[[@pone.0134447.ref012]\]. Moss crusts can fix carbon (C) through photosynthesis \[[@pone.0134447.ref013]\], increase the organic matter content in soils \[[@pone.0134447.ref014]\], fix sands \[[@pone.0134447.ref015]\], provide better fertility for the subsequent germination of vascular plant seeds, and engineer a solid foundation for the establishment of vascular plants \[[@pone.0134447.ref003],[@pone.0134447.ref016]\]. Although moss crusts have a significant positive impact on the ecosystems in arid areas, their growth can take several years or even decades under natural conditions \[[@pone.0134447.ref017]\]. Meanwhile, mosses are very sensitive to disturbance \[[@pone.0134447.ref018]\], and thus, damage to stable developed mosses can easily result in changes in their coverage, composition, and functions, leading to severe soil erosion. In addition, mosses take a long time to fully recover after disturbance \[[@pone.0134447.ref019], [@pone.0134447.ref020]\], so it would be both effective and practical to cultivate artificially moss crusts for use in ecological restoration. Compared with vascular plant restoration materials, moss crusts are better adapted to environments with drought or poor soils, especially in some of the ecosystems most vulnerable to degradation. Artificial moss crusts could immediately play a role in preventing erosion of damaged surfaces in urgent need of restoration. Technology development to accomplish fast cultivation is the first step toward this goal. Therefore, the identification of key factors that affect the rapid development of moss crusts and aid in the achievement of rapid recovery is of great practical significance for exploiting their positive ecological functions. A previous report \[[@pone.0134447.ref021]\] suggested that the recovery of the mosses on scalped surfaces was relatively fast even under the extreme arid conditions of the Negev Desert (with long-term annual precipitation \<100 mm), however, there are few studies on the artificial cultivation of moss crusts in arid areas and their applications for ecological restoration \[[@pone.0134447.ref022],[@pone.0134447.ref023]\], and most studies on mosses have concentrated on cultivating their tissues, primarily for applications in medicine \[[@pone.0134447.ref024], [@pone.0134447.ref025]\]. The feasibility of artificially establishing moss-dominated crusts needs to be examined to narrow the information gap between research and practical applications. Typical dune-stabilizing moss crusts in the Mu Us Sandy land were collected for the present experiment, and a moss crust cultivation experiment was performed using incubators that allowed for the careful control of moisture, illumination, nutrients, and other environmental factors. The key factors that affect the rapid development of moss crusts were investigated by measuring and analyzing various indicators, including plant height, plant density, and chlorophyll *a* and exopolysaccharide contents, to determine the optimal environment for the rapid development of moss crusts under constant light intensity and constant temperature and, thus, provide baseline references for engineering applications. Materials and Methods {#sec002} ===================== Sample collection and experimental design {#sec003} ----------------------------------------- Under natural conditions, asexual reproduction through fragments of stems and leaves is the primary means of moss propagation and development of moss crusts \[[@pone.0134447.ref024],[@pone.0134447.ref025]\]. Based on this, typical dune-stabilizing moss-dominated (*Bryum argenteum* was the dominant species) crust samples were collected from the southeast edge of the Mu Us Sandland (Gechougou of Shenmu County, Shaanxi, 38° 53\'57\"N, 109° 52\'44\"E) administered by Northwest A&F University. Samples were brought indoors, soaked in water, and seived to remove most impurities including soil and litter. The leaf and stem fragments of moss with some cyanobacteria were ground using plant grinder after the samples were dried at 35°C. A plate-like container (diameter: 18 cm, height: 2 cm) was used as the cultivation vessel. The underlying sands at the sampling sites were placed in each container as the substrate (1.5 cm thick) (soil nutrient contents are shown in [Table 1](#pone.0134447.t001){ref-type="table"}). Substrate sands and crusts layer were watered to a gravimetric water content of 13.9%, which not only completely hydrated the crusts but avoided water ponding (as determined in preliminary testing). Then 2.48 g of moss fragments were evenly sowed to achieve the ideal coverage and homogeneity (after attempting various methods, we found that manual sowing achieved the best uniformity) and cultivated in an incubator for 40 days. In general, 5--25°C is the adaptive range for most moss growth \[[@pone.0134447.ref022]\]. Our previous study showed that moss crusts (*Bryum argenteum* dominated) developed best in terms of plant density and height at 15°C, compared to 25°C or 35°C \[[@pone.0134447.ref026]\]. Similar studies demonstrated that when the temperature is higher than 17°C, moss crusts (*Barbula vinealis* dominated) coverage and moss plant growth are inhibited \[[@pone.0134447.ref024]\]. Accordingly, the cultivation temperature of the experiment was set to 15°C. The experimental factors and their levels were as follows: light intensity: 2,000 lx, 6,000 lx, or 12,000 lx \[[@pone.0134447.ref022],[@pone.0134447.ref025]\]; watering frequency \[[@pone.0134447.ref027]\]: once every 2 days or once every 6 days. All treatments underwent a natural evaporative process in the growth chamber with the relative air humidity of 80%, and were supplemented every 2 days or 6 days with just enough water to bring the soil water content back to 13.9% (determined by weighing); Knop nutrient solution \[[@pone.0134447.ref022]\]: solution was applied by spraying once every 2 days \[[@pone.0134447.ref028]\] and 38 ml per container was applied each time, and the control is the same 38 ml/container of water without nutrients. There were a total of 12 treatments (shown in [Table 2](#pone.0134447.t002){ref-type="table"}) and 3 replicates per treatment, for a total of 36 experimental units. This study was approved by the Institute of Soil and Water Conservation, Northwest A&F University. 10.1371/journal.pone.0134447.t001 ###### Soil nutrient content. {#pone.0134447.t001g} Organic N(g/kg) Total N(g/kg) Ammonium N (mg/kg) Nitrate N (mg/kg) Total P(g/kg) Available P(mg/kg) Total K(g/kg) Available K(mg/kg) pH value ----------------- --------------- -------------------- ------------------- --------------- -------------------- --------------- -------------------- ----------- 6.49±0.02 0.16±0.01 4.02±0.06 3.33±0.02 0.35±0.02 4.04±0.04 25.24±0.36 109.02±0.52 8.04±0.04 10.1371/journal.pone.0134447.t002 ###### The design scheme for each treatment. {#pone.0134447.t002g} Treatments Light intensity Watering frequency Culture medium ------------ ----------------- --------------------- ---------------- 1 2,000 lx 1 watering / 2 days -Knop 2 2,000 lx 1 watering / 2 days +Knop 3 2,000 lx 1 watering / 6 days -Knop 4 2,000 lx 1 watering / 6 days +Knop 5 6,000 lx 1 watering / 2 days -Knop 6 6,000 lx 1 watering / 2 days +Knop 7 6,000 lx 1 watering / 6 days -Knop 8 6,000 lx 1 watering / 6 days +Knop 9 12,000 lx 1 watering / 2 days -Knop 10 12,000 lx 1 watering / 2 days +Knop 11 12,000 lx 1 watering / 6 days -Knop 12 12,000 lx 1 watering / 6 days +Knop Measured indicators and measuring methods {#sec004} ----------------------------------------- For plant density determination, 5 sampling points for each replicate plate were measured every 10 days and the values (total 3 plates) averaged. At the end of experiment (40 days duration), 4 points per plate were sampled and pooled to determine Chlorophyll *a* and exopolysaccharide contents for each replicate plate. The sampler was a cylindrical hollow tube with an inner diameter of 1.86 cm with an area of 2.72 cm^2^ (equivalent to 12.8% of the total surface area of one plate). The sample thickness was 3mm. Chlorophyll *a* and exopolysaccharide were used as indicators of the photoautotrophic activity of the biocrust organisms (moss or cyanobacteria) \[[@pone.0134447.ref029]\] and conditions for moss-dominated crusts development \[[@pone.0134447.ref030]\]. Chlorophyll *a* was extracted with acetone \[[@pone.0134447.ref031]\]. The specific steps for chlorophyll *a* extraction were as follows: 5 ml of 80% acetone was added to the moss samples, the samples were ground, and then placed into test tubes and left in the dark for 18 h. The sample volume was adjusted to 25 ml using 80% acetone, and then the absorbance at 645 nm (A645) and 663 nm (A663) was measured separately. The equation, chlorophyll a = 12.72 (A663)- 2.59 (A645), was used to calculate the chlorophyll *a* contents. Exopolysaccharides, the primary components of extracellular polymers that cement soil particles and increase the erosion resistance of soils, can adhere to clay minerals by forming hydrogen bonds. The anthrone method was used to determine the exopolysaccharide content \[[@pone.0134447.ref031]\]: moss-dominated crusts sample collected was put into the test tube, 5 ml dilute sulphuric acid was added and then shocked for 1 h and filtered to obtain extracted sample. 1 ml extracted sample was placed in a test tube, and 5 ml water was added; the extraction took 30 min in an 80°C water bath. 0.5 ml of anthrone reagent and 5 ml of concentrated sulfuric acid were added, and the sample was kept in the 80°C water bath for another 10 min. After cooling, the absorbance was measured at 630 nm. The standard curve was plotted using a sucrose solution. Data analysis {#sec005} ------------- The response data collected were organized and calculated using Excel 2007. One-way ANOVA and three-factor ANOVA were performed using SPSS 13.0 to examine moss density, chlorophyll *a* or exopolysaccharides responses to light intensity, watering frequency, and nutrient solution. The Duncan\'s multiple range test using DPS 7.05 was used for post hoc comparison of the means. Results {#sec006} ======= Effects of three factors on moss growth {#sec007} --------------------------------------- [Fig 1](#pone.0134447.g001){ref-type="fig"} shows the growth status of mosses that received 6,000 lx illumination+1 watering/2 days-Knop at 0 days (A), 20 days (B) and 40 days (C). There were significant changes in the growth of the bryophytes. At the end of experiment the associated cyanobacteria could be seen. The growth rate of moss plant densities ([Fig 2A, 2B and 2C](#pone.0134447.g002){ref-type="fig"}) demonstrated a consistent trend under various treatments: initially fast and subsequently slow. The same trend was also observed for plant height, and the average plant height of all treatments reached 0.49±0.06 mm after 40 days. The order of the plant height under the 3 light intensities was 6,000 lx \> 12,000 lx \> 2,000 lx, the average plant height was 0.52±0.06 mm, 0.48±0.08 mm and 0.47±0.02 mm, respectively. Differences between them were non-significant (p\>0.05). {#pone.0134447.g001} {#pone.0134447.g002} Three-factor ANOVA (Table A in [S1 File](#pone.0134447.s001){ref-type="supplementary-material"}) showed that both illumination and watering frequency had significant effects on the moss plant density (P\<0.05). The nutrient solution and the interaction between the 3 factors showed no significant effect on the moss plant density (P\>0.05). [Fig 3](#pone.0134447.g003){ref-type="fig"} shows the dynamic characteristics of moss plant densities under the 3 different light intensities. Under low light conditions (2,000 lx, [Fig 3A](#pone.0134447.g003){ref-type="fig"}), the mosses that were watered every 2 days had higher plant densities than those that were watered every 6 days. Using the same watering frequency, mosses treated with extra water had higher plant densities than those treated with the nutrient solution, indicating that applying the nutrient solution did not promote the growth of bryophytes. Under moderate light intensity (6,000 lx, [Fig 3B](#pone.0134447.g003){ref-type="fig"}), the watering frequency had similar effects on moss plant densities as were observed under 2,000 lx. Nevertheless, there was only a small difference between the two watering frequencies at day 40. Under high light intensity (12,000 lx, [Fig 3C](#pone.0134447.g003){ref-type="fig"}), the effects of the watering frequency were similar to those observed under 2,000 lx and 6,000 lx. However, the plant density differences among the various treatments were the largest at day 40. {#pone.0134447.g003} Overall, the order of plant density under different watering treatments, from high to low, was the same regardless of light intensity: 1 watering/2 days-Knop \> 1 watering/2 days+Knop \> 1 watering/6 days-Knop \> 1 watering/6 days+Knop. The order of plant density for the same watering treatment but different light intensities was, from high to low, 6,000 lx \> 12,000 lx \> 2,000 lx. For the optimal moss plant density, the best combination of factors was 6,000 lx illumination+1 watering/2 days-Knop. Effects of three factors on the chlorophyll *a* of moss-dominated crusts {#sec008} ------------------------------------------------------------------------ Under low light intensity (2,000 lx), the amount of moss was small, and there was not enough biomass to determine the chlorophyll *a* and exopolysaccharide contents. Therefore, only changes in the chlorophyll *a* of the mosses that were grown under 6,000 lx and 12,000 lx were analyzed. Three-factor ANOVA (Table B in [S1 File](#pone.0134447.s001){ref-type="supplementary-material"}) demonstrated that illumination, watering frequency, watering frequency × nutrient solution and illumination × watering frequency × nutrient solution all had highly significant effects on the chlorophyll *a* contents of moss-dominated crusts (P\<0.01). Illumination × nutrient solution had a significant effect (P\<0.05), the effect of the nutrient solution and illumination × watering frequency was not significant (P\>0.05). [Fig 4](#pone.0134447.g004){ref-type="fig"} shows the effect of illumination on chlorophyll *a* contents, and the comparison of the means using Duncan's test. The chlorophyll *a* contents of moss-dominated crusts under varying watering treatments and 12,000 lx illumination were greater than those under 6,000 lx illumination though with lower moss plant density (except for the treatment of 12,000 lx illumination+1 watering/6 days+Knop). The chlorophyll *a* contents were higher in moss-dominated crusts that were watered once every 2 days than those that were watered once every 6 days. Under 6,000 lx illumination, there were no significant differences in chlorophyll *a* contents between moss-dominated crusts treated with water and nutrient solution, regardless of watering frequency. However, a significant effect was observed for watering frequency, with greater chlorophyll *a* levels in moss-dominated crusts under the low watering frequency. In particular, chlorophyll *a* of moss-dominated crusts under the treatment 12,000 lx+1 watering/2 days+Knop was significantly larger than those of moss-dominated crusts under various treatments receiving 6,000 lx illumination, as well as those of moss-dominated crusts receiving other treatments under 12,000 lx illumination. One-way ANOVA revealed that the watering frequency significantly affected the chlorophyll *a* contents of moss-dominated crusts under 12,000 lx illumination (F = 9.883, P = 0.010), while the nutrient solution did not show a significant effect (F = 1.057, P = 0.328). Under 6,000 lx illumination, the chlorophyll *a* contents of moss-dominated crusts that were watered once every 2 days was significantly higher than those that were watered once every 6 days (F = 50.93, P = 0.000). At the high watering frequency, the chlorophyll *a* contents were greater in moss-dominated crusts treated with the nutrient solution than in those treated with extra water; and at the low watering frequency, the results were the opposite; however, these differences were not significant (F = 0.022, P = 0.884). {#pone.0134447.g004} The order of the chlorophyll *a* content of moss-dominated crusts under different treatments was shown in [Fig 4](#pone.0134447.g004){ref-type="fig"}. The chlorophyll *a* contents were significantly higher in moss-dominated crusts under the 12,000 lx+1 watering/2 days+Knop treatment than in those under any other treatment. In summary, the best environmental combinations for the best development of moss-dominated crusts crust were 12,000 lx illumination+1 watering/2 days+Knop and 12,000 lx illumination+1 watering/2 days-Knop. Effects of three factors on the exopolysaccharide of moss-dominated crusts {#sec009} -------------------------------------------------------------------------- Three-factor ANOVA (Table C in [S1 File](#pone.0134447.s001){ref-type="supplementary-material"}) showed, except for illumination × nutrient solution, that all of the other individual factors and their interactions significantly affected the exopolysaccharide contents of mosses (P\<0.05). Similar to the changes observed in the chlorophyll *a*, the effect of illumination on the exopolysaccharide contents was highly significant. [Fig 4](#pone.0134447.g004){ref-type="fig"} shows that the exopolysaccharide contents of moss-dominated crusts under various treatments at 12,000 lx illumination were greater than those under 6,000 lx illumination (except for the 12,000 lx illumination+1 watering/6 days+Knop treatment), that the exopolysaccharide contents were significantly greater in moss-dominated crusts watered once every 2 days than in those watered once every 6 days, and that the exopolysaccharide contents were significantly greater in those treated with water than in those treated with nutrient solution. One-way ANOVA showed that the watering frequency significantly affected the exopolysaccharide contents of moss-dominated crusts (F = 40.343, P = 0.000), whereas the effect of the nutrient solution on their exopolysaccharide contents was not significant (F = 2.223, P = 0.167). Under 6,000 lx illumination, the exopolysaccharide content was higher for moss-dominated crusts receiving the 1 watering/2 days treatment than for those receiving the 1 watering/6 days treatment; the exopolysaccharide contents were significantly lower for moss-dominated crusts treated with the nutrient solution treatment than for those treated with water. The frequency of watering had a highly significant impact on the exopolysaccharide contents of moss-dominated crusts (F = 10.617, P = 0.009). Knop solution had a significant negative effect on the exopolysaccharide contents of moss-dominated crusts (F = 6.843, P = 0.026). The order of exopolysaccharide contents in moss-dominated crusts under different treatments was demonstrated in [Fig 4](#pone.0134447.g004){ref-type="fig"}. The highest exopolysaccharide content in moss-dominated crusts was under 12,000 lx illumination+1 watering/2 days-Knop treatment. In terms of exopolysaccharide content, the best combination of factors for moss-dominated crusts crust cultivation was 12,000 lx illumination+1 watering/2 days-Knop. Discussion {#sec010} ========== Factors influencing development of moss-dominated crusts {#sec011} -------------------------------------------------------- The moss species tested, *Bryum argenteum*, has hygrophilous properties and requires a certain amount of humidity or water to perform photosynthesis, respiration, and physiological metabolism. The present study demonstrated that moss-dominated crusts receiving a high watering frequency resulted in higher moss plant densities, plant heights, chlorophyll *a* contents, and exopolysaccharide contents. Mosses watered once every 2 days grew better than those watered once every 6 days, indicating that water or moisture is a key factor for the growth of bryophytes. This result is supported by related studies. For example, Kidron et al. \[[@pone.0134447.ref032],[@pone.0134447.ref033],[@pone.0134447.ref034]\] found that wetness duration of soil surface had a high positive correlation with moss growth, rather than dust-driven nutrients, direct rain precipitation, or dew. Severe desiccation of soil surface negatively affected the shoots biomass of moss crusts in Mojave Desert \[[@pone.0134447.ref035]\]. Other reports demonstrated that relative air humidity is a major factor limiting the growth of bryophytes and high humidity is conducive to generating more protonema \[[@pone.0134447.ref024]\], the optimum moisture content for the photosynthesis of mosses was 80%- 100% \[[@pone.0134447.ref036]\]. Mosses are primarily shade plants but can also adapt to a wide range of light intensities \[[@pone.0134447.ref036]\]. Of the three light intensities tested in the present experiment, moss-dominated crusts did not grow adequately under the lowest light intensity (2,000 lx), and the chlorophyll *a* and exopolysaccharide contents were the highest under 12,000 lx illumination. The possible reasons are as follows: a light intensity of 2,000 lx is not adequate for moss growth, resulting in the slow growth of the bryophytes; illumination at 12,000 lx provided relatively sufficient light, and would obviously result in development of accompanying cyanobacteria and moss plant density. These results suggest that the light inhibition point of mosses was not reached at 12,000 lx. This result is also supported by similar studies: for moss crusts, the light saturation point is approximately 1,000 μmol m^-2^ s^-1^ (approximately 80,000 lx) \[[@pone.0134447.ref036]\]. Moss plants under low light (2,000 lx) were significantly thinner than those under other illuminations. The higher moss plant density and lower chlorophyll *a* and exopolysaccharide content under 6,000 lx than that under 12,000 lx were probably because the interaction of 6,000 lx with the temperature and soil water content resulted in higher emergence of moss. Under 12,000 lx, the photosynthesis rate and accompanying cyanobacteria is higher resulting in higher chlorophyll *a* and exopolysaccharide content. In theory, applying nutrient solution should increase the growth rate of bryophytes. However, treatment with Knop nutrient solution did not demonstrate any significant advantage and instead demonstrated disadvantages for plant density and plant height. This was the opposite of expectations and of prior work \[[@pone.0134447.ref024],[@pone.0134447.ref027]\]. The possible reasons are as follows: the moss growth had a higher demand for water than for nutrients during the early stage of the present study, but as time extended, nutrients gradually played more important role. For example, the treatment of 12,000 lx illumination+1 watering/2 days+Knop produced a higher i rate of increase in plant density ([Fig 2C](#pone.0134447.g002){ref-type="fig"}) and a larger chlorophyll *a* content ([Fig 4](#pone.0134447.g004){ref-type="fig"}) than that without Knop. This indicates that the application of the nutrient solution would be beneficial to the growth of mosses in the long run, which is consistent with the results reported by Maestre et al. \[[@pone.0134447.ref027]\]. In addition, the chlorophyll *a* results of indicated that a moderate increase in the light intensity can promote moss-dominated crusts growth and that the magnesium (Mg) and N in the Knop solution can promote the synthesis of chlorophyll *a* under the high watering frequency. The exopolysaccharide contents were significantly lower in treatments with the nutrient solution than in those treated with water alone. These results may have occurred because the metal ions contained in the Knop nutrient solution inhibited the physiological activities of mosses and accompanying cyanobacteria during the growth stage, preventing moss-dominated crusts from showing significant nutrient effects \[[@pone.0134447.ref022]\]. As a whole, Knop solution application played a lesser role in comparison to light intensity and watering frequency in this study. However this does not imply that Knop nutrient would not be important in moss-dominated cultivation. For example, Ahmed et al. \[[@pone.0134447.ref037]\], proposed that the concentration of Knop solution affects the bud induction of mosses. Modified Knop medium is able to facilitate the elongation of the protonemata of *Rhodobryum giganteum* moss and prolong their growth time \[[@pone.0134447.ref038]\], but half-strength Knop did not clearly promote the growth of moss *Brachymenium capitulation* \[[@pone.0134447.ref039]\]. In our experiment, exopolysaccharide with Knop solution under higher watering frequency are higher than that without Knop, which supported its rather complicated interactive effects in combination with other factors. Therefore, the reasons underlying the somewhat unexpected results can only be speculative. Further studies are needed to determine how and why moss-dominated crusts may, or may not, respond to nutrient amendments. Potential applications of artificial moss crusts {#sec012} ------------------------------------------------ Although bio-crusts are distributed widely in arid and semi-arid regions and have a large number of important ecological functions, their natural development or restoration after disturbance generally takes from several years to decades. Therefore, in recent years, researchers \[[@pone.0134447.ref024],[@pone.0134447.ref025],[@pone.0134447.ref026]\] have attempted to achieve fast cultivation of biocrusts to restore functions in the ecosystem. Especially, in many extreme conditions, bio-crusts can act as pioneers. For example, there are 76810 large-scale construction projects covering 552.8×10^4^ hm^2^ from 2001--2005 in China, which resulted in vast area of ecologically damaged lands in need of restoration. Compared to traditional tree and grass planting, artificial cultivated biocrusts is thought to have potential as a high- benefit and low-cost way to prevent erosion in these damaged surfaces that are in urgent need of stabilization. Our current results could provide some useful baseline information for selecting factors including light intensity, watering, and nutrients, for artificial cultivation of biocrusts in the lab. However, there are at least three further steps before practical applications occur in the field. First, more factors such as air humidity and plant growth regulators, which might influence the development of moss crusts should be investigated in further studies, to enable specifying the optimal environment for fast cultivation in the lab under controlled environmental conditions. Also, the influence of substrate conditions including soil type, soil texture, and chemical properties which may affect the growth of moss crusts should be addressed. Second, cultivation of moss-dominated crusts in large pieces \[[@pone.0134447.ref040]\] needs to be investigated. This would determine whether it is possible to transport moss crusts from laboratory to the field and whether artificially produced moss crusts could be transplanted in the field in a similar manner as laying sod. Third, the evaluation of stress resistance and appropriate management for artificially moss-dominated crusts are essential to make them better adapted under natural conditions. In this study, we used the fragments of stem and leaf as initial moss propagules. The more elaborate method (spore propagation) for in vitro cultivation of bryophytes proposed by Duckett et al. \[[@pone.0134447.ref022]\] will be attempted in future studies. Artificially-produced moss-dominated crusts are suitable for application in construction scarred sites especially those that are vulnerable to erosion. In some cases, *in situ* moss crusts cultivation, through direct spreading of moss-dominated crust samples salvaged from construction sites, will be a better choice. The cultivation and management or the protection of moss-dominated crusts under these unpredictable environments is also an important research topic for their rapid restoration. In conclusion, our current study improves the understanding of the factors influencing moss-dominated crusts development, and these results provide a basic and helpful reference for advancement from laboratory experiment to field application. Nevertheless, there is still much work to be done to narrow the information gaps and to accelerate the transition between research and practical application, for restoring and engineering moss crusts to control erosion for ecologically impaired areas in urgent need of restoration. Supporting Information {#sec013} ====================== ###### Table A: Variance analysis of different factors on moss plant density. Table B: Variance analysis of different factors on moss chlorophyll *a* content. Table C: Variance analysis of different factors on moss exopolysaccharide content. (DOCX) ###### Click here for additional data file. We deeply appreciate the kind assistance of Prof. Guoxiong Gao and Dr. Yongsheng Yang at Institute of Soil and Water Conservation, Chinese Academy of Sciences and Ministry of Water Resources during the experimental process. We also appreciate the helpful and critical comments from six anonymous reviewers and the editors. [^1]: **Competing Interests:**The authors have declared that no competing interests exist. [^2]: Conceived and designed the experiments: CB KZ SW. Performed the experiments: KZ CZ. Analyzed the data: CB KZ. Contributed reagents/materials/analysis tools: KZ CZ. Wrote the paper: CB KZ SW.

Corneal diameter and axial length in congenital glaucoma. The corneal diameter was recorded and the ocular axial length measured by A-scan ultrasonography in 31 eyes of 17 children (ages 0.05 to 7.0 years) who had undergone or were about to undergo surgery for primary congenital glaucoma. These measurements were also done in 60 normal eyes of 33 children (ages 0.20 to 9.6 years) undergoing nonophthalmic surgery. Both measures were usually greater than normal in the glaucomatous eyes. However, the corneal diameter was more sensitive than the axial length in identifying congenital glaucoma. The axial length measurement did not provide additional useful information for any of the eyes. We conclude that the corneal diameter is a more reliable guide than the axial length in the assessment of congenital glaucoma. A transparent plastic gauge for rapid and accurate measurement of the corneal diameter is described.

Resistance to antibiotics is becoming increasingly prevalent and threatens to undermine healthcare systems across the globe. Antibiotics including penicillins, cephalosporins and carbapenems are known as β-lactams and are the most commonly prescribed worldwide. In the first paper, University of Bristol researchers defined the relative importance of two mechanisms associated with β-lactam antibiotic resistance. In one, bacteria restrict the entry of antibiotics into the cell; in the other, bacteria produce an enzyme (a β-lactamase), which destroys any antibiotic that gets into the cell. The latter was found to be the more important of the two mechanisms. These findings imply that if chemicals could be developed to inhibit β-lactamase enzymes, a significant proportion of antibiotic resistance could successfully be reversed. Building on these findings, and working in partnership with chemists at the University of Oxford and the University of Leeds, in the second paper, Bristol researchers studied the effectiveness of two types of β-lactamase enzyme inhibitor in a bacterium known to be highly resistant to common antibiotics. Using a variety of approaches, the authors studied avibactam, an inhibitor that has recently been introduced into clinical practice, and a "bicyclic boronate" inhibitor, which was first reported by the Oxford/Leeds/Bristol team in 2016. They found both inhibitors failed to consistently protect the β-lactam antibiotic, ceftazidime, from attack by the β-lactamase enzyme. However, when paired with a different β-lactam antibiotic =, aztreonam, the inhibitors worked extremely well and killed some of the most resistant bacteria ever seen in the clinic. Dr Matthew Avison, Reader in Molecular Bacteriology from the University of Bristol's School of Cellular & Molecular Medicine, and senior author for both studies said: "Our bacteriology research has further demonstrated that β-lactamases are the real "Achilles heel" of antibiotic resistance in bacteria that kill thousands of people in the UK every year. "Structural/mechanistic work on β-lactamase enzymes, including that led by my colleague Dr Jim Spencer, is helping to drive the discovery of wave after wave of β-lactamase inhibitors, including the potentially game-changing bicyclic boronate class, shown to be effective in our research, and recently successful in phase one clinical trials. "Two β-lactamase inhibitors have recently been licenced for clinical use: avibactam and vaborbactam. Our work shows that avibactam might more successfully be deployed with aztreonam instead of ceftazidime as its antibiotic partner. We are delighted to see that this combination has entered clinical trials, and has recently saved the life of a patient in the USA who was suffering from a previously untreatable infection." "This is an exciting time for researchers studying β-lactamase inhibitors. At the risk of sounding like King Canute, it is the first time for a decade that there is some genuine positivity about our ability to turn back the rising tide of β-lactam antibiotic resistance."

In hot-sections of gas turbines and other heat engines, high temperature protective coatings are necessary to protect engine components and improve engine reliability. Alloyed metallic coatings that form protective, slow growing oxide scales such as alumina (Al2O3) and chromia (Cr2O3) have been designed and used as oxidation and corrosion resistant coatings, thus enabling load-bearing components to exhibit extended service lives due to the prevention of fast oxidation and corrosion degradations occurring under high temperature, oxidation and thermal cycling conditions. However, these metallic coatings have a limited temperature capability, with most applications limited to less than 1000° C. Thus large amounts of cooling air are required to reduce component temperatures, even under moderate engine operating temperatures, and engine performance and efficiency are severely limited due to component temperature capability. In order to increase the temperature capability of engine components, thermal barrier coatings have been developed and applied to component surfaces. Thermal barrier coatings are thin ceramic layers, generally applied by plasma-spraying or physical vapor deposition techniques, used to insulate air-cooled metallic components from high temperature gases. Such coatings are useful in protecting and extending the service life of metallic and ceramic components exposed to high temperatures, such as jet engine turbine blades, vanes and combustors. Thermal barrier coatings comprised of zirconia-yttria (ZrO2—Y2O3) are well known in the art, wherein yttria typically is present from 7 to 9 weight percent (wt %) (4 to 5 molar percent), and have been widely used in more advanced engine systems. These coatings are typically applied using plasma-spraying or physical vapor deposition in which melted ceramic particles or vaporized ceramic clouds are deposited onto the surface of the component to be protected. Thermal barrier coatings are designed to be porous, with overall porosities generally in the range of 5 to 20%. The porosity serves to reduce the coatings thermal conductivity below the intrinsic conductivity of the dense zirconia-yttria ceramic, and thus retards the flow of heat from the hot gases to the underlying component surface. As operating temperatures continue to increase, current zirconia-yttria coating conductivities (approximately 2.5 W/m-K) are not acceptable (i.e. too high) for future high performance, low emission turbine engines currently under development. Moreover, the phase and microstructural stability of the current zirconia-yttria coatings remain a significant issue. For example, the destabilization of the zirconia-yttria phases starting at temperatures ranging between 1200-1300° C. may result in the coatings premature spallation. Furthermore, phase destabilization aids in the sintering of a zirconia-yttria coating during high temperature service, thereby decreasing porosity, increasing thermal conductivity and reducing the coatings effectiveness. In summary, the coating and component durability are adversely impacted by the degradation of the coating phase structure and properties associated with higher temperature aging effects. Thus, an improved thermal barrier coating is required for advanced engine applications.

In 2011, two episodes of Jeopardy stunned the world when the best Jeopardy players in the history squared off against IBM’s Watson Cognitive Computing System and were soundly beaten. For many, this was the moment when artificial intelligence probably became a very real thing in their minds; one contestant even scrawled "I, for one, welcome our future computer overlords" on his answer in his final losing round. He likely spoke for many in the audience. Watson dominated a game where nuanced wordplay was intrinsic to the challenge of the contest, where contestants needed to provide the question that fit an answer shrouded in double meaning. For humans, Jeopardy is a unique cognitive exercise—as anyone playing along at home can attest to—but for a machine that can be thwarted by a reCAPTCHA challenge on a web page, Watson’s success was a monumental achievement in computing that has implications for the future of practical, everyday technology. Cognitive Computing vs. Artificial Intelligence Calling cognitive computing a form artificial intelligence isn’t wrong, but it misses a fundamental distinction that makes it so remarkable. When we talk about artificial intelligence, often we are talking about something that is necessarily an incredible sophisticated functional algorithm. That is, an AI is a very, very complex decision tree—one we may not even be able to follow ourselves—that when given a specific input, will produce a predictable output. This is how autonomous vehicles work, by taking in a starting point and a destination as input and navigating between the two according to a mind-bogglingly long sequence of if-else statements. If the light is red, stop; otherwise, proceed. No human input needed. This is a radical simplification, but this is essentially what most people are talking about when they talk about AI. An AI is something that finds the best possible way to do something within a given set of parameters and makes a decision or takes action as a result. This applies to autonomous vehicles as much as it does to high-speed trading platforms on Wall Street. What is Cognitive Computing? If it isn’t just another form of AI, then what is cognitive computing? Cognitive systems use all of the same machine learning, natural language processing, and data mining techniques that the above AI uses, but it takes things a step further and seeks to emulate the way the human brain reasons and makes decisions, often with conflicting or outright contradictory information. It crunches all of this data and considers all the parameters and variables at play and sorts through each the way humans might choose which restaurant to eat at or which car to buy. It’s much more subjective than the typical AI system. When it finishes its analysis, a cognitive computational system like IBM’s Watson will provide what it thinks is the best choice for a given problem from an array of possible solutions. This is not necessarily the right choice, however. It leaves it to the human who is using the system to decide what the right course of action is in a given situation. Assisting Human Decision Making, Not Replacing It The essential distinction between cognitive platforms and artificial intelligence systems is that you want an AI to do something for you. A cognitive platform is something you turn to for collaboration or for advice. The applications for these platforms range from medicine to customer service. Doctors can use these systems to assist them in diagnosing patients, utilizing their ability to analyze a patient’s medical history against every medical textbook ever written, identifying possible diseases a Doctor might never have considered, or even know about. Businesses can use it to incorporate all kinds of risk factors into a decision before providing a company with a recommendation about an investment or a location to build a new satellite office. The possibilities for this technology in the future are enormous, and no industry will be left untouched by it in the next decade. Where Should We Expect to See the Biggest Impact? Innovation 5 Intractable Problems Quantum Computing Will Solve Financial services are the most likely place we’ll see these systems make significant advances. As we see the exponential growth of data across every sector of the economy, there will be more and more ways to make money that may not be apparent to humans who have no way to process and analyze the petabytes of data stored in the cloud. This sort of thing is precisely what these platforms is designed to do, and if anyone has the money to invest in this technology, it will be financial services firms. Health care and law both stand to gain significantly from this technology as well. With the millions of pages of case law that attorneys have to sift through when preparing lawsuits—or when defending a client from one—a whole army of paralegals could not provide the kind of analysis and assistance that this platform could provide. Consumer service will see a massive benefit from these systems, both in retail and in corporate communications, as well. Retail outlets already use AIs to act as shopping assistants for customers, and this trend will only accelerate once this technology becomes more widespread. Chatbots are already a rudimentary form of this kind of computing that can field basic customer service inquiries. As they become more sophisticated, they could eventually replace entire call centers, routing only the most unconventional customer service issue to a human agent. Considering the cost savings on this alone, we should expect to deal with a lot fewer humans on the phone than we already do. Implications for the Future When people first watched IBM’s Watson master the nuances of human language and beat the two greatest Jeopardy players back in 2011, there was considerable anxiety. A machine could suddenly beat us at something we thought only humans could do and beat us soundly. When people express anxieties about artificial intelligence taking over entire industries and displacing millions of workers, this is the technology they are talking about. Whether or not those anxieties are exaggerated remains to be seen, but without a doubt, we'll know soon enough—the cognitive computing revolution is already here and there’ll be no going back.

Facts ===== Notch signaling is an evolutionarily conserved molecular pathway, crucial for the development and homeostasis of most tissues.The Notch receptors, a family of trans-membrane proteins, are also known to be involved in the pathogenesis of a spectrum of human diseases, including cancer. Nowadays, Notch receptors are reported to act both as tumor suppressors and oncogenes.Inflammation is characterized by a complex mixture of mediators that have a strong impact on normal and cancer cells.The role of Notch in inflammatory-driven tumors is now emerging, but its effect is still controversial. Open question ============= How does inflammation influence Notch signaling?Is the inflammatory context a contributing factor for Notch pathway activation?What is the relevance of the Notch pathway in inflammatory-driven cancers?Can the targeting of inflammation impact Notch pathway activity? Notch signaling is a molecular pathway used as a general developmental tool for controlling organ formation and morphogenesis in both invertebrate and vertebrate organisms,^[@bib1]^ and avails itself of a direct cell-cell model of communication.^[@bib2]^ The signals exchanged between neighboring cells through the Notch pathway can orchestrate a surprisingly wide spectrum of specific programs, including differentiation, proliferation and apoptosis, which are able to influence cell-fate and to regulate tissue homeostasis.^[@bib3]^ Importantly, the deregulation of Notch signaling has been found involved in many pathological processes, including cancer.^[@bib4][@bib5]^ In particular, a double role of the Notch pathway, acting as both tumor suppressor or tumor promoter, has been reported.^[@bib6]^ Although the inflammatory microenvironment arises from a normal host defense with the goal of inducing pathogen elimination, it is well documented that low-grade/chronic inflammation plays a pivotal role in cancer promotion.^[@bib7]^ Moreover, the tumor microenvironment, which is largely orchestrated by inflammatory cells and their secreted factors, is an indispensable participant in cellular apoptosis/survival and migration.^[@bib8]^ Interestingly, inflammatory cells share and/or modulate some of the signaling molecules of the tumor cells, including those belonging to the Notch canonical and non-canonical signaling pathways.^[@bib9]^ Thus, inflammation could have an 'intrinsic\' effect, specifically stimulating the Notch pathway in the epithelial cells; likewise, inflammation could have an 'extrinsic\' effect on tumor progression, since it modulates Notch within cells of the inflammatory compartment, that in turn are able to interact with tumor cells ([Figure 1](#fig1){ref-type="fig"}). The involvement of inflammatory mediators in the regulation of Notch signaling is documented in many malignancies, including breast cancer,^[@bib10]^ multiple myeloma,^[@bib11]^ hepatocellular carcinoma^[@bib12]^ and colorectal cancer.^[@bib13],\ [@bib14],\ [@bib15]^ Given these premises, an intriguing overview for understanding the ambiguity of Notch signaling in tumors relies on its crosstalk with the inflammatory *milieu*. Therefore, in this review we will examine the state of the art concerning the influence of inflammation on the biological effect of the Notch signaling in different types of cancer, with a particular focus on the intestinal epithelium. Canonical Notch pathway ======================= The Notch pathway, which is able to regulate many different biological functions, relies on a cell-to-cell model of communication.^[@bib16]^ In humans, the canonical Notch cascade begins when one of the specific trans-membrane Notch ligands of the sending cell (Jagged1-2, DLL1, DLL3 and DLL4) binds to one of the Notch receptors (Notch1--4) expressed on a receiving cell surface. The receptor-ligand binding triggers two consecutive proteolytic cleavages in the Notch receptor. The first proteolytic event, catalyzed by the TACE metalloproteinase (ADAM17), cleaves the extracellular portion of the receptor; the second proteolytic step involves the remaining membrane-anchored fragment, which is processed by the γ-secretase enzyme, and induces the release of the active intracellular domain of Notch (NICD). NICD translocates into the nucleus where it interacts with the transcriptional repressor protein CSL/RBP-J. Following the recruitment of Mastermind-like co-activators and the histone acetyltransferase p300, CSL/RBP-J is converted to a transcriptional activator leading to the induction of downstream target genes, including Hes1 and Notch-regulated ankyrin repeat protein 1.^[@bib17]^ Non-canonical Notch pathway =========================== Importantly, to date a non-canonical role for Notch signaling has been reported, especially regarding the immune system. The non-canonical Notch pathways are RBP-Jκ-independent signals involved in several physiological and pathological cellular processes, including oncogenesis.^[@bib18]^ A role for non-canonical Notch signaling in transformed cells has been suggested by the evidence that inhibition of *γ*-secretase does not block all Notch-related functions in tumor cells.^[@bib19]^ The principal mechanisms able to interact in a non-canonical manner with Notch and involved in the response to inflammation are: I- the pathway of the nuclear factor kappa-light-chain-enhancer of activated B cells (NFkB);^[@bib20],\ [@bib21]^ II- hypoxia;^[@bib22],\ [@bib23],\ [@bib24],\ [@bib25],\ [@bib26],\ [@bib27]^ III- the epithelial-to-mesenchymal transition (EMT), in particular involving Transforming growth factor-beta (TGF-β),^[@bib28]^ and matrix metalloproteinases (MMP9);^[@bib29]^ IV- the Wnt signaling pathway, affecting the stability of β-catenin;^[@bib9],\ [@bib30]^ V- the mitogen-activated protein kinase (MAPK) and nutrient sensor kinase mTOR.^[@bib31]^ [Table 1](#tbl1){ref-type="table"} shows the principal molecular mechanisms concerning the inflammation-driven non-canonical Notch pathways in the field of malignant progression. The Notch pathway: oncogenic or tumor-suppressive role? ======================================================= Although there has been extensive research on Notch deregulation in cancer in the last two decades, the biological effects upon Notch signaling activation are still not fully understood. Indeed, some reports clearly describe a tumorigenic activity of this pathway^[@bib32]^ but, on the other hand, a tumor suppressor function of Notch signaling has also been reported.^[@bib33]^ For instance, while studies demonstrated that the truncated form of Notch4 has a causative role in the development of mammary tumors in animal models,^[@bib34]^ others reported a possible oncogenic role of Notch1 overexpression in human breast cancer tissues.^[@bib35]^ Another context in which Notch exerts a tumor-promoting role is melanoma: indeed, global gene expression profiling revealed an overexpression of Notch receptors in primary human malignant melanomas.^[@bib36]^ Importantly, it was demonstrated that the activation of Notch1 enables primary melanoma cells to gain metastatic capability via *β*-catenin.^[@bib37]^ On the other hand, a protective role of Notch in other tumor settings has been reported. In a model of small cell lung cancer Sriuranpong and colleagues demonstrated that the overexpression of the active forms of Notch1 and Notch2 causes the block of cell cycle at G1 phase and the arrest of the tumor growth.^[@bib38]^ Furthermore, Notch1-deficient animals spontaneously develop basal cell-carcinoma-like tumors associated with upregulation of Shh signaling. The authors also found that Notch1 deficiency leads to increased expression of *β*-catenin expression in the epidermis, which was reverted by the re-introduction of a dominant active form of the Notch1 receptor.^[@bib39]^ Consistently with these findings, it has been reported a reduced expression of Notch1, Notch2 and Jagged1 in human basal cell carcinomas.^[@bib40]^ Taken together, these data highlight that the activation of Notch pathway can trigger both oncogenic and tumor-suppressive functions depending on the specific cell and tissue context. Inflammation and cancer: the oncogenic role of Notch ==================================================== The rationale for studying the inflammation-mediated carcinogenesis arises from the evidence that chronic inflammation is a known unfavorable condition, which predisposes to the onset of cancer; moreover, most solid tumors are characterized by an intrinsic tumor-promoting inflammatory response.^[@bib41]^ For example, Rokavec and colleagues reported a feedback loop among Interleukin (IL)-6, STAT3 and miR34a, able to increase the invasiveness of colorectal cancer (CRC) cells.^[@bib42]^ In a mouse model of colon cancer, the overexpression of IL-8 induces cancer growth and metastatization.^[@bib43]^ Several studies demonstrated a strong correlation between Notch signaling and specific inflammatory mediators. It is known that high expression levels of Jagged1, Notch 1 and Notch2 correlate with tumor progression of myeloma;^[@bib44]^ in this context, it has been recently proposed an activating role of Notch on IL-6 proliferating signals in the bone marrow niche, which results in an enhancement of tumor growth.^[@bib45]^ In a mouse model of pancreatic cancer, it has been found that the crosstalk between TNF-*α*, the basal Notch signaling and Ikk2 (the Inhibitor of *κ*B kinase 2, a component of the NF-*κ*B signaling) induces the suppression of the nuclear receptor Pparg, which encodes for the anti-inflammatory nuclear receptor Ppar*γ*. In particular, the Hes1-mediated suppression of Pparg perpetuates the autocrine inflammatory activity of tumor pancreatic cells, inducing the production of inflammatory mediators, such as TNF- *α*, IL-6 and IL-1*β*. Therefore, through this loop, inflammation sustains the pancreatic cancer progression through the activation of the Notch pathway.^[@bib46]^ A role for TNF-*α*/IKK*α* in the regulation of Notch1 signaling has also been reported in liver cancer cell lines: it has been proposed that the phosphorylation of FOXA2 (critical gene required for bile acid homeostasis), by IKK*α*, leads to activation of Notch1 signaling through downregulation of NUMB, thereby inducing tumorigenesis.^[@bib47]^ Sansone *et al.* demonstrated that IL-6 is able to induce cancer stem cell renewal via Notch3 in an *in vitro* model of breast cancer.^[@bib48]^ Another study showed that a gamma secretase inhibitor, able to block the Notch signaling and to attenuate the stem-like phenotype of cancer cells, reduced the T-cell-mediated production of both IL-6 and IL-8 in an *in vitro* model of inflammatory breast cancer.^[@bib10]^ Another interesting interaction between the pro-inflammatory cytokine IL-1 and Notch1-4 has been reported in breast cancer, where Leptin, a well-defined pro-proliferation factor, is the link that leads to the expression of pro-angiogenic molecules, promoting cell proliferation and migration.^[@bib49]^ In tongue squamous cell carcinomas, the IL-1*β* upregulates CXC chemokine receptor 4 (CXCR4), that mediates cancer growth and metastasis, leading to the concomitant activation of extracellular sregulated kinase (ERK); interestingly, the pharmacological inhibition of Notch1 signaling reversed this up-regulation.^[@bib50]^ These multiple lines of evidence support the idea that pro-inflammatory *stimuli*, such as IL-1*β*, IL-6, IL-8 and TNF-*α* can lead to the activation of Notch signaling with a tumor-promoting effect on epithelial cells. Inflammation-mediated tumor suppressor role of Notch ==================================================== As previously addressed, some data support a possible protective role of Notch signaling towards cancer progression^[@bib51]^ and also in this case inflammation plays an important role. An example is the work of Talora and colleagues, in which they demonstrated that HPV-positive cervical carcinoma cell lines express significantly lower levels of the Notch1 indicating a protective role in infected keratinocytes.^[@bib52]^ Another evidence is that NF-kB blockade and oncogenic Ras trigger invasive human epidermal neoplasia through TNF/JNK activity.^[@bib53]^ Since Notch activation leads to induction of NF-κB,^[@bib54]^ an attractive possibility is that the tumor suppressing function of Notch in keratinocytes is mediated by NF-*κ*B. Another context in which pro-inflammatory factors can drive a tumor-suppressive role for Notch is within the endothelium,^[@bib55]^ where specific pro-inflammatory cytokines play a pivotal role in regulating functions of endothelial cells.^[@bib56]^ Although this regulation is not directly connected to tumorigenesis, it is important to highlight that endothelial cell-fate is implicated in angiogenesis.^[@bib57]^ An example is provided by Quillard *et al.*, who found that the inflammatory cytokines TNF-α and IL-1β lead to overexpression of Notch2 over Notch4, promoting apoptosis.^[@bib58]^ On the other hand, other works support the hypothesis that proinflammatory factors, such as IL-6, may positively contribute to the abnormal angiogenesis in cancer.^[@bib59]^ The previous examples support the hypothesis that, in some specific cases, the inflammation-dependent activation of Notch signaling could result in tumor-suppressive effects. Notch activation in intestinal inflammation =========================================== The interplay between inflammation and Notch is particularly intriguing in the context of the intestinal epithelium ([Figure 2](#fig2){ref-type="fig"}). In the intestinal mucosa, Notch signaling is crucial for the maintenance of the stem cell phenotype, as well as for determining cell-fate.^[@bib60]^ In particular, the balanced composition of the four types of intestinal epithelial cells is essential for intestinal homeostasis as well as for host defense functions. ATOH1, repressed by the Notch target gene Hes1, is a master regulator for differentiation of secretory cell lineages.^[@bib61],\ [@bib62]^ In this scenario, Notch activation is necessary for epithelial regeneration after an inflammatory injury (such as in ulcerative colitis) where a depletion of secretory cells is observed.^[@bib15]^ Interestingly, Kim and colleagues showed that the activation of Notch in the Apc^min/+^ mouse model converted intestinal high-grade into low-grade adenomas, suggesting a negative effect on cancer progression. They demonstrated that this mechanism is mediated by the negative control of Notch-regulated ankyrin repeat protein 1 on WNT target genes.^[@bib63]^ The involvement of WNT/*β*-catenin in the protective role of Notch has also been demonstrated in an *in vivo* model of colitis-associated cancer (CAC), indicating that these pathways (Notch and WNT) cooperate even under sustained inflammation.^[@bib64]^ More recently, an innovative link between the above mentioned protective role of Notch and inflammation has been proposed by Taniguchi and his group. They showed that gp130, a co-receptor for IL-6, triggers activation of Yes-associated protein (YAP) and Notch, independently of the classic gp130 effector STAT3, in order to stimulate epithelial cell proliferation and confer resistance to mucosal erosion.^[@bib65]^ In the context of colorectal cancer and inflammation, a further mechanism that explains the role of Notch activation in carcinogenesis is related to Matrix metalloproteinases-9 (MMP9), a protein involved in the epithelial to mesenchymal transition (EMT). Garg and colleagues demonstrated that MMP9, which is a mediator of pro-inflammatory response, plays a protective role in the AOM/DSS mouse model of colitis-associate colorectal cancer, by activating p21WAF1/Cip1, which in turn modulates Notch1 and suppresses β-catenin.^[@bib66]^ Intriguingly, in a different model of intestinal inflammation the role of MMP9 has also been related to an oncogenic function of Notch signaling. Indeed, Pope and his collaborators recently postulated that the up-regulation of Claudin-1, an integral component of the tight junctions structure, induces MMP9 and p-ERK signaling, leading to subsequent activation of Notch signaling, which in turn decreases goblet cell number thus enhancing susceptibility to mucosal inflammation.^[@bib67]^ This evidence is in accordance with our recent *in vitro* work in which we demonstrated that the Notch1 pathway is activated in CRC cells in an MMP9-dependent manner under the *stimulus* of a complex mixture of pro-inflammatory factors obtained by activated macrophages.^[@bib29]^ Indeed, other reports sustain the role of inflammatory factors in promoting Notch pathway activation and colon cancer progression, for example through the IL-6/Notch1/CD44 signaling axis.^[@bib68]^ [Table 2](#tbl2){ref-type="table"} summarizes the different roles of MMP9 realtive to the Notch activity. While the common object is Notch signaling, what effectively changes among the above-mentioned reports is the 'type\' of inflammatory context, which profoundly differs in colitis, CAC or in the inflammatory microenvironment of CRC, as explained in the next section. Therefore nowadays, what we can affirm concerning the role of Notch activation and its complex interplay with inflammatory processes in intestinal epithelium is that the 'quality\' of the inflammation and the tissue-specific characteristics certainly influence the biological meaning of the activated pathway. Further studies are needed to increase our knowledge regarding the context specific function of Notch. Notch in immune system ====================== In the previous sections we approached the issue of how the Notch signaling can be 'bidirectionally\' regulated by inflammatory context in epithelial or cancer cells. However, the modulation of Notch occurs in immune cells as well.^[@bib69]^ Since the polarization of myeloid cells, primarily macrophages, can influence carcinogenesis, this topic has to be taken into account for a complete understanding of the relationship between Notch and inflammation in cancer progression. Depending on environmental signals, macrophages can be differentially activated: they can be classically activated (M1 phenotype) or alternatively activated (M2 phenotype). While M1 macrophages are characterized by production of inflammatory mediators in response to microbial product-mediated activation of Toll-like receptors, M2 macrophages express less inflammatory molecules and play a key role in host defense and resolution of inflammation.^[@bib70]^ Specific inflammatory mediators are expressed in relation to the context; for instance, during the transition from acute to chronic inflammation of colitis, a switch from Th1-Th17 derived cytokines to a prevalent Th2 inflammatory mediated response occurs.^[@bib71]^ Several reports link Notch activation to macrophage functional phenotypes. Outz *et al.* demonstrated that Notch1 deficiency regulates vascular endothelial growth factor Receptor-1 (VEGFR-1) and inflammatory cytokine expression in macrophages, in particular Tumor Necrosis Factor-alpha (TNF-α), inducing a decrease of inflammation during wound healing.^[@bib72]^ In particular, Notch1 system activation in macrophages drives the acquisition of the M1 phenotype, through the axis RBP-J-TLR4-IRF8.^[@bib73]^ A recent study identified a novel function of Numb, a negative regulator of Notch1 signaling, in the induction of TNFα, IL-6, and IL-12 cytokine production in macrophages. Furthermore, Numb interacts with Itch that, in turn, regulates downstream signaling pathways, including NF-κ B p65 and p38 MAPK. Interestingly, the authors also report that sustained Notch activity in bone marrow, as a result of interrupting Numb, do not affect monocyte differentiation into macrophages, and speculate that Numb may influence cellular differentiation in a context-dependent manner.^[@bib74]^ An appropriate example of the impact of Notch signaling on inflammatory responses is represented by cardiovascular disorders, such as myocardial infarction or atherosclerosis, and Leukemia, since Notch receptors and ligands are shared or simultaneously modulated by inflammatory effectors as well as endothelial cells.^[@bib55]^ An example is provided by a mouse model of atherosclerosis and metabolic disorders resembling the cardiometabolic syndrome obtained by feeding LDL-receptor--deficient (*Ldlr*−dlrmple is provided by a mouse model of atherosclerosis and metabolic disorders resembling the cardiometabolic syndrome obtained by feeding LDL-receptor--deficient (sclerosis, and Leukemia, since Notch receptoy, reduces MCP-1 expression and attenuates the proinflammatory phenotype of macrophages, thus demonstrating that Notch signaling is able to drive proinflammatory programs of gene associated with the cardiometabolic syndrome. In particular, a central role seems to be played by DLL4, which acts both in homotypic and heterotypic crosstalk between different pathways that control inflammatory responses.^[@bib75]^ Taken together, these data suggest that Notch, especially Notch1 and Notch3, appears to be a regulatory pathway controlling the balance of the immune system. Targeting inflammation to control the Notch pathway =================================================== Given its dichotomy between tumor-promoting and -suppressing function, and at the same time given its important implications in tissue homeostasis, direct intervention on Notch signaling as a target for cancer therapy is a delicate issue. When its precise function, in terms of positive or negative regulation of tumorigenesis, is clearly defined (at present only in specific *in vitro* or *in vivo* models), then the manipulation of Notch could be a relevant therapeutic target. This is the case of the employment of the γ-secretase inhibitor DBZ for the conversion of metaplastic Barrett\'s epithelium into post-mitotic goblet cells^[@bib76]^ or in mouse models of familial adenomatous polyposis.^[@bib77]^ However, since Hath1 mediates the effects of γ-secretase inhibitor, it has been proposed that only the subset of colorectal cancers that retain Hath1 expression could respond to the treatment.^[@bib78]^ This evidence suggests that the pharmacological manipulation of the Notch pathway should be considered with caution and requires an in-depth knowledge of the related context. Besides this approach, another attractive target for molecular intervention could be aimed at controlling the inflammatory processes which in turn modulate the Notch signaling. Notably, Chang Mo Moon and his group found that treatment with NSAIDs (indomethacin, sulindac and aspirin) has a suppressing effect on cancer stem cells both in an *in vitro* and in a xenograft model of colorectal cancer. Importantly, they contextually explored the modulation of Notch signaling, and they found that the effect of inhibition on colosphere formation is related to the downregulation of Notch/Hes1 signaling and to the upregulation of PPARG.^[@bib79]^ Similarly, epidemiological evidence suggests that diet supplementation with anti-inflammatory agents exerts a protective role toward tumorigenesis.^[@bib80]^ Noteworthy, our *in vitro* and *in vivo* studies revealed that the omega-3 polyunsatured fatty acids (ω-3 PUFAs), which are natural anti-inflammatory compounds, and in particular Eicosapentaenoic Acid is able to counteract the Notch pathway at normal expression levels in different settings of inflammatory-related colorectal cancers.^[@bib29],\ [@bib66],\ [@bib81]^ Conclusion ========== The crosstalk between inflammation and Notch signaling is extremely complex, due to the multifactorial nature of the inflammatory stimulus, which is context-specific, as well as for the duality of the Notch expression pattern. We analyzed how different effects of the Notch pathway in terms of biological meaning could be at least in part explained by the influence of the inflammatory context. We explored how this interaction generates a large number of cell type-specific responses. In this scenario, the improvement of the knowledge regarding the molecular mechanisms at the basis of this interaction is indispensable to achieve adequate and innovative therapies. LR is supported by the Italian Association for Cancer Research (AIRC) IG Investigator grant no. 14281 and the European Community\'s Seventh Framework Program FP7/2007--2013 under grant agreement 311876, Pathway-27. Edited by R Johnstone The authors declare no conflict of interest. {#fig1} {#fig2} ###### Link between Pathways related to inflammation and non-canonical Notch pathways: involved molecular mechanisms *Inflammation-linked pathway* *Molecular mechanism* *Effect* *Model* *References* -------------------------------------------- ---------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------- ----------------------- NFκB Signaling Induction of Jagged 1 expression in non-cancer stem cells Stimulation of Notch signaling in cancer stem cells Basal-like breast cancer cell lines ^[@bib21]^   Induction of PI3K/Akt pathway Activation of Notch1, tumor growth Human melanoma samples and cell lines ^[@bib23]^ Tissue Hypoxia Stabilization of HIF-1a Activation of Notch, tumor growth Human melanoma samples and cell lines ^[@bib23]^   Stabilization of Hif-1a Augmented Notch1 signaling, altered expression of cell cycle regulatory proteins, accelerated cell proliferation T-cell acute lymphoblastic leukemia cells ^[@bib24]^   Induction of Notch pathway, up-regulation of Notch ligand expression Induced EMT, E-Cadherin down-regulation, expression of Snail1 Cell lines of cervical, colon, glioma and ovarian cancer; breast cancer ^[@bib26],\ [@bib27]^   Induction of 66-kDA isoform of the SHC gene (p66Shc) Induction of Notch3 signaling, self-renewal (induction of Jagged1) and hypoxia survival Mammospheres ^[@bib25]^ Epithelial to mesenchymal transition (EMT) Transforming growth factor-beta (TGF-b) induction Expression of Hey1 and Jagged1 Epithelial cells from mammary gland, kidney tubules and epidermis ^[@bib28]^ WNT *β*-catenin/TCF-mediated transcriptional activation of Jagged1 Activated Notch1 and Notch2 in tumors containing nuclear *β*-catenin Colorectal cancer cells, human tumors from FAP ^[@bib30]^ ###### Role of interaction between MMP9 and Notch pathway in colon carcinogenesis *MMP9 function* *Molecular mechanism* *Effect on Notch pathway* *Model* *References* ------------------------------------------------- ------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------- -------------- Protective role against CAC Activation of p21WAF1/Cip1, suppression of b-catenin Increased Notch1 activation MMP9-/- and WT mice; AOM/DSS mouse model ^[@bib66]^ Enhanced susceptibility to mucosal inflammation Claudin-1 induced activation Activation of Notch signaling, inhibition of differentiation of intestinal epithelial cells into goblet cells, decrease of Muc-2 positive cells Villin-claudin1 transgenic mouse model ^[@bib67]^ Oncogenic role in CRC Inflammation-driven activation Overexpression of NICD and Jagged1; induction of Notch-regulated ankyrin repeat protein 1 *In vitro* model of interaction between macrophages and CRC cells ^[@bib29]^

The Super Protein That Can Cut DNA and Revolutionize Genetic Engineering JAMIE CONDLIFFE | Gizmodo When scientists Phillipe Horvath and Rodolphe Barrangou set out to find a better way to make yogurt, they didn't expect to stumble across one of the future's most promising discoveries: a super protein that can accurately cut DNA--and could perhaps revolutionize genetic engineering. The protein, called Cas9, can be exploited to snip strands of DNA in exactly the place researchers want. It doesn't make genetic engineering easy, but does make it much, much easier--as it allows researchers to splice sequences of DNA together affordably, with unprecedented accuracy. So how does it work? Well, Cas9 was found last year to join forces with bacteria in such a way that, combined, they home into viruses and kill them by cutting their DNA at specific, targeted points. That's interesting--in fact, it made it a prime candidate for making yogurt production more efficient. But what's more interesting is that Cas9 can be paired with any string of RNA--strings of molecules not unlike DNA which code and regulate gene expression--to target a matching piece of DNA and snip it with incredible accuracy. Kind of like a pair of tiny, custom DNA scissors. That's not interesting--that's amazing. Now, though, reports Forbes, the world of biology is swarming over Cas9 and the possibilities it affords. George Church of Harvard University explains: "It is spreading like wildfire from everyone who knows about it and it certainly is very tantalizing. It's easy to get in and start doing lots of experiments." The embrace of Cas9 could bring with it massive advances, then. Not least the ability to study genetics in ways never before possible. Forbes explains: [S]ay there are three changes in the DNA in or around a gene that might cause a disease. Right now, it's hard to study them directly. But now, Church says, you could take a cell from a person who has already had their DNA sequenced, as he is doing with his Personal Genome Project. Then you'd create what's known as an induced pluripotent stem cell, a cell that behaves much like one in an embryo. After that, you could use Cas9 to change each of those DNA spelling changes. There is, of course, still a long way to go--this research is being conducted in Petri dishes right now, not living creatures--but it's a long time since a single protein had the entire world of biology so excited. It's only a matter of time before something major comes of it; not bad, for a protein which was originally discovered to make better yogurt. [Forbes, Science] Gizmodo is dedicated to gadgets, gizmos, and cutting-edge consumer electronics. Its tech-hungry audience stops by frequently to check out the newest products and recommendations for laptops, cell phones, PDAs, digital cameras, home entertainment, and other shiny new toys. Widely viewed as an authority in tech media, Gizmodo publishes breaking news and reviews 60 times per weekday. About The Author Zoë Schlanger is Frontpage Editor at TPM. Zoë was a TPM intern in 2011, and prior to returning here she was editor in chief of NYU Local, the alternative independent student news site at NYU. Zoë has interned at places like the Nation, InsideClimate News, The Rachel Maddow Show and Gothamist. She can be reached at zoe@talkingpointsmemo.com.

Q: Python yield vs Ruby yield In Ruby, the yield keyword is used to yield to closures for blocks of execution. How does this keyword differ in the Python language? A: In ruby, yield is a shortcut that is used to call an anonymous function. Ruby has a special syntax for passing an anonymous function to a method; the syntax is known as a block. Because the function has no name, you use the name yield to call the function: def do_stuff(val) puts "Started executing do_stuff" yield(val+3) yield(val+4) puts "Finshed executing do_stuff" end do_stuff(10) {|x| puts x+3} #<= This is a block, which is an anonymous function #that is passed as an additional argument to the #method do_stuff --output:-- Started executing do_stuff 16 17 Finshed executing do_stuff In python, when you see yield inside a function definition, that means that the function is a generator. A generator is a special type of function that can be stopped mid execution and restarted. Here's an example: def do_stuff(val): print("Started execution of do_stuff()") yield val + 3 print("Line after 'yield val + 3'") yield val + 4 print("Line after 'yield val + 4'") print("Finished executing do_stuff()") my_gen = do_stuff(10) val = next(my_gen) print("--received {} from generator".format(val)) output: Started execution of do_stuff() --received 13 from generator More code: val = next(my_gen) print("--received {} from generator".format(val)) output: Line after 'yield val + 3' --received 14 from generator From the output, you can see that yield causes a result to be returned; then execution is immediately halted. When you call next() again on the generator, execution continues until the next yield statement is encountered, which returns a value, then execution halts again.

All relevant data are within the paper and its Supporting Information files. Introduction {#sec001} ============ A wide range of daily life activities cause major problems for blind and visually impaired persons (VIPs), including wayfinding in unfamiliar surroundings, detecting objects and persons, and recognition of faces and facial expressions \[[@pone.0194737.ref001]--[@pone.0194737.ref004]\]. One such activity is face-to-face interaction: When they take place between two sighted people (SPs), much information is exchanged nonverbally via body posture, gestures, interpersonal proximity and facial expressions. For example, facial expressions are believed to be closely related to one's emotions and provide information about the message one is trying to convey \[[@pone.0194737.ref005]\]. Because of their inability to fully access nonverbal information, VIPs who lost vision early in life can experience adverse effects on their social development, ultimately impacting their social inclusion as adults \[[@pone.0194737.ref003],[@pone.0194737.ref006]--[@pone.0194737.ref008]\]. Despite demand from the VIP community \[[@pone.0194737.ref001],[@pone.0194737.ref002]\], to our knowledge, there are only few assistive technologies available that attempt to support VIPs in accessing nonverbal communication in real time during social interactions. In the absence of the ability to see, the human brain can learn to process information normally acquired through vision by using other senses, such as the auditory or haptic systems \[[@pone.0194737.ref009],[@pone.0194737.ref010]\]. For VIPs, this means that information such as color, written information, nonverbal cues, or landmarks, can be obtained through auditory or haptic cues. The most well-known example is Braille, which is widely used amongst VIPs to interpret written information \[[@pone.0194737.ref009]\]. A study in the late 1960's showed that it was possible to convey visual information to VIPs using a haptic display built into the back of a chair, a so-called sensory substitution device (SSD) \[[@pone.0194737.ref011]\]. This system, which translated visual information directly to haptic patterns, enabled VIPs (after extensive training) to pick up objects. More recently, several other SSDs were presented that use audio or tactile tongue displays to convey visual information through another sense \[[@pone.0194737.ref012]--[@pone.0194737.ref016]\]. However, in the case of conveying information during social interactions, the use of audio or a tactile tongue displays seem unsuited, for these concepts interfere with hearing and speech, which needs to be avoided during social interactions. When it comes to conveying social information, it has been demonstrated that it is possible to convey spatial information (such as the location of and distance to other persons), walking directions, person identity, and social cues to VIPs through a vibrotactile belt, using variations in vibration location, frequency, and intensity \[[@pone.0194737.ref017]--[@pone.0194737.ref022]\]. Various studies have presented a tactile grid in the back of a chair to convey facial expressions (amongst others the Haptic Face Display (HFD) \[[@pone.0194737.ref008],[@pone.0194737.ref023],[@pone.0194737.ref024]\]). While the HFD conveyed information with a high level of detail (the device used 48 tactors to display 15 vibration patterns), it was not mobile, as it required users to sit in the chair for it to be effective \[[@pone.0194737.ref008],[@pone.0194737.ref023]\]. Furthermore, a vibrotactile glove was developed to convey Ekman's facial expressions of emotions plus neutral expressions through seven different vibrotactile patterns displayed on 14 tactors mounted on the back of the fingers \[[@pone.0194737.ref025]\]. In each of these studies, participants were quickly able to learn and interpret complex vibrotactile patterns conveyed. However, both studies focused on methods to convey information about facial expressions, but did not present a fully functional system that is capable of recognizing facial expressions and conveying these to its users in real time. In this paper, a wearable SSD designed to support VIPs in determining the facial expressions of other persons is presented. The SSD classifies facial expressions into emotions, which are then conveyed using vibrotactile stimuli provided by a belt worn on the waist underneath clothing. Through user evaluations by VIPs and SPs, we sought to determine whether such a device could improve one's ability to determine the facial expressions of others and whether such as device is desired for use by VIPs. Materials and method {#sec002} ==================== Participants {#sec003} ------------ Medio 2016, VIPs who had participated in earlier studies, and lived at a reasonable distance from the University of Twente were approached to participate in the study. Ultimately, twenty participants were included in the study including 10 VIPs and 10 SPs (see [Table 1](#pone.0194737.t001){ref-type="table"} for an overview of the participant characteristics). To maximize the number of potential users, we choose to include a group of VIPs (age: 38.8, SD: 14.4, range = 18--58) with a wide range of visual impairments who reported difficulties recognizing facial expressions and consisted of both early and late blind persons. As a control, the SPs (age: 44.5, SD: 19.6, range = 20--68) were each gender and age matched to one of the VIPs, creating two groups with reasonably similar compositions. Exclusion criteria included other cognitive or sensory impairments besides visual loss. The study was approved by the ethical committee of the Faculty of Electrical Engineering, Mathematics and Computer Science of the University of Twente and conducted in accordance with the guidelines of the Declaration of Helsinki. Data acquired from the study were only used after obtaining oral informed consent from the participant. Participants were told they could quit participation at any moment, without having to provide a reason for doing so. There were no drop-outs after informed consent was obtained. 10.1371/journal.pone.0194737.t001 ###### Overview of the VIP participant characteristics. {#pone.0194737.t001g} Visually impaired group ------------------------- ---- ----------------------------------------------------------------- -------------------- Male 27 Fully blind Late blind Female 18 Fully blind Early blind Male 58 Light perception Congenitally blind Female 23 Central vision loss: Stargardt Disease (macular degeneration) Late blind Female 44 Left eye: Light perception; Right eye: Tunnel vision Late blind Male 58 Blurred vision, Severe near-sightedness Late blind Female 50 Familial Exudative Vitreoretinopathy Congenitally blind Male 27 Peripheral tunnel vision Early blind Female 43 Left eye: Blurred vision; Right eye: Light perception, Glaucoma Congenitally blind Female 40 Light perception, Retinitis Pigmentosa Early blind Apparatus {#sec004} --------- The SSD used in the study is shown in [Fig 1](#pone.0194737.g001){ref-type="fig"}. The various components of the device were controlled and linked via custom software on a Microsoft Surface Pro 4 tablet (6th Gen 2.2-GHz Intel Core i7-6650U processor with Intel Iris graphics 540, Windows 10 operating system). Users wore a Logitech HD Pro Webcam C920 mounted on a baseball-cap to record images in the gaze direction. The detection of faces and facial expression recognition from this live video stream was achieved using FaceReader 6™ (Vicar Vision, Amsterdam, The Netherlands). This software uses a robust real-time face detection algorithm to detect a face from the video stream \[[@pone.0194737.ref026]\] and an artificial deep neural network that can classify facial expressions into one of six basic emotions (anger, disgust, joy, fear, surprise, sadness) as well as a neutral facial expression \[[@pone.0194737.ref005],[@pone.0194737.ref027]\]. {#pone.0194737.g001} The detected facial expressions were conveyed to the user by a series of vibrating motors (tactors) which were connected to the tablet via a Bluetooth connection. These tactors (3V pancake direct current unbalanced motors with a maximum rotational speed of 150 cycles/s and maximum vibration strength of 158.3 ± 2.4 Hz), were attached to a fabric belt with Velcro worn around the waist (Science Suit, Elitac, Utrecht, The Netherlands). The waist was chosen as it is not often used for social interactions, unlike for example the hands. Furthermore, the waist provides sufficient space to place multiple tactors (sized 34 x 16 x 11mm) at the spatial distance required to ensure that people could easily distinguish vibrations from different tactors \[[@pone.0194737.ref028],[@pone.0194737.ref029]\]. Vibrotactile signals on the torso can be distinguished with an acuity of 2 to 3 cm \[[@pone.0194737.ref030]\]; an even lower acuity can be achieved on the back near the spine, where it is likely that distances lower 1.3 cm are distinguishable \[[@pone.0194737.ref031]\]. The six tactors used in the current study were placed at least 4 cm apart, meaning the minimal distinguishable distances were amply complied with. Each tactor was coupled to one of six basic emotions \[[@pone.0194737.ref005]\]. More positive emotions were positioned toward the front whereas negative emotions were positioned toward the back (see [Fig 1](#pone.0194737.g001){ref-type="fig"} for tactor placement) in line with expressions of emotions ("butterflies in the stomach" or "stabbed in the back/talking behind one's back" \[[@pone.0194737.ref032]\]). The one to one association of each tactor to an emotion was purposely chosen to make the task of learning and interpreting the vibrations very easy for VIPs. As the ultimate goal was for VIPs to use such a system in daily life situations during which they may face other sensory information and/or use other assistive devices that require their attention, the system was designed to avoid unnecessary sensory and cognitive overload in real-life situations. Upon detection of a face, the user was alerted with two 150ms vibrations on all tactors with a 50ms break in between. After another 200ms, the tactor associated with the recognized facial expression vibrated so long as the expression held. This feedback was only provided if the facial expression detected deviated from the neutral expression. A long 300ms vibration on all tactors was used to indicate when the software no longer detected a face. Materials {#sec005} --------- Three types of materials were used as test stimuli to determine how accurately persons could identify facial expressions: pictures, silent videos, and videos with audio. The pictures and videos were derived from validated sets of pictures from the Warsaw Set of Emotional Facial Expression Pictures (WSEFEP) \[[@pone.0194737.ref033]\] and videos from the Amsterdam Dynamic Facial Expression Set (ADFES) \[[@pone.0194737.ref034]\], and included facial expressions of joy, surprise, fear, sadness, anger, and disgust \[[@pone.0194737.ref005]\]. Audio-visual stimuli were created by combining silent videos from the ADFES with (very obvious) annotated non-linguistic affect bursts (i.e. short bursts of sounds persons made while expressing an emotion) from other validated sets \[[@pone.0194737.ref035],[@pone.0194737.ref036]\]. Although the set of Hawk and colleagues \[[@pone.0194737.ref035]\] did contain both audio and video files (not combined), video files from the ADFES were used due to their better image quality. Audio and video files were matched based on the annotated emotion and its intensity and combined using video editing software. All syncing was done manually to ensure the beginning of the facial expression and the affect burst matched. To see how FaceReader performed when it was confronted with stimuli that were not directly loaded into the software, but that were subject to head movement and lighting conditions, only stimuli were used for which it was known that the software could detect the correct emotion. Therefore, prior to the experiments, all visual stimuli to be used in the experiment were loaded directly into FaceReader to verify that the software could determine the correct facial expressions in each of the stimuli under optimal conditions. Stimuli that were not correctly detected were excluded from the study. For comparison, earlier studies showed that the accuracy of SPs in determining facial expressions from these sets was 87% for the ADFES and 82% for the WSEFEP. Similarly, FaceReader achieved an accuracy of 88% and 89% for these sets, respectively \[[@pone.0194737.ref037]\]. Experimental design {#sec006} ------------------- The experiment was divided into three phases (an unsupported control phase, a training phase, and a supported phase) ([Fig 2](#pone.0194737.g002){ref-type="fig"}). The visual stimuli were projected on a wall, two meters in front of the participant ([Fig 3](#pone.0194737.g003){ref-type="fig"}), while audio was played at a volume that all participants could clearly hear from the speakers of a laptop placed right behind the participant. The size of the projected face was slightly bigger than a normal face would be at a two-meter distance to create face sizes like those encountered in normal social interactions. {#pone.0194737.g002} {#pone.0194737.g003} During the control and supported phases, 12 pictures, 12 silent videos, and 12 videos with audio were presented to the participant. The order in which stimuli were presented within each set of 12 was predefined, but randomized beforehand to ensure that participants could not guess which emotion was presented next. To avoid order bias, the stimuli sets were presented in reverse order for half of the participants (5 VIPs and 5 SPs). The training session included only pictures, the first 12 of which were presented in an order of emotion, whereas the remaining 24 were presented in a random order. The control phase was used to ascertain how accurately subjects could identify the emotions displayed in the stimulus sets whilst relying only on their functional senses. A short beep was used to indicate when a stimulus was about to be presented, after which each stimulus was displayed for six seconds. Following each stimulus, the participants were instructed to indicate which emotion was expressed. The participants were made aware that no new stimulus would be displayed until they finished giving their answer. If a VIP was unable to detect the first three stimuli of a set, the session continued to the next set of stimuli. During the training phase, which lasted for about 20 minutes to half-an-hour, participants were introduced to the SSD and received instructions on how to interpret the vibrotactile cues. After measuring waist circumference to ensure correct tactor spacing and placement, the minimum perceivable and maximum comfortable vibration strengths of each user were determined and the upper and lower boundaries of the tactor vibrations were programmed accordingly. Participants were then instructed which emotion was assigned to each tactor location. To familiarize participants with the device, three sets of 12 pictures were shown while they received the corresponding tactile cues on the belt. SPs were asked to close their eyes during training to ensure attention was directed to the vibrotactile cues. During the first 12 pictures, the participants were told which emotions were conveyed by the belt. For the second set of pictures, answers given by the participants were either confirmed or corrected by the examiner. For the final 12 pictures in the training set, participants practiced completely without receiving feedback. In the last phase of the experiment, trained participants were supported by the device and asked to identify the emotions from a stimulus set consisting of 12 pictures, silent videos and videos with audio. In addition to the questions asked during the control measurements, participants were also asked to report the location of the vibrating tactor for each stimulus. Data analysis {#sec007} ------------- Trials with correctly identified emotions were scored with a 1, whereas incorrect answers were scored with 0. For each measurement, mean performance scores were calculated. The performances of both the participant and FaceReader were rated in this way. For the user performance, it did not matter whether mistakes were made due to wrong interpretation of the vibrotactile cue by the respondent or to a misclassification by the FaceReader software causing the device to convey the wrong vibrotactile cue. The between-subject effects of group (SP or VIP), and the within-subject effects of phase (control---no SSD, supported---with SSD) and stimuli (pictures, silent videos, video with audio), were analysed using repeated measures ANOVA with an alpha of 0.05 in IBM SPSS Statistics 22. A similar analysis was also performed to analyse how participants performed when the FaceReader software misidentified the emotion shown. In this case, the between-subject effect of group (SP or VIP), and the within-subject effects of stimuli (pictures, silent videos, videos with audio) and FaceReader accuracy (wrong, correct) was analysed. Because data for some conditions were slightly skewed towards a performance 100%, the assumption of normality was violated, which should be considered when interpreting the results. Furthermore, Mauchly's test was used to test the assumption of sphericity. If the assumption of sphericity was violated, the degrees of freedom were corrected using Greenhouse-Geisser or Huynh-Feldt corrections. *Post hoc* comparisons were performed using Bonferroni adjustments. Finally, the performance of the participants was compared to that of FaceReader to determine the extent the SSD contributed to the performance of the participants. Unless otherwise stated, descriptive statistics are represented by the mean±standard error of the mean. Results {#sec008} ======= An overview of the performances for both participant groups under the different experimental phases can be found in [Fig 4](#pone.0194737.g004){ref-type="fig"} and [Table 2](#pone.0194737.t002){ref-type="table"}. Overall, higher performance levels were achieved with the support of the SSD compared to control for both SPs and VIPs across all types of stimuli. Statistical analysis showed significant main effects of phase, stimuli, and group on performance. Significant two-way interactions were found between phase and group, stimuli and group, and phase and stimuli. A significant three-way interaction also existed between phase, stimuli, and group. {#pone.0194737.g004} 10.1371/journal.pone.0194737.t002 ###### Overview of the mean performance across different phases, stimuli, and groups. {#pone.0194737.t002g} [Group]{.ul} [Stimuli]{.ul} [Phase]{.ul} ------------------------------- ----------------- -------------- ----- ---------- ----- -------------------------------------------------------- **VIP (N = 10)** **All stimuli** **35.0** 2.5 **79.4** 2.1 **44.4** \*[^**b**^](#t002fn003){ref-type="table-fn"} Pictures 14.2 3.2 82.5 3.5 68.3 \*\*\* [^**b**^](#t002fn003){ref-type="table-fn"} Silent videos 18.3 3.5 69.2 4.2 50.8 \*\*\* [^**b**^](#t002fn003){ref-type="table-fn"} Videos audio 72.5 4.1 86.7 3.1 14.2 \* [^**b**^](#t002fn003){ref-type="table-fn"} **SP (N = 10)** **All stimuli** **86.9** 1.8 **94.2** 1.2 **7.2** Pictures 82.5 3.5 89.2 2.8 6.7 Silent videos 84.2 3.3 95.8 1.8 11.7 Videos audio 94.2 2.1 97.5 1.4 3.3 **All participants (N = 20)** **All stimuli** **61.0** 1.8 **86.8** 1.3 **25.8** \* [^**b**^](#t002fn003){ref-type="table-fn"} Pictures 48.3 3.2 85.8 2.3 37.5 \* [^**b**^](#t002fn003){ref-type="table-fn"} Silent videos 51.3 3.2 82.5 2.5 31.3 \* [^**b**^](#t002fn003){ref-type="table-fn"} Videos audio 83.3 2.4 92.1 1.8 8.7 \*\*\* [^**b**^](#t002fn003){ref-type="table-fn"} The table presents the mean performance and standard error of the mean across different phases and stimuli for SPs and VIPs separately (top 2 sections) as displayed in [Fig 4](#pone.0194737.g004){ref-type="fig"} and that for all participants combined (bottom section). In addition, the table also indicates the differences between the mean performances of the control and supported phases. ^a^ SEM = Standard error of the mean ^b^ \*\*\* p \< .001, \* p \< .05. Effect of the SSD on performance {#sec009} -------------------------------- The SSD had a significant effect on performance (F(1,18) = 39.59, *p* \< .001) for all participants combined: Average performance scores differed significantly (*p \<* 0.001) between the supported phase (86.8±1.3%) and the control phase (61.0±1.8%). Note that Mauchly's sphericity test was not applied for this within-subject factor, as there were only two levels (unsupported and supported) In addition, there was an significant interaction effect for condition and group (F(1.18) = 20.55, *p* \< .001): Whereas the mean score of VIPs increased significantly (*p* \< 0.05) from 35.0±2.5% during control to 79.4±2.1% when supported; SPs also achieved an improvement (from 86.9±1.8% to 94.2±1.2%), but the difference was not statistically significant. These results suggested that participants were more capable of identifying facial emotions whilst supported by the SSD. Effect of sightedness on performance {#sec010} ------------------------------------ The between-subject effect of group (SP or VIP) had a significant effect on performance (F (1,18) = 42.311, *p* \< 0.001). The SPs were overall significantly better (*p* \< 0.001) in detecting facial expressions than their VIP counterparts: the average performance across both phases was 90.6±1.1% for SPs and 57.2*±*1.8% for VIPs. Without the support of the SSD in the control phase, eight of the 10 VIPs could not identify emotions at all, while two VIPs were able to use their remaining vision to achieve performance scores above chance level. However, this sample size is too small and diverse (one person had tunnel vision in one eye and light perception in the other, whereas the other had only peripheral vision due to Stargardt disease) to conduct separate statistical analysis. The differences in accuracy between VIPs and SPs were much bigger in the control phase (35.0±2.5% for VIPs vs 86.9±1.8% for SPs) than in the supported phase (79.4±2.1% for VIPs vs 94.2±1.2% for SPs). In fact, the performance of VIPs when supported by the SSD reached a level that was not significantly different from those of SPs in the control phase (t(18) = 2.061, *p* = 0.054). Altogether these findings emphasize the beneficial effects of using the SSD for VIPs in recognizing emotions. Effect of stimulus type on performance {#sec011} -------------------------------------- For the within-subject effect of stimulus, Mauchly's test showed a violation of the assumption of sphericity (χ^2^(2) = 6.044, p \< .05). Therefore, Greenhouse-Geisser corrections were applied (ε = .77). The type of stimulus presented to the participant (picture, silent videos, or videos with audio) had a significant effect on performance (F (1.54,27.71) = 50.259, *p* \< 0.001). *Post hoc* tests showed that performance for videos with added audio (87.7±1.5% was significantly higher than for pictures (67.1±2.1%) and silent videos (66.9±2.2%). No significant performance difference was found between pictures and silent videos. Thus, participants found it easiest to identify emotions when additional auditory cues were provided. For the two-way interaction between the type of stimuli and phase, Mauchly's test showed that the assumption of sphericity was violated (χ^2^(2) = 7.817, p \< .05) and Greenhouse-Geisser corrections were applied (ε = .731). A significant two-way interaction was found for phase and stimuli (F (1.46,26.30) = 23.05, *p* \< 0.001). Furthermore, a significant three-way interaction effect between the phase, type of stimuli, and participant group was found (F (1.46, 26.30) = 16.35, *p* \< 0.001). For SPs, there were no significant performance differences between control and supported phase for each type of stimuli. In contrast, VIPs showed significant performance improvements for pictures (68.3% increase, *p* \< 0.001), silent videos (50.8% increase, *p* \< 0.001), and videos with added audio (14.2% increase, *p* \< 0.05) compared to control. In the control phase, VIPs were significantly better at determining the expressed emotions from videos with audio than those from other types of stimuli (*p* \< 0.001). With the support of the SSD, the mean performance difference between pictures and videos with audio was no longer statistically significant. The difference between silent videos and videos with audio remained significant, possibly due to the inherent performance of FaceReader (see below). These results suggest that vibrotactile cues could enhance the recognition of facial expressions, especially in the absence of auditory cues. Interpretation of the vibrotactile signals {#sec012} ------------------------------------------ The accuracy of FaceReader was a limiting factor in the performance improvements of the VIPs. Overall, the software achieved an average accuracy of 73.6±1.6% in classifying the facial expressions from the experimental stimuli. SPs outperformed FaceReader overall, whereas VIPs performed only as well as FaceReader in absence of auditory cues whilst outperforming FaceReader (65% vs. 86.7%) when auditory cues were also provided ([Fig 5](#pone.0194737.g005){ref-type="fig"}). {ref-type="fig"} and [Table 2](#pone.0194737.t002){ref-type="table"}) compared to FaceReader (left). Error bars represent standard error.](pone.0194737.g005){#pone.0194737.g005} To examine how participants dealt with inaccuracies in FaceReader, an additional analysis was conducted to compare how participants performed when FaceReader was correct with how they performed when FaceReader was incorrect ([Fig 6](#pone.0194737.g006){ref-type="fig"} and [Table 3](#pone.0194737.t003){ref-type="table"}). Mauchly's test of sphericity showed that the assumption of sphericity is met for stimuli (χ^2^(2) = 1.275, p \< .528) and the interaction between stimuli and FR (χ^2^(2) = 4.389, p \< .111. Similar to before, the main effects of group (F (1,16) = 26.474, p \< .001), stimuli (F (2,32) = 7.921, p \< .01) and the two-way interaction between stimuli and group (F (2,32) = 3.752, p \< .05 were significant. Notably, the main effect of FR (F (2,32) = 25.456, p \< .001) and the interaction effect between FR and group (F (1,16) = 14.946, p \< .002 were also significant. No significant interaction effects were found for the two-way interaction between stimuli and FR (F (2,32) = 3.194, ns) and the three-way interaction of stimuli, FR, and group (F (2,32) = 2.016, *ns*). {#pone.0194737.g006} 10.1371/journal.pone.0194737.t003 ###### Performance of participants in relation to FaceReader accuracy. {#pone.0194737.t003g} [Group]{.ul} [Stimuli]{.ul} [FR]{.ul} [N]{.ul} [Performance Mean]{.ul} [SEM]{.ul}[^a^](#t003fn002){ref-type="table-fn"} [Mean difference]{.ul} ------------------- ---------------- ----------- ---------- ------------------------- --------------------------------------------------- --------------------------------------------------- Sighted Pictures Wrong 25 84.00 7.48 14.2 Correct 95 90.53 3.02 Silent videos Wrong 30 93.33 4.63 3.6 Correct 90 96.67 1.90 Videos with audio Wrong 36 94.44 3.87 2.4 Correct 84 98.81 1.19 VIP Pictures Wrong 22 36.36 10.50 54.4 \*\*\*[^b^](#t003fn003){ref-type="table-fn"} Correct 98 92.86 2.61 Silent videos Wrong 35 25.71 7.50 63.3 \*\*\*[^b^](#t003fn003){ref-type="table-fn"} Correct 85 87.06 3.66 Videos with audio Wrong 42 66.67 7.36 34.6 \*[^b^](#t003fn003){ref-type="table-fn"} Correct 78 97.44 1.80 The table shows the mean and difference in mean participant performance, when FaceReader correctly and incorrectly detect the emotion shown. Furthermore, the table shows the number of times FaceReader was wrong/correct for each condition (N). ^a^ SEM = Standard error of the mean ^b^ \*\*\* p \< .001, \* p \< .05. The performance of SPs did not depend on the success of FR, which suggested that SPs were able to correct for the mistakes of FaceReader using visual and auditory cues. VIPs, however, performed significantly worse across all stimulus types when FaceReader conveyed the incorrect emotion. While unsurprising for stimuli lacking audio (pictures and silent videos), VIPs also performed significantly worse for videos with audio (66.7±7.4 vs 72.5±4.1). Although their performance for videos with audio exceeded that for pictures and silent videos, auditory cues were insufficient for VIPs to fully correct for FaceReader mistakes. VIPs seemed to be unable to correct for mistakes by the system using the auditory stimuli. Nevertheless, the performance of VIPs remained higher when the system was used in combination with auditory cues (86.7±3.1), because of the near perfect performance in cases where FR was correct (97.4±1.8). Discussion {#sec013} ========== The objective of the study was to determine the feasibility of using a wearable device to convey facial expressions of emotions through vibrotactile feedback. By combining various existing technologies, we developed a wearable SSD that conveys facial expressions to its users in real time through a vibrotactile belt. This study showed that participants could easily distinguish and interpret vibrotactile stimulation associated with the six basic emotions in real time. In fact, VIPs significantly improved their ability to determine facial expressions while wearing the SSD for all types of stimuli, reaching an overall accuracy of 79.4%. As participants were still able to use their senses of hearing and sight, if any, in determining the facial expressions, the SSD also did not interfere with other sensory modalities. Thus, our study confirms the conclusions of previous studies that haptic cues can be a beneficial tool for conveying visual information \[[@pone.0194737.ref008],[@pone.0194737.ref018]\]. In line with earlier studies using the same annotated sets \[[@pone.0194737.ref033],[@pone.0194737.ref034],[@pone.0194737.ref037]\], SPs reached a performance mean of 86.9% without the help of the SSD. In the control phase, VIPs were able to determine the facial expression in 72.5% of the videos with audio, which is in line with the expected performance for the affects bursts \[[@pone.0194737.ref036]\]. Previous studies showed that the FaceReader software can recognize facial expressions from annotated sets of stimuli with an accuracy close to 90% \[[@pone.0194737.ref027],[@pone.0194737.ref037]\]. In our study, the software reached lower accuracy averaging 73.6% (range: 65%-81.7%). This discrepancy may be explained by the fact that the stimuli presented in our study were not directly loaded into FaceReader, but rather fed from a live video stream, and therefore subject to head movements, changing focal length, and changes in lighting and luminance. The results of the studies are consistent with the general principles of multisensory integration. According to the Bayesian view on multimodal cue integration, perception is probabilistic and in order to form a coherent percept of the world cues from different sensory modalities are combined in such a way as to favour the most reliable (or least uncertain) cues \[[@pone.0194737.ref038]\]. With limited sight, VIPs therefore generally rely on auditory and haptic cues (e.g. text-to-speech and braille). As shown in the study, VIPs achieved a high degree of accuracy in trials with auditory stimuli, even without additional haptic cues, since the auditory cues used in the study were very unambiguous and easy to interpret. The performance of VIPs to detect the correct emotion from auditory stimuli significantly improved as soon as (the even more unambiguous) haptic cues were added. This improvement of performance was highly dependent on the accuracy of the software, as inaccuracies of the software were hardly corrected for by the VIP participants. Even when auditory stimuli were presented, mistakes by the software led to a significant decrease in performance, resulting in a performance that was lower than performance in auditory stimuli only. Overall however, the accuracy of the software was sufficient to improve the performance of VIPs for all types of stimuli, including auditory. Furthermore, it is important to take into account that during social interactions in real-life conditions, emotions are often conveyed without auditory cues (e.g. smiling, frowning, etc.). In such cases, VIPs are forced to rely on the haptic cues conveyed by the vibrotactile device. It is promising that the performance of VIPs for videos with audio without haptic feedback was comparable to that for silent videos with the support of the vibrotactile belt, meaning that in the absence of auditory cues their ability to detect the correct emotion did not decrease. Moreover, the performance with both auditory and haptic feedback was higher than that with either sensory modality alone. In contrast with previous SSD studies \[[@pone.0194737.ref008],[@pone.0194737.ref011]--[@pone.0194737.ref016],[@pone.0194737.ref021],[@pone.0194737.ref022]\], the system presented here is fully wearable, does not interfere with other sensorimotor functions used in social interactions, namely touch of hand, speech, and hearing, and provides simple cues to represent a basic set of emotions to avoid cognitive overload in more realistic usage situations \[[@pone.0194737.ref039]\]. Furthermore, the full working prototype was tested in real time with VIPs, showing that the system could process live visual input and convey facial expressions of emotions in an easily interpretable fashion. The responses to the device were generally positive amongst the VIPs. VIPs described various scenarios in which the device could be beneficial including face-to-face and group meetings (in line with \[[@pone.0194737.ref021]\]) and were willing to try the device in such settings. Nevertheless, the participants stated that the device required some alterations before they would use it over an extended period. Participants namely had reservations about the weight and fit of the cap-mounted camera and were concerned that the SSD would bring unwanted attention to their impairment. Finally, to make it more worthwhile for VIPs to wear the device for the entire day, the participants desired additional features such as those within the domain of social interactions or beyond, such as outdoor navigation or the access to public transport information \[[@pone.0194737.ref001],[@pone.0194737.ref002],[@pone.0194737.ref004],[@pone.0194737.ref040]\]. Limitations of the study {#sec014} ------------------------ One could argue that it is perhaps unsurprising that VIPs were able to learn how to use the SSD within a short training period and achieve significant performance improvements, considering results from earlier studies \[[@pone.0194737.ref030],[@pone.0194737.ref031]\]. Indeed, only six tactors placed at least 4 cm apart were used on the waist, while the spatial acuity of the torso is between 2 to 3 cm \[[@pone.0194737.ref030]\]. Moreover, participants were only required to learn one to one associations between six tactors and emotions, while earlier research has shown that persons are able to learn far more complex (vibrotactile) cues \[[@pone.0194737.ref008],[@pone.0194737.ref009],[@pone.0194737.ref011],[@pone.0194737.ref012],[@pone.0194737.ref015]\]. Nevertheless, the ultimate goal was to create a system that VIPs could easily use in real-life situations. According to \[[@pone.0194737.ref041],[@pone.0194737.ref042]\], the ability to process tactile information is likely to be significantly worse in real-world conditions where other sensory inputs are competing for attention. The simplicity of the system and the sensory mapping was therefore intentional lest the vibrotactile cueing becomes unnecessarily difficult in daily life. Another drawback of the study is its potential lack of generalizability to real-life situations, a concern that was also raised in \[[@pone.0194737.ref041],[@pone.0194737.ref042]\]. In the experimental setup, the stimuli were presented on a fixed position and participants were instructed as to where the stimuli were presented. In real-life, users would have to localize and aim the camera towards the targeted person on their own. The lighting and gaze direction of the conversation partner were also stable in the experimental setup but would change continuously in the real world, thus impacting the quality of the analysis of facial expressions. Furthermore, it is important to thoroughly determine how well device users can interpret the vibrotactile cues in real-life situations, where other sensory stimuli might compete for attention and cognitive overload might become an issue. Second, there was a purposeful 550ms delay between the displayed stimulus and the vibrotactile cues associated to the displayed facial expression to warn users that a face was recognized. This caused for the fact that audio and visual cues were often interpreted before vibrotactile information was conveyed. In such cases the vibrotactile cues were merely used to confirm or adjust already made decisions and caused more confusion than clarity. Conclusions {#sec015} ----------- This study showed that a SSD like the one presented, using vibrotactile cues at the waist, was a feasible method to convey information about facial expressions to VIPs, which may lead to improvements in their social interactions \[[@pone.0194737.ref002],[@pone.0194737.ref018]\]. Participants were quickly able to learn how to interpret the cues conveyed by the device and combined this with information acquired from other functional senses. Furthermore, VIPs saw potential use of the device in real situations. Nevertheless, for the device to be readily adopted and accepted by VIPs as a daily life assistive technology, a more aesthetically pleasing design is required (e.g. smaller camera, less weight, unobtrusiveness) and more usage goals should be addressed (e.g. navigation). Finally, studies that are more closely resembling realism are needed to determine the accuracy of the device in real-life situations and user acceptance of the technology over time. Supporting information {#sec016} ====================== ###### Performance data. The data that was used for analysis. (XLSX) ###### Click here for additional data file. ###### Enhancing emotion recognition in VIPs with haptic feedback. Extended abstract presented as a poster at the 18th International Conference on Human-Computer Interaction, 17--22 July 2016, Toronto, CA. (PDF) ###### Click here for additional data file. [^1]: **Competing Interests:**Tjerk Kostelijk is employed at VicarVision, which developed the FaceReader software used in this study. There are no patents, additional products in development or marketed products to declare. This does not alter our adherence to all the PLOS ONE policies on sharing data and materials.

Many conventional regulators include a valve body and a control assembly for regulating fluid flow through the valve body. The control assembly generally comprises a control element such as a valve plug, for example, coupled to a diaphragm or other pressure sensing device for automatically moving the control element in response to pressure changes at the outlet of the valve body. Additionally, some conventional regulators include a spring that biases the control element into a predetermined position in the valve body, e.g., an open position or a closed position. So configured, during operation, the spring naturally biases the control element into its predetermined position and changes in the outlet pressure change the position of the control element to enable or disable fluid flow through the valve body, as desired. Fluid flowing through the valve body can generate vibrations in the system. High and low frequency resonance caused by these vibrations can hamper the operational integrity of the regulators. One solution for reducing resonance is to include a spring clip surrounding a portion of the load spring to dampen vibrations. One conventional design of a spring clip 1 includes a generally U-shaped member such as that depicted in FIGS. 1 and 2. The spring clip 1 depicted in FIGS. 1 and 2 includes a body plate 2 and a pair of opposing arm plates 3 extending outwardly therefrom. When assembled into the regulator, the spring clip 1 is positioned into a cylindrical cup shaped member 4, as depicted in FIG. 2, and then a bottom portion of a spring 5 is disposed positioned between the opposing arm plates 3 and body plate 2. This assembly process can be tedious and time-consuming as the spring clip must be manually manipulated to spread the arm plates 3 apart.

Population-based surveys indicate that 68 percent of adult Americans drink at least one alcoholic beverage per month. About 10 percent consume more than two drinks per day, which is a commonly used definition of "heavy drinking" ([@b29-257-269]). However, substantial differences exist in the prevalence of heavy drinking among population subgroups. For example, 18 percent of men but only 3 percent of women are classified as heavy drinkers, and heavy drinking is more common among Whites than among African Americans or Hispanics. Heavy drinking and its consequences are important public health problems, as illustrated by the following statistics: - Five percent of the deaths occurring annually in the United States (approximately 100,000 per year) are either directly or indirectly attributable to alcohol abuse ([@b29-257-269]). - Only about 10 percent of all drinkers account for 50 percent of the total alcohol consumption in the United States per year ([@b36-257-269]). - About 13.8 million people in the United States meet the diagnostic criteria for alcohol abuse or dependence specified in the fourth edition of the American Psychiatric Association's *Diagnostic and Statistical Manual of Mental Disorders* ([@b28-257-269]). - About 15 percent of U.S. alcoholics eventually will develop alcoholic liver disease (ALD), a broad spectrum of liver injuries---ranging from asymptomatic fatty liver (i.e., steatosis) or abnormalities of liver enzymes to end-stage liver disease---that result from alcohol ingestion. Women in general show greater susceptibility to ALD than men, and African Americans show greater susceptibility than Whites. - Among heavy drinkers, liver disease is highly prevalent. Thus, 90 to 100 percent of heavy drinkers have steatosis, 10 to 35 percent have alcohol-induced inflammation of the liver (i.e., alcoholic hepatitis), and 8 to 20 percent have alcoholic cirrhosis ([@b42-257-269]). - The 5-year and 10-year survival rates for patients with alcoholic cirrhosis are 23 percent and 7 percent, respectively ([@b42-257-269]). These rates are significantly worse than survival rates for patients whose cirrhosis was not caused by alcohol. Alcohol consumption is one of the leading causes of chronic liver disease in the United States and worldwide. In Western countries, alcohol is the major causative factor in about 50 percent of deaths from end-stage liver disease ([@b42-257-269]). To date, liver transplantation (also known as orthotopic[1](#fn1-257-269){ref-type="fn"} liver transplantation \[OLT\]) is the only definitive treatment for end-stage liver disease. However, OLT for patients with ALD continues to be controversial because of the ever-increasing demand for donor organs and the inadequate rate of organ donation, combined with concerns that alcoholic patients might relapse to drinking, thereby damaging the transplanted liver. This review discusses the patterns and controversies relating to liver transplantation in patients with ALD. After providing some historical perspective and summarizing the current status of OLT in these patients, the article discusses elements of the pretransplantation evaluation that can help identify suitable patients for the procedure. Outcomes for ALD patients who have received liver transplants are reviewed, and the ethical issues surrounding this procedure in alcoholic patients are discussed. This article concludes by summarizing future research directions that might improve the outcomes of liver transplants in alcoholics and thereby resolve some of the ethical concerns. Historical Perspective and Current Status of OLT in Alcoholic Patients ====================================================================== Historical Perspective ---------------------- Before the National Institutes of Health (NIH) Consensus Conference on Liver Transplantation in 1983, OLT rarely was performed in patients with ALD. The Consensus Conference concluded that ALD is an appropriate indication for OLT if the patient is judged likely to abstain from alcohol after transplantation ([@b37-257-269]). This conclusion, which was adopted by many transplant centers, led to an increase in the number of transplants performed for ALD. A report by [@b55-257-269] made the most convincing argument for OLT for ALD patients, demonstrating that 73 percent of ALD patients who had received a liver transplant still were alive 1 year after the procedure, and that only 3 percent of those patients had relapsed to alcoholism. Based on these findings, in 1991 the Health Care Financing Administration (HCFA) identified ALD as one of the seven conditions for which it approved payment for OLT, but the HCFA recommended a "significant" period of abstinence for alcoholics before undergoing the procedure as well as the availability of a reasonable social support system. To identify alcoholic patients suitable for OLT, [@b7-257-269] proposed a selection method that included measures of the likelihood of abstinence, such as the extent to which alcohol dependence was recognized by the patient and his or her family, the patient's degree of social stability, and the nature and extent of lifestyle changes conducive to long-term abstinence. Using this selection method, [@b39-257-269] reported on a multidisciplinary collaboration of transplant hepatologists, surgeons, and psychiatrists that identified psychosocial predictors of long-term sobriety and compliance after OLT in alcoholics. (These predictors are summarized in the University of Michigan Alcoholism Prognosis Scale, which is discussed later.) These researchers reported that ALD patients judged suitable using these criteria had outcomes after OLT that were similar to outcomes for transplant patients with non-alcohol-related liver disease (non-ALD). People who were judged suitable for OLT included patients with severe end-stage liver disease without an available alternative therapy, who showed a clear understanding of the risks and benefits of the procedure, had a favorable psychiatric assessment including acceptance of alcoholism, and had favorable prognostic factors for future sobriety. The minimal listing criteria established by the United Network for Organ Sharing (UNOS) in 1996 do not include an absolute requirement for a 6-month period of abstinence before ALD patients are listed as candidates for OLT ([@b61-257-269]). Furthermore, a 1996 NIH workshop on OLT for patients with ALD concluded that liver transplantation provides a good outcome in alcoholic patients and that relapse rates after OLT were lower if the patients had successfully completed conventional alcohol rehabilitation programs prior to OLT ([@b29-257-269]). ALD now is widely accepted by many transplant centers as a valid indication for OLT, provided the transplant team caring for the patient can reasonably expect him or her to remain abstinent after the transplant. Current Status -------------- According to the UNOS database, 41,734 liver transplants using organs from dead donors (i.e., cadaveric transplants) were performed in the United States between 1992 and 2001 ([@b62-257-269]). Of those, 12.5 percent were performed in patients with ALD, and 5.8 percent were performed in patients with ALD and a concurrent infection with the hepatitis C virus (HCV).[2](#fn2-257-269){ref-type="fn"} This makes ALD the second most frequent indication (after HCV infection alone) for which OLT was performed during this period. As of November 2002, 17,646 patients in the United States were on the waiting list for a cadaveric liver transplant; of these, about 14.1 percent had ALD, and 6.2 percent had combined ALD and HCV infection. Overall, the number of liver transplants performed annually for ALD has been relatively constant for many years (see the accompanying figure), but the number performed because of chronic HCV infection has increased annually, as has the number of liver transplants for combined ALD and HCV infection. Pretransplant Evaluation of Patients With ALD ============================================= To ensure the success of liver transplantation, ALD patients are required to undergo a thorough evaluation to determine whether they are suitable candidates. This evaluation addresses any coexisting medical problems that might influence the outcome of the transplant and includes a psychological evaluation to identify those patients who are most likely to remain abstinent and comply with the medical regimen after the procedure. Coexisting Medical Problems --------------------------- Alcohol affects many organ systems in addition to the liver. For example, as described by [@b32-257-269] and [@b45-257-269], alcohol abuse can lead to: - Damage of the heart muscles (i.e., cardiomyopathy) and skeletal muscles (i.e., skeletal myopathy). - Inflammation of the pancreas (i.e., pancreatitis). - Malnutrition. - Central and peripheral nervous system dysfunction. - "Soft" bones that lack minerals for stability (i.e., osteopenia/osteoporosis). - Cancers of the airways and digestive tract. These conditions, particularly if they are severe, can complicate the management of patients with ALD both before and after OLT, and some may even be contraindications for OLT ([@b32-257-269]). However, some of these alcohol-induced conditions (e.g., cardiomyopathy and acute pancreatitis) can be reversed by abstinence, and when such a reversal occurs, these conditions do not affect the decision on a patient's suitability for a transplant. The clinical approach to evaluating a patient for OLT also may be markedly altered by other disorders that can coexist with ALD, such as infection with hepatitis viruses, particularly HCV, and the presence of liver cancer. The impact of all these coexisting conditions is discussed in the sections to follow. ### Cardiomyopathy The exact prevalence of heart disease in patients with end-stage ALD is unknown ([@b32-257-269]). Overall, cardiomyopathy is far more common in actively drinking alcoholics than in abstinent alcoholics ([@b13-257-269]). In general, alcohol-related cardiomyopathy rarely is a reason for refusing liver transplantation ([@b37-257-269]). Anecdotal evidence suggests that coronary artery disease (CAD) may be more prevalent than cardiomyopathy in patients with ALD ([@b32-257-269]). To identify either condition in liver transplant candidates, many transplant centers routinely assess cardiac function through noninvasive tests (e.g., electrocardiography, echocardiography, and stress tests) as part of their pretransplant evaluations ([@b45-257-269]). A more invasive technique, coronary angiography, uses X rays to visualize the structure of the heart and blood vessels following the injection of a contrast medium, and can identify more patients with CAD than the various noninvasive cardiac tests used ([@b32-257-269]). Although CAD is not a reason to refuse a patient a transplant because it usually can be reversed by abstinence, the condition can create problems if it has not been identified prior to the OLT. ### Skeletal Myopathy Muscle damage occurs in up to 42 percent of alcoholic patients with ALD; 46 percent of actively alcoholic men show changes in muscle cell structure indicative of skeletal myopathy ([@b32-257-269]). This condition is manifested as muscle weakness, muscle pain, and abnormal tests for muscle enzymes; the disorder results from a combination of alcohol's direct effects on the muscles, malnutrition, and alcohol-related inflammation or degeneration of nerves (i.e., neuropathy) ([@b32-257-269]). The presence of skeletal myopathy appears to depend on how much alcohol the person has consumed over his or her lifetime ([@b32-257-269]; [@b13-257-269]). In general, skeletal myopathy is not a contraindication for OLT, and severe myopathy is unusual in potential alcoholic OLT candidates. ### Pancreatitis Chronic inflammation of the pancreas is five times less common in people with ALD than in alcoholics without liver disease; the reasons for this difference are not known ([@b32-257-269]). In general, pancreatitis is not considered a contraindication for liver transplantation; however, severe chronic pancreatitis can adversely affect the absorption of medications that prevent the immune system from rejecting the transplanted liver. Therefore, patients with pancreatitis may require closer monitoring for rejection of the transplanted organ as well as administration of higher doses of antirejection medications to achieve effective concentrations. ### Malnutrition Malnutrition occurs in many, if not all, patients with ALD. Causes of malnutrition include a poor diet; increased breakdown (i.e., catabolism) of carbohydrates, proteins, and lipids in the body; as well as impaired absorption of nutrients, interruption of the bile flow (i.e., cholestasis), reduced pancreatic function, bacterial overgrowth, and/or alcohol-induced injury to the intestinal mucosa ([@b41-257-269]). In particular, alcoholics commonly show deficiencies in various vitamins, including thiamine, which is essential for normal brain functioning. Therefore, alcoholics with ALD routinely should be prescribed thiamine and multivitamins. Severe malnutrition is associated with a poorer prognosis after OLT and may require postponement of the procedure until the patient has achieved a better state of nutrition ([@b41-257-269]). The nutritional status of OLT candidates can be improved by providing additional nutrition directly into the gastrointestinal tract (i.e., by enteral feeding). Moreover, nutritional support before and after the transplant can improve the clinical outcome after OLT ([@b41-257-269]). ### Neurological Deficits Chronic alcoholism may lead to neurological deficits through alcohol's direct actions on the brain and nerve fibers, which can result in structural damage ([@b37-257-269]; [@b32-257-269]). In patients with ALD, however, neurological deficits also can result from a condition called hepatic encephalopathy, which is caused by the damaged liver's inability to remove substances from the blood that can interrupt brain function. In these patients, it is difficult to distinguish deficits resulting from alcohol's direct effects on the brain from those resulting from hepatic encephalopathy. Severe neurological deficits may contraindicate liver transplantation because the patient may not be able to comply with post-transplant medication regimens and because OLT may not improve the patient's quality of life significantly. Therefore, most transplant centers routinely perform brain-imaging analysis of OLT candidates to identify any structural damage that may exist before the transplant and which could affect the patient's outcome after the transplant ([@b37-257-269]). ### Abnormal Bone Structure Patients with ALD are prone to bone loss because of impaired activity of the bone-producing cells; reduced activity of the ovaries or testes, which produce hormones regulating bone formation; reduced body mass index; and limited physical activity ([@b32-257-269]). Between 10 and 42 percent of patients with ALD have a reduced bone density, which can lead to a condition called osteopenia (or, in severe cases, osteoporosis), which is characterized by bone softening, accompanied by weakness and susceptibility to fractures. Therefore, routine bone mineral density measurements and, in appropriate cases, blood tests assessing calcium metabolism and ovarian or testicular function are recommended in patients with ALD. Treatment with calcium and vitamin D (which regulates calcium metabolism) can improve bone mineral density in patients with ALD ([@b53-257-269]). Other approaches used to improve bone mineral density in patients with non-ALD include administration of hormones to compensate for reduced ovarian or testicular activity as well as treatment with other compounds that influence calcium metabolism (i.e., calcitonin and biphosphonates) ([@b53-257-269]). The effectiveness of these approaches in alcoholics, however, has not been studied specifically. ### HCV Infection About 20 to 30 percent of patients with ALD are infected with HCV ([@b32-257-269]), and the rate of progression of liver disease and the long-term outcome are worse for these patients than for alcoholics not infected with HCV ([@b50-257-269]). In addition, the most commonly used treatment for HCV infection---an agent called interferon---is less effective in active alcoholics, probably because the antiviral activity of interferon is decreased in these patients ([@b50-257-269]). HCV infection in alcoholic patients also influences the outcome after liver transplantation; in fact, the transplanted liver is much more likely to be damaged by renewed HCV infection in these patients than by a relapse to alcohol abuse. Patients with ALD who also are infected with the hepatitis B virus face challenges similar to those experienced by ALD patients with HCV infection. In general, patients with liver disease resulting from alcohol abuse and coexisting viral infection appear to have a worse prognosis than patients with liver disease resulting from only one of these factors ([@b2-257-269]). ### Liver Cancer Patients with alcoholic cirrhosis have an increased prevalence of liver cancer (i.e., hepatocellular carcinoma, or HCC) ([@b50-257-269]; [@b58-257-269]). These tumors can substantially influence the patient's outcome after OLT because of the risk that they will recur. The presence of HCC itself is not a contraindication for OLT, because patients can have a reasonably good prognosis after OLT if they have only small tumors (≤ 5 centimeters \[cm\] in diameter) and/or fewer than four tumors of 3 cm or less each that have not spread to major blood vessels or outside the liver. Studies have found that cancers other than HCC (e.g., cancers of the airways and digestive tract or lymph node tumors) occur significantly more commonly in patients undergoing OLT for ALD than for non-ALD and are a major cause of illness and death late after OLT for ALD ([@b2-257-269]). To rule out the presence of a coexisting liver cancer, routine hepatic imaging studies are recommended as part of a pretransplant workup for all OLT candidates. Similarly, it is imperative that patients being considered for OLT undergo a thorough pretransplant screening for tumors outside the liver as well as a regular evaluation after the transplantation. Psychiatric Evaluation ---------------------- For OLT to be successful in alcoholic patients it is essential that the patients remain abstinent after the transplant and comply with the demanding medical regimen (e.g., consistently take the necessary antirejection medications). Routinely conducting psychiatric evaluations before patients are included on the list of candidates for transplantation may identify those who are most likely to fail these criteria.[3](#fn3-257-269){ref-type="fn"} In a survey using a five-point questionnaire, staff at 93 percent of transplant centers felt that a psychiatric evaluation was an important component in the pretransplant workup, and staff at 83 percent of the centers reported routinely using a psychiatrist or addiction specialist during the pre-transplant evaluation ([@b20-257-269]). In most cases, the psychiatric evaluation includes assessments of the patient's socioeconomic condition as well as of underlying psychiatric disorders, job status, number and duration of prior attempts at abstinence, and use of other drugs. During this evaluation, the psychiatrist routinely interviews both the patient and one or more family members, and estimates the risk of post-transplant alcohol relapse. One measure that has been proposed to predict post-transplant sobriety is the University of Michigan Alcoholism Prognosis Scale (MAPS), which assesses a variety of factors, including: - The patient's and family's recognition and acceptance of alcoholism. - Four prognostic factors indicating sobriety, including involvement in activities that can substitute for drinking (e.g., sports), negative behavioral consequences of alcoholism, presence of hope/self-esteem, and availability of social relationships. - Social stability factors, such as a stable job, residence, and marriage, or living with another person. Data on the effectiveness of the MAPS are equivocal, however. In a prospective study, patients identified as suitable OLT candidates based on their MAPS scores had a low incidence of pathological drinking 3 years after liver transplantation ([@b8-257-269]). Conversely, a retrospective study conducted 5 years after ALD patients had received transplants showed that their pretransplant scores did not predict continued sobriety ([@b40-257-269]). Some researchers consider an abstinence period of 6 months prior to OLT a predictor of long-term abstinence ([@b6-257-269]; [@b64-257-269]). Some transplant programs and insurance companies insist on an absolute 6-month period of abstinence before a patient with ALD can be listed for liver transplantation. This 6-month rule remains controversial, however, and appears to be arbitrary. Some studies favoring the 6-month rule have demonstrated that patients who are abstinent for less than 6 months have a greater relapse rate ([@b6-257-269]; [@b64-257-269]), but these studies only examined short periods of time, included only a small number of patients, and did not include control subjects. In contrast, many retrospective and prospective studies have demonstrated that the 6-month rule does not predict long-term sobriety after OLT (see [table 1](#t1-257-269){ref-type="table"}). As a result, the current minimal listing criteria for liver transplantation proposed by UNOS do not require a 6-month period of abstinence before listing ALD patients for liver transplantation. As an alternative to the 6-month abstinence requirement for predicting abstinence after OLT, [@b66-257-269] proposed a High Risk Alcoholism Relapse (HRAR) scale, which is based on the patient's history of heavy drinking, usual number of drinks, and number of prior alcoholism inpatient treatment episodes. Initial studies have demonstrated that patients with low HRAR scores had a low relapse rate and could be deemed eligible for transplant without a pre-OLT 6-month period of abstinence ([@b66-257-269]). A subsequent study by the same research group, however, showed that the HRAR scale had little ability to predict continued sobriety after OLT ([@b16-257-269]). Outcomes for ALD Patients After OLT =================================== When assessing the long-term outcome for patients receiving OLT or any other kind of transplant, researchers and clinicians evaluate numerous factors in addition to the survival of the patient, including how long the transplanted organ continues to function (i.e., graft survival) and the patient's quality of life. Out of concerns that ALD patients may resume drinking after OLT and thereby damage the transplanted liver, investigators frequently assess graft survival in these patients. These assessments have found that the graft-survival rate in patients with ALD is comparable to that of patients with non-ALD (see [table 2](#t2-257-269){ref-type="table"}) ([@b62-257-269]). This finding suggests that the ALD patients are not more likely to relapse (or that their alcohol consumption may not be likely to damage the transplanted liver). In fact, the 1- and 3-year graft-survival rates in patients with ALD are above the average graft-survival rates for all diagnoses for which OLTs are performed (see [table 2](#t2-257-269){ref-type="table"}). Moreover, the presence of a concurrent HCV infection does not appear to alter the 1-, 3-, and 5-year graft-survival rates in patients with ALD. However, a study by [@b45-257-269] demonstrated that patients undergoing OLT for combined ALD and HCV infection were more likely to develop hepatic fibrosis than were patients with either ALD or HCV infection alone. Additional survival rates reported by various groups of investigators are summarized in [table 1](#t1-257-269){ref-type="table"}. A few retrospective studies have been performed in abstinent patients who underwent OLT for ALD. These patients' livers subsequently were removed and examined for the presence of hepatitis caused by alcohol. Again, the presence of hepatitis appeared to have no impact on outcome, with the survival and relapse rates of these patients comparable to those of patients with alcoholic cirrhosis alone ([@b38-257-269]). No specific studies have assessed OLT survival rates and sobriety in patients with acute alcoholic hepatitis. Quality of Life --------------- The term "quality of life" encompasses various factors that influence a patient's subjective well-being, such as medical status, social status, employment status, or relationships. Overall, the physical and psychological outcomes for ALD patients after OLT appear similar to those of non-ALD patients ([@b49-257-269]). However, patients who relapse to alcohol use after receiving transplants have poorer post-transplant scores on quality-of-life measures than patients who do not relapse ([@b15-257-269]). ALD patients in general have problems keeping a job and fulfilling their job requirements (i.e., they have low levels of occupational functioning). OLT can ameliorate these problems to a certain extent. Nevertheless, an analysis combining the findings of several studies (i.e., a meta-analysis) demonstrated that the employment status of ALD patients both before and after transplantation is dismal ([@b12-257-269]). Before transplantation, 29 percent of ALD patients and 59 percent of non-ALD patients were employed. At 3 years after the OLT, employment rates for non-ALD patients had increased substantially (i.e., to 80 percent), whereas employment rates for ALD patients had increased only marginally (i.e., to 33 percent). Furthermore, no associations were found between alcohol use and employment status after OLT or between pre- and post-transplant employment and sobriety. With all these findings it is important to note, however, that the employment status reported in many studies is based on self-reports, which have substantial limitations (i.e., respondents may not always answer truthfully or may not accurately recall the information). Relapse to Alcohol Use ---------------------- As mentioned previously, an important concern in selecting alcoholic candidates for OLT and evaluating the outcome of the procedure is the likelihood of a relapse to alcohol use after the transplant. The definition of an alcohol relapse is controversial, varying from any use of alcohol after OLT to alcohol abuse resulting in physical and social consequences or rehospitalization for alcoholism ([@b24-257-269]). Although any alcohol use after OLT should be viewed as serious because it is the earliest indicator of high risk for the long-term viability of the graft ([@b4-257-269]), not all relapses may be harmful to the transplanted liver and the patient. The occasional use of small amounts of alcohol (i.e., a "slip") is not considered harmful and should not be treated punitively ([@b24-257-269]). These slips may not progress to an overt relapse that is potentially harmful to the new liver. Because of the differing definitions of relapse, the reported relapse rates vary widely across studies (see [table 1](#t1-257-269){ref-type="table"}), whereas the rates of graft dysfunction resulting from alcohol relapses are more consistent regardless of the definition of relapse used. Furthermore, the transplanted liver is rejected at a similar rate in both abstinent and nonabstinent alcoholic patients ([@b13-257-269]). This rejection reaction can occur if the patient does not consistently take necessary antirejection medications. Studies have found that among patients receiving OLT for ALD, the overall rate of non-compliance with the antirejection medications is as high as 16 percent ([@b10-257-269]). However, alcohol relapses per se do not appear to influence the patients' compliance with their medication regimen. Interestingly, a meta-analysis found that ALD and non-ALD patients reported similar rates of alcohol use at 6 months (4 percent and 5 percent, respectively) and 12 months (17 percent and 16 percent, respectively) after OLT ([@b12-257-269]), although heavy drinking was more common in patients who had undergone liver transplantation for ALD. At 7 years after OLT, 32 percent of ALD patients reported drinking some alcohol ([@b12-257-269]). As previously mentioned, continued alcohol use after OLT puts the patient at risk for renewed ALD. Studies have found, however, that from a purely biological perspective, recurrent ALD is less prevalent and less severe after OLT than recurrent liver disease from other causes (e.g., reinfection with a hepatitis virus) ([@b2-257-269]). The reported relapse rate is influenced not only by the different definitions of relapse but also by the method used to identify a relapse. The most useful identification method appears to be a clinical interview conducted by a transplant psychiatrist or a questionnaire interview by an assistant ([@b17-257-269]). Biochemical markers (e.g., alcohol levels in the blood, urine, or breath, or tests for the presence of certain enzymes) as well as regular liver biopsies are less effective at identifying relapses ([@b45-257-269]; [@b17-257-269]; [@b14-257-269]). Relapse rates are highest during the initial 6 months after the transplant and decline after this period ([@b51-257-269]). About 95 percent of all relapses occur in the first 2 years after OLT. Predictors of Relapse After OLT ------------------------------- Most patients with ALD are less severely dependent on alcohol than patients attending alcohol clinics ([@b30-257-269]), possibly because patients who do not exhibit symptoms of severe alcohol dependence are at greater risk of developing ALD because they can sustain continuous alcohol consumption over many years ([@b65-257-269]). The patient's premorbid social stability and Alcoholics Anonymous attendance record before OLT are important determinants of sustained abstinence after the procedure ([@b30-257-269]; [@b5-257-269]). Such factors can be assessed prior to a transplant using measures such as the Strauss-Bacon and Skinner indices, but few transplant centers report using these indices ([@b5-257-269]). Another factor influencing relapse risk is the presence of other psychiatric disorders. The prevalence of preexisting psychiatric disorders in ALD patients is unknown. The few studies conducted in this patient population appear to show a higher rate of major psychiatric disorders among ALD patients than in the general population ([@b5-257-269]). However, major depressive disorders or schizophrenic conditions, which would indicate a greater risk of relapse after OLT, occur only rarely ([@b30-257-269]; [@b5-257-269]). The presence of post-traumatic stress disorder also increases the risk of alcohol relapse. Coexisting dependence on drugs other than alcohol also is associated with higher rates of alcohol relapse. Studies have found that although 30 to 50 percent of patients who are dependent only on alcohol achieve sustained abstinence after alcoholism treatment, only 10 percent of patients who used more than one drug achieved abstinence ([@b5-257-269]).[4](#fn4-257-269){ref-type="fn"} A prolonged period of documented abstinence from all drugs can indicate a low risk of relapse. Conversely, multiple failed attempts at alcohol abstinence before OLT are considered an indication that the prognosis for sustained sobriety after the transplant is poor ([@b5-257-269]). Based on long-term studies of alcoholism remissions and relapses, [@b63-257-269] proposed four prognostic factors that indicate a favorable outcome: the patient's involvement in activities that can substitute for alcohol, a caring relationship with another person, a source of hope or improved self-esteem, and negative behavioral reinforcement for subsequent drinking (e.g., the development of acute pancreatitis). When at least two of these factors are present, the patient is likely to remain abstinent for 3 or more years. If none of these factors or only one of them applies, the patient is likely to relapse within 2 years. Individual transplant centers also assess long-term abstinence among their patients. Based on their findings, UNOS developed the following guidelines for considering individual alcoholic patients for liver transplantation ([@b61-257-269]; [@b63-257-269]): - A few months of sobriety as a test of short-term compliance (UNOS does not require a 6-month period of abstinence). - Presence of a supportive social network at home. - Absence of comorbid risk factors. - A clinical impression that the patient has been compliant in the past. Some transplant centers have used contingency contracting as a method to improve long-term abstinence ([@b18-257-269]). With this approach, the patient and the center enter a formal agreement that specifies the consequences of certain actions of both parties. No studies to date have assessed the efficacy of this strategy, however. Several investigators have proposed additional risk factors for an alcohol relapse (also see the textbox). A study by [@b51-257-269] suggested that these risk factors include being female, having a poor social environment, having poor personal stability as assessed by a psychologist, and completing less than 6 months of abstinence. [@b17-257-269] identified a history of other drug use, a family history of alcoholism, and previous experience with alcoholism treatment as risk factors associated with a higher incidence of alcohol relapse. These investigators did not find any relationship between a prior psychiatric disorder and abstinence at 6 months after the transplant. ###### Predictors of Relapse in Patients With Alcoholic Liver Disease Following Liver Transplantation 1. Psychiatric comorbidity 2. Social instability 3. Prior rehabilitation attempts 4. Lack of involvement with other activities 5. Poor self-image 6. Associated chronic illness 7. Abuse of more than one drug 8. Lack of coordinated care Types of Liver Damage During an Alcohol Relapse ----------------------------------------------- Although it is not necessary to take a tissue sample (i.e., biopsy) of the liver to make a diagnosis of recurrent ALD in patients who have relapsed to alcohol use, researchers have examined changes in liver structure (i.e., histological changes) that occur in these patients. These analyses found that the histological features of recurrent ALD that affect the transplanted liver are similar to those of ALD in the native liver ([@b35-257-269]). The major histological changes seen with recurring ALD in transplant patients are steatosis, which is found in 83 percent; steatosis accompanied by inflammation (i.e., steatohepatitis), found in 10 percent of cases; fibrosis in certain areas of the liver, which occurs in 28 percent of patients; and cirrhosis, found in 23 percent of patients. Other less commonly seen changes include enlarged mitochondria[5](#fn5-257-269){ref-type="fn"} in 14 percent of cases, excess levels of iron (i.e., siderosis) in the liver cells in 24 percent of cases, and interruption of the bile flow within the liver. These changes are not specific for ALD, and the physician therefore must exclude the presence of other diseases (e.g., viral infection). Management of Alcoholic Patients After an OLT ============================================= With the exception of patients who are dependent on other drugs in addition to alcohol, ALD patients do not have a higher incidence than non-ALD patients of pre- or postoperative psychiatric problems that would necessitate additional treatment ([@b30-257-269]). However, ALD patients at high risk for relapse should be followed closely, and regular psychiatric followup should be considered in such cases. To date, no controlled studies have evaluated specific treatment methods for managing relapse after liver transplantation. The alcoholism treatment approaches used in the general population are probably applicable to these patients as well, with close monitoring by the transplant psychiatrist/psychologist and physician. Several studies have demonstrated that the involvement of a transplant psychiatrist or psychologist both before and after OLT reduces the alcohol relapse rate after transplantation ([@b39-257-269]; [@b9-257-269], [@b10-257-269]). Several investigators have attempted to study the effectiveness of motivational enhancement therapy in patients who relapse after liver transplantation ([@b18-257-269]). The results of such studies are unclear, however, because few patients enroll in these studies and because other problems are associated with the care of such patients. Another approach to achieving abstinence in alcoholic patients, administering the medication disulfiram, which serves to deter people from drinking by causing unpleasant effects when combined with alcohol, is not recommended in patients after OLT because disulfiram has toxic effects on the liver. Ethical Issues Associated With OLT for ALD Patients =================================================== Although most people in the population consume alcohol at least occasionally, alcoholism and the diseases caused by it continue to carry a stigma among the general public. This is true particularly for ALD, and no other alcohol-induced organ damage is viewed so negatively. Many people have a bias against liver transplants in alcoholics, resulting at least in part from the continued organ shortage and ever-increasing demand for donor organs, which necessitates rationing of the donor organs. For example, some people consider ALD a self-inflicted disease and therefore propose that ALD patients have lower priority on transplant waiting lists. This attitude is reflected in an opinion poll conducted in Great Britain, which showed that both the general public and family physicians believed that alcoholic patients should have a lower priority than others for OLT ([@b44-257-269]). Similar results were reported in Oregon, where the general public was asked to allocate priorities for 714 disorders or treatments. The respondents rated the priority of OLT for non-ALD patients at a moderate level (364 out of 714), but gave a very low priority (695/714) to OLT for ALD ([@b43-257-269]). Transplant psychiatrists and psychologists, however, have a more favorable opinion on OLT for alcoholics. For example, in a survey of these health care professionals from 14 academic liver transplant centers in the United States, a consensus favored offering further alcoholism treatment to patients who continued to use alcohol rather than refusing OLT outright ([@b54-257-269]). Researchers and clinicians originally thought that ALD patients would have poorer graft and patient survival rates than non-ALD patients, but such a difference has never been documented. Neither has the assumption of high relapse rates in ALD patients been confirmed. Relapse rates following OLT are lower than in patients undergoing alcoholism treatment, and serious relapses that adversely affect the transplanted liver or the patient are uncommon (see [table 1](#t1-257-269){ref-type="table"}). In contrast, patients who receive OLT because of an infection with hepatitis B or C viruses always experience disease recurrence and have an increased likelihood of losing the transplanted liver primarily because of this recurrence. Another concern, that patients with ALD would not be able to comply with the anti-rejection medication regimen, also has not been confirmed. Graft-rejection rates are similar for patients transplanted for ALD and those transplanted for other types of liver disease, which indicates comparable rates of compliance with the antirejection medications. Finally, it was anticipated that ALD patients would utilize more resources, thereby incurring higher costs, than non-ALD patients, but again this assumption never has been corroborated by research evidence ([@b13-257-269]). In contrast to these negative assumptions regarding the outcome of OLT in ALD patients, many clinicians argue that ALD is an excellent indication for liver transplantation. For example, the overall improvement in the status of patients with ALD after OLT, including the improvement in productivity, supports considering such patients for liver transplantation. Moreover, the long-term costs of OLT and the subsequent management of the alcoholic patient probably are lower than the costs of managing alcoholism and ALD without transplantation. This assumption is based on the observation that only 22 percent of all alcohol-dependent people seek help within any 1-year period, and fewer than one drug abuser in eight receives formal treatment for alcohol or other drug dependence ([@b32-257-269]). The suitability of ALD patients for OLT also must be considered in the context of the three principles of organ and tissue allocation identified by UNOS ([@b19-257-269]). First, *the principle of medical utility* requires that organs be allocated to those patients who are likely to experience the maximum medical benefit. This requirement is well satisfied by patients with ALD. Second, *the principle of justice* requires that equal respect and concern be given to all patients in need of an organ or tissue. This principle generates some ethical questions regarding the potential wastage of organs by transplantation in patients who may "voluntarily" revert to alcoholism. Third, *the principle of autonomy* requires that the personal choices of the patients be respected. In this regard, the UNOS Ethics Committee holds the view that a person's past behavior (including alcohol consumption) should not be considered as an exclusion criterion for OLT. There is no one-to-one correlation between alcoholism and ALD ([@b3-257-269]). Only a minority of alcoholics develop ALD and may require OLT; conversely, many patients diagnosed with ALD do not meet the criteria for alcoholism. However, the indiscriminate allocation of a donor liver to an alcoholic who may relapse and thus endanger the function of the transplanted organ is not justifiable to the general public. It is important to remember that the general public makes up the donor pool and may be discouraged from organ donation by a policy of equal transplantation for alcoholics and nonalcoholics. Thus, clinicians must make an effort to identify OLT candidates among the ALD patients who are at low risk for relapse. Moreover, additional education of the public is necessary to displace the stigma for OLT in alcoholics and to increase organ donation. Future Directions ================= Because outcome after liver transplantation, particularly the risk of relapse, is such an important concern in patients with ALD, identifying the factors that could indicate the most suitable candidates for OLT is a highly desirable goal of research ([@b36-257-269]). The following lines of inquiry show promise in this regard: - Studies have identified genetic characteristics that influence alcohol intake. Additional in-depth analyses are needed to determine the specific influences of these genes on the development of ALD or on the risk of alcohol relapse after OLT. - Genetic factors may determine a person's susceptibility to developing liver damage after alcohol consumption or to becoming alcohol dependent. Such possible factors should be investigated further, because transplanting a new liver might alter or negate the genetic influence. For example, a patient with a high susceptibility to ALD might not be as susceptible to ALD after OLT even if he or she returned to heavy drinking because the new liver would be governed by its own set of genetic factors. Conversely, if genetic factors determining alcohol metabolism by the liver play a role in maintaining alcohol dependence, then OLT might "cure" the addiction. - Researchers must develop better means of identifying ALD patients who are at risk of relapse after OLT. With better identification methods, transplant centers could focus their resources on this rather small group of patients before OLT in an effort to prevent subsequent relapses. Furthermore, research assessing various treatment programs may identify those approaches that best improve abstinence rates after OLT. - Currently no definite blood tests (i.e., biochemical markers) can identify relapses after OLT. Isolated elevations in a liver enzyme called gamma-glutamyl transpeptidase without concomitant elevation of another enzyme, called alkaline phosphatase, may serve as a surrogate marker of relapse ([@b48-257-269]). Further research directed at identifying a marker that can indicate abstinence over a period of time would be valuable for monitoring the patients' drinking behavior before and after OLT. - Investigators must further evaluate the outcome of liver transplantation in patients with severe alcoholic hepatitis; currently these patients rarely are considered for an OLT (because they usually do not have enough time to prove sobriety). Conclusions =========== OLT currently is the only definitive treatment for liver failure, including ALD. Because of the shortage of donated organs, however, OLT in patients with ALD remains controversial, mainly out of concerns that the transplanted liver could be "wasted" on a patient who eventually relapses to drinking, thereby damaging the transplanted liver. To address this concern, transplant centers generally perform a multidisciplinary screening procedure before the transplant to identify psychosocial predictors of relapse and select suitable ALD patients for OLT. Higher survival rates and lower relapse rates than expected in ALD patients after OLT have encouraged many transplant centers to reevaluate their criteria for these patients. As a result, many transplant centers currently do not require that ALD patients complete a 6-month abstinence period before being placed on a transplant list. Nevertheless, future studies should focus on identifying patients at risk for relapse, so that preventive and therapeutic interventions can be selectively targeted to these patients. The ethical debate regarding the justification of OLT in patients with ALD continues, although this subject is less controversial than in the past. Further education of the public regarding the outcomes of liver transplantation in ALD patients should help eliminate the stigma and misapprehensions associated with ALD in the context of OLT and could increase organ donation rates. Orthotopic means "in the normal or usual place." Infection with HCV (as well as with other related viruses, such as the hepatitis B virus) can lead to chronic inflammation of the liver (i.e., hepatitis), which eventually can cause complete liver failure and death. Currently, ALD patients get on transplant lists later than patients with nonalcoholic liver disease because of the requirement for an evaluation of future abstinence. The failure of investigators to distinguish between alcohol dependence and multiple-drug dependence in patients with ALD is one of the reasons for the variable relapse rates after OLT. The mitochondria are membrane-enclosed components of the cell that are responsible for most of the cell's energy production. {#f1-257-269} ###### Studies Reporting Outcomes of Orthotopic Liver Transplantation (OLT) in Patients With Alcoholic Liver Disease Study[\*](#tfn1-257-269){ref-type="table-fn"} Period No. of Patients No. of Patients Lost to Followup Months of Followup After OLT Patients Employed (Part-Time/Full-Time) (%) Used 6-Month Abstinence Criteria? Survival (%) Patients Who Relapsed (%) Research Method Used Patients Who Experienced Graft Dysfunction Because of Relapse (%) Deaths Related to Relapse (%) ----------------------------------------------- ---------- ----------------- ---------------------------------- ------------------------------ --------------------------------------------- ----------------------------------- -------------- --------------------------- ---------------------- ------------------------------------------------------------------- ------------------------------- ------ --------------------------- ----- ----- Starzl et al. 1980--87 41 11 12--36 N/A N/A No 73 \- \- \- 3 Retrospective 3 3 Kumar et al. 1982--88 73 21 25 0 54 No 74 \- \- \- 11.5 Phone interview 2 2 Bird et al. 1980--89 24 6 4--84 N/A 94 No 66 \- \- \- 22 Retrospective 17 0 Stevens et al. 1985--90 10 \- 1--24 N/A N/A No \- \- \- \- 0 Retrospective 0 0 Knechtle et al. 1984--90 41 30 N/A 63 33 No 83 \- \- 71 13 Psychiatric interview 0 0 Goldstein et al. 1985--91 41 4 6--66 N/A N/A Yes 86 \- \- 72 13.5 Retrospective N/A N/A Gish et al. 1988--91 29 0 12--41 N/A 80 No 93 \- \- \- 21 Prospective, combined \- 0 Osorio et al. 1988--91 43 0 7--38 62 59 Yes 100 \- \- \- 19 Mailed questionnaire N/A 0 [@b9-257-269] 1982--93 58 14 33 48 89 No 71 66 \- 63 31 Clinic interview 16 3.4 Howard et al. 1987--92 20 20 12--72 N/A N/A N/A 79 \- \- \- 95 Extensive interviews 10 N/A Raakow et al. 1988--94 78 0 0.5--64 N/A 99 No 96 96 \- 85 22 Retrospective \- 2.6 Gerhardt et al. 1985--91 67 26 36--96 N/A N/A No 90 84 82 76 49 Phone interview N/A 4.5 Tringali et al. 1988--90 103 45 18--46 33 40 No \- \- \- \- 21 Retrospective, combined N/A N/A Zibari et al. 1986--92 42 0 N/A 0 76 No 74 71 71 \- 7 Retrospective, combined 0 0 [@b40-257-269] 1987--91 59 9 6--89 N/A N/A No 80 \- \- 77 34 Combined N/A 2 Foster et al. 1986--94 84 21 28--70 N/A N/A No 79 75 \- \- 21 Combined 17 5 Anand et al. 1987--94 39 0 7--63 N/A N/A No 79 \- \- 79 13 Clinic interview 2.6 0 Everson et al. 1988--96 68 6 \< 90 N/A N/A N/A 91 \- \- \- 30 Phone interview 9.7 6.5 Stefanini et al. 1986--96 18 7 \< 118 0 73 Yes 75 75 \- 75 27 Retrospective, combined 27 N/A Fabrega et al. N/A 44 0 20--59 N/A N/A Yes \- \- \- \- 18 Urine alcohol measurement 7 N/A Tang et al. 1987--96 71 15 NA 8 52 No 83 80 \- \- 48 Clinic interview N/A 1.4 Pageaux et al. 1989--94 53 0 42 N/A 30 No 75 69 67 62 32 Clinic interview 4 2 For full citations of these studies, see References. ###### Percentage of Liver Transplant Patients in Whom the Transplanted Organ Was Still Functional at 1, 3, and 5 Years After the Procedure, Listed According to the Underlying Causes of the Patient's Liver Disease Underlying Cause of the Liver Disease Number of Patients Survival (%) ------------------------------------------------------------------------ -------------------- -------------- ------ ------ Hepatitis C virus (HCV) infection 9,525 77.3 67.5 61.0 Alcoholic liver disease (ALD) 6,527 77.1 68.9 60.8 Acute hepatic necrosis[\*](#tfn2-257-269){ref-type="table-fn"} 3,546 66.9 59.4 54.2 Other postnecrotic[\*](#tfn2-257-269){ref-type="table-fn"} causes 3,500 72.7 63.8 56.6 Primary sclerosing cholangitis[\*](#tfn2-257-269){ref-type="table-fn"} 3,469 83.0 77.8 74.1 Primary biliary cirrhosis[\*](#tfn2-257-269){ref-type="table-fn"} 3,345 80.3 75.5 71.3 ALD + HCV infection 2,402 79.8 67.9 61.7 Metabolic disease 1,958 77.3 71.6 67.3 Autoimmune[\*](#tfn2-257-269){ref-type="table-fn"} liver disease 1,381 78.8 71.5 66.0 Liver cancer (hepatocellular carcinoma) 1,187 68.1 51.2 37.5 All Causes 46,940 74.5 67.4 62.7 Necrosis is tissue death occurring in groups of cells; cholangitis is an inflammation of the bile ducts; biliary cirrhosis is an inflammation of the liver resulting when bile flow through small ducts in the liver is obstructed; autoimmune diseases are those conditions in which the body's immune system erroneously attacks the body's own cells. SOURCE: United Network for Organ Sharing (UNOS) registry, 1988--2001. Public data from UNOS/OPTN scientific registry (<http://www.unos.org>). Accessed December 2002.

Leguminous plants fix nitrogen from the air and convert it to organic nitrogenous compounds used by the plant for protein synthesis. Nitrogen fixation in leguminous plants is possible because of the symbiotic relationship with bacteria of the genus Rhizobium and Bradyrhizobium, which forms nodules on the roots of legumes. Different species of rhizobia cause nodulation in specific legume genera. Maximum symbiotic nitrogen fixation occurs when plant and bacteria are properly matched, and when nodule formation is maximized. Bradyrhizobium japonicum is associated with (nodulates) soybeans, Rhizobium leguminosarum biovar trifolii with clovers, R. meliloti with alfalfa and sweetclovers, R. leguminosarum biovar viceae with peas and vetches, and R. leguminosarum biovar phaseoli with garden variety beans. It is common practice to inoculate leguminous plants with rhizobia to aid nodule formation. Inoculation can be accomplished by pre-inoculating seeds, or either inoculating seeds, or placing inoculant in-furrow at planting time. Previous methods of producing an inoculant have included mixing an active, living rhizobial culture with a carrier such as humus or peat. The moist carrier maintains the bacteria in a living state. An early method of preparing inoculants was by converting the bacteria to a dormant state. U.S. Pat. No. 3,168,796 to Scott, et al describes a method of preparing an inoculant including a step of freeze-drying. This process must be done rapidly to prevent cell rupture. The dried, ground bacteria are mixed with a powdered carrier such as kaolin or montmorillonite. Freeze-drying gives a high initial recovery of bacteria, but the inoculant does not remain stable for long storage periods. Another method of preparing a dry, dormant inoculant is cited in PCT Published Application No. 92/08355, published May 29, 1992. The described process produces a dry, dormant bacterial composition wherein the water content is less than 5% by weight and at least 10.sup.9 viable bacteria per gram of the composition. The carrier is a clay mixture of montmorillonite and kaolinite which has an essentially neutral pH. Such a dry, dormant bacterial composition is available commercially under the trademark Nitragin Gold. Biocidal compositions containing bacteria or fungi which combat insects, fungi or the like may also be prepared using the slow drying process described in the foregoing European patent publication. Interest in dry, dormant bacterial products has increased due to recent interest in biological pesticides as an ecological alternative to conventional pesticides. Seed coating is a popular method for applying bacterial inoculants and other beneficial bacteria such as biopesticides to the target plants, particularly for alfalfa seeds. Several methods may be used to make coated alfalfa seeds, including dusting, pelleting, and film coating. Dusting of alfalfa seeds with a dry, dormant inoculant containing R. meliloti gives rise to a product which has an excellent shelf life, but the dust is not completely adhered to the seed, resulting in release of loose dust to the surrounding atmosphere whenever the coated seeds are handled in the open. Film coated seeds have the advantage of not releasing dust. However, known film coating processes incorporate water in the process. Bacteria from a moist product, or which are rehydrated during the coating process, have poor viability upon subsequent drying. A need persists for a method of preparing a coated seed wherein the bacteria in the coating have been pre-conditioned for survival after temporary rehydration. The adverse effects of temporary rehydration on previously dried, dormant bacteria are well known.

Q: Print file out 1 character at a time in the terminal - Python This program opens a file and prints the text out to the terminal 1 character at a time and at a predetermined speed using time.sleep() Simple and maybe, if you think like me, pretty cool.. GitHub from time import sleep import sys BLINK = 0.2 chars_in_line = 50 def open_file(fn): with open(fn, "r") as f: for line in f: if line: yield line def type_out_text_to_line(text, end="", sep="", line_chars=None, blink=0.2): if not text: return "" c = line_chars for i, j in enumerate(text): sys.stdout.flush() sleep(blink) print(j, end=end, sep=sep) if line_chars: if i + 1 == c: print() c += line_chars return "" print("\n\tSTART PRINTING\n") for text in open_file('example.txt'): if len(text) > 1: print(type_out_text_to_line(text, line_chars=chars_in_line, blink=BLINK, sep="")) print("\n\tEND PRINTING\n") A: I would recommend just using the built in functionality of print to do the flushing. Though I am an advocate for breaking things out into classes and functions, you should use built in functionality when you can. Making code complex for no reason results in two things: 1) More bugs. 2) More programmers who want to wring your neck down the road because they have to maintain or fix your software. So you can simplify your code like this: from time import sleep BLINK = 0.2 print("\n\tSTART PRINTING\n") with open('example.txt') as f: for line in f: for char in line: print(char, flush=True, end='') sleep(BLINK) print("\n\tEND PRINTING\n") If you want to make this into a function (to make it easier to import/export) then I would do following: from time import sleep def time_print_file(filename, print_rate, **print_kwargs): """ INPUT: filename: The path to the file to be printing print_rate: The delay used to print each character print_kwargs: keyword arguments accepted by pythons print statement. (Except `end` and `flush`) """ print_kwargs.pop('flush', None) # We don't allow the flush print-keyword print_kwargs.pop('end', None) # We don't allow the end print-keyword with open(filename) as f: for line in f: for char in line: print(char, flush=True, end='', **print_kwargs) sleep(print_rate) if __name__ == '__main__': print("\n\tSTART PRINTING\n") time_print_file(filename='example.txt', print_rate=0.2) print("\n\tEND PRINTING\n")

In the modern telecommunications industry, standard communications systems are linked to each other using protocols based on the Open Systems Interconnection (hereinafter referred to as “OSI”) model. The goal of OSI is to create an open system networking environment where any vendor's computer system, connected to any network, can freely share data with any other computer system on that network. In fact, the OSI model would allow any terminal connected to any computer to access any application on any other computer provided that the computers were connected by some form of common network. In networks adopting the OSI reference model, data flow between systems is performed through the OSI environment. The OSI model for network communications defines seven layers, each of which performs specific communications operations independent of the other layers. The seven layers are divided largely into upper layers and lower layers. The upper application-oriented layers perform services related to session management, data abstraction, and applications. The upper layers provide services that handle the applications, and the structuring, and encoding of data. The lower, network-dependent, layers provide services related to the physical connections, types of links, and routing functions. The lower layers provide transparent connections over diverse network configurations and a consistent interface to the upper layers. The upper layers comprise an application layer, a presentation layer, and a session layer. The application layer executes protocols for user and network operation management and enables communications between the users' CPUs (central processing units). This layer provides services to the user and applications, such as job control, file transfer facilities, electronic mail, virtual terminal and directory services. The presentation layer has structure for communication between function modules of the application layer and handles presentation formats of information. This layer negotiates a common syntax used to encode data for data transfer and allows data to be transferred, independent of hardware considerations. The session layer controls dialog between the application layers. This layer provides organizing functions for synchronizing dialog and session recovery from lower layer problems. The lower layers comprise a transport layer, a network layer, a data link layer, and a physical layer. The transport layer enables correct communications between terminals even if the upper layers do not consider the quality of line or physical constitution of additional systems. This layer provides an interface between the upper layers and the lower layers, concealing the detailed functional operation of the physical network connections to provide a network-independent service to the application-oriented upper layers. The network layer provides data transfer services. This layer provides addressing and routing functions, and may also include flow control between networks. The data link layer transmits data correctly without a hitch by enhancing reliability of a physical link in a logic network. This layer takes the information provided by the physical layer and adds error detection and retransmission functions. At this stage data is treated as units of data. The physical layer defines a physical interface between physical media, and transmits and receives bits according to the transmission requirement from the data link layer. In an open system, user program data in a system A is entered into OSI environment and the data is transferred from the application layer to the physical layer in sequence to transmission media. Here, the data is enclosed in frames used in a high-level data link control (hereinafter referred to as “HDLC”) procedure prior to transmission. The frame passes a data switching network, so-called a relay open system in the OSI model, and arrives at a receiving computer in the open system. In the receiving computer, the data is passed from the physical layer to the application layer in sequence and, finally, transmitted to an application process B, the destination in a system B in the open system. The data flow between systems may be performed between systems or a system and a terminal connected to another system. However, communications between more than two systems with different protocols is restricted. Thus, a protocol converter is required to perform data communications between different communication networks. As a prior art, U.S. Pat. No. 5,852,660, Lindquist et al., discloses a network protocol conversion module within a telecommunications system. The U.S. patent provides a method and apparatus for enabling telecommunications signals containing application layer data generated by a first SS7 (Signaling System No. 7) telecommunications network to be transported across a second SS7 telecommunications network, wherein the first SS7 telecommunications network and the second SS7 telecommunications network are incompatible. Conventional protocol converters allow two different protocols to exchange data between CPUs. It means direct data exchange between applications, or data exchange using simple logic between devices. In those conventional protocol converters, time delay is generated while the CPU performs other tasks. In addition, while one CPU receives signals and exchanges responses with the inside of system, a load on the CPUs and a waste of time are caused thereby incurring a large loss in the view of performance. Conventional protocol conversion methods for communications between various network protocols are classified into three classes. First, there is 1 to 1 protocol conversion method. This method converts a particular layer of a particular protocol into a corresponding layer of another protocol, based on the seven-layered OSI model. In order to convert m layers, m conversion methods are required and in order to convert n protocols, nC2 methods are required. As a result, m□nC2 methods are required in total. Therefore, for data exchange between various network protocols having various protocol layers, a lot of conversion methods are required thereby causing great complexity. Second, there is a method of converting into a particular protocol. This means to convert n network protocols into a particular network protocol selected from the n network protocols. In order to convert n network protocols into a particular protocol, (n−1) conversion methods are required and in order to convert m layers, m conversion methods are required for each protocol. As a result, m□ (n−1) methods are required in total. Although it shows less complexity in converting network protocols compared to the first method, it still requires a lot of protocol conversions. Third, there is a method of utilizing an overlay way. For example, it is IP-over-IEEE1394, IP-over-ATM, and so on. These are structures that an internet protocol, IP, is laid on an IEEE1394 or ATM layer. They do not perform particular conversions and are not data exchange methods between different network protocols. In other words, in the IP-over-IEEE1394, an apparatus in an IEEE1394 network transmits IEEE1394 data laid on the IP and receives data through the IP. The data received through the IP is passed through the IEEE1394 layer so that the IEEE1394 apparatus can accept the data. Therefore, it is not data exchange between different network protocols. For example, U.S. Pat. No. 5,715,250, Watanabe, discloses an ATM-LAN (asynchronous transfer mode local area network) connection apparatus capable of connecting terminals of different protocol standards. The U.S. patent provides a small-scale ATM-LAN connection apparatus which enables communications between first and second ATM terminals of different standards, namely, the first ATM terminal of a LAN emulation protocol and the second ATM terminal of an IP over ATM protocol. However, the above-mentioned conventional protocol conversion methods have problems such as complexity in conversion methods, complexity due to different layer architectures and roles of protocols, and complexity in accessing apparatuses in different networks. In other words, the number of conversion methods increases in proportion to the number of network protocols to be converted and the number of layers in the network protocols to be converted, thereby increasing complexity. In addition, when the protocol conversion is performed, the complexity increases by times of a particular factor, because the protocol layer architectures and roles of each layer in each network protocol are very different based on the seven-layered OSI model. The particular factor may depend on the number of option fields and tasks to be treated in each protocol layer. Moreover, there is no common address hierarchy recognizable between different network apparatuses when communications between the different network apparatuses are performed.

Discrimination and Exclusion Both the Chinese and Japanese immigrants, Buddhist or not, encountered anti-Asian ordinances and general hostility at the local level. Anti-Chinese rhetoric and violence erupted repeatedly throughout the 1850s and 1860s. The first major anti-Chinese riot in San Francisco was in 1866. In the early 1870s the city of San Francisco passed ordinances prohibiting the use of firecrackers and Chinese ceremonial gongs, both of which played important roles in Buddhist and Daoist ceremonies. The campaign intensified in the late 1870s, culminating in the federal Chinese Exclusion Act of 1882, which suspended immigration of Chinese workers for ten years and made the Chinese ineligible for naturalization as citizens. Not only were workers prohibited, but Chinese women who might have enabled the workers already here to settle down to a family life were also barred. The Chinese population of the United States dwindled, though many workers who could not afford to return to China found themselves stranded thousands of miles from their families. The exclusion policy was reaffirmed and expanded to include other “Asiatics” by the end of the century. Despite the concerted efforts of the Japanese to assimilate, there was an anti-Japanese movement. By 1924, a new wave of anti-immigrant and anti-Asian sentiment set quotas on all immigration and prohibited the entry of all people not eligible for citizenship, which included Chinese and Japanese. The general hostility toward East Asians was exhibited not only because of their race, but because of their “alien” customs and religious practices. Second and third generation Chinese and Japanese, wishing to assimilate more fully into American life, gradually abandoned the temples. It was, however, in terms of their “nonwhite” race that the exclusion from citizenship was cast.

Q: Is there a megametre (Mm)? With miles, there are no SI prefixes, so, you just write "every 3k/10k miles". With kilometres, there's already an SI prefix present. What's the sane way to write, say, "5000 / 16'000 km" in a shorter form, without all the zeros? A: Yes you can apply all SI prefixes to meters. So a megameter would be one million meters or 1000 kilometers. Gigameter is 1000 megameters. Terameter is 1000 gigameters. Petameter is 1000 terameters etc. Gigameter and higher are usually only used in the context of space and astronomy because in normal contexts it is impossible to visualize or relate those distances. People don't simplify down 120,000 km to 120 Mm because of tradition and because their odometer reads in kilometres, and also because it is hard to relate to a megameter.

Hi everyone, my name is Max Holliday, and I'm Peter Knapp and I'm Andrew Dianetti, We are part of the 2013 NASA Aeronautics Academy at Glenn Research Center , where we are characterizing and investigating the failure modes of Nickel-based superalloys in jet turbine disks. This exciting research can help improve the thermal capabilities of these alloys which can directly increase the fuel efficiency of commercial aircraft by lowering the amount of fuel used during operation Turbine engines are used in virtually all commercial aircraft. In these engines, air is compressed into the combustion chamber, where fuel is mixed and ignited. A turbine is used to extract energy from this combustion to power the compressor, and the remaining energy is used for thrust. The turbine disk is one of the most critical components in engine design, as it is subjected to a high velocity stream of hot gas. The maximum temperature that can be withstood by the turbine disc limits the amount of energy that can be extracted from the fuel, and thus impacts the engine s performance. Materials that can withstand higher temperatures under the harsh operating conditions of the engine are sought to improve engine performance. The advanced powder metallurgy disk alloy ME3 was developed in the NASA High Speed Research/Enabling Propulsion Materials program in cooperation with GE Aviation and Pratt & Whitney Aircraft Engines. This alloy was designed to have extended durability at temperatures up to 700 C in large disks. The higher temperature capability of ME3 significantly improved fuel efficiency in jet turbine engines and is considered a major advancement in disk alloys. The team we are working with at NASA, along with GE and Pratt & Whitney won a 2004 R&D 100 award for the development of ME3. Superalloys such as these are being utilized in compressor and turbine disks in current and emerging aircraft such as the Boeing 787 and Airbus A380. A turbine disk is a fracture critical structural engine component. Failures are typically uncontained, and can result in the loss of an engine, considerable airframe damage, or loss of the entire aircraft. These advanced alloys are susceptible to surface processing defects that have been known to cause failures. The FAA frequently requires enhanced inspections to detect disk cracking, in order to ensure no uncontainable failures occur. The durability of these material systems was assessed during material and engine development, however, issues can emerge as these new components spend more time in service. It would be too expensive and time consuming to produce hundreds of disks to test, so we use tensile specimens to observe corrosion effects on alloy life and predict fracture initiation. The specimens are corroded using different techniques to help simulate similar engine-like conditions and analyzed on the Alicona 3D imaging microscope to look at corrosion pit depth, width, and overlap. We use these metrics to predict exactly where the specimen will fail. The specimens are then Fatigue tested until failure. Then we use a high scanning electron microscope to observe the fracture surface and determine the points of failure in a process known as Fractography. The data collected during fractography can be used to determine what type of pit initiated crack growth and which type lead to failure. So far we are 85% successful at predicting which pit will cause fatigue failure, but we are improving with every new set of data. These facets of failure analysis not only help characterize the ME3 superalloy, but allow materials scientists to evaluate failed disks and determine exactly where the failure occurred and why. A key goal of this project is to understand how physical and microstructural factors control the physical properties of nickel-based superalloys. Specifically, the machining of disk features can profoundly affect the fatigue like of these alloys by imparting cold work or surface defects. Additionally, changes in the distribution of phases within these alloys can cause order of magnitude reductions in fatigue life. It is possible to quantify the effects of these processes using a technique called Vickers microhardness testing. In Vickers mcrohardness testing a square oyramidal diamond identer is pressed into a surface at a given load, the hardness is then determined from the dimensions of the remaining indent. We can use this testing procedure to create a map of surface hardness to determine the effects of machining. This summer we are examining broached specimens of NASA s Low Solvus High Refractory alloy that have been cycles to the point of failure. Following hardness testing we will etch these samples to expose the microstructure, i.e. grain and phase distribution, inorder to correlate changes in hardness with changes in phase. One method that can be used to resist the growth of fatigue cracks is to create a residual stress in the surface of the disk. A process known as shot peening, where small pellets are fired at the material surface, is used to create a compressive stress layer near the surface that resists external tension and suppresses the growth of fatigue cracks. Residual stress can be measured using a technique known as X-Ray Diffraction. In XRD, the strain of the lattice is measured to determine the stresses present. By removing different amounts of surface material using a process known as electropolishing the residual stress profile, as a function of depth, can be determined. Understanding these stresses will allow us to better understand how to resist crack growth. This summer, we are working to characterize the effect of different shot peening conditions on the residual stresses present in these alloys, as well as to characterize the effect of cyclic loading and elevated temperature conditions on the residual stresses throughout the life of a component. Our projects have involved characterizing aspects related to the failure modes of turbine disks. Current and future work involving these superalloys will help to create more efficient, safer aircraft engines. We would like to thank NASA for the opportunity to work on such an important and exciting program and we encourage any and all prospective engineers to consider NASA as outlet for conducting meaningful research. Thank you!

Motion Capture The term “Motion Capture” means different things to people using it for unique purposes. At the UM3D Lab: Motion Capture is the recording of movement in 3D space. Many people have heard of motion capture from its use in creating animated characters for movies and video games. At the 3D lab, we are applying this technology to projects in other fields such as kinesiology, anthropology, and even aerospace. If you want to capture and study motion in 3D space, we can provide you with the guidance and expertise to see if motion capture can benefit your project and help you through the steps. Types of Motion Capture How to Get Started Available Technologies Other Resources Types of Motion Capture The data captured during a motion capture session can be used for many different purposes including: Computer Body Interaction Using motion capture to understand the movements made by the human body. This can be applied to medicine, sports science, cultural preservation, or motion research purposes. Engineering This field applies to man-made objects that are tracked to test their function. The 3D Lab has captured the movement of a vehicles and robots, including Tubman College’s Kuka Robot. Entertainment The use of motion capture to create life-like animated characters in the entertainment industry has revolutionized this field. From video game characters to realistic CGI effects in blockbusters like “Avatar”, the 3D Lab makes use of the same technology utilized in Hollywood. These categories show some of the ways motion capture can applied to various fields. If your project does not fall into any of these categories it does not mean that it cannot be captured. Create an outline of your project while keeping these key questions in mind. What is the motion you are trying to capture? What range does this motion require? What data/information do you need to get from the motion? How will the data be presented or shared? We can help you work through these questions regardless of where you are in your project’s life-cycle and what skills you have available to you. How to Get Started As there are many different kinds of motion capture, you can learn more about it and get comfortable with it in a few ways. Consultation Session After you have decided who or what you want to motion capture and what you want out of it, it is time to schedule a consultation with our group. Steffen Heise, our Motion Capture Specialist, can help you figure out the project details, describe the technology used in our lab, and set up a time schedule to get started. Additionally, you may want to also think about how the data you collect will be presented at the end of the capturing. Workshops Starting in the Fall, students will be able to acquire digital “badges” in Motion Capture by taking hands-on motion capture workshops. Whether you are trying to earn the digital badge or just want to learn more about it, you may attend one of the workshops to learn more about capabilities of motion capture and the software used. Experiment There are a few ways to experiment on your own without involving the 3D lab. One option is renting out the Leap Motion system from the information desk located on the second floor of the Duderstadt. Another is trying out a Kinect system on your own. These systems require less expertise and preparation to use but are also less accurate. Schedule a Session Once you have met with an expert and decided on your course of action, it’s time to get started and capture data. The setup is done by our staff so all you need to do is bring your subject and come prepared to start learning the Blade software, which is used to polish the resulting data. Available Technologies Different projects require various kinds of capture systems and software. Below we have listed the those available to use at our lab. Software Blade If the motion is captured by the Vicon system, there are often a few mistakes in each take where the camera did not have direct view of one of the markers or mixed up two of them. We then use Blade software to manually edit the clips and gather the correct data. This is usually the longest part of the project since it takes time to become familiar with the software and correct all of the blunders. Motionbuilder After the data is initially edited on Blade, it can be further refined on Motionbuilder. This software uses the data provided from Blade to create a 3D animation which can be fit to a certain character or kept as a neural plasticman. Separate takes can also be combined into one clip on Motionbuilder. This is where the data actually becomes an animation. Hardware Kinect The Kinect was created by Microsoft to use with the Xbox gaming system. It is easy to use and setup, widely available and affordable. However, the Kinect can only track humans and that too only when they are facing the camera. Since it only has one camera, it is not very accurate. In our lab we applied the Kinect to create 3D spaces that can easily be manipulated by anyone with simple instructions. Vicon The Vicon system uses a ring of eight cameras that tract the location of reflective markers in space. If the motion of a human is being recorded, the person has to wear a black suit that then has markers attached to it. Although more prior preparation required, this system is highly accurate and gives the subject freedom to move in any direction. It can record more than one person at a time, a person with an object, or any moving object alone. As long as it has a marker on it, its movement can be recorded. Leap If your project only needs to capture hand and finger movements than the Leap system is for you. As it only tracts hand movements, this hardware is usually used to make interaction with the computer easier and seamless.

Various types of software development applications exist that software developers may use to develop software. An integrated development environment (IDE) is a type of software development application that contains several development tools in one package. An IDE may include tools such as a source code editor, a build automation tool, and a debugger. Examples of IDEs include Eclipse™ developed by Eclipse Foundation of Ottawa, Canada, ActiveState Komodo™ developed by ActiveState of Vancouver, Canada, IntelliJ IDEA developed by JetBrains of the Czech Republic, Oracle JDeveloper™ developed by Oracle Corporation of Redwood City, Calif., NetBeans developed by Oracle Corporation, Codenvy™ developed by Codenvy of San Francisco, Calif., Xcode® developed by Apple Corporation of Cupertino, Calif., and Microsoft® Visual Studio®, developed by Microsoft Corporation of Redmond, Wash. Code optimization refers to a method of code modification that improves code quality and/or efficiency. A program may be optimized so that it becomes a smaller size, consumes less memory, executes more rapidly, or performs fewer input/output operations. Code optimization may be performed, for example, by a specialized software tool or a built-in unit of a compiler (a so-called “optimizing compiler”). Code optimization is used in the development of many types of applications, including the development of video games, where developers may generate optimized builds in daily use (primarily for performance reasons). An optimized build results in machine code that is semantically equivalent to machine code generated without optimizations, but is configured in a way that fewer resources are used during execution of the optimized machine code (e.g., less memory, fewer procedure calls, etc.). As noted above, many developers use optimized build configurations for their daily developer build scenarios. This is a very common practice for game developers, who need their games to run at a particular speed to add visual effects, etc. Due to the introduction of certain optimizations (e.g., inlining, register allocation, common subexpression elimination, etc.), it is common for a developer that is debugging optimized code to observe a hopping program counter (the program counter jumps around in a manner that is not sequential), cross-jumping, the well-known roving variable phenomenon (e.g., a variable might be dead and its register is reused, assignment to a variable has been moved etc.), as well as other undesired phenomenon. Thus, such optimizations can make debugging the optimized code a difficult and frustrating experience for the average developer.

When high-speed and low voltage swing data transfer is needed, differential signaling (also commonly referred to as double ended signals), wherein signals are carried on two conductors and the signal is defined as the difference in the two signals. Differential signaling is perhaps the most robust and promising signaling concept. Current mode logic (CML), a design technique commonly used in high speed signaling applications such as communications chips and routers, uses differential signaling. CML is widely used in high-speed applications due to its relatively low power consumption and low supply voltage when compared to other types of logic, such as emitter coupled logic (ECL). CML is also considerably faster than CMOS logic due to its lower voltage swings. CML also has an added advantage of the capability of being fabricated using CMOS fabrication technology. When a signal needs to be transmitted off-chip, a signal driver commonly referred to as an off chip driver (OCD) may be used. An OCD may be used to provide sufficient driving current in order to transmit the signal on a transmission line. Certain OCDs may also provide voltage compatibility conversions. In a CML OCD, resistors are used to provide a necessary voltage drop that is necessary to the operation of the CML circuit. When a signal is received over a transmission line, it is desired that the transmission line be properly terminated with resistors of a desired value so that the optimum signal transfer be achieved. In most situations, the resistors will have the same value (or approximately the same value) as the resistance seen by the signals being transmitted over the transmission line. These termination resistors are commonly referred to as on die termination (ODT) resistors. Unless a particular application communicates in only one direction (either transmit or receive), a typical solution would be to have separate OCD and ODT circuits for each transmission line used in the application. One disadvantage of the prior art is that through the use of separate OCD and ODT circuits, more resistors are used. In integrated circuits, it can be relatively difficult to produce resistors of a specific desired value, especially if the resistance of the resistors is large. This may lead to a more expensive integrated circuit. A second disadvantage of the prior art is that integrated resistors (especially resistors with large resistances) may be physically large in size. Therefore, the use of a relatively large number of resistors may result in an integrated circuit that is physically large. Additionally, the presence of the large resistors may make it more difficult to route and place circuitry in the integrated circuit.

11th Parliament of Great Britain The Eleventh Parliament of Great Britain was the parliament of the Kingdom of Great Britain that sat from 31 May 1754 to 20 March 1761. It was assembled following the general elections held in April–May 1754. History As with its predecessor, the Eleventh Parliament was an overwhelmingly Whig parliament. Traditional Whig–Tory party alignments had little meaning in the course of this parliament. Instead, political competition ran primarily between different Whig factions, such as the "Old Corps", Bedfordites, and Patriots. There were several changes of ministries in the course of the Eleventh Parliament. Newcastle's "Old Corps" Whigs assembled the first ministry, but had to accommodate the rise of the Bedfordite faction in late 1755 with several cabinet posts. Newcastle's ministry fell in late 1756, during the parliamentary recess, and the third session began with a new Bedfordite–Patriot Whig coalition in control. However, King George II could not brook them and fired them before the end of that session, placing the government in the hands of an interim caretaker ministry. More satisfactory to the king, Newcastle returned to power in coalition with William Pitt before the beginning of the fourth session in late 1757. The Seven Years' War was fought for the duration of the Eleventh Parliament, and much of its legislation addressed the financing and conduct of the war. Officers Surrey MP Arthur Onslow was Speaker of the House of Commons for the three prior parliaments, and had been re-elected to serve as speaker for the entire Eleventh Parliament. In the Cabinet, the Secretary of the South served as the Leader of the House of Commons. The "Old Corps" Whig Thomas Robinson held that office until late 1755, when the Bedfordite Henry Fox replaced him. In 1756, William Pitt took and held that position until the end of the parliament. The Prime Minister of Great Britain was Leader of the House of Lords during this parliament, namely Newcastle from 1756 to 1757, Devonshire briefly from 1756 to 1757, and Newcastle again from 1756 to 1761. Sessions The Eleventh Parliament went through eight sessions. Its first session opened on 31 May 1754 for only a few days for formalities, and passed no public act. Thereafter, parliamentary sessions usually opened in November and ran for around six months. They were in recess for the subsequent half of the year. Parliament was not immediately dissolved with the death of King George II (25 October 1760) but rather met for an additional eighth and final session that November, opened by the new King George III. The Eleventh Parliament was finally dissolved on 25 April 1761, and new elections called. By tradition, a parliament passes only one public "act" per session, albeit an act with multiple chapters. Legal statutes are cited by parliamentary session labelled by the regnal year in which that session sat. The regnal year of George II began on 11 June, and thus most parliamentary sessions do not overlap regnal years (and thereby do not need a double citation). As this parliament was the first new parliament assembled after the calendar reform went into effect in 1752, there is no citation conflict between legal dates and common dates. The session dates in the table below follow Cobbett's Parliamentary History . The legal titles of the sessions are as given in common compilations, such as the Statutes at Large . For the specific acts of parliament passed in each session, see the lists of Acts of Parliament for 1740–59 and 1760–79. See also List of Parliaments of Great Britain List of Acts of the Parliament of Great Britain, 1740–59 List of Acts of the Parliament of Great Britain, 1760–79 References Category:Parliament of Great Britain Category:1754 establishments in Great Britain Category:1761 disestablishments in Great Britain

To make the lab equipment on the right, Michigan Tech's Joshua Pearce first shredded milk jugs and then turned them into plastic filament. A 3D printer transformed the filament into a DremelFuge, a centrifuge for rotary tools. Credit: Sarah Bird/Michigan Technological University Suppose you could replace "Made in China" with "Made in my garage." Suppose also that every time you polished off a jug of two percent, you would be stocking up on raw material to make anything from a cell phone case and golf tees to a toy castle and a garlic press. And, you could give yourself a gold medal for being a bona fide, recycling, polar-bear-saving rock star. Michigan Technological University's Joshua Pearce is working on it. His main tool is open-source 3D printing, which he uses to save thousands of dollars by making everything from his lab equipment to his safety razor. Using free software downloaded from sites like Thingiverse, which now holds over 54,000 open-source designs, 3D printers make all manner of objects by laying down thin layers of plastic in a specific pattern. While high-end printers can cost many thousands of dollars, simpler open-source units run between $250 and $500—and can be used to make parts for other 3D printers, driving the cost down ever further. "One impediment to even more widespread use has been the cost of filament," says Pearce, an associate professor of materials science and engineering and electrical and computer engineering. Though vastly less expensive than most manufactured products, the plastic filament that 3D printers transform into useful objects isn't free. Milk jugs, on the other hand, are a costly nuisance, either to recycle or to bury in a landfill. But if you could turn them into plastic filament, Pearce reasoned, you could solve the disposal problem and drive down the cost of 3D printing even more. So Pearce and his research group decided to make their own recycling unit, or RecycleBot. They cut the labels off milk jugs, washed the plastic, and shredded it. Then they ran it through a homemade device that melts and extrudes it into a long, spaghetti-like string of plastic. Their process is open-source and free for everyone to make and use at Thingiverse.com. The process isn't perfect. Milk jugs are made of high-density polyethylene, or HDPE, which is not ideal for 3D printing. "HDPE is a little more challenging to print with," Pearce says. But the disadvantages are not overwhelming. His group made its own climate-controlled chamber using a dorm-room refrigerator and an off-the-shelf teddy-bear humidifier and had good results. With more experimentation, the results would be even better, he says. "3D printing is where computers were in the 1970s." The group determined that making their own filament in an insulated RecycleBot used about 1/10th the energy needed to acquire commercial 3D filament. They also calculated that they used less energy than it would take to recycle milk jugs conventionally. RecycleBots and 3D printers have all kinds of applications, but they would be especially useful in areas where shopping malls are few and far between, Pearce believes. "Three billion people live in rural areas that have lots of plastic junk," he says. "They could use it to make useful consumer goods for themselves. Or imagine people living by a landfill in Brazil, recycling plastic and making useful products or even just 'fair trade filament' to sell. Twenty milk jugs gets you about 1 kilogram of plastic filament, which currently costs $30 to $50 online." More information: Pearce's research is described in depth in two articles: "Distributed Recycling of Waste Polymer into RepRap Feedstock,"coauthored with Christian Baechler and Matthew DeVuono of Queen's University and published in the March issue of Rapid Prototyping; and "Distributed Recycling of Post-Consumer Plastic Waste in Rural Areas," coauthored by Jerry Anzalone, Megan Kreiger, Meredith Mulder and Alexandra Glover of Michigan Tech, which will appear in the Proceedings of the Materials Research Society.

1. Introduction =============== *Brassica* vegetables such as cauliflower and broccoli are popular and are among the most consumed vegetables in the world. Many epidemiological studies have indicated that a diet rich in these vegetables is associated with reduced risk of a several type of cancers, type 2 diabetes, and cardiovascular diseases \[[@B1-molecules-20-01228],[@B2-molecules-20-01228],[@B3-molecules-20-01228]\]. Additionally, *Brassicas* are known to possess antioxidant activity \[[@B4-molecules-20-01228],[@B5-molecules-20-01228]\]. Such beneficial health properties of these crops are due to the presence of health-promoting compounds such as vitamins, carotenoids, phenols, flavonoids, minerals, and glucosinolates \[[@B6-molecules-20-01228],[@B7-molecules-20-01228],[@B8-molecules-20-01228],[@B9-molecules-20-01228],[@B10-molecules-20-01228]\]. Among these, glucosinolates are one of the most important phytochemicals in *Brassica* crops, a large group of sulfur-containing compounds possessing anticancer activity that are known to be responsible for the pungent flavor of the plants \[[@B11-molecules-20-01228],[@B12-molecules-20-01228]\]. Vitamin C is another health-promoting water-soluble primary nutrient in broccoli and other *Brassica* crops \[[@B13-molecules-20-01228]\] that protects against cell death, singlet oxygen, and hydroxyl radicals and acts as a lipid peroxidation chain-breaking agent \[[@B14-molecules-20-01228]\]. Likewise, polyphenols are a large group of antioxidant compounds present in considerable amounts in these vegetables \[[@B15-molecules-20-01228]\], often considered the most abundant antioxidants in the human diet \[[@B2-molecules-20-01228]\]. Flavonoids and their derivatives are the largest and most prominent group of polyphenols and are ideal scavengers of peroxyl radicals due to their specific reduction actions relative to alkyl peroxyl radicals, making them effective inhibitors of lipoperoxidation \[[@B16-molecules-20-01228]\]. Likewise, free sugars in *Brassica* crops are responsible for masking the bitter taste of glucosinolates, promoting human consumption \[[@B17-molecules-20-01228]\]. Additionally, the lipophilic portion of these plant extracts may also contain both saturated fatty acids (SFA) and unsaturated fatty acids (monounsaturated fatty acids (MUFA) and polyunsaturated fatty acids (PUFA)), which contribute to human health in many ways \[[@B18-molecules-20-01228],[@B19-molecules-20-01228]\]. The content of these compounds in *Brassica* vegetables varies significantly depending on the genotypes of cultivars, the specific plant tissue, fertilization, growing season, and several other environmental factors \[[@B9-molecules-20-01228],[@B20-molecules-20-01228],[@B21-molecules-20-01228],[@B22-molecules-20-01228],[@B23-molecules-20-01228]\]. For example, significant variation in glucosinolate concentration as well as the content of other compounds has been shown in the same cultivar grown in different seasons \[[@B6-molecules-20-01228],[@B24-molecules-20-01228]\]. There are several reports regarding the glucosinolate, vitamin C, phenolic, and flavonoid content in various *Brassica* crops such as cauliflower and broccoli \[[@B6-molecules-20-01228],[@B9-molecules-20-01228],[@B15-molecules-20-01228],[@B25-molecules-20-01228]\]. However, most of this research has focused only on their floret parts, and information about such compounds in leaf tissue is scarce. Furthermore, information regarding fatty acid profiles is very limited, and most previous research has been related only to the seeds \[[@B26-molecules-20-01228]\]. It is therefore important to establish the compositional ratio of fatty acids in different cauliflower and broccoli cultivars, as fatty acids may play an important role in human health. Therefore, in this study, we aimed to evaluate the influence of plant parts on the health benefits of some chemical constituents such as glucosinolates, vitamin C, phenolics, flavonoids, and free sugar content, along with the fatty acid composition and antioxidant activity of commercial cauliflower and broccoli cultivars. 2. Results and Discussion ========================= 2.1. Vitamin C, Total Phenol, and Total Flavonoid Content --------------------------------------------------------- Our results showed variation in antioxidant (vitamin C, total phenol, and total flavonoid) contents with crop type, cultivar, and plant part ([Figure 1](#molecules-20-01228-f001){ref-type="fig"}A--D). In broccoli, the vitamin C content in florets and leaves ranged from 402.8 to 474.7 mg·100 g^−1^ and from 298.6 to 454.3 mg·100 g^−1^, respectively. The cultivar AMaGi exhibited higher vitamin C content in floret and leaf tissues ([Figure 1](#molecules-20-01228-f001){ref-type="fig"}A) than did Baeridom and Cheonjae. The value observed in this study was lower than that found in a previous study by Koh*et al.* \[[@B27-molecules-20-01228]\], who observed 573.5--1313.5 mg·100 g^−1^ of vitamin C in various commercial broccolis. In contrast, total phenol content was lower in AMaGi than in Baeridom and Cheonjae in both the floret (599.6 mg·GAE 100 g^−1^) and leaf (533.6 mg·GAE 100 g^−1^) parts ([Figure 1](#molecules-20-01228-f001){ref-type="fig"}B). Regardless of cultivars and plant tissue, total phenol content ranged from 533.6 mg·GAE 100 g^−1^ in AMaGi leaf tissue to 740.1 mg·GAE 100 g^−1^ in Cheonjae florets, which was higher than previously reported by Zhang and Hamauzu \[[@B28-molecules-20-01228]\] and within the range reported by Koh*et al.* \[[@B27-molecules-20-01228]\]: 481--1577 mg·GAE 100 g^−1^ of total phenol in various broccoli cultivars. All three cultivars showed statistically higher total phenol contents in florets compared with leaf tissue. In contrast, total flavonoid content was statistically higher in leaf tissue in all the cultivars and showed higher variation (more than twofold) between florets and leaves in all the cultivars. Similar to vitamin C, the highest flavonoid content was present in AMaGi in both floret (317.1 mg·CE 100 g^−1^) and leaf (816.8 mg·CE 100 g^−1^). The presence of higher total flavonoid content in leaf suggests higher nutritional value of leaves, as flavonoids possess strong antioxidant activity and inhibit oxidative stress \[[@B29-molecules-20-01228]\]. {#molecules-20-01228-f001} The vitamin C content in floret tissues of the three cauliflower cultivars was highest in Asia purple (649.7 mg·100 g^−1^), followed by Bridal (410.4 mg·100 g^−1^) and Asia white (396.7 mg·100 g^−1^) ([Figure 1](#molecules-20-01228-f001){ref-type="fig"}A). This result was in agreement with Picchi*et al.* \[[@B30-molecules-20-01228]\], who reported 346--638 mg·100 g^−1^ of vitamin C, though it was higher than the vitamin C content reported by Singh*et al.* \[[@B9-molecules-20-01228]\]. Compared with the florets, the leaf parts showed statistically higher vitamin C content in Asia white (441.7 mg·100 g^−1^) and Bridal (471.9 mg·100 g^−1^). Likewise, total phenol content was highest in Asia purple (1345.2 mg·GAE 100 g^−1^) and lowest in Bridal in the floret part ([Figure 1](#molecules-20-01228-f001){ref-type="fig"}B). In contrast to the vitamin C content, only Bridal (914.1 mg·GAE 100 g^−1^) exhibited statistically higher total phenol content in leaves compared with florets. Similar to the broccoli cultivars, total flavonoid content in cauliflower cultivars was also statistically higher in leaf parts compared with floret parts, and Asia white and Bridal exhibited an approximately fivefold higher flavonoid content in leaf tissue compared with their respective floret parts. The presence of higher total flavonoid content in leaf parts in both broccoli and cauliflower crops suggest that its leaf can be used as an alternative source of total flavonoids, as flavonoids are responsible for various beneficial health effects \[[@B27-molecules-20-01228],[@B29-molecules-20-01228],[@B31-molecules-20-01228]\]. 2.2. Glucosinolate Profiles --------------------------- Total and individual glucosinolate concentrations were significantly affected by crop type, cultivar, and plant part in most cases ([Table 1](#molecules-20-01228-t001){ref-type="table"}). Similar to the previous reports \[[@B25-molecules-20-01228],[@B32-molecules-20-01228]\], glucoraphanin was the major glucosinolate in both parts of broccoli cultivars except in the leaf tissue of AMaGi, where glucobrassicin was the dominant glucosinolate (2.30 µmol·g^−1^) ([Table 1](#molecules-20-01228-t001){ref-type="table"}). Furthermore, glucobrassicin was the second major glucosinolate except in the florets of AMaGi, ranging from 2.03 in AMaGI to 2.44 µmol·g^−1^ in Cheonjae florets and from 0.92 µmol·g^−1^ in Cheonjae to 2.30 µmol·g^−1^ in AMaGi leaves. All of the broccoli cultivars showed statistically higher total glucosinolate concentrations in the floret tissues compared with leaf tissues, and Baeridom (9.66 µmol·g^−1^) showed the highest total glucosinolate concentration compared with AMaGi (8.09 µmol·g^−1^) and Cheonjae (5.59 µmol·g^−1^) ([Table 1](#molecules-20-01228-t001){ref-type="table"}). The glucosinolate levels found in this study were within the range found by Lee*et al.* \[[@B25-molecules-20-01228]\] and lower than the results reported by Rosa and Rodrigues \[[@B32-molecules-20-01228]\]. The composition of glucosinolate concentration in this study was also different than in Aries*et al.* \[[@B6-molecules-20-01228]\], who reported considerable amount of glucoiberin in broccoli. Such differences in glucosinolate concentration and composition in this study might be due to the difference in genotype of the cultivars and other several environmental factors. Among cauliflower cultivars, Asia purple exhibited the highest total glucosinolate concentration (8.80 µmol·g^−1^), followed by Bridal (7.41 µmol·g^−1^) and Asia white (1.97 µmol·g^−1^) ([Table 1](#molecules-20-01228-t001){ref-type="table"}). With the exception of Asia white, the cultivars exhibited relatively higher total glucosinolates in their floret parts compared with leaf parts. Among the nine glucosinolates analysed in our experiment, five glucosinolates were detected in Asia purple, and Asia white and Bridal showed the presence of gluconapin and other glucosinolates. Similar to the results of Hodges *et al.* \[[@B33-molecules-20-01228]\], glucobrassicin was a major glucosinolate compound in cauliflower, except in florets of Asia white (0.05 µmol·g^−1^), which revealed relatively higher proportions of glucoraphanin and gluconapin. However, the levels of gluconapin and glucoraphanin observed in this study appear to be higher than those in previous reports \[[@B30-molecules-20-01228],[@B33-molecules-20-01228]\]. molecules-20-01228-t001_Table 1 ###### Glucosinolate profile (µmol·g^−1^ in dry weight) in various parts of broccoli and cauliflower cultivars. Crop Cultivar Part Progoitrin Glucoraphanin Sinigrin Gluconapin Glucobrassicanapin Glucobrassicin Total Glucosinolates ------------- ------------- --------- ---------------- --------------- ---------- ------------ -------------------- ---------------- ---------------------- Broccoli AMaGi Floret 2.73 ^x^ a ^y^ 2.77 b N/D ^z^ 0.56 a N/D 2.03 c 8.09 c Leaf 0.34 e 2.05 d N/D 0.20 c N/D 2.30 c 4.89 fg Baeridom Floret 1.66 b 5.19 a 0.31 e 0.43 b N/D 2.07 c 9.66 a Leaf 0.22 f 2.11 d 0.06 f 0.08 de N/D 1.93 c 4.40 g Cheonjae Floret 0.44 d 2.50 c 0.09 f 0.12 d N/D 2.44 c 5.59 ef Leaf 0.04 h 1.10 e 0.02 f 0.04 ef N/D 0.92 d 2.12 hi Cauliflower Asia purple Floret 0.41 d 0.69 fg 1.71 a N/D 0.85 a 5.14 a 8.80 b Leaf 0.13 g 0.32 h 1.04 c N/D 0.43 b 5.28 a 7.20 d Asia white Floret 0.51 c 0.65 fg 0.12 f 0.59 a 0.05 c 0.05 e 1.97 h Leaf 0.07 h 0.73 fg 0.44 d N/D 0.42 b 1.15 d 2.81 h Bridal Floret 0.31 e 0.76 f 1.17 b 0.09 de N/D 5.08 a 7.41 cd Leaf 0.16 g 0.49 gh 0.98 c 0.11 d 0.41 b 3.69 b 5.84 e ^x^ Values are the mean of three independent replications; ^y^ Different letters within the column are statistically significant by Duncan's multiple-range test at *p* \< 0.05; ^z^ N/D: Not detected. 2.3. Free Sugar Content ----------------------- Three free sugars, namely glucose, fructose, and sucrose, were evaluated in this study, and glucose was most abundant in all cultivars and their parts, followed by fructose and then sucrose ([Table 2](#molecules-20-01228-t002){ref-type="table"}). Of all cultivars and plant parts, total free sugar content in broccoli ranged from 153.3 mg·g^−1^ in the florets to 241.6 mg·g^−1^ in the leaves of AMaGi, and total sugar content was statistically higher in leaf parts, except in Cheonjae (237.2 mg·g^−1^). Compared with previous reports by Rosa*et al.* \[[@B24-molecules-20-01228]\], who reported 51--143 mg·g^−1^ of total free sugars in the florets of various broccoli cultivars in different seasons, we observed comparatively higher total free sugar in all cultivars. The highest free sugar content was observed in Cheonjae (237.2 mg·g^−1^), followed by Baeridom (205.8 mg·g^−1^) and AMaGi (153.3 mg·g^−1^). In the case of individual free sugars, Cheonjae exhibited statistically higher glucose and fructose content compared with AMaGi and Baeridom ([Table 2](#molecules-20-01228-t002){ref-type="table"}). However, sucrose, a minor free sugar in broccoli, showed some unusual patterns and exhibited greater difference between florets and leaves. Specfically, AMaGi and Baeridom displayed a greater than 12-fold difference in the sucrose content between florets and leaves, compared with an approximate two fold difference in Cheonjae. molecules-20-01228-t002_Table 2 ###### Free sugar content (mg·g^−1^ in dry weight) in various parts of broccoli and cauliflower cultivars. Crop Cultivar Part Glucose Fructose Sucrose Total Free Sugar ------------- ------------- ------------ ---------------- ---------- --------- ------------------ Broccoli AMaGi Floret 77.4 ^x^ g ^y^ 75.3 f 0.6 j 153.3 h Leaf 134.5 b 99.3 d 7.8 g 241.6 d Baeridom Floret 105.5 f 98.4 d 1.9 i 205.8 f Leaf 112.8 ef 78.2 f 23.3 d 214.3 ef Cheonjae Floret 126.3 b--d 110.2 b 0.7 j 237.2 d Leaf 118.9 de 100.8 cd 4.0 h 223.7 e Cauliflower Asia purple Floret 133.3 b 104.1 c 32.2 b 269.6c Leaf 127.8 bc 49.4 h 14.8 e 192.0 g Asia white Floret 161.8 a 127.0 a 10.5 f 299.3 b Leaf 120.5 c--e 65.1 g 29.2 c 214.8 ef Bridal Floret 133.1 b 113.5 b 72.0 a 318.6 a Leaf 127.3 bc 88.3 e 8.8 g 224.4 e ^x^ Values are mean of two independent replications; ^y^ Different letters within the column are statistically significant by Duncan's multiple-range test at *p* \< 0.05. In cauliflower cultivars, glucose was present in a statistically higher quantity in florets (161.8 mg·g^−1^) than in leaves (120.5 mg·g^−1^) in the Asia white cultivar, whereas Asia purple and Bridal exhibited statistically similar glucose contents in their plant parts. In contrast, all cultivars displayed statistically higher fructose content in florets compared with leaves. Similarly, sucrose content exhibited cultivar- and plant-part-dependent variation. Among the three cultivars and their parts, florets of Asia white showed higher glucose (161.8 mg·g^−1^) and fructose (127.0 mg·g^−1^) content but lower sucrose content (10.5 mg·g^−1^) compared with the other cultivars. Total free sugar content in the florets was statistically higher in Bridal (318.6 mg·g^−1^) than in Asia white (299.3 mg·g^−1^) or Asia purple (269.6 mg·g^−1^), and in all these cultivars, florets exhibited statistically higher total free sugar content compared with leaves ([Table 2](#molecules-20-01228-t002){ref-type="table"}). The levels observed in this study were lower to those found by Hodges*et al.* \[[@B33-molecules-20-01228]\], who reported approximately 320 mg·g^−1^ of total free sugars in the dry powder of cauliflower florets; however, to the author's knowledge, this is the first report to examine free sugars in the leaf parts of *Brassica* species. Similar to broccoli, the sucrose content of cauliflower also exhibited greater variation (approximately two- to eightfold) between plant parts. Of the two crops, cauliflower exhibited comparatively higher free sugar content than broccoli. All of these results suggest that the free sugar content in *Brassica* crops is dependent not only on the genotype of the crop, but also on the specific plant tissue. 2.4. Fatty Acid Composition --------------------------- The results of the fatty acid composition analyses are presented in [Table 3](#molecules-20-01228-t003){ref-type="table"}. Among the 37 fatty acids analyzed, only 13 fatty acids were found in the florets of broccoli cultivars, and only 12 in the leaf parts. Three major fatty acids,*i.e.*, palmitic, linoleic, and linolenic acids, comprised more than 85% of total fatty acids in all cultivars and their parts, except in the florets of AMaGi. The cultivar-dependent variation in major fatty acids was statistically significant only in the florets of some cultivars. The SFA content ranged from 31.51% to 47.81%, with a statistically higher value in florets than in leaves in all cultivars. Monounsaturated fatty acids (MUFA) and polyunsaturated fatty acids (PUFA) ranged from 3.34% to 4.67% and from 47.90% to 65.89%, respectively. Compared with other cultivars, florets of AMaGi exhibited higher SFA (46.75%) and lower PUFA (47.92%). Similarly, in the case of cauliflower cultivars, 12 fatty acids were found, the major ones being palmitic (27.11%--38.42%), linoleic (13.09%--18.97%) and linolenic acid (26.32%--41.03%), accounting for more than 80% of total fatty acid content ([Table 3](#molecules-20-01228-t003){ref-type="table"}). Similarly enhanced levels of palmitic and linolenic acids were previously reported by Scalzo*et al.* \[[@B23-molecules-20-01228]\]. The other fatty acids were myristic, pentadecanoic, palmitoleic, heptadecanoic, oleic, stearic, arachidic, behenic, and lignoceric acids, and almost all the fatty acids showed statistically significant variation among cultivars and plant parts. Total SFA ranged from 40.08% to 49.70%, with the highest value found in florets of Bridal. MUFA and PUFA ranged from 3.95% to 5.01% and 45.29% to 55.85%, respectively. Compared with leaves, florets exhibited statistically higher SFA values and lower PUFA values in all cultivars. Overall, regardless of crop type and plant part, linolenic acid was the major fatty acid in all cultivars, followed by palmitic and linoleic acids. In both the crop types and cultivars, linolenic acid, which is an important essential fatty acid, was relatively higher in leaves compared to floret parts, thereby suggesting higher nutritional value of leaves because linolenic acid provides various health benefits such as lowering of the plasma lipid level \[[@B34-molecules-20-01228]\]. Altogether, total unsaturated fatty acids were more than 50% of the total fatty acids in all the cases, suggesting the nutritional importance of these crops, as unsaturated fatty acids promote the proper functioning of blood vessels, which in turn reduces the risk of heart attack or stroke \[[@B35-molecules-20-01228]\]. Our results suggest that the fatty acid composition of *Brassica* crops differs depending upon the genotype and plant part, however, further research on *Brassica* fatty acid composition using a large number of germplasms is required. molecules-20-01228-t003_Table 3 ###### Fatty acid composition (%) in various parts of broccoli and cauliflower cultivars. Fatty acids Broccoli Cauliflower ----------------------- ---------------- ------------- ----------- ---------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- ----------- Lauric (C12:0) 0.17 ^u^ a ^v^ N/D ^w^ 0.10 b N/D 0.10 b N/D N/D N/D N/D N/D N/D N/D Myristic (C14:0) 1.04 a 0.39 f 0.51 e 0.28 g 0.39 f 0.29 g 0.87 b 0.91 b 0.87 b 0.68 d 0.77 c 0.67 d Pentadecanoic (C15:0) 0.40 ab 0.44 a 0.29 e 0.38 bc 0.35 cd 0.36 b--d 0.37 bc 0.30 e 0.36 b--d 0.37 bc 0.32 de 0.44 a Palmitic (C16:0) 31.74 c 23.55 g 29.75 e 24.05 g 31.03 cd 23.52 g 30.50 de 27.11 f 34.75 b 27.25 f 38.42 a 27.15 f Palmitoleic (C16:1) 0.66 a 0.21 de 0.44 c 0.21 de 0.37 c 0.13 e 0.73 a 0.22 d 0.53 b 0.17 de 0.40 c 0.20 de Heptadecanoic (C17:0) 0.61 a 0.40 e 0.30 fg 0.33 f 0.31 fg 0.27 g 0.59 a 0.47 bc 0.51 b 0.45 cd 0.41 de 0.42 de Stearic (C18:0) 11.90 a 5.53 g 5.98 f 4.70 i 5.59 g 5.07 h 10.37 b 11.72 a 9.97 d 10.11 cd 8.73 e 10.24 bc Oleic (C18:1n9c) 3.63 d--g 3.13 g 3.82 b--e 3.22 fg 4.30 ab 3.74 c--f 3.56 e--g 3.99 b--e 4.12 a--d 4.23 a--c 4.61 a 3.75 c--f Linoleic (C18:2n6c) 13.56 ef 14.43 d 18.02 b 14.09 de 18.23 b 14.36 d 16.42 c 14.38 d 16.69 c 14.52 d 18.97 a 13.09 f Linolenic (C18:3n3) 34.34 f 50.72 a 39.13 de 51.80 a 37.80 e 51.03 a 35.52 f 39.76 cd 30.61 g 41.00 c 26.32 h 42.76 b Arachidic (C20:0) 0.99 a 0.53 de 0.84 ab 0.42 e 0.74 a--d 0.44 e 0.48 e 0.55 e 0.81 a--c 0.57 c--e 0.61 b--e 0.62 b--e Behenic (C22:0) 0.30 a 0.21 a--c 0.22 a--c 0.12 c 0.22 a--c 0.28 ab 0.22 a--c 0.23 a--c 0.32 a 0.21 a--c 0.17 b--c 0.23 a--c Lignoceric (C24:0) 0.66 a 0.46 cd 0.60 ab 0.40 cd 0.57 ab 0.51 bc 0.37 de 0.36 de 0.46 cd 0.44 cd 0.27 e 0.43 cd SFA ^x^ 47.81 b 31.51 g 38.59 f 30.68 g 39.30 e 30.74 g 43.77 c 41.65 d 48.05 b 40.08 e 49.70 a 40.20 e MUFA ^y^ 4.29 bc 3.34 e 4.26 bc 3.43 dc 4.67 ab 3.87 cd 4.29 bc 4.21 bc 4.65 ab 4.40 bc 5.01 a 3.95 c PUFA ^z^ 47.90 f 65.15 a 57.15 b 65.89 a 56.03 c 65.39 a 51.94 e 54.14 d 47.30 f 55.52 c 45.29 g 55.85 c ^u^ Values are the mean of two independent replications; ^v^ Different letters within the raw are statistically significant by Duncan's multiple-range test at *p* \< 0.05; ^w^ N/D: Not detected; ^x^ SFA: saturated fatty acid; ^y^ MUFA: monounsaturated fatty acid; ^z^ PUFA: polyunsaturated fatty acid. 2.5. Antioxidant Activity ------------------------- In our experiment, we measured antioxidant activity by evaluating the 2,2,-diphenyl-1-picrylhydracyl (DPPH) radical-scavenging activity of different concentrations of methanolic extracts from *Brassica* crops. The IC~50~ (50% of inhibition) value was calculated following a linear regression analysis of the observed inhibition percentage*versus* concentration, where a lower IC~50~ value shows higher antioxidant activity. Antioxidant activity in broccoli cultivars varied significantly in florets, whereas no such variation was observed in leaves ([Figure 1](#molecules-20-01228-f001){ref-type="fig"}D). Both AMaGi and Cheonaje showed relatively higher antioxidant activity in florets compared with leaves, whereas Baeridom showed the opposite result. Of all cultivars and plant parts, the highest antioxidant activity was observed in floret of Cheonjae cultivar (IC~50~ value = 2.27 mg·mL^−1^). In the case of cauliflower, only the Asia purple showed statistically higher antioxidant activity in its floret (IC~50~ value = 1.12 mg·mL^−1^) compared with leaves (IC~50~ value = 2.27 mg·mL^−1^), while other cultivars exhibited higher antioxidant activity in their leaf parts than in floret parts. This might be due to the higher content of total phenols, as phenolics are major contributors to total antioxidant activity \[[@B36-molecules-20-01228]\]. Overall, antioxidant activity differed depending upon the crop type, cultivar, and plant part in most cases. However, of all cultivars and plant parts, florets of Asia purple showed the lowest IC~50~, thus indicating the highest antioxidant activity ([Figure 1](#molecules-20-01228-f001){ref-type="fig"}D) and enhanced potential health benefits of these cultivars. 2.6. Correlations among Phytonutrients -------------------------------------- To determine the contribution of antioxidants to antioxidant activity and phytonutrients, we performed a correlation analysis on the relationships among vitamin C, phenolics, flavonoids, total glucosinolates, and antioxidant activity ([Table 4](#molecules-20-01228-t004){ref-type="table"}). In our study, regardless of the crop type, cultivar or plant part, vitamin C exhibited the highest positive correlation with total flavonoid (*r* = 0.574 \*\*), followed by the correlation with total phenol (*r* = 0.522 \*\*) and total glucosinolates (*r* = 0.494 \*\*). Likewise, we found a significant positive correlation between antioxidant activity and total phenols (*r* = 0.698 \*\*), vitamin C (*r* = 0.632 \*\*), and total flavonoid (*r* = 0.456 \*\*). These results are consistent with previous reports that described the antioxidant capacity of various *Brassica* vegetables \[[@B6-molecules-20-01228],[@B20-molecules-20-01228],[@B30-molecules-20-01228],[@B37-molecules-20-01228]\]. In contrast, no correlation was found between antioxidant activity and total glucosinolates, perhaps due to the low antioxidant capacity of glucosinolates or the low quantity of glucosinolates in these cultivars. The stronger positive correlation between antioxidant activity and total phenol content found in this study is in agreement with Aires*et al.* \[[@B6-molecules-20-01228]\] and Samec*et al.* \[[@B37-molecules-20-01228]\], possibly due to the greater contribution of phenolic compounds to antioxidant activity. molecules-20-01228-t004_Table 4 ###### Correlation coefficients among phytochemicals and antioxidant activities. Attributes Total Phenol Total Flavonoid Total Glucosinolate Antioxidant Activity --------------------- -------------- ----------------- --------------------- ---------------------- Vitamin C 0.522 \*\* 0.574 \*\* 0.494 \*\* 0.632 \*\* Total phenol 1 0.292 0.169 0.698 \*\* Total flavonoid 0.292 1 0.014 0.456 \*\* Total glucosinolate 0.169 0.014 1 0.219 \*\* Correlation is significant at *p* \< 0.01. 3. Experimental Section ======================= 3.1. Plant Materials -------------------- Six commercial F~1~ hybrid *Brassica* cultivars, including three cauliflower cultivars (Asia purple, Asia white, and Bridal) and three broccoli cultivars (AMaGi, Baeridom, and Cheonjae), were used in this study. All were grown in an experimental field of the National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), Suwon, South Korea. For both the crop types, seedlings were transplanted to the cultivation field 33 days after sowing. Seedlings were planted in rows with 50 cm between plants and 60 cm in rows. The sowing date was 5 March 2011, and the plant materials were harvested at commercial maturity stage, which occurred between 65 and 75 days after sowing. During the field experiments, water, fertilizers and pesticides were applied according to standard cultural practices of NIHHS and RDA. Ten broccoli/cauliflower heads were used for each sample. After harvesting, florets and leaf parts were separated, cut into small pieces, and then freeze dried. The samples were ground into fine powder and then stored at −20 °C until used for the analysis of glucosinolates, vitamin C, total phenol, total flavonoid and free sugar content, fatty acid composition, and antioxidant activity. 3.2. Authentic Standards and Chemicals -------------------------------------- The glucosinolate standards, glucoiberin, progoitrin, glucoraphanin, sinigrin, gluconapin, glucobrassicanapin, glucoerucin, glucobrassicin, and gluconasturtiin, were purchased from Cfm Oskar Co. (Marktredwitz, Germany). Authentic standards for DEAE (Diethyl aminoethyl) Sephadex-A25, aryl sulfatase (EC 3.1.6.1, type H-1) from *Helix pomatia*, vitamin C, glucose, sucrose, fructose, gallic acid, DPPH (2,2-diphenyl-1-picrylhydrazyl), and catechin hydrate were purchased from Sigma-Aldrich (St. Louis, MO, USA). A standard for fatty acid methyl esters (FAME) was obtained from Supelco (Bellefonte, PA, USA). Chemicals such as sodium hydroxide, sodium carbonate, sodium nitrite, aluminum chloride, Folin−Ciocalteu reagent, and 2,2-dimethoxypropane were purchased from Sigma-Aldrich (St. Louis, MO, USA). Benzene, n-heptanes, and sulfuric acid were acquired from Daejung Chemicals (Seoul, Korea). Other chemicals, including acetonitrile (HPLC grade), methanol (HPLC grade), and formic acid (ACS reagent), were purchased from J. T. Baker (Phillipsburg, NJ, USA). 3.3. Analysis of Vitamin C -------------------------- Vitamin C content was analyzed according to the methods described by Spinola*et al.* \[[@B38-molecules-20-01228]\] with modifications. Freeze-dried powdered *Brassica* samples (0.5 g) were extracted with 5% metaphosphoric acid solution. Then, after centrifugation and filtration (with a 0.20 μm syringe filter), the aliquot was analyzed using an H-Class UPLC (ultra performance liquid chromatography) (Waters, Milford, MA, USA) equipped with an Acquity UPLC^®^ HSS T3 (2.1 × 100 mm, 1.8 μm, Waters) column and PDA (photo diode array) detector (Waters) at 254 nm in wave length. An isocratic mobile phase composed of aqueous 0.1% (*v*/*v*) formic acid at a flow rate of 0.3 mL·min^−1^ was used for separation of the vitamin C peak. An authentic ascorbic acid standard at various concentrations (5, 10, 25, 50, and 100 ppm) was used for the identification and quantification of the peak and vitamin C content was expressed as milligrams per 100 gram (mg·100 g^−1^) of dry weight. 3.4. Analysis of Total Phenol ----------------------------- Total phenolic content was estimated by the Folin--Ciocalteu colorimetric method based on the procedure previously described by Singleton and Rossi \[[@B39-molecules-20-01228]\] using gallic acid as a standard phenolic compound. Briefly, 1 g freeze-dried powdered sample was extracted in 80% methanol for 15 h at room temperature on an orbital shaker. Then, the extract was centrifuged and filtered through a Whatman No. 42 filter paper, and 1 mL of supernatant was mixed with 3 mL distilled water in a 15 mL falcon tube. After adding 1 mL of Folin reagent, the solution was incubated in a water bath at 27 °C for 5 min. Then, 1 mL of saturated sodium carbonate was added. After 1 h, absorbance of the extract was measured with an EON^TM^ microplate spectrophotometer (BioTek^®^ Instruments Inc. Highland Park, Winooski, VT, USA) at 640 nm. Gallic acid standards at different concentrations (5, 10, 25, 50, 75, and 100 ppm) were used for the calibration. Total phenol content was expressed as milligrams of gallic acid equivalent per 100 g (mg·GAE 100 g^−1^) dry weight. 3.5. Analysis of Total Flavonoid -------------------------------- The vegetable extracts obtained for total phenol analysis were also used for total flavonoid analysis using a colorimetric method described by Zhishen*et al.* \[[@B40-molecules-20-01228]\]. Only 1 mL of the extract was kept in a 15 mL Falcon tube containing 4 mL of distilled water, and then 0.3 mL of 5% sodium nitrite was added. After 5 min, 10% of AlCl~3~ was added to the solution. At 6 min, 2 mL of 1 M NaOH was added, and the sample was brought to final volume 10 mL using distilled water. The solution was mixed carefully, and the absorbance was measured at 510 nm using an EON^TM^ microplate spectrophotometer (BioTek^®^ Instruments Inc., Highland Park, Winooski, VT, USA). Catechin hydrates at different concentrations (5, 10, 25, 50, 75, and 100 ppm) were used as the standard compound. Total flavonoid was expressed as milligrams of catechin hydrate equivalent per 100 g (mg·CE 100 g^−1^) of dry weight. 3.6. Analysis of Glucosinolates ------------------------------- Sample preparation and glucosinolate analysis were performed according to methods described by Lee*et al.* \[[@B41-molecules-20-01228]\]. Briefly, freeze-dried powder samples (0.1 g) were extracted with 2 mL of boiling methanol (70%) for 20 min and centrifuged at 12,000 rpm for 10 min at 4 °C, after which the pellet was re-extracted one more time and the supernatants were combined. The crude glucosinolate extract was then loaded onto a Mini Biospin chromatography column (Bio-Rad Laboratories, Hercules, CA, USA) containing 0.5 mL of DEAE-Sephadex A 25, which was preactivated with 0.1 M sodium acetate (pH 4.0), following which desulfation was carried out by the addition of 200 µL of purified aryl sulphatase*.* The column was capped and left for 24 h at room temperature, and the desulfoglucosinolates were eluted with 1.5 mL distilled water, filtered through a 0.2-µm syringe filter, injected into H-Class UPLC (Waters) using an Acquity UPLC^®^ BEH-C18 column (1.7 µm, 2.1 × 100 mm; Waters), and measured at 229 nm with a PDA detector. Solvent A (100% distilled water) and solvent B (20% acetonitrile) were used for the elution of compounds at the flow rate of 0.2 mL·min^−1^. The gradient programs were as follows: a linear step from 1% to 99% of solvent B within 6 min, followed by constant conditions for up to 10 min and then a quick dropdown to 1% of solvent B at 12 min and isocratic conditions with 1% of solvent B up to 15 min. Authentic standards of glucosinolates were used for the identification and quantification of the peaks. Total and individual glucosinolates were expressed as micromole per gram (µmol·g^−1^) of dry weight. 3.7. Analysis of Free Sugar --------------------------- Free sugars (glucose, fructose, and sucrose) were analyzed according to Bhandari*et al.* \[[@B42-molecules-20-01228]\] with some modifications. Briefly, powdered *Brassica* samples (1.0 g) were extracted with distilled water by shaking for 20 min in a water bath at 80 °C, centrifuged at 3500 rpm for 5 min, filtered through a 0.45 µm syringe filter, and analysed using an HPLC system (Waters) with a Kromasil^®^ 100-NH2 column (250 × 4.6 mm; Eka Chemicals AB, Seperation Products, Bohus, Sweden) and RI (refractive index) detector (Waters) with acetonitrile/distilled water (75/25, *v*/*v*) for the mobile phase at a flow rate of 1.5 mL·min^−1^. Authentic standards of free sugars at different concentrations were used for the identification and quantification of the peaks. Total as well individual free sugars were expressed as milligram per gram (mg·g^−1^) of dry weight. 3.8. Analysis of Fatty Acid Composition --------------------------------------- Samples for fatty acid composition analyses were prepared and analyzed according to Bhandari*et al.* \[[@B42-molecules-20-01228]\]. Briefly, powdered samples (0.1 g) were mixed with 680 µL of methylation mixture (MeOH: benzene: 2,2-dimethoxypropane: H~2~SO~4~ = 39:20:5:2) and 400 µL of heptane. After vigorous mixing and heating for 2 h at 80 °C in a water bath, samples were cooled at room temperature, and then a heptane layer was collected and injected into a gas chromatograph (GC; Varian 3800, Palo Alto, CA, USA) equipped with a flame ionization detector and a capillary column: CP SIL 88 CB FAME (50 m × 0.25 mm, 0.25 µm, Agilent Technologies, Santa Clara, CA, USA). The temperature was set 210 °C for both the injector and FID (flame ionization detection) detector (Varian 3800, Palo Alto, CA, USA). The injection volume was 1 µL with a split ratio of 1:50 on a constant column flow (1 mL·min^−1^) of helium gas. The oven temperature was initially maintained at 100 °C for 5 min, and FID was increased up to 160 °C at a rate of 5 °C min^−1^, maintained for 5 min, and then increased again at a rate of 4 °C min^−1^ up to 180 °C. All the fatty acids were expressed as relative percentage (%) of dry weight. 3.9. Determination of Antioxidant Activity ------------------------------------------ The antioxidant activity of vegetable extracts taken from different plant parts was determined using the 2,2,-diphenyl-1-picrylhydracyl (DPPH) radical scavenging method described in Koleva*et al.* \[[@B43-molecules-20-01228]\], with modifications. The aliquot obtained for total phenol analysis was also used for the measurement of radical scavenging activity. At first, 400 μM of DPPH solution in 80% MeOH was prepared. Then, 100 μL of DPPH solution was added to 100 μL of different concentrations of extracts (0.5, 1.0, 1.5, 2.5, and 5.0 mg·mL^−1^) and 100 μL of methanol in 96-well plates. After 30 min, the absorbance of the resultant solution was measured using an EON^TM^ microplate spectrophotometer (BioTek^®^ Instruments Inc., Highland Park, Winooski, VT, USA) at 517 nm wavelength against a blank, which was 80% methanol without DPPH. Similarly, the absorbance of samples was measured after mixing 100 μL samples with 100 μL of 80% methanol. Free radical-scavenging activity (%) was calculated using the following equation: where A is the absorbance of \[(Sample + DPPH) − (Sample + Methanol)\], and B is the absorbance of \[(Methanol + DPPH) − (Methanol)\]. The IC~50~ value, which is the concentration required to obtain 50% antioxidant capacity, was calculated and used to compare the antioxidant activity of sample extracts. 3.10. Statistical Analyses -------------------------- For each sample, three independent replicate measurements were used in all statistical analyses. To determine differences among crop types, cultivars, and plant parts, one-way analysis of variance (ANOVA) followed by Duncan's multiple-range test (DMRT) was performed at a significance level of 0.05 using SAS^®^ 9.2 software (SAS Institute Inc., Cary, NC, USA, 2013). 4. Conclusions ============== In conclusion, the results of our study showed that the levels of chemical constituents and antioxidant activity are significantly dependent on crop type, cultivar, and plant part. Most of the compounds as well as the antioxidant activity were higher in plant florets; however, phytonutrients, such as flavonoids in both broccoli and cauliflower and free sugar in broccoli cultivars, revealed statistically higher values in leaves, indicating that leaves are a good source of those phytochemicals. Similarly, the highest levels of vitamin C, total phenol, total flavonoids, free sugar, and antioxidant activity were observed in the cauliflower cultivars, whereas the highest total glucosinolate was present in the broccoli cultivars; however, no specific cultivar had significantly higher quantities of all the phytochemicals. All of these results suggest that phytonutrients in *Brassica* are affected in different ways depending on the nature of the compounds. Furthermore, the major fatty acids were palmitic, linoleic, and linolenic acids with a high compositional ratio of unsaturated fatty acids, thereby signifying the nutritional value of these fatty acids that are responsible for the promotion of human health in a number of different ways. This work was carried out with the support of "Golden Seed Project (Project No. 213003-04-2-SB410)" funded by the Ministry of Agriculture, Food and Rural Affairs, Republic of Korea. *Sample Availability*: Not available. J.H. Kwak designed the experiments, analyzed the data and revised the manuscript. S.R. Bhandari performed whole experiments, analyzed the data and wrote manuscript. The authors declare no conflict of interest.

This invention relates generally to the field of alert systems and, in its preferred embodiments, to alert systems utilizing cellular, personal communication system, or wireless telecommunication technology to deliver an alert to a person. In recent decades, the science of meteorology has advanced rapidly, allowing increasingly accurate detection and prediction of severe and hazardous weather. Specifically, Doppler radar systems and high resolution satellites have been developed which allow early detection of tornadoes and severe thunderstorms and accurate tracking of their paths. The National Weather Service (NWS) and National Oceanographic and Atmospheric Administration (NOAA) now routinely issue warnings in advance of most severe or tornadic storms, alerting individuals and saving lives. However, in order for these warnings, or xe2x80x9calertsxe2x80x9d to be effective, they must be communicated to and received by their intended recipients. Some local governments and municipalities utilize civil defense siren systems to provide warnings to persons within the localized range of the siren systems in case of severe weather, natural disaster, war or other emergency conditions. However, weather-related warnings are more commonly provided through the NOAA Weather Radio system which is a nationwide network of radio stations operating twenty-four (24) hours per day to broadcast continuous weather information directly from the local offices of the National Weather Service. The NOAA Weather Radio system also broadcasts alerts for the Emergency Alert System (EAS), maintained by the Federal Communication Commission, in order to provide emergency warnings for all types of hazards, including, but not limited to, earthquakes, volcano erruptions, severe weather and nuclear war. The NOAA Weather Radio system has more than 450 transmitters, covering broad areas in each of the 50 states, adjacent coastal waters, Puerto Rico, the U.S. Virgin Islands, and the U.S. Pacific Territories. Unfortunately, reception of the Emergency Alert System warnings via the NOAA Weather Radio system generally requires a special radio receiver or scanner capable of picking up its emergency warning signals. Tone-activated alert receivers are commonly used to monitor NOAA Weather Radio broadcasts, to provide warning of severe weather and to provide emergency and civil defense alerts. A tone-activated alert receiver constantly monitors the local NOAA Weather Radio broadcasts for a specific 1050 Hz emergency alert tone. In response to receiving an emergency alert tone, a tone-activated alert receiver produces an audible and/or visual alarm, and activates a radio tuned to the NOAA Weather Radio broadcast. Since each NOAA Weather Radio station transmits its signals to a relatively large geographical area, older tone-activated alert receivers suffer from the disadvantage of falsely responding to alerts when the condition to which the emergency alert pertains is only relevant to other geographical areas in the broadcast area of the particular NOAA Weather Radio station transmitting the alert tone. Newer NOAA Weather Radio receivers, known as xe2x80x9cSAME receiversxe2x80x9d, incorporate a feature known as Specific Area Message Encoding (SAME) to decrease the frequency of false alerts. A SAME receiver recognizes a specific digital location code, in an emergency broadcast signal, which designates a specific locality for which alerts are relevant. Once programmed by a user to respond only to a specific digital location code for the area of the user, a SAME receiver switches into alarm mode only upon receipt of an emergency broadcast signal which includes a SAME digital location code matching the preprogrammed digital code. Accordingly, SAME receivers are generally deployed in a particular, fixed location such as an individual""s home or office. While these SAME receivers are useful in their fixed locations, they are not particularly useful if moved from the location for which they have been programmed. Additionally, like many individuals who cannot program a video cassette recorder (VCR), some individuals may find it difficult or inconvenient to program the SAME receiver. As an alternative to SAME receivers, some persons are proposing that cellular or Personal Communication System (PCS) wireless telephone networks be employed to deliver emergency alerts to individuals having cellular or PCS wireless telephones because cellular and PCS telephone networks typically employ short-range, broadcast transceivers (or transmitters) which have coverage areas, or cells, of a reasonably small size, thereby enabling the delivery of emergency alerts to persons in selected areas served by particular broadcast transmitters. As proposed, delivery of emergency alert messages to selected local areas would be achieved by activating only those cellular or PCS broadcast transceivers providing coverage for the specific geographical area to which the emergency alert is relevant, instead of requiring the transmission, preprogramming, and recognition of a specific digital location code corresponding to the geographical area for which the emergency alert is relevant. However, until recently, wireless telephone networks have not had the capability of transmitting alphanumeric messages that would be required to effectively distribute emergency alert messages. In contrast, conventional paging systems have the capability of supporting alphanumeric messaging, but have coverage areas far to large to provide the level of geographical specificity required to deliver location specific, emergency alert messages. New cellular and PCS telephone networks are currently being deployed, or have been deployed, throughout North America and Europe which are capable of transmitting alphanumeric messages and which have coverage areas providing sufficient geographical specificity to make them ideal vehicles for the delivery of location-specific, emergency alert messages. Using the newer cellular and PCS networks, a network operator can send messages to a cellular or PCS telephone present in any single cell or any group of cells serviced by the transceivers of the network. Accordingly, some persons have recently proposed that these cellular and PCS networks be used to transmit location-specific, emergency alert messages to the cellular or PCS telephone handsets of individual users by dialing the telephone number associated with each handset and, upon answer by the cellular or PCS handset, delivering the emergency alert message to the handset. While cellular or PCS telecommunications systems may be an effective vehicle for conveying location-specific, emergency alert messages, such systems enable delivery of emergency alert messages to only those individuals who can figure out how get such messages via their wireless telephones. Currently, to get such messages, individuals must find their way through a myriad of icons (which many individuals cannot do) and then review all of their messages in order to identify the emergency alert messages from other messages. Further, the delivery of emergency alert messages via cellular or PCS telecommunications systems requires individuals to have their handsets nearby and turned-on (and not depleted of battery power). Unfortunately, individuals often turn-off their handsets, forget to recharge them, or leave their handsets, for instance, in the car while they are at home or work. As a result, a system that relies upon cellular or PCS handset receivers to receive emergency alert messages may fail to notify a large number of individuals of the existence of an emergency condition. Other similar difficulties are inherent in the delivery of information or messages that relate to military or other operations (i.e., a different type of xe2x80x9calertxe2x80x9d). For instance, if a branch of the military needs to inform its reservists to report for duty on Sunday instead of Saturday as the reservists were originally notified, it typically contacts each reservist individually by telephone to provide the reservist with such information, thereby requiring a substantial use of labor to perform such a task. Therefore, there is a need in the industry for an apparatus and method whereby individuals may reliably receive cellular or PCS transmissions of location-specific alert information without requiring the use of a cellular or PCS telephone handset. Furthermore, there is a need for an apparatus and method whereby individuals may reliably receive cellular or PCS transmissions of location-specific alert information without requiring individuals to perform complex retrieval steps or inconvenient receiver programming steps. Briefly described, the present invention comprises an alert apparatus and method for receiving a location-specific alert (i.e., an alert directed and relevant to a particular geographical area) and for informing a user, who may be visually or hearing impaired, of the existence and severity of the alert. More particularly, the present invention includes an alert apparatus and method which allow a user to receive data corresponding to an alert which has been broadcast via particular transmitters operating within a cellular, PCS, or wireless telephone communications network, thereby allowing receipt of a location-specific alert (and a textual message associated with the alert) without requiring the user to input, to the alert apparatus, data representative of or identifying the location of the apparatus. Further, the present invention includes an alert apparatus and method which produces high-decibel level audible sounds and high-intensity flashing strobe light corresponding to alerts of the most severe level and which produces low-decibel level audible sounds and low-intensity flashing light from a light-emitting diode corresponding to alerts of a less severe level. In accordance with the preferred embodiment, the apparatus of the present invention comprises an alert device having a microcomputer that directs operation of the alert device according to the instructions of a computer software program stored therein. The alert device also includes a receiver that receives digital PCS transmissions broadcast over a PCS or cellular telecommunication network. The microcomputer has a central processing unit and a monitoring circuit communicatively connected to the central processing unit and receiver. The monitoring circuit is capable of setting the receiver to receive transmissions, if any, on radio channels identified by the central processing unit, of determining the signal strength associated with transmissions received on such radio channels, of identifying the presence of a digital control channel on a radio channel, and of communicating signal strength information, digital control channel information, and broadcast short messages, received by the receiver, to the central processing unit. According to the preferred embodiment of the present invention, the alert device further comprises a plurality of peripheral devices and the microcomputer further comprises a peripheral device controller which connects to the plurality of peripheral devices. The plurality of peripheral devices includes a liquid crystal display, a high-level audio speaker, a low-level audio speaker, a high-intensity strobe light, and a low-intensity light-emitting diode. The microcomputer, via the peripheral device controller, controls the operation of the plurality of peripheral devices according to the severity of a condition identified by an alert. For instance, the microcomputer causes the production of audible sound from the high-level audio speaker-at a high-decibel level and flashing of the high-intensity strobe light to warn a user of the existence of a xe2x80x9cLevel Onexe2x80x9d alert (i.e., the most severe or important alert condition). Similarly, the microcomputer causes the production of audible sound from the low-level audio speaker at a low-decibel level and flashing of the low-intensity light-emitting diode to warn a user of the existence of a xe2x80x9cLevel Twoxe2x80x9d alert (i.e., a less severe or less important alert condition). The microprocessor, via the peripheral device controller, also causes the display, on the liquid crystal display, of textual information received as part of an alert message. The alert device, in accordance with the preferred embodiment, is operable to continuously monitor broadcasts from a cellular, PCS, or wireless telecommunications network. Accordingly, the alert device connects to an electrical outlet to receive electrical power for normal operation, but includes a battery backup and charging circuit to ensure operation of the alert device even in the event of a power failure. Furthermore, in the preferred embodiment, the alert device operates continuously when supplied with electrical power, has no on/off switch, and thus cannot easily be deactivated by a user unlike a cellular or PCS telephone handset. The alert device does, however, include a reset pushbutton that enables a user to temporarily deactivate, or stop, the audible and visual alarms once notified of an alert condition. In the preferred embodiment, the alert device is mountable to an electrical wall socket in a manner substantially similar to that of a conventional smoke detector. In an alternate embodiment, the alert device has an enclosure that enables the device to reside atop a table or other surface in a manner substantially similar to that of a weather radio. In an alternate preferred embodiment, the alert device includes a plurality of peripheral devices that are locatable at sites remote from the alert device. In accordance with a method of the preferred embodiment of the present invention, the alert device operates according to the instructions of a computer software program residing in the microcomputer and performs a self-test when powered-up to determine whether the alert device is functioning properly. The alert device, through cooperation between the microcomputer, monitoring circuit, and receiver, then scans a factory-set, pre-identified set of radio channels comprising a range of channels used by compatible cellular or PCS telecommunication networks in order to identify the channel associated with the cellular or PCS transmitter which transmits on a digital control channel and which has the strongest signal strength at the location of the alert device. The alert device then locks onto and passively monitors the selected channel for digital alerts in the form of broadcast short messages. Because the alert device passively monitors PCS network broadcasts, use of the alert device should not result in the user incurring periodic service charges from the network provider. According to the method of the present invention, the alert device, upon detecting and receiving a broadcast short message, identifies whether the broadcast short message comprises an alert message. If so, the alert device then analyzes the alert message and determines the severity level of the alert identified by the alert message. If the alert is a xe2x80x9cLevel Onexe2x80x9d alert, the alert device operates, as described above, the high-level audio speaker to produce a highly obtrusive, high-decibel level sound substantially similar to that of a conventional smoke detector (i.e., a sound that would cause even the hardest of sleepers to awaken) and the high-intensity strobe light to produce flashing, high-intensity, bright light. If the alert is a xe2x80x9cLevel Twoxe2x80x9d alert, the alert device operates, as described above, the low-level audio speaker to produce a less-obtrusive, low-decibel level, xe2x80x9cchirpingxe2x80x9d sound and the low-intensity light-emitting diode to produce less-intense, less-bright, flashing light. Regardless of the severity level of the alert, the alert device extracts textual message information, if any, from the alert message and displays the textual message information on the liquid crystal display to provide a user with a more detailed explanation as to the nature of the alert. Once the user is informed as to the existence and nature of the alert, the production of audible sounds and the generation of flashing light is terminable by the user through depression of the reset pushbutton protruding partially from the alert device. In accordance with an alternate preferred embodiment of the present invention, the alert device is operable with an alert messaging system of a service provider which provides different levels of service (i.e., service levels or modes) to a user of the alert device in exchange for a subscription fee paid to the service provider by the user. The plurality of service levels or modes enable different classifications of alert messages to be related to and associated with the subscription status of a user (i.e., the service level selected by, subscribed to, and paid for by a user). Based upon the service level selected by the user and stored in a service level data element of the user""s alert device, the user""s alert device will provide that level of service to the user. For example and not limitation, a user may select a service level from any of the following levels: fully enabled; partially enabled; or, fully disabled. The user pays a subscription fee to the service provider in an amount determined by the selected service level, and the service provider causes a service level data element stored at the user""s alert device to be set to a value indicating the service level or mode selected by the user. Once set, the user""s alert device operates at the selected service level. In the fully enabled mode, the alert device reacts to all alert messages and provides the user with any received information pertaining to the corresponding alert. In the partially enabled mode, the alert device only reacts to the most severe alerts (i.e., xe2x80x9cLevel Onexe2x80x9d alerts) to provide subscribers with a minimal level of service and warnings. In the fully disabled mode, the alert device does not react to any alerts. Such operability allows a service provider of alert messages to establish and enforce compliance with a subscription system. According to another alternate preferred embodiment of the present invention, the alert device is operable with an alert messaging system of a service provider which provides a service level that enables the user""s alert device to receive and react to an advertisement that is present in the body of an alert message. In operation, the service provider causes a service level data element stored at the user""s alert device to be set to a value indicating that the user""s alert device is to display received advertisements on the device""s display. Then, whenever the alert device receives a short message having a service level with that value, the alert device extracts an advertisement from the body of the message and displays it on the alert device""s display. Accordingly, it is an object of the present invention to provide an apparatus and method for receiving location-specific alert information without requiring a user to input data representative of the user""s location. Another object of the present invention is to provide an apparatus and method for receiving location-specific alert information that is not limited to a fixed location. Still another object of the present invention is to provide an apparatus for receiving location-specific alert information that can be moved from an old location to a new location without requiring reprogramming or the input of data representative of the new location. Still another object of the present invention is to provide an apparatus for receiving location-specific alert information that self-identifies the strongest source of such alert information. Still another object of the present invention is to provide an apparatus for receiving location-specific alert information that self-identifies the frequency on which the alert information is transmitted or broadcast. Still another object of the present invention is to provide an apparatus and method for receiving location-specific alert information that identifies the different levels of severity associated with alerts. Still another object of the present invention is to provide an apparatus and method for receiving location-specific alert information that produces different sensory outputs corresponding to the different levels of severity or importance of alerts. Still another object of the present invention is to provide an apparatus and method for receiving location-specific alert information which operates continuously, unless moved by a user, at a particular location. Still another object of the present invention is to provide an apparatus and method for receiving location-specific alert information which is continuously operable from an external electrical power source and which has an internal battery backup for use during power failures. Still another object of the present invention is to provide an apparatus and method for receiving location-specific alert information which displays a textual message related to the alert for which the alert information pertains.

Hyperloop transport: Edinburgh to London in less than 30 minutes? A team of Scottish students are one of two British universities in Texas pitching their version of a hyperloop - a method of travel that can reach 700mph. By The Newsroom Wednesday, 27th January 2016, 6:50 pm Updated Thursday, 28th January 2016, 12:32 pm The proposed interior of the windowless pod It sounds like space-age transport straight out of a science fiction movie, but the Hyperloop could become a reality. The futuristic idea was originally the brainchild of SpaceX entrepreneur Elon Musk, who is in the process of building a demonstration track in the Nevada desert. Sign up to our daily newsletter The i newsletter cut through the noise Sign up Thanks for signing up! Sorry, there seem to be some issues. Please try again later. Submitting... Travelling at speeds equivalent to a hypersonic jet, the Hyperloop would have the capability to travel from Edinburgh to London in roughly 30 minutes, making the capital-to-capital commute quicker than a train journey across the central belt. How the hyperloop pod might look on the track Now, an ever-expanding team of around 30 members from the University of Edinburgh have entered a design competition to earn a place in the SpaceX Hyperloop design semi-finals in Texas this week. Their design for the super-speed transportation contains a small capsule that can hold eight people, with the ability to reduce travel between Edinburgh and London to just 30 minutes. Adam Anyszewski, one of the student engineers on the project said: “The Hyperloop capsule would be placed into a long tube, that would stretch a regularly commuted distance - such as Edinburgh to London, or Los Angeles to San Francisco. “All the air is removed from the tube, to eliminate wind resistance. The capsule would then be powered towards London, using electricity, where passengers would arrive in around 35 minutes. The University of Edinburgh team's unique seating design takes inspiration from smartwatches. Picture: Contributed. “These capsules would be launched roughly once a minute.” Using electricity as a power source would make the Hyperloop a clean method of transport, and more green than its two equivalents - plane and train travel. Fellow student, Gabrielis Cerniauskas said that the Hyperloop is one of the most environmentally friendly methods of travel: “The capsule is able to travel at tens of miles without needing a boost, so it wouldn’t have to be continually powered. How the hyperloop pod might look on the track “The idea would be that you could place solar panels along the outside of the tube so not only would it be self reliant on energy, but you could even sell off excess electricity back to the power grid. “Once you’ve built it, the emissions from the loop would be zero. Literally no emissions. So it’s very environmentally friendly” The project is still in the development stage, but after testing was completed, the hyperloop would potentially be ready for the first passenger by 2020. The University of Edinburgh team's unique seating design takes inspiration from smartwatches. Picture: Contributed. The innovative engineers will present their own concept - created in collaboration with students from Edinburgh’s College of Art - to a panel at the American competition, who will judge the team on the project’s engineering and design merits. When dealing with such phenomenal speeds, safety and comfort will be a significant factor for designers to consider. The logistics of stopping the Hyperloop as it hits speeds of 700mph remains a challenge. The student team put a great deal thought into the interior design and calculated how much space passengers would need to feel comfortable so as reducing the risk of claustrophobia. Their interior also borrowed concepts found in the links smart watches. Peter Vaculciak, another engineer student in the team, praised the product designers on the team. “The designers worked on many things - such as how different classes could have different seating; ways to put in lighting so it looks like there is more room; even down to the colour scheme - it can affect how big the pods look inside.” “All of the materials needed to build a Hyperloop are actually available now,” said Vaculciak. “It’s just that the cost is so high, no one wants to invest. And this cuts to one of the fundamental problems limiting Hyperloop progress so far: funding. The ability to build the high speed tubes around heavily populated areas or even underground makes attractive when compared to high speed rail, in which often people must be displaced for ne lines to be built. Yet costs and return on investment remains a key issue. “I think it’s mostly just a lack of investors,” explains Anyszewski, “It’s not like an app, where there’s a quick development process with no overhead costs. “When businessmen look to invest they see projects and they hear, ‘If you give me £1 million now, I’ll give you £4 million in two years.’ This project would be more like ‘If you give me £5 billion now, I’ll give you £6 billion in 20 years.’ The time period on returns may make it seem undesirable.” “No board of director would make a decision on a project that has the potential to outrun their life on the board. They want to see fast results to ensure their position. “The only way it may work, I think, is if a Government-backed third sector company went into it. Because you can’t look at profits during the development stage. “You would have to employ hundreds of people, and generate losses for the first 10 years at least, before you start to see a turn around. However despite the barrier entries the test track being built in Nevada is tangible evidence that progress is being made.

Type of Planet: Ice Giant (gas surface with an interior composed of ices and rock) What is Uranus like? Uranus is the 7th planet from the Sun. It is more than twice as far from the Sun as Saturn. Uranus is an ice giant like its sister planet Neptune. Although it has a gas surface, like the gas giants Jupiter and Saturn, much of the interior of the planet is made up of frozen elements. As a result, Uranus has the coldest atmosphere of all the planets in the Solar System. The surface of Uranus is made up of mostly hydrogen gas with some helium gas as well. The gas atmosphere makes up about 25% of the planet. This atmosphere is stormy, but not nearly as stormy or active as Saturn or Jupiter. As a result, the surface of Uranus is fairly featureless and uniform. Some of the moons of Uranus. Left to Right: Puck, Miranda, Ariel, Umbriel, Titania and Oberon. Source: NASA. Strange Rotation One of Uranus' most unique features is that it rotates on its side. If you picture the Sun and the planets of the solar system on a table, the other planets would rotate or spin like tops. Uranus, on the other hand, would roll like a marble. Most scientists agree that Uranus' odd rotation is because another large planetoid object collided with the planet with enough force to change its tilt. How does Uranus compare to Earth? Uranus is very different from Earth. It's a gas giant, meaning its surface is gas, so you couldn't even stand on it. Being so much further from the Sun, Uranus is much, much colder than Earth. Also, Uranus' odd rotation in relation to the Sun gives it very different seasons. The Sun would shine on parts of Uranus for as long as 42 years and then it would be dark for 42 years. Uranus is much larger than Earth. Source: NASA. How do we know about Uranus? Uranus was first called a planet by British astronomer William Herschel. Herschel discovered Uranus by using a telescope. Prior to Herschel, Uranus was thought to be a star. Since then the only space probe that has been sent to Uranus was the Voyager 2 in 1986. Voyager 2 brought us some detailed pictures of Uranus and its moons and rings. Fun Facts about the Planet Uranus Uranus is the only planet named after a Greek god rather than a Roman god. Uranus was the Greek god of the sky and was married to Mother Earth. It is a bright bluish-green color which it gets from the methane in its atmosphere. It is possible to see Uranus with the naked eye. Uranus has rings like Saturn, but they are thin and dark. It was the first planet discovered in the modern age by using a telescope.

UA Astronomers Discover That Earth's Second Moon Wears Apollo Paint This image of the Apollo 12 lunar module was taken from the command module during the 1969 mission. Part of an Apollo Saturn IV booster rocket may have just become Earth's 2nd "moon." (NASA photo) Astronomers have the first direct evidence that a newly discovered object orbiting Earth is debris from one of the Apollo moon launches over 30 years ago. Carl Hergenrother and Robert Whiteley, astronomers at the Lunar and Planetary Laboratory at the University of Arizona, used the Steward Observatory 61-inch telescope near Mount Bigelow in the Santa Catalina Mountains north of Tucson for observations of J002E3. The mysterious object named J002E3 was discovered in orbit around Earth on Sept. 3 by amateur astronomer Bill Yeung, viewing from a site in southern California. The discovery made news headlines as it could be the only satellite, other than the moon, naturally captured by Earth to enter Earth orbit. After studying the object's past motion, Paul Chodas of the NASA Jet Propulsion Laboratory (JPL) in Pasadena, Calif., concluded that the object had been orbiting the sun until April of this year, when it was captured by Earth. Researchers have believed that J002E3's small size and unusual orbit suggest the object is no asteroid or other natural object, but a piece of man-made "space junk," possibly a piece of one of the Saturn V rockets that launched American astronauts to the moon during the Apollo program. The JPL news release is on the web at http://neo.jpl.nasa.gov Hergenrother and Whiteley measured reflected light from the object Sept. 12 and 13. The photometric measurements showed that the object spins once every 63.5 seconds or once every 127 seconds – more observations are needed to pin down the exact time, Hergenrother said. "Such a rapid rate of rotation is not unheard of either for an asteroid or a piece of man-made space junk, but is very consistent with each," he added. The UA astronomers made their definitive observations with various filters to sample the colors, or spectra, that J002E3 reflects. "Rather than looking like a known asteroid, the colors were consistent with the spectral properties of an object covered with white Titanium oxide (TiO) paint," Hergenrother said. "The Apollo Saturn S-IVB upper stages were painted with TiO paint," he noted. Hergenrother and Whiteley checked their observations with some professional colleagues, " a kind of informal 'peer review' just in case we were way off on things," Hergenrother said. Those key colleagues include Richard Binzel and Andy Rivken of the Massachusetts Institute of Technology. Binzel and Rivken took infrared spectra on the unique object, and those spectra "confirm that J002E3 is a dead ringer for white TiO paint," Hergenrother added. The object is most likely a S-IVB from either Apollo 8, 10, 11, or 12, with Apollo 12 being most likely, the UA researchers conclude. "As Bill Yeung said, this is the first recorded observation of any object being captured into a geocentric orbit," Hergenrother said. "There is also a fairly good chance that J002E3 might crash into the moon at some point. Scientifically, that isn't too important, but it is interesting, " he said.

Q: How to insert proper punctuation in string I have removed all the punctuation from a string sentence to manipulate the order of words. Then I am to insert the punctuation back to the original position. What do I do? Do I find the position index of the original punctuation and add it back in manipulated string? For example: Original: "Hello. My name is John Smith." Manipulated: "elloh my amen is ohnj ithms" Goal: "elloh. my amen is ohnj ithms." A: A solution to this would be to use the insert method. However, this method only works for lists, so you would have to convert the strings to lists. original = 'Hello. My name is John Smith.' manipulated = "elloh my amen is ohnj ithms" manipulated = list(manipulated) for i in range(len(original)): if original[i] in [".","!","?",":",";"]: # add more if needed manipulated.insert(i,original[i]) print("".join(manipulated)) This program will give your desired output of "elloh. my amen is ohnj ithms."

Summary Sponsored by the Navy and civilian science agencies, the SCICEX (Scientific Ice Exercise) missions conducted between 1993 and 1999 used nuclear attack submarines as platforms for gathering scientific data. The importance of these data were magnified by the fact that he Arctic Ocean has been the subject of less scientific study than any of Earth’s other oceans, even though it contains vital economic resources and is a critical factor in and potential harbinger of global climate change. The SCICEX cruises confirmed the unique capabilities of nuclear submarines as platforms for scientific research. Their ability to move quickly and easily beneath the ice caps in any weather and any season enables an extraordinary range of data-collection activities. Moreover, the U.S. Navy’s long, successful history of conducting Arctic research from nuclear submarines has shown the feasibility of these submarines as scientific research platforms. However, the last SCICEX mission ended in November 2000, and the SSN 637class submarines are now retiring from the Navy’s active fleet. To preserve the possibility of using this unique research platform, it has been proposed that one of these vessels be converted into a dedicated science submarine, conducting unclassified scientific research throughout the world’s oceans. To inform its deliberations on this proposal, the National Science Foundation (NSF) asked RAND to assess the costs and benefits of a dedicated science submarine. This study addresses two core questions: • What are the research benefits of using a converted SSN 637-class nuclear attack submarine solely for civilian scientific research? • What are the costs of operating, maintaining, and manning such a submarine? Research Approach To address these questions, the RAND study team assesses the benefits and costs of a science submarine. As a concrete example, we consider the conversion of SSN 686, the L. Mendel Rivers, the last, recently retired SSN 637 hull, into a scientific platform. We envision the Rivers operating for seven years, conducting a variety of scientific observations on three, 40-day cruises each - ix - year. Each cruise would follow a course determined by scientific requirements and carry 15 scientific researchers on board. We estimate the benefits of such a science submarine with qualitative assessments of its potential contributions to high-priority national research goals as identified by the scientific community. These goals fall in the topic areas of Geologic and Geophysical Exploration in the Arctic Basin, Arctic Climate Change, the Dynamics of Bering Sea Ecosystems, and general Oceanographic Studies in the Ice-Free Oceans. We focus on the unique contributions of a science submarine, that is, the benefits gained by adding a submarine to the existing portfolio of research platforms for the Arctic. These platforms include surface ships, icebreakers, satellites, autonomous underwater vehicles (AUVs), ice camps, airplanes, remote buoys, and instrumentation for acoustic propagation measurements. We first identify the unique measurements that could be provided by a submarine. We then place these measurements in a framework that relates measurements to the high-priority research goals they address. We choose this approach as a means to address the notoriously hard problem of estimating the benefits from scientific research. This approach to benefits assessment is consistent with NSF’s common assessment of large research facilities, but addresses the exceptionally interdisciplinary quality of submarine data. We then estimate the costs to convert, maintain, and operate a dedicated science submarine by starting with extensive Navy data on the comparable costs of a military submarine. We then develop a variety of cost scenarios, making different assumptions about how these costs might be reduced for scientific operations. Scientific Benefits We find that the most important contribution of a dedicated science submarine would be its ability to collect survey data in ice-covered seas. With its ability to navigate freely during all seasons and in all weather, a submarine is unmatched in its capability to collect large amounts of bathymetric or hydrographic data over the Arctic Basin, especially in the winter. A submarine also has unique capabilities to collect controlled seismic refraction and reflection surveys. Such data directly support the geological and geophysical exploration of the Arctic Ocean Basin. A dedicated science submarine could also make unique contributions to understanding climate change in the Arctic and its relationship to global climate change. For climate change research, the most important feature of the -x- submarine is the capability to collect data over broad areas of the Arctic Basin at all times of year. Of particular importance are hydrographic measurements in the upper ocean (temperature/salinity profiles), detailed mapping of ice draft and structure, and high-resolution bathymetric surveys. The science submarine could also uniquely contribute to understanding Bering Sea ecosystems. The submarine has a unique capability to make hydrographic and ice draft measurements under the ice in those regions of the Bering Sea where the water is sufficiently deep for safe operations and can also make unique contributions by monitoring biological features, such as water sampling from specific oceanographic features and mapping fish and zooplankton populations using the submarine’s sonar systems, in ice-covered seas. In the ice-free oceans, the submarine has fewer unique capabilities relative to surface ships, satellites, and drifting buoys. Without the limitations of an ice cover, ships have greater navigational capabilities, satellites can image a range of ocean properties over vast areas, and buoys can drift great distances. Under these circumstances, the submarine’s primary strength centers on data gathering in remote regions, rough seas, and bad weather. Our analysis focuses on the benefits of a dedicated science submarine in relation to the proven, current capabilities of other research platforms. We note, however, that autonomous underwater vehicles (AUV) technology is improving rapidly and could possibly equal or surpass many of the submarine’s unique measurement capabilities over the course of roughly a decade. Costs The total cost of operating and maintaining the L. Mendel Rivers as a dedicated science submarine could range from roughly $200 million to $300 million over an expected seven years of operation. Approximately $95 million to $125 million would be required for depot overhaul and science conversion, $20 million to $38 million for depot maintenance, $37 million to $55 million for operations including the cost of a Navy crew and consumables, and approximately $60 million for science support. The wide variation of potential costs is largely due to varying assumptions about whether the submarine could be overhauled and maintained at public or private shipyards, the allocation of overhead, and cost sharing between NSF and the Navy. These issues would likely be resolved and the cost made clearer if and when the government begins serious planning for a dedicated science submarine. The average annual cost of the submarine would range from $30 million to $40 million per year. By - xi - comparison, current NSF funding for Arctic research, logistics, and facilities support totaled approximately $70 million in fiscal year (FY) 2000. The cost of the submarine is unevenly distributed over time. The initial overhaul and science conversion of the existing vessel constitutes more than a third of the total lifetime costs of the science submarine. Thus in any scenario, the majority of spending would occur in the first years of the program, and hence there is little flexibility to reduce costs by focusing the dedicated science submarine on a few high-priority missions. Assessment A dedicated science submarine could make unique and important contributions to the priority research areas of Geologic and Geophysical Exploration of the Arctic Basin and Arctic Climate Change. It could make unique, important, though relatively lesser contributions to the priority research areas of the Bering Sea Ecosystem and General Oceanographic Studies in the Ice-Free Oceans. Maintaining and operating a science submarine could cost $200 million to $300 million over seven years of operations. Many uncertainties remain over the extent of these benefits and costs. For instance, the submarine could have nonscientific benefits not considered in this study; or technological advances could produce autonomous underwater vehicles that in a decade or more could obtain some of the measurements currently available only from a dedicated science submarine. Nonetheless, this report lays a foundation for decisionmaking on the deployment of such a research platform. Specifically we identify the priority research areas that would benefit most from the unique capabilities of a dedicated science submarine. Policymakers can assess the importance of these benefits in light of the costs we have identified. - xii -

Introduction {#Sec1} ============ Cone beam computed tomography (CBCT) {#Sec2} ------------------------------------ CBCT is a radiographic investigation that creates a three-dimensional image of the exposure site. Developed in the early 1990s, it is increasingly being used in dentistry for various indications. The European Commission has formed the SEDENTEXCT guidelines for radiation protection in CBCT for dental radiology (2012) and a number of other dental specialties have developed specific guidelines ([@CR12]; Isaacson et al. [@CR8]). There are several justifications and clinical indications for the use of CBCT in paediatric dentistry, indicated by *SEDENTEXCT*, which include assessment of the localised developing dentition, assessment of the generalised developing dentition, dental trauma, surgical assessment and endodontic application. Hidalgo-Rivas et al. ([@CR7]) found that the most common indication for CBCT examinations in children and young people in United Kingdom (UK) dental hospitals was the localisation of impacted teeth and the detection of root resorption; similarly Van Acker et al. ([@CR15]\]) found that 36% of the CBCT examinations in their study were prescribed to assess the localized developing dentition. The majority of these examinations were undertaken for orthodontic purpose. Furthermore, Marcu et al. ([@CR10]) found the most common justification for CBCT imaging in paediatric patients was for the evaluation of dental anomalies which included monitoring for tooth eruption, treatment planning and orthodontics. Although CBCT has advantages compared to two-dimensional imaging, the International Commission on Radiological Protection (ICRP) states that the use of CBCT in paediatric patients is of particular concern due to their higher radio sensitivity and smaller size. It generates a higher effective dose in paediatric tissues compared to plain films and has increased stochastic biological effects compared to adults (Aps [@CR2]). It is therefore imperative that as paediatric dentists, a CBCT investigation is clearly justified with careful consideration of how it could impact the patients' treatment, following the principles of IRMER (The Ionising Radiation (Medical Exposure) Regulations (IRMER) No 1322, [@CR14]). Clinical indications in paediatric dentistry {#Sec3} -------------------------------------------- Whilst there are European guidelines (SEDENTEXCT) and cumulative literature focused on CBCT use in paediatric patients, there is limited literature as to when and why paediatric dentists require CBCT images. Giray et al. ([@CR6]) conducted a cross-sectional questionnaire concluding that about a third of the paediatric dentists who responded had no knowledge of CBCT. Those who did use CBCT imaging, cited their most common reason for use was for pathology of the jaw; whereas Mizban et al. ([@CR11]) found the most common reason for a paediatric dentistry consultant to request a CBCT was for unerupted teeth. There are no other studies to our knowledge that investigate the trends of paediatric dentists using CBCT. The aim of this cross-regional service evaluation was to assess the current practice of CBCT imaging within paediatric dental departments in Northern England. Objectives include:Identify the trends of CBCT investigations over four years.Compare clinical indications for CBCT requested by paediatric consultants.Compare the diagnostic findings from the CBCT examinations.Audit compliance of CBCT justifications to the standards set by SEDENTEXCT.Assess whether the use of CBCT affected the treatment plan for each individual patient. Methods {#Sec4} ======= The project was registered with the relevant clinical effectiveness units and approval was granted. Patient records were anonymised during data collection and patient confidentiality ensured. A pilot study was conducted which evaluated 3 years of CBCT referral data at hospital site one (H1), and the results demonstrated that CBCTs were increasingly being requested (Gallichan and Albadri [@CR5]). A service evaluation was then conducted by a cross-regional network of paediatric dental departments in Northern England. In the retrospective analysis of CBCT examinations taken over a four-year period between January 2015 and January 2019, children aged 16 or under were included and the CBCT examinations must have been requested by paediatric dental specialists and not by any other specialty. The age of patient at the time of exposure, clinical indication, region of interest (ROI) and diagnostic findings were identified using digital radiographic programme, Carestream PACS software. Clinical notes were also used to identify whether the CBCT had an effect on the patient treatment plan and any documented description of how it affected the treatment plan was noted and analysed. The clinical indication for each exam was recorded and grouped using the standards set by SEDENTEXCT ([@CR13]): localised developing dentition, generalised developing dentition, dental trauma, endodontics and surgical assessment. ROI was classified in sextants if more than one ROI was requested. Age of the patient was also grouped into one of the three categories, ≤ 6 years, 7--12 years, and 13--16 years. Diagnostic findings were defined as being related to abnormal tooth development, pathology, trauma related, and others including ectopic and failure to erupt. Statistical analysis using IBM SPSS 25 was performed to compare mean age. Results {#Sec5} ======= Demographic data {#Sec6} ---------------- A total of 335 CBCT examinations were requested by paediatric dentists over a four-year period. This represented 3.7% of all CBCTs taken in the dental hospitals and 27% of the total number of CBCTs requested for children aged 16 or under across the three units. The average age of children was 11 years (SD 2.7 years) with a distribution age range between 4 and 16 years (Fig. [1](#Fig1){ref-type="fig"}). There was no significant difference between the mean age in the three hospitals, which were 11.1 ± 2.8 years (H1), 11.1 ± 2.9 years (H2), and 10.8 ± 2.5 (H3). Paediatric dentists in H2 requested the highest number of CBCTs (164), followed by H1 (129) and H3 (*n* = 42). Tables [1](#Tab1){ref-type="table"} and [2](#Tab2){ref-type="table"} illustrate the distribution of age groups. Age groups were categorised by the average for dentition type; primary dentition (3--6 years), mixed dentition (7--12 years) and permanent dentition (13--16 years). The majority of patients (204, 61%) were in the mixed dentition age group.Fig. 1Distribution of age at the time of CBCT exposure, comparison of three dental hospitalsTable 1Indications for CBCT defined by age categoryIndicationAge groupTotal(%)3--6 years7--12 years13--16 yearsLocalised developing dentition61074215546Generalised developing dentition1102134Dental trauma323194513Surgical assessment442196519Endodontics022355717Total1420411733599Table 2The regions of interest of the 335 CBCT and age group correlation Region of interest was grouped into sextant, defined as: (1) upper anterior, (2) upper right posterior, (3) upper left posterior, (4) lower anterior, (5) lower right posterior, (6) lower left posterior, (7) more than one sextantRegion of interestAge groupTotal3--6 years7--12 years13--16 years17149732292235103188174199195052761671472241339Total14204117335 The number of CBCT examinations increased each year from 45 in 2015 to 117 in 2018 with a generalised increase each year (Fig. [2](#Fig2){ref-type="fig"}). The most significant increase was between 2015 and 2016 when there was an 80% increase from 45 to 81 CBCTs taken across the three dental hospitals.Fig. 2Trends over 4 years for CBCT clinical indications in paediatric patients Clinical indications {#Sec7} -------------------- The clinical indications for CBCT investigations were grouped according to the original request into one of the justifications set by SEDENTEXCT ([@CR13]). The most common clinical indication for CBCT was consistent, to assess localised developing dentition (155, 46%), Fig. [2](#Fig2){ref-type="fig"}. Seventy percent of these CBCTs were taken in the mixed dentition age group (Table [1](#Tab1){ref-type="table"}). The least common clinical indication was to assess the generalised developing dentition; however, it was a prevalent indication across each of the four years and each hospital. Region of interest {#Sec8} ------------------ The majority of the investigations were in the maxilla (256, 76%) with a total of 68% (229) taken in the upper labial sextant. This was the most commonly requested sextant in children aged 7--12 years (73% of ROI) and 13--16 years (62% ROI); in children aged 4--6 years, this sextant represented 50% ROI, as shown in Table [2](#Tab2){ref-type="table"}. More than one sextant was examined in 39 (11%) of the investigations. Within the mandible, 19 CBCTs examined the anterior sextant, 7 posterior right and 14 posterior left, respectively. Diagnostic findings {#Sec9} ------------------- Diagnostic findings within each CBCT report were categorised into four groups. The most prevalent was an ectopic tooth or supernumery teeth (99, 30%), followed by teeth with abnormal formation or development (86, 26%), and teeth with pathology-associated (84, 25%) and trauma-associated diagnosis (66, 20%). Percentages have been rounded to the nearest whole number. The ratio of each diagnosis at each dental hospital was very similar (Fig. [3](#Fig3){ref-type="fig"}).Fig. 3Diagnostic findings from CBCT investigations across three dental hospitals Compliance with standards and effect on treatment planning {#Sec10} ---------------------------------------------------------- All CBCT examination requests were deemed to be justifiable according to SEDENTEXCT and therefore complied with the standards. Investigation had a clear documented effect on the treatment planning in 327 cases (97%). There were eight CBCTs where the record-keeping failed to note the CBCT report prior to treatment being implemented, however, from review it was clear that the images had a positive impact on the assisting patient management and treatment. Descriptions of how CBCT affected the treatment was analysed; the overriding reason was the use of CBCT to aid surgical planning, which was evident across all diagnosis. It was particularly relevant when assessing supplemental teeth, cysts and ectopic teeth. Paediatric dentists found that the CBCT confirmed their diagnosis and analysis of proximity to adjacent local structures, and therefore aided their surgical approach. Analysis also identified how treatment plans were changed because of the use of CBCT. This was most applicable in trauma related cases where the CBCT identified additional findings which had not been clear in 2D images such as resorption, additional fractures, and in some cases, the CBCT rejected those findings which were questioned in 2D images. Finally, CBCTs aided the planning of multidisciplinary cases. Discussion {#Sec11} ========== Trends over 4 years {#Sec12} ------------------- There are limited publications studying how paediatric dentists use CBCT. This study included CBCTs which were requested by a named consultant in paediatric dentistry only. It is noted that all three dental hospitals involved in this study are based in the North of England and therefore results may not be generalizable. However, these three dental hospitals have a mixed demographic of patients and a mix of academic and hospital staff, and therefore, they are likely to provide a reasonable sample of the UK dental hospitals. A recent service evaluation at a London-based dental hospital also only included CBCTs requested by paediatric dental specialists and found that the mean age of subjects was 11.5 years and the most common clinical indication for the CBCT examinations was the assessment of unerupted teeth (Mizban et al. [@CR11]). This supports the findings of the present study and echoes the authors' comment when comparing another UK-based service evaluation (Hidalgo-Rivas et al. [@CR7]) which assessed CBCT in paediatric patients. They found the mean age to be 13.1 years; however, the study was not specific to paediatric dentistry and therefore, the mean age could be higher due to an older cohort of patients requiring CBCT associated with orthodontics. Furthermore, both previous studies included patients aged 17 compared to this study which excluded 17-year-old patients because referrals to the paediatric department are only accepted up to 16 years. This could have affected the mean age in the present study. One dental hospital in the study had significantly less CBCT investigations requested by paediatric dentists, a total of 42 CBCT examinations. This was due to a staffing shortage of radiologists. Radiology departments are facing increased pressure which can cause long waiting times for patients to have a CBCT examination. Although there is a clear increasing trend of CBCT use in paediatric dentistry, the ratio of CBCT investigations requested by paediatric dentists is limited compared to other specialties. Only 27% of all CBCTs taken in patients aged 16 and under were requested by paediatric dentists, indicating that the majority of paediatric patients' CBCTs are taken for orthodontic purposes. In all three units, CBCT requests are vetted by a Dental and Maxillofacial Radiologist to ensure they are justifiable. There are increased radiation risks associated with CBCT in children compared to adults, and the comparison to other specialties and adults highlights how paediatric dentists have remained conservative and vigilant when ordering CBCTs. Clinical indications and ROI {#Sec13} ---------------------------- The most common indication for requesting a CBCT was to investigate the local developing dentition and when examined within age group categories, this remained consistent in all age groups 4--6, 7--12 and 13--16 years (50%, 73%, 62%) and was succinct with the findings from other studies (Barba et al. [@CR3]; Mizban et al. [@CR11]). The divison of clinical indications was further divided into different groups for these studies whereby in the present study assessment of the localised developing dentiton group included teeth with root resoption unrelated to dental trauma, bony pathology, supernumeries and unerupted teeth. SEDENTEXCT ([@CR13]) list three main justifications for CBCT: developing dentition, restoring the dentition and surgical applications. This study divided developing dention into two subgroups: generalised and localised as well as dividing restoring the dentiton into two subgroups: dental trauma and endodontic uses. The authors recognise that more data could be sought by dividing clinical indications into further localised justifiable subcategories. A study by Barba et al. ([@CR3]) found that within a population sample in San Jose, Costa Rica 100% (*n* = 16) patients \< 12 years had a CBCT of the anterior maxilla; however, the most scanned region of interest in adolescents (*n* = 20) was equal in the anterior maxilla, posterior maxilla and posterior mandibular. However, this was a much smaller cohort of paediatric patients compared to both the present study and the study by Hidalgo-Rivas et al. ([@CR7]) which found that the most common ROI in paediatric patients is the maxillary canine and incisor region. This study includes the largest cohort of paediatric patients (\< 16 years) referred for CBCT examinations to the best of the authors knowledge. It is also novel in investigating the trends of CBCT investigations taken over a 4-year period, across three UK dental hospitals; providing insight into the use of CBCT in paediatric dentistry. Diagnostic findings {#Sec14} ------------------- This study supports the findings from a (single unit) similar service evaluation by Mizban et al. ([@CR11]) who found that CBCT can significantly change the diagnoses and opinions in teeth with dental trauma and pathology associated with developmental anomalies. The impact that CBCT has on treatment planning also supports a statement by IATD ([@CR4]) on CBCT: it provides improved visualisation of traumatic dental injuries, particularly root fractures and lateral luxation injuries, monitoring of healing, and complications. In relation to management of cases including root resorption, it was found that CBCT has a positive impact on effecting management, supported by the European Society of Endodontology (Patel et al. [@CR12]). Compliance to standards and effect on treatment planning {#Sec15} -------------------------------------------------------- There is a pattern of similarity in the use of CBCT examinations in paediatric dental patients. All dental hospitals displayed a variety of indications for CBCT and the quantity taken is increasing to assist treatment planning but more often to enable improved surgical planning. All CBCTs taken in 2018 across all dental hospitals had a documented effect on treatment planning, and this could be a result of the disseminated results of previous audit that led to quality improvement. Furthermore, all CBCT requests in the dental hospitals involved are monitored and the prescriptions are assessed by a radiologist. This ensures the units adhere to IRMER (The Ionising Radiation (Medical Exposure) Regulations (IRMER) No 1322, [@CR14]), keeping exposures as low as reasonably possible (ALARP). Clinical records were analysed retrospectively, however, it was difficult to assess what the original treatment plan or opinion was prior to the CBCT. The records usually raised a question or highlighted two options and the CBCT helped in the decision making. Alqerban et al. ([@CR1]) found that the orthodontist had a higher confidence level in the treatment planning of impacted canines when the CBCT was available compared to 2D images. Thematic analysis of the CBCT records identified themes, the most significant theme was to aid surgical planning and to confirm diagnosis. This could suggest that CBCT also increases confidence levels in paediatric dentists in decision making. This study is based in a dental hospital where access to CBCT can be readily available. However, paediatric dental specialists' also practice in community dental services and private practices. Further research is necessary to understand the use of CBCT by paediatric dentists in all settings and its effect on their treatment planning. A questionnaire conducted by the members of EAPD and TSPD (Turkish Society of Paediatric Dentistry) reported that 36% of the paediatric dentists had no knowledge of CBCT, and the majority of dentists cited the reason for using CBCT to be for the pathology of the jaws (Giray et al. [@CR6]). Conclusion {#Sec16} ========== This study is unique in identifying key trends across several UK dental hospitals. CBCT are increasingly utilised in UK paediatric dental departments, most commonly to assess localised developing dentition. Despite the increase, requests for CBCTs in paediatric dental departments only represent a small percentage of CBCTs in paediatric patients (27%) and in all patients (3.7%). Following the EAPD symposium, May 2019, new guidelines are being created and the results of this project can support these guidelines. **Publisher\'s Note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Thanks to Mr P Nixon, consultant DMFR and Mr L Feinberg, StR DMFR at Liverpool University Dental Hospital. Radiology Departments of University Dental Hospital of Manchester and Newcastle Dental Hospital. Ethical approval was not required, as each dental hospital involved registered it as a service evaluation with the appropriate hospital NHS trust and gained approval.

An ink-jet printer includes a pen in which small droplets of ink are formed and ejected from the printer pen toward a printing medium. Such pens include printheads with orifice plates with several very small nozzles through which the ink droplets are ejected. Adjacent to the nozzles are ink chambers, where ink is stored prior to ejection through the nozzle. Ink is delivered to the ink chambers through ink channels in fluid communication with an ink supply. The ink supply may be, for example, contained in a reservoir part of the pen. For color printing, multiple colors are made available to the printer. For each color of ink there is a separate ink reservoir and ink delivery system coupled to a separate group of ink chambers and nozzles. In order to achieve high quality, high-resolution printing, these groups of nozzles are placed relatively close together on the printhead. Control of ink flow is required to prevent excess ink from being delivered to the printhead. Excess ink delivery leads to leakage, or drooling from the nozzles. Ink-jet printer systems are affected by changes in ambient conditions, such as temperature and pressure. When the ambient temperature increases or ambient pressure decreases, air diffused throughout the ink and air bubbles present within the ink reservoir expand to cause displacement of ink. Unless this expansion is managed, the displaced ink is forced out the printhead nozzles resulting in undesired drool. When an inkjet pen drools, one color of ink may migrate across the surface of the printhead to another color group. When ambient temperature or pressure changes, the migrated ink may be sucked back into the nozzles of another color ink. The mixing of these two ink colors causes contamination, producing poor quality printing. Open cell foam is often used to store ink within a reservoir of an ink jet pen. In conventional foam ink storage systems, the top of the reservoir may be vented to ambient to allow equalization of pressure within the ink container to the outside air pressure. However, substantially all of the exterior surfaces of conventional foam ink storage members are in contact with the walls of the pen reservoir. Such contact between ink saturated foam and the reservoir walls creates a seal through which air is unable to pass for venting to atmosphere. When changes in ambient conditions occur to expand air in the reservoir, the expanded trapped air displaces ink and causes drool through the nozzles. To control leakage, extra felting of the foam member has been employed. Felting is a measure of the extent to which foam is compressed. Compressing the foam decreases the pore dimensions. By increasing the felting of the foam (i.e., the amount of compression of the foam), pore size decreases and capillary force increases. A greater capillary force increases back pressure within the reservoir. An increase in back pressure within the reservoir helps to prevent drool. However, extra felting of the foam does not aid removal of air trapped within the foam. Extra felting also reduces the foam's ink storage capacity. Moreover, extra felting makes manufacturing difficult, as the foam is difficult to insert in the necessarily small reservoir. Grooved reservoir walls have been used to prevent ink drool. The grooves create a series of interconnected channels between the foam member and the reservoir walls. Expanding air from the foam's interior diffuses into these channels and is vented out of the reservoir. However, the grooved reservoir walls can be difficult to manufacture. Additionally, grooved reservoir walls can make the walls more flexible, and the pressure exerted by the compressed foam can deform the flexible reservoir walls so that the ink-jet pen does not fit properly within the printer. The present invention is directed to a system for storing ink in a pen reservoir, while preventing ink leakage due to a change in ambient temperature or pressure. The system comprises porous grooved foam. The porous foam is grooved on the exterior portion to provide paths for air to move to the atmosphere. Thus, air within the interior portion of the foam may expand to the grooves on the exterior portion. An atmospheric vent is in fluid communication with at least one of the grooves, thereby to vent excess air within the reservoir. The grooved foam may be used in any of a variety of ink-jet pen reservoirs and may be implemented with any foam-based pen.

Electronic devices such as tablet computers, slate computers, personal digital assistants, gaming consoles, and smart phones can permit users to provide input thereto using a digital pen, a digitizer pen, a stylus, a stylus pen, or the like, generally referred to herein as an “electronic stylus” or “stylus.” For example, a stylus can be used to control a tablet computer as with a mouse, a joystick, or a keyboard, such as by manipulating icons on the tablet computer's screen, by moving windows on the screen, etc. Besides functioning as a basic selection tool, the stylus can allow writing (text, drawing, etc.) on the tablet computer's screen, such as to jot down notes and illustrations, which can be stored digitally. An electronic stylus can facilitate use of an electronic device, but electronic styluses involve a number of potential hazards. Electronic styluses can be easily misplaced, as with ordinary writing implements such as pencils and ballpoint pens. Replacing misplaced electronic styluses is typically more costly than replacing ordinary writing implements and can result in interrupted use of an electronic device for hours, days, or more while a user obtains a replacement electronic stylus. Another potential hazard with electronic styluses is that they usually must be stored and transported with increased care and safety over non-electronic devices in order to avoid stylus damage, e.g., from being dropped, from being exposed to rain or other moisture, from being cracked or crushed by a heavier object, etc. Many electronic devices do not include storage space for an electronic stylus. The stylus must therefore be otherwise stored and/or transported by a user, which can increase chances of stylus damage and/or increase chances of misplacing the stylus. Even if an electronic device does include storage space for an electronic stylus, the stylus occupies valuable device real estate, thereby preventing other aspects of the device from occupying that space. The electronic device may thus be limited in any one or more of its processing capabilities, battery power, memory size, audio output ability, etc., in order to provide storage space for the electronic stylus. Built-in storage space for an electronic stylus can additionally or alternatively increase an electronic device's size, which can make the electronic device less attractive to a user. Accordingly, there remains a need for an improved electronic stylus.

To let C see functions that will be used, it is enough to declare them. Normally this is done in a header file; in this example we do it directly in the code. If we do not declare them explicitly, they get an implicit declaration (if implicit declaration matches the use, everything's fine; but it is better however to write an explicit declaration) #include <stdio.h>#include <stdlib.h> /* let us declare our functions; indeed here we need really only M declaration, so that F can "see" it and the compiler won't complain with a warning */int F(constint n);int M(constint n); C++ has prior declaration rules similar to those stated above for C, if we would use two functions. Instead here we define M and F as static (class) methods of a class, and specify the bodies inline in the declaration of the class. Inlined methods in the class can still call other methods or access fields in the class, no matter what order they are declared in, without any additional pre-declaration. This is possible because all the possible methods and fields are declared somewhere in the class declaration, which is known the first time the class declaration is parsed. The following version shows better what's going on and why we seemingly didn't need pre-declaration (like C) when "encapsulating" the functions as static (class) methods. This version is equivalent to the above but does not inline the definition of the methods into the definition of the class. Here the method declarations in the class definition serves as the "pre-declaration" for the methods, as in C. In E, nouns (variable names) always refer to preceding definitions, so to have mutual recursion, either one must be forward-declared or we must use a recursive def construct. Either one of these is syntactic sugar for first binding the noun to an E promise (a reference with an undetermined target), then resolving the promise to the value. def M binds M to a promise, and stashes the resolver for that promise where bind can get to it. When def F... is executed, the function F closes over the promise which is the value of M. bind M... uses the resolver to resolve M to the provided definition. The recursive def operates similarly, except that it constructs promises for every variable on the left side ([F, M]), executes the right side ([fn ..., fn ...]) and collects the values, then resolves each promise to its corresponding value. As long as the code of the two functions is inside the same "block" (module or program) we don't need special care. Otherwise, we should "load" at least the interface of the other function (each module will load mutually the other; of course the compiler won't enter in a infinite loop), e.g. by using a "use" (we do that if M and F function are inside different modules) jq supports mutual recursion but requires functions to be defined before they are used. In the present case, this can be accomplished by first defining a function with the desired arity. He we define F and M as arity-0 filters: Objective-C has prior declaration rules similar to those stated above for C, for C-like types. In this example we show the use of a two class method; this works since we need an interface block that is like declaration of functions in C code. We don't need to pre-declare or specify in some other way a function that will be defined later; but both must be declared before their use. (The code is written to handle vectors, as the testing part shows) Since Order is powered by the C preprocessor, definitions follow the same rule as CPP macros: they can appear in any order relative to each other as long as all are defined before the ORDER_PP block that calls them. If you wanted to use a let-like construct to create local bindings, you would do the following. The define construct above is just a syntactic sugar for the following where the entire rest of the scope is used as the body. uBasic/4tH supports mutual recursion. However, the underlying system can't support the stress this puts on the stack - at least not for the full sequence. This version uses memoization to alleviate the stress and speed up execution. Forward declarations are not an issue in Ursala, which allows any definition to depend on any symbol declared within the same scope. However, cyclic dependences are not accepted unless the programmer explicitly accounts for their semantics. If the recurrence can be solved using a fixed point combinator, the compiler can be directed to use one by the #fix directive as shown, in this case with one of a family of functional fixed point combinators from a library. (There are easier ways to define these functions in Ursala than by mutual recursion, but fixed points are useful for other things as well.) Since all "labels" (symbols), if not local, can be seen by the whole code in the same source unit, we don't need special care to let the subroutine func_f call func_m. If the function would have been in another source unit, we should have declared it extern (the linker will resolve the symbol), as done for printf. (It must be linked with the C standard library libc or similar and a startup code; lazyly a gcc mutrec.o works, being mutrec.o produced by e.g. nasm -f elf mutrec.asm)

Q: 承る and 賜る: are they etymologically related? I was studying kanji when I noticed that 承{うけたまわ}る and 賜{たまわ}る share 「たまわる」and they do seem to have related meanings. In fact, it appears to me that 承る　is a compound verb that combines 受ける and 賜る but I'm not sure. Are they related? And if so, why the difference in kanji? A: (Full disclosure: I edited the Wiktionary entry linked earlier in the comments.) Derivation 承{うけたまわ}る and 賜{たまわ}る are indeed related: 承{うけたまわ}る even has a rare alternative spelling as 受{う}け賜{たまわ}る. 賜{たまわ}る has a meaning of "to be granted or gifted something from a social superior", and the additional 受{う}け on the front in 承{うけたまわ}る adds an additional sense of "to receive, to take in". Spelling As others have noted, don't let the spellings confuse you about the derivations. Spellings in Japanese have historically been rather fluid (and, if you've read any manga and noticed the liberal use of furigana, you'll see that they can still be quite flexible). If you are curious about the derivation of a particular word, and that word is kun'yomi, examine it with a focus on the kana -- how the word is spoken. Kanji for kun'yomi terms are an additional layer, providing further nuance, but the kanji are largely irrelevant to the actual derivation of kun'yomi terms.

The legal movement to restore the Constitution’s original public meaning continues to secure legal victories, but not with respect to freedom of speech. Some cases, like Citizens United v. Federal Election Commission, have reinvigorated political-speech protection, but—as I explain in detail in a recent article for National Affairs—the Free Speech Clause’s original meaning does not inform the Supreme Court’s free-speech jurisprudence overall. The Free Speech Clause adopted by the American people protects the ascertainment of truth for the benefit of self-government. The freedom of speech does not include speech lacking in social value—either vile speech, or speech unconnected to matters of public concern (frequently called “private speech”). While drawing these distinctions can be difficult in some cases, they are rooted in what Robert Bork called “neutral principles” about self-government and the role of the courts. In contrast, modern jurisprudence asserts that the Free Speech Clause was meant to create a marketplace of ideas that develops truth by permitting autonomous individuals to express or ignore nearly any speech they want. This may sound attractive to free-speech “absolutists,” at least up to a point. What the “marketplace” and “autonomy” arguments are less up-front about is that the Court determines them both. As the Court rejects the distinction between socially valuable speech protected by the Constitution and speech without social value that may be regulated, the Court is the only body that may draw lines between permitted and prohibited speech. It thus possesses the tools to restrict even public speech—and, occasionally, it does just that. This jurisprudence rests on principles far removed from the Free Speech Clause’s original meaning. It is detrimental to the distinct constitutional protection for socially valuable speech, the public’s understanding of that distinctiveness, and democratic authority to protect self-government from speech that undermines the search for truth. This should compel a refresher on the Clause’s original meaning. Free Speech at the Founding As originally understood, the Free Speech Clause ensured that Americans could debate and make determinations about matters of public life. This endeavor is consonant with the search for truth, and it follows from the Clause’s text. The phrase “freedom of speech” is part of a broader one in the First Amendment: “Congress shall make no law . . . abridging the freedom of speech, or of the press . . .” At the founding, these clauses guaranteed different manifestations of the same freedom: to speak or publish, as the First Continental Congress said in 1774, on “the advancement of truth, science, morality, . . . arts in general, and . . . liberal sentiments on the administration of Government.” Including this freedom within the Bill of Rights makes sense, as the enumerated rights identify those that a tyrant would probably target. A tyrant may not mind speech without social value; indeed, “bread and circuses” can complement tyranny. But speech about the truth of matters connected to the public good cannot be harmonized with tyranny. Protecting the right of free speech does not bear upon the authority of communities to restrict speech unconnected to public life and ascertaining truth. Some sentiments may serve to corrupt the search for truth or the civic responsibility necessary for self-government’s endurance. The founders were well aware of man’s propensity to indulge evil, and the debates over ratifying the Constitution include admonitions from Federalists and Anti-Federalists alike to eschew speech that indulges man’s “passions” in favor of a thoughtful, rigorous public debate oriented toward truth. Even as much speech regulation during the founding era came through social standards, rather than legal rules, restricting speech lacking in social value did not implicate the freedom of speech. Even with state constitutional provisions similar to the federal Freedom of Speech Clause, several states possessed bans on pornography, blasphemy, profanity, false statements, or libel. At the national level, the founders’ distinction between speech with and without social value was made manifest in public reaction to congressional restrictions on speech. When the First Continental Congress passed a ban on theater performances in 1774, the Act met with widespread compliance and community enforcement, mirroring bans in some colonies. The Congress would pass another theater ban in 1778, and significant opposition only arose in response to the Congress’s doubling down on the 1778 ban in light of George Washington having Joseph Addison’s play Cato performed for the Continental Army. This opposition, however, came from solidarity with the army—watching Cato, a play extolling republican virtues, was intended to boost the troops’ morale in fighting for self-government—not an outcry against restricting speech. The major speech controversy during the founding era confirms a distinction between speech with and without social value. The primary argument against the Sedition Act—which prohibited certain speech against the government and officials—was not premised on its infringing the freedom of speech. As Professor Kurt Lash observed, “modern notions of individual liberty cannot obscure what was to Madison and Jefferson the central problem with the [Sedition] Act: [it] violated the rights of the states” to restrict slanderous speech. The founders’ agreement on this point—that the “freedom of the press” does not protect vile speech—also intimates the risk in failing to draw this distinction. Why Distinguish Valuable Speech? When the Free Speech Clause sweeps all speech under its ambit, as Alexander Meiklejohn explained in Free Speech and Its Relation to Self-Government, it conflates the “private interest in speech”—which includes expressing one’s individual tastes and goals—with “the public interest in speech”—attaining truth and adopting wise public policy. Meiklejohn writes: And from this it follows that, so far as the First Amendment is concerned, the freedom of speech in the public interest may also be abridged. By its association with private speech under a common principle, public speech is reduced to the level of “proximity and degree.” The camel, once admitted to the tent, knocks it down. As Judge Robert Bork recognized in “Neutral Principles and Some First Amendment Problems,” every serious theory of speech protection draws lines. If a line is to be drawn, Bork explained, the question “is whether the location of the cut is justified.” The reality of line-drawing reveals the logic behind protecting public speech while leaving private speech and vile speech to democratic regulation. Speech on “truth, science, morality, and arts in general, [and] the diffusion of liberal sentiments on the administration of Government” relies on truth-testing to achieve its ends and furthers public policy toward the good. Defamation of public officials, as Jefferson explained in opposing the Sedition Act, “confound[ed]” vice and virtue and is thus uninterested in the search for truth. Along with private speech, it may need to be tempered to ensure both self-government and the advancement of truth. By leaving those value choices to the people, self-government is preserved. The Court can then evaluate the rationale for private-speech regulations in light of how they bear upon protected public speech and other constitutional protections—which, however, has not been the Supreme Court’s course. The “Marketplace of Ideas” and “Autonomy” Empower the Court to Censor Public Speech Modern free-speech jurisprudence takes its cue from Oliver Wendell Holmes’s dissent in Abrams v. United States. Holmes argued that “the best test of truth is the power of the thought to get itself accepted in the competition of the market.” The “marketplace” approach facilitated the Court’s embrace of a related free-speech rationale: individual autonomy. Rather than facilitate the pursuit of truth, the freedom of speech aids individuals in expressing their emotions. Both of these rationales give way to relativism about speech’s social value. As the Supreme Court said when articulating these doctrines in Cohen v. California, “one man’s vulgarity is another’s lyric.” The people cannot make “principled distinctions” between valuable and vile speech because such issues are just “matters of taste and style so largely [left] to the individual.” This analysis does away with the First Amendment’s distinct protection of public speech connected to the search for truth. The result is, as Meiklejohn predicted and Bork reasoned, a balancing of all forms of speech by the Court and an erosion of democratic authority to make principled distinctions between valuable and vile speech. At this point, defenders of current free-speech jurisprudence may mount a few objections. They may argue that the “marketplace of ideas” allows for truth to be developed through truth testing without fear of censorship. They may also argue that, far from eroding restrictions on vile speech, current free-speech jurisprudence—as the Court explained in United States v. Stevens—simply limits democracy’s censoring power to that speech with a demonstrable history of proscription. This both protects the search for truth and distinguishes vile speech, they would claim, without risking the censoring of most speech. These positions do not withstand scrutiny in light of the Court’s jurisprudence, however. In certain contexts, the Court has provided less protection to public speech than to speech lacking in social value. In “Where Speech Loses its Luster: Campaign Finance Laws and the Constitutional Downgrading of Political Speech,” law professor Patrick Garry compares how the Court has treated campaign finance regulations and how it has treated vile speech. He concludes that, “[c]ontrary to its highly scrutinizing, non-deferential approach in cases involving the regulation of indecent television programming, the Court’s campaign finance jurisprudence does not require tangible evidence of corruption to uphold regulations.” Since Garry’s 2007 analysis, the Supreme Court’s decision in Citizens United correctly overruled some of the case law upon which Garry’s critique relies, but key disparities remain—such as the Court’s presumption that restrictions on anonymous political speech are valid to begin with, and the freestanding interest in regulating certain political speech without tangible evidence of corruption. Abortion counseling cases provide another example of this “second-class” treatment to unquestionably public speech. The Court continues to hold that state laws adopted to prohibit pro-life counseling outside abortion clinics are not restrictions of speech content—even when the Court has struck down such regulations on other grounds. Justice Scalia credits this deferential analysis to the “entirely separate, abridged edition of the First Amendment applicable to speech against abortion.” United States v. Alvarez provides both an example of the Court’s ability to manipulate its self-imposed limitations on speech regulation and—in an admirable dissent by Justice Alito, joined by Justices Scalia and Thomas—a powerful response to the concern about majoritarian value distinctions in speech. The plurality opinion by Justice Kennedy struck down a statute prohibiting lying about receiving military medals. Despite the dissent providing several examples demonstrating “that false statements of fact merit no First Amendment protection in their own right,” the most the plurality would concede is that speech’s falsity “bears” upon whether the people may restrict certain speech. The plurality’s re-characterization of the nation’s long history of false-speech regulation is akin to how the Court in Stevens avoided the long history of proscribing animal cruelty when it struck down a statute banning the depiction of animal torture—drawing a contrived distinction between animal cruelty, which the government can prohibit, and depicting animal cruelty, which it could not. The attempt at a self-imposed limit at speech regulation, as Alvarez reveals, contains characterization loopholes that a return to the Free Speech Clause’s original meaning could avoid. The Alvarez dissent makes a strong argument for the Clause’s original social-value speech distinction. Leaving the regulation of false factual statements—speech lacking in any social value—to democratic judgment does not make the state the “arbiter of truth” generally. To the contrary, the dissent identifies a number of areas where the state would lack the authority to prohibit false statements. They are, unsurprisingly, the same areas where the founders found the link between the ascertainment of truth and public policy to be strong: “philosophy, religion, history, the social sciences, the arts, and other matters of public concern.” But even in these areas, the reason for protecting potentially false statements is not because falsity has value in itself, but because these disciplines rely on testing the truth in order to determine it. The right to freedom of speech facilitates the debate over what is true and false by carving out a distinct protection for speech that furthers the determination of truth in connection with public concern. Ensuring this “valuable speech,” as the dissent explains, does not bear upon the people’s ability to proscribe speech that is “verifiably false and entirely lacking in intrinsic value, [and] also fails to serve any instrumental purpose that the First Amendment might protect.” Reclaiming Free Speech In sum, free-speech jurisprudence has reached a state where it is acceptable to abridge speech on matters of public concern, but not on vile or private speech. Lopsided Court majorities have prohibited efforts to target the depiction of animal cruelty and shouting hateful epithets at a military soldier’s funeral. But the Court’s protection of public speech, such as in Citizens United, results in closely divided decisions that remain contentious, or in doctrinal manipulation, as in abortion-counseling cases. College campuses evince a similar development: Calling out the vulgarity of certain campus events inspires rebuttals wrapped in the First Amendment, while many of these same free-speech “absolutists” then insist on limiting political or religious speech to designated “zones” or prefacing such speech with “trigger warnings.” The Court’s failure to preserve the distinct protection for socially valuable speech, and the accompanying arrogation of the people’s power to weigh restrictions on vile speech, crafted a “freedom of speech” defined by its lowest ebb—while leaving any value-weighing over any speech to the least-accountable branch. If defenders of free speech are truly concerned about censorship—of individuals to speak freely on public matters as well as on the people to establish the bounds of acceptable behavior within reason—they ought to be more worried about today’s free-speech jurisprudence, not the founders’ free-speech jurisprudence. While there are surely challenges in reviving the Free Speech Clause’s distinct protection for public speech, the distinction is critical to the preservation of self-government. The Court should revive the lines drawn by the First Amendment as an original matter.

Albania Population: 3,038,594 Albania declared its independence from the Ottoman Empire in 1912, but was conquered by Italy in 1939 and occupied by Germany in 1943. Communist partisans took over the country in 1944. Albania allied itself first with the USSR (until 1960), and then with China (to 1978). In the early 1990s, Albania ended 46 years of xenophobic communist rule and established a multiparty democracy. The transition has proven challenging as successive governments have tried to deal with high unemployment, widespread corruption, dilapidated infrastructure, powerful organized crime networks, and combative political opponents. Albania has made progress in its democratic development since first holding multiparty elections in 1991, but deficiencies remain. Most of Albania's post-communist elections were marred by claims of electoral fraud; however, international observers judged elections to be largely free and fair since the restoration of political stability following the collapse of pyramid schemes in 1997. Albania joined NATO in April 2009 and in June 2014 became a candidate for EU accession. Albania in November 2016 received a European Commission recommendation to open EU accession negotiations conditioned upon implementation of a judicial reform package passed the same year. Although Albania's economy continues to grow, it has slowed, and the country is still one of the poorest in Europe. A large informal economy and an inadequate energy and transportation infrastructure remain obstacles. conventional long form: Republic of Albania conventional short form: Albania local long form: Republika e Shqiperise local short form: Shqiperia former: People's Socialist Republic of Albania etymology: the English-language country name seems to be derived from the ancient Illyrian tribe of the Albani; the native name "Shqiperia" is popularly interpreted to mean "Land of the eagles" history: several previous; latest approved by the Assembly 21 October 1998, adopted by referendum 22 November 1998, promulgated 28 November 1998; amended several times, last in 2012 amendments: proposed by at least one-fifth of Assembly members; approval required by at least two-thirds vote of members; referendum required only if approved by two-thirds of Assembly; amendments approved by referendum effective upon declaration by the president of the republic; amended several times, last in 2012 (2016) Legal system: civil law system except in the northern rural areas where customary law known as the "Code of Leke" prevails Suffrage: 18 years of age; universal Executive branch: chief of state: President of the Republic Bujar NISHANI (since 24 July 2012) cabinet: Council of Ministers proposed by the prime minister, nominated by the president, and approved by the Assembly elections/appointments: president indirectly elected by the Assembly for a 5-year term (eligible for a second term); a candidate needs three-fifths majority vote of the Assembly in 1 of 3 rounds or a simple majority in 2 additional rounds to become president; election last held in 4 rounds during the period 30 May-11 June 2012 (next election to be held in 2017); prime minister appointed by the president on the proposal of the majority party or coalition of parties in the Assembly highest court(s): Supreme Court or Cour Supreme (consists of 150 judges organized into 4 divisions: civil and commercial; social security and labor; criminal; and administrative; Constitutional Council (consists of 9 members including the court president); note - Algeria's judicial system does not include sharia courts judge selection and term of office: Constitutional Court judges appointed by the president with the consent of the Assembly to serve single 9-year terms with one-third of the membership renewed every 3 years; chairman elected by the People's Assembly for a single 3-year term; Court of Cassation judges, including the chairman, appointed by the president with the consent of the Assembly to serve single 9-year terms) subordinate courts: Courts of Appeal; Courts of First Instance Political parties and leaders: Alliance for Employment, Welfare, and Integration or APMI (coalition of 24 centrist and center-right parties) [Sali BERISHA]: Christian Democratic Party or PDK [Nard NDOKA] Democratic Party or PD [Lulzim BASHA] Movement for National Development of LZHK [Dashamir SHEHI] Republican Party or PR [Fatmir MEDIU] Alliance for a European Albania or ASHE (coalition of 38 parties from far left to right wing) [Edi RAMA]: Christian Democratic Party of PKD [Mark FRROKU] Party for Justice, Integration and Unity or PDIU [Shpetim IDRIZI] (formerly part of APMI) Socialist Movement for Integration or LSI [Ilir META] Socialist Party or PS [Edi RAMA] Union for Human Rights Party or PBDNJ [Vangjel DULE] other parties: New Democratic Spirit or FRD [Bamir TOPI] note: only the major parties of each coalition are listed Albania, a formerly closed, centrally-planned state, is a developing country with a modern open-market economy. Albania managed to weather the first waves of the global financial crisis but, more recently, the negative effects of the crisis have caused a significant economic slowdown. Close trade, remittance, and banking sector ties with Greece and Italy make Albania vulnerable to spillover effects of debt crises and weak growth in the euro zone. Remittances, a significant catalyst for economic growth, declined from 12-15% of GDP before the 2008 financial crisis to 5.7% of GDP in 2014, mostly from Albanians residing in Greece and Italy. The agricultural sector, which accounts for almost half of employment but only about one-fifth of GDP, is limited primarily to small family operations and subsistence farming, because of a lack of modern equipment, unclear property rights, and the prevalence of small, inefficient plots of land. Complex tax codes and licensing requirements, a weak judicial system, endemic corruption, poor enforcement of contracts and property issues, and antiquated infrastructure contribute to Albania's poor business environment making attracting foreign investment difficult. Albania’s electricity supply is uneven despite upgraded transmission capacities with neighboring countries. Technical and non-technical losses in electricity - including theft and non-payment - continue to undermine the financial viability of the entire system, although the government has taken steps to stem non-technical losses and has begun to upgrade the distribution grid. Also, with help from international donors, the government is taking steps to improve the poor national road and rail network, a long standing barrier to sustained economic growth. Inward FDI has increased significantly in recent years as the government has embarked on an ambitious program to improve the business climate through fiscal and legislative reforms. The government is focused on the simplification of licensing requirements and tax codes, and it entered into a new arrangement with the IMF for additional financial and technical support. Albania’s IMF program may be at risk, however, because the government has not collected sufficient tax revenue needed to reduce the budget deficit. The country continues to face increasing public debt, exceeding its former statutory limit of 60% of GDP in 2013 and reaching 73% in 2015. domestic: offsetting the shortage of fixed-line capacity, mobile-cellular phone service has been available since 1996; by 2011, multiple companies were providing mobile services, and mobile teledensity had reached 100 per 100 persons; Internet broadband services in 3 public TV networks, one of which transmits by satellite to Albanian-language communities in neighboring countries; more than 60 private TV stations; many viewers can pick up Italian and Greek TV broadcasts via terrestrial reception; cable TV service is (2010)

Computer and other electronic assemblies typically include a plurality of printed circuit (PC) boards that support electronic components. Commonly, PC boards are secured within a steel or plastic chassis for an electronic assembly by means of screws extending through holes in the PC board and threadedly engaged to a portion of the chassis. In addition to the mounting screws, the assignee of the present invention also has used an alternative PC board mounting technique by which vertically-extending plastic hooks are molded into the base of the computer chassis. The hooks are received through slots formed in a PC board as the PC board, lying in a horizontal plane, is lowered onto the base of the chassis. After the PC board is seated on the chassis, with hooks extending through slots, the PC board is displaced horizontally to engage the hooks on the upper surface of the PC board at one end of the slots, thereby preventing vertical motion of the PC board. Thereafter, a small plastic catch mechanism is snapped into engagement with an edge of the PC board to prevent horizontal motion. Because of the sensitivity of electrical components, and the risk that electrical circuits may be shorted if not properly secured within the product, it is necessary to ground the circuit board and to provide a ground for the electrical components on the circuit board. In many instances, both of these functions are provided by the fasteners (screws and/or hooks) that extend through the circuit board to the chassis of the product. Thus, for example, in a personal computer chassis, the motherboard containing many of the computer's electrical components is fastened to the chassis by a plurality of mounting screws and/or hooks. Because the chassis usually is constructed of a conductive material, or contains a conductive layer, a path to ground is provided through the mounting fasteners. The grounding of the circuit board is necessary to provide shielding against electromagnetic interference ("EMI") from outside sources, which might otherwise disturb the operation of the components on the circuit board. As one skilled in the art will understand, a large variety of electrical components may be mounted on the circuit board, including integrated circuits and other discrete components. Typically, the electrical components are mounted on the circuit board in one of two ways. The first technique for mounting electrical components on a circuit board is to provide electrical leads on the electrical components that extend through the circuit board. The tips of these leads then are bent and/or soldered to an outer surface of the circuit board. Where space is limited, solder usually is preferred as a method to both secure the electrical component to the circuit board, and to provide a high quality electrical connection between the leads and the circuit paths on or in the circuit board. In order to perform this soldering process, usually a wave soldering machine is used to provide the requisite soldering of connections on one or both sides of the circuit board. Typically, the circuit board is placed in the wave soldering machine so that solder is applied to all conductive surfaces on the bottom of the circuit board. In addition to providing solder to the leads of the electrical components, solder also is applied to conductive pad surfaces on the solder-side of the circuit board during the wave soldering process. To the extent that conductive surfaces on the solder-side of the board are not to be soldered, a solder mask must be provided as the bottom layer of the circuit board. The solder mask resists the application of solder. Thus, in accordance with normal techniques, the solder-side surface of the circuit board is designed with conductive pads, such as copper, where solder is to be deposited during the wave soldering process. Some of the larger conductive pads that are provided on the bottom of the circuit boards are the grounding pads, where grounding screws and/or hooks are to be attached or mounted. Printed circuit boards typically are designed in layers, with various circuit paths, and in some instances, circuit elements, in each layer of the board. Thus, a typical circuit board has a number of different layers, with the upper and lower layers including circuit paths for connecting to components that are mounted to the top or bottom of the circuit board. In prior art circuit boards, typically a plurality of "plated through holes" are provided for receiving the grounding screws. As that term is conventionally used, plated through holes are holes drilled through the circuit board, which include a conductive material applied to the board at the periphery of the mounting hole so that each layer of the circuit board can be electrically connected to the grounding screw. In addition, a solid conductive (copper) pad typically is provided on external layers of the board adjacent the aperture for the screw. The upper pad functions to connect to the head of the screw, while the lower pad functions to connect to the body or chassis of the product in which the board is mounted. Solder tends to wick through the plated through holes, and to accumulate in large mounts on the relatively large pads. Because solder is not applied evenly in the wave solder process (based upon various considerations such as surface tension, etc.), after soldering the solder deposited on the conductive pads and plated through holes tends to be uneven, and in fact, relatively large bumps or clusters may appear at one portion of the pad while other portions have relatively large valleys. This problem is greatly exaggerated on larger pad areas, such as the grounding pads. Because of these abnormalities in solder heights at the grounding pads and plated through holes, the installation of the boards may prove difficult, if not impossible. For example, in assignee's personal computers, hooks are used to secure the motherboard to the chassis. The hook therefore functions as a clamp by sandwiching the motherboard in place. See U.S. application Ser. No. 08/179,806, filed Jan. 11, 1994, the teachings of which are incorporated by reference as if fully set forth herein. The hook has a certain clearance to accommodate the circuit board. If the conductive pads at the site of the hook are too high, the circuit board will not fit within the hook structure. If, conversely, the height of the solder is too low, the conductive pad will not make a good contact with the hook and/or the metal chassis of the product in which the board is mounted, causing potential problems with electromagnetic interference. Moreover, if the height of the solder varies from one pad to another, the board will not lie flat within the chassis, but instead will be required to flex and bulge to fit properly in the chassis, causing stress on the circuit board. To alleviate these problems it typically is necessary to manually touch-up the larger solder pads in order to remove excess solder, or to add solder to provide a uniform solder height. This manual rework of the PC board adds significantly to the cost of manufacturing the circuit boards. Consequently, it would be advantageous to develop a technique for uniformly depositing solder on a circuit board during a wave soldering process to provide a solder joint with sufficient quantities of solder to provide adequate EMI protection, without providing too much solder to create problems with installation. A second common technique for attaching electrical components to circuit boards is to surface mount the components by placing the component on conductive solder pads on the surface of the board. The solder then is heated in an appropriate chamber to reflow the solder on each pad to obtain a soldered connection with an associated lead or pad on the component. During the assembly of the circuit board, solder paste typically is deposited on the board by an automated (solder paste screening) machine, so that the solder paste is deposited in a relatively uniform manner to all of the conductive surfaces on the board. In addition to providing conductive paths for connecting to the leads of the surface mount components, it is common to also deposit solder paste on larger conductive pads where grounding is necessary, for example, where grounding screws and other attachments are to be located. In the situation where the conductive pads are relatively large, the solder paste deposited on these pads tends to flow unevenly over the entire pad boundary when the reflow process occurs, leaving minimal or no solder height to electrically connect to the components provided on the chassis for grounding. There is a need to control and maintain the flow of the solder during the reflow process, to achieve enough solder raised above the surface in a desired area to provide a high quality electrical connection. In many applications, such as computer motherboards, both types of components (surface mounts and through-hole) are used on the same circuit board. Typically, the surface mount components are soldered first on one side of the board, and then the board is placed in a wave solder machine to wave solder the other side of the board to connect the through hole devices to circuitry on the circuit board. In this situation, the problems with surface mount soldering and wave soldering are both present. It obviously would be advantageous to develop a method for constructing a circuit board which would provide a uniform solder height for the larger solder areas to facilitate ease of installation and to insure adequate grounding for EMI protection regardless of the type of soldering that is used or the type of circuit board that is implemented.

Q: When do we use '{ }' in javascript imports? I am learning Javascript imports and I am yet to understand when we use curly braces while importing items(functions, objects, variables) from another JS file. import Search from './models/Search'; import * as searchView from './views/searchView'; import { elements, renderLoader } from './views/base' //elements is an object, renderLoader is a function A: The import statements are used to import the exported bindings from another module The curly braces ({}) are used to import named bindings and the concept behind it is called destructuring assignment The concept of destructuring assignment is a process that makes it possible to unpack the values from arrays or objects into distinct variables in the imported module The curly braces ({}) are used to import named bindings I would like to explain different types of imports in ES6 with the help of an example Suppose we have a a module named Aninmals(Animals.js) let suppose the module exports a default binding Man and several other named bindings such as Cat, Dog etc /* Animal.js */ .. export Cat; export Dog export default Man Import a single export from a module In order to export a single export from another module (let say Cat) we can write it like this /* Anothermodule.js */ import {Cat} from "./Animals" Similarly for Dog /* YetAnothermodule.js */ import {Dog} from "./Animals" Import multiple exports from module You can also import multiple modules as follows /* Anothermodule.js */ import {Dog, Cat} from "./Animals" Import an export with a more convenient alias /* Anothermodule.js */ import {Dog as Puppy} from './Animals.js'; Rename multiple exports during import /* Anothermodule.js */ import {Dog as Puppy, Cat as Kitty} from './Animals.js'; But in the case to import Man into another module since it is a default export you can write it like thie /* Anothermodule.js */ import Man from './Animals.js'; You can also mix the both the above variants for example /* Anothermodule.js */ import Man, {Dog as Puppy, Cat as Kitty} from '/Animals.js'; Import an entire module's contents If you want to import everything you can use /* Anothermodule.js */ import * as Animals from './Animals.js'; Here, accessing the exports means using the module name ("Animals" in this case) as a namespace. For example, if you want to use Cat in this case you can use it like below Animals.Cat You can read more information about import here you can read about destructuring here A: import { elements, renderLoader } from './views/base' is the way you need to import single, named exports from a module, in this case it is importing named exports elements and renderLoader from base.js. The { elements, renderLoader } syntax is in many cases just syntactic sugar (called destructuring) added in recent versions of the ECMAScript standard. https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/Operators/Destructuring_assignment#Object_destructuring In this case, though, it is necessary to get only the named exports you want. https://developer.mozilla.org/en-US/docs/Web/JavaScript/Reference/Statements/import#Import_a_single_export_from_a_module Please note that you can also pick new names for your variables like this: import { elements as newNameForElements, renderLoader as newNameForRenderLoader } from './views/base' which would then make the elements export available as newNameForElements etc. A: import Search from './models/Search'; Imports the default exported element as Search. import * as searchView from './views/searchView'; Imports everything into searchView that has been exported. import { elements, renderLoader } from './views/base' Imports a hand-picked number of named exported elements.

What is the first thing that comes to mind when you read ingredients such as “partially hydrogenated oil” and “hydrogenated oil” on a food label? Do you think of heart disease, heart health, or atherosclerosis? Most people probably do not. As we uncover what hydrogenation is and why manufacturers use it, you will be better equipped to adhere to healthier dietary choices and promote your heart health. Hydrogenation: The Good Gone Bad? Food manufacturers are aware that fatty acids are susceptible to attack by oxygen molecules because their points of unsaturation render them vulnerable in this regard. When oxygen molecules attack these points of unsaturation the modified fatty acid becomes oxidized. The oxidation of fatty acids makes the oil rancid and gives the food prepared with it an unappetizing taste. Because oils can undergo oxidation when stored in open containers, they must be stored in airtight containers and possibly be refrigerated to minimize damage from oxidation. Hydrogenation poses a solution that food manufacturers prefer. When lipids are subjected to hydrogenation, the molecular structure of the fat is altered. Hydrogenation is the process of adding hydrogen to unsaturated fatty-acid chains, so that the hydrogen atoms are connected to the points of saturation and results in a more saturated fatty acid. Liquid oils that once contained more unsaturated fatty acids become semisolid or solid (upon complete hydrogenation) and behave like saturated fats. Oils initially contain polyunsaturated fatty acids. When the process of hydrogenation is not complete, for example, not all carbon double bonds have been saturated the end result is a partially hydrogenated oil. The resulting oil is not fully solid. Total hydrogenation makes the oil very hard and virtually unusable. Some newer products are now using fully hydrogenated oil combined with nonhydrogenated vegetable oils to create a usable fat. Manufacturers favor hydrogenation as a way to prevent oxidation of oils and ensure longer shelf life. Partially hydrogenated vegetable oils are used in the fast food and processed food industries because they impart the desired texture and crispness to baked and fried foods. Partially hydrogenated vegetable oils are more resistant to breakdown from extremely hot cooking temperatures. Because hydrogenated oils have a high smoking point they are very well suited for frying. In addition, processed vegetable oils are cheaper than fats obtained from animal sources, making them a popular choice for the food industry. Trans fatty acids occur in small amounts in nature, mostly in dairy products. However, the trans fats that are used by the food industry are produced from the hydrogenation process. Trans fats are a result of the partial hydrogenation of unsaturated fatty acids, which cause them to have a trans configuration, rather than the naturally occurring cis configuration. Health Implications of Trans Fats No trans fats! Zero trans fats! We see these advertisements on a regular basis. So widespread is the concern over the issue that restaurants, food manufacturers, and even fast-food establishments proudly tout either the absence or the reduction of these fats within their products. Amid the growing awareness that trans fats may not be good for you, let’s get right to the heart of the matter. Why are trans fats so bad? Processing naturally occurring fats to modify their texture from liquid to semisolid and solid forms results in the development of trans fats, which have been linked to an increased risk for heart disease. Trans fats are used in many processed foods such as cookies, cakes, chips, doughnuts, and snack foods to give them their crispy texture and increased shelf life. However, because trans fats can behave like saturated fats, the body processes them as if they were saturated fats. Consuming large amounts of trans fats has been associated with tissue inflammation throughout the body, insulin resistance in some people, weight gain, and digestive troubles. In addition, the hydrogenation process robs the person of the benefits of consuming the original oil because hydrogenation destroys omega-3 and omega-6 fatty acids. The AHA states that, like saturated fats, trans fats raise LDL “bad cholesterol,” but unlike saturated fats, trans fats lower HDL “good cholesterol.” The AHA advises limiting trans-fat consumption to less than 1 percent. How can you benefit from this information? When selecting your foods, steer clear of anything that says “hydrogenated,” “fractionally hydrogenated,” or “partially hydrogenated,” and read food labels in the following categories carefully: Choose brands that don’t use trans fats and that are low in saturated fats. Dietary-Fat Substitutes In response to the rising awareness and concern over the consumption of trans fat, various fat replacers have been developed. Fat substitutes aim to mimic the richness, taste, and smooth feel of fat without the same caloric content as fat. The carbohydrate-based replacers tend to bind water and thus dilute calories. Fat substitutes can also be made from proteins (for example, egg whites and milk whey). However, these are not very stable and are affected by changes in temperature, hence their usefulness is somewhat limited. Tools for Change One classic cinnamon roll can have 5 grams of trans fat, which is quite high for a single snack. Foods such as pastries, frozen bakery goods, cookies, chips, popcorn, and crackers contain trans fat and often have their nutrient contents listed for a very small serving size—much smaller than what people normally consume—which can easily lead you to eat many “servings.” Labeling laws allow foods containing trans fat to be labeled “trans-fat free” if there are fewer than 0.5 grams per serving. This makes it possible to eat too much trans fat when you think you’re not eating any at all because it is labeled trans-fat free. Always review the label for trans fat per serving. Check the ingredient list, especially the first three to four ingredients, for telltale signs of hydrogenated fat such as partially or fractionated hydrogenated oil. The higher up the words “partially hydrogenated oil” are on the list of ingredients, the more trans fat the product contains. Measure out one serving and eat one serving only. An even better choice would be to eat a fruit or vegetable. There are no trans fats and the serving size is more reasonable for similar calories. Fruits and vegetables are packed with water, fiber, and many vitamins, minerals, phytonutrients, and antioxidants. At restaurants be aware that phrases such as “cooked in vegetable oil” might mean hydrogenated vegetable oil, and therefore trans fat. Key Takeaways Hydrogenation is the process of adding hydrogen to the points of unsaturation in unsaturated fatty acid chains. The resulting oil is very hard and unusable. Partial hydrogenation is the process of adding hydrogen to some of the points of unsaturation in unsaturated fatty acid chains. This produces oils that are more spreadable and usable in food products. Food manufacturers favor the use of hydrogenated oils because they do not succumb to oxidative damage, they increase the shelf life of food products, and they have a high smoking point. Fat replacers mimic fat but do not have the same chemical configuration as fat. Therefore the body does not process these the same way it would a naturally occurring fat. Fat substitutes such as Olestra have produced symptoms of fat malabsorption in some people. Discussion Starters Describe how trans fatty acids are created. Explain the drawbacks of consuming this type of fat and its impact on human health. Make a list of the foods in your kitchen. Read each food label. List all of the food items that contain trans fat. Recall the recommendation that trans fat be less that 1 percent of your fat intake. About what percentage of your diet is currently trans fat? Do you see a need to adjust your trans fat intake? Recommended articles The LibreTexts libraries are Powered by MindTouch®and are supported by the Department of Education Open Textbook Pilot Project, the UC Davis Office of the Provost, the UC Davis Library, the California State University Affordable Learning Solutions Program, and Merlot. We also acknowledge previous National Science Foundation support under grant numbers 1246120, 1525057, and 1413739. Unless otherwise noted, LibreTexts content is licensed by CC BY-NC-SA 3.0. Have questions or comments? For more information contact us at info@libretexts.org or check out our status page at https://status.libretexts.org.

Risky internet behaviors of middle-school students: communication with online strangers and offline contact. In today's world, more adolescents are using the Internet as an avenue for social communication and a source of information and to experiment with risky online behaviors. To better understand how early adolescents are using the Internet, a study was undertaken to more clearly identify online use and online risky behaviors and to describe any online relationships with strangers middle-school students may be participating in. This exploratory study adapted the Youth Internet Safety Survey of Finkelhor et al to identify the usage and characteristics of online youth, solicitation of youth, and risky behaviors. Four hundred and four students, with a mean age of 12 years, were recruited from public and parochial schools located in the Northeast. Findings from this study indicate that of a total sample of 404 middle-school students, a small grouping (n = 59; 14.6%) are beginning risky online communication behaviors with strangers. Students who communicated online with strangers were older and had higher rates of posting personal information, risky online behaviors, and stealing. The majority of this group (84%) met offline with the online stranger, and three students reported having been assaulted. Findings suggest that early adolescents are beginning risky online and offline behaviors. Understanding their experiences is important since they highlight how middle-school students are undertaking risks in a new environment that many adults and parents do not fully understand. Clinicians, educators, healthcare providers, and other professionals need to be informed of Internet behaviors in order to assess for risk, to make referrals, to intervene, and to educate.

As a power source of a mobile device, or the like, a lithium ion secondary battery is mainly used. The function of the mobile device or the like is diversified, resulting in increasing in power consumption thereof. Therefore, a lithium ion secondary battery is required to have an increased battery capacity and, simultaneously, to have an enhanced charge/discharge cycle characteristic. Further, there is an increasing demand for a secondary battery with a high output and a large capacity for electric tools such as an electric drill and a hybrid automobile. In this field, conventionally, a lead secondary battery, a nickel-cadmium secondary battery, and a nickel-hydrogen secondary battery are mainly used. A small and light lithium ion secondary battery with high energy density is highly expected, and there is a demand for a lithium ion secondary battery excellent in large current load characteristics. In particular, in applications for automobiles, such as battery electric vehicles (BEV) and hybrid electric vehicles (HEV), a long-term cycle characteristic over 10 years and a large current load characteristic for driving a high-power motor are mainly required, and a high volume energy density is also required for extending a driving range (distance), which are severe as compared to mobile applications. In the lithium ion secondary battery, generally, a lithium salt, such as lithium cobaltate, is used as a positive electrode active material, and a carbonaceous material, such as graphite, is used as a negative electrode active material. Graphite is classified into natural graphite and artificial graphite. Among those, natural graphite is available at a low cost. However, as natural graphite has a scale shape, if natural graphite is formed into a paste together with a binder and applied to a current collector, natural graphite is aligned in one direction. When an electrode made of such a material is charged, the electrode expands only in one direction, which degrades the performance of the electrode. Natural graphite, which has been granulated and formed into a spherical shape, is proposed, however, the resulting spherical natural graphite is aligned because of being crushed by pressing in the course of electrode production. Further, the surface of the natural graphite has high reaction activity, resulting in a low initial charge-discharge efficiency and poor cycle characteristics. In order to solve those problems, Patent Document 1 and the like propose a method involving coating carbon on the surface of the natural graphite processed into a spherical shape. However, sufficient cycle characteristics have not been attained. Regarding artificial graphite, there is exemplified a mesocarbon microsphere-graphitized article described in Patent Document 2 and the like. However, the article has a lower discharge capacity compared to a scale-like graphite and had a limited range of application. Artificial graphite typified by graphitized articles made of oil, coal pitch, coke and the like is available at a relatively low cost. However, although a crystalline needle-shaped coke shows a high discharge capacity, it tends to align in a scale shape and be oriented in an electrode. In order to solve this problem, the method described in Patent Document 3 and the like yield results. Further, negative electrode materials using so-called hard carbon and amorphous carbon described in Patent Document 4 are excellent in a characteristic with respect to a large current and also have a relatively satisfactory cycle characteristic. Patent Document 5 discloses artificial graphite being excellent in cycle characteristics. Patent Document 6 discloses an artificial graphite negative electrode produced from needle-shaped green coke. Patent Document 7 discloses an artificial graphite negative electrode produced from cokes coated with petroleum pitch in a liquid phase.

The semiconductor integrated circuit industry has experienced rapid growth in the past several decades. Technological advances in semiconductor materials and design have produced increasingly smaller and more complex circuits. These material and design advances have been made possible as the technologies related to processing and manufacturing have also undergone technical advances. In the course of semiconductor evolution, the number of interconnected devices per unit of area has increased as the size of the smallest component that can be reliably created has decreased. Many of the technological advances in semiconductors have occurred in the field of device fabrication. As device densities continue to increase and feature sizes continue to decrease, device fabrication processes must constantly adapt and improve. One such process includes the use of photolithography with a mask. During photolithography a pattern is defined on the surface of a substrate through the use of light shined through or reflected off a mask. The pattern is typically used to identify two regions on the substrate: a first region that will be exposed to a further processing step and a second region that will be protected from the same further processing step. For example, the pattern might divide the substrate into regions where material is to be deposited or not deposited. In another example, the pattern might divide the substrate into regions where material is to be etched away or should remain. Accordingly, it would be desirable to have improved photolithography patterns and methods. The various features disclosed in the drawings briefly described above will become more apparent to one of skill in the art upon reading the detailed description below. Where features depicted in the various figures are common between two or more figures, the same identifying numerals have been used for clarity of description.

The development of electronic devices with printed circuit boards typically involves many steps known as a design flow. This design flow typically starts with a specification for a new electronic device to be implemented with a printed circuit board. The specification of the electronic device can be transformed into an electronic device design, such as a netlist, for example, by a schematic capture tool or by synthesizing a logical design, sometimes referred to as a register transfer level (RTL) description of the electronic device. The netlist may be specified in an Electronic Design Interchange Format (EDIF) or the like, which can describe nets or connectivity between various components or parts in the electronic device design. The design flow may continue by verifying functionality of the electronic device design, for example, by simulating, emulating, or prototyping the electronic device design and verifying that the results of the simulation or emulation correspond with an expected output from the electronic device design. The functionality also can be verified by formally verifying with one or more solvers or statically checking the electronic device design for various attributes that may be problematic during operation of the electronic device built utilizing the electronic device design. Once the electronic device design has been functionally verified, the design flow may utilize the logical design to generate a layout design for the electronic device. This procedure can be implemented in different ways, but typically, through the use of a layout tool, which can place and interconnect various components or parts into a representation of a printed circuit board. For example, the layout tool implemented in a computing system can present a graphical view of the printed circuit board and allow a designer to utilize the layout tool to place parts from a library onto the printed circuit board in the graphical view. The design flow may perform one or more design for manufacturability (DFM) procedures on the layout design, which can determine whether the electronic device described in the layout design can be manufactured. The design for manufacturability procedures can include a design for fabrication (DFF) processes, a design for assembly (DFA) processes, a design for test (DFT) processes, or the like. The design for fabrication processes can determine whether a bare printed circuit board can be fabricated based on the layout design. The design for assembly processes can determine whether components can be disposed or coupled to the printed circuit board during assembly of the electronic device. The design for test processes can identify whether testing procedures can be utilized on manufactured electronic devices, for example, to detect process defects during assembly, perform electrical verification of a manufactured electronic device, or the like. The design for test processes may be able to identify whether the electronic device, when built, can be tested by a particular fabricator to identify process defects, such as whether a component has been placed and soldered to the printed circuit board correctly. The design for test processes also may determine whether the electronic device can be electrically verified during testing procedures, for example, by performing at speed testing of the electronic device and sampling signaling at various test points in the electronic device under test. Often, however, practical constraints, such as fabricator test capabilities, space on the layout design available for test points, or the like, may result in the testing procedures to not being able to verify a portion of the electronic device. This inability to test the portion of the electronic device can reduce test coverage and leave the electronic devices built based on the layout design susceptible to undetected manufacturing-related faults. In other instances, the design for test processes may determine that a fabricator has the capability of testing manufactured electronic devices for the layout design, but the testing procedures may be time-consuming, expensive, or both than other available options. In these instances, the developer of the electronic system can decide whether to re-design the electronic device or to accept the reduced test coverage and/or more time-consuming, expensive, or both testing procedures and move forward with production of the electronic design.

Pappmine The Pappmine or Cardboard Mine in English was an anti-tank mine that was developed by Germany and used by the Wehrmacht during World War II. Design The Pappmine was designed to be a low cost, and easy to produce cardboard anti-tank mine which could relieve pressure on the overstretched metalworking industry. The Pappmine was made entirely of non-metallic materials to prevent detection by electric mine detectors. The Pappmine was a close copy of the Soviet TMB series of cardboard mines except the Pappmine was better waterproofed to resist moisture and rotting. The Pappmine was black in color and consisted of a container with a lid. The lid covered the full diameter of the container and both the top and bottom edges of the container were rounded and held together by a band of cardboard.  In the center of the lid, there was a pressure plate of thick green glass which resembled a glass stopper. In the center of the mine, the pressure plate sat on top of a glass igniter that was embedded in of TNT. Only pressure on the plate caused an explosion and pressure on the cardboard side of the mine would not set it off. of pressure on the plate crushed the igniter creating a flash which then passed to the priming charge which exploded the TNT filling. A 3-second delay could also be incorporated in the igniter. The Pappmine relied on blast effect to destroy enemy tanks and it did not have a shaped charge warhead. References Category:Anti-personnel mines Category:World War II weapons of Germany Category:Land mines of Germany

The recent skydiving death of Sean Carey may have some interesting parallels for spaceflight and space exploration. As Abby Sewell said in the Los Angeles Times: The deaths reflect a divergent nationwide trend: equipment upgrades and safety rules have reduced overall skydiving fatalities among novices — but the smaller, more aerodynamically designed parachutes have allowed more experienced divers to take more risks. Increasingly, industry veterans said, fatal accidents involve experts attempting advanced maneuvers with high-performance equipment. We are likely to see a similar trend in human spaceflight over the next few decades. As suborbital and orbital spaceflight become more routine, safety will improve as operators benefit from experience (the learning-curve effect). At the same time, however, low-cost access to space and in-space infrastructure such as propellant depots will enable explorers to undertake riskier missions into deep space with increasing frequency. The result will be an increasing number of fatalities among NASA and commercial explorers on advanced missions to the Moon, the asteroids, Mars, and beyond, while near-space missions become safer and more routine. That should not be a cause for alarm, however. It is part of the normal process of opening a new frontier.

Growing Plants to Save Lives Tucked behind old factory buildings on Penn’s South Bank campus stands a gleaming greenhouse. The $2 million structure, completed late last year, is state-of-the-art. Drip irrigation ensures each pot receives just the right amount of water. Humidity and temperature are precisely monitored and can be accessed and modified remotely. And if short winter days, snow cover, or cloudy skies prevent enough sunlight from entering the greenhouse, panels and lights on the ceiling adjust automatically to provide light that matches solar radiation. Such cutting-edge technology might seem over-the-top for a mere greenhouse. But the plants grown inside are not destined for a garden, farm, or windowsill; their intended fate is to save lives. The greenhouse is the domain of the School of Dental Medicine’s Henry Daniell, a professor in the departments of Biochemistry and Pathology and director of translational research. Daniell joined Penn’s faculty last year and has been working diligently to see his research move from the lab to the clinic. His life’s work centers on a unique means of delivering drugs and vaccinations to the human body. Instead of relying upon sterile injections to ferry the therapeutic protein of interest to the intended tissue, Daniell has used a humbler vehicle: lettuce leaves. His research has demonstrated the effectiveness of plant-based vaccines and therapeutics in treating nearly 30 conditions, from infectious diseases such as cholera, malaria, and anthrax, to autoimmune diseases such as diabetes and hemophilia. The way Daniell sees it, plant-based vaccines have a number of advantages over their traditional counterparts. They’re shelf-stable and don’t require refrigeration, they’re less likely than egg-based injections to provoke an allergy, they’re relatively easy to grow, and they’re safer because they only contain proteins from a pathogen, rather than the pathogen itself. Perhaps the greatest advantage of these vaccines and therapeutic agents, however, is their cost. “Interferon, a common cancer drug, for example, costs $30,000 to $40,000 for a four-month treatment, and a third of the global population earns $2 or less a day,” Daniell says. “To me, there is something morally not right about that. If you have something that saves lives, you have an obligation to make it available to everyone.” Manufacturing these so-called “green vaccines” does not require expensive purification equipment, and transporting and storing them doesn’t require a costly “cold chain” of refrigeration. Freed from these constraints, Daniell says the therapies could be produced and distributed relatively inexpensively, even to remote areas where refrigeration and electricity are rare commodities. In a soon-to-be published article that has attracted attention from pharmaceutical companies eager to scale up his techniques and make them available to patients, Daniell and colleagues have shown that his platform effectively counteracts one of the most dangerous complications of hemophilia treatment. And in the new greenhouse, he’s growing genetically modified tobacco and lettuce plants that could be used to vastly improve treatment for diabetes, HPV, polio, and hemophilia. Trials in humans could begin as early as next year. “This will be a paradigm shift in delivery of drugs,” Daniell says. “This will change the landscape and save lives.” Text by Katherine Unger Baillie Video by Rebecca Abboud Multimedia: Other Stories in Science & Technology Electric cars may be the future of driving, but first, the vehicles need to spark excitement among the general public. That’s why Penn students have been working hard for the past two years to build one of the world’s first electric racecars.