Datasets:

ewhfef

/

mix_cpt

like 1

children has been the target of oral health promotion policies for a long time in brazil , and this is due to several prevalence studies that were carried out during the 1980 's and 1990 's , showing that children are the part of population most susceptible to dental caries and also the most benefited from prevention programs . there are , however , few population - based studies evaluating the prevalence and progression of dental caries among adolescents and young adults in brazil,10 . this is the phase in which the population is no longer a target for epidemiological surveys and preventive programs in oral health27 . although a decrease in the prevalence of dental caries was observed in several countries , there was also a skewed distribution of dental caries in the 12-year - old age range . in fact , part of the 12-year - old individuals has high or very high dmft values while the rest has low dmft values or is " caries free"19 . thus , to identify this part of population with high or very high dmft values and to target the still caries - susceptible individuals , a new index , named significant caries index ( sic ) , was proposed by bratthall4 ( 2000 ) to bring attention to the children with the highest caries scores in a given population . it is represented by the mean dmft of the one - third of the individuals having the highest of dmft values in a specific population19 . according to baldani , et al.2 ( 2004 ) , the polarization of dental caries is a phenomenon associated with economic deprivation . socioeconomic factors have also been identified as risk indicators to the development of dental caries24 . in addition , sic is considered a good indicator to compare the risk of dental caries between different groups17 . therefore , sic was chosen in the present study to evaluate which variables were associated with high and very high dmft values in adolescents from the city of santa brbara d'oeste , brazil . an evaluation of variables related to self - perceived oral health was made because recent evidence have shown that self - perceived need for dental care is strongly associated with fractured fillings , cavities , tooth mobility , among others12 . thus , the purpose of this study was to estimate the prevalence of dental caries , to calculate sic and to evaluate the role of socioeconomic variables and self - perceived oral health measures in the polarization of dental caries in adolescents aged 15 - 18 years living in santa brbara d'oeste , sp , brazil . the city of santa barbara d'oeste has 20 schools , of which 16 are public and the remaining 4 are private . the city had 17,062 inhabitants aged 15 to 19 years in 2002 . in 2004 , 8,185 subjects aged 15 to 18 years were attending the public ( n=7,867 ) and private ( n=318 ) high schools of santa barbara d'oeste . adolescents from twelve of the sixteen public schools were randomly selected using a table of random numbers generated with software microsoft excel and the list of students provided by the department of education of santa barbara d'oeste . the twelve schools were selected to represent three out of the four distinct districts of santa barbara d'oeste . the number of adolescents examined at each school was proportional to the population of adolescents studying at each public school in the city . this cross - sectional study , approved by the ethics in research committee of the faculty of dentistry of piracicaba ( research protocol # 089/2002 ) was carried out in accordance with the resolution 196/96 of the brazilian health council , which regulates ethical issues related to human studies . a sample size of 345 subjects was calculated using the criteria used in the sp 98 survey , according to the methodology proposed by the world health organization ( who ) . the adolescents aged 15 to 18 years were invited to take part in the study and , upon acceptance , informed written informed consents were granted by the subjects themselves or their parents / representatives if under 18 years of age30 . santa brbara d'oeste is located in the metropolitan area of campinas and 130 km away from the city of so paulo . in the year 2000 , the city had 169,574 inhabitants and 100% of its households with electricity and fluoridated water supply , according to the brazilian census . teeth were evaluated using dmft index , in accordance with the criteria proposed by the world health organization30 ( 1997 ) . five examiners using flat dental mirrors and cpi probes ( " ball point " ) performed the dental examinations under natural light conditions . all examiners were previously trained in a 32-hour program by experienced professionals from the health department of santa brbara d'oeste and from the social dentistry department of the faculty of dentistry of piracicaba . self - perceived oral health , access to dental services and socio - demographic variables were assessed with an adapted version of the structured inventory proposed by the brazilian ministry of health during the national oral health survey5 in 2004 . race was assessed by the examiners and participants were regarded as white , mixed , native brazilian , yellow or black and later categorized into whites or non - whites for analytical purposes . housing status was self - reported with participants answering if their households were owned , rented or yielded by their relatives / legal representatives . later , housing status was categorized into own or rent / yield for analytical purposes . subjects were also asked about the number of rooms in their homes , a continuous variable that was later categorized into equal or bellow to the lower tertile (= or < 4 ) or above the lower tertile (= or > 4 ) of distribution of the studied sample . family income was self - reported and a monthly family income equal or bellow to the first tertile ( i.e. , r$ 1,000.00 ) of the distribution was considered an indicator of financial disadvantage in the studied sample . the following questions were used to assess self - perceived oral health : 1 . " how would you classify the health of your teeth and gingiva ? " , and 2 . " " answers were in a likert - type scale and ranged for both questions from extremely poor to extremely good and were later categorized into good and not good . the occurrence of toothache within the six months prior to the study was also self - reported , with subjects answering yes or no to this question . dmft index means , mean number of decayed teeth and the proportion of " caries free " subjects were described according to age , gender and race evaluated in this study . chi - square tests were used for dichotomic variables while student 's t - tests were used for continuous . the correspondent non - parametric tests were used when appropriate . the value to reject the null hypothesis was set at p=0.05 . the intra and inter - examiner reliability of the before study obtained data were summarized by kappa coefficient and percentage of agreement . associations were adjusted for the demographic and socioeconomic confounders , as well as for self - perceived oral health and access to dental services by means of the multivariate logistic regression . sic was set as the outcome and those subjects with high or very high dmft values ( i.e. , those in the group of subjects of the higher third of caries experience in the sample ) were regarded as " sic positive " while those with low dmft or without caries were regarded as " sic negative " . all statistical analyses were carried out using the spss 11.0 software ( spss inc . , all independent variables that showed association with p<0.25 , as well as those with clinical - epidemiological relevance , according to data in the literature , were candidates to the multivariate model14 . variables that did not contribute ( i.e. , p>0.25 ) to the model were eliminated and a new model was calculated . the new model was always compared to the previous one using the likelihood ratio test . adjusted odds ratios ( or ) this cross - sectional study , approved by the ethics in research committee of the faculty of dentistry of piracicaba ( research protocol # 089/2002 ) was carried out in accordance with the resolution 196/96 of the brazilian health council , which regulates ethical issues related to human studies . a sample size of 345 subjects was calculated using the criteria used in the sp 98 survey , according to the methodology proposed by the world health organization ( who ) . the adolescents aged 15 to 18 years were invited to take part in the study and , upon acceptance , informed written informed consents were granted by the subjects themselves or their parents / representatives if under 18 years of age30 . santa brbara d'oeste is located in the metropolitan area of campinas and 130 km away from the city of so paulo . in the year 2000 , the city had 169,574 inhabitants and 100% of its households with electricity and fluoridated water supply , according to the brazilian census . teeth were evaluated using dmft index , in accordance with the criteria proposed by the world health organization30 ( 1997 ) . five examiners using flat dental mirrors and cpi probes ( " ball point " ) performed the dental examinations under natural light conditions . all examiners were previously trained in a 32-hour program by experienced professionals from the health department of santa brbara d'oeste and from the social dentistry department of the faculty of dentistry of piracicaba . self - perceived oral health , access to dental services and socio - demographic variables were assessed with an adapted version of the structured inventory proposed by the brazilian ministry of health during the national oral health survey5 in 2004 . race was assessed by the examiners and participants were regarded as white , mixed , native brazilian , yellow or black and later categorized into whites or non - whites for analytical purposes . housing status was self - reported with participants answering if their households were owned , rented or yielded by their relatives / legal representatives . later , housing status was categorized into own or rent / yield for analytical purposes . subjects were also asked about the number of rooms in their homes , a continuous variable that was later categorized into equal or bellow to the lower tertile (= or < 4 ) or above the lower tertile (= or > 4 ) of distribution of the studied sample . family income was self - reported and a monthly family income equal or bellow to the first tertile ( i.e. , r$ 1,000.00 ) of the distribution was considered an indicator of financial disadvantage in the studied sample . the following questions were used to assess self - perceived oral health : 1 . " how would you classify the health of your teeth and gingiva ? " , and 2 . " " answers were in a likert - type scale and ranged for both questions from extremely poor to extremely good and were later categorized into good and not good . the occurrence of toothache within the six months prior to the study was also self - reported , with subjects answering yes or no to this question . dmft index means , mean number of decayed teeth and the proportion of " caries free " subjects were described according to age , gender and race evaluated in this study . chi - square tests were used for dichotomic variables while student 's t - tests were used for continuous . the correspondent non - parametric tests were used when appropriate . the value to reject the null hypothesis was set at p=0.05 . the intra and inter - examiner reliability of the before study obtained data were summarized by kappa coefficient and percentage of agreement . associations were adjusted for the demographic and socioeconomic confounders , as well as for self - perceived oral health and access to dental services by means of the multivariate logistic regression . sic was set as the outcome and those subjects with high or very high dmft values ( i.e. , those in the group of subjects of the higher third of caries experience in the sample ) were regarded as " sic positive " while those with low dmft or without caries were regarded as " sic negative " . all statistical analyses were carried out using the spss 11.0 software ( spss inc . , all independent variables that showed association with p<0.25 , as well as those with clinical - epidemiological relevance , according to data in the literature , were candidates to the multivariate model14 . variables that did not contribute ( i.e. , p>0.25 ) to the model were eliminated and a new model was calculated . the new model was always compared to the previous one using the likelihood ratio test . adjusted odds ratios ( or ) the response rate was 80.3% and non - response was related to inability to provide relatives ' consent to participate or being absent of class in the day of clinical examinations . before study intraexaminer reproducibility of the dmft was 0.96 or higher while before study inter - examiner reproducibility ranged from 0.70 to 0.84 . mean dmft , mean number of decayed teeth and the proportion of " caries free " subjects regarding the different ages , genders and race evaluated in this study are shown in table 1 . the mean dmft of the studied sample was 5.48 ( 4.22 ) , while the mean number of decayed teeth was 0.91 ( 1.67 ) and the proportion of " caries free " subjects was 15.5% . no statistically significant differences were observed for mean dmft , mean number of decayed teeth and proportion of " caries free " subjects between males and females . mean dmft and proportion of " caries free " subjects was also not significantly different between " whites " and " non - whites " . however , there was a significant difference regarding the mean number of decayed teeth between " whites " [ 0.76 ( 1.51 ) ] and " non - whites " [ 1.32 ( 2.01 ) ] , p=0.016 . mann - whitney test , p=0.016 the characteristics of the sample , regarding the sic outcome , are shown in table 2 . there was a significantly higher number of subjects that reported toothache in the six months prior to the study among the sic positive subjects ( 47.8% versus 33.3% ) , p<0.0001 . mean dmft ( 9.712.85 ) and mean number of decayed teeth ( 1.672.18 ) of the sic positive subjects were significantly higher than the mean dmft ( 2.882.17 ) and the mean number of decayed teeth ( 0.450.87 ) of the sic negative subjects , p<0.0001 . the only variable associated independently with the sic positive outcome was the toothache reported within the six months prior to the study [ or=1.83 ( 95% ci : 1.08 to 3.12 ) ] , ( table 3 ) . although dental caries has been the most commonly investigated oral disease , most studies focus on children , and studies on caries among adolescents and young adults are scarce27 . the lack of basic epidemiological information about dental caries among adolescents constitutes a serious limitation due to two main reasons . firstly , to keep an adequate surveillance of dental caries it is important to know its behavior in all age groups . secondly , with the decline of dental caries in several countries , including brazil , the chances of extending oral health care to other groups of the population , such as adolescents and young adults , increased significantly10 . the first national brazilian study with 15 - 19 year - olds was performed in 1986 and reported a mean dmft of 12.70 for brazil , and 12.40 for the southeast region , which includes santa brbara d'oeste20 . when the mean value of dmft in 1986 is compared with the mean dmft for the 15 - 18 year - olds of santa brbara doeste in 2002 , a clear decrease in the prevalence of dental caries is observed , confirming a tendency observed in several industrialized countries . when the values for the 15 - 19 year - olds from the state of so paulo in 2002 are evaluated ( mean dmft=6.44)5 , the same tendency of a decline in the caries prevalence is observed . when the variable race was categorized as " whites " and " non - whites " , a significant association between " non whites " and the mean number of decayed teeth was observed ( mann - whitney test , p=0.016 ) . these results are in accord with the results from a study performed by our group in pre - school children of piracicaba6 , a city located close to santa brbara doeste where the mean number of decayed teeth among " non - whites " 5 - 6 year - olds was observed to be significantly higher than the mean number of decayed teeth among " whites " . these findings indicate that further studies are needed to evaluate the association between untreated caries experience and deprived populations in brazil , as well as the variables influencing this complex relationship . similarly to our study , a survey with north american adults21 showed a disproportional distribution of caries in different races . the findings of this study showed that afro - americans were more likely to have untreated dental caries than non - hispanic whites , even after controlling material factors , such as poverty , education and employment , and behavioral factors , such as marital status , tobacco use , alcohol use and obesity21 . the findings of our study indicate that the only variable associated with sic was " toothache reported in the six months prior to the study " . in addition , socio - demographic variables were unable to explain the outcome ( i.e. , were not significantly associated with sic ) , contradicting , in this age group , the previous evidence that demonstrated an association between sic and socioeconomic status in a brazilian population of 11 to 12 year - old childen,1 . further studies are needed to elucidate which variables are associated with inequalities in caries distribution in brazilian adolescents . the association between " toothache reported in the six months prior to the study " and sic among the 15 to 18 year - olds of santa brbara d'oeste may be due to the difficulties in accessing dental services because in this age range students are no longer target of oral health care and prevention programs carried out in the schools27 . there is some research - based evidence supporting this hypothesis . in a study performed with 11 to 12 year - olds in the state of so paulo , brazil , another feasible explanation to our results lies on the fact that dental pain itself is a result of progressive and untreated dental caries , which was also significantly more prevalent among sic positive adolescents in our study . this hypothesis is supported by the findings from a study performed in a sample of young male adults in brazil where previous history of dental pain was a risk indicator of untreated dental caries3 . thus , the results must be interpreted with caution , since dental pain is not a cause for caries , but caused by its progression into dentine and pulp . although socioeconomic factors played a significant role in the reduction of dental caries observed in the last decades18 and that several evidences indicate that caries is polarized among underprivileged groups9111328 , our findings do not support the association between socioeconomic variables and caries polarization , as represented by sic , in the population of15 to 18 year - olds evaluated in the city of santa brbara d'oeste . this might be due to difficulties in accessing dental health services , as discussed above , or a result of methodological weakness of our study , since we evaluated only students from public schools , known to represent a homogenous group of adolescents in brazil . the lack of students from private schools represented an important limitation of our study because generalization of results is affected by the fact that only students from public schools were evaluated . students from private schools were not included because there were few subjects attending such schools and also because they did not represent the users of the public dental health services in the city , and the data gathered from study were intended to be used in the planning of public health policies and actions by the department of heath of santa barbara d'oeste . an analysis to assess if non - participants differed significantly from participants in terms of socio - demographic variables was not carried out and the effects of non - participants should be taken into account when interpreting the results from this study . there are several findings in the literature , including evidences from brazilian studies8,23,25 , indicating that self - perceived oral health , dental health behavior , and motivation to dental hygiene among adolescents are influenced by the societies to which they belong15,16,26 . although significant differences were observed regarding caries levels when adolescents were grouped by their sic status , most subjects from both groups rated their oral health as good ( table 2 ) . these findings are in accordance with the literature that shows low predictive values and sensibility of self - rated oral health measures , when compared with dental treatment needs of adults22 and normative evaluations ( e.g. complete clinical exams ) of young adults29 . the fact that the words pain and disease have a common etymologic origin in portuguese ( in latin pain is dolor and disease is dolentia ) is , by itself , representative of the intimate relation that exists between pain experience and the recognition of a disease by a subject7 and may help explaining the significant association between the variable " reporting toothache in the six months prior to the study " and sic observed in the present study . the findings of this study showed , concerning the population of adolescents from santa brbara d'oeste , that the sic was significantly associated with the " report of toothache in the six months prior to the study " , even after controlling of confounders . in conclusion , further studies are needed to elucidate the other factors associated with inequalities in the distribution of dental caries among adolescents , including adolescents from private schools in order to allow generalization of results based on large and representative samples of adolescents and focusing on the role of the access to dental health services because this is the age range in which students are no longer a target of oral health care and prevention programs .

a 61-year - old man presented with a swelling on the palmar aspect of the right thumb , at the level of the interphalangeal joint . the patient had noticed the emergence of a soft swelling after sustaining a benign trauma 3 months earlier . the patient experienced pain on movement . on clinical exam , the mass was soft , freely mobile , and painless on palpation . evaluation of the swelling by ultrasound showed a 1.4 cm well defined homogeneous and mildly hyperechoic lesion abutting the ulnar collateral ligament of the interphalangeal joint . differential diagnosis based on imaging characteristics included , amongst others , giant cell tumor of tendon sheath , nerve sheath tumor , and granuloma . resection of the mass was performed at the operation room under local anesthesia and light sedation . we identified a white nodular encapsulated lesion of 1.5 cm that was in contact with the medial collateral nerve . the patient had an uneventful postoperative course , particularly with no paresthesia of the medial aspect of the thumb . lipoma is by far the most common soft - tissue tumor , nearly accounting for 50% of all soft - tissue tumors and approximately 16% of soft - tissue mesenchymal tumors . most common locations are in the upper back , neck , shoulder , and abdomen . however , they rarely present in the hand with a reported incidence of 1% , and they often arise in the thenar or hypothenar regions . lipomas occur most commonly in the fifth and sixth decade and are more frequently encountered in women . de la cruz monroy in her literature review identified 36 cases of digit lipomas since stein published the first lipoma of the finger in 1959 [ 3 , 7 ] . moreover , in terms of location , only few cases affected the thumb and all these cases have presented with pain or restricted motion as did our patient [ 4 , 79 ] . we noted that all patients were males : two were infants ( 8 and 9 years old ) and two were adults ( 53 and 70 years old ) . according to world health organization , lipomas are categorized into 9 entities , one of which is spindle cell / pleomorphic lipoma . however , no case of spindle cell lipoma of the thumb adherent to the digital nerve has been reported in the literature . presented a rare case of spindle cell lipoma adherent to the digital nerve in the palm . this subtype of lipoma is a mixture of spindle cells , adipocytes , and collagen bundles and presents with an infiltrative pattern . knowing that it can be misdiagnosed with a liposarcoma , it is important to know that it can appear in that location . patients are often uncomfortable from limitation of mobility once they reach a significant size [ 2 , 5 ] . our patient in fact presented with both symptoms of pain and flexion limitation ( approximately 20 of ip flexion ) . in fact , lipomas may be superficial arising from the subcutaneous fat or less commonly subfascial , where they can have a larger size [ 5 , 6 , 12 ] . differential diagnosis for a swelling in the hand is a large spectrum including neoplastic and nonneoplastic lesions . however , the most common lesions are ganglion cyst , inclusion cyst , and giant cell tumor of tendon sheath [ 2 , 3 ] . imaging studies ( ct scan and mri ) appear to be diagnostic in 71% of the cases [ 2 , 4 ] . in our case in fact , in their retrospective study on 62 subjects with tumor - like finger lesions , horcajadas et al . found that mri can provide a highly accurate diagnosis in more than 80% of the cases . treatment depends mainly on the degree of functional impairment as well as on the cosmetic appearance . surgical resection is the gold standard and requires extensive dissection to prevent recurrence . in our case , the postresection recurrence rate of these subcutaneous lipomas is found to be less than 5% [ 1 , 4 ] . with an adequate marginal resection our case adds to the previous ones and reminds us to always consider a benign lipoma in our differential diagnosis in swelling of the thumb , even though it is a rare entity .

lions ( panthera leo ) formerly ranged throughout africa , the middle east , and southwestern asia [ 14 ] . in recent prehistory up to 2500 bc , lions persisted in europe as far north as bulgaria , hungary , ukraine , italy , and spain with some still sighted in greece into early historic times before their eventual extinction [ 5 , 6 ] . populations found at extremes of the range were traditionally considered distinctive geographic groups and given colloquial names including the cape lion in south africa , the barbary lion in north africa ( morocco , algeria , tunisia , and libya ) , and the asiatic lion in the middle east through india . the asiatic lion is currently the only population listed as a subspecies ( p. l. persica ) by the iucn and cites although the species taxonomy for lions is under review by the cat classification task force of the iucn ssc cat specialist group . the range and population size of lions have significantly declined over the past 150 years . south african cape populations were extinct by the mid-19th century and north african lions had disappeared by the mid-20th century [ 2 , 8 , 9 ] . the asiatic lion disappeared from syria , turkey , and iran in the 19th century , held on longer in iraq until the 20th century [ 5 , 6 ] , and , despite approaching extinction , still survives as a population of several hundred animals in the gir forest and adjacent pockets of habitat down to the shores of the arabian sea in the state of gujarat , india [ 7 , 10 ] . today , west and central african lion populations survive in small isolated groups and have declined significantly in recent decades . the last strongholds for lions are in eastern and south - eastern africa [ 3 , 11 ] ( figure 1 ) . traditionally , the subspecies status of populations of lions was determined by hunters , naturalists , and scientists , largely on the basis of morphology and geography , and consequently the historical taxonomy of panthera leo has previously been quite complex , only now becoming clearer through recent advances in molecular research [ 1214 ] . barbary lion of north africa was familiar to historical writers in europe due to the proximity of wild populations . the transport of wild lions to gladiatorial events of the roman period and later menageries of medieval europe imprinted the barbary lion in popular culture , art , and literature . the morphology of those animals , the shaggy mane and forequarters , became the model for lion images in mosaics , heraldry , pottery , paintings , and sculpture . north african lions are intriguing to scientists , natural historians , and conservationists being perceived through morphology and behavioural ecology as the most distinctive of all lion populations [ 15 , 16 ] , living in temperate , forested montane habitats of north africa 's maghreb region . the north african maghreb is the region isolated from the rest of nonarid africa by the sahara and forms the southern extent of the mediterranean biodiversity hotspot . this is a region of high species endemism as well as an unusual mix of african and eurasian species ; however , lions have not existed in the wild in north africa since the late 1950s [ 2 , 8 ] . whilst the habitat in the maghreb is now thought to be largely unable to support the needs of lions , leopards still appear to survive in the region . the interest in a potential reintroduction of lions to north africa carries a broad conservation [ 16 , 19 , 20 ] and scientific [ 8 , 17 ] and cultural significance [ 19 , 21 ] , and the topic regularly surfaces both within conservation circles and the wider media [ 15 , 2225 ] . the north african barbary lion 's recent extinction history and the impact of human encroachment into its former range have been well documented in the literature . the loss of lions from north africa repeats a similar pattern of anthropogenic decline observed in europe in ancient historical times ( including across the caucasus and areas around the caspian sea ) and later through the countries of the eastern mediterranean and across the middle east since medieval times [ 2 , 6 ] . the north african lion decline also resonates with the challenges faced today by dwindling lion populations in west and central africa [ 11 , 26 , 27 ] , where a small , dispersed population of around one thousand animals is perilously close to extinction , including several extremely vulnerable isolated subpopulations of perhaps ten or twenty animals approaching imminent demise [ 26 , 27 ] . an examination of the significance of north africa 's barbary lion , its relevance to global lion conservation , and potential place in contemporary conservation of north africa and the wider continent is overdue . scientific understanding of how the various lion populations are related is now becoming clearer , based upon the findings from recent molecular genetic studies [ 12 , 14 , 28 ] . north african ( barbary ) lions were previously connected to other populations through the mediterranean basin and the nile delta eastwards and transient corridors south occurring during changes in saharan climate but ultimately became separated by the sahara desert to the south and the later rise of the egyptian empire to the east 4000 years ago . the historical north african lion is , however , an important ecological link between the last surviving lions in india and the dwindling west and central african populations . aside from earlier recorded histories of the roman and medieval periods , sightings of lions in north africa were regularly documented by travellers from the 16th century in the lowland northern coastal plains and forests and the rif mountains of morocco as well as the coastal forests of algeria and tunisia ( figure 2 ) . as 19th century travellers later ventured into remoter areas such as the tell atlas of northern algeria , the higher altitudes of the middle and high atlas mountains of morocco , and further south into the saharan atlas range and into remoter saharan fringes , lions were encountered and found to be familiar to local people . land encroachment by human communities from the 1600s across northern libya , tunisia , algeria , and morocco led to the final extirpation of lions from north africa by the mid-20th century [ 2 , 8 ] . lions finally disappeared from the maghreb due to a combination of human pressures on the landscape and direct extirpation , a loss which occurred , therefore , just a few decades before the emergence of the modern postcolonial period of wildlife conservation . the possibility of restoring the animal back to the region has nevertheless been debated at least since the 1970s [ 16 , 22 , 25 ] . to justify and support lion conservation management by way of translocations , reintroduction , or captive management , it is important to define distinctive populations of animals , also referred to as evolutionary significant units or esus . recent molecular advances have enabled traditional taxonomic classification of lion subspecies to be simplified significantly . the latest studies suggest to the iucn that panthera leo should be split into two groups ; the first is wild populations found ( whether in part , formerly , or currently ) in north africa / asia , west africa , and central africa , which should be considered panthera leo leo , whilst the second group in southern africa , east africa , and north east africa should be considered panthera leo melanochaita . at the very least , each population within these groups should be managed as an evolutionary significant unit ( esu ) [ 11 , 12 , 33 ] . in general terms , historical populations of north africa 's barbary lion would therefore be considered within the modern taxonomy for panthera leo leo and within this context considered as an evolutionary significant unit ( esu ) based on geographical location . in the absence of a wild population in north africa today , contemporary conservationists argue that lions should be restored as an apex predator to balance the ecosystems of the region . potential candidates for reintroduction would include either their nearest relatives from india or possible putative barbary lions in captivity should they be proven to be authentic . despite the disappearance of animals in the wild , debate surrounding the possibility of extant representatives of north african lions in captive collections has continued for decades without resolution . in morocco , a collection of lions , traditionally trapped and presented to the sultan by the local berber tribes who inhabited the surrounding region , have been held at the royal palaces for centuries . it is not definitely known whether today 's descendants of these animals ( hereafter termed moroccan lions ) represent the wild north african lion or only partly descended from wild north african stock or are indeed completely unrelated to wild north african lions . previous attempts to address the issue of identification were led in the 1970s by helmut hemmer and paul leyhausen . in the absence of pedigree information , hemmer and leyhausen instigated a breeding programme for moroccan lions to select against foreign allele introgression by determining external characteristics and by checking skull features in respective breeding lineages . whilst historical accounts of north african barbary lions often paid attention to the luxuriant mane and other morphological features , there is no strong evidence that these particular traits were definitive [ 4 , 15 ] . cases of morphological identification of captive lions are confounded by the effects of nutrition , testosterone levels , abrasion or wear , and climatic effects on mane growth . it has been suggested that these variables could contribute up to half of the observed variation in manes . in the late 1980s when genetic research appeared to suggest that all lions ( including asiatic lions ) shared a common ancestor , many zoos stopped their involvement in captive conservation efforts with moroccan lions and several zoos which previously bred moroccan lions abandoned their programmes , as a result of difficulties in obtaining new breeding stock ( a harland pers . comm . ) . nevertheless , aside from the animals that descended from those known to hemmer and leyhausen , other captive lions suspected of being of direct north african ancestry have since periodically surfaced in zoo collections and circuses despite the lack of evidence to confirm whether these captive animals are authentic representatives . fairly recent claims have since been made for the barbary origins of captive lions in addis ababa zoo , using morphological comparisons ( mane size and appearance ) noting the possibility that their forebears were a gift from the king of morocco to the emperor of ethiopia . interestingly , recent genetic work suggests that these captive ethiopian lions are actually a distinct subpopulation in their own right . the most plausible prospect is that animals derived from the king 's collection in morocco are the most likely wild descendants from north africa . although zoo - based efforts to breed moroccan lions were temporarily halted in the 1980s and 1990s , the work was revived and improved in 2009 with the development of a scientifically based studbook breeding programme in european zoos . this work stimulated interest amongst zoos to transfer and breed the animals , establish new collections , and enable the captive population to survive . the captive population has since demonstrated improved breeding success and several zoos have new breeding groups . however , there is a possibility that some individuals in the original moroccan collection bred with lions of non - north - african descent before the 1960s ( a. harland pers . whilst this raises the chance of a watered - down genotype across the current captive population , this hypothesis is currently untested and the facts are therefore unknown . in the absence of definitive diagnostic molecular genetic techniques , including investigation of paternal bloodlines , neither the distinctiveness of moroccan lions ( or indeed any other candidate animals ) nor their authenticity as true north african lions has been established . nevertheless , if the non - north african animals were close relatives of lions from india or west or central africa , their offspring would remain authentic representatives of panthera leo leo within the iucn 's proposed classification . if moroccan lions were genetically designated within panthera leo leo ( west africa , central africa , north africa , and india ) , then as a captive group they become significant . the current known population for the p. l. leo group , accounting for known asiatic lions in captivity ( n , circa 100 ) , plus 400 in the wild in india itself , with perhaps 250 individuals in west africa [ 3 , 40 ] and around 1000 in central africa [ 11 , 41 ] , forms a total of perhaps 1750 individuals worldwide under the proposed designation of panthera leo leo . the additional captive moroccan lions ( n = circa 100 individuals ) would represent a significant proportion ( > 5% ) of the extant genome for the designated subspecies . this captive moroccan lion group is also unusual since the original menagerie curators and subsequent zoos have kept the animals separate from generic zoo lions ( i.e. , other lions largely of east african descent ) for nearly 50 years . currently , the understanding of genetics in lions lags somewhat behind equivalent knowledge for leopards , jaguars , and tigers . historically , the study of lions was largely focused on qualitative assessments of morphology . it is possible that genetic divergence between lion populations was accelerated due to isolation caused by geographical changes and human habitation , but evidence suggests that traditionally observed variation in morphology is greater in larger bodied mammals , and phenotypes ( both morphology and behaviour ) may be affected by genetic drift , such as the increasing presence over the last 150 years of certain cranial characteristics in asiatic lions . the past decade has seen increasing clarity on the relationships between lion populations through the application of molecular techniques . [ 4345 ] using the mitochondrial cytochrome b region ( which codes for an enzyme involved in the respiratory chain complex ) and a short 130 bp strand of mtdna in the hypervariable noncoding control region . the latter is useful in retaining genetic variation since it is a nonfunctioning dna sequence unaffected by selective pressures . the identified haplotypes generated a phylogeographic distribution of lion populations , based on 32 origin - known lions ( both contemporary and ancient museum specimens ) . modern lions showed 13 variable sites across the control region enabling reconstruction into phylogeographic groups including west africa , eastern sahel ( steppe / savannah areas south of the sahara ) , eastern - southern africa , southwestern africa , and north africa - asia ( figure 3 ) . microsatellites ( noncoding , repeating variable patterns of dna base pairs ) have also been used alongside mtdna analysis in a number of studies to differentiate lion populations and infer evolutionary history of the species [ 14 , 46 , 47 ] . improvements in molecular technologies have , however , encountered a number of practical limitations including a lack of reference samples or the necessity to sample captive animals of dubious provenance . first , the reliance on maternally transferred haplotypes in samples of suspected nontarget origin continues to confound a complete genomic understanding . secondly , the earlier microsatellite studies of samples from across africa and india included animals of putative north african origin but lacked samples from west africa . even antunes 's promising recent study of genetic information left by lion feline immunodeficiency virus ( fivpleo ) within host lion populations could only consider sub - saharan african lions , since asiatic lions were found not to have the virus and ancient samples from north africa were not accessed . the most recent studies have been able to move towards a clearer consensus , particularly that extant populations of lions from west and central africa ( plus india ) should be considered distinct from lions in southern and east africa [ 13 , 14 ] . . 's extensive study generated a phylogeny with lions grouped into two well - supported clusters : north , west , and central africa plus india ( 6 haplotypes ) and eastern and southern africa ( 14 haplotypes ) . the former group was itself subdivided into three clusters : the indian gir forest , north and central africa , and west africa . lions from eastern and southern africa were collectively more weakly clustered together , for example , lions from botswana appearing in both eastern and southwestern clusters . this work was able to identify a stronger basis for considering the genetic relatedness of lion populations when considering and enacting translocations as part of active population management . furthermore , the study highlighted the extensive natural movement of lions between eastern and southwestern clades and its implications on conservation management in those regions . from this , dubach et al . ( 2013 ) proposed that there were two principal clades of lions which should be recognized as p. l. leo and p. l. melanochaita . [ 13 , 14 ] conducted further analysis of over 100 samples across the species ' range , to generate a phylogeny that also challenges the traditional taxonomic split of african lions and an asian subspecies . they further argue , in an analysis which builds on historical studies by earlier authors [ 12 , 45 ] , that the traditional taxonomy does not satisfactorily reflect the overall genetic diversity that can be observed across modern lion populations . additionally identified emerging consistencies in phylogeographic patterns described by both autosomal markers and mtdna studies suggesting genetic lineages which should be prioritised to conserve genetic diversity [ 13 , 47 ] . their analysis of 20 microsatellites and 1,454 bp of mitochondrial dna in 16 lion populations across the entire geographic range of the species identified four major clusters from both types of markers : west / central africa , eastern africa , southern africa , and asia / north africa [ 14 , 47 ] . the pattern of clusters identified in these extensive population genetics studies suggests a possible ice age extinction of lions from west and central africa , followed by recolonisation of the region by lions from refugia in the middle east [ 14 , 21 ] . in effect , this creates a taxonomic split into two subspecies : a north group of p. l. leo ( india , west africa , and central africa ) and a south group of p. l. melanochaita ( southern africa , east africa , and north east africa ) [ 12 , 14 , 28 , 32 , 47 ] . previous research including genetic analysis infers that lions from the rabat zoo supposedly descending from barbary lions have a complicated history including a suggestion that they originated in west or central africa instead [ 12 , 14 , 28 , 43 ] . suspected that a central african haplotype in many captive lions of supposed moroccan origin was due to introgression . an alternative , untested , and least likely hypothesis is that the remaining animals derived from the moroccan royal collection were never of north african origin ( somewhat improbable due to the particular efforts made to keep them as a distinct group over centuries and certainly over many recent decades ) . a third , untested but relevant possibility is that moroccan lions carry haplotypes consistent with central africa simply because they are historically part of the same broad population ( i.e. , north africa , west africa , central africa , and india ) . this latter situation is currently difficult to test since the number of museum reference samples is so small and therefore less likely to be representative of all haplotypes present across the original north african population . so whilst mitochondrial dna studies on a small number of animals from the moroccan royal lion collection have demonstrated that these individuals cluster with lions from central africa [ 12 , 13 ] , an additional word of caution should be expressed . the studies are to date based on tiny samples of particular individuals and not a systematic sampling of all moroccan lions across all bloodlines in the moroccan lion studbook . the studbook includes 12 founder bloodlines across the whole captive population , yet only two or three of these bloodlines have been analysed in dna studies to date [ 12 , 13 , 21 , 43 , 46 ] . also , since mitochondrial dna expresses maternal lineage only , any retained paternal genotype that could include north african heritage remains undetected . the number of moroccan lions ( all held in captivity ) is under 100 animals , well below the 1000 or so individuals which is regarded as the lower limit for an effective , sustainable population . moroccan lions as a group are therefore vulnerable to the normal threats associated with small populations , amplified by the restrictions of the dispersed captive environment . in terms of population management , expansion of the captive breeding project reduces these risks as well as maintaining appropriate gender balances for future breeding . an additional complication occurs where some groups are dominated by particular breeding pairs resulting in lack of normal pair selection that would be experienced in the wild , causing a potential skew in the genetic structure of the population . the moroccan lion group has likely undergone a genetic bottleneck , due to the establishment ( or sometimes historic shrinkage ) of the population to a small number of individuals from which the subsequent existing population is founded , largely imposed by the limitations of captive breeding . within a bottlenecked population , inbreeding may have occurred which could skew genetic characteristics ( genetic drift ) due to limitations in parental heritage . one - off haplotype is retained in the population due to the imposed breeding bottleneck whereas in a larger population the genotype might otherwise dissipate and possibly disappear . another possibility is that introgression with introduced lions from outside morocco has caused expression of a haplotype for another geographical region which is , as yet , not identified within literature . for example , barnett et al . concede that to date little data exists for other populations of lions from the sahel ( i.e. , the immediate sub - saharan region ) . burger and hemmer report an analysis of cytochrome b extraction for a cub from neuwied zoo , germany , born of parents taken from the moroccan collection . their genetic results suggest this individual is more similar to asiatic lions ( p. l. persica ) than sub - saharan lions . however , yamaguchi argues that , in the absence of a comparison of this sequence with ancient dna from known barbary lion specimens , it is difficult to conclude that the neuwied zoo cub is true ( i.e. , of direct wild north african descent ) . also , the comparison sequences used by burger and hemmer did not include lions representing regions such as the sahel , so the difference in the cub could be due to non - north african genotype . variation in cytochrome b ( an mtdna region of approximately 1300 base pairs ) is very low across lion populations as would be expected , since the region codes for a protein necessary for electron transport within cells so variation over time ( mutation rate ) is very low . cytochrome b is commonly used in phylogenetic reconstruction and is useful in initial matching of samples with lion mtdna documented in genbank and has enabled various lab protocols to be established and the outputs to be verified . to date , control region sequence has been essential to explore regional variations in origin - known lions , due to it being a noncoding mtdna region and therefore able to accumulate greater mutational variation without being purged from the genome due to deleterious effects . although haplotypes in a 130-base pair strand of control region have been used as identifiers of differentiation in lion populations of known origin [ 12 , 43 , 44 ] , emerging genomic analyses are likely to provide a better understanding of taxonomic differences in the future . the north african barbary lion remains an enigma , recently extirpated , less accessible even to established ancient molecular genetic techniques ( due to the small number of available samples ) , and tantalisingly out of reach to modern conservation interventions . clearly , as apex predator , the species had an important role in north african ecosystems and its cultural importance within north african countries and their near neighbours around the mediterranean suggests that the lion is a potential flagship for conservation of the maghreb region . to date , the insufficient evidence to count or discount the relevance of putative descendants , particularly the captive moroccan royal lions , does not change this expectation . the evolutionary importance of finding representatives who could form the basis of a recovered north african population is significant , since the only other representatives of the northern lion clade ( which the iucn suggests as panthera leo leo ) are either the few hundred asiatic lions living wild in gujarat or those captive in asiatic lion studbook programmes or the few hundred wild animals dispersed at low densities across west and central africa . these highly threatened populations , particularly the micropopulations in west and central africa , form a group that is distinct from the bulk of global lion populations , found in eastern and southern africa [ 12 , 14 , 32 , 43 , 45 , 47 ] , so active conservation planning and systematic intervention for the former group are in any event paramount . next - generation sequencing methodologies offer opportunities to examine single nucleotide polymorphisms ( snps ) between members of a species . snv / snp genotyping techniques may hold an important role in determining the lion genome to an extent where regional populations can be identified as has been demonstrated in other fields . important early snp work to date with lions by bertola has so far confirmed the proposed north / south division in lion classification which has been proposed to the iucn . snp methods have also been applied in other felid populations that comprise potentially introgressed individuals providing opportunity to weed out introgressed individuals from the moroccan lion population . snp techniques have already been used as part of local population management and breeding control in captive lion collections against degenerative diseases . although viral dna analyses of the type used in fiv analyses offer potential to overcome some of these shortfalls , the ancient reference samples held in museum collections might not offer suitable viral material within lion samples for application of those techniques . since no lions exist in the wild in north africa today , the essential limiting issue with all of these advanced genetic techniques is the reliance on access to recovered dna from verified origin - known ancient museum specimens , which are themselves extremely rare . as yamaguchi points out , currently , there are no possibilities of identifying the true status of living putative representatives of the north african lion without either ( i ) comparison directly to lions of known north african origins ( through ancient dna from museum samples ) or ( ii ) comparison with samples from all extant lion populations . although mitochondrial dna analyses continue to provide insights into the evolutionary history of lions and regional variances [ 43 , 45 ] , these diagnostic tools are limited to the maternal line of descent , the differentiating haplotypes being sourced in mitochondrial dna . examination of paternal measures of biogeographical origin in lions ( through genomic dna ) will be important for future research investigation . although better diagnostic examination of lion clades can be made by further exploring mitochondrial dna building on haplotypes identified by barnett et al . [ 12 , 43 , 45 ] , future use of genomic dna is more likely to enable significant progress in differentiating lion genotypes . in terms of the captive moroccan lion population , to date , the findings from a small number of mtdna isolates suggest that the genetic characteristics of moroccan lions contrast with other lions of known origin [ 12 , 50 ] . further exploration should be conducted to validate these assertions and to compare results with a wider sample of individual lions . yamaguchi notes the importance of ex situ conservation of the lion to support retention of its genetic diversity . for example , the mtdna haplotype within cytochrome b of the neuwied moroccan royal lion is not found in any wild lion population so far tested ( only in one origin - unknown zoo lion ) . it is possible therefore that genetic characteristics lost from wild populations may continue to survive in captive animals . this increases the potential importance of restoring the zoo population of moroccan lions and better understanding of their genetics relative to wild lion populations and the conservation management implications of that knowledge . in any event , lion populations are in dangerous decline across their range , with the iucn suggesting a 43% population decline between 1993 and 2014 noticeable even in the past 1015 years , most particularly in west africa . it is a remarkable , albeit somewhat uncomfortable , fact that the 90-or - so moroccan royal lions recorded in the eaza studbook represent a population in the same order of magnitude as the global captive asiatic lion studbook population , perhaps only one - half the size of the wild population in west africa and one - quarter the size of the wild population in india . the preservation of the iucn designated panthera leo leo esus and the entire lion genome globally ( both in situ and ex situ ) is vitally important in the species ' future conservation . on a practical level , the small size of the target zoo population of moroccan lions means that , to preserve genetic variation , a key requirement will be to equalise founder representation and maximise effective population size and genetic studies will help to determine these decisions . however , the potential restoration of an authentic north african barbary bloodline as an esu , through some form of backbreeding of moroccan lions , might itself also be possible and is not entirely without precedent . recent developments in molecular methodologies mean that genetic approaches could support selective breeding if sufficient genetic characteristics can be defined for the true north african ( barbary ) genotype . nevertheless , if the breeding of moroccan lions in captivity is deemed worthwhile , by inference and precedent in conservation practice , that breeding programme should be purposed towards the ultimate reintroduction of the animals into the wild . this could ultimately influence the preservation of lions across their precarious northern ranges in india , west africa , central africa , and , potentially , north africa itself . if potential representatives of north africa 's barbary lion still persist in zoo collections , then efforts to conserve its genotype are justified . provisional research should focus initially on which origin - known haplotypes [ 12 , 45 ] can be identified within moroccan lions , particularly the various bloodlines in that small population . it may also be prudent to investigate the collection of lions at addis ababa and other putative barbary lions as these may prove to be closely related to the last lions of west and central africa and india . more importantly , future genomic investigations should explore the relative relatedness of captive moroccan lions versus wild lion groups . in terms of in situ conservation of lions in north africa , it is also possible to consider whether india 's asiatic lions should be treated as conspecific with north africa 's barbary lions and therefore propose the option that asiatic lions could be used in a future north african reintroduction . precaution would suggest that the status of putative barbary lions , such as moroccan lions , should be definitively established ( or rejected ) from comprehensive genetic understanding of the genome before turning to this alternative source of animals . nevertheless , taking a wider perspective on global lion conservation , the possibility of translocating indian animals to a suitable location in north africa would offer the advantage of a second wild population of the endangered asiatic lion as representatives of the north african - asian clade . if moroccan lions are shown to be relatives of indian , west african , and central african lions , then a new perspective can be taken on their potential use as a genetic pool to support recovery in those regions with the most threatened populations of panthera leo .

idiopathic ( primary or essential ) hypertension accounts for approximately 85% of the cases of hypertension , whereas in rest of 15% of cases , the cause of hypertension is secondary with known conditions that result in blood pressure elevation ( secondary hypertension ) . endocrine hypertension accounts for approximately 3% of the secondary hypertension due to excess production of hormones from various endocrine glands . the importance of endocrine or hormone - mediated hypertension resides in the fact that the cause is clear and can be treated surgically in most of the cases . the surgical intervention may result in complete cure , obviating the need for lifelong antihypertensive treatment . the need of imaging is obvious in patients with secondary hypertension and may be an integral part of clinical decision making . moreover , in younger age group , therefore , it is prudent to pursue diagnostic imaging in young patients with hypertension . with the advent of more sophisticated diagnostic imaging techniques , computed tomography ( ct ) , magnetic resonance imaging ( mri ) , ultrasonography ( usg ) , and various nuclear medicine imaging techniques can be used to evaluate the adrenal , thyroid and pituitary gland . imaging is necessary in the problematic case in which the clinical and laboratory data support the possibility of endocrine hypertension . this article focuses on those abnormalities where radiological imaging plays a paramount role in establishing a firm diagnosis . below is an outline of abnormalities that are frequently encountered in clinical practice , presenting with endocrine hypertension . hyperfunctioning adrenal medullary neoplasm pheochromocytoma hyperfuntioning adrenal cortical neoplasm aldosteronoma cushing 's disease congenital adrenal hyperplasia ( cah)hyperthyroidismhyperparathyroidismacromegaly hyperfunctioning adrenal medullary neoplasm hyperfuntioning adrenal cortical neoplasm aldosteronoma cushing 's disease congenital adrenal hyperplasia ( cah ) this discussion will focus mainly on the role of imaging in evaluating the causes of hypertension listed above . pheochromocytoma arises from the adrenal medulla which secretes excess catecholamine leading to hypertension and palpitations . it is commonly known as 10% tumor as it is bilateral , extra - adrenal and malignant in 10% of patients . the clinical diagnosis is suspected in a younger patient with hypertension , which can be established by measuring free plasma or fractionated urinary metanephrines and normetanephrines , with sensitivities ranging from 89 to 100% . whenever the clinical suspicion is very high in corroboration with laboratory data , multi - detector computed tomography ( mdct ) [ figure 1 ] is usually performed to exclude an adrenal mass . once the adrenal mass is demonstrated , surgery is usually the next treatment after adequate control of the blood pressure . paraspinal and organ of zuckerkandl close to aortic bifurcation also need to be evaluated properly to exclude extra - adrenal mass which is preferably known as paraganglioma . approximately 35% of extra - adrenal pheochromocytomas are malignant as opposed to approximately 10% of those arising in the adrenal gland . multi - detector computed tomography showing large heterogeneously enhancing necrotic left supra renal mass which was confirmed to be malignant pheochromocytoma at histopathology usg has proved its accuracy in detecting pheochromocytoma confined to the adrenal , as these are usually large and well - marginated masses . in a small series , histopathologically confirmed pheochromocytomas appeared both homogenous [ figure 2 ] and heterogeneous , the later appearance being characterized by areas of hemorrhage and necrosis . however , usg has limited role in detecting small adrenal tumors and extra - adrenal pheochromocytomas such as those found in the retroperitoneum . large , well - circumscribed , homogenous mass in the left adrenal ; biochemical tests confirmpheochromocytoma mri [ figure 3 ] is more specific and may show light bulb sign on t2/stir images due to presence of more interstitial space . mri is also very useful for detecting extra - adrenal lesion to assess the recurrences after surgery . pheochromocytoma : the mass is hypointense ( arrow ) on ( a ) axial t1-weighted image . the mass shows bright signal light bulb sign ( arrow ) on ( b ) t2 axial and ( c ) coronal mages nuclear medicine imaging can be used when ct or mri could not demonstrate a mass in patients with high index of suspicion . i-131 iodine-131-meta - iodobenzylguanidine ( mibg ) and in-111 octreotide are the two radiopharmaceuticals used to evaluate suspected cases of pheochromocytoma . abdominal imaging is performed 2472 hours after iv administration of i-131 mibg , whereas imaging is performed at 4 and 24 hours after injection of in-111 octreotide . when pheochromocytoma is suspected , any focal uptake of i-131 mibg in the adrenal gland is abnormal . the reported sensitivity of i-131 mibg for detection of a pheochromocytoma is 8090% , with a specificity of 90100% , whereas in-111 octreotide has a sensitivity of 7590% . 50% of pheochromocytomas are visualized with both agents , 25% of pheochromocytomas are seen only with i-131 mibg and another 25% are seen only with in-111 octreotide . for malignant pheochromocytomas , 18f - fluorodopamine positron emission tomography ( pet ) appears to be very helpful . the adrenal cortex is composed of three separate zones : the zona glomerulosa ( produces aldosterone ) , fasciculate ( produces cortisol ) and reticularis ( produces androgens ) . for hormone secretion , positive feedback is provided by adrenocorticotropic hormone ( acth ) from the pituitary gland , whereas negative feedback is given by cortisol . cushing syndrome is either acth dependent or acth independent . in cushing disease , which accounts for approximately 80% of cushing syndrome , a pituitary adenoma secretes excess acth that stimulates the adrenal gland to release cortisol . up to 30% of patients may have normal - sized adrenal glands . in 1525% of cases of cushing syndrome , the role of scintigraphy for the evaluation of patients with cushing syndrome is limited , particularly with the advances in ct and mri . adrenal cortical scintigraphy may be performed in patients who have persistent elevated cortisol levels after adrenalectomy . primary aldosteronism is caused by adrenal adenoma in about 80% of cases and is characterized clinically by hypertension and hypokalemia . mdct with thin ( 3 mm ) collimation is usually the first - line imaging examination [ figure 4 ] . chemical shift mri is emerging as one of the most sensitive and specific investigations for differentiating adenoma from non - adenoma of the adrenal gland . adenomas contain abundant amount of intracytoplasmic lipids ( cholesterol , fatty acids and neutral fat ) in clear and compact cells . the chemical shift imaging is used to identify this intracytoplasmic lipid and is the most sensitive and specific mri technique in characterization of adrenal adenoma . out - of - phase imaging reveals loss of signals from these intra - cytoplasmic lipids , which helps in characterizing the adenoma [ figure 5 ] . adrenal adenoma : axial ct image in ( a ) shows hypodense fat containing mass ( arrow ) in the right adrenal . axial ct image in ( b ) shows a lipid - poor adenoma in left adrenal ( arrow ) in a patient with conn 's syndrome adrenal adenoma : axial ct image in ( a ) shows hypodense fat containing mass ( arrow ) in the right adrenal . ( b ) the mass is hyperintense ( arrow ) on fat - saturated axial t2-weighted images although the rest of the fat gets suppressed . ( c ) the mass shows signal drop ( arrow ) on out - of - phase t1 axial image adrenal carcinoma : axial t1w image in ( a ) shows well - defined , large suprarenal mass and axial t2 image in ( b ) shows the mass being hyperintense . abnormal steroidogenesis due to defective 11 beta - hydroxylation is the second most common form of cah . due to excess accumulation of 11-deoxy corticosterone ( 11-doc ) , patient presents with hypertension ( unlike in classic cah ) and hyperandrogenism ( like in classic cah ) . the 17 alpha - hydroxylase deficiency is rarer and leads to diminished production of cortisol and sex steroids . ct or mri findings are nonspecific and show diffuse bilateral enlarged adrenal with preserved shape of the limbs . hyperthyroidism increases systolic blood pressure by increasing heart rate and raising cardiac output . in thyrotoxicosis , patients usually have tachycardia and high cardiac output with an increased stroke volume and elevated systolic blood pressure . approximately one - third of patients with hyperthyroidism have hypertension which often resolves after achieving euthyroidism . usually , the gland is diffusely hyperechoic or may show heterogeneous echotexture [ figure 7 ] . color doppler shows extensive hypervascularity within the gland , also described as thyroid inferno [ figure 7 ] . it can be used to monitor therapeutic response in patients with graves disease as there is decrease in flow velocities in superior and inferior thyroid arteries after successful medical treatment . there is significant increase in vascularity , also described classically as thyroid inferno ( lower panel ) there seems to be a close association of prevalence of systemic hypertension with primary hyperparathyroidism . up to 50% of patients with primary hyperparathyroidism seem to have high blood pressure . interestingly , elevated parathyroid hormone has been reported to be more common among patients with essential hypertension . however , it is arguable that such an association is merely statistical , as more than 50% of such patients will continue to be hypertensive even after a successful parathyroidectomy . it is also worth mentioning that both essential hypertension and primary hypertension are conditions which are more common after 5 decade of life . they appear characteristically oval , but may appear oblong or elongated or even bilobar when enlarged . due to uniform hypercellularity , they are typically hypoechoic , with the echogenicity being substantially lower than the overlying thyroid [ figure 8 ] . note the oval shape , high vascularity ( a ) and hypoechoic appearance ( b ) the prevalence of hypertension in patients with growth hormone ( gh ) excess is approximately 50% and more frequent than in the general population . because gh - secreting pituitary adenoma is the most common cause , mri of the sella is the investigation of choice which provides detailed information about the mass as well as the surrounding structures such as the optic chiasm and cavernous sinuses [ figure 9 ] . pituitary macroadenoma in a patient with acromegaly : coronal t1 ( a ) and axial t2 ( b ) showing a mass in sella with suprasellar extension having figure of 8 appearance . the mass shows avid enhancement in post - contrast coronal t1 ( c ) and axial t1 ( d ) images with central nonenhancing area suggesting necrosis in conclusion , endocrine hypertension is a special clinical entity in which imaging has definite role in its evaluation to guide the endocrinologist as well as the endocrine surgeon . a detailed clinical work with laboratory evaluation will be necessary before shortlisting the radiological imaging procedure which the patient would be subjected to .

common madder ( rubiae tinctorum l. ) is a plant commonly found in southern and southeastern europe , in the mediterranean area , and in central asia . the herb contains many polyphenol derivatives such as flavonoids and anthraquinones [ 13 ] . several years ago its medicinal usefulness was discovered and the root of madder is used for the kidney and bladder stone treatment [ 1 , 3 , 4 ] . the observed activity is due to the presence of polyphenols and polyphenol glycosides which dissolve calcium oxalate , the foremost compound in kidney stones . it was recognized that carbohydrates and polyphenols serve as ligands of the calcium cation with a multiple coordination number . three frequent coordination numbers , mainly 6 , 7 and 8 were observed , but less common numbers ( 5 , 9 , 10 ) are also possible . the high numbers correspond to the second coordination sphere and are possible due to small ligand - ligand repulsions . in general , the bidentate binding is common for these ions [ 79 ] and carboxylates form complexes with calcium in such a fashion . polyphenols , such as curcumin , tannic acid and ( + ) catechin , control the intercellular calcium transport due to complexation of ions . flavonoids , as the most frequent antioxidants , possess ability of chelating of divalent metal . the formation of metal - carbohydrate structures requires an appropriate steric arrangement of at least three hydroxyl groups . according to the general rule : pyranoses in a chair conformation with axial - equatorial - axial ( ax - eq - ax ) or with 1,3,5 triaxial ( ax - ax - ax ) hydroxyl groups or furanoses with three adjacent hydroxyl groups in the cis - cis arrangement are the best coordinating ligands [ 13 , 14 ] . furthermore , the preferred configuration of binding depends of the size of cation ( e.g. , for the ionic radius smaller than 80 pm the ax - ax - ax arrangement is preferred ) . however , it is still not known which of the metal - carbohydrate complex constitutes the most stable moiety . the spectroscopic studies for d - glucuronate , epi - inositol , and l - arabinose were performed in order to characterize the structure of sugar after the ca complexation . the observations lead to the following conclusions [ 1418 ] ( i ) the hydrogen - bonding network of the free sugar is preserved upon the metalation ( ii ) all groups of its or sugar derivatives containing oxygen and water molecules are involved in the metal - ligand bonding ( iii ) usually the -anomer of calcium complexes crystallizes ( iv ) the most common coordination number amounts to eight . the above findings indicate the strong complexing properties of sugar and polyphenols and suggest that the glycosylation of polyphenols can increase their calcium binding ability . the analysis of different fractions of the extract of humulus lupus l. has indicated that fractions richer in glycoside compounds possess better calcium oxalate dissolving properties . moreover , studies on synthetic glycosides have shown that anthraquinone glycosides form stronger complexes compared to that of lone anthraquinones . in the above experiment glycosyl compounds were analyzed as dissolving media of calcium oxalate and inhibitors of the crystals formation . in all studied cases , the sample of glycoside had shown two times higher efficiency compared to one of lone aglycon . additionally investigatios , we have also characterized the complexation of ca by alizarine , one of the most popular anthraquinone , by applying nmr and theoretical dft studies . the results indicated that the metal cation is attached to two hydroxyl groups in the bidentate mode . the studies presented in this work supplement the investigation of caligand complexes for carbohydrate and alizarine glucoside ligands . the calculations presented here were performed applying the density functional theory ( dft ) formalism . the approach is based on the hybrid exchange - correlation functional proposed by becke , lee , yang and parr ( b3lyp ) . the studies applied the standard pople s 6 - 31g(d , p ) atomic basis set [ 23 , 24 ] . thermodynamic properties of studied complexes were calculated taking into account the ideal gas , rigid rotor , and harmonic oscillator approximations . the interaction energies were calculated according to the expression\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \vardelta { e_{{\operatorname{int}}}}={e_{ab } } -\left ( { { e_a}+{e_b } } \right ) , $ $ \end{document}including the correction for the basis set superposition error . because of the large number of potential conformers of glucose the proper selection of starting structures is critical . the formal number of conformers ( 2900 ) may be reduced considering the stereochemistry . the further reduction can be achived taking into account the fact that in the aqueous solution of d - glucose preferably adopts the chair c1 conformation [ 30 , 31 ] . however some additional structures have to be considered , since the coordination of metal may lead to energetically preferred complexes not favored in the case of non - interacting glucose . our selection is based on the carefull work of salpin and tortajada which reports the conformational study for the [ pb(d - glucose)h ] cation . twenty structures , out of 31 presented in their work , were adopted in the present study . the number of conformers is further reduced due to the fact that some of the original conformers differ only by the place of deprotonation . the selected structures of glucose and alizarin constitute the reasonable starting point for designing the glycoside of alizarin . the nomenclature applied in this work is the same as one developed in the paper , where the name of particular complex contains the anomer type ( or which are identified here as a or b ) , the type of conformer , the position of the hydroxymethyl group ( gg , gt , tg ) and labels of glucose ( table 1 ) or glucoside ( table 2 ) atoms coordinating calcium . additionally , some structures are characterized by the dihedral angle f - c1-o2-c2 ( in parenthesis).table 1the number of contacts ( n ) , relative interaction energy ( eint ) , relative enthalpy ( h ) and relative free enthalpy of the complex formation ( g ) for glucose - ca cation and the mulliken atomic charge on the ca center . the lowest interaction energy of 178.0 kcal mol in the -glucose - ca complex in s2 and cefa sequence constitutes the reference levelneint heint-hgatomic charge on caa_glc_os2_gt_efa_ca320.115.44.714.51.535a_glc_5s1_gg_dfa_ca322.423.10.723.01.545a_glc_os2_gg_efc_ca325.314.410.914.91.519a_glc_25b_tg_dfa_ca325.525.30.224.21.551a_glc_4so_gt_efa_ca327.722.15.621.11.558a_glc_1c4_gt_efa_ca330.522.58.022.31.553a_glc_4c1_gt_efa_ca330.518.412.117.31.545a_glc_4c1_tg_cd_ca234.522.312.222.01.611a_glc_4c1_tg_de_ca242.431.411.030.21.610a_glc_4c1_tg_bc_ca245.927.218.726.71.629a_glc_4c1_tg_ab_ca251.534.716.833.71.588b_glc_os2_gg_cefa_ca40.00.000.01.486b_glc_5s1_gt_efa_ca317.918.70.818.11.550b_glc_1c4_gt_efa_ca326.520.16.420.11.554b_glc_4c1_gt_efa_ca327.020.07.018.31.563b_glc_4c1_gg_efa_ca327.118.19.017.01.551b_glc_4c1_tg_cd_ca238.923.915.023.61.614b_glc_4c1_tg_de_ca246.233.113.132.01.615b_glc_4c1_tg_bc_ca248.029.818.229.11.631b_glc_4c1_tg_ab_ca254.036.517.535.41.636table 2the ca - oxygen distances in glucose - cacomplexes . distances in angstromnabcdefa_glc_os2_gt_efa_ca32.392.342.38a_glc_5s1_gg_dfa_ca32.312.382.36a_glc_os2_gg_efc_ca32.352.322.35a_glc_25b_tg_dfa_ca32.302.352.40a_glc_4so_gt_efa_ca32.472.402.30a_glc_1c4_gt_efa_ca32.492.382.30a_glc_4c1_gt_efa_ca32.362.352.42a_glc_4c1_tg_cd_ca22.292.27a_glc_4c1_tg_de_ca22.252.30a_glc_4c1_tg_bc_ca22.322.29a_glc_4c1_tg_ab_ca22.312.31b_glc_os2_gg_cefa_ca42.452.382.392.35b_glc_5s1_gt_efa_ca32.362.372.31b_glc_1c4_gt_efa_ca32.402.302.41b_glc_4c1_gt_efa_ca32.452.422.26b_glc_4c1_gg_efa_ca32.382.372.31b_glc_4c1_tg_cd_ca22.292.27b_glc_4c1_tg_de_ca22.252.30b_glc_4c1_tg_bc_ca22.322.29b_glc_4c1_tg_ab_ca22.322.29 the number of contacts ( n ) , relative interaction energy ( eint ) , relative enthalpy ( h ) and relative free enthalpy of the complex formation ( g ) for glucose - ca cation and the mulliken atomic charge on the ca center . the lowest interaction energy of 178.0 kcal mol in the -glucose - ca complex in s2 and cefa sequence constitutes the reference level the ca - oxygen distances in glucose - cacomplexes . two arrangements of hydroxyl groups : axial - equatorial - axial ( ax - eq - ax ) or axial - axial - axial ( ax - ax - ax ) are possible for carbohydrates . since interactions are influenced by the volume of cation , because the ca size is greater than 80 pm ( 114 pm ) , the preffered arrangement results as ax - eq - ax [ 3235 ] . in glucose five possible sites were indicated for the cation coordination . the preferred locations of metal are those where interactions occur with oxygen atoms a , e ( hydroxyl groups ) and oxygen f included in the ring ( fig . 1schematic representation of glucoside including glucose ( with a - f letters designating oxygen atoms ) and alizarin ( o1 , o2 , o9 , o10 for the oxygen atoms ) fragments schematic representation of glucoside including glucose ( with a - f letters designating oxygen atoms ) and alizarin ( o1 , o2 , o9 , o10 for the oxygen atoms ) fragments for the case of glucose the results may be divided into three groups according to the number of coordination contacts ( four ( iv ) , three ( iii ) and two ( ii ) ) . only one isomer exists with calcium coordinated by four oxygen atoms ( fig . 2 ) . such a complex is the energetically most stable with the glucose - ca interaction energy of 178.0 kcal mol . the iii - coordinate complexes are significantly weaker ( table 1 ) , with the smallest relative interaction energy of 17.9 kcal mol . the -anomer always coordinates calcium via f oxygen , whereas -anomers possess the same sequence of oxygens mainly e , f , a. with the single exception , the interaction energy for boat and skew ( or twisted boat ) conformations is higher comparing to chair conformations . however due to the hydroxyl anomeric group located on the same side as the hydroxymethyl group the lower interaction energy is observed for the -anomer . 2the structure of the most stable a glucose - ca b glucoside of alizarin - ca complexes the structure of the most stable a glucose - ca b glucoside of alizarin - ca complexes the number of contacts constitutes the main parameter characterizing thermodynamics of studied complexes . since interactions are dominated by the electrostatic term , and in the first order approximation interactions may be considered as additive . each new cao contact contributes roughly 20 kcal mol to the total interaction energy . the consecutive inclusion of contacts influences the atomic charge on the calcium atom and in consequence lowers the interaction . the atomic charge on metal , due to the electron charge transfer from oxygen , decreases by approximately 0.05 electron , leading to the observable energetical effect . however the effect is too small to change the order between isomers grouped according to the number of contacts . the relative enthalpy and free enthalpy values , compared to interaction energy , include additionally the effect of the ring modification due to the conformation change as well as ring organization ( table 1 ) . the inclusion of ring effects always increases the stabilization of isomers ( compared to the iv - contact structure ) . the shortest distances characterize the ii - contacts complexes , while the most stable complex iv - contacts possesses the longest cao bonds ( table 2 ) . in glycoside , due to new bonds formed between glucose and alizarin , the number of active oxygen centers for the ca coordination is significantly higher . additionally , the alizarine fragment with the complex corresponds to the tautomer with carbonyl group in the o1 position ( fig . 1 ) . the isomers may be devided into two groups characterized by v and iv coordinating oxygens . as expected , v - coordinate structures are more stable compared to those with four o - ca contacts . the lowest interaction energy ( 233.0 kcal mol ) was obtained for the s2 conformation of -anomer . the geometry of glycone in this glucoside and interactions between calcium ion and oxygen atoms in glycone are similar to that observed in the most stable glucose - ca complex ( fig . 2 ) . the glucoside - ca complexes are characterized by an additional ca - o bond corresponding to the carbonyl group of alizarin fragment ( fig . 2 ) . the additivity of interactions is again visible and the number of contacts , in analogy to glucose , constitutes the main factor controlling the stability . the difference between eint and h ( table 3 ) is positive or negative indicating that the structure of the energetically lowest total energy is characterized by skeleton ( conformer ) which is not energetically the most preferred . the atomic charge on the calcium cation is lower for moieties of v - contacts compared to that of iv - contact . the small difference between h and g indicate little influence of entropy of the studied processes . the computations including the solvent effect ( cpcm model ) suggest that general conclusions for glycoside do not change.table 3the number of contacts o - ca ( n ) , relative interaction energy ( eint ) , relative enthalpy ( h ) , and relative free enthalpy ( g ) for glucoside complexes , the atomic charge on ca and the c = oca distance . energy in kcal mol , atomic mulliken charge in electron , distance in angstrom . the reference lowest interaction energy amounts to 233.0 kcal mol neint heint-hgatomic charge on ca distances c = oca a_gli_1s5_gt_befo1o2_ca(85)57.813.05,212.81.3672.28a_gli_1s5_gt_befo1o2_ca(161)58.416.98.516.61.3732.30a_gli_1c4_gg_bdfo1o2_ca59.59.10.410.11.3742.28a_gli_1c4_gt_bdfo1o9_ca(85)514.523.28.723.61.3562.34 ( o9)a_gli_os4_tg_bdo1o2_ca(75)417.214.82.414.31.4222.27a_gli_os4_tg / gg_bdo1o2_ca(77)418.412.65.812.41.4262.27a_gli_os4_gt_bdo1o2_ca(72)418.718.80.117.91.4232.27a_gli_25b_gt_dfo1o2_ca423.325.32.024.61.4092.26a_gli_1s5_gt_efo1o9_ca424.425.91.525.21.3782.31 ( o9)b_gli_os2_gg_cefo1o2_ca(95)50.00.00.00.01.3652.28b_gli_o3b_gg_cefo1o2_ca(168)52.55.93.46.51.3732.32b_gli_o3b_gg_cefo1o9_ca(42)59.216.16.916.71.3352.35 ( o9)b_gli_2s4_gg / gt_efo1o2_ca(121)414.515.51.015.71.4102.27b_gli_os4_gt_efo1o9_ca(75)422.626.84.225.21.3742.33 ( o9)b_gli_os2_gt_cfo1o2_ca423.724.50.823.11.3952.26b_gli_2so_gg_beo1o2_ca429.532.32.831.71.4112.27b_gli_4c1_gt_efo1o9_ca(59)433.831.22.630.21.3722.33 ( o9)b_gli_4c1_gt_efo1o9_ca(83)434.525.68.924.81.3832.32 ( o9 ) the number of contacts o - ca ( n ) , relative interaction energy ( eint ) , relative enthalpy ( h ) , and relative free enthalpy ( g ) for glucoside complexes , the atomic charge on ca and the c = oca distance . energy in kcal mol , atomic mulliken charge in electron , distance in angstrom . two arrangements of hydroxyl groups : axial - equatorial - axial ( ax - eq - ax ) or axial - axial - axial ( ax - ax - ax ) are possible for carbohydrates . since interactions are influenced by the volume of cation , because the ca size is greater than 80 pm ( 114 pm ) , the preffered arrangement results as ax - eq - ax [ 3235 ] . in glucose five possible sites were indicated for the cation coordination . the preferred locations of metal are those where interactions occur with oxygen atoms a , e ( hydroxyl groups ) and oxygen f included in the ring ( fig . 1schematic representation of glucoside including glucose ( with a - f letters designating oxygen atoms ) and alizarin ( o1 , o2 , o9 , o10 for the oxygen atoms ) fragments schematic representation of glucoside including glucose ( with a - f letters designating oxygen atoms ) and alizarin ( o1 , o2 , o9 , o10 for the oxygen atoms ) fragments for the case of glucose the results may be divided into three groups according to the number of coordination contacts ( four ( iv ) , three ( iii ) and two ( ii ) ) . only one isomer exists with calcium coordinated by four oxygen atoms ( fig . 2 ) . such a complex is the energetically most stable with the glucose - ca interaction energy of 178.0 kcal mol . the iii - coordinate complexes are significantly weaker ( table 1 ) , with the smallest relative interaction energy of 17.9 kcal mol . the -anomer always coordinates calcium via f oxygen , whereas -anomers possess the same sequence of oxygens mainly e , f , a. with the single exception , the interaction energy for boat and skew ( or twisted boat ) conformations is higher comparing to chair conformations . however due to the hydroxyl anomeric group located on the same side as the hydroxymethyl group the lower interaction energy is observed for the -anomer . 2the structure of the most stable a glucose - ca b glucoside of alizarin - ca complexes the structure of the most stable a glucose - ca b glucoside of alizarin - ca complexes the number of contacts constitutes the main parameter characterizing thermodynamics of studied complexes . since interactions are dominated by the electrostatic term , and in the first order approximation interactions may be considered as additive . each new cao contact contributes roughly 20 kcal mol to the total interaction energy . the consecutive inclusion of contacts influences the atomic charge on the calcium atom and in consequence lowers the interaction . the atomic charge on metal , due to the electron charge transfer from oxygen , decreases by approximately 0.05 electron , leading to the observable energetical effect . however the effect is too small to change the order between isomers grouped according to the number of contacts . the relative enthalpy and free enthalpy values , compared to interaction energy , include additionally the effect of the ring modification due to the conformation change as well as ring organization ( table 1 ) . the inclusion of ring effects always increases the stabilization of isomers ( compared to the iv - contact structure ) . the shortest distances characterize the ii - contacts complexes , while the most stable complex iv - contacts possesses the longest cao bonds ( table 2 ) . in glycoside , due to new bonds formed between glucose and alizarin , the number of active oxygen centers for the ca coordination is significantly higher . additionally , the alizarine fragment with the complex corresponds to the tautomer with carbonyl group in the o1 position ( fig . 1 ) . the isomers may be devided into two groups characterized by v and iv coordinating oxygens . as expected , v - coordinate structures are more stable compared to those with four o - ca contacts . the lowest interaction energy ( 233.0 kcal mol ) was obtained for the s2 conformation of -anomer . the geometry of glycone in this glucoside and interactions between calcium ion and oxygen atoms in glycone are similar to that observed in the most stable glucose - ca complex ( fig . 2 ) . the glucoside - ca complexes are characterized by an additional ca - o bond corresponding to the carbonyl group of alizarin fragment ( fig . 2 ) . the additivity of interactions is again visible and the number of contacts , in analogy to glucose , constitutes the main factor controlling the stability . the difference between eint and h ( table 3 ) is positive or negative indicating that the structure of the energetically lowest total energy is characterized by skeleton ( conformer ) which is not energetically the most preferred . the atomic charge on the calcium cation is lower for moieties of v - contacts compared to that of iv - contact . the small difference between h and g indicate little influence of entropy of the studied processes . the computations including the solvent effect ( cpcm model ) suggest that general conclusions for glycoside do not change.table 3the number of contacts o - ca ( n ) , relative interaction energy ( eint ) , relative enthalpy ( h ) , and relative free enthalpy ( g ) for glucoside complexes , the atomic charge on ca and the c = oca distance . energy in kcal mol , atomic mulliken charge in electron , distance in angstrom . the reference lowest interaction energy amounts to 233.0 kcal mol neint heint-hgatomic charge on ca distances c = oca a_gli_1s5_gt_befo1o2_ca(85)57.813.05,212.81.3672.28a_gli_1s5_gt_befo1o2_ca(161)58.416.98.516.61.3732.30a_gli_1c4_gg_bdfo1o2_ca59.59.10.410.11.3742.28a_gli_1c4_gt_bdfo1o9_ca(85)514.523.28.723.61.3562.34 ( o9)a_gli_os4_tg_bdo1o2_ca(75)417.214.82.414.31.4222.27a_gli_os4_tg / gg_bdo1o2_ca(77)418.412.65.812.41.4262.27a_gli_os4_gt_bdo1o2_ca(72)418.718.80.117.91.4232.27a_gli_25b_gt_dfo1o2_ca423.325.32.024.61.4092.26a_gli_1s5_gt_efo1o9_ca424.425.91.525.21.3782.31 ( o9)b_gli_os2_gg_cefo1o2_ca(95)50.00.00.00.01.3652.28b_gli_o3b_gg_cefo1o2_ca(168)52.55.93.46.51.3732.32b_gli_o3b_gg_cefo1o9_ca(42)59.216.16.916.71.3352.35 ( o9)b_gli_2s4_gg / gt_efo1o2_ca(121)414.515.51.015.71.4102.27b_gli_os4_gt_efo1o9_ca(75)422.626.84.225.21.3742.33 ( o9)b_gli_os2_gt_cfo1o2_ca423.724.50.823.11.3952.26b_gli_2so_gg_beo1o2_ca429.532.32.831.71.4112.27b_gli_4c1_gt_efo1o9_ca(59)433.831.22.630.21.3722.33 ( o9)b_gli_4c1_gt_efo1o9_ca(83)434.525.68.924.81.3832.32 ( o9 ) the number of contacts o - ca ( n ) , relative interaction energy ( eint ) , relative enthalpy ( h ) , and relative free enthalpy ( g ) for glucoside complexes , the atomic charge on ca and the c = oca distance . energy in kcal mol , atomic mulliken charge in electron , distance in angstrom . the presented theoretical studies confirm the experimental findings indicating that glucose and its alizarin glycoside can form complexes with the calcium cation . the results show that the stronger interaction energy correlates with the higher coordination number . for both , glucose and glycoside the largest interaction the results suggest that the s2 conformation constitutes the preferred structure for glucose and glucoside complexes . the interaction energy depends on distances between calcium and oxygen , the shortest distances are observed for carbonyl oxygen . the increasing number of o - ca contact decreases the single contact contribution but the overall interaction energy increases . these findings suggest that the coordination number constitutes the main factor controlling the total energy .

hashimoto 's encephalitis or encephalopathy ( he ) is a rare autoimmune disease often under diagnosed . it can present as rapidly progressive dementia ( rpd ) or dementia of unknown origin which is treatable with high dose steroids . we present a case of he to signify the importance of its early recognition and management . the present case report is about a 58-year - old female patient who was brought by her family members with a 4 month history of progressive memory impairment ; both recent and remote memory loss , inability to carry out activities of daily living namely dressing , toileting , bathing and cooking . she demonstrated features of compulsive behavior in the form of repeated folding of hands . on examination , she was conscious but was not oriented to time , place or person with gross psychomotor retardation . mini - mental state examination ( mmse ) could not be performed as she was not speaking and would follow few commands . her routine laboratory work - up was normal ( hemoglobin = 13.2 g% , total white blood cell = 12900 cumm , platelet count = 425000/cumm , packed cell volume = 42.3% , mean corpuscular volume = 92.8 fl , random blood glucose = 101 mg / dl , serum amylase = 119 u / ls , serum sodium = 137 mg / l , serum potassium = 5 mg / l , serum calcium = 8.7 mg / dl , total bilirubin = 0.7 mg / dl , direct bilirubin = 0.3 mg / dl , indirect bilirubin = 0.4 mg / dl , serum glutamic oxaloacetic transaminase = 28 u / l , serum glutamic pyruvic transaminase = 36 u / l , alkaline phosphatase = 184 u / l , serum urea = 39 mg / dl , serum creatinine = 1.2 mg / dl , serum uric acid = 6.2 mg / dl , rheumatoid factor : 4.6 iu / ml , anti - nuclear antibodies and double - stranded deoxyribonucleic acid : negative , erythrocyte sedimentation rate : 61 mm in 1 h , serum b12 level : 192 pg / dl , test for venereal disease research laboratory , human immunodeficiency virus i and ii serology were non - reactive ) . chest x - ray , urine / stool examination , electrocardiogram and cerebrospinal fluid analysis yielded normal results . examination of fundus did not show any sign of raised intracranial pressure or abnormal deposits . thyroid profile revealed ; t3 : 2.34 pg / ml , t4 : 1.21 ng / dl , thyroid stimulating hormone ( tsh ) : 5.4 , anti - thyroid peroxidase antibodies ( anti - tpo ) : 1300 u / ml ( n < 65 u / ml ) and anti - thyroglobulin antibodies ( anti - tga ) : 2049.70 u / ml . magnetic resonance imaging ( mri ) brain scan showed mild diffuse cerebral atrophy and electroencephalogram ( eeg ) revealed diffuse slowing with generalized theta / delta activity . a diagnosis of he with dementia was made and she was treated with intravenous methylprednisolone 1 g / daily for 5 days and later shifted to oral prednisone 60 mg / day . she was regularly evaluated every 2 - 3 weeks showing gradual improvement in symptoms and by 4 months mmse score was 30/30 and she was performing all her routine activities of daily living . her anti - tpo and anti - tga levels markedly reduced to normal limits and eeg became normal . her oral steroid therapy was tapered over a period of 4 months and the patient remained symptom free on subsequent follow - up . he should be considered in a case of sub - acute encephalopathy associated with high levels of anti - thyroid antibodies despite normal thyroid functions and in the absence of other brain diseases . it is a rare disease with no specific known cause . since , the link between he and hashimoto thyroiditis is not clear , the condition is now termed as steroid - responsive encephalopathy associated with autoimmune thyroiditis ( sreat ) . it should be suspected in all cases with mental status changes in the setting of normal brain imaging and normal routine lab results . sreat has two types of initial clinical presentation : an acute stroke like ( vasculitic type ) episode and a gradual cognitive impairment . diagnostic criteria for sreat includes confusion , focal / generalized seizure , focal neurological deficit , cognitive decline , dementia , increase in anti - thyroid antibody titers and an excellent response to corticosteroids . sreat is associated to non - specific eeg abnormalities , elevated cerebrospinal fluid proteins and nonspecific white matter changes . since clinical features of sreat are unspecific , other etiologic factors such as infectious , metabolic , toxic , vascular , neoplastic and paraneoplastic causes have to be excluded . it was initially believed that anti - thyroid antibodies have a role in the pathogenesis of sreat ; however , various studies have reported that there is no evidence of pathogenic role of antibodies in sreat . . the levels of antibody do not correlate with severity or type of clinical presentation and its levels are not influenced by corticosteroids . however , the combination of encephalopathy , high serum anti - thyroid antibody concentrations and responsiveness to glucocorticoid therapy are seen in almost every case and therefore this association may not be due to chance alone . endocrinologists , neurologists and psychiatrists should be aware of this condition and consider it as one of the differential diagnosis in every case of rpd . all cases of encephalopathy of unknown origin and rpd during their initial screening must have tsh levels checked along with complete blood count , vitamin b12 , chemistry panel and mri along with evaluation of personal and familial history of thyroid disease . it is very important to diagnose sreat early because it has a good prognosis upon treatment responding drastically to immunosuppressive drugs . after being described in 1966 as he , the small number possibly indicate it to be an under diagnosed condition may be due to lack of awareness . we must check for thyroid abnormalities in every case of rpd and rule out antithyroid antibody titers in cases with deranged thyroid function test . there have been no reports suggestive of any environmental or geographic factors playing a role in the pathogenesis of this condition . there is scope for research to find out the actual cause of sreat and the role of antithyroid antibodies .

the clinical manifestations of graves orbitopathy ( go ) can be variable and patients may require surgery for cosmetic problems , severe proptosis or optic neuropathy . several surgical techniques have been adopted , including the removal of retro - orbital fat ( olivari 1991 ) , one or more orbital walls ( walsh and ogura 1957 ; maroon and kennerdell 1982 ; hurwitz and birt 1985 ; kennedy et al 1990 ; mourits et al 1990 ; garrity et al 1993 ; rootman et al 1995 ; goldberg et al 2000 ; graham et al 2003 ) , or both together . for this reason , and because of the small number of patients participating in each study , it is difficult to evaluate the results and to understand the advantages and the risks of one surgical approach compared with another . surgical complications are rarely described and no information is given as to whether these patients required further operations . we herein report the results of a retrospective study on 19 patients , 14 operated at our unit , and 5 elsewhere , who required a second operation , and analyze the reasons of further surgery . we reviewed the medical records of 375 patients with go ( 719 orbits ) operated on at 1st ent unit , university of pisa , between december 1992 and april 2007 . the patients were operated on using various techniques , including the walsh - ogura ( wo ) ( walsh and ogura 1957 ) , the 3 walls decompression according to mourits and colleagues ( m ) ( mourits et al 1990 ) , and a balanced decompression with medial and lateral wall approach ( graham et al 2003 ; sellari - franceschiniet al 2005 ) ( table 1 ) . eight patients ( group a1 ) required a second operation due to a complication closely connected to the first operation ( table 2 ) and seven ( group a2 ) needed further decompression because of residual proptosis ( table 3 and 4 ) . we also studied five patients ( group b ) who underwent orbital decompression elsewhere using the olivari s technique ( o ) ( olivari 1991 ) . four of them required further surgery because of insufficient results and one because of persistent severe sight loss ( table 5 ) . one patient ( 3 ) required re - operation because of bleeding upon removal of the nasal swabs on the second day after the operation , while another ( 7 ) was operated on again three years later for a mucocele in the posterior part of the ethmoid , which was causing proptosis . patient 1 , after the nasal swabs had been removed on the second day , started complaining of strong headache after blowing the nose . a computed tomography ( ct ) scan showed a pneumocephalus associated to cerebrospinal fluid ( csf ) leak ( figure 1 ) . one patient ( 8) complained on the second day after decompression of monolateral visual loss . a ct scan showed a fragment of papiracea pushing against the medial rectus muscle , with compression of the optic nerve ( figure 2 ) . after removing the fragment the visual function steadily recovered until normal . of the remaining 4 patients , one ( 2 ) complained of reduction in the visual field monolaterally nine days after the operation . a ct scan was performed and showed the presence of a bone fragment from the sphenoid wall which was pushing against the optic nerve ( figure 3 ) . three patients ( 4 , 5 , and 6 ) were operated on the second and third day after surgery because of sudden and rapid onset of post - operative monolateral proptosis with ipsilateral chemosis ( figure 4 ) . a ct scan was performed and in all cases blood collection in the lateral area of the orbit was detected and removed surgically . two patients ( 9 and 11 ) were operated on owing to insufficient bilateral decompression . one patient ( 1 ) had worsening of proptosis because of a recurrence of go after seven years , and another ( 10 ) was re - operated on twice due to recurrence of go with a slight reduction in the visual field , first on the left eye and then on the right eye , one and three years after the first operation , respectively ( figure 5 ) . a transnasal approach with removal of small fragments of residual papiracea and posterior orbital floor was performed . in both patients patients 13 and 14 were operated on monolaterally , due to persistent asymmetry in the two eyes . both patients underwent a nasal approach with removal of the residual lamina papiracea , where possible , removal of the middle turbinate and partial removal of the floor , the greater sphenoidal wing having been already completely removed ( figure 6 ) . patient 12 refused the external approach due to fear of ugly eyelid scars and was submitted to a transnasal approach , operating only on the medial wall . because of insufficient reduction in proptosis , he then accepted a transeyelid approach to the lateral wall . as far as group b is concerned , it is difficult to ascertain the reasons of the first failure in the 4 patients who required further decompression for persistent proptosis , since information regarding the preoperative status were scarce . the remaining patient ( 15 ) has been already described in a previous paper ( sellari - franceschini et al 2005 ) . he was re - operated because of a serious optic neuropathy that persisted after the previous operation , which was performed using the o technique associated with a coronal decompression a la m. the ct scan showed the persistence of all bone structures at the apex of the orbit and compression on the optic nerve by the extraocular muscles . a new transnasal approach was performed , removing the posterior part of the lamina papiracea and the posterior part of orbital floor ; in addition the great sphenoidal wing was completely removed through a transeyelid approach . the recovery of vision was rapid and significant and the computerized analysis of the visual field showed an almost complete recovery . one patient ( 3 ) required re - operation because of bleeding upon removal of the nasal swabs on the second day after the operation , while another ( 7 ) was operated on again three years later for a mucocele in the posterior part of the ethmoid , which was causing proptosis . patient 1 , after the nasal swabs had been removed on the second day , started complaining of strong headache after blowing the nose . a computed tomography ( ct ) scan showed a pneumocephalus associated to cerebrospinal fluid ( csf ) leak ( figure 1 ) . one patient ( 8) complained on the second day after decompression of monolateral visual loss . a ct scan showed a fragment of papiracea pushing against the medial rectus muscle , with compression of the optic nerve ( figure 2 ) . after removing the fragment the visual function steadily recovered until normal . of the remaining 4 patients , one ( 2 ) complained of reduction in the visual field monolaterally nine days after the operation . a ct scan was performed and showed the presence of a bone fragment from the sphenoid wall which was pushing against the optic nerve ( figure 3 ) . three patients ( 4 , 5 , and 6 ) were operated on the second and third day after surgery because of sudden and rapid onset of post - operative monolateral proptosis with ipsilateral chemosis ( figure 4 ) . a ct scan was performed and in all cases blood collection in the lateral area of the orbit was detected and removed surgically . two patients ( 9 and 11 ) were operated on owing to insufficient bilateral decompression . one patient ( 1 ) had worsening of proptosis because of a recurrence of go after seven years , and another ( 10 ) was re - operated on twice due to recurrence of go with a slight reduction in the visual field , first on the left eye and then on the right eye , one and three years after the first operation , respectively ( figure 5 ) . a transnasal approach with removal of small fragments of residual papiracea and posterior orbital floor was performed . in both patients patients 13 and 14 were operated on monolaterally , due to persistent asymmetry in the two eyes . both patients underwent a nasal approach with removal of the residual lamina papiracea , where possible , removal of the middle turbinate and partial removal of the floor , the greater sphenoidal wing having been already completely removed ( figure 6 ) . patient 12 refused the external approach due to fear of ugly eyelid scars and was submitted to a transnasal approach , operating only on the medial wall . because of insufficient reduction in proptosis , he then accepted a transeyelid approach to the lateral wall . as far as group b is concerned , it is difficult to ascertain the reasons of the first failure in the 4 patients who required further decompression for persistent proptosis , since information regarding the preoperative status were scarce . the remaining patient ( 15 ) has been already described in a previous paper ( sellari - franceschini et al 2005 ) . he was re - operated because of a serious optic neuropathy that persisted after the previous operation , which was performed using the o technique associated with a coronal decompression a la m. the ct scan showed the persistence of all bone structures at the apex of the orbit and compression on the optic nerve by the extraocular muscles . a new transnasal approach was performed , removing the posterior part of the lamina papiracea and the posterior part of orbital floor ; in addition the great sphenoidal wing was completely removed through a transeyelid approach . the recovery of vision was rapid and significant and the computerized analysis of the visual field showed an almost complete recovery . several surgical approaches have been described for orbital decompression in go and the choice in each medical center often depends on the local surgeon expertise . there are only few surgeons who perform different approaches based on individual needs and have a follow - up of large series of patients . therefore , it is difficult to understand from the literature which complications are associated with a given surgical approach , and how often a second surgery is needed for their solution . our experience indicates that three patients of group a1 needed to be re - operated shortly after the first surgery because of hemorrages in the outer region of the orbit , due to bleeding from the orbital fat and temporalis muscle . one patient accidentally removed the drainage by himself immediately after the operation instead of having it left in place for 24 hours , and two other patients bled within the first day after removal of the drainage . thus the observed rate of bleeding ( 3 out of 719 orbit ) is extremely low and therefore it is fair to conclude that a 24-hour drainage period is usually sufficient . the complications associated with the endonasal approach were more serious . of the two patients ( 2 and 8) with compression of the optic nerve by bone fragments , the one with an indirect compression via the medial rectus muscle and operated on the third day had a complete recovery in few weeks , whilst the other with a direct compression on the nerve and the surgery performed with a delay of ten days recovered completely in two years . csf leak was also associated with a serious complication , ie , pneumocephalus , which in any case cleared without any residual effect . as far as group a2 is concerned , two patients had to be operated on again due to recurrence of go . the first ( 1 ) was operated on bilaterally , seven years after the first operation . the other one ( 10 ) required two additional surgical procedures because of newly developed slight loss in the left eye after one year and in the right eye after three years . a transnasal approach with removal of small fragments of residual papiracea and posterior orbital floor was sufficient to rectify the situation . at the time of both revision surgeries , the patient was euthyroid on l - t4 replacement therapy and trab were negative . in our experience , that was the only case of two consecutive recurrences of disease with optic neuropathy after orbital decompression . two patients ( 9 and 11 ) were operated on bilaterally due to insufficient decompression after the first operation . in these patients the emphasis on trying to avoid a postoperative diplopia brought about a limited medial approach and the result of the decompression was not satisfactory . two patients ( 13 and 14 ) very often the patients have a different proptosis in the two eyes and , when the difference is greater than 2 mm , there is the risk that the asymmetry will persist after decompression . from the patient s perspective , this result is felt much more as a failure than a globally lesser , but balanced , reduction in proptosis . in these two patients the second operation , in which particular attention was paid to avoid diplopia in primary gaze , turned out to be only partially satisfactory for the patients , because of a residual minor imbalance and development of diplopia in the lateral gaze . the patient ( 18 ) who refused a combined approach subsequently accepted a second operation with an external approach . are concerned , four were initially operated on using the o technique and one patient was operated endoscopically with the 2 walls removal technique according to kennedy and colleagues ( 1990 ) . it is difficult to comment on these patients due to the lack of accurate information on the preoperative conditions . the patient ( 15 ) with persistent optic neuropathy was initially operated on using the o technique in combination with bone decompression through a coronal approach a la m. the ct scan showed that the limited opening of the lateral and medial walls did not resolve the compression on the optic nerve at the orbital apex , suggesting that in patients with optic neuropathy it is necessary to perform a wide opening of the bone walls at the orbital apex . our experience indicates that three patients of group a1 needed to be re - operated shortly after the first surgery because of hemorrages in the outer region of the orbit , due to bleeding from the orbital fat and temporalis muscle . one patient accidentally removed the drainage by himself immediately after the operation instead of having it left in place for 24 hours , and two other patients bled within the first day after removal of the drainage . thus the observed rate of bleeding ( 3 out of 719 orbit ) is extremely low and therefore it is fair to conclude that a 24-hour drainage period is usually sufficient . the epistaxis appearing when the swabs were removed required a simple hemostasis procedure . of the two patients ( 2 and 8) with compression of the optic nerve by bone fragments , the one with an indirect compression via the medial rectus muscle and operated on the third day had a complete recovery in few weeks , whilst the other with a direct compression on the nerve and the surgery performed with a delay of ten days recovered completely in two years . csf leak was also associated with a serious complication , ie , pneumocephalus , which in any case cleared without any residual effect . as far as group a2 is concerned , two patients had to be operated on again due to recurrence of go . the first ( 1 ) was operated on bilaterally , seven years after the first operation . the other one ( 10 ) required two additional surgical procedures because of newly developed slight loss in the left eye after one year and in the right eye after three years . a transnasal approach with removal of small fragments of residual papiracea and posterior orbital floor was sufficient to rectify the situation . at the time of both revision surgeries , the patient was euthyroid on l - t4 replacement therapy and trab were negative . in our experience , that was the only case of two consecutive recurrences of disease with optic neuropathy after orbital decompression . two patients ( 9 and 11 ) were operated on bilaterally due to insufficient decompression after the first operation . in these patients the emphasis on trying to avoid a postoperative diplopia brought about a limited medial approach and the result of the decompression was not satisfactory . two patients ( 13 and 14 ) were operated on again monolaterally because of eye asymmetry after the decompression . very often the patients have a different proptosis in the two eyes and , when the difference is greater than 2 mm , there is the risk that the asymmetry will persist after decompression . from the patient s perspective , this result is felt much more as a failure than a globally lesser , but balanced , reduction in proptosis . in these two patients the second operation , in which particular attention was paid to avoid diplopia in primary gaze , turned out to be only partially satisfactory for the patients , because of a residual minor imbalance and development of diplopia in the lateral gaze . the patient ( 18 ) who refused a combined approach subsequently accepted a second operation with an external approach . as far as patients of group b are concerned , four were initially operated on using the o technique and one patient was operated endoscopically with the 2 walls removal technique according to kennedy and colleagues ( 1990 ) . it is difficult to comment on these patients due to the lack of accurate information on the preoperative conditions . the patient ( 15 ) with persistent optic neuropathy was initially operated on using the o technique in combination with bone decompression through a coronal approach a la m. the ct scan showed that the limited opening of the lateral and medial walls did not resolve the compression on the optic nerve at the orbital apex , suggesting that in patients with optic neuropathy it is necessary to perform a wide opening of the bone walls at the orbital apex . because of the small series of patients and the lack of homogeneity our study does not allow to drawn definite conclusions , but some considerations can be made . in patients with optic neuropathy it is very important to obtain an adequate decompression at the orbital apex . in one of our patients , the o technique , even if associated to a partial opening of the orbital walls , was not adequate to provide satisfactory results . indeed , a wide opening of the bone at the orbital apex should be advisable . as far as the complications closely tied to the decompression procedure are concerned , those associated with the endonasal approach were more serious . we experienced two cases of optic nerve compression due to bone fragments . in one case surgical manipulation of the lateral wall of the sphenoid sinus led to the formation of a bone fragment compressing the optic nerve in the optic canal . in the other case a fragment of lamina papiracea provoked the compression of the medial rectus muscle and then of the optic nerve . here , ct findings did nt correspond to the symptoms , but the surgical removal of the fragment solved the visual loss . such complications are not reported in the literature , where also complications in general are fairly mentioned . thus , extreme attention is needed in performing the ethmoidectomy and opening of the papiracea , particularly in the posterior section . hemorrhages in the lateral part of the orbit were rather rare and easy to control . concerning the operations performed for persistent proptosis , we have noticed that , even if it was considerably reduced by first surgery , a difference in proptosis between the two eyes was felt by the patient as a failure . a lesser , yet balanced , reduction in proptosis was accepted more willingly . since the two eyes are often involved in the disease with different severity , balancing the decompression is easier when operating simultaneously on the two eyes . in our experience is often more difficult to obtain a good decompression in the eye with a higher preoperative proptosis . therefore , in cases where the preoperative difference in proptosis between the two eyes is greater than 2 mm , the surgeon should address firstly the worst eye and then adapt the extent of decompression in the other eye in order to obtain a symmetric reduction in proptosis .

a 38-year - old man presented to his primary care physician with complaints of dry cough , left - sided pleuritic chest pain and left - sided back pain of 2 weeks duration . he was found by chest radiography to have an infiltrate in the left lower lobe and treated for community - acquired pneumonia with moxifloxacin for 10 days . after completing the course of antibiotics , he presented again with worsening symptoms of left - sided chest pain and attesting to a weight loss of approximately 5 lbs over the past month . a repeat chest radiograph showed worsening of the left lower lobe infiltrate and an enlarging effusion . a ct scan of the chest showed a large effusion on the left with some loculation inferomedially ( fig . 1 ) . his laboratory analysis revealed a decrease in hemoglobin from 14.0 to 10.4 g / dl within the past 10 days as well as a leukocyte count of 10.6 10/l . laboratory work - up also demonstrated normal platelets and a normal metabolic profile . with a high suspicion for hemorrhagic effusion , he underwent video - assisted thoracoscopic surgery which revealed a large 12.5 8.0 cm gelatinous mediastinal mass with bleeding into the pleural cavity ( fig . the patient had a negative work - up for tumor markers including alpha - fetoprotein , ca-125 , ca 15 - 3 , ca 19 - 9 and carcinoembryonic antigen . a biopsy of the mass revealed myxoid stroma with pleomorphic cells and atypical nuclei with high mitotic activity most consistent with myxofibrosarcoma ( fig . he was evaluated for surgical resection of the mass and was advised preoperative radiation therapy . he was then started on chemotherapy with a regimen of doxorubicin , ifosfamide and mesna . his clinical course was complicated by multiple episodes of neutropenic fevers , pancytopenia requiring transfusions as well as pericardial and pleural effusions . in addition to this , in subsequent imaging it was found that the mass was infiltrating the pericardium . follow - up scans showed progression of his cancer and the development of liver metastases . his condition deteriorated over a period of a few months with worsening respiratory symptoms due to progression of the mass in size . treatment of soft tissue sarcomas , including myxofibrosarcomas , is generally based on surgery combined with radiotherapy and/or chemotherapy . surgery has evolved greatly throughout the years , shifting from whole limb amputation in the early years to selective tumor excision with flap tissue reconstruction in recent years . however , despite complete resection , recurrence remains common . a retrospective study was done at memorial sloan - kettering cancer center to assess for prognostic indicators of local and distant recurrences in patients with chest wall soft tissue sarcomas . the study showed that high tumor grade and tumor size > 5 cm were statistically associated with an increased risk of recurrence . of these two factors , tumor grade was the most important prognostic factor , with a high grade conferring a hazard ratio of about 34 times that of patients with low - grade tumors . studies have shown varying rates of recurrence , ranging from 16 to 54% . given this high rate of recurrence , researchers have investigated strategies for decreasing the rate of recurrence and improving mortality . with this goal in mind , radiotherapy is often added to surgery as it has been shown to decrease the rate of recurrence . these two modalities have been shown to decrease the risk of local recurrence [ 4 , 5 ] . port was shown in a single - center trial to significantly decrease the risk of local recurrence ; however , overall survival ( os ) was not impacted . this is due to the association of port with significant morbidity , including edema and reduced strength and joint motion . prerx was developed with the hypothesis that limiting the radiated area would decrease the side effects . however , a study where prerx was compared to port had to be stopped early when patients who received prerx were found to have a higher incidence of surgical wound complications . brachytherapy has also been utilized and , similarly , found to decrease the risk of local recurrences , but with no impact on os . high - dose radiation has been studied in patients with unresectable disease ; nevertheless , this should always be used as a last resort . chemotherapy is usually added to patients who have high - grade tumors , and is used mostly to decrease the rate of distant metastases and to increase os . a study conducted in italy randomized patients to standard therapy ( surgery plus radiotherapy ) or standard therapy plus epirubicin and ifosfamide . the investigators found an improvement in disease - free survival ( dfs ) and os at a median follow - up of 59 months . os in the intervention group was improved by 48% . however , a later follow - up on this same study at a median of 89 months found that the statistical significance in dfs and os had disappeared . a meta - analysis of these two studies and several other trials of doxorubicin - based chemotherapy plus ifosfamide chemotherapy compared with doxorubicin alone found that use of any chemotherapy decreased the risk of local and distant recurrences significantly ( by about 3040% ) ; however , only doxorubicin plus ifosfamide affected os . most of the research in the treatment of soft tissue sarcomas was done in patients with limb or girdle masses . nevertheless , we can extrapolate that these patients treatment should include wide excision surgery with port and chemotherapy with doxorubicin and ifosfamide . however , the location of the tumor in our patient poses a challenge for treatment . the patient 's tumor is located adjacent to vital structures , namely the heart , great vessels and lungs . in addition to this , in subsequent imaging , it was found that the mass was infiltrating the pericardium . this makes resection by surgery technically difficult and wide resection with the recommended 5 cm tumor - free margin impossible . these factors would classify our patient 's disease as unresectable , raising the question of what is the best course of treatment . as discussed previously , unresectable disease is typically treated with high - dose radiation . according to studies , a dose of 63 gy or more is recommended to improve dfs and os . however , it was noted in this same study that patients who received > 68 gy of radiation had significantly higher morbidity compared to those who received a lower dose . these two factors become extremely important in this patient , in whom location of the mass would put the heart and lungs in the trajectory of the radiation beam . it is known from previous experience with radiotherapy of breast tumors and hodgkin lymphomas that radiation to the heart poses an increased risk of complications . these complications include , but are not restricted to , pericarditis and pericardial disease , which can happen early or late in the treatment , valvular abnormalities and myocardial infarction [ 11 , 12 ] . in addition to the adverse effects of radiotherapy , the recommended chemotherapy for this patient , which is doxorubicin plus ifosfamide , has also been associated with adverse cardiovascular effects . this is especially true when large doses of radiation are given concomitantly . despite the potential adverse effects of radiotherapy and chemotherapy , the fact that this patient has an unresectable mass stresses the need for palliative therapies . in a young patient who has no cardiovascular disease , the potential short - term benefits of radiotherapy and chemotherapy would outweigh the long - term risks and as such , aggressive treatment should be sought after discussion with the patient of potential benefits and complications . this case of primary mediastinal myxofibrosarcoma appears to be only the second described in the english - language literature . we can also say that , despite appropriate guidelines , the existing literature does not apply to every patient in the same way . personalization of treatment , especially in patients with rare tumors and atypical presentation like in our patient , is often necessary . involvement of the patient in the decision on the final therapy becomes even more important in cases like this .

hereditary multiple exostoses ( hme ) also referred to as multiple osteochondromas ( mo ) are one of the most common benign bone tumors with an estimated prevalence rate of 1 per 50,000 in european population ( hennekam 1991 ; schmale et al . the disorder is usually inherited in autosomal dominant manner , however de novo mutations are also known to occur . hme are highly penetrant ( close to 100 % ) and show significant variability in symptoms expression and the age of onset , which varies from 2 to 15 years ( schmale et al . 1994 ) . clinical picture of hme involves formation of benign cartilage - capped tumors most frequently located in the juxta - epiphyseal parts of long bones , especially around the knee ( femur , tibia ) , the wrist , the proximal humerus , the proximal fibula , and the ribs . exostoses can also occur in scapula and pelvis , but neither mandible nor the calvarium are involved ( shapiro et al . 1979 ; schmale et al . lesions are usually inconspicuous at birth and tend to grow in number and size through childhood and adolescence until the closure of growth plates in puberty . it has been suggested that the formation of exostoses in hme patients is the consequence of a two - hit model in which predisposition for tumor development due to germline mutation and a second somatic osteochondromas may lead to the various skeletal deformities , such as limb shortening , angular deviation of long bones ( especially the ulna ) , madelung deformity , movement restrictions , as well as short stature . in addition , exostoses can cause nerve or blood vessel compression , joint limitations , and in some cases ( up to 5 % ) can transform into malignant tumors such as chondrosarcoma or osteosarcoma ( hennekam 1991 ; wicklund et al . hme result from the mutations of at least two putative tumor suppressor genes , i.e. , ext1 located on chromosome 8q24.1 and ext2located on chromosome 11p11 ( ahn et al . third region with a hypothetical ext3 gene was mapped to the chromosome 19p in linkage studies of ext1/ext2 negative family , nevertheless causative mutations associated with this locus have not been identified to date ( le merrer et al . 1994 ) . mutations in ext1 gene underlie 5678 % of hme cases , whereas in ext22144 % ( jennes et al . both ext1 and ext2 genes encode for glycotransferase enzymes of endoplasmic reticulum ( n - acetylglucosamine transferase and d - glucuronic acid transferase respectively ) involved in the synthesis of heparan sulfate and proteoglycans ( busse et al . while lesions of ext1 are scattered throughout the gene , mutations in ext2 tend to cluster in the first n - terminal part of the protein ( busse et al . we investigated 33 unrelated polish index cases with the clinical and radiological diagnosis of hme . we extend the mutational spectrum of the genes and report our diagnostic experience regarding ext1 and ext2 screening in polish patients , who were not represented so far in published molecular studies . thirty three unrelated index cases of polish ethnicity who were clinically and radiographically suspected of hme were recruited for this study . the inclusion criteria involved two or more exostoses diagnosed upon clinical assessment and/or x - ray imaging . blood was collected from all index cases as well as from affected and unaffected available family members . the local ethics committee approved the study and written informed consent was obtained from all subjects or their legal guardians . genomic dna was isolated from whole blood according to the conventional salting - out method . the coding sequences of both ext1 and ext2 genes ( genbank accession number nm_000127 and nm_207122.1 ) , comprised of all coding exons , and the flanking intronic regions were amplified in a set of pcr reactions and directly sequenced by means of dye - terminator chemistry ( kit v.3 , abi 3130xl ) . sequences of the primers used for amplification and sequencing pcr reactions are given in table 1 ( primers for ext1 were as described elsewhere by baasanjav et al . multiplex ligation - dependent probe amplification ( mlpa ) for all exons of the ext1 and ext2 was performed with the use of commercial kit p215-b1 per the manufacturer s protocol ( mrc holland ) . data was intra - normalized by dividing the area of each peak by the overall area of the reference probes peaks in the probemix . inter - sample normalization was obtained by comparing the investigated samples to several reference control samples ( healthy individuals ) run in the same experiment . relative peak areas ranging from 0.67 to 1.33 were considered normal , below 0.67deleted , and above 1.33duplicated ( schouten et al . dna of all index cases was screened for both point mutations and intragenic copy number changes involving ext1 and ext2 gene , by means of sequencing and mlpa . next , co - segregation testing was performed in all affected and unaffected family members to check for co - occurrence of the detected mutation with the phenotype . alternatively , parental studies were done in sporadic cases to confirm a de novo occurrence of the alterations . detected mutations were referred to human gene mutation database ( hgmd ) professional 2013.4 ( hgmd ) and leiden open variation database ( lovd ) version 2.0 ( fokkema et al . pathogenicity of all identified missense variants was additionally assessed in silico using mutation taster 2 , polyphen2 , and sift software.table 1sequences of the primers used for ext1 and ext2 gene amplification and sequencingexon namef primer sequence 5-3r primer sequence 5-3ext1 geneext1_e1atctttacaggcgggaagatgtgttccacaagtggagactctgext1_e1bccaggttctacacctcggacctcagttccaggctcaaaggext1_e2ctggtggctttcccgagaagggaaaccacaccttctcext1_e3aagcttcctttccttctggcccatgacacaggtaattttctccext1_e4tgctagaagccaaatgctatgtggaccaatcacacatcccext1_e5ctctgactgccaccatctttcaagcaatcttcaatgcagggext1_e6atttgctccagcatgaggctgaatgaaagggagtagcaggext1_e7gctgagatttccagctcctcaacagggagaagatatctagggcext1_e8agattccttcggtgttgaggcaaggcacggctaaaagaagext1_e9ccggattttgcattatgaattagatcagcaaaacttaagcgggext1_e10gggattcaaagaatgggtatgctgggtggaacagctagaggext1_e11tgctcatttgcctgactccacaatctggctctgctgatgext2 geneext2_e2acctgagtgacagagtgaaacccggttgaagccacagcgatagext2_e2btgatgtgccggttgttaggagaagacagcatcgggaaacext2_e3ttgcatacctgagaagcggtcttcaggaggaaaatacttatgacext2_e4ctgactctgtaaacgttagctggcagtgcctcaaggaccctacext2_e5tcagtggaggtgaagactggtgctatgttttcttccccttgext2_e6gtgagctgttgtcttttggcgctctagaccagtgtactaactctccext2_e7gttcagccagtgaagaagggttcctatcgtttcagtttggcext2_e8agcatatgccctaggcaccaaaagcacactctcatcttagaaagext2_e9agcagttgcttagctctggggcatgctgtctcagaaatggext2_e10tttggatttgatgagagccgtcttacgcacaccttttggacext2_e11gggaggaagtcagaatcagctggttatctcgaagtgacaggext2_e12cattctaatgcctccttttaccccaatttcccaatgtgaccgext2_e13gagttgaatggaggaatggctaacccaattcccacagtgcext2_e14gaacctgggagcagactgtggaaagtgggttaggtgggtg sequences of the primers used for ext1 and ext2 gene amplification and sequencing thirty three unrelated index cases of polish ethnicity who were clinically and radiographically suspected of hme were recruited for this study . the inclusion criteria involved two or more exostoses diagnosed upon clinical assessment and/or x - ray imaging . blood was collected from all index cases as well as from affected and unaffected available family members . the local ethics committee approved the study and written informed consent was obtained from all subjects or their legal guardians . genomic dna was isolated from whole blood according to the conventional salting - out method . the coding sequences of both ext1 and ext2 genes ( genbank accession number nm_000127 and nm_207122.1 ) , comprised of all coding exons , and the flanking intronic regions were amplified in a set of pcr reactions and directly sequenced by means of dye - terminator chemistry ( kit v.3 , abi 3130xl ) . sequences of the primers used for amplification and sequencing pcr reactions are given in table 1 ( primers for ext1 were as described elsewhere by baasanjav et al . multiplex ligation - dependent probe amplification ( mlpa ) for all exons of the ext1 and ext2 was performed with the use of commercial kit p215-b1 per the manufacturer s protocol ( mrc holland ) . data was intra - normalized by dividing the area of each peak by the overall area of the reference probes peaks in the probemix . inter - sample normalization was obtained by comparing the investigated samples to several reference control samples ( healthy individuals ) run in the same experiment . relative peak areas ranging from 0.67 to 1.33 were considered normal , below 0.67deleted , and above 1.33duplicated ( schouten et al . dna of all index cases was screened for both point mutations and intragenic copy number changes involving ext1 and ext2 gene , by means of sequencing and mlpa . next , co - segregation testing was performed in all affected and unaffected family members to check for co - occurrence of the detected mutation with the phenotype . alternatively , parental studies were done in sporadic cases to confirm a de novo occurrence of the alterations . detected mutations were referred to human gene mutation database ( hgmd ) professional 2013.4 ( hgmd ) and leiden open variation database ( lovd ) version 2.0 ( fokkema et al . 2011 ) . pathogenicity of all identified missense variants was additionally assessed in silico using mutation taster 2 , polyphen2 , and sift software.table 1sequences of the primers used for ext1 and ext2 gene amplification and sequencingexon namef primer sequence 5-3r primer sequence 5-3ext1 geneext1_e1atctttacaggcgggaagatgtgttccacaagtggagactctgext1_e1bccaggttctacacctcggacctcagttccaggctcaaaggext1_e2ctggtggctttcccgagaagggaaaccacaccttctcext1_e3aagcttcctttccttctggcccatgacacaggtaattttctccext1_e4tgctagaagccaaatgctatgtggaccaatcacacatcccext1_e5ctctgactgccaccatctttcaagcaatcttcaatgcagggext1_e6atttgctccagcatgaggctgaatgaaagggagtagcaggext1_e7gctgagatttccagctcctcaacagggagaagatatctagggcext1_e8agattccttcggtgttgaggcaaggcacggctaaaagaagext1_e9ccggattttgcattatgaattagatcagcaaaacttaagcgggext1_e10gggattcaaagaatgggtatgctgggtggaacagctagaggext1_e11tgctcatttgcctgactccacaatctggctctgctgatgext2 geneext2_e2acctgagtgacagagtgaaacccggttgaagccacagcgatagext2_e2btgatgtgccggttgttaggagaagacagcatcgggaaacext2_e3ttgcatacctgagaagcggtcttcaggaggaaaatacttatgacext2_e4ctgactctgtaaacgttagctggcagtgcctcaaggaccctacext2_e5tcagtggaggtgaagactggtgctatgttttcttccccttgext2_e6gtgagctgttgtcttttggcgctctagaccagtgtactaactctccext2_e7gttcagccagtgaagaagggttcctatcgtttcagtttggcext2_e8agcatatgccctaggcaccaaaagcacactctcatcttagaaagext2_e9agcagttgcttagctctggggcatgctgtctcagaaatggext2_e10tttggatttgatgagagccgtcttacgcacaccttttggacext2_e11gggaggaagtcagaatcagctggttatctcgaagtgacaggext2_e12cattctaatgcctccttttaccccaatttcccaatgtgaccgext2_e13gagttgaatggaggaatggctaacccaattcccacagtgcext2_e14gaacctgggagcagactgtggaaagtgggttaggtgggtg sequences of the primers used for ext1 and ext2 gene amplification and sequencing we found ext1 and ext2 heterozygous mutations in 28 out 33 ( 84.9 % ) unrelated probands from our cohort . in total , we demonstrated 26 different mutational hits , since two of them were recurrent . eighteen causative alterations ( 54.6 % ) were identified in ext1 , while ten ( 30.3 % ) were shown in ext2 . the remaining five cases ( 15.1 % ) were negative for both ext1 and ext2 mutations . dna sequencing has allowed for the detection of causative changes in 26 ( 78.8 % ) probands , whereas mlpa showed intragenic copy number changes in two ( 6.1 % ) further cases . out of 28 molecularly confirmed unrelated probands , six cases ( 21.4 % ) occurred due to de novo mutation while 22 ( 78.6 % ) inherited the disease causing variant from an affected parent . according to hgmd professional 2013.4 and lovd v.2.0 databases , out of 26 different mutations demonstrated in this study , 15 alterations were novel , whereas 11 were previously reported elsewhere ( hgmd , fokkema et al . nine out of the 15 novel single nucleotide variants ( snvs ) were identified in ext1 and six in ext2 . for the description of the mutations and their reference to literature data , 23 ( 82.1 % ) represented inactivating variants ( 17 frameshift , three nonsense , three splicing mutations ) . the remaining causative changes were two intragenic deletions ( both in ext2 ) and three missense substitutions ( all in ext1).table 2list of mutations in ext1 and ext2 genes identified in our mo probandsgeneexon / intron nucleotide changeprotein changetype of mutationcasereferenceext11c.15dupap.r6tfs24frameshiftfjennes et al . ( 2013)9/ivs9c.1859_1883 + 1dupp.k628kfs1frameshiftsnovel mutationivs9c.1883 + 1g > tskipping exon 9splicingfnovel mutation10c.1902_1903instap.s635yfs9frameshiftsnovel mutation10c.2006delcp.p669qfs4frameshiftfnovel mutationext22c.273deltp.f91lfs21frameshiftfnovel mutation2c.310delap.i104sfs8frameshiftfnovel mutation5c.722c > tp.q258 nonsensesfrancannet et al . ( 2009)5/ivs5c.934_939 + 3delp.l312_q313delframeshift / splicingfnovel mutation7c.1110delg p.m370ifs66frameshifts / f novel mutation8c.1177delcp.r393gfs43frameshiftfnovel mutation710exons 710 deletiondeletionsnovel mutation8exon 8 deletiondeletionfjennes et al . ( 2009 ) the reference sequences for ext1 and ext2 genes are nm_000127 and nm_207122.1 , respectivelyonly deleted exons in ext2 are numbered according to the reference sequence nm_000401.3 , as counted by the manufacturer of salsa mlpa probemix p215-b2 ext description version 10 ( mrc holland ) f familial s sporadic mutation detected in two unrelated patients , both familial cases mutation detected in two unrelated patients , one sporadic and one familial case list of mutations in ext1 and ext2 genes identified in our mo probands the reference sequences for ext1 and ext2 genes are nm_000127 and nm_207122.1 , respectively only deleted exons in ext2 are numbered according to the reference sequence nm_000401.3 , as counted by the manufacturer of salsa mlpa probemix p215-b2 ext description version 10 ( mrc holland ) mutation detected in two unrelated patients , both familial cases mutation detected in two unrelated patients , one sporadic and one familial case in all sporadic cases , presence of the mutation was excluded in both healthy parents , thus confirming their de novo occurrence in the probands . in familial cases , the identified alterations were checked for co - segregation with the phenotype and were not shown in the unaffected family members . furthermore , all three missense variants were predicted to be probably damaging in most of the in silico analyses performed by us with the use of mutation taster 2 , polyphen2 , and sift software ( table 3).table 3location of the missense mutations identified in our patients in reference to the ext1 domain organization . pathogenicity of each variant was assessed by mutation taster 2 , polyphen-2 , and siftcase noinheritance patternreference to literatureext1 mutation at cdna and protein levellocation at the ext1 domain levelmutation taster 2 predictionsift scorepolyphen-2 score1ad(familial)knownc.812a > g ( p.y271c)exostosin domaindisease causing0.05 ( damaging)1.000(probably damaging)2ad(familial)knownc.1019g > a ( p.r340h)exostosin domaindisease causing0.39 ( tolerated)0.948(possibly damaging)3ad(familial)knownc.1036a > g ( p.r346g)exostosin domaindisease causing0.02 ( damaging)0.940(possibly damaging ) ad autosomal dominantmutationtaster 2 : mutationtaster employs a bayes classifier to eventually predict the disease potential of an alteration . the bayes classifier is fed with the outcome of all tests and the features of the alterations and calculates probabilities for the alteration to be either a disease mutation or a harmless polymorphism sift ( sorting intolerant from tolerant ) : the amino acid substitution is predicted damaging if the score is < 0.05 , and tolerated if the score is 0.05polyphen-2 : score ranges from 0 to 1 . the amino acid substitution is predicted damaging if the score is above 0.85 location of the missense mutations identified in our patients in reference to the ext1 domain organization . pathogenicity of each variant was assessed by mutation taster 2 , polyphen-2 , and sift ad autosomal dominant mutationtaster 2 : mutationtaster employs a bayes classifier to eventually predict the disease potential of an alteration . the bayes classifier is fed with the outcome of all tests and the features of the alterations and calculates probabilities for the alteration to be either a disease mutation or a harmless polymorphism sift ( sorting intolerant from tolerant ) : the amino acid substitution is predicted damaging if the score is < 0.05 , and tolerated if the score is 0.05 polyphen-2 : score ranges from 0 to 1 . hereditary multiple exostoses is a relatively frequent autosomal dominant bone disorder resulting from heterozygous inactivating mutations of ext1 and ext2 genes . both gene products represent tumor suppressor proteins involved in heparan sulphate ( hs ) synthesis and cartilage formation . ext1 and ext2 act in a hetero - oligomeric complex and catalyze the elongation of hs chains ( mccormick et al . mutations in ext1 or ext2 are believed to result in reduced level of hs biosynthesis as well as in shortening of hs chains , what disrupts the gradient of morphogens and impair signal transduction in the epiphyseal growth plate in the cartilage . this leads to the loss of cell polarity and once occur in the peripheral part of bone , the cells maintain to proliferate , bring other wild - type cells along and grow into a cartilaginous cap , i.e. , osteochondroma ( jones 2011 ; de andrea and hogendoorn 2012 ) . there are only a few reports on large hme cohorts studied with a comprehensive molecular diagnostic testing including both gene sequencing and quantitative assays , such as mlpa or quantitative pcr ( qpcr ) for all exons ( porter et al . thus , our analysis represents the first source of information on molecular cause , frequencies , and the proportion of ext1 and ext2 mutations in polish patients affected by hme . in our study , we demonstrated ext1 and ext2 mutations in 28 ( 84.9 % ) out of 33 unrelated probands , which represents a similar diagnostic success rate to previously published reports in which this value varied from 70 to 95 % ( jennes et al . importantly , in ext1/ext2 positive polish patients , ext1 mutations were found almost twice more frequently than ext2 mutations ( 18 vs 10 hits , i.e. , 64.3 % vs 35.7 % respectively ) , which is also in accordance with the literature data ( jennes et al . the majority of mo causing changes ( 7580 % ) represent inactivating mutations , i.e. , nonsense , frameshift , and splice - site ( jennes et al . as shown in table 2 , 23 out of 28 mutations ( 82 % ) detected in our cohort were also leading to the premature truncation of the protein product . in addition , we found three different ext1 missense substitutions associated with hme phenotype : p.y271c , p.r340h , and p.r346 g ( fokkema et al . 2011 ; raskind et al . all missense substitutions were located within exostosin domain of ext1 and were predicted to be probably damaging to the protein function in computational analyses by means of polyphen2 , sift , and mutation taster2 software . an overview of missense mutations , along with their intragenic location , and predictive values of in silico analyses is presented in table 3 . in keeping with the past reports , ext1 mutations are usually distributed throughout the entire protein sequence , while ext2 lesions cluster in the first half of the protein ( jennes et al . ( 2013 ) , 50.1 % of all ext1 mutations were localized in exons 1 and 2 . our findings based on polish patients support the hypothesis that there may be an excess of mutations in the first two exons of ext1 . in our cohort , mutation in exons 1 or 2 was identified in ten of 18 ( 55.6 % ) ext1 mutation carriers , which comprised 30.3 % of our initial cohort ( ten probands out of 33 ) . therefore , we propose that diagnostic screening of hme polish patients should start with the sequencing of the first two exons of ext1 , followed by sequencing of the rest of the gene . next , in the case of negative results , we suggest ext2 sequencing followed by copy number assays for ext1/ext2 exons . to conclude , our paper is the first report that provides the results of exhaustive mutational screening of both hme related genes ( ext1/ext2 ) in a polish cohort . the ratio of ext1 vs ext2 gene lesions in our study is in full accordance with the relative mutational frequencies published previously for other caucasian cohorts . we also expand here the mutational spectrum associated with mos by describing the 15 novel pathogenic alterations in the ext1 and ext2 genes . in addition , although based on a small sample , our study supports the hypothesis that at least in certain groups of patients ext1 mutations may cluster within the first two exons of the gene . this important finding should influence the diagnostic algorithm , thereby leading to the optimization of cost - effectiveness rate in hme genetic testing . furthermore , we showed that intragenic ext1/2 deletions may account for a non - negligible proportion of hme causative mutations . therefore , we propose that mlpa or qpcr should be implemented into routine molecular diagnostic of the ext1/2 genes , especially if the sequence analysis detects no pathogenic alteration .

laparoscopy represents the gold standard for the diagnosis and treatment of a nonpalpable intraabdominal testis ( npat ) , which makes up around 20% of cases of undescended testis . with the evolution of minimally invasive surgery , the operative approach toward orchidopexy for npat has shifted from a traditional open approach to a multiport and single laparoscopic technique . the aim of this study was to evaluate the feasibility of orchidopexy for an npat by use of a surgical glove port and conventional rigid instruments . we retrospectively reviewed all cases of patients with npat who had undergone laparoendoscopic single - site ( less ) orchidopexy at our department between january 2013 and september 2014 . throughout the study period , less all families consented to the single - incision approach and possible conversion to multiport laparoscopy . the medical records of the patients were reviewed , and data concerning age , weight , operative time , complications , and surgical outcome were collected . as we previously described , we initially made a transumbilical glove port using a flexible ring ( fr ) , a rigid larger ring ( rr ) , one powder - free surgical glove , a wire - to - skin , and standard laparoscopic trocars . the fingertips of the glove were cut off where the trocars were inserted and fixed by a vicryl 3/0 ligature wire . then , the open end of the glove was passed through the fr and turned around it in the middle of the glove ( fig . a 1-cm incision was made at the level of the umbilicus without dissection of subcutaneous tissue . after the incision , the inner fr , fitted with the glove , was introduced into the abdomen . a 30 angle laparoscope with 3-mm or 5-mm straight rigid instruments identical to those for conventional laparoscopy including graspers , scissors , and electrocautery was used to perform our less orchidopexy ( fig . we opted for the first stage of two - stage fowler - stephens orchiopexy if the testis was closer to the iliac vessels . their age ranged from 9 months to 24 months ( mean age , 18 months ) . all patients had a nonpalpable unilateral undescended testis , which was on the right side in 14 patients and on the left side in 6 patients . seventeen patients underwent laparoscopic orchidopexy without vessel division as a one - stage procedure and 3 patients had less fowler - stephens orchidopexy for the first and the second stage . average operating time was 57 minutes , with extremes ranging from 40 to 80 minutes . the mean operative time for those undergoing one - stage orchidopexy was 57.11 minutes ( range , 40 to 80 minutes ) , that for primary fowler - stephens orchidopexy was 24 minutes ( range , 20 to 26 minutes ) , and that for second - stage surgery was 56.66 minutes ( range , 56 to 58 minutes ) . neither intraoperative nor postoperative complications were seen and the patients were discharged within a few hours of surgery . no patients were lost to follow - up . the total duration of the follow - up period ranged from 3 months to 1 year , 6 months . one patient had atrophy after the fowler - stephens orchiopexy procedure , and two cases had reascension of the testicle . no scoring was done to evaluate the final scar . however , the umbilical incision was nearly invisible and much appreciated by the parents . the question arises , why did we choose this technique to perform orchidopexy for npat ? in fact , society pushes us to remain up to date and even be ahead of our time , but not at any price , in terms of potential complications and financial costs , especially in the pediatric population . it is for these reasons we chose less , which has gained popularity over the last decade . in addition , these approaches offer documented benefits including improved cosmetic outcomes , decreased pain , and the ability to easily perform combined procedures without having to place additional ports . less procedures can be performed with the r - port , uni - x port , and sils port , which are very costly . the alexis wound retractor , curved instruments , and flexible - tip laparoscope are not available in our country . therefore , we chose a less expensive access method to perform orchidopexy for npat , known as a " surgical glove port " or " homemade single - port , " which was described previously for the completion of various procedures in adults . our technique may be an alternative to the costly commercially available single - port systems , especially in a developing country . to our knowledge , this technique has been previously used for orchidopexy in a pediatric population by only four authors . sultan et al . used an r - port in a 2-year - old boy ; raju et al . and de lima et al . used rigid instruments in an 18-month - old child and for 3 boys , respectively ; and noh et al . reported a series of 17 patients in which a multichannel single port and flexible tip laparoscope were used . all of these studies showed less orchidopexy in children to be feasible , safe , and scarless , with no intraoperative complications . in terms of technical considerations , the single - incision technique allows adequate visualization and counter traction for performing orchidopexy , especially with a standard instrument . the mean operative time for less orchidopexy in this report was longer than in the series reported by noh et al . , probably because of the use of the flexible tip laparoscope , but it was shorter than the time reported by raju et al . , who reported a technique using standard trocars through a single umbilical incision with an intraabdominal time of 126 minutes . in fact , when the first 10 operative single - incision cases were compared with the second 10 cases , a trend toward a shorter operative time was noted , but this was not statistically significant . recently , zani et al . reported that less seems to be associated with more postoperative pain than standard laparoscopy . the postoperative pain score was not analyzed because this score did not correlate with the requirement for additional analgesics . this is one of the largest series of pediatrics patients to undergo less orchidopexy and the only pediatric study to have been done with a surgical glove port . our results demonstrate the safety and feasibility of this procedure , which can be an alternative to costly commercially available single - port systems , especially in a developing country .

person - to - person contact and transfer through common contact surfaces are further routes that can lead to widespread infectious outbreaks of pathogens such as norovirus and methicillin resistant staphylococcus aureus ( 13 ) . when considering inert surfaces it is generally acknowledged that door handles and forcets are key points where potential virulent pathogens can be transferred ( 1 ) . currency ( paper notes and coins ) is a further common contact surface whereby pathogens can be transferred within a population although the significance remains unknown ( 4 , 5 ) . given that currency is frequently handled and transferred over large geographical areas there is the potential to readily disseminate contamination across the globe ( 46 ) . with respect to risk factors , it can be considered that contamination carried on currency would be most significant in food retail outlets whereby pathogens can be transferred to high risk products such as meat that can support growth of introduced microbes to hazardous levels ( 710 ) . e. coli o157:h7 and salmonella enteritidiscan survive for up to eleven days and up to nine days respectively on the surface of money coins ( 11 ) , thus making it possible for coins to transfer bacteria to human hands ( 12 , 13 ) . paper currency can be contaminated by droplets during coughing , sneezing , touching with previously contaminated hands or other materials and placement on dirty surface ( 13 ) . surveys performed on the pathogens carried via currency have illustrated that e. coli , salmonella and s. aureus , amongst others , are highly prevalent on notes and coins handled at food retail ( 1 , 4 , 5 , 9 ) . several studies from united states reported contamination of coin and paper bills and identification revealed presence of pathogenic or fecal indicator microbes that included s. aureus , e. coli , klebsiella and enterobacter ( 13 , 14 ) . to date , the carriage of pathogens on currency has been studied in europe and north america with little data on other countries ( 6 , 9 , 14 ) . the aim of this study was to investigate the microbial populations associated with iranian paper currency notes . a total of 108 samples of the iranian currency in circulation consisting of six iranian denominations ( including 1000 , 2000 , 5000 , 10000 , 20000 and 50000 rials ) were collected using random sampling approach . these currencies were collected from seven areas representing tabriz city and 108 food - related shops that included food service outlets , greengrocery , supermarket , bakery , confectionary and poultry meat retail outlets . in the laboratory , the currency was categorized according to three criteria ; denomination of currency , source of currency and the physical condition based on the appearance of banknotes . with regards to the latter , currency notes were classed as clean(notes that had a clean appearance without any obvious damage ) , soiled notes ( notes that were not new , torn or frayed and had not sticky tape ) , very soiled notes ( notes that were frayed , dirty and had sticky tape ) ( 1 , 12 , 13 ) . individual currency notes were suspended in 15 ml of tryptic soy broth ( tsb ; merck , darmstadt , germany ) and agitated for 45 min . a serial dilution was prepared in 0.1% peptone and plated onto plate count agar ( pca ; merck ) ( 12 ) . colonies were enumerated and total bacteria ( colony forming unites ) yield from each note calculate . the currency note rinse tsb was then incubated at 37c for 24 hours to enrich for bacteria prior to plating onto selective agar . specifically , maconkey agar ( coliforms ) , eosin methylene blue agar ( emb ) ( escherichia coli ) , baird - parker agar ( s. aureus ) , manitol salt agar ( enterococcus ) , bacillus cereus selective agar ( b. cereus ) , palcam listeria selective agar ( listeria ) ( 12 , 13 ) . for identification salmonella was utilized of manitol selenite cystine broth , rappaport vasidialis broth , xylose lysine deoxycholate agar ( xld ) , bismuth sulphite agar , brilliant green phenol red lactose agar ( bpls ) , salmonella shigella agar ( ss agar ) ( 15 ) . data were verified and analyzed using spss for windows statistical software ( version 11.0 ; spss inc , chicago ) . chi - square test was used to compare the association between the categorized groups and the bacterial contamination . 2000r had the highest tac , followed by 5000r , 10000r and the lowest in 50000r . the majority of notes fell into the soiled or very soiled category reflective of currency that had been in circulation for a period of time . there were no significant ( p>0.05 ) correlations between the carriage of pathogens / fecal indicator bacteria and currency note condition . this would suggest that clean notes are as likely to be contaminated compared to very soiled ( table 1 ) . bacterial contamination of paper currency in relation to their condition in this study the isolated bacteria recovered were bacillus cereus , e. coli , staphylococcus aureus , salmonella , listeria monocytogenes , yersinia entrocolitica ( table 2 ) . the fecal indicator , e. coli , was the most frequently encountered bacteria recovered from currency notes followed by s. aureus . with respect to pathogens , it was noteworthy that all the pathogens screened for where encountered on currency notes were recovered from one sample . this would confirm that bank notes may represent a significant vehicle for disseminating pathogens and also that microbial populations are highly diverse . currency notes from confectionary , meat shops , supermarkets or food service outlets had high carriage of e. coli . in contrast , notes sampled from bakery tended to have a low prevalence of e. coli although carried s. aureus . yet , in general there were no significant correlation between carriage of pathogens / fecal indicators with source of currency notes . from the results obtained in the study it was evident that currency notes represent a significant vehicle for human pathogens . the results agree with the findings of others who also reported a high prevalence of bacteria such as e. coli and s. aureus ( 6 , 16 ) . it has been suggested that the prevalence of microbes recovered from notes is related to the period of time in circulation . from the results , the existence of such correlations between pathogen carriage and physical condition of the currency notes . ( 2011 ) who reported a correlation between carriage and the condition of currency notes ( 3 ) . in the present study , it is likely that the bacteria encountered on notes reflected recent contamination as opposed to long - term exposure to contamination . this view was supported by the fact that e. coli was recovered at high frequency on notes sampled at meat shops compared to those derived from bakery retail outlets . e. coli is frequently recovered from meat due to the transfer of faecal material during the slaughter process or via transfer from contact surfaces . consequently it was not unexpected to encounter e. coli on currency notes derived from meat outlets where transfer to currency notes was via handling . it was suggested that this route accounted for the high prevalence of enteric bacteria recovered from banknotes sampled from poultry meat shops ( 1 ) . yet , the finding that of no correlation between bacterial type encountered and sampling location , suggests that contamination can also be introduced outside the retail environment . our findings indicate that paper currencies notes represent a significant vehicle for human pathogenic bacteria . further investigation should also be focused on how long human pathogens can surviveon paper currency . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors .

patients with chronic abdominal pain often consult many doctors and can undergo extensive testing that is ultimately unsuccessful in identifying the etiology of their pain.(1 ) chronic abdominal pain remains a continuing challenge and may be caused by the presence of intra - abdominal adhesions that lead to disturbances in organ motility . recently , sulaiman et al.(2 ) showed that sensory nerve fibers in all peritoneal adhesions are capable of conducting pain . nearly all patients of both sexes develop intra - abdominal adhesions after surgery in the abdominal cavity.(3 ) about 5% of all abdominal surgery patients will suffer from the consequences of these adhesions , which include bowel obstruction , strangulation , and intermittent acute or chronic abdominal pain.(3,4 ) although an explorative laparotomy is an option in patients with this condition , the open procedure for chronic abdominal pain without complete bowel obstruction has never gained wide acceptance . laparotomy bears the risk of inducing new adhesions and the morbidity and mortality of such an open procedure is thought to be too high to justify it . however , the introduction of laparoscopic techniques has renewed interest in surgical treatment of adhesions causing chronic pain . laparoscopic surgery has been accepted as a technique for diagnostic and therapeutic procedures in general surgery , and the value of diagnostic laparoscopy in patients with chronic abdominal pain has been documented . a diagnosis was established in 76% of 265 patients with chronic abdominal pain as described by salky and edye.(5 - 8 ) a previous history of gynecologic procedures and appendectomy are reported to be the most frequent causes of chronic pain after diagnostic laparoscopy , but upper gastroenterologic procedures are rarely performed.(1,4 - 6 ) this case study provides evidence that laparoscopic evaluation of selected patients is beneficial in providing relief from chronic abdominal pain . our findings provide a basis for recommendations for the selection of patients who are likely to benefit from diagnostic laparoscopy . here we describe two cases of laparoscopic adhesiolysis for chronic abdominal pain without intestinal obstruction after total gastrectomy . a 71-year - old male was diagnosed with early gastric cancer in december , 2007 . the cancer was located in the lower third and greater curvature of the stomach , so we performed distal gastrectomy . however , five days later , the patient underwent total gastrectomy because the proximal resection margin was found to be positive on pathologic analysis . there was no recurrence or intestinal obstruction on abdominopelvic computed tomography ( ct ) ( fig . 1a ) and simple abdominal x - rays revealed mild paralytic ileus without definite intestinal obstruction ( fig . we decided to perform diagnostic laparoscopy to determine the cause of his chronic abdominal pain in november , 2009 . three working ports , including a right lower anti - mcbourney points port inserted by the open method , were placed . he is currently doing well with no abdominal pain and his weight has increased from 45 kg to 51 kg . a 57-year - old male underwent distal gastrectomy with gastrojejunostomy under the diagnosis of gastric cancer in may , 2007 . recurrence in the remnant stomach was detected during a regular check - up , and completion gastrectomy was performed in march , 2010 . however , the patient complained of intermittent chronic abdominal pain radiating from his back to his waist for one year following the completion gastrectomy . we performed abdominopelvic ct , an upper gastrointestinal series , small bowel series , and simple x - rays , none of which indicated stricture , intestinal obstruction , or strangulation ( fig . we performed diagnostic laparoscopy in june , 2012 , and the surgical technique was the same as in case 1 . the operative findings included an adhesion in the jejunojejunostomy anastomosis and dense adhesion in the small bowel itself . the operation time was 100 minutes and he was discharged from the hospital on postoperative day 1 without any complications . he is doing well , although he has reported intermittent abdominal pain and has stopped taking analgesics . a 71-year - old male was diagnosed with early gastric cancer in december , 2007 . the cancer was located in the lower third and greater curvature of the stomach , so we performed distal gastrectomy . however , five days later , the patient underwent total gastrectomy because the proximal resection margin was found to be positive on pathologic analysis . there was no recurrence or intestinal obstruction on abdominopelvic computed tomography ( ct ) ( fig . 1a ) and simple abdominal x - rays revealed mild paralytic ileus without definite intestinal obstruction ( fig . we decided to perform diagnostic laparoscopy to determine the cause of his chronic abdominal pain in november , 2009 . three working ports , including a right lower anti - mcbourney points port inserted by the open method , were placed . he is currently doing well with no abdominal pain and his weight has increased from 45 kg to 51 kg . a 57-year - old male underwent distal gastrectomy with gastrojejunostomy under the diagnosis of gastric cancer in may , 2007 . recurrence in the remnant stomach was detected during a regular check - up , and completion gastrectomy was performed in march , 2010 . however , the patient complained of intermittent chronic abdominal pain radiating from his back to his waist for one year following the completion gastrectomy . we performed abdominopelvic ct , an upper gastrointestinal series , small bowel series , and simple x - rays , none of which indicated stricture , intestinal obstruction , or strangulation ( fig . we performed diagnostic laparoscopy in june , 2012 , and the surgical technique was the same as in case 1 . the operative findings included an adhesion in the jejunojejunostomy anastomosis and dense adhesion in the small bowel itself . the operation time was 100 minutes and he was discharged from the hospital on postoperative day 1 without any complications . he is doing well , although he has reported intermittent abdominal pain and has stopped taking analgesics . major abdominal operations often result in random and unpredictable intra - abdominal scar tissue formation . sometimes intra - abdominal scar tissue may result in symptomatic intermittent chronic pain without intestinal obstruction , especially in patients with a prior history of gynecological procedures and appendectomy.(4 - 6 ) diagnostic laparoscopy is often used to identify specific intra - abdominal pathology as the cause for chronic abdominal and pelvic pain . however , few studies have determined that laparoscopic adhesiolysis , as the only operative intervention , ameliorates a significant amount of chronic abdominal pain.(7 - 9 ) furthermore , only a few reports of the role of laparoscopic adhesiolysis in the setting of chronic pain have been published . additionally , in terms of upper gastroenterologic procedures , there have been no studies of laparoscopic adhesiolysis for chronic abdominal pain without intestinal obstruction after total gastrectomy . we performed two cases of laparoscopic adhesiolysis for chronic abdominal pain without intestinal obstruction after total gastrectomy . although many diagnostic tests were performed in our cases , the cause of the chronic intermittent pain was not found . according to available data , peritoneal adhesions form in 93~100% of adults after laparotomy for upper abdominal surgery , with the laparoscopic approach decreasing that percentage to 45% . the frequency of surgical re - intervention for adhesion - related symptoms varies with the type of initial procedure but , in all cases , remains between 6.4 and 10% of adult patients . the greater omentum is the organ most typically involved in adhesion formation.(10 ) however , the incidence of postoperative chronic pain in upper abdominal surgery without intestinal obstruction is unknown . laparoscopy has both a diagnostic and therapeutic role since it permits recognition and simultaneous treatment of the cause of pain , although adhesiolysis may result in renewed adhesion formation . in any case , the benefit of extensive adhesiolysis in the treatment of patients with chronic abdominal pain and diffuse adhesions has not been proven , and this procedure has its own significant morbidity ( enterotomy ) . the use of laparoscopy in patients with ill - defined chronic abdominal pain remains controversial . while others have found that the patients in whom adhesions were found seemed to experience the most relief after laparoscopy , ikard questioned whether laparoscopic adhesiolysis is of benefit and suggested that it may not be safe . he refers to the " traditional surgical teaching " that " adhesions do not cause pain unless they are obstructing " and believes that the only currently recognized surgical indication for enterolysis is bowel obstruction . as he indicates , the laparoscopic approach in a patient with known bowel obstruction can provide inadequate exposure and may be dangerous.(7,11,12 ) however , it is unclear whether non - obstructing adhesions involving the bowel can cause pain . a study by mueller et al . , who support and cite the findings of kresch et al . , indicated that not all abdominal adhesions cause pain . instead , they believe that only those adhesions limiting the movement or distensibility of organs involving the parietal peritoneum or bowel are likely to cause pain.(13,14 ) thus , one may infer that lysis of these adhesive bands , which allows the free movement and distensibility of organs or may release traction on bowel loops , could potentially result in relief from chronic abdominal pain.(8 ) diagnostic laparoscopy makes it possible for the surgeon to visualize the surface anatomy of the intra - abdominal organs in detail better than any other imaging modality . however , deep parenchymal organs , processes of the retroperitoneal space , and the inner surface of hollow organs can not always be visualized using laparoscopy . thus , preoperative imaging studies have to be undertaken to rule out tumors of the retroperitoneum before laparoscopy is performed in patients with chronic abdominal pain.(7 - 9,15 ) as in our cases , these patients should be examined via several endoscopies , computed tomography , and ultrasound prior to laparoscopy . furthermore , the patients included in this study underwent laparoscopy after other pathologic causes for their pain had been excluded by radiographic and laboratory tests . the subjective benefit of laparoscopy for both the operating surgeon and for the patient is that it can be used to definitively determine whether there is serious pathology intra - abdominally . in summary , we have found that patients with a prior history of abdominal surgery who are referred to a surgeon experienced in laparoscopy due to complaints of chronic abdominal pain are likely to benefit from exploratory laparoscopy if other pathologic causes have been ruled out . in carefully selected patients laparoscopic adhesiolysis for chronic abdominal pain is safe and effective and results in minimal peri - operative morbidity . moreover , laparoscopic adhesiolysis can be considered suitable for patients with chronic abdominal pain if other diagnostics tests are negative .

coronary heart disease ( chd ) , including its severe sequelae , myocardial infarction ( mi ) , is the leading cause of disease - related morbidity and mortality worldwide , and accounts for approximately 7 million deaths each year . chd is a multifactorial disease , with both environmental and genetic factors involved [ 35 ] . the key risk factors for chd are smoking , family history , hypertension , obesity , diabetes , sedentary behavior , hyperlipidemia , and low - density lipoprotein cholesterol ( ldl - c ) [ 68 ] . with advancing age , inflammatory deposits or atherosclerotic plaques coat the walls of arteries supplying blood and oxygen to the heart and consequently severely restrict blood supply , causing angina , and shortness of breath ; plaques rupture or break , causing heart attack and myocardial infarction , which severely diminishes heart function and is often fatal . atherosclerotic inflammation is the critical factor in formation of coronary plaques and the progression of plaques to an unstable state , resulting in mi . in the past decade , the influence of genetic factors in the development of chd has been widely investigated . adenosine triphosphate - binding cassette transporter a1 ( abca1 ) belongs to the atp - binding cassette super family , and single - nucleotide polymorphisms ( snps ) have been discovered in this gene that are relevant to human disease conditions . in particular , mutations in this gene lead to heritable high - density lipoprotein ( hdl ) disorder and tangier disease , both of which are associated with increased risk of early - onset chd . among the absc1 snps , r219k polymorphism occurs in the coding region , leading to an amino acid substitution from arginine to lysine in exon 7 ( rs2230806 ) , and is widely studied for its association with susceptibility to chd . the c - reactive protein gene ( crp ) is mapped to chromosome 1q21 to 1q23 within a conserved genetic region spanning approximately 1.9 kb . elevated levels of serum crp reflect an inflammatory state and crp itself participates in inflammation responses ; and its circulating concentration is a sensitive marker for cardiovascular disease risk . previous studies reported that snps in crp alter crp levels in plasma and , since crp protein is present in atherosclerotic plaques , where it elicits pro - inflammatory and atherogenic outcomes , snps in crp are of direct relevance to chd risk [ 2022 ] . although the precise role of genetic factors in susceptibility to chd remains unclear , the role of crp and abca1 gene polymorphisms in chd susceptibility is of significant interest due to their high clinical value . however , a few previous studies noted no significant association of crp gene polymorphisms with the susceptibility to chd , but other studies showed a significant association of crp and abca1 gene polymorphisms with chd susceptibility . to address the conflicting data and to investigate the role of crp and abca1 gene polymorphisms in chd susceptibility , we studied 1059 g > c snp in exon 2 of crp and r219k ( rs2230806 ) polymorphism of abca1 in this meta - analysis . to identify relevant published studies , the electronic databases pubmed , springer link , wiley , ebsco , ovid , wanfang database , vip database , and china national knowledge infrastructure ( cnki ) were searched exhaustively ( last updated search in october , 2014 ) by applying a sensitive search strategy using search terms : ( coronary heart disease or myocardial infarction or acute myocardial infarction or ami ) and ( abca1 or crp or crp c - reactive protein or genetic polymorphism ) . manual searches were conducted to retrieve other cross - references . published studies retrieved met these inclusion criteria : ( 1 ) research topic : correlations between abca1 r219k ( rs2230806 ) or crp + 1059g / c ( rs1800947 ) gene polymorphisms and susceptibility to chd ; ( 2 ) study type : case - control studies ; ( 3 ) subject investigated : chd patients and normal controls ; ( 4 ) relevant indicators : allele and genotype frequency ; and ( 5 ) studies published in chinese or english . only the latest complete study was considered when the extracted studies were published by the same authors . the exclusion criteria were : ( 1 ) insufficient data ; ( 2 ) animal studies ; ( 3 ) duplicate publications ; and ( 4 ) absence of data integrity . collected information included : the first author , publication year , country , age , sex , gene , number of case and controls , ethnicity , language , genotyping method , detection method , and snp site . the study quality was assessed by 2 or more investigators independently using the critical appraisal skill program ( casp ) criteria ( http://www.casp-uk.net/ ) . the differences in allele and genotype frequency of abca1 r219k ( rs2230806 ) and crp + 1059g / c ( rs1800947 ) polymorphisms were estimated by odds ratio ( or ) with 95% confidence intervals ( 95%ci ) . forest plots were used to reflect the comparisons of ors with 95%ci between the 2 groups . the heterogeneity was determined using the cochran s q - statistic ( p<0.05 was considered significant ) and i test ( 0% , no heterogeneity ; 100% , maximal heterogeneity ) . the random - effects model was used in case of significant heterogeneity ( p<0.05 or i test exhibited > 50% ) ; otherwise , the fixed - effects model was used . the potential sources of heterogeneity were evaluated by univariate and multivariate meta - regression analysis , confirmed by monte carlo method . sensitivity analysis was conducted to assess whether a study had significant influences on the overall results by deleting each study sequentially . funnel plots , classic fail - safe n , and egger s linear regression test were used to define the publication bias . to identify relevant published studies , the electronic databases pubmed , springer link , wiley , ebsco , ovid , wanfang database , vip database , and china national knowledge infrastructure ( cnki ) were searched exhaustively ( last updated search in october , 2014 ) by applying a sensitive search strategy using search terms : ( coronary heart disease or myocardial infarction or acute myocardial infarction or ami ) and ( abca1 or crp or crp c - reactive protein or genetic polymorphism ) . published studies retrieved met these inclusion criteria : ( 1 ) research topic : correlations between abca1 r219k ( rs2230806 ) or crp + 1059g / c ( rs1800947 ) gene polymorphisms and susceptibility to chd ; ( 2 ) study type : case - control studies ; ( 3 ) subject investigated : chd patients and normal controls ; ( 4 ) relevant indicators : allele and genotype frequency ; and ( 5 ) studies published in chinese or english . only the latest complete study was considered when the extracted studies were published by the same authors . the exclusion criteria were : ( 1 ) insufficient data ; ( 2 ) animal studies ; ( 3 ) duplicate publications ; and ( 4 ) absence of data integrity . disagreements between the investigators were resolved by discussion with a third investigator . collected information included : the first author , publication year , country , age , sex , gene , number of case and controls , ethnicity , language , genotyping method , detection method , and snp site . the study quality was assessed by 2 or more investigators independently using the critical appraisal skill program ( casp ) criteria ( http://www.casp-uk.net/ ) . the differences in allele and genotype frequency of abca1 r219k ( rs2230806 ) and crp + 1059g / c ( rs1800947 ) polymorphisms were estimated by odds ratio ( or ) with 95% confidence intervals ( 95%ci ) . the z test forest plots were used to reflect the comparisons of ors with 95%ci between the 2 groups . the heterogeneity was determined using the cochran s q - statistic ( p<0.05 was considered significant ) and i test ( 0% , no heterogeneity ; 100% , maximal heterogeneity ) . the random - effects model was used in case of significant heterogeneity ( p<0.05 or i test exhibited > 50% ) ; otherwise , the fixed - effects model was used . the potential sources of heterogeneity were evaluated by univariate and multivariate meta - regression analysis , confirmed by monte carlo method . sensitivity analysis was conducted to assess whether a study had significant influences on the overall results by deleting each study sequentially . funnel plots , classic fail - safe n , and egger s linear regression test were used to define the publication bias . our search identified 139 published records , from which we excluded duplicates ( n=17 ) , letters , reviews , or meta - analysis ( n=4 ) , non - human studies ( n=4 ) , and studies in languages other than chinese or english ( n=3 ) . the remaining 111 studies were reviewed and a total of 78 studies were removed because they were not case - control ( n=10 ) , they were unpublished studies ( n=2 ) , or they were irrelevant to abca1 and crp gene ( n=35 ) or irrelevant to chd ( n = 31 ) . after further assessment , 22 studies were removed for not containing enough information . following this multi - step screening process , 11 studies with 3053 chd patients and 3403 healthy controls were finally selected after a full - text analysis [ 20,23,3240 ] . the 11 studies were published from 2005 to 2013 , with sample sizes ranging from 121 to 1900 . the gene loci of abca1 r219k ( rs2230806 ) and crp + 1059g / c ( rs1800947 ) are presented in figure 1 . among the 11 studies , 3 studies were performed in caucasians , 7 studies were performed in asians , and 1 study was performed in africans . polymerase chain reaction with restriction fragment length polymorphism ( pcr - rflp ) was a common genotyping method among the studies . the baseline characteristics and selection procedure for the 11 studies are presented in table 1 and figure 2 , respectively . five studies reported the correlation between abca1 r219k ( rs2230806 ) polymorphism and susceptibility to chd . considering the significant heterogeneity among studies , the random - effects model was used ( allele model : i=69.552% , p=0.011 ; dominant model : i=59.318% , p=0.043 ) . as shown in figure 3a , 3b , and table 2 , the abca1 r219k ( rs2230806 ) polymorphism significantly increased the susceptibility to chd ( allele model : or=0.729 , 95% ci=0.559~0.949 , p=0.019 ; dominant model : or=0.698 , 95% ci=0.507~0.961 , p=0.027 ) . meta - regression analysis showed that publication year , ethnicity , and sample size were neither the heterogeneous sources nor the key factors that influenced the overall effect size ( both p > 0.05 ) ( figure 4a4c , table 3a ) . a total of 6 studies reported the correlation between crp + 1059g / c ( rs1800947 ) polymorphism and susceptibility to chd . the random - effects model was used due to significant heterogeneity ( allele model : i=78.465% , p<0.001 ; dominant model : i=76.652% , p=0.001 ) . the results of the present meta - analysis failed to show any significant correlation between the polymorphism of crp + 1059g / c ( rs1800947 ) and susceptibility to chd ( allele model : or=1.170 , 95% ci=0.782~1.751 , p=0.444 ; dominant model : or=1.175 , 95% ci=0.768~1.797 , p=0.457 ) ( figure 3c , 3d , table 2 ) . meta - regression analysis suggested that publication year , ethnicity and sample size are not heterogeneous sources or key factors influencing the overall effect size ( both p>0.05 ) ( figure 4d4f , table 3b ) . the sensitivity analysis showed that no single study significantly affected the pooled ors of correlations between crp + 1059g / c ( rs1800947 ) polymorphism and susceptibility to chd . except for the studies by li et al . 2013 , no single study affected the pooled ors of correlations between abca1 r219k ( rs2230806 ) polymorphism and susceptibility to chd ( figure 5 ) . the shape of funnel plots did not reveal any evidence of funnel plot asymmetry and the statistical results did not show any publication bias . classic fail - safe n and egger s linear regression test confirmed that there was no significant publication bias ( all p>0.05 ) ( figure 6 ) . our search identified 139 published records , from which we excluded duplicates ( n=17 ) , letters , reviews , or meta - analysis ( n=4 ) , non - human studies ( n=4 ) , and studies in languages other than chinese or english ( n=3 ) . the remaining 111 studies were reviewed and a total of 78 studies were removed because they were not case - control ( n=10 ) , they were unpublished studies ( n=2 ) , or they were irrelevant to abca1 and crp gene ( n=35 ) or irrelevant to chd ( n = 31 ) . after further assessment , 22 studies were removed for not containing enough information . following this multi - step screening process , 11 studies with 3053 chd patients and 3403 healthy controls were finally selected after a full - text analysis [ 20,23,3240 ] . the 11 studies were published from 2005 to 2013 , with sample sizes ranging from 121 to 1900 . the gene loci of abca1 r219k ( rs2230806 ) and crp + 1059g / c ( rs1800947 ) are presented in figure 1 . among the 11 studies , 3 studies were performed in caucasians , 7 studies were performed in asians , and 1 study was performed in africans . polymerase chain reaction with restriction fragment length polymorphism ( pcr - rflp ) was a common genotyping method among the studies . the baseline characteristics and selection procedure for the 11 studies are presented in table 1 and figure 2 , respectively . five studies reported the correlation between abca1 r219k ( rs2230806 ) polymorphism and susceptibility to chd . considering the significant heterogeneity among studies , the random - effects model was used ( allele model : i=69.552% , p=0.011 ; dominant model : i=59.318% , p=0.043 ) . as shown in figure 3a , 3b , and table 2 , the abca1 r219k ( rs2230806 ) polymorphism significantly increased the susceptibility to chd ( allele model : or=0.729 , 95% ci=0.559~0.949 , p=0.019 ; dominant model : or=0.698 , 95% ci=0.507~0.961 , p=0.027 ) . meta - regression analysis showed that publication year , ethnicity , and sample size were neither the heterogeneous sources nor the key factors that influenced the overall effect size ( both p > 0.05 ) ( figure 4a4c , table 3a ) . a total of 6 studies reported the correlation between crp + 1059g / c ( rs1800947 ) polymorphism and susceptibility to chd . the random - effects model was used due to significant heterogeneity ( allele model : i=78.465% , p<0.001 ; dominant model : i=76.652% , p=0.001 ) . the results of the present meta - analysis failed to show any significant correlation between the polymorphism of crp + 1059g / c ( rs1800947 ) and susceptibility to chd ( allele model : or=1.170 , 95% ci=0.782~1.751 , p=0.444 ; dominant model : or=1.175 , 95% ci=0.768~1.797 , p=0.457 ) ( figure 3c , 3d , table 2 ) . meta - regression analysis suggested that publication year , ethnicity and sample size are not heterogeneous sources or key factors influencing the overall effect size ( both p>0.05 ) ( figure 4d4f , table 3b ) . the sensitivity analysis showed that no single study significantly affected the pooled ors of correlations between crp + 1059g / c ( rs1800947 ) polymorphism and susceptibility to chd . except for the studies by li et al . 2013 , no single study affected the pooled ors of correlations between abca1 r219k ( rs2230806 ) polymorphism and susceptibility to chd ( figure 5 ) . the shape of funnel plots did not reveal any evidence of funnel plot asymmetry and the statistical results did not show any publication bias . classic fail - safe n and egger s linear regression test confirmed that there was no significant publication bias ( all p>0.05 ) ( figure 6 ) . to investigate the associations of crp and abca1 gene polymorphisms with chd susceptibility , we selected 2 polymorphisms , 1059 g > c ( rs1800947 ) of crp and r219k ( rs2230806 ) of abca1 , and performed a comprehensive meta - analysis of the available data . the results of the present meta - analysis suggest that r219k ( rs2230806 ) polymorphism of abca1 is associated with a significantly increased risk of chd . the influence of abca1 on plasma lipid levels may be a potential mechanism by which abca1 r219k polymorphism is involved with the risk of chd . disorders of lipid homeostasis are important in the development and progression of chd and hyperlipidemia is a major risk factor for chd . atherosclerosis , the major cause of chd , is characterized by accumulation of unbalanced lipid in the arterial wall , resulting in narrowing of the vessel lumen . the major pathogenesis of atherosclerosis is reverse cholesterol transport ( rct ) mediated by hdl - c , which facilitates cholesterol efflux from peripheral cells . abca1 stimulates cholesterol efflux to lipid - poor hdl apolipoproteins , the initial step in reverse cholesterol transport . high plasma ldl - c concentration contributes to the development of atherosclerotic plaques , whose break - up or rupture result in angiemphraxis and ischemic cardiac events . another probable mechanism is that r219k polymorphism enhances abca1 activity , leading to mediation of cholesterol efflux , independent of plasma hdl - c levels . several case - control studies investigated the association between abca1 r219k polymorphism and the susceptibility to chd , but the findings were conflicting . consistent with our results , the r219k variant was shown to modulate the hdl - c response to chd medication in patients with chd , suggesting a possible association between r219k gene polymorphism and chd . studies investigating the association between polymorphisms of the crp gene and atherosclerosis suggest that variations in crp might be involved in the pathogenesis of chd and could be helpful in predicting chd . in the present meta - analysis , we found no significant association between crp 1059 g > c ( rs1800947 ) polymorphism and chd susceptibility . in accordance with our result , a previous study also found that crp 1059g / c gene variation resulted in higher plasma crp levels but was not associated with risk for ami and chd . some limitations should be noted while interpreting the results of the present meta - analysis . first , inter - study heterogeneity still existed in this meta - analysis even though we minimized its likelihood by performing a sensitive search strategy . second , as a retrospective study , the present meta - analysis may have recall or selection bias , possibly influencing the stability of our results . third , the limited access to the original data from some studies restrained our further investigation of the potential interactions between other factors and chd risks , such as gene - environment and gene - gene interactions . fourth , most of the 11 eligible studies were performed in asians and only 1 study was performed in africans . finally , the language of included studies was limited to english and chinese , and studies published in other languages were excluded . in summary , our meta - analysis shows that abca1 r219k ( rs2230806 ) polymorphism is associated with susceptibility to chd , but crp + 1059g / c ( rs1800947 ) is not correlated with chd risk . furthermore , gene - to - gene and gene - to - environment interactions should also be investigated in future studies . a better understanding of the mechanism of chd pathogenesis will be beneficial in future studies on prevent chd progression .

pseudoaneurysms of the axillary artery are uncommon and usually encountered after penetrating or blunt trauma to the axilla ( 1 ) . in the latter case there tends to be an associated bony injury to the shoulder , most often an anterior dislocation ( 2 ) , in which axillary artery damage has been reported at around 0.3% prevalence ( 3 ) . other injuries that have been described are fractures of the neck of the humerus and proximal humerus ( 4 ) . indeed clinical suspicion can be lessened by the absence of hard initial signs of arterial injury ( 6 ) and the patient may present much later with potentially irreversible sequelae , particularly brachial plexus injuries ( 5 ) . here we describe hare a unique case , where the patient initially presented with no dislocation or fracture and indeed the full consequences of the injury only became apparent when significant secondary neurological deficit had occurred . an 80 year old man sustained an injury to his left shoulder during a fall . as a result of the intoxication the history of the mechanism of injury was poor . the gentleman was not taking aspirin or other anticoagulants . on examination movements of the shoulder girdle neurological examination of the left upper limb was normal , as was vascular state of the left arm . conservative therapy was adopted and the patient was discharged to the rehabilitation ward after two weeks . x - ray of left shoulder on presentation ten weeks later a repeat orthopaedic review was requested by the rehabilitation team . there had been a slow onset and progression of oedema in the arm , with gradual progression of neurological deficit to the point at which the arm became useless and insensate . an increase in axillary bruising was noted . also , the patient required a three - unit blood transfusion for a drop in haemoglobin six weeks after the injury . there was a thrill over the whole pectoral region and signs of venous hypertension in the arm . the left radial , ulnar and brachial pulses were normal . repeat x ray showed subluxation of the left shoulder joint ( figure 2 ) . ct angiography revealed a distal axillary pseudoaneurysm with a sac of 15 cm diameter ( figure 3 ) . repeat x - ray of left shoulder demonstrating subluxation of the head of the humerus ct angiography of left shoulder demonstrating the pseudoaneurysm to attempt endovascular repair , an operative approach to the brachial artery preceded retrograde insertion of a 6 cm long , 8 mm thick fluency nitinol self - expanding ptfe covered stent ( bard ) . pseudoaneurysms after blunt trauma to the shoulder tend to occur in the third part of the axillary artery ( 7 ) . one theory for this is the lesser mobility of this region of artery because of the relatively fixed nature of the circumflex humeral and subscapular arteries , leading to tearing of the axillary artery with attempts at mobilisation ( 3,4 ) . there are at least 27 reported cases in the literature of axillary pseudoaneurysm as a complication of anterior shoulder dislocation . we are unable to find any cases reported in the absence of a bony injury in blunt trauma . in this case presentation was late with total paralysis of the arm secondary to a brachial plexus lesion . this has been described by several authors and can occur as a primary injury or delayed , as the aneurysm grows in size and compresses the plexus ( 8) . the anatomical basis for this is likely the association of the axillary artery and cords of the brachial plexus in a common fascial sheath , the medial brachial fascial compartment ( 9 ) . the secondary brachial plexus injury may be a neuropraxia ( 5 ) or an axonotmesis ( 8) , the latter having significantly worse prognosis . delay decompression of paramount importance for recovery ( 1 ) . in this case axonal degeneration was observed , with low likelihood of significant recovery . six weeks post surgery , assessment by the rehabilitation team had not shown any sign of recovery . the poor outlook is supported by several authors , including robbs et al ( 5 ) , who reported 12 cases of delayed ( after one to six weeks ) compression of the brachial plexus by an axillary pseudoaneurysm in a variety of injuries . the outcome of the six patients presenting initially with total brachial plexus lesions were that none recovered fully , and one showed no recovery whatsoever at 18 months . clearly if a patient presents with signs of circulatory compromise of the upper limb or a wound very close to the anatomical location of a major artery there will be significant clinical suspicion of vessel injury . the problem in this case , as in others , is that none of these signs were present . several authors have highlighted important symptoms or signs in the early period post injury that can raise suspicion . in the study by robbs ( 5 ) retrospective signs were found which would have aided diagnosis . these were : the prescence of significant bruising , swelling or a large haematoma ; persistence of pain ; a distal pulse deficit ; onset of progressive neurological deficit ; and a significant drop in haemoglobin or haematocrit . this is supported by the findings of other authors ( 1,4,6 ) most of these observations were also made with this case . perhaps the most significant and early finding in our patient was the large haematoma commented upon in the shoulder ultrasonographs . the lesion was repaired by an endovascular retrograde approach whereby the neck of the lesion was located just distal to the origin of the subscapular artery and the cavity excluded successfully by the insertion of self - expanding fluency nitinol ptfe - covered stent ( bard ) . such a method was favoured here because the condition of the arm rendered open approaches hazardous . there are several reports of the treatment of such lesions by stent graft , including those of xenos ( 10 ) , whilst open repair also offers a simultaneous opportunity to explore for and deal with associated injuries .

breast cancer ( bc ) , the most frequent carcinoma diagnosed and cause of death among women , affects 1,676,660 women worldwide and causes 521,900 mortalities every year . the latest statistics have revealed that the morbidity and mortality rates associated with bc accounts for 29% and 14% of cancers , respectively , in the united states . targeted drugs have been approved to treat her2-positive bc , but resistance remains an inevitable outcome . bc is a molecularly heterogeneous disease , and well - defined and effective molecular targets are still lacking . micrornas ( mirnas ) are highly conserved , small , noncoding , single - stranded rnas with 1924 nucleotides . mirnas transcriptionally or post - transcriptionally regulate gene expression through binding to targeted mrnas and influence the degradation and translation of mrna . mirnas regulate gene expression and the levels of proteins that act as oncogenes or cancer suppressors . moreover , mirnas are involved in various biological processes , and accumulating evidence suggests that aberrant levels of mirnas are linked to proliferation , angiogenesis , and metastasis in various human malignancies . with the development and application of molecular biology technology , a vital role for mirnas in the diagnosis , prognosis , and therapy prediction of bc has been revealed [ 911 ] . the mature mirna microrna-101 - 3p ( mir-101 - 3p , previously named mir-101 ) can be generated from mir-101 - 1 and mir-101 - 2 ( the precursor mirna , pre - mirna ) . mir-101 - 1 and mir-101 - 2 are located on different chromosomes and have different sequences , with diverse functions in the process of transcription . mir-101 - 3p inhibits proliferation , invasion , and metastasis via targeting stathmin1 ( stmn1 ) and cxcr7 and promotes apoptosis by targeting jak2 in bc cells . nevertheless , the precise mechanism of mir-101 - 3p in inhibiting neoplasia is still not entirely clear . therefore , comprehensive analysis of the target gene networks and clinical value may help further clarify the function of mir-101 - 3p . in recent years , the development of microarray technology has served as an effective measure to identify differentially expressed genes ( degs ) . degs can be found through different experimental treatments , and their biological functions can be speculated via known information . several expression chips have confirmed the aberrant expression of mirnas in bc and mirnas influencing tumor behavior and progression . a massive amount of complex biological information data has been generated and has greatly deepened our understanding of bc . comprehensive analysis of gene expression patterns may aid in the prevention , treatment , and determination of prognosis in bc . in this study , datasets of mir-101 in patients with bc , including 781 tumors and 87 adjacent non - tumor breast tissues from the cancer genome atlas ( tcga ) , were explored . furthermore , we analyzed the gene expression profile to identify degs between the mir-101 - 3p transfected group and the negative control group of bc cells . the target genes acquired from gene expression omnibus ( geo ) and prediction software were combined , and their potential roles were further explored with pathway , gene ontology ( go ) , and network analyses . the present study explored the comprehensive roles and prospective molecular mechanisms of mir-101 - 3p and might facilitate the discovery of potential novel biomarkers for future investigation of the mechanisms involved in bc . mir-101 ( mir-101 - 1 and mir-101 - 2 ) sequence data of bc were obtained from the tcga dataset on 15 may 2016 ; the dataset included 781 patients with bc and 87 adjacent noncancerous breast tissues . in bc , the expression levels of log2-transformed mir-101 - 1 and mir-101 - 2 were analyzed , as was their correlation with survival data and clinical parameters . microarray data for mir-101 - 3p transfected in bc cells were searched in gene expression omnibus ( geo , http://www.ncbi.nlm.nih.gov/geo/ ) . the array data for gse31397 were retrieved as raw data files based on the gpl570 platform ( affymetrix human genome u133 plus 2.0 array ; affymetrix , inc . , the alterations in mir-101 - 3p transfected mcf-7 cells compared with scramble control transfected cells were included in the expression profiling . the affymetrix package in r language preprocessed the original data , and probe - level data were mapped to gene names . the degs between the mir-101 - 3p transfected cells and the control group were identified with the limma package of r language . down - regulated degs were determined with the criteria of fold change > 2.5 and p value < 0.05 . potential target genes of mir-101 - 3p were predicted by 13 online databases : dianamt , mirtarbase , rna22 , miranda , pictar , mirdb , mirwalk , polymirts , pita , rnahybrid , targetscan , targetminer , and tarbase . targets were acquired from the dges in geo and the predicted genes that were identified in more than 5 out of 13 programs . moreover , the experimental validation of the targets using a luciferase reporter assay , wb , and rt - pcr was collected from tarbase , mirtarbase , and published studies . to discern the biological attributes of the putative target genes , go and kegg enrichment analyses spss 20.0 was used for data analysis ; data are presented as the mean standard deviation ( sd ) . statistical significance was assessed with a 2-sample t test between the cancer samples and adjacent noncancerous tissues and the correlation between mir-101 - 3p and clinical features . mir-101 ( mir-101 - 1 and mir-101 - 2 ) sequence data of bc were obtained from the tcga dataset on 15 may 2016 ; the dataset included 781 patients with bc and 87 adjacent noncancerous breast tissues . in bc , the expression levels of log2-transformed mir-101 - 1 and mir-101 - 2 were analyzed , as was their correlation with survival data and clinical parameters . microarray data for mir-101 - 3p transfected in bc cells were searched in gene expression omnibus ( geo , http://www.ncbi.nlm.nih.gov/geo/ ) . the array data for gse31397 were retrieved as raw data files based on the gpl570 platform ( affymetrix human genome u133 plus 2.0 array ; affymetrix , inc . , santa clara , ca ) . the alterations in mir-101 - 3p transfected mcf-7 cells compared with scramble control transfected cells were included in the expression profiling . the affymetrix package in r language preprocessed the original data , and probe - level data were mapped to gene names . the degs between the mir-101 - 3p transfected cells and the control group down - regulated degs were determined with the criteria of fold change > 2.5 and p value < 0.05 . potential target genes of mir-101 - 3p were predicted by 13 online databases : dianamt , mirtarbase , rna22 , miranda , pictar , mirdb , mirwalk , polymirts , pita , rnahybrid , targetscan , targetminer , and tarbase . targets were acquired from the dges in geo and the predicted genes that were identified in more than 5 out of 13 programs . moreover , the experimental validation of the targets using a luciferase reporter assay , wb , and rt - pcr was collected from tarbase , mirtarbase , and published studies . to discern the biological attributes of the putative target genes , go and kegg enrichment analyses were completed using david ( https://david.ncifcrf.gov , version 6.7 ) . spss 20.0 was used for data analysis ; data are presented as the mean standard deviation ( sd ) . statistical significance was assessed with a 2-sample t test between the cancer samples and adjacent noncancerous tissues and the correlation between mir-101 - 3p and clinical features . the mir-101 - 2 expression level was lower in bc than in the normal cells , but this difference was not statistically significant ( figure 1a , 1d ) . a receiver operating characteristic ( roc ) curve was constructed to identify diagnostic value in the cases of bc compared with non - cancer breast tissues . the area under the curve ( auc ) of mir-101 - 1 was 0.56 ( 95% ci : 0.500.62 ) , with a sensitivity and specificity of 51.0% and 62.1% , respectively ( figure 1b ) . the auc of mir-101 - 2 was 0.63 ( 95% ci : 0.580.68 ) , with a sensitivity and specificity of 83.9% and 44.8% , respectively ( figure 1e ) . in the analysis of mir-101 and clinical parameters , mir-101 - 1 was prominently associated with the expression of the estrogen receptor ( er ) , progesterone receptor ( pr ) , and human epidermal growth factor receptor 2 ( her2 ) in bc ( table 1 ) . mir-101 - 2 was significantly associated with tumor ( t ) , lymph node ( n ) , and metastasis ( m ) stages of bc ( table 2 ) . moreover , decreased mir-101 - 1 expression revealed a poor prognosis in bc ( hr=1.79 ; 95% ci : 1.063.01 ; p=0.028 ) ( figure 1c ) . however , no significant prognostic value was identified for mir-101 - 2 in bc ( hr=1.423 , 95% ci : 0.842.41 ; p=0.183 ) ( figure 1f ) . as shown in figure 2 , gse31397 array data were acquired , and 921 genes were selected as differentially expressed in mir-101 - 3p transfected mcf-7 cells compared with scramble control cells . in addition , the online prediction process was conducted with 13 databases to obtain potential targets of mir-101 - 3p , and 7924 genes were identified after duplicated genes were excluded . the genes predicted by 5 out of 13 programs were selected , and then 377 target genes were searched from the array data and predicted targets . furthermore , 69 available genes that were identified as targets of mir-101 - 3p through tarbase , mitarbase and published literature were included ( table 3 ) . eventually , a total of 427 genes were identified for the gene - annotation enrichment analysis and kegg pathway analysis . selecting homo sapiens as the background of listed target genes in david , we obtained the go term annotations and kegg pathway analysis through the functional annotation summaries . an ease score or modified fisher s exact test was utilized for calculating the p value . the results of the go analysis are summarized in table 4 and figure 3 , and the top 10 enriched items are listed according to p values . the biological processes ( bp ) of the potential targets of mir-101 - 3p markedly focused on the gene expression , transcription , metabolism , biosynthesis , and proliferation processes ( p<0.001 ) . as for the cellular component ( cc ) , the target genes were significantly located in insoluble , cell , and membrane fractions ( p<0.001 ) . moreover , molecular function ( mf ) category was enriched in transcription factors and proteins involved in nucleotide binding ( p<0.001 ) . in terms of the kegg pathway analysis , the results were notably enriched in pathways involved in cancer , renal cell carcinoma , and colorectal cancer . moreover , results were highly enriched in the vegf , mtor , focal adhesion , wnt , chemokine , erbb , and p53 signaling pathways ( p<0.05 , table 5 and figure 4 ) . as shown in figure 5 , the clearly associated functional modules were metabolism , development , cellular , and biological processes in bp . analysis of cc revealed the most correlated functions were membrane and intracellular fractions ( figure 6 ) . in the mf network , protein and transcription factor binding were the top results ( figure 7 ) . the mir-101 - 2 expression level was lower in bc than in the normal cells , but this difference was not statistically significant ( figure 1a , 1d ) . a receiver operating characteristic ( roc ) curve was constructed to identify diagnostic value in the cases of bc compared with non - cancer breast tissues . the area under the curve ( auc ) of mir-101 - 1 was 0.56 ( 95% ci : 0.500.62 ) , with a sensitivity and specificity of 51.0% and 62.1% , respectively ( figure 1b ) . the auc of mir-101 - 2 was 0.63 ( 95% ci : 0.580.68 ) , with a sensitivity and specificity of 83.9% and 44.8% , respectively ( figure 1e ) . in the analysis of mir-101 and clinical parameters , mir-101 - 1 was prominently associated with the expression of the estrogen receptor ( er ) , progesterone receptor ( pr ) , and human epidermal growth factor receptor 2 ( her2 ) in bc ( table 1 ) . mir-101 - 2 was significantly associated with tumor ( t ) , lymph node ( n ) , and metastasis ( m ) stages of bc ( table 2 ) . moreover , decreased mir-101 - 1 expression revealed a poor prognosis in bc ( hr=1.79 ; 95% ci : 1.063.01 ; p=0.028 ) ( figure 1c ) . however , no significant prognostic value was identified for mir-101 - 2 in bc ( hr=1.423 , 95% ci : 0.842.41 ; p=0.183 ) ( figure 1f ) . as shown in figure 2 , gse31397 array data were acquired , and 921 genes were selected as differentially expressed in mir-101 - 3p transfected mcf-7 cells compared with scramble control cells . in addition , the online prediction process was conducted with 13 databases to obtain potential targets of mir-101 - 3p , and 7924 genes were identified after duplicated genes were excluded . the genes predicted by 5 out of 13 programs were selected , and then 377 target genes were searched from the array data and predicted targets . furthermore , 69 available genes that were identified as targets of mir-101 - 3p through tarbase , mitarbase and published literature were included ( table 3 ) . eventually , a total of 427 genes were identified for the gene - annotation enrichment analysis and kegg pathway analysis . selecting homo sapiens as the background of listed target genes in david , we obtained the go term annotations and kegg pathway analysis through the functional annotation summaries . an ease score or modified fisher s exact test was utilized for calculating the p value . the results of the go analysis are summarized in table 4 and figure 3 , and the top 10 enriched items are listed according to p values . the biological processes ( bp ) of the potential targets of mir-101 - 3p markedly focused on the gene expression , transcription , metabolism , biosynthesis , and proliferation processes ( p<0.001 ) . as for the cellular component ( cc ) , the target genes were significantly located in insoluble , cell , and membrane fractions ( p<0.001 ) . moreover , molecular function ( mf ) category was enriched in transcription factors and proteins involved in nucleotide binding ( p<0.001 ) . in terms of the kegg pathway analysis , the results were notably enriched in pathways involved in cancer , renal cell carcinoma , and colorectal cancer . moreover , results were highly enriched in the vegf , mtor , focal adhesion , wnt , chemokine , erbb , and p53 signaling pathways ( p<0.05 , table 5 and figure 4 ) . as shown in figure 5 , the clearly associated functional modules were metabolism , development , cellular , and biological processes in bp . analysis of cc revealed the most correlated functions were membrane and intracellular fractions ( figure 6 ) . in the mf network , protein and transcription factor binding were the top results ( figure 7 ) . mirnas play vital roles in bc , and an increasing amount of research has made important contributions to this field . mirnas , including mir-21/9/10b/27a/155 , were overexpressed in bc , while mir-31/34a/125/205 were down - regulated during bc progression [ 24 , 25 ] . . demonstrated that mir-221 may be a predictive biomarker for bc . in the research of eissa et al . , patients with bc positive for mir-10b had shorter relapse - free survival rates , and mir-10b was an independent prognostic factor of bc . mir-451 influenced the drug resistances and mir-129 - 5p regulated radiosensitivity via accelerating the apoptosis of breast cancer cells . peptide nucleic acid ( pna ) has been researched as a novel drug in mirna therapeutics , but has still not been successfully used to treat bc . recently , decreased mir-101 - 3p levels were observed in tumors , including colon , gastric , lung , ovary , and prostate cancers . mir-101 - 3p has important roles in the tumorigenesis of bc ; however , the mechanisms and target genes of mir-101 - 3p are still unknown . tcga data demonstrated that mir-101 - 2 expression was lower in bc tissues than in normal tissues , while no statistical difference was shown for mir-101 - 1 expression . mir-101 - 1 was also closely linked to er , pr , and her2 , while mir-101 - 2 was associated with the t , n , and m stages of bc . this result revealed that mir-101 - 2 may have diagnostic value in bc to some extent . down - regulated mir-101 - 1 was associated with poor prognosis in patients with bc , while no statistical significance was found for mir-101 - 2 . mir-101 has 2 genomic loci , with mir-101 - 1 being located on chromosome 1p31.3 and mir-101 - 2 located on chromosome 9p24.1 . this result revealed that the mir-101 transcripts on different chromosomes play diverse roles in the diagnosis , prognosis , and clinical outcome of bc . mir-101 - 1 is processed into mir-101 - 3p and mir-101 - 5p , while mir-101 - 2 only produces mature mir-101 - 3p . in addition , the different sequences of mir-101 - 1 and mir-101 - 2 will promote or restrict different targets through participation in the translation process and reveal different biological functions . however , it was difficult to extrapolate the mature mirna levels ( which are the final cellular effectors ) based on these data . one precursor may be processed to 1 or 2 mirnas ; thus , the mature and precursor mirna levels might not correlate , and this therefore will influence the clinical interpretation . putative mir-101 - 3p targets were derived from the expression profiling of mir-101 - 3p transfected in mcf-7 cells compared with scramble control cells , online prediction databases , validated targets , and published studies . among the 427 putative target genes , the most predominant functions were transcription , metabolism , biosynthesis , proliferation , and transcription factor binding . this result indicated that candidate genes have a definitive impact on the pathogenesis of bc . in previous studies , 8 targets of mir-101 - 3p were validated in bc : amp - activated protein kinase ( ampk ) , cx chemokine receptor 7 ( cxcr7 ) , eyes absent homolog 1 ( eya1 ) , janus kinase 2 ( jak2 ) , membrane - associated guanylate kinase 2 ( magi2 ) , myeloid cell leukemia 1 ( mcl-1 ) , stathmin1 ( stmn1 ) , and von hippel - lindau tumor suppressor ( vhl ) . ampk was found to regulate tumor metabolism and be targeted by mir-101 - 3p and was identified as a promising therapeutic target in triple - negative breast cancer ( tnbc ) . mir-101 - 3p inhibited the development and lymph node metastasis of bc via targeting cxcr7 . the latest research by guan et al . showed that mir-101 - 3p was down - regulated and inhibited cell proliferation and promoted apoptosis by targeting eya1 in bc . jak2 has been verified to participate in suppressing proliferation and promoting apoptosis in bc cells through mir-101 - 3p . sachdeva et al . demonstrated that mir-101 - 3p reduced phosphatase and tensin homolog ( pten ) activity by suppressing magi-2 , leading to akt activation . mir-101 - 3p , which directly inhibited mcl-1 , was reported to restrain cell progression and increase sensitivity to paclitaxel in tnbc . in a study by wang et al . , the down - regulation of mir-101 - 3p was confirmed to regulate stmn1 , and was associated with cellular proliferation and invasiveness in different subtypes of bc tissues . moreover , mir-101 - 3p enhanced apoptosis and cell cycle arrest by down - regulating vhl expression in normoxic conditions . mir-101 - 3p inhibited cxcr7-stat3 signaling and exerted tumor - suppressive effects in bc cells . down - regulated mir-101 - 3p suppressed cell proliferation through the notch signaling pathway in bc . furthermore , estrogen deprivation enhanced the mir-101 - 3p - mediated activation of the akt signaling pathway . in this paper , a total of 26 bio - pathways were identified , and analysis of mir-101 - 3p targets revealed statistical significance for 21 pathways . in addition , the visualized network graph of mir-101 - 3p - mediated targets in cytoscape showed biological functions similar to the david analysis mentioned above . the highly connected targets are involved in important biological processes and molecular functions . among the pathways of the mir-101 - 3p targeted genes , the vegf , mtor , focal adhesion , wnt , chemokine , erbb , and p53 signaling pathways were highly enriched . the vegf signaling pathway enhanced angiogenesis for the aggressive proliferation and malignant progression of bc . the pi3k / akt / mtor signaling pathway plays a vital regulatory function in proliferation , apoptosis , metabolism , and migration , and the invasion of bc can be alleviated by mir-199a-5p via targeting the fak / src / akt / mtor signaling pathway . focal adhesion kinase ( fak ) regulates cell motility , extracellular matrix integrin signaling , cell proliferation , and survival . mir-7 inhibited cell transformation and the metastasis of bc via regulating fak , which is correlated with a poor prognosis . the chemokine signaling pathway mediates chemokines and promotes the chemotaxis , growth , and survival of bc cells . mir-195 suppressed the wnt signaling pathway , which promotes cell proliferation and the metastasis of tnbc . reported that the erbb signaling pathway can be regulated by stat1 in the tumorigenesis of bc . furthermore , scaffold / matrix - associated region - binding protein 1 ( smar1 ) may increase radiosensitivity in the mcf-7 bc cell line by regulating the p53 signaling pathway . enrichment analysis of the potential pathways revealed that the wnt signaling pathway probably regulates the cell cycle , metabolism , and phosphorylation by targeting ccnd3 and rock . mapk1 , mtor , and vegfa may contribute to metabolism and biosynthesis , which are associated with the mtor signaling pathway . the vegf signaling pathway is involved in proliferation and apoptosis via targeting mapk1 , rac1 , nras , and vegfa . the chemokine , focal adhesion , mtor , vegf , and erbb signaling pathways might influence metabolism , phosphorylation , kinase activity , and intracellular signaling cascades by regulating pik3cb . however , the interaction of target genes and their signaling pathways , as well as their molecular mechanisms , should be further explored . this study is a comprehensive target analysis of the mir-101 using gene expression profiling , public databases , and prediction software . mir-101 plays vital roles in bc , while the products derived from different locations on different chromosomes did not show the same functions . the genes targeted by mir-101 - 3p influence the progression of bc and might influence the biological functions performed by the vegf , mtor , focal adhesion , wnt , and chemokine signaling pathways by targeting crucial genes . the mechanisms of novel molecular markers should be further verified with new techniques , and will contribute to the diagnosis and treatment of bc .

follicular lymphoma is a neoplasm of germinal center b cells and comprises about 20% of all lymphomas with the highest incidence in the united states and western europe . it affects primarily adults , with a median age in the sixth decade and a male : female ratio of 1:1.7.1 follicular lymphoma is generally considered to be an indolent , but incurable disease , with a median overall survival of 7 - 10 years . transformation to an aggressive b - cell lymphoma occurs in about 25 - 35% of cases and is associated with a poor outcome.1 a chromosomal translocation , t(14;18)(q32;q21 ) , is the genetic hallmark of follicular lymphoma . this translocation can be identified in 85 - 90% of nodal follicular lymphoma cases.2 juxtaposition of the b - cell leukemia / lymphoma 2 gene ( bcl2 ) at chromosome 18q21 and the immunoglobulin heavy chain gene ( igh ) at 14q32 results in deregulation of bcl2 , an anti - apoptotic protein . additional genetic alterations result in progression to follicular lymphoma.3 , 4 however , 10 - 15% of cases do not harbor the t(14;18)(q32;q21 ) and in these t(14;18)-negative cases , other mechanisms are thought to be involved in the pathogenesis . a frequent chromosomal translocation in mature b - cell lymphoma is a rearrangement affecting chromosomal band 3q27 , which results in deregulation of expression of bcl6 , a human proto - oncogene.5 , 6 bcl6 encodes a 95 kd nuclear zinc finger phosphoprotein which functions as a sequence - specific transcriptional repressor.7 chromosome 3q27 rearrangement / bcl6 translocation is frequently found in diffuse large b - cell lymphoma , at a frequency of 25 - 37% , depending on the detection methods used and patient population studied.8 - 10 bcl6 translocations have also been reported at a lower frequency in follicular lymphoma ( 13% and 14.3%).8 , 10 the highest frequency of bcl6 translocation has been reported in grade 3b follicular lymphoma ( 44%).11 interestingly , a higher frequency of 3q27 abnormalities ( 22% ) was also found in t(14;18)-negative follicular lymphoma,12 , 13 including the t(3;14)(q27;q32 ) , suggesting an important role for bcl6 in t(14;18)-negative follicular lymphoma.12 , 13 in addition to translocation at the major breakpoint region ( mbr ) that encompasses the noncoding first exon and part of the first intron of bcl6 , an alternative breakpoint region ( abr ) located 245 - 285 kb 5 ' to bcl6 has been described.14 , 15 translocations of bcl6 involving the abr were reported to be associated with grade 3b follicular lymphoma.16 however , translocation at the abr has not been examined in a large series of follicular lymphoma , particularly in t(14;18)-negative cases . the aim of this study was to determine the frequency of bcl6 rearrangements at the mbr and abr in a series of well - defined t(14;18)-negative and t(14;18)-positive follicular lymphoma cases . we have used break - apart fish probes for the mbr and abr of bcl6 . the splitting of the fish signals could be caused by many different cytogenetic rearrangements occurring in that region , including translocations , inversions and insertions , we will therefore use the term ` rearrangement ' for all subsequent discussions . we also compared these results with our previously - published study of diffuse large b - cell lymphoma.17 we selected 142 cases of follicular lymphoma ( from year of 1982 to 2005 ) , including 63 t(14;18)-negative and 79 t(14;18)-positive cases . briefly , we retrieved all t(14;18)-negative follicular lymphoma cases from our cytogenetic database and the selected cases were further verified by fish analysis to confirm the t(14;18 ) status . for t(14;18)-positive follicular lymphoma cases , the selective criteria were based on either conventional karyotype analysis or fish analysis . the diagnosis of follicular lymphoma was confirmed by at least two hematopathologists in all cases . interphase fish analysis for bcl6 rearrangements was performed on the 142 cases using tissue microarrays made from formalin - fixed , paraffin - embedded tissue blocks , as described previously.17 briefly , hematoxylin and eosin - stained sections from each tissue block were used to define diagnostic areas , and 3 representative 0.6-mm cores were obtained from each case . only follicular lymphoma components were selected for fish studies in the composite lymphomas cases . a bcl6 break - apart probe ( abbott - vysis , downers grove , il , usa ) was used to detect bcl6 rearrangement at the mbr , and a home - brew break - apart probe ( clones rp11 - 1144d2 and rp11 - 76l15 , kindly provided by w. l. lam and r. j. deleeuw ) was used for rearrangement at the abr ( figure 1 ) . nuclei were counterstained with 4,6-diamidino-2-phenylindole ( dapi ) in antifade solution and the slides were visualized using an olympus bx51 fluorescence microscope . images were captured and archived using cyto vision software ( applied imaging , santa clara , ca , usa ) . to analyze the hybridization , a total of 50 - 100 nuclei per case were scored for the presence of the bcl6 rearrangement . a cutoff for positive fish assays for both the mbr and abr interphase fish analysis for bcl2 rearrangement was also performed using a bcl2 break - apart probe ( abbott - vysis , downers grove , il , usa ) with a positive cutoff of 20% . any ambiguous fish results from the tissue microarrays were repeated using unstained whole tissue sections . cytogenetic analysis was performed according to a previously described protocol.18 when available , at least 20 metaphases were analyzed . karyotypes of giemsa banded chromosomes were described according to the international system for human cytogenetic nomenclature ( iscn 2005 ) . we selected 142 cases of follicular lymphoma ( from year of 1982 to 2005 ) , including 63 t(14;18)-negative and 79 t(14;18)-positive cases . briefly , we retrieved all t(14;18)-negative follicular lymphoma cases from our cytogenetic database and the selected cases were further verified by fish analysis to confirm the t(14;18 ) status . for t(14;18)-positive follicular lymphoma cases , the selective criteria were based on either conventional karyotype analysis or fish analysis . the diagnosis of follicular lymphoma was confirmed by at least two hematopathologists in all cases . interphase fish analysis for bcl6 rearrangements was performed on the 142 cases using tissue microarrays made from formalin - fixed , paraffin - embedded tissue blocks , as described previously.17 briefly , hematoxylin and eosin - stained sections from each tissue block were used to define diagnostic areas , and 3 representative 0.6-mm cores were obtained from each case . only follicular lymphoma components were selected for fish studies in the composite lymphomas cases . a bcl6 break - apart probe ( abbott - vysis , downers grove , il , usa ) was used to detect bcl6 rearrangement at the mbr , and a home - brew break - apart probe ( clones rp11 - 1144d2 and rp11 - 76l15 , kindly provided by w. l. lam and r. j. deleeuw ) was used for rearrangement at the abr ( figure 1 ) . nuclei were counterstained with 4,6-diamidino-2-phenylindole ( dapi ) in antifade solution and the slides were visualized using an olympus bx51 fluorescence microscope . images were captured and archived using cyto vision software ( applied imaging , santa clara , ca , usa ) . to analyze the hybridization , a total of 50 - 100 nuclei per case were scored for the presence of the bcl6 rearrangement . a cutoff for positive fish assays for both the mbr and abr interphase fish analysis for bcl2 rearrangement was also performed using a bcl2 break - apart probe ( abbott - vysis , downers grove , il , usa ) with a positive cutoff of 20% . any ambiguous fish results from the tissue microarrays were repeated using unstained whole tissue sections . cytogenetic analysis was performed according to a previously described protocol.18 when available , at least 20 metaphases were analyzed . karyotypes of giemsa banded chromosomes were described according to the international system for human cytogenetic nomenclature ( iscn 2005 ) . sixty - three t(14;18)-negative cases of follicular lymphoma had a median age of 62 years ( range , 24 - 86 years ; 59% female and 41% male ) . bcl2 rearrangement status was verified by bcl2 fish analysis in all t(14;18)-negative follicular lymphoma cases . a total of 112 fish assays for the bcl6 rearrangements yielded interpretable results , including 63 mbr and 49 abr studies . there were a total of 79 t(14;18)-positive cases of follicular lymphoma with a median age 55 years ( range , 34 - 89 years ; 48% female and 52% male ) . in these t(14;18)-positive cases , a total of 117 fish assays for the bcl6 rearrangements yielded interpretable results , including 79 mbr and 38 abr studies . the frequency of the bcl6 rearrangement was 26% in t(14;18)-negative follicular lymphoma ( bcl6-mbr : 14% , bcl6-abr : 12% ) and 19% in t(14;18)-positive follicular lymphoma ( bcl6-mbr : 14% , bcl6-abr : 5% ) ( table 1 ) . we found that t(14;18)-negative follicular lymphoma appeared to have a higher frequency of rearrangement at the abr with an abr : mbr ratio of 0.86 , compared to t(14;18)-positive follicular lymphoma ( abr : mbr ratio of 0.36 ) and diffuse large b - cell lymphoma ( abr : mbr ratio of 0.32).17 there was no statistically significant difference detected in the distribution of bcl6-abr rearrangement positive cases between the 2 groups ( t(14;18)-negative and t(14;18)-positive cases ) ( p=0.46 ) . a comparison of clinical features and histological grade by sites of the rearrangement of bcl6 in the t(14;18)-negative and t(14;18)-positive follicular lymphoma is listed in table 2 . the t(14;18)-negative follicular lymphoma group contains a higher frequency of grade 3 cases than t(14;18)-positive follicular lymphoma group ( 57% vs. 37% , p=0.02 ) . bcl6 rearrangements were found in all grades of follicular lymphoma , but were the highest in grade 3 t(14;18)-negative follicular lymphoma cases ( 60% ) ( table 2 ) . the distribution of bcl6 rearrangement was analyzed in grade 3 follicular lymphoma cases , particularly in grade 3 cases with a diffuse large b - cell lymphoma component . due to higher technical failure rate in the bcl6 abr fish analysis , only 49 t(14;18)-negative follicular lymphoma cases had interpretable fish assays for the bcl6-mbr and bcl6-abr rearrangements , and only two cases were grade 3b , both of which also contained a diffuse large b - cell component . twenty - eight of the 49 cases were grade 3a and half of the 28 cases were grade 3a with a diffuse large b - cell component . among these 14 cases , similarly , in the 38 t(14;18)-positive follicular lymphoma cases with interpretable fish assays for both the bcl6-mbr and bcl6-abr rearrangements , only two cases were grade 3b , both of which also contained a diffuse large b - cell lymphoma component , and one of these 2 cases had a bcl6-mbr rearrangement . twelve of the 38 cases were grade 3a and 3 of the 12 cases were grade 3a with a diffuse large b - cell lymphoma component , and one of these 3 cases had a bcl6-abr rearrangement . conventional cytogenetic ( karyotype ) results were available in 58 of the 63 t(14;18)-negative follicular lymphoma cases . eleven of these 58 cases showed either trisomy 3 or a chromosomal translocation involving band 3q27 . table 3 displays 21 cases that had either bcl6 rearrangements detected by fish ( 15 cases ) or cytogenetic abnormalities by karyotype analysis . three of these 15 cases also had a chromosomal translocation involving 3q27 identified by karyotype analysis , with 2 cases having t(3;22)(q27;q11.2 ) and one t(3;14)(q27;q32 ) . of the remaining 12 cases , karyotype analysis results were not available in the t(14;18)-positive follicular lymphoma cases , therefore , comparison between karyotype analysis and fish studies was not performed . chromosomal translocation involving band 3q27 ( bcl6 ) is common in diffuse large b - cell lymphoma and is recognized to be pathogenetically significant.19 this translocation is also seen in other b - cell non - hodgkin lymphoma , mainly in follicular lymphoma , but also in marginal zone lymphoma.20 however , most studies of bcl6 translocation by fish or southern blot analysis in follicular lymphoma did not include probe(s ) for the bcl6-abr rearrangement.8 - 10 , 13 translocation at the abr has been reported to occur more frequently in follicular lymphoma ( 2/20 , 10% ) than in diffuse large b - cell lymphoma ( 2/84 , 2.4%).15 this finding questions the reported incidence of bcl6 translocation especially in follicular lymphoma when the abr was not examined . therefore , we examined a large series of well - defined t(14;18)-negative and t(14;18)-positive follicular lymphoma for bcl6 rearrangement at the mbr and abr by fish analysis . our study shows an overall frequency of bcl6 rearrangement of 26% in t(14;18)-negative and 19% in t(14;18)-positive follicular lymphoma . for the mbr alone , the frequency of bcl6 rearrangement is very similar between t(14;18)-negative and t(14;18)-positive follicular lymphoma ( table 1 ) . using fish analysis , diaz - alderete et al also reported similar frequencies of bcl6 rearrangement at the mbr in t(14;18)-negative ( 14.6% ) and t(14;18)-positive follicular lymphoma ( 13.1%).21 in addition , we found that the frequency of bcl6 rearrangement at the abr appeared to be higher in t(14;18)-negative ( 12% ) than in t(14;18)-positive follicular lymphoma ( 5% ) ( table 1 ) . there is only a trend that t(14;18)-negative follicular lymphomas are associated with a higher frequency of bcl6-abr rearrangement , though there was no statistically significant difference for this rearrangement between t(14;18)-negative cases and t(14;18)-positive cases due to the overall low incidence of bcl6 rearrangements at the mbr and abr . the bcl6-abr rearrangement occurred in all grades of follicular lymphoma but was most frequent in grade 3 t(14;18)-negative follicular lymphoma cases ( 67% ) ( table 2 ) . in a smaller series , bosga - bouwer et al selected eight cases of grade 3b follicular lymphoma with cytogenetic abnormalities at the 3q27 and reported that the abr translocation was found in six of these cases.16 however , in our series of 87 follicular lymphoma cases with interpretable fish assays for both the bcl6-mbr and bcl6-abr rearrangements , none of the four cases of grade 3b follicular lymphoma ( 2 t(14;18)-negative and 2 t(14;18)-positive ) had a bcl6-abr rearrangement . while bcl6 rearrangement was common in grade 3 follicular lymphoma , especially in t(14;18)-negative cases , we did not observe a high frequency in grade 3b cases . however , the number of 3b follicular lymphoma is small and this issue needs further investigation . we also found the overall frequency of bcl6 rearrangement in t(14;18)-negative follicular lymphoma ( 26% ) to be similar to that of our previously - published study for diffuse large b - cell lymphoma cases ( 25%),17 suggesting that bcl6 may also be pathogenetically significant in t(14;18)-negative follicular lymphoma . however , t(14;18)-negative follicular lymphoma had a higher frequency of bcl6 rearrangement at the abr , whereas diffuse large b - cell lymphoma more frequently used the mbr . we found that the intergenic region around the abr is actively transcribed , with transcripts found in germinal center b - cell lines but not in cell lines at other stages of b - cell differentiation ( data not shown ) . the chromatin structure in germinal center b - cells may , therefore , permit rearrangements to occur at this location . however , why this region is preferentially used in t(14;18)-negative follicular lymphoma and the mechanism of rearrangement is not currently understood . the mechanism of dysregulation of bcl6 expression due to bcl6 rearrangement at the mbr has been extensively investigated . chromosomal translocations at the mbr place the intact coding region of bcl6 under the control of heterologous promoters derived from partner chromosomes , resulting in deregulated expression of bcl6 . 22 - 24 moreover , most rearrangements at the mbr remove the first noncoding exon of bcl6 gene that contains two bcl6 binding sites , and thus disrupt a negative autoregulatory circuit . 25 , 26 some of the rearrangement may also disrupt an interferon regulatory factor 4 ( irf4 ) responsive region in the first intron of bcl6 and block its downregulation by cd40 signaling.27 in contrast , chromosomal rearrangements at the abr leave the regulatory regions intact in the first exon and first intron of bcl6 . thus , rearrangement at the abr must introduce a strong enhancer signal to dysregulate bcl6 expression . it has been reported that diffuse large b - cell lymphoma and follicular lymphoma cases with abr rearrangement expressed bcl6 at levels comparable to phenotypically - similar cases with mbr rearrangement or with no 3q27 abnormality.15 it should be noted that dysregulation of bcl6 expression may also result from mutations introduced by the somatic hypermutation affecting the 5 ' regulatory region of bcl6 , as noted above.25 thus , the frequency of cases with dysregulated bcl6 expression may be significantly higher than the frequency of cases with bcl6 rearrangement . also , rearranged cases with a preserved 5 ' regulatory region may be further affected by these mutations . discrepancies between fish analysis and conventional cytogenetics ( karyotype study ) were not infrequent in our study . the possible explanations include : 1 ) 3q27 rearrangements not involving the mbr and abr regions , 2 ) compromised morphology of tumor chromosomes making it difficult to recognize rearrangements near the telomeric end of 3q , 3 ) the rearrangement involving 3q27 are hidden in partially characterized karyotypes containing ` add ' ( additional uncharacterized chromosomal material ) or ` marker ' chromosomes.28 in summary , our study demonstrates that the frequency of the bcl6 rearrangement is similar in t(14;18)-negative follicular lymphoma and diffuse large b - cell lymphoma . however , t(14;18)-negative follicular lymphoma has a higher frequency of bcl6 rearrangement at the abr , whereas t(14;18)-positive follicular lymphoma and diffuse large b - cell lymphoma more frequently use the mbr than the abr . therefore , it is important to include the abr for fish analysis of bcl6 rearrangements in follicular lymphoma , especially in t(14;18)-negative cases . the high frequency of bcl6 rearrangement in t(14;18)-negative follicular lymphoma suggests that bcl6 could play an important role in the lymphomagenesis . the mechanism of bcl6 rearrangement at the abr is currently under investigation and may explain the differential use of this breakpoint in the different lymphomas . how rearrangements at the far 5'abr affect bcl6 expression is intriguing and requires further study .

intimal sarcoma ( is ) is defined as a malignant tumor arising in the tunica intima of large blood vessels . in the systemic circulation , most of is derived from the aorta artery , accounting for only 1% of all sarcomas . the primary neoplasm of the major blood vessels is divided into three categories based on their site of origin : a ) from large veins ( extremely rare group ) b ) pulmonary artery and c ) aorta and its branches . large vessel intimal sarcomas tend to occur in the elderly with a history of peripheral vascular disease , and usually present with advanced disease with an aggressive course . the differential diagnosis of intimal sarcomas should include benign lesions as well other soft tissue sarcoma ( sts ) , diagnostic approach should have a high degree of suspicious , clinical manifestations are unspecific . imaging should include an adequate and high - quality studies such as a magnetic resonance imaging ( mri ) preoperative to determine resectability as well as a ct scan of the chest , abdomen and pelvis to exclude metastatic disease , , , , , , . vascular neoplasms are classified as intimal sarcomas , angiosarcomas and leiomyiosarcomas ; this last one represent most of the peripheral arterial tumors ; to differentiate intimal sarcomas from the other two , histology and immunohistochemistry is needed . the cornerstone of treatment is extrapolated of sts , surgery with margins greater than 1 cm , limb - sparing surgery with rt are the standard of treatment , . for stage ii and iii sts , preoperative chemoradiation , chemotherapy alone or with hyperthermia , postoperative chemotherapy are options but not the standard of treatment ( as the literature shows not benefit ) . preoperative rt increase wound complications and postoperative rt improves local control but not overall survival , , , , , , , . for unresectable disease the options of treatment include rt alone , chemoradiation or chemotherapy alone with the same considerations ; tumors that become resectable can be treated with surgery follow by rt with or without chemotherapy . regional limb therapy has been evaluated with good results to preserve the limp , tumor necrosis factor alpha and melphalan appear to have the best results , , , , . there is very limited data available in the literature on surveillance strategies for sts , physical examination is the most important factor . no data exists in the follow up either with mri , ct scans or ultrasound . the median survival time is only a few months ; aggressive tumors that can metastasize , the life expectancy is usually about 1218 months . a 61-year - old man presented with progressive increase in left forearm , physical examination reveals a multilobular , heterogenous mass of 5 6 cm , in the middle third , without impaired mobility , no distal neurovascular compromise , corresponding with the cephalic vein in the forearm . the ct scan showed only the presence of a small rounded hypodense mass located in diaphragmatic dome , hepatic segment viii measuring 12 mm compatible with simple cyst . an incisional biopsy of the forearm was obtained and reported as pleomorphic and spindle cell sarcoma , intermediate grade at least . the tumor cells stained strongly positive for vimentin , which is found in both benign and malignant mesenchymal tumors , but were negative for other immunohistochemical stains such as desmin ( smooth muscle origin ) , cytokeratin and s100 protein ( to ruled out metastatic carcinoma and melanoma respectively ) . the absence of cd34 staining argued against sarcoma origin of endothelial cells such angiosarcoma and malignant endothelioma . in a multidisciplinary session , it was decided to take the patient to isolated limb perfusion with melphalan , in order to reduce its size followed by limb sparing surgery . the after - treatment response was evaluated three months later as stable disease per recist 1.1 criteria ( fig . 1 , fig . the specimen consisted as an irregular vein , with overall dimensions of 20.1 5.9 4.2 cm . the final diagnosis was a high degree pleomorphic spindle cell sarcoma with cartographic necrosis that affects the whole course of the vessels compatible with intimal sarcoma . the immunohistochemistry was positive for vimentin and negative for s-100 , cd56 , mdm2 and cd34 ( fig . 4 ) . it was decided to continue with adjuvant radiotherapy completing a dose of 66 gy in 33 fractions . 2 months after the end of adjuvant radiotherapy , the presence of multiple bilateral pulmonary nodules was documented , the largest with a diameter of 31 mm in the right parahiliar side . currently the patient is without local recurrence , with stable lung metastatic disease and a 100% karnofsky score , ecog 0 and the limb with full functionality . a 29 years old male diagnosed with hodgkin lymphoma in 2004 treated with first- and second - line chemotherapy regimens , who achieved a complete response with no evidence of disease . in 2014 he was diagnosed with deep vein thrombosis secondary to a tumor in the left arm , imaging studies reported a tumor in the medial compartment and middle third of the left arm apparently originated from the basilica vein , about 5 3 cm in its greater axes ( fig . core needle biopsy reported a high - grade sarcoma with pleomorphic areas and production of osteoid material compatible with an intimal sarcoma . surgery was the first line of treatment , the findings were a left arm tumor , in the proximal third , 5 4 cm , subfascial , infiltrating the biceps muscle medially , with abundant newly formed vessels , obliterating the basilica vein , displacing the neurovascular structures . the pathology findings were a tumor of 7 6 4.5 cm , poorly defined , with firm and cystic areas and necrotic internal bleeding . adjuvant treatment consisted of chemotherapy ( gemcitabine 6 cycles ) plus radiotherapy ( 60 gy standard fractions ) . intimal sarcoma is an extremely rare group of undifferentiated pleomorphic sarcoma arising from the tunica intima or associated with a great vessel ; is represent only 1% of all sarcomas . the defining features of these tumors are intraluminal growth with obstruction of the lumen and seeding of emboli . the mean age at diagnosis is 48 years old for patients with pulmonary intimal sarcoma and 62 years old for those with aortic intimal or peripheral large veins . the primary neoplasm of the major blood vessels is divided into three categories based on their site of origin : a ) from large veins , b ) pulmonary artery and c ) aorta and its branches . over 60% of reported sarcomas of the aorta and its branches are intimal sarcomas , arising from the tunica intima , rather than from endothelial , medial or adventitial cells . in adults , the most common subtypes are undifferentiated pleomorphic sarcomas including the historically defined malignant fibrous histiocytoma . the latter are predominantly located in the left atrium . regarding sarcomas arising in large vessels , the sites most frequently involved are the pulmonary arteries and the aorta , followed by venous sarcomas , especially of the inferior vena cava . large vessel intimal sarcomas tend to occur in the elderly with a history of peripheral vascular disease , and usually present with advanced disease with an aggressive course . many are centrally located , and can present as an asymptomatic thoracic aneurysm , or with dyspnea , sudden death , or distal embolization . the differential diagnosis of intimal sarcomas should include benign lesions as well other soft tissue sarcoma ( sts ) . history and physical examination are an essential element of the workup , contrary to other sts , this type of tumor must never been biopsied . diagnostic approach should have a high degree of suspicious , the clinical manifestations are unspecific , symptomatic thoracic aneurysm , dyspnea , distal embolization or sudden death for tumors at the aorta , this mistaken diagnosis can lead to inappropriate therapy , such as anticoagulation or thrombolysis , , or local pain , claudication , motor or sensory loss , or as a mass in peripheral localization , . imaging should include an adequate and high - quality imaging studies , an mri preoperative of the extremity in compromise to determine resectability as well an iv contrast ct scan of the chest , abdomen and pelvis to exclude secondary tumors or metastatic disease . there is no data regarding the use of pet scans in this type of tumors . the most common histologic subtype in the vessels is leiomyosarcoma , which tends to grow to a large size without metastasizing . the prognosis is dismal , because many patients present with locally advanced or metastatic disease at the time of initial diagnosis . burke and virmani classified luminal sarcomas as poorly differentiated ( intimal ) , angiosarcoma , and leiomyosarcoma . to differentiate intimal sarcomas from these other two , histology and angiosarcomas show endothelial cells on microscopy and stain positively for vimentin factor viii and cd34 . leiomyosarcomas , on the other hand , have characteristic spindle shaped cells and stain positively for desmin and actin . intimal sarcomas , which have an unknown cell of origin , usually show undifferentiated cells with variable immunophenotyping . in a review of 180 primary sarcomas of large arteries , 109 ( 61% ) were classified as intimal sarcomas , and of these , 28 ( 26% ) were well differentiated . commonly reported types include angiosarcoma , leiomyosarcoma , myxofibrosarcoma , epithelioid hemangioendothelioma , myxoid chondrosarcoma , and undifferentiated pleomorphic sarcoma ( or malignant fibrous histiocytoma ) . rarer differentiations such as osteosarcoma and rhabdomyosarcoma have been reported in pulmonary artery and aortic origin intimal sarcoma . understanding the pathogenesis of graft - associated sarcomas involves understanding not only the tumor as a sarcoma but also its precursor lesions . intermediate variants between atypical proliferative endothelium and frank carcinoma have also been described and have been named intravascular papillary endothelial hyperplasia ( also known as masson 's pseudoangiosarcoma ) and low - grade , epithelioid - sarcoma - like hemangioendothelioma . whether these can progress to angiosarcoma postulated that the mdm-2/p53 pathway is instrumental in the pathogenesis of intimal sarcoma . in his studies , one reason why the pathogenesis and precursor lesions are not well described is because they usually do not present until late in the process during surgery or at autopsy . these tumors usually have symptoms that mimic atherosclerosis or thromboembolic disease and are treated as such without undergoing the proper screening modalities for diagnosis . for the reported cases , the time lag from graft placement until presentation with malignancy ranged from 4 months to 17 years . the specific time at which early changes begin on the pathway to malignancy in the endothelium is unknown . the treatment of the soft - tissue sarcoma of the extremity on early stages ( tumors with a size of < 5 cm superficial or < 5 cm deep , without regional o distance disease , low or intermediate histologic grade ) is surgery with margins greater than 1 cm or by removal of the intact fascial plane . limb - sparing surgery with rt is the standard of treatment with a recurrence rate of 15% and no statistical difference in overall survival ( 83% vs 88% at five years ) and disease - free survival ( 71% vs 78% at five years ) as compared to amputation . positive margins after resection increased the recurrence rate from 12% to 38% at 6 years compared to negative margins . re - resection may be necessary if the surgical margins are 1 cm or less and without an intact fascial plane . however , if it is not possible to obtain clear margins after re - resection , rt should be offered . . ii iii ( tumors with intermediate and high histologic grade 2 or 3 ) the treatment options should be decided by a multidisciplinary team . preoperative chemoradiation ( adriamycin , ifosfamide and dacarbazine 3 cycles interdigitated with 44 gy of rt ) has been shown to improve overall survival ( 79% vs 45% ) and disease - free survival ( 81% vs 50% ) with a significant toxicity but is not a standard treatment . chemotherapy alone is not associated with benefit in high - grade tumors ; the addition of hyperthermia improves local control but the technique is not highly reproducible . the anthracycline based postoperative chemotherapy ( doxorubicin , ifosfamide or epirubicin and ifosamide ) 6 cycles improve disease - free survival in patients with good performance and high risk of recurrence ( 69% vs 44% only with surgery or surgery plus rt ) , but is not a standard treatment because others study s show not benefit , . preoperative rt increase wound complications ( 35% vs 17% in postoperative rt group ) but is an option in limb - sparing surgery with a similar control of postoperative rt . postoperative rt improves local control in high grade lesions like intimal sarcoma tumors but not in overall survival ( 74% vs 56% ) , . unresectable disease can be treated primarily with rt ( 7080 gy ) with local control of 70% in lesions 5 cm or less , 40% lesion 510 cm and 25% for more than 10 cm . other treatment options are chemoradiation or chemotherapy followed by wide margin resection if the initial lesion become resectable . isolated limb perfusion has been evaluated with good results in unresectable disease in an attempt reduce general toxicity ; tumor necrosis factor alpha and melphalan appear to have greater activity and less toxicity than doxorubicin , with overall response rate of 75% , with a limb salvage form 8187% of the perfused limbs , with a complete response of 22% , local recurrence rate of 2730% ( highest for multifocal tumors and after previous radiotherapy ) a distant failure of 40% with a mean disease specific survival of 54% at 10 years , , , . the resection after isolated limb perfusion should be a marginal resection , because the recurrence rate do not differ from wide resections . no data exists in the follow up either with mri , ct scans or ultrasound . in sts , the ultrasound was slightly better than mri at detecting local recurrences with better sensitivity and specificity at a lower cost . however , both of our patients had distant recurrence to the lungs and not in the primary site . routine use of chest radiographs or ct should be considered , preferably ct scan within the 46 month after surgery , if negative we recommend chest radiograph every 4 months the first year followed up by a chest ct scan every 612 months . it is determined by stage at diagnosis , including resectability , degree of metastasis and tumor margin free . in sts , intimal sarcoma of the aorta is usually diagnosed postoperatively or at autopsy ; the median survival time is only a few months , these are aggressive tumors that can metastasize to bones and visceral organs , including the liver , kidneys , adrenal glands , and lungs . pulmonary artery intimal sarcoma , most commonly diagnosed at surgery or autopsy can metastasize to the brain , pancreas , adrenal glands , and lungs . the prognosis after the onset of symptoms is unfavorable ; life expectancy is usually 1218 months . we propose that given the aggressive behavior of these tumors , they should be handled with chemoradiotherapy postoperative , however , isolated limb perfusion is a viable option for the limp sparing surgery in this histology . written informed consent was obtained from the patient for publication of this case report and case series and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . dr . javier lpez - gmez design , data collection , data analysis , writing the paper . dorian y. garcia - ortega data analysis , data interpretacin and writing the paper .

pseudoepitheliomatous keratotic and micaceous balanitis ( pkmb ) is a rare penile condition affecting the elderly uncircumscribed men . it presents as a hyperkeratotic plaque over the glans penis , with an overlying thick micaceous scale . the condition is generally asymptomatic but fissuring , maceration , and irritation may be associated . though it is described as a distinct entity , there is considerable overlap with verrucous carcinoma . a 65-year - old male presented with a chronic nonhealing lesion over his penis since 6 months . clinical examination , after retracting the prepuce , revealed a well - defined hyperkeratotic plaque with thick adherent micaceous scales surrounded by a slight erythematous halo [ figure 1 ] . was performed under local anesthesia with clinical differential diagnoses of verrucous / squamous cell carcinoma ( scc ) and lichen sclerosus in mind . histopathology of the lesion revealed epidermal hyperkeratosis , parakeratosis , acanthosis , and papillomatosis ( features of pseudoepitheliomatous hyperplasia ) with perivascular mononuclear cell infiltrate in the dermis [ figure 2 ] . there were no cellular dysplasia or frank neoplastic changes and the basement membrane was intact . based on these clinical and histopathological findings patient is on treatment with topical 5-fluorouracil ( 5-fu ; 5% ) cream once - a - day [ figure 3 ] , and is being regularly followed - up . well - defined hyperkeratotic plaque with thick adherent micaceous scales hyperkeratosis , parakeratosis , acanthosis , and papillomatosis with fusion of some of the adjacent elongated papillae and perivascular mononuclear infiltrate in dermis . no cellular atypia seen ( h and e , 10 ) after 3 weeks of treatment with topical 5% 5-fluorouracil pkmb presents as a thick hyperkeratotic plaque with thick adherent micaceous scaling . although irritation , burning sensation , fissuring or maceration may be associated , pkmb is generally asymptomatic . thickness of the plaque may sometimes be so much so that the lesion appears as a penile horn . hyperkeratotic plaques involving perimeatal skin may cause multiple urinary streams on micturition giving an appearance of a watering - can penis . though pkmb is described as a distinct entity , there is considerable overlap with verrucous carcinoma . krunic et al . , theorized that pkmb evolves into four stages ; ( a ) initial plaque stage , ( b ) late tumor stage , ( c ) verrucous carcinoma , and ( d ) transformation to scc and invasion . histopathological examination demonstrates hyperkeratosis , parakeratosis , acanthosis , elongated rete ridges , and mild lower epidermal dysplasia with a nonspecific dermal inflammatory infiltrate composed of eosinophils and lymphocytes . differential diagnoses include penile horn , penile psoriasis ( early plaque stage ) , giant condyloma , verrucous carcinoma , erythroplasia of queyrat , scc , and keratoacanthoma . pkmb and penile horn , as premalignant penile lesions , may be histologically classified as one of the squamous hyperplastic lesions that stain negatively for immunohistochemical markers of high grade penile intraepithelial lesions . chaux et al . , analyzed 74 penile intraepithelial lesions using a triple immunohistochemical panel ( p16/p53/ki-67 ) and found a distinctive immunohistochemical profile for associated and precursor penile epithelial lesions . in their study , all patients with squamous hyperplasia were p16 and p53 negative , and patients with high grade penile intraepithelial neoplasia ( basaloid and warty patterns ) were consistently p16 and p53 positive , and variably ki-67 positive . in a study by cubilla et al . , the squamous hyperplastic lesions were negative for p16 , which serves as a surrogate for high risk human papillomavirus infection . based on these evidences , treatment options include topical measures like 5-fu , podophyllin resin , steroids ; physical measures like cryotherapy , radiotherapy ; and surgical excision . the clinical course of pkmb is chronic and associated with recurrences despite initial response to treatment which , most of the times , is partial . in case of clinical and histological suspicion ( based on clinical observation and repeated biopsies ,

hepatitis c virus ( hcv ) is an enveloped positive - stranded rna virus of the flaviviridae family . the hcv replication cycle is initiated by virions entering the host cell via interaction with cell surface receptors . following ph - dependent fusion and uncoating , the hcv rna genome is translated . the resulting polyprotein undergoes proteolytic cleavage into structural ( core , e1 , and e2 ) and nonstructural ( p7 , ns2 , ns3 , ns4a , ns4b , ns5a , and ns5b ) proteins . after rna replication , hcv undergoes assembly , maturation , and secretion processes . hcv leads to acute and chronic inflammatory hepatic infections that often progress toward chronic liver diseases , including cirrhosis , with an elevated risk of developing hepatocellular carcinoma . besides there being around 180 million people chronically infected worldwide with hcv , the standard of care for many years has been limited to interferon ( ifn- ) in combination with ribavirin ( rbv ) . drug discovery efforts during the past 20 years led to a new paradigm for hcv treatment , which is marked by the recent approval of multiple direct - acting antivirals ( daas ) for interferon - free regimens . the daas inhibit certain replication steps in the hcv replication cycle by directly targeting viral proteins , such as ns3/4a proteases , ns5a or ns5b polymerase . viral rebounds were often observed during monotherapy of these daas due to the selection of drug - resistant viral mutants . thus , the clinical application of daas is mostly limited to combination regimens , which face challenges including additional side effects , complex administration , and drug drug interactions . sofosbuvir , a daa that has been approved for interferon - free regimen , costs more than $ 80,000 during a typical 12-week course of treatment alone , raising concerns about the affordability of daas in order to globally impact the burden of hcv disease . host - targeting agents ( htas ) , however , inhibit host factors that are essential in the viral replication cycle . promising host - factor targets of htas include entry factors , components of viral replication complex cyclophilin a , and mir122 that bind to viral rna to facilitate replication . there is a higher genetic barrier to develop resistance to htas . moreover , htas can also be used as chemical probes to elucidate anti - hcv mechanisms and host virus interactions . however , few hta candidates are in the anti - hcv drug discovery pipeline , possibly due to the nature of primary drug screen assays that were mostly based on certain viral proteins or hcv replicons . overall , there is still need to improve the current therapeutic regimens by exploring novel anti - hcv targets and small molecules . recently , we reported the anti - hcv activity of chlorcyclizine ( ccz , rac-2 ) , discovered through the screening of the ncgc pharmaceutical collection ( npc ) , in a cell - based anti - hcv quantitative high - throughput screening ( qhts ) platform . the hit compound chlorcylizine hcl ( ccz ( rac-2 ) , figure 1 ) showed potent in vitro anti - hcv activity and preferable liver distribution in mouse models , as well as in vivo efficacy against hcv infection in alb - upa / scid chimeric mouse model engrafted with primary human hepatocytes . ccz ( rac-2 ) was also reported by chamoun - emanuelli et al . to block hcv entry , possibly via a cholesterol - dependent pathway . however , the target and precise mechanism of action of ccz ( rac-2 ) in inhibiting hcv entry remains unknown . here , we present a sar study aiming to optimize ccz ( rac-2 ) for an anti - hcv application focusing on the following features : generation of a nonchiral lead , improvement of its anti - hcv potency , modulation of its physicochemical properties to potentially reduce cns exposure , reduction or elimination of its antihistamine activity , and improvement of pharmacokinetic properties . the resulting lead compounds in this series , represented by nonchiral compound 30 , exhibited increased anti - hcv activity and selectivity ( up to 19-fold and 8-fold , respectively ) and improved in vivo pharmacokinetics properties . the optimized lead compounds merit further preclinical development for the treatment of hepatitis c. chlorcylizine hcl identified from qhts . thus , following modified literature procedures , the corresponding aldehyde or ketone underwent reductive amination with commercially available chiral ( r)-1 or ( s)-1 and nabh3cn in the presence of acetic acid ( compounds 1015 ) or p - toluenesulfonic acid ( compound ( s)-18 ) using an alcoholic solvent to afford the corresponding n - alkylated derivatives . ti(oipr)4 was required to carry out the reductive amination of the cyclopentyl ( ( s)-16 ) and cyclohexyl ( ( s)-17 ) derivatives . deuterated derivatives ( r)-20 and ( s)-20 were synthesized from ( r)-1 and ( s)-1 with cd3i in the presence of aqueous naoh . likewise , trifluorinated derivatives ( r)-21 and ( s)-21 were prepared from the common chiral starting material and trifluoroethyl triflate in the presence of k2co3 . ec50 sem ( n 3 ) is from the hcv - luc infection assay ; cc50 sem ( n 3 ) is from the atplite cytotoxicity assay ; selectivity index = cc50/ ec50 . scheme 1b displays the synthesis of racemic ccz analogues with a solubilizing polyethylene glycol side chain . starting from the commercially available hydroxyzine ( rac-5 ) , introduction of the phthalimido moiety via standard mitsunobu conditions afforded rac-22 . elongation of the solubilizing side chain was obtained by alkylating rac-5 to produce n - boc derivative rac-24 , which was deprotected to the free amine rac-25 and subsequently acylated to afford rac-26 ( scheme 1b ) . starting from dichlorobenzophenone 27 , nabh4 mediated reduction of the ketone , followed by chlorination with socl2 afforded chloride 28 , which was used to alkylate a variety of cyclic amine derivatives following modified literature procedures to yield compounds 2933 ( scheme 2a ) . piperazine derivative 29 was further alkylated , following a modified literature procedure , to produce the diehtylene glycol - containing compound 34 , which was further elongated to the pentaethylene glycol amine 35 . to probe the halogen effect on the cyclizine scaffold , compounds 38 and 39 were prepared according to scheme 2b , via reductive amination of acetaldehyde with the corresponding piperazines 36 and 37 in the presence of nabh3cn and acetic acid in methanol . ec50 sem ( n 3 ) is from the hcv - luc infection assay ; cc50 sem ( n 3 ) is from the atplite cytotoxicity assay ; selectivity index = cc50/ ec50 . cyclizine scaffold modification via exchange of the central tertiary carbon with the nitrogen analogue is displayed in scheme 3a , where methyl piperidone underwent reductive amination with the corresponding aniline 40 and 41 to afford the intermediate amines 42 and 43 , which subsequently underwent n - arylation under buchwald conditions to afford amines 44 and 45 . the last modification studied was the introduction of rigidity into the cyclizine scaffold . as displayed in scheme 3b , this was accomplished by starting from the commercial bromofluorenone 46 , which was reduced to the alcohol with nabh4 and subsequently converted to the chloride 47 with cacl2 and concentrated hcl . chloride 47 was used to alkylate n - ethyl piperazine to afford the cyclizine rigid analogue 48 ( scheme 3b ) . ( n 3 ) is from the hcv - luc infection assay ; cc50 sem ( n 3 ) is from the atplite cytotoxicity assay ; selectivity index = cc50/ec50 . tables 13 disclose the activity of synthesized compounds in our structural / chemical modification study centered around ccz ( rac-2 ) . the anti - hcv activity was reported in ec50 values ( concentration of compound inhibiting 50% of viral levels in comparison with the dmso control ) using the hcv - luc ( hcv jfh-1 strain , genotype 2a ) with insertion of the luciferase reporter gene ) infection assay . the cytotoxicity was measured by cc50 values ( concentration of compound exhibiting 50% cytotoxicity in comparison with the dmso control ) evaluated with an atplite assay in huh7.5.1 cells , the same cell line used for measuring the antiviral activity . thus , the activities of the hit compound , racemic ccz ( rac-2 ) , and its enantiomers ( ( r)-2 and ( s)-2 ) were confirmed as having good selectivities ( selective indices = 11321875 , table 1 ) . nor - ccz ( compound 1 ) , a known in vivo metabolite of ccz , showed comparable anti - hcv activity but with reduced selectivity ( table 1 ) . it should be noted with interest nor - ccz s lack of antihistamine activity ( table 4 ) . ec50 sem ( n 3 ) is from the hcv - luc infection assay ; cc50 sem ( n 3 ) is from the atplite cytotoxicity assay ; selectivity index = cc50/ec50 . all compounds were tested at 10 m , except that compounds ( s)-1 , rac-23 , and rac-29 were tested at 3.2 , 3.2 , and 1 m , respectively , to avoid potential cytotoxicity . assay description : the h1hr assay addresses the h1-histamine receptor ( h1hr ) inhibitory activity . the numeric value corresponds to the percentage of activation induced by histamine ( 250 nm ) in the presence of 10 nm of compound ; the hcvsc assay applies single - round infectious hcv to detect the inhibition of early stage prior to assembly in the virus replication cycle ; the hcvpp assay uses an hcv pseudoparticle to determine hcvpp entry inhibition , while the murine leukemia virus pseudoparticle ( mlvpp ) and vesicular stomatitis virus g pseudoparticle ( vsv - gpp ) were tested as controls to address viral specificity . in the hcv subgenomic replicon assay , the genotype 2a hcv replicon cell line was used to evaluate the inhibitory effect of hcv rna replication . in table 1 , we addressed the effect of two types of structural modifications : ( 1 ) chiral configurations and ( 2 ) side chains off the piperazine ring . the enantiomers of compounds 1 , 2 , 10 , 11 , 12 , 13 , 15 , 20 , and 21 showed comparable ec50 and cc50 values , suggesting that the chiral configuration of ccz analogues does not have a major effect on the antiviral activity and selectivity . with compounds 10 , 11 , 12 , 13 , and 18 , we investigated the effect of the length of the aliphatic chain on anti - hcv activity . when the number of carbons was less than 4 , analogues showed comparable activity in the range of low double - digit nanomolar and comparable selectivity to ccz ( rac-2 ) , regardless of whether the chain was linear or branched . chains with a carbon number of 4 led to decreased activity as shown for compounds 12 and 13 . surprisingly , compound 16 , having a cyclopentyl ring exhibited improved activity ( ec50 = 19 nm ) , while compound 17 , having a cyclohexyl ring , showed an activity in the expected range ( ec50 = 177 nm ) , comparable to that of compounds 12 and 13 . additionally , acetylation of the piperazine ring dramatically reduced the potency of analogue 19 to a double - digit micromolar value . introduction of a bulky substituted benzyl group also reduced the anti - hcv activity ( compound 14 , ec50 = 456 nm ) . deuterium , introduced in the side chain of compounds 20 and 15 with the aim of increasing their metabolic t1/2 , did not impact their anti - hcv activity and indeed led to a slightly improved t1/2 value ( 2.9 h for ( r)-15 in comparison with 2.2 h for ( r)-10 in the rat microsomal stability assay ) . moreover , the trifluoromethyl group in compound 21 led to a complete loss of activity , potentially indicating that the pka value of the tertiary amine was important for anti - hcv activity . the side effects of ccz ( rac-2 ) include drowsiness , dizziness , and headache , attributed to its ability to cross the blood brain barrier and its cns penetration . for this reason , first generation antihistamine drugs were replaced by analogues like cetirizine , with reduced cns - related side effects . in order to explore the possibility of reducing the cns penetration of our molecules this structural modification would increase the molecular weight , solubility , total polar surface area , and number of free rotatable bonds , also potentially leading toward longer pharmacokinetic half - lives . by using ethylene glycol or polyethylene glycol as linker , we explore the effect of introducing a series of functional groups at the terminal position . compound rac-3 having a terminal carboxylic acid , completely lost the anti - hcv activity , potentially due to the lack of cell permeability . moderate activities in the range of triple - digit nanomolar to single - digit micromolar were observed with carboxamide - substituted compounds rac-4 , rac-22 , rac-24 , and rac-26 ( table 1 ) . compounds rac-5 , rac-23 and rac-25 , having hydroxyl or amino groups at the chain terminal position , displayed high anti - hcv activity and moderate cytotoxicity . it was noteworthy that a 6-fold increased activity and retained selectivity were observed with compound rac-23 ( ec50 values below 8 nm with selective indices above 1000 ) ( table 1 ) . thus , elimination of the para - chloro substituent reduced the activity from double - digit nanomolar ( compound rac-2 , ec50= 44 nm ) to single - digit micromolar ( compound 6 , ec50= 1.14 m ) . introduction of an additional para - cloro substituent in the other ring slightly increased the activity ( compound 30 , ec50= 17 nm ) . following a similar trend , nonchiral dichloro compounds 29 , 31 , 34 , and 35 also showed increased activity ( 1.38.7-fold ) in comparison with that of the corresponding monochloro analogues rac-1 , ( s)-10 , rac-5 , and rac-25 . in general , the introduction of br substituents led to comparable activity and selectivity to the corresponding cl substituted compounds as shown in rac-36 , rac-37 , rac-38 , and rac-39 . structural modifications to the piperazine core are displayed in table 3 , where compounds rac-2 , 29 , 6 , and rac-38 were included for comparison . compound rac-7 , having a one carbon extension of the piperazine ring , retained the activity but led to increased cytotoxicity . the replacement of the piperazine ring with other ring structures in compounds 32 , 33 , and 9 led to a dramatic loss of activity . in contrast , compounds 44 , 45 , and 8 retained the anti - hcv activity and selectivity . compound 48 , which has a rigid cyclizine scaffold , showed an ec50 value that was more than 1 m , indicating that the conformation of the rings was important for anti - hcv activity . from our sar studies , we selected a number of lead compounds based on their anti - hcv activity , selectivity , and structure diversity for an expanded characterization ( table 4 ) . the cytotoxicity of these molecules was further evaluated in hepg2 cells and primary human hepatocytes . all compounds showed less than 1.8-fold difference in cc50 values in these two cell types in comparison with huh7.5.1 cells ( used for our anti - hcv activity assay ) , with the exception of compound 31 , which was less cytotoxic in hepg2 cells than in huh7.5.1 ( approximately 3-fold higher cc50 ) ( table 4 ) . the h1hr antagonistic activity of the chosen compounds were evaluated by measuring their capacity to block the -arrestin internalization signal induced by histamine . the numeric value observed corresponds to the percentage of activation induced by histamine ( 250 nm ) in the presence of 10 nm of compound , using ccz ( rac-2 ) and ( s)-1 as the positive and negative controls , respectively . shown in table 4 , the results of ccz ( rac-2 ) and ( s)-1 were consistent with previously reported results . lead compounds with r3 = h ( compounds ( s)-1 and 29 ) showed very low h1hr inhibition ( approximately 10% ) . meanwhile , when r3 = me , et , or the medium oligoethylene glycol chain , the h1hr inhibitory effects were generally lower than that of ccz ( rac-2 ) ( compounds rac-23 , 30 , 31 , and 34 ) , and ( s)-10 showed approximately 4-fold lower inhibition . compound rac-25 having a long oligoethylene glycol chain showed more than 3-fold lower inhibitory effect toward h1hr . additionally , hcv replication cycle assays were carried out to study the target stage of the ccz analogues in the hcv replication cycle . the lead compounds exhibited potent inhibition in the hcv single - cycle assay , in which single - round infectious hcv ( hcvsc ) can infect hepatocytes but does not assemble into new virions ( table 4 ) . the activity suggested that the ccz analogues inhibited early steps of the hcv replication cycle prior to assembly . the analogues were tested in the hcv pseudoparticle ( hcvpp ) assay and the hcv subgenomic replicon assay , which detect whether the compounds target hcvpp entry and hcv replication , respectively . the hcvpp assay applies defective retroviral particles that harbor the hcv envelope glycoproteins to assess viral entry inhibition . no significant inhibitory effect was observed in the hcvpp ( genotype 1a and 1b ) assay with the lead compounds , except for rac-23 possibly due to cytotoxicity ( table 4 ) . to address viral specificity in the entry process , a vesicular stomatitis virus g pseudoparticle ( vsv - gpp ) and a murine leukemia virus pseudoparticle ( mlvpp ) were tested as the control , in which no inhibitory effect was detected ( table 4 ) . it is worth noting that the lack of hcvpp inhibition of a compound does not necessarily exclude virus entry as a mode of action . a compound could be targeting an entry step that is not otherwise captured by the hcvpp system . multiple hcv entry inhibitors were reported without hcvpp inhibitory effect , including npc1l1 antagonist ezetimibe and human apolipoprotein e peptides . in the genotype 2a hcv replicon cell line , all the lead compounds failed to reduce below 60% the replicon activity , as compared to the dmso control , indicating that rna replication was not the target of these analogues ( table 4 ) . moreover , besides the in vitro physical properties of the chosen lead compounds , their in vitro metabolic properties were also evaluated using human , mouse , and rat microsomes . compounds 29 , 30 , and 34 showed preferable human microsomal stability ( t1/2 30 min ) , while maintaining reasonable solubility . in vivo pharmacokinetics and tissue distribution levels of compound 30 were measured in mice after a single dose of 10 mg / kg through the intraperitoneal ( i.p . ) the half - life in the liver was 8.5 h , which was an improvement in comparison with the half - lives of ( s)-ccz [ compound ( s)-2 ] and ( s)-nor - ccz [ compound ( s)-1 ] ( 1.99 and 4.7 h , respectively ) measured under the same conditions ( figure 2a and c ) . preferential liver distribution was also observed , as shown by the liver / plasma auclast ratio of 16 ( figure 2c ) . within 24 h after a single dose of 10 mg / kg , the liver concentration of compound 30 ( 56.95.29 m ) was dramatically above its in vitro ec50 values ( 0.017 m ) . to detect any potential hepatotoxicity effect , the alanine transaminase ( alt ) levels in the mouse serum the alt levels were around or below 80 u / l at most time points except when t = 2 and 4 h , which may suggest a potential transient mild liver toxicity . from these observations , we concluded that there was not a clear correlation between the alt levels and liver concentration of the compounds . to study whether the mild elevations of alt level were due to compounds or the vehicle , a control study was carried out dosing the vehicle only . the alt level was elevated at multiple time points with the treatment of the vehicle only ( figure 2b ) . overall , we concluded that no clear hepatotoxicity was detected with the treatment of compound 30 in this condition . in vivo ( a ) plasma and liver samples were collected at indicated time points after a single i.p . ( b ) alanine transaminase level of mouse serum samples collected from the pharmacokinetic study . results from each mouse are shown with scatter plots , and error bars show the means sem . ( c ) pharmacokinetics parameters of compound 30 in comparison with previously reported results of compounds ( s)-2 and ( s)-1 . to evaluate the capacity of these compounds to potentially impact other viruses in the flaviviridae family , their antiviral activity was tested against the dengue virus . both lead compounds ( s)-10 and 30 showed ec50 values in the denv - rvps assay that were approximately 1000-fold more than their ec50 values against hcv - luc infection ( table 4 ) , together with cc50 values consistent with the observation when cells were infected with hcv - luc ( table s1 ) . the selective indices were below 5 for both compounds against the dengue virus . furthermore , the activity of ( s)-10 was submitted for evaluation in the niaid antiviral screen against 13 types of viruses : hepatitis b virus , hcv replicon , herpes simplex virus-1 , human cytomegalovirus , vaccinia virus , dengue virus , influenza a ( h1n1 ) virus , respiratory syncytial virus , sars coronavirus , poliovirus 3 , rift valley fever virus , tacaribe virus , and venezuelan equine encephalitis virus . little or no antiviral activity was detected ( selective index < 10 and/or ec50 1 m ) , suggesting that the antiviral effects and mechanism of these analogues were hcv - specific . besides the advancement in developing efficacious treatments for chronic hcv infection , the cost and side effects of current approved methods point to the direction of developing alternative approaches to therapeutically intervene in the disease . in this sense , in our previous study , we disclosed the in vitro and in vivo anti - hcv properties of chlorcyclizine ( ccz , rac-2 ) , a first generation antihistamine compound approved for over - the - counter use . its affordability and established clinical safety profile make ccz ( rac-2 ) an attractive candidate for repurposing toward chronic hcv infection ( https://clinicaltrials.gov/ct2/show/nct02118012 ) . additionally , we decided to carry out structural modifications , in vitro and in vivo studies to further optimize this series with the aim of improving their anti - hcv profile . we focused the chemical modifications on four major structural motifs : chirality , side chains off the piperazine ring , substituents on the phenyl rings , and modifications on the piperazine core . as summarized in figure 3 , chirality had little effect on the antiviral activity and selectivity . dual para - chloro substitution on the aromatic rings led to more potent nonchiral analogues . furthermore , the introduction of an oligoethylene glycol off the piperazine ring nitrogen improved the activity without compromising the selectivity . most of the structure modifications in the piperazine core were not tolerated , suggesting that its geometry and its pka value were important for the anti - hcv activity of the series . selected lead compounds were also analyzed for additional assessment of cytotoxicity in hepg2 hepatocytes and primary human hepatocytes . they showed profiles similar to those observed in huh7.5.1 cells , suggesting that the cytotoxicity evaluation in huh7.5.1 cells in parallel with the hcv infection assay provides a good estimation of the cytotoxicity in human hepatocytes . overall , the lead compounds in table 4 exhibited excellent antiviral activity and selectivity in host cells ( si = 8608201 ) . one of the goals of this medicinal chemistry study was to eliminate the antihistamine side effect of ccz ( rac-2 ) , which was achieved with lead compounds having r3 = h or long ethylene glycol chains ( compounds 29 and rac-25 ) . in the hcv replication cycle assays , the lead compounds showed inhibitory patterns similar to those of ccz ( rac-2 ) , displaying a dramatic inhibition in early stage hcv infection ( in the hcvsc assay ) but no inhibition on hcvpp entry or in the hcv replicon system . although the exact mechanism of action of ccz ( rac-2 ) is still under investigation , the observations here strongly suggest that the lead compounds likely follow the same mechanism of action as ccz ( rac-2 ) , only with improved activity and selectivity . in vitro microsomal stability assays were carried out to evaluate the potential metabolic stability of the lead compounds . among compounds 29 , 30 , and 34 with t1/2 > 30 min in human microsomes , compound 30 was selected for in vivo pharmacokinetic mouse studies because of its lower in vitro cytotoxicity . compound 30 showed improved pk properties in comparison with that of ( s)-ccz ( ( s)-2 ) , namely , a longer half - life , while retaining a high liver / plasma ratio . besides the progress in the treatment of chronic hcv infection , among other issues , the global affordability is still an important factor to consider within the current treatment options . repurposing the over - the - count drug ccz ( rac-2 ) may offer an affordable treatment for chronic hcv infection . additionally , we presented a chemical / structural modification study , which resulted in optimized , nonchiral well - tolerated ccz analogues with improved anti - hcv potency and pharmacokinetic properties that are able to provide good coverage in the liver at very reasonable doses . the lead compounds inhibited hcvsc infection without affecting hcvpp entry or hcv replication in the replicon assay , which is similar to the findings for ccz ( rac-2 ) , suggesting an unaltered mechanism of action . the lead compounds showing overall improved properties , will be selected for in vivo anti - hcv efficacy studies and potentially for further preclinical drug development efforts with the aim of moving additional compounds of this series toward anti - hcv human clinical trials . all air or moisture sensitive reactions were performed under positive pressure of nitrogen with oven - dried glassware . anhydrous solvents such as dichloromethane , n , n - dimethylformamide ( dmf ) , acetonitrile , methanol , and triethylamine were purchased from sigma - aldrich ( st . preparative purification was performed on a waters semipreparative hplc system ( waters corp . , the column used was a phenomenex luna c18 ( 5 m , 30 75 mm ; phenomenex , inc . , torrance , ca ) at a flow rate of 45.0 ml / min . the mobile phase consisted of acetonitrile and water ( each containing 0.1% trifluoroacetic acid ) . a gradient of 10% to 50% acetonitrile over 8 min was used during the purification . analytical analysis was performed on an agilent lc / ms ( agilent technologies , santa clara , ca ) . method 1 : a 7 min gradient of 4% to 100% acetonitrile ( containing 0.025% trifluoroacetic acid ) in water ( containing 0.05% trifluoroacetic acid ) was used with an 8 min run time at a flow rate of 1.0 ml / min . method 2 : a 3 min gradient of 4% to 100% acetonitrile ( containing 0.025% trifluoroacetic acid ) in water ( containing 0.05% trifluoroacetic acid ) was used with a 4.5 min run time at a flow rate of 1.0 ml / min . a phenomenex luna c18 column ( 3 m , 3 75 mm ) was used at a temperature of 50 c . purity determination was performed using an agilent diode array detector for both method 1 and method 2 . mass determination was performed using an agilent 6130 mass spectrometer with electrospray ionization in the positive mode . h nmr spectra were recorded on varian 400 mhz spectrometers ( agilent technologies , santa clara , ca ) . chemical shifts are reported in ppm with undeuterated solvent ( dmso at 2.49 ppm ) as internal standard for dmso - d6 solutions . all of the analogues tested in the biological assays have a purity of greater than 95% based on both analytical methods . spectrometry was recorded on an agilent 6210 time - of - flight ( tof ) lc / ms system . confirmation of molecular formula was accomplished using electrospray ionization in the positive mode with the agilent masshunter software ( version b.02 ) . enantiomerically pure compounds were purified to > 99% purity using supercritical fluid chromatography ( sfc ) preparative systems at lotus separations , llc ( princeton , nj , usa ) . compounds rac-1 , ( s)-1 , and ( r)-1 were purchased from albany molecular research ( albany , ny , usa ) . compounds rac-2 , ( s)-2 , and ( r)-2 were purchased from mp biomedicals ( santa ana , ca , usa ) . compounds rac-3 and 6 were purchased from prestwick chemical ( france ) . compounds 8 and 9 were purchased from sigma - aldrich ( st . louis , mo , usa ) . compounds rac-36 and rac-37 were purchased from vitas - m laboratory ( the netherlands ) . a solution of ( s)-1 ( 50.0 mg , 0.174 mmol ) in methanol ( meoh ) ( 2.00 ml ) was treated at room temperature with acetaldehyde ( 38.4 mg , 0.872 mmol ) , nabh3cn ( 32.9 mg , 0.523 mmol ) , and acetic acid ( 30.0 ml , 0.523 mmol ) . the reaction mixture was stirred at room temperature overnight and then quenched with 1 n naoh solution . the mixture was dried by blowing air , and the residue was redisolved in dmso , filtered , and purified by preparative hplc to afford ( s)-10 ( 47.0 mg , 63% ) as the tfa salt . h nmr ( 400 mhz , dmso - d6 ) ppm 9.22 ( s , 1h ) , 7.507.29 ( m , 8h ) , 7.297.19 ( m , 1h ) , 4.54 ( s , 1h ) , 3.42 ( d , j = 12.23 hz , 2h ) , 3.183.09 ( m , 2h ) , 3.04 ( q , j = 11.21 hz , 2h ) , 2.84 ( d , j = 13.01 hz , 2h ) , 2.21 ( q , j = 11.50 hz , 2h ) , 1.18 ( t , j = 7.27 hz , 3h ) ; lcms rt ( method 1 ) = 4.566 min ; rt ( method 2 ) = 3.035 min , m / z 315.1 [ m + h ] ; hrms ( esi ) m / z calcd for c19h24cln2 [ m + h ] 315.1623 ; found , 315.1637 . a solution of 27 ( 3.00 g , 11.9 mmol ) in meoh ( 15.0 ml ) was treated at 0 c in portions with nabh4 ( 0.678 g , 17.9 mmol ) . the reaction mixture was stirred at 0 c for 15 min , allowed to warm to room temperature , and stirred for 2 h. the reaction was quenched with ice , diluted with h2o , and extracted with etoac . the organic layer was separated , dried over mgso4 , and concentrated to give the title compound as a white solid ( 3.00 g , 99% ) , which was used without further purification . h nmr ( 400 mhz , cdcl3 ) ppm 7.31 ( d , j = 8.8 hz , 4h ) , 7.28 ( d , j = 8.7 hz , 4h ) , 5.78 ( d , j = 3.2 hz , 1h ) , 2.26 ( d , j = 3.5 hz , 1h ) . lcms rt ( method 2 ) = 3.733 min , m / z 254.5 [ m + h ] . bis(4-chlorophenyl)methanol ( 3.00 g , 11.8 mmol ) was dissolved in ch2cl2 ( 10.0 ml ) ; to this was added 34 drops of dmf followed by thionyl chloride ( 2.60 ml , 35.6 mmol ) . the resulting reaction mixture was allowed to stir at room temperature for 45 min , after which tlc anlysis ( 20% etoac in hex ) showed completion . the reaction mixture was concentrated under reduced pressure to afford 28 ( 2.50 g , 78% ) as a white solid , which was used without further purification . h nmr ( 400 mhz , cdcl3 ) ppm 7.427.27 ( m , 8h ) , 6.06 ( s , 1h ) . lcms rt ( method 2 ) = 3.932 min , m / z 272.6 [ m + h ] . a solution of 28 ( 80.0 mg , 0.295 mmol ) in thf ( 10.0 ml ) was treated with piperazine ( 38.1 mg , 0.442 mmol ) followed by k2co3 ( 81.0 mg , 0.589 mmol ) . a catalytic amount of tetrabutylammonium iodide ( 10.9 mg , 0.029 mmol ) was added to the mixture . the reaction mixture was refluxed for 8 h , after which lc / ms analysis showed completion . the organic layer was washed three times with saturated nahco3 solution , dried over mgso4 , filtered , and concentrated . the crude product was purified by preparative hplc to give 29 ( 80.0 mg , 63% ) as the tfa salt . h nmr ( 400 mhz , dmso - d6 ) ppm 8.50 ( s , 2h ) , 7.43 ( d , j = 8.7 hz , 4h ) , 7.39 ( d , j = 8.6 hz , 4h ) , 4.56 ( s , 1h ) , 3.11 ( s , 4h ) , 2.46 ( s , 4h ) . lcms rt ( method 1 ) = 4.760 min , m / z 322.7 [ m + h ] ; hrms ( esi ) m / z calcd for c17h19cl2n2 [ m + h ] 321.0920 ; found , 321.0930 . to a stirred solution of 28 ( 0.800 g , 2.95 mmol ) in thf ( 10.0 ml ) was added k2co3 ( 0.814 g , 5.89 mmol ) , 1-methylpiperazine ( 0.654 ml , 5.89 mmol ) , and catalytic potassium iodide ( 73.0 mg , 0.442 mmol ) . the reaction was heated to 100 c for 48 h. the reaction mixture was partitioned between etoac and h2o , the layers separated , and the organic phase washed with brine , dried over mgso4 , filtered , and concentrated . the crude mixture was purified by flash column chromatography , silica gel with a gradient of 05% meoh in ch2cl2 to afford 30 ( 603 mg , 61% ) as a free - base oil , which was then mixed in a 1:1 ratio with oxalic acid to form the oxalate salt as a white powder . h nmr ( 400 mhz , dmso - d6 ) ppm 7.41 ( d , j = 8.6 hz , 4h ) , 7.34 ( d , j = 8.5 hz , 4h ) , 4.33 ( s , 1h ) , 2.32 ( s , 4h ) , 2.27 ( s , 4h ) , 2.14 ( s , 3h ) . lcms rt ( method 1 ) = 4.843 min , m / z 336.9 [ m + h ] ; hrms ( esi ) m / z calcd for c18h21cl2n2 [ m + h ] 335.1076 ; found , 335.1086 . a solution of 28 ( 160 mg , 0.589 mmol ) in thf ( 10.0 ml ) was treated with 1-ethylpiperazine ( 101 mg , 0.884 mmol ) followed by k2co3 ( 163 mg , 1.18 mmol ) . a catalytic amount of tetrabutylammonium iodide ( 21.8 mg , 0.059 mmol ) was added , and the resulting reaction mixture was heated to 100 c for 48 h. the reaction mixture was partitioned between etoac and h2o , the layers separated , and the organic phase washed with brine , dried over mgso4 , filtered , and concentrated . the crude mixture was purified by flash column chromatography , silica gel with a gradient of 05% meoh in ch2cl2 to afford 31 ( 123 mg , 60% ) as a free - base oil , which was then mixed in a 1:1 ratio with oxalic acid to form the oxalate salt . h nmr ( 400 mhz , dmso - d6 ) ppm 7.44 ( d , j = 8.8 hz , 4h ) , 7.40 ( d , j = 8.8 hz , 4h ) , 4.57 ( s , 1h ) , 3.113.02 ( m , 2h ) , 2.80 ( s , 8h ) , 2.24 ( s , 2h ) , 1.17 ( t , j = 7.2 hz , 3h ) . lcms rt ( method 1 ) = 5.029 min , m / z 350.7 [ m + h ] ; hrms ( esi ) m / z calcd for c19h23cl2n2 [ m + h ] 349.1233 ; found , 349.1239 . et3n ( 0.279 ml , 2.00 mmol ) was added to a solution of rac-5 ( 250 mg , 0.667 mmol ) in thf ( 10.0 ml ) at room temperature . the mixture was stirred for 15 min , then phthalimide ( 147 mg , 1.000 mmol ) and triphenylphosphine ( 262 mg , 1.00 mmol ) were added to the mixture followed by diisopropyl azodicarboxylate ( 0.130 ml , 0.667 mmol ) . the reaction mixture was stirred at room temperature for 4 h , after which lcms analysis showed product formation . the reaction mixture was concentrated to dryness and residue purified by preparative hplc to give rac-22 ( 239 mg , 58% ) as the tfa salt . h nmr ( 400 mhz , dmso - d6 ) ppm 9.42 ( s , 1h ) , 7.72 ( m , 4h ) , 7.46 ( d , j = 8.4 hz , 2h ) , 7.447.38 ( m , 4h ) , 7.34 ( t , j = 7.5 hz , 2h ) , 7.25 ( t , j = 7.4 hz , 1h ) , 4.53 ( s , 1h ) , 3.73 ( d , j = 4.8 hz , 4h ) , 3.58 ( t , j = 5.2 hz , 4h ) , 3.14 ( d , j = 11.2 hz , 2h ) , 3.042.97 ( m , 2h ) , 2.82 ( d , j = 12.8 hz , 2h ) , 2.28 ( m , 2h ) . lcms rt ( method 1 ) = 5.205 min , m / z 505.7 [ m + h ] ; hrms ( esi ) m / z calcd for c29h31cln3o3 [ m + h ] 504.2048 ; found , 504.2043 . hydrazine ( 0.181 ml , 5.77 mmol ) was added to a solution of rac-22 ( 97.0 mg , 0.192 mmol ) in etoh ( 3.00 ml ) . the reaction mixture was stirred at 60 c for 3 h , after which lcms analysis showed completion . the reaction mixture was concentrated under reduced pressure and residue purified by preparative hplc to give rac-23 ( 58.0 mg , 63% ) as the tfa salt . h nmr ( 400 mhz , dmso - d6 ) ppm 9.39 ( s , 1h ) , 7.44 ( d , j = 8.1 hz , 2h ) , 7.417.38 ( m , 4h ) , 7.35 ( t , j = 7.8 hz , 2h ) , 7.23 ( t , j = 7.3 hz , 1h ) , 4.55 ( s , 1h ) , 3.77 ( d , j = 4.6 hz , 2h ) , 3.55 ( t , j = 5.0 hz , 4h ) , 3.19 ( d , j = 11.0 hz , 2h ) , 3.092.95 ( m , 2h ) , 2.80 ( d , j = 11.5 hz , 2h ) , 2.25 ( m , 2h ) . lcms rt ( method 1 ) = 3.959 min , m / z 374.7 [ m + h ] ; hrms ( esi ) m / z calcd for c21h29cln3o [ m + h ] 374.1994 ; found , 374.2002 . a solution of rac-5 ( 250 mg , 0.558 mmol ) in dmf ( 5.00 ml ) was treated with a 60% dispersion in mineral oil of nah ( 89.0 mg , 2.23 mmol ) at 0 c . the reaction mixture was stirred at 0 c for 10 min and room temperature for 30 min . to this mixture was added a solution of tert - butyl ( 2-(2-(2-bromoethoxy)ethoxy)ethyl)carbamate ( 174 mg , 0.558 mmol ) in dmf ( 1.00 ml ) and the resulting mixture allowed to stir overnight . the organic layer was separated , dried over mgso4 , filtered , and concentrated . the crude residue was purified by preparative hplc to give rac-24 ( 220 mg , 55% ) as the tfa salt . h nmr ( 400 mhz , cdcl3 ) ppm 7.457.37 ( m , 4h ) , 7.377.18 ( m , 5h ) , 4.44 ( s , 1h ) , 3.86 ( t , j = 4.4 hz , 2h ) , 3.633.48 ( m , 14h ) , 3.29 ( s , 4h ) , 2.91 ( s , 9h ) , 1.43 ( s , 9h ) . lcms rt ( method 1 ) = 5.372 min , m / z 607.7 [ m + h ] ; hrms ( esi ) m / z calcd for c32h49cln3o6 [ m + h ] 606.3304 ; found , 606.3307 . a solution of rac-24 ( 217 mg , 0.358 mmol ) in ch2cl2 ( 10.0 ml ) was treated with trifluoroacetic acid ( 5.00 ml ) at 0 c . the reaction mixture was stirred at 0 c for 10 min and room temperature for 30 min , after which lcms analysis showed completion . the reaction mixture was concentrated , and the crude residue was purified by preparative hplc to give rac-25 ( 109 mg , 60% ) as the tfa salt . h nmr ( 400 mhz , cdcl3 ) ppm 7.95 ( s , 2h ) , 7.517.41 ( m , 4h ) , 7.387.25 ( m , 4h ) , 4.57 ( s , 1h ) , 3.79 ( dd , j = 11.2 , 6.6 hz , 4h ) , 3.703.49 ( m , 9h ) , 3.58 ( s , 7h ) , 3.36 ( d , j = 4.8 hz , 2h ) , 3.17 ( s , 3h ) , 3.00 ( s , 5h ) . m / z 507.2 [ m + h ] ; hrms ( esi ) m / z calcd for c27h41cln3o4 [ m + h ] 506.2780 ; found , 506.2803 . human hepatoma cell line huh7.5.1 and other hepg2 cells were maintained in dulbecco s modified eagle s medium ( dmem ) ( life technologies , grand island , ny , usa ) with 10% fetal bovine serum ( fbs ) ( life technologies , grand island , ny , usa ) and antibiotics in 5% co2 at 37 c . hcv - luc ( hcv jfh-1 strain with insertion of the luciferase reporter gene ) and pseudotyped viruses ( hcvpp-1a , hcvpp-1b , and vsv - gpp ) were produced as reported before . hcv - luc ( hcv jfh-1 strain with insertion of the luciferase reporter gene ) , hcvsc ( single - round infectious defective hcv particle ) , and pseudotyped viruses ( hcvpp-1a , hcvpp-1b , and vsv - gpp ) were produced as reported before . cells were plated in 96-well plates at 10 cells / well and incubated overnight . the cells were infected with hcv - luc in the presence of increasing concentrations of the compound of interest . the viral level was measured 48 h after treatment using a renilla luciferase assay system ( promega , madison , wi , usa ) . atp - based cell viability assay was carried out in parallel to evaluate the cytotoxicity with an atplite assay kit ( perkinelmer , waltham , ma , usa ) . the concentration values that led to 50% viral inhibition and cytotoxicity ( ec50 and cc50 ) were calculated using the nonlinear regression equation in graphpad prism 5.0 software ( graphpad software inc . , la jolla , ca , usa ) . in the hcvsc assay , huh7.5.1 cells were cultured in 96-well plates ( 10 cells / well ) overnight before infection with hcvsc in the presence of compound treatments . after 48 h of incubation , the viral level was detected by a luciferase assay . in the hcv subgenomic replicon assay , hcv replicon ( gt 2a ) cells were plated into 96-well plates at 10 cells / well and incubated overnight . the cells were treated with tested compounds for 48 h , and luciferase activity was measured . in hcvpp assays , huh7.5.1 cells were seeded in 96-well plates ( 10 cells / well ) and cultured overnight . then , the cells were infected with hcvpp gt 1a , 1b , vsv - gpp , and mlvpp for 4 h in the presence of compound treatment . the cells were then washed and cultured for 48 h followed by a luciferase assay to detect the hcv entry . positive controls ( cyclosporin a at 10 m and bafilomycin a1 at 10 nm ) were tested in parallel . pathhunter -arrestin gpcr assay kit ( discoverx , fremont , ca , usa ) was used following the antagonist procedure . the pathhunter cells were plated in white 96-well plates with clear bottoms and cultured overnight . after incubation with the compound of interest for 3 h , agonist histamine at 0.25 m was added , and the plates were incubated for an additional 2 h. the chemiluminescent signal was read after 60 min of incubation with detection agent at room temperature . percent antihistamine activity was calculated based on the result from histamine - treated wells . huh7.5.1 cells were plated in 96-well plates at 10 cells / well and cultured overnight . dengue rvps ( integral molecular , philadelphia , pa , usa ) the nonclinical and preclinical services program offered by the national institute of allergy and infectious diseases ( niaid ) ( http://www.niaid.nih.gov/labsandresources/resources/dmid/invitro/pages/invitro.aspx ) was used for the antiviral screen against the 13 viruses . the viruses include hepatitis b virus , hcv replicon , herpes simplex virus-1 , human cytomegalovirus , vaccinia virus , dengue virus , influenza a ( h1n1 ) virus , respiratory syncytial virus , sars coronavirus , poliovirus 3 , rift valley fever virus , tacaribe virus , and venezuelan equine encephalitis virus . the in vitro microsomal stability was measured by incubation of compounds with human / mouse / rat liver microsomes at 37 c in the presence of the cofactor , nadph . the concentrations of compounds were measured by lc - ms / ms at 0 , 5 , 15 , 30 , and 45 min half - life ( t1/2 ) was calculated as described before . the kinetic solubility of compounds was determined in phosphate buffer at ph 7.4 , using sol evolution from pion inc . ( www.pion-inc.com ) , with a fully automated system of sample preparation , sample analysis , and data processing . the effective permeability of compounds was determined via passive diffusion using the stirring double - sink pampa ( parallel artificial membrane permeability assay ) method from pion inc . ( www.pion-inc.com ) with a fully automated system of sample preparation , sample analysis , and data processing . for in vivo pharmacokinetics , 27 male cd-1 mice ( 35 g ) were obtained from charles river laboratories ( wilmington , ma ) . mice were housed at the centralized animal facilities at the nih ( bethesda , md ) with a 12 h light dark cycle . the housing temperature and relative humidity were controlled at 22 c and 55% , respectively . the animals had free access to water and food . all experimental procedures were approved by the animal care and use committee of the nih . a dosing concentration of 2 mg / ml of the appropriate compound was freshly prepared in 10% peg300 and 90% of 30% hp--cd in water . the blood and liver samples were collected at predose , 0.083 , 0.25 , 0.5 , 1 , 2 , 4 , 7 , and 24 h. three samples ( n = 3 ) were collected at each time point . the concentrations of the compound in the plasma and liver were determined by ultraperformance liquid chromatography mass spectrometry analysis ( uplc - ms / ms ) . the pharmacokinetic parameters were calculated using the noncompartmental method ( model 200 ) of the pharmacokinetic software package phoenix winnonlin , version 6.2 ( certara , st . the area under the plasma and liver concentration versus time curve ( auc ) was calculated using the linear trapezoidal method . where warranted , the slope of the apparent terminal phase was estimated by log linear regression using at least 3 data points , and the terminal rate constant ( ) was derived from the slope . auc0- was estimated as the sum of the auc0-t ( where t is the time of the last measurable concentration ) and ct/. the apparent terminal half - life ( t1/2 ) was calculated as 0.693/.

the prevention of pocket depth and its recurrence is the important goal of periodontal treatment . the outcomes of periodontal treatment to eliminate periodontal pockets and/or perioplastic surgeries is beneficial ; however , it is most often associated with gingival recession which is known to influence the postsurgical pocket depth and exposure of guided tissue regeneration ( gtr ) membrane and leading to esthetic concern . the success of pocket elimination procedures in terms of pocket depth reduction is questionable when associated with gingival recession , which is not often measured postoperatively , and the influence of gingival margin position ( gmp ) is often less defined in such situation . the gmp , which is greatly influenced by gingival thickness ( gt ) , is not discussed in the periodontal literature . the thickness of gingival tissue covering the membrane in furcation treatment appears to be a factor to consider if the post treatment recession is to be minimized or avoided . the influence of gtr membrane in a postsurgical recession is well - discussed in their paper . the alterations of the position of the marginal soft tissue following periodontal surgery in 43 patients have showed that during active periodontal treatment the position of the gingival margin was shifted in an apical direction . this displacement was to some extent compensated by a coronal regrowth during the postoperative maintenance care period . the alteration of the position of gingival margin was similar pattern in areas with and without a zone of keratinized gingiva . medline search using keywords gmp , gingival recession , gt , open flap debridement revealed minimum studies . hence , the purpose of this paper was to evaluate the gmp before and after open flap debridement in different gt . twenty - seven moderate to advanced adult periodontitis patients , consisting of 12 males , 15 females , and age 2535 years , participated in the study . the study protocol was approved by the institutional review board , college of dental sciences and rajiv gandhi university of health sciences . patients were in good health with no history of systemic disease and presented with 57 mm periodontal pockets without gingival recession . all patients received presurgery hygiene therapy , including plaque control instruction , root debridement , and occlusal adjustment as indicated . informed consent was obtained after the explanation of the procedure and its associated risks and benefits to the patient . thickness of gingiva is determined by transgingival probing using calibrated probe . depending on the gt , group 2 ( thick ) consisted of 15 patients with gt > 1 mm . a calibrated unc-15 periodontal probe and customized plastic , occlusal stent was used for all clinical measurements [ figure 1 ] , which was used to accurately align the probe . all the measurements were made by the same investigator to the nearest 0.5 mm throughout the study period ( 016 months ) . the changes in gmp were studied at midbuccal ( mi - b ) , mesiobuccal ( mb ) , and distobuccal ( db ) sites . presurgery gmp was recorded by measuring from the lower end of stent fixed reference point ( frp ) to the free gingival margin ( frp to fmg1 ) at 3 sites of selected tooth . stent and probe in position to measure gingival margin position the gt was assessed midbuccally in the attached gingiva , half way among the mucogingival junction , free gingival groove , and at the base of the interdental papilla . the gt was assessed by anesthetizing the facial gingiva with xylonar spray ( lignocaine 15.0 g ) and if required , infiltration was conducted using 2% lignocaine hydrochloride with 1:80,000 adrenaline injection . using a unc-15 probe [ figure 2 ] , measurements were not rounded off to the nearest millimeter , then the sulcular incision was made , and mucoperiosteal flap was reflected . the defect was debrided of all soft tissue and the roots were scaled and planed free of accretions to a hard , smooth consistency . prior to flap suture , the chernihiv airport ( cej ) location was measured at mi - b , mb , and db sites from frp to cej . transgingivial probing using calibrated probe no patients received periodontal dressings or antibiotics during the study . patients were prescribed analgesics for postsurgery discomfort and a 0.12% chlorhexidine digluconate oral rinse for plaque suppression . patients returned for flap suture removal at 1 week postsurgery and weekly for the next 4 weeks for professional plaque control . patients were then placed on a monthly recall schedule for supportive periodontal treatment over the duration of the study . the postsurgical measurements were done by the same investigator who was blinded for the 2 groups . change in gmp was determined by comparing postsurgical measurements ( frp - fgm2 ) to presurgical measurement ( frp - fgm1 ) at each site . a total 482 sites ( mi - b 72 ; mb 58 ; db 62 ) in 1 mm ( n = 15 ) and 606 sites ( mi - b 96 ; mb 54 ; db 52 ) in > 1 mm ( n = 12 ) gt groups were included from 27 subjects . the results of the study are expressed in table 1 , graphs 16 and figures 3a f and 4a f . the gmp ( frp - gmp ) , gingival thickness and cej ( frp - cej ) at different sites in 1 mm and > 1 mm gingival thickness groups at baseline ( mm meansd ) gingival thickness 1 mm ( baseline , 1 month , 3 month ) gingival thickness > 1 mm ( baseline , 1 month , 3 month ) gingival thickness 1 mm ( baseline , 6 month ) gingival thickness 1 mm ( baseline , 16 month ) gingival thickness > 1 mm ( baseline , 6 month ) gingival thickness > 1 mm ( baseline , 16 month ) ( a - f ) diagrammatic representation of gingival margin position in gingival thickness 1 mm or > 1 mm ( 1 month and 3 month ) ( a - f ) diagrammatic representation of gingival margin position in gingival thickness 1 mm or > 1 mm ( 6 month and 16 month ) there was no significant difference between group 1 and 2 for probing pocket depth ; however , the gmp was significantly apical in group 1 ( < 1 mm ) as compared to group 2 ( > 1 mm ) . in gt of 1 mm group , at all 3 sites such as mi - b , mb , and db , there was a significant apical shift of gm from baseline to 1 month ( 0.000 ) and 3 months ( 0.045 , 0.000 , and 0.000 , respectively ) [ graph 1 ] . in gt of > 1 mm group , there was a significant apical shift of gingival margin at all the 3 sites ( mi - b , mb , and db ) from baseline to 1 month ( 0.000 ) and 3 months ( 0.001 , 0.000 , and 0.000 , respectively ) [ graph 2 ] . however , at baseline to 6 months and 16 months , there was no significant apical shift in mb ( 0.84 , 0.019 ) and db sites ( 0.360 , 0.729 ) in both the groups [ graphs 36 ] . the correlation of static cej ( frp - cej measurement ) distance and gmp ( frp - gingival margin measurement ) from baseline to 1 and 3 months [ figure 3a f ] ; baseline to 6 and 16 months [ figure 4a f ] are depicted . the static frp - cej distance was used as a reference measurement to compare the pre- to postsurgical frp - gm position to designate whether there was an apical shift with cej exposure causing gingival recession ( a ) or only apical shift without causing gingival recession ( b ) in both the gt 1 mm and > 1 mm groups . during 6 and 16 months postsurgery , there was a reduction in the number of sites due to patient dropout . the baseline gmp data differed from those at early postsurgical period , i.e. the baseline data was calculated to those sites which continued up to 6 and 16 months . in gt of 1 mm group , the statistically significant apical shift of gmp led to gingival recession at all sites throughout the study sites in the early postsurgical period of 1 and 3 months [ figure 3a f ] . during 6 and 16 months , the apical shift of gmp coincided with the cej at mi - b site ( 6 months ) , mb site ( 16 months ) . the gingival recession was obvious at mi - b sites ( 16 months ) [ figure 4a f ] . in the gt of > 1 mm , the statistically significant apical shift of gmp did not cause gingival recession at any sites throughout postsurgical ( 1 , 3 , 6 , and 16 months ) period [ figures 3a f and 4a f ] . the various factors influencing the gmp are gt , tooth position , shallow vestibule , and adequacy of keratinized gingiva and frenal attachments . the apical shift in gmp with and without cej exposure depends on gt that requires being measured pre- and post - operatively . most of the periodontal literature suggests that gingival recession ( apical shift of gmp on the root ) is caused by the inadequate width of attached gingiva , and rarely , the gt is discussed as a causative factor for gingival recession / apical shift of gmp . in the present study , the dynamics of gmp has been measured from frp during early ( 1 and 3 months ) and later ( 6 and 16 months ) postsurgical period and compared with the baseline gmp levels in of 1 mm and > 1 mm gt groups . in the current study , the extent of the apical shift was either gingival recession exposing cej or it was close to the cej . the interpretation of this study results are depicted in figures 1 and 2 . in the gt of 1 mm group , throughout the study period ( 016 months ) , the mi - b sites demonstrated a significant apical shift , which caused gingival recession . at mb and db sites , the apical shift resulted in gingival recession during 1 and 3 months postsurgically . however , the reduced number of sites in the 6 and 16 months period demonstrated apical shift either coinciding with cej or causing gingival recession . in the gt of more than 1 mm group , the postsurgical apical shift did not result in gingival recession throughout the study period . the results of this study are not directly comparable to few of the studies in the literature due to variation in the methods and use of regenerative materials for the treatment of grade ii furcation with gtr , long - term assessment of combined osseous graft , and gtr in periodontal osseous defects , the mean increase in recession for patients in the thin ( 1 mm ) group was 2 times that was recorded in other studies in which flap thickness was not assessed , there are several possible explanations for this observation . in a study of dogs , it was reported that circulatory embarrassment of mucogingival flaps was greater after partial thickness compared to full thickness dissection . while all the flaps in the present study were full thickness mucoperiosteal elevations , it is reasonable to consider that thin flaps are at greater risk than thick ( > 1 mm ) flaps for ischemia and necrosis due to their relatively thinner connective tissue component . pressure of the flap against the membrane or tension in the flap as a result of attempting to completely cover the membrane may also compromise blood supply to the flap margin , flaps under tension become ischemic and subject to necrosis . the blood supply in thin flaps is more likely to be embarrassed by tension than in thicker flaps of equal mobility . in addition to the effects of routine operative flap manipulation , flap margins can be inadvertently thinned during sulcular incisions , and increase risk of postsurgery recession . this effect might be magnified in thinner , more delicate tissues . if recession occurs , flaps with thin connective tissue are at greater risk for inflammation - induced postsurgery recession than thick flaps . in case of gtr , the revascularization of any flap may be further compromised by blockage of the potential blood supply from the periodontal ligament and bone defect to the flap connective tissue by polytetrafluoroethylene ( eptfe ) membrane . the placement of a mucoperiosteal flap over an avascular membrane is not unlike placement of a soft tissue graft over an avascular root surface . the failure of thin ( 1 mm ) free gingival autografts to successfully cover wide areas of gingival recession was overcome by preparation of an adequately large recipient bed and a connective tissue graft of thicker dimension ( 1.52 mm ) . after dissection or elevation , thicker connective tissue grafts or flaps the thicker the connective tissue , the better the potential circulatory pool and the greater chance for flap survival . the thickness of soft tissue overlying an eptfe membrane should be maximized . these findings may suggest a tendency of the periodontium to reform a new physiological supracrestal gingival unit . the regrowth of the soft tissue from the level where the osseous crest was defined at surgery had already begun 1 month after surgery , when the gingival margin reached about 60% of its final coronal position at interproximal sites and about 40% at buccal / lingual sites . few studies on surgical crown lengthening in the current literature report results on the location of the gingival margin after treatment in relation to the level of the alveolar osseous crest defined during surgery . the factors influencing the amount of coronal displacement of the marginal periodontal tissue seemed to be related to the different gt since patients with thick tissue demonstrated significantly more coronal soft tissue regrowth than patients with thin gingival tissue and to the natural biological differences in inter - individual patterns of the healing response . considering the behavior of the gingival margin observed in the present study following surgery , it may be suggested that : when surgical therapy is performed to gain access for proper restorative measures to deep subgingivally located carious lesions , endodontic perforations , crown - root fractures , or preexisting margins of failing restorations , an early ( during healing ) definition of the previously inaccessible margins is recommended . through current study results , the gmp is not stabilized till 1 and 3 months postsurgically in gt of 1 mm as compared to > 1 mm . the restorative esthetic procedures have to consider the dynamics of gmp prior to finalizing the time of permanent restorationwhen it is esthetically important , visible areas of the prosthetic reconstruction margins are planned to be positioned in an intrasulcular location , a close monitoring of the different degree of tissue regrowth , which occurs during healing among patients should be recommended to determine the achieved gingival margin stability and , therefore , to assess the ideal time for the definitive restorative procedures . when surgical therapy is performed to gain access for proper restorative measures to deep subgingivally located carious lesions , endodontic perforations , crown - root fractures , or preexisting margins of failing restorations , an early ( during healing ) definition of the previously inaccessible margins is recommended . through current study results , the gmp is not stabilized till 1 and 3 months postsurgically in gt of 1 mm as compared to > 1 mm . the restorative esthetic procedures have to consider the dynamics of gmp prior to finalizing the time of permanent restoration when it is esthetically important , visible areas of the prosthetic reconstruction margins are planned to be positioned in an intrasulcular location , a close monitoring of the different degree of tissue regrowth , which occurs during healing among patients should be recommended to determine the achieved gingival margin stability and , therefore , to assess the ideal time for the definitive restorative procedures . measurement of gingival dimension , i.e. gt and width is clinically meaningful for both academician and periodontist . those academicians or clinicians who record gt measurement regularly could understand the outcome measures meaningfully . it should be mandatory to record gt for all periodontal surgical procedures as the common outcome such as recession depends on the gt . most importantly , the need of the hour is to add gt measurement in the standard textbooks of periodontics .

congenital hepatic fibrosis ( chf ) is a rare disorder of the portobiliary system characterized histologically by defective remodeling of the ductal plate , abnormal branching of the intrahepatic portal veins , and progressive fibrosis of the portal tracts.1 typically , chf is associated with autosomal recessive polycystic kidney disease.2 although liver transplantation is curative , it should be limited to the minority of patients with chronic cholangitis or progressive hepatic dysfunction . in most instances , chf is a disorder characterized by well - preserved hepatic function and a good prognosis if complications such as variceal bleeding and cholangitis are controlled.3 pancreaticobiliary maljunction ( pbm ) is a congenital anomaly defined as a union of the pancreatic and biliary ducts outside the duodenal wall . pbm is associated with a high risk for biliary tract carcinoma because of the continuous reflux of pancreatic juice into the biliary tract.4 to prevent biliary tract carcinogenesis in pbm patients , the cystic - dilated choledochus should be excised in childhood before the development to a precancerous stage.5 a case of chf and pbm who suffered recurrent fever of unknown origin not responsive to several antibiotics after roux - en - y reconstruction is reported . her height and weight were within the reference ranges , and her developmental history was age - appropriate . her abdominal enhanced computed tomography ( ct ) showed hepatomegaly , dilation of intrahepatic bile ducts , and a polycystic kidney . viral markers of hepatitis a virus , hepatitis b virus , hepatitis c virus , cytomegalovirus , and epstein barr virus were all negative . the patient had a healthy elder sister and younger brother , and her family had no liver or renal diseases . at the age of 4 years , she was treated by resection of the choledochal cyst and roux - en - y reconstruction because of the cyst 's risk of cancer . the bands sometimes connected with adjacent portal tracts . distorted irregular bile ducts in the portal tracts were noted ( fig . after roux - en - y reconstruction , she suffered recurrent fever of unknown origin not responsive to several antibiotics ( sulbactam / cefoperazone , panipenem / betamipron , piperacillin , amikacin , etc . ) . when she had a high fever , although c - reactive protein was high ( 10 mg / dl ) , her aspartate aminotransferase , alanine aminotransferase , lactate dehydrogenase , alkaline phosphatase , gamma - glutamyl transpeptidase , prothrombin time , total bilirubin , direct bilirubin , and immunoglobulin levels were all normal . she had no jaundice , cough , nasal discharge , diarrhea , pyuria , or otitis media . the symptoms were intractable , and her systemic condition gradually deteriorated and her quality of life was reduced . therefore , she underwent living donor liver transplantation ( ldlt ) from her father at the age of 6 years . on histological examination , neutrophilic cholangitis with diffuse infiltration of neutrophils in the bile duct and hepatic vein and reactive lymphadenitis with infiltration of neutrophils and macrophages in sinusoids were seen . three species of multi - drug - resistant pseudomonas aeruginosa were cultured in the recipient 's liver . after ldlt , the patient had no episodes of recurrent fever , and her outcome was good . ( a ) on histological examination of the liver biopsy specimen , portal areas greatly expanded by fibrous tissue and increased bile ducts are seen . in the present case , complete choledochal cyst resection and roux - en - y reconstruction were performed in a 4-year - old girl with pbm and a choledochal cyst . at the time of the operation , hepatic histological findings were hyperplasia of the interlobular bile duct and diffuse fibril formation around the portal vein , compatible with a diagnosis of chf . postoperatively , the patient repeatedly suffered from fever of unknown origin . although an investigation was performed from various perspectives to identify the cause of the fever , the focus could not be determined . while blood test findings did not include elevated transaminase levels or elevated bile duct related enzymes such as gamma - glutamyl transpeptidase , it was considered that the cause of the fever was ascending cholangitis with foci at the liver and bile ducts . therefore , ldlt from the patient 's father was performed when the patient was 6 years old . in japan , the number of deceased donors is still extremely low , especially for pediatric recipients . ldlt was efficacious for a patient with intractable cholangitis following roux - en - y reconstruction for chf and pbm . since there are risks of biliary tract carcinoma in patients with pbm and a choledochal cyst , surgery at an early stage is recommended for such cases.5 choledochal cyst resection in japan is usually performed when the patient is between 1 and 4 years of age.6 therefore , choledochal cyst resection and roux - en - y reconstruction were performed when the patient was 4 years old , because pbm was observed in the present case . it is considered that chf and caroli disease are ductal plate malformations from an embryological point of view.1 chf is often accompanied by portal hypertension . even if portal hypertension is clearly present , hepatic function usually remains normal , and the patient 's prognosis is relatively good.3 liver transplantation is indicated in those children who develop liver failure in association with portal hypertension.7 also , recurrent cholangitis in chf is an indication for liver transplantation.8 in the present case , the patient suffered repeatedly from intractable cholangitis after roux - en - y reconstruction ; therefore , this may have caused the liver transplantation to be performed earlier than otherwise . in alagille syndrome accompanying hypoplasia of the intrahepatic bile duct , performing the kasai procedure may result in a poor outcome.9 one possible mechanism could be that exposure to intestinal contents and/or ascending cholangitis via the portoenterostomy could result in a second hit on already abnormal bile ducts . therefore , in such cases , the kasai procedure is not recommended . in ductal plate malformation , as for chf , the intrahepatic bile duct has a complicated form , and , therefore , once an infection is established , it becomes intractable . similar to alagille syndrome , roux - en - y reconstruction should be avoided for ductal plate malformations such as chf . if polycystic kidneys are identified , liver biopsy should be performed before any operative intervention to rule out / diagnose chf .

the rising prevalence of obesity and cardiometabolic risk observed among youth has led to predictions of decreased life expectancy among the next generation of north americans , a first in history . major , modifiable risk factor for coronary heart disease ( chd ) and diabetes . classical clinical interventions promoting a healthy lifestyle are based primarily on counseling not always tailored to individual 's profile and on structured exercise programs that have proven to be complex , costly to maintain , and have long - term poor adherence . sustainable interventions need to focus on interindividual specificity [ 4 , 5 ] and the development of personalized activity plans . advances in mobile health and wearable devices offer new ways to collect and interpret data on environments , behaviours , physiology and well - being . recently , a clinical cardiac rehabilitation intervention among adults using a wearable electrocardiogram ( ekg ) , a global positioning system ( gps ) receiver , and a smartphone for real - time data transmission on exercise sessions showed significant improvements in walking distance , depression , and the physical component of the sf36 general health questionnaire . to our knowledge , no clinical lifestyle intervention targeting children and youth has integrated the use of gps , accelerometers , and heart rate monitors . this paper describes the use of multiple technologies to integrate real - life information in tailored clinical lifestyle interventions in youth . proof of concept and feasibility is illustrated using baseline data collected among the 37 first participants of the dyn@mo intervention . the dyn@mo lifestyle intervention ( sainte - justine university hospital center , montreal , canada ) targets children and adolescents aged 6 to 17 years old with cardiometabolic risk factors , such as obesity , hypertension , disorders in glucose regulation , or dyslipidemia . its primary goal is to promote physical activity and reduce sedentary time to improve children 's cardiometabolic profile . to do so , the intervention relies on gathering data on mobility and physical activity using wearable sensors . these data provide a detailed picture of real - life conditions and physical activity levels , improving the health care professional 's ability to tailor counseling . this paper presents these tools and baseline pilot data that is , gps and accelerometry collected for seven days after the first visit among the first 37 patients who enrolled in the dyn@mo program between march and november 2011 . the intervention comprises several clinical encounters and regular followup by phone and email . on three occasions ( 0 , 12 months , and 24 months ) , children are equipped with a heart rate monitor , a gps receiver , and an accelerometer to collect heart rate , daily mobility , and physical activity data during a 7-day period ( results presented here use baseline , that is , data collected for seven days after first visit at 0 month ) . four to six weeks later , patients , families , and professionals visualise resulting indicators which could be called a the next sections present the tools developed for such continuous monitoring and analysis of real - time data , including ( i ) the data collection tools and methods , ( ii ) the data treatment expert system , and ( iii ) the map - based interactive web application for rendering of spatio - behavioural information to patients and caregivers . then , data obtained from the 37 first patients enrolled in the program are presented , along with some exploratory statistics linking spatial , behavioural , and environmental characteristics . during an initial visit at the clinic , patients are equipped with a gps receiver , an accelerometer , and a heart rate monitor . they are instructed on device usage wearing the accelerometer at the hip , the heart rate monitor on the chest during all waking hours , and carrying the gps device with them at all times and charging it overnight . a return envelope is provided to send the devices back through regular mail after completion of the 7-day period . the monitoring hardware configuration includes a trimble juno sc gps unit ( http://www.trimble.com/ ) , an actigraph actitrainer activity monitor ( http://www.theactigraph.com/ ) , and a polar wearlink heart transmitter chest monitor with wireless link to the activity monitor receptor . the gps device has a manufacturer - reported spatial accuracy of 13 meters and is configured to collect location information over an epoch of one second . collected coordinates are saved in an arcgis shapefile ( .shp ) format by a coding procedure that was developed under arcpad and installed on the trimble device within the windows mobile 6 platform . the actitrainer accelerometer is configured to record counts for each axis at a one minute epoch . data are saved on the local memories of the gps device for gps tracking and of the physical activity monitor for hr and accelerometry . upon reception of the devices at the clinic , an expert panel composed of epidemiologists , kinesiologists , pediatricians , cardiologists , geomaticians , and geographers worked on defining relevant indicators to support the lifestyle promotion intervention . the indicators were classified as follows : ( a ) physical activity and sedentary behaviour indicators , ( b ) spatial indicators and ( c ) combined indicators of physical activity and spatial behaviour , and finally ( d ) usage / device performance indicators . an arcgis arctoolbox was developed using python language to automatise data treatment , that is , to derive indicators from raw gps , accelerometry , and heart rate data files and generate a synthetic xml output file for web integration . the xml file contains data to be visualised through the online application , including geographic information of activity locations , gps tracks of trips , accelerometry - related information , and hr data . the procedure is automated an analyst runs the arctoolbox on the raw data , which generates the xml file . poor quality datapoints are eliminated and missing gps data are imputed according to specific rules outlined below . accelerometry periods of 60 consecutive minutes with zero counts or more are considered as nonvalid / nonwear time [ 9 , 10 ] . gps data points are cleaned according to measures of precision related to the configuration of the satellites ( dilution of precision , dop values ) and speed ( values with horizontal dop > 8 or vertical dop > 15 or positional dop > 13 and speed > 130 km / h are removed ) . given that gps tracks are rarely continuous because of loss of signal due to nonvisibility of satellites , particularly when inside homes or buildings , missing gps data points are imputed according to time and proximity rules . no interpolation is done if the gap is over 60 minutes , except if the two observed consecutive points are less than 100 m apart . a web - based application supports data handling , data visualisation , and tailored counseling . developed in a html and flash programming environment , it runs on a iis 7.0 web server with a microsoft sql server 2008 database deployed on the hospital 's internal servers . an administration page provides information on patient 's intervention in terms of upcoming , planned , or completed meetings , advancement of data collection and upload , state of activity profile , and counseling reports . maps of the home and school areas are automatically generated , to facilitate validation of locations by participants . a complementary mapping module documents relevant activity locations , such as actual places used for physical activity , or potential activity places , that is , sport centers , community centers , outdoor recreational areas , friend 's homes , and so forth . the interactive map allows searching destinations through a textual search box connected to the google map api which will suggest results , or directly through the placement of a marker on the map . this allows the mapping of opportunities for physical activity which can be enriched by contributions of the child , the family , and the caregiver . expert - system generated indicators of physical activity , spatial information or combinations thereof are visualised through an interactive module through tables , graphs , or maps ( see example of visual presentation of patient 's residential neighbourhood and opportunities in figure 1 and additional graphs and maps in figure 2 ) . this visual interface is used by health care professionals to better understand the child 's spatio - behavioural dynamics , and as a tool to communicate with the child and its family members and tailor physical activity counseling . all visual information such as maps or graphs as well as complementary text such as goals and objectives can be saved and reorganised at will in the evaluation report module . the discussed tools and methods are illustrated using baseline data from the 37 first participants aged 6 to 17 who were enrolled in the program between march and november 2011 . all patients had a specific cardiovascular risk factors ( e.g. , diabetes , hypercholesterolemia , hypertension , obesity , etc . ) . the dyn@mo intervention and its related research program were approved by the sainte - justine hospital ethics committee . physical activity and spatio - behavioural indicators were compiled and compared between primary school - aged and secondary school - aged children . residential neighbourhood variables were further compiled within a geographic information using a 500 meter network - buffer centered on place of residence . variables of interest included 2006 census - derived population density , proportion of immigrants , proportion of population with a university degree , household income , greenness using landsat tm-5 satellite images and computing the normalised difference vegetation index ( ndvi ) , and street connectivity [ 13 , 14 ] , that is , the number of four - way intersections per square kilometer . all these variables have been associated with physical activity or walking in previous studies [ 15 , 16 ] . summary statistics are provided in table 1 . among the 37 initial participants , three had abnormally high accelerometry - derived step counts ( above 55,000 steps a day in average ) and were considered as outliers and removed from accelerometry analysis . among the 34 remaining patients , 24 were females , and 10 males . average standardised body mass index ( zbmi according to who growth curves ) was 3.16 ( sd = 0.711 ) . bmi for age classified 33 out of 34 patients as obese ( i.e. , above the 95th percentile ) and one patient as overweight ( between the 85th and 95th percentile ) . three participants provided less than 4 valid days , 27 participants 5 days or more , 22 participants 6 days or more , and 11 participants provided valid accelerometry data for the full seven - day period . on average , a valid day included a total of 12 hours 54 minutes of wear time ( sd = 59 minutes ) . among the 34 participants , 33 had gps data . valid interpolated gps data covered the full seven - day period for some 18 participants , 6 days for 3 participants , 5 days for 4 participants , and less than four days for three others . after data correction and imputation , cumulated gps data was available on average for 17 hours and 10 minutes per day . gps data was mostly imputed while being at home or at school ( 72% ) . only one participant provided less than 4 valid days , 31 participants 5 days or more , 27 participants 6 days or more , and 24 participants provided heart rate data for the full seven - day period . accelerometry - derived data show 7,596 steps per day in average ( sd = 2,315 ) , with an average of 7,771 ( 2,497 ) steps recorded during weekdays and 6,609 ( 2,924 ) steps recorded during weekend days ( nonsignificant difference , p = 0.577 ) . accelerometry count data revealed that participants spent an average of 10 hours 41 minutes in sedentary ( < 760 count per minute , cpm ) , one hour and 36 minutes in light ( between 760 and 1951 cpm ) , and 36 minutes in moderate to vigorous physical activity ( mvpa , above 1951 cpm ) . mvpa time during weekend days was significantly lower compared to week days ( 25 versus 38 minutes per day , p = 0.01 ) . heart rate data showed some inconsistencies , particularly some very low counts ( minimum heart rate beats of 20 beat per minute ) . the average recorded that heart rate was 80 beats per minute . because of low observed values , reliability of these measures is questioned . thirteen participants lived within 1 km from their school , 15 within 1.6 km , 18 within 3 km , and 8 more than 10 km away . gps data processing revealed that participants visited some 6.42 distinct activity locations on average and visited these locations in average 17.18 times . when establishing the convex hull polygon encompassing all gps data points collected in a day a measure of the area covered by a participant through his / her daily travelling the median activity space area was 18.3 km for week days , and 1.7 km for weekend days . some participants covered relative large areas with maximum values at 1,094 km and 316 km , respectively . participants also lived in areas with a range of density and socioeconomic profiles , as indicated by relatively large standard deviations in neighbourhood ses measures ( see table 1 ) . exploratory statistics of bivariate associations between physical activity and spatial behaviour showed that the average number of steps was negatively associated with home - school distance during weekdays ( 0.399 , p = 0.020 ) , but not during week - end days ( 0.117 , p = 0.553 ) . yet , when separating primary school aged children ( 11 and younger ) from high - school aged children ( 12 and up ) , correlations became nonsignificant within each group , possibly due to a too small sample . high - schoolers attend schools further away from home , cumulate less steps daily both during week days and weekend days , have shorter times of mvpa , and have larger activity spaces than their younger counterparts . this paper presents a series of tools supporting the dyn@mo lifestyle intervention of the sainte - justine university hospital center , which targets lifestyle changes among children and youth with cardiometabolic risk factors . these tools include an objective seven - day evaluation of children 's daily mobility and physical activity using three wearable sensors : a gps receiver , an accelerometer , and a heart rate monitor . a semiautomated algorithm processes collected data to derive relevant indicators on patients ' health behaviour , mobility , and life geographies . a web - based application further allows handling , visualization , and sharing of data between patients and their health practitioners . these novel tools and corresponding indicator statistics facilitate the integration of objective behavioural and physiological measures , as well as the patient 's environmental constraints and opportunities , for a personalized , tailored lifestyle intervention . with high levels of compliance and good data coverage over a 7-day period , this study demonstrated that wearable devices could be used in a clinical lifestyle intervention to collect real - life data among children . furthermore , data processing algorithms allowed indicator construction and data restitution through an interactive mapping and graph - enabled web application . these tools and data provide information on patients ' day - to - day environmental constraints and opportunities and can thereby contribute to lifestyle counseling . more precisely , the use of a gps device proved useful to document spatial behaviour and reveal the types of urban environments participants were exposed to in their everyday geographies . combined to accelerometry data , it further allowed to situate physical activity , that is , understand when and where health behaviours such as sedentary behaviour or mvpa were occurring . the mapping of activity locations and trips , along with an interactive mapping capacity for identification of resources , further provided ways to visualize accessibility to opportunities , such as sports clubs or parks or other physical activity installations . a series of limitations apply to the tools and methods used to support the dyn@mo lifestyle intervention . the analysis and interpretation of accelerometry data to evaluate active living and physical activity require further refinement . we used cut - off points recommended by the actilife 4.3 user 's manual , yet , the distinction between nonwear time and sedentary time , the derivation of step counts , or transformation of accelerometry counts into levels of physical activity or energy expenditure estimates that is , in part , establishing valid age- and bmi - specific cut - off points remain contentious issues in pediatrics . recent proposals have been made for nonwear / sedentary wearing time and could be tested , and comparative analyses have assessed the performance of different cut - off points and predictive equations of energy expenditure among children and youth . however , although pediatric obesity is on the rise and a major concern , relatively few accelerometry validation studies have been done among obese children [ 2022 ] . concerning the use of a gps device , issues related to battery life , manipulation errors , or device limitation such as nonfix or imprecision in measurement , are well described [ 23 , 24 ] . data analysis clearly revealed measurement errors , with abnormal values nonlife supporting beat per minutes recorded among some participants . adequate wearing of such devices may be problematic for longer periods and in free - living environments . for example , it is recommended to wet the electrode area of the chest belt for proper functioning . this may generate discomfort or electrode contact issues which may reduce compliance or bias the readings towards lower numbers . alternatively , ways of providing instructions on wearing and handling procedure may need to be improved . future of wearable sensors for clinical interventions : use of gps for understanding spatial behaviour and exposure to environments is relatively new but rapidly gaining momentum . pilot and feasibility studies have demonstrated the capacity of gps to locate health behaviours , with a potential to better understand environmental influences . for example , gps units have been used to track travel patterns among adolescents [ 27 , 28 ] , analyze walking among adults , analyze bicycling routes in relation to existing road infrastructures , mobility patterns among older adults [ 31 , 32 ] , link mobility with mental health outcomes [ 33 , 34 ] , analyze active transportation [ 3537 ] or relations between pa , and the built environment [ 38 , 39 ] . gps data have also been used to validate parent - reported questionnaires on children 's activity locations , with results showing significant place misclassifications in parent - reported activity locations and times , thus underscoring the usefulness of gps systems for obtaining reliable information on activities and locations . along that line , novel map - based questionnaires also allow the collection of regular destinations for improved exposure assessment and may be used in place of or in complement to gps tracking . yet recently , a clinical cardiac rehabilitation intervention used a wearable electrocardiogram ( ekg ) , a gps receiver , and a smartphone for real - time data transmission to monitor walking - based exercise sessions in real - time . participants showed statistically significant improvements in walking distance , depression , and the physical component of the sf36 general health questionnaire . use of wearable sensors was however limited to short periods exercise times and on adult patients only . further research will need to explore how gps- and complementary sensor based spatio - behavioural indicators such as those proposed here are associated to cardiometabolic profiles . measures of accessibility to food sources or opportunities for physical activity in proximity to regular destinations could further serve to analyse actual health behaviour and cardiometabolic profile . challenges in mobile health arise along the three phases of what can be seen as a three - tier continuum going from data capture to data processing to data usage . beyond measurement validity issues , challenges in data capture include practical considerations such as relatively short continuous sensing time linked to poor battery capacities , particularly for gps ; difficulty of manipulation ; a relatively poor integration of sensors generally implying to wear several distinct devices ; and a relative lack of integrated communication protocols which limits linkage between sensors or between sensors and cellphone networks , which limits real - time tracking and feedback to the user . in order to address some of these issues , team members have developed a novel integrated multisensor device containing a gps module , a triaxial accelerometer , and two means of communication : a gprs module for cellphone network data transmission and an ant+ module for local 2.4 ghz data transmission , which allows addition of external sensors such as accelerometers or continuous glucose monitors , or home - based sensors such as rfid tags . real - time data transmission capacities allow distant patient monitoring , or feedback through web or mobile applications . whereas increasing ubiquity of smartphones which provide a series of embedded sensors may represent an important potential in the future [ 43 , 44 ] . yet , various issues including relatively poor battery life or unknown validity of embedded sensors in addition to continuous updates of new hardware / software configurations clearly limit current applicability in clinical settings . data processing is key because continuous monitoring generates large amounts of raw data , which need to be transformed and synthesized to be useful , both for the patient and the clinician . for example , there is a need for clear documentation of how raw gps data is transformed into spatio - temporal indicators , how raw accelerometry data is transformed into energy estimates . physical activity estimates should not be based on undocumented procedures providing proprietary counts of physical activity . more research and documentation in the creation of useful spatial / behavioural / physiological indicators is needed and will require multidisciplinary perspectives including contributions from nonhealth fields such as geography , computer science , or engineering . to support increasing real - time data streams coming from a variety of sensors , novel sound and secure cloud architectures will help move toward big real - time data which in turn will then support the development of advanced machine learning algorithms for improved performance . among the applications of such systems , feedback loops to the user can not only improve health management but also further data collection for example , using web or mobile based prompted recall applications [ 4547 ] . further research should evaluate patients ' and physicians ' perception and usage of such tools and methods and better assess how sensor - based information is best put at use . caution is required , because although the potential is promising , both across age groups and across health domains , unintended harmful consequences can arise . yet , because such development require large ranges of expertise , research funding schemes also need to be able to support interdisciplinary teams reaching beyond the sole domain of population health or clinical research , to computer science and engineering .

the vacuum sealing drainage ( vsd ) technique is a therapeutic concept to achieve secure and rapid wound healing in traumatic soft wound and chronic infections . its use is widespread among the surgical specialties , many of which employ negative - pressure wound therapy to varying degrees as part of their armamentarium against challenging wounds . the tubes are either drawn transcutaneously through the tissue or placed epicutaneously , depending on the condition of the wound . the wound including the adjacent skin and the drainage tubes is covered by a transparent vapor transmitting polyurethane film . when the drainage tubes are connected with a vacuum bottle , anatomically difficult body regions such as buttocks and perianal infection , it is still questionable whether these dressings have similar beneficial effects . in this case a 58-year - old man suffered from a severe buttocks and perianal infection after injection ( fig . he was admitted to our emergency department after a failure conservative treatment of another hospital . he had a little bit fever ( 38.5 c , 101.3f ) , the wbc was 12 10/l with a normal ecg . a colostomy was applied first to prevent defecation and keep the perianal region clean . after the tissue culture was taken , 3 ) , the drainage tubes became obstructed by a substantial amount of waste ( fig . the infection was controlled 9 days after the first surgery by prompt surgical debridement , the application of vsd treatment , and the use of narrow - spectrum antibiotics based on tissue culture result . finally , granulation tissues on the buttock surface grew well and grafted skin was conducted to close the wound ( fig . four days after the second surgery . after 3 applications of vacuum sealing drainage ( vsd ) treatment , granulation tissues on the wound surface grew well and free dermatoplasty was conducted to close the wound . after 8 weeks , the skin graft had completely survived and the wound had healed well . the colon was sent back to abdominal cavity . a 58-year - old man suffered from a severe buttocks and perianal infection after injection ( fig . he was admitted to our emergency department after a failure conservative treatment of another hospital . he had a little bit fever ( 38.5 c , 101.3f ) , the wbc was 12 10/l with a normal ecg . a colostomy was applied first to prevent defecation and keep the perianal region clean . after the tissue culture was taken , 3 ) , the drainage tubes became obstructed by a substantial amount of waste ( fig . the infection was controlled 9 days after the first surgery by prompt surgical debridement , the application of vsd treatment , and the use of narrow - spectrum antibiotics based on tissue culture result . finally , granulation tissues on the buttock surface grew well and grafted skin was conducted to close the wound ( fig . four days after the second surgery . after 3 applications of vacuum sealing drainage ( vsd ) treatment , granulation tissues on the wound surface grew well and free dermatoplasty was conducted to close the wound . after 8 weeks , the skin graft had completely survived and the wound had healed well . the colon was sent back to abdominal cavity . we found that injection leading to such severe buttocks and perianal infection has never been reported . the management of the perineal skin graft wound is complex , because it has an irregular skin surface and is close to the urethra anteriorly and the anus posteriorly , which can easily contaminate the wound . the vsd technique has been widely used for treating various types of wound surfaces and deep wounds , such as soft tissue in the foot , prosthetic infections , and large - area skin defects , but there are no reports on severe buttocks and perianal infections . the vsd technique combined with a colostomy showed an advantage to treat severe buttocks and perianal infections . first , it is close to the urethra anteriorly and the anus posteriorly , which can easily be contaminated . second , the perineum is irregular . finally , the perineum is too mobile to fix the wound dressing . it has been found to be useful in the treatment of various types of wound surfaces . recently , wu et al have reported the first use of vsd as a convenient and effective alternative to manage the complications of extensive polyacrylamide hydrogel ( paag ) migration after breast augmentation . the mechanism of vsd for prompting granulation growth and accelerating wound healing has been proven at the cellular level . vac therapy is also an excellent alternative for managing complicated wounds after head and neck reconstruction . it has been proven to be safe and comfortable for the patient and provides good results regarding infection control , dead space obliteration , and improvement of wound healing . perianal infections are difficult to treat because of the fecal contamination and the anatomical characteristics . in our study , vacuum - based therapy appears to be safe , effective , and convenient for the patient and nursing staff and allows for less frequent dressing changes .

prematurity is a particularly significant risk factor for survival of the neonate and is associated with increased perinatal mortality . the prognosis of low birth weight ( lbw ) infants has been improved drastically with advances in perinatal medicine . more than 80% of infants survive delivery at 24 weeks of gestation in many perinatal centers in japan . interest has now turned to improvement of the intact survival rate of extremely low birth weight ( elbw ) infants . to save the lives of elbw infants , particularly those born at 22 - 23 gestational weeks , it has been well known that antenatal steroid administration improves the prognosis as well as survival , whereas vaginal delivery in nonvertex presentation is an adverse factor [ 35 ] . however , indication of cesarean section in extremely preterm infants less than 24 weeks is a matter of wide debate . this debate is also of great importance in japan . to reach a conclusion , a nationwide survey in japan the world health report 2005 stated that the neonatal mortality rate within 28 days was 1.8 per 1000 live births in japan , which was the next best data after singapore ( 1.1 per 1000 ) . it meant that medical care and treatment for neonates in japan was the highest level in the world . consequently , analysis of the risk factors for mortality in elbw infants in japan will shed light on critical problems found during the perinatal period . the purpose of this study was to clarify the survival rates in elbw infants in japan , to reveal the effect of perinatal events on the survival of elbw infants , and to identify risk factors associated with survival rates in perinatal centers in japan . the study protocol was reviewed and approved by the ethics committee of tokyo women 's medical university . data were collected from 92,630 live births in 2001 and 2002 in the japan perinatal registry network database , which was managed by japan society of obstetrics and gynecology . it includes all live births and stillbirths at 125 medical centers in japan in 2001 and at 133 medical centers in 2002 , including almost all level iii hospitals . we restricted our analysis to women who delivered a single live infant at 22 or more weeks . the obstetric notes on the mothers were reviewed by a researcher unaware of the children 's outcome . the pregestational factors were age , smoking habit , prenatal care , and the maternal medical history ( complications , family history , and history of the relevant current pregnancy ) . the prenatal events were the presence of vascular disease , polyhydramnios , urogenital infection , and preeclampsia / superimposed preeclampsia . details of the diagnosis , onset , duration , and clinical management of any relevant condition were also recorded . elbw infant was defined as that born weighing less than 1,000 g , and very low birth weight ( vlbw ) infant was defined as less than 1,500 g. a total of 1,713 elbw infants born at 2236 weeks of gestation were registered in 2001 and 2002 . the other cases , that is , survival at discharge , were used as controls . the relevant variables were compared between the cases ( n = 366 ) and the controls ( n = 1 , 347 ) . this study covered 35.7% of all elbw live births in japan , including 2,382 and 2,421 cases in 2001 and 2002 , respectively . clinical chorioamnionitis was defined as a maternal temperature more than 38c and at least one of the following four criteria : maternal tachycardia more than 100 bpm / min , uterine tenderness , white blood cell count more than 15,000 , and foul smelling vaginal discharge . fetal growth restriction ( fgr ) was defined as that with estimated weight less than 10th percentile . oligohydramnios was diagnosed when the amniotic fluid index ( afi ) was 8.0 or less or maximal fluid volume was 2.0 or less . nonreassuring fetal status ( nrfs ) was defined as case with one or more of the following abnormal fetal heart rate patterns , including loss of fetal heart rate variability , recurrent late decelerations , recurrent severe variable decelerations , prolonged deceleration , or baseline fetal heart rate less than 120 beats per minute ( bpm ) or more than 160 bpm . statistical analyses were performed using sas 9.1 ( sas institute , cary , nc , usa ) . our choice of risk factors for inclusion in the regression model was based on the results of univariable analysis . a relative risk with 95% confidence intervals ( ci ) was derived from these models to quantify the association between the causative determinant and obstetric complications . statistical analysis was carried out using the chi - square test , fisher 's exact probability test , and wilcoxon signed - rank test . odds ratios ( or ) with 95% ci were calculated to estimate the relative risk between the case and the control subjects with regard to the risk factors for neonatal death . survival rates according to birth weight or gestational weeks at delivery in cesarean delivery and in vaginal delivery were analyzed . a comparison of the clinical characteristics in the death and survival groups is shown in table 2 . the risk factors rate of nonvertex presentation ( 48.1% ) , rate of vaginal delivery ( 63.9% ) , and incident rate of placental abruption ( 10.1% ) were significantly higher in the death group as compared with the survival group . however , the risk factors rate of nonreassuring fetal status ( 30.9% ) , rate of premature rupture of the membranes ( 21.3% ) , rate of antenatal steroid administration ( 7.1% ) , birth weight ( 631.3 152.3 g ) , gestational weeks at delivery ( 26.0 2.7 ) , and apgar score at 5 minutes ( 1.8 2.8 ) were significantly lower in the death group as compared with the survival group . in terms of the prevalence of maternal complications , such as placental abruption , placental previa , oligohydramnios , clinical chorioamnionitis , and fgr , cesarean sections were indicated for nonreassuring fetal status , nonvertex presentation , and previous hysterotomy . the total survival rate was 76.2% ( 366 versus 1,347 ) . survival rates by birth weight and by delivery method ( vaginal or cesarean ) are shown in figure 1 . cesarean delivery showed a significantly higher survival rate at all birth weight levels as compared with vaginal delivery . survival rates by birth weight at each gestational week of delivery from 22 weeks to 31 weeks are presented in figure 2 . cesarean delivery showed significantly higher survival rates at 24 and 31 gestational weeks of delivery as compared with vaginal delivery , but there were no differences at 22 and 23 weeks . survival rates according to delivery mode in nonvertex presentation of appropriate - for - date infants are shown in figure 3 . according to multiple regression analysis , nonvertex presentation ( or : 1.86 , 95% ci [ 1.25 , 2.76 ] ) , vaginal delivery ( or : 1.58 , [ 1.04 , 2.40 ] ) , and placental abruption ( or : 2.12 , [ 1.06 , 4.22 ] ) were found to be significantly associated with neonatal death . however , the significant contributing factors for survival were antenatal steroid ( or : 0.41 , [ 0.22 , 0.75 ] ) , apgar score at 5 minutes ( or : 0.56 , [ 0.52 , 0.61 ] ) , and birth weight ( or : 0.996 , [ 0.995 , 0.998 ] ) . the probability of survival of premature infants often depends on prematurity such as gestational age and birth weight . however , many other factors are also at work such as race , level of neonatal care [ 1 , 10 ] , and presence of malformation . in addition , this study was limited to data from asians , who are considered to have the highest survival rates . moreover , the quality of neonatal care in japan is high , with it being known to have the lowest neonatal mortality rate among countries included in the who database . the present study includes data from all level iii hospitals in japan , where the quality of neonatal care is presumed to be the highest . consequently , the results may more faithfully reflect factors that affect causes of mortality attributable to prematurity such as gestational age and birth weight . in reports published to date , survival rate and mortality rate have been investigated by week of gestation and by birth weight level , but vlbw infants have been included in the investigations when determining risk factors . the cases in this study were limited to elbw infants with a birth weight of less than 1,000 g. as a result , effects related to survival of vlbw infants weighing 1,000 g or more have been excluded . we concluded that this would allow us to derive certain important results from the standpoint of coming up with measures to take when encountering this limit of viability . it is assumed that the results of this study will serve as the answer to prematurity . that is , it is hoped that the present study will shed light on the current limit of viability . the results of this study show that the overall survival rate in elbw infants weighing 400500 g is about 40% , and that in those weighing 500600 g it exceeds 60% . in terms of week of gestation , the survival rate is 30% at 22 weeks and 60% at 23 weeks , and gestational age and birth weight with a survival rate that already exceeds 50% are 23 weeks and 500 g , respectively . in other words , it can be said that this is the 50% limit of viability . moreover , the survival rate exceeds 80% beginning at 25 weeks of gestation . as shown in figure 1 , the survival rate in infants weighing 400500 g delivered by cesarean section is about 1.8 times that for vaginal delivery or about 55% . however , the results in figure 2 show no advantage for cesarean section at weeks 22 and 23 of gestation , with the difference becoming significant beginning at week 24 . therefore , cesarean section to save the life of the infant may be indicated in infants with an estimated body weight of 400 g or 24 weeks of gestation . lee and gould conducted a large - scale retrospective study of vlbw infants and extraction methods in 2006 . they reported that the survival rate in the caesarean section group improved significantly in infants weighing 500700 g. likewise , malloy retrospectively investigated the prognosis of vlbw infants in 2008 . he reported that cesarean section at 2225 weeks increased the survival rate of the infants . reported that the overall mortality rate of infants did not improve significantly despite an increase in the number of cesarean sections over time , and they concluded that the use of cesarean section for premature infants should be questioned . however , the results of their investigations have demonstrated that the mortality rate is significantly lower in the caesarean section group when delivery is at 22 to 26 weeks of gestation . the problem becomes complicated if the long - term prognosis and neurological prognosis of neonates are considered , but if we limit the discussion to the short - term prognosis of neonates , the present study showed that cesarean delivery offered a clear advantage beginning at 24 weeks of gestation or a birth weight of 400 g. the present study did not shed light on the reason why cesarean section was beneficial to infants 24 weeks of gestation or weighing 400 g. however , it is presumed that vaginal delivery can be harmful to infants weighing less than 1000 g. in terms of the incidence of maternal illness in the survival group and death group , the frequency of nonvertex presentation , vaginal delivery , and placental abruption [ 14 , 18 ] , which can generally be risk factors , was also significantly high in this study in the death group . however , it is very interesting that the occurrence of preterm rupture of membranes ( prom ) and nonreassuring fetal status ( nrfs ) was significantly high in the survival group . this result might be more a problem in terms of care in the perinatal period . earlier termination might have been chosen upon consideration of the fact that nrfs is a sign of placental factor and preterm prom is a sign of intrauterine infection . this is supported by the results of multivariable analysis . in other words , while the odds ratios of nonvertex presentation , vaginal delivery , and placental abruption , which were determined to be poor prognostic factors in the survival group , all increased significantly and were greater than 1 according to the results of multivariable analysis , the odds ratios for nrfs and preterm prom were not significant , but they were below 1 and were determined not to be risk factors . as reported by other researchers , antenatal corticosteroid administration reliably increases the viability of infants [ 2 , 19 ] . there are not likely any who would voice a dissenting opinion to this . on the other hand , the occurrence of pregnancy induced hypertension ( pih ) , which is often seen in other reports [ 20 , 21 ] , was hardly seen at all and was not a risk factor . this was probably because the cases included in the present study were infants delivered in the second trimester , that is , weeks 26 - 27 of gestation , unlike other reports to date , because this study was limited to elbw infants weighing less than 1,000 g. pih generally occurs at weeks 3234 of gestation . about 95% of the cases in this study , however , were less than week 32 of gestation , likely explaining why pih was not a risk factor . the odds ratio was high , that is , 1.91 , according to univariable analysis , and the odds ratio was also high , that is , 2.50 , according to multivariable analysis . signs of separation of the placenta , such as placental abruption and severe hemorrhage at parturition , have been identified as risk factors in reports published to date [ 14 , 18 , 21 ] . they reported that an acute process , for example , intrauterine infection , and a chronic process associated with fetal growth restriction and pih acted alone or together to cause placental abruption . in their investigation of placental abruption at 2036 weeks , was found to be four times more frequent than overall . in terms of the timing of onset of placental abruption , onset at week 24 of gestation was the most frequent ( 6% ) of the entire gestational period , and they found that the occurrence of placental abruption associated with an acute process was about 10 times more frequent as compared with full - term pregnancy . in addition , they found that prom was a risk factor for acute placental abruption . the results of our present study showed that there was no difference in the incidence of fetal growth restriction and pih , suggesting that the principal cause of placental abruption was an acute process , not a chronic process . therefore , it is important to pay adequate attention to onset of placental abruption during delivery of elbw infants . since intrauterine infection markers allow detection of intrauterine infection before chorioamnionitis becomes clinically evident [ 2325 ] , it might be wise to consider them during delivery of elbw infants . however , further studies on which delivery method to select when intrauterine infection is suspected are needed . there are some limitations with respect to the accuracy or the depth in the clinical information due to the nature of a retrospective case - control study . we are convinced of the need for further study by means of a well - organized and prospectively planned study . in conclusion , in the present study , in which we did our best to remove risk factors other than those related to prematurity that affect the viability of premature infants , elbw infants with a 50% survival rate were those at week 23 of gestation or with a birth weight of 500 g , and the present results suggested that cesarean section might improve viability beginning at week 24 of gestation or a birth weight of 400 g. since nonvertex presentation , vaginal delivery , and placental abruption are poor prognostic factors in neonates , when performing vaginal delivery of elbw infants at week 24 of gestation or later or with an estimated body weight of 400 g , it should be contingent on a vertex delivery , and measures may need to be taken to prevent placental abruption due to intrauterine infection .

porphyrins , corroles , phthalocyanines , and other polypyrrole derivatives display rich photophysical and redox properties that distinguish these platforms for applications that include solar light harvesting , electrogenerated chemiluminescence , and photocatalysis . additionally , tetrapyrrole macrocycles , such as porphyrinogens and related complexes that contain sp hybridized meso - carbons , can support an intriguing supramolecular chemistry with anions and multielectron redox properties that can enable energy conversion processes . the lack of -conjugation between the pyrrole units of such architectures , however , curtails the ability of these systems to absorb visible light . the 5,5-dimethylphlorin ( 3h(phl ) ) is a recently developed tetrapyrrole macrocycle in which only one meso - carbon is sp hybridized . much like the porphyrinogen , phlorins also support a multielectron redox chemistry and can be reversibly oxidized by up to three electrons . since -conjugation is maintained about the entire periphery of the phlorin framework , these systems also display excellent photophysical properties with broad absorbance profiles that span the entire uv vis spectrum . moreover , because of the nonplanar geometry of the phlorin macrocycle , which is imposed by the single sp hybridized meso - carbon on the poprhyrinoid s periphery , these platforms can form robust hydrogen - bonded assemblies with fluoride . since the phlorin is a strongly absorbing redox active chromophore , the supramolecular association of f with the n h groups of this macrocycle provides a means to tune both the photophysical and electrochemical properties of these unusual porphyrinoids . although the phlorin s intriguing physical properties and supramolecular capabilities have started to be uncovered , the underlying factors that drive the unusual electronic structure and compelling anion binding chemistry of this architecture have remained undefined . previous work has shown that phlorin constructs can strongly bind two equivalents of fluoride via an allosteric / cooperative process , but do not associate with less basic halides ( i.e. , cl and br ) to even a minimal extent . hydrogen - bonding of fluoride to the phlorin n h residues is accompanied by dramatic perturbations to the phlorin absorption profile , making this porphyrinoid an excellent candidate for colorimetric fluoride sensing ; however , the factors that drive the phlorin s exceptional selectively for fluoride remain unknown . moreover , the capacity of the phlorin macrocycle to form supramolecular assemblies with nonhalide based anions has not previously been documented . in confronting the limitations in our understanding of the phlorin s properties , we have made use of density functional theory ( dft ) calculations in combination with photophysical experiments to help unravel the unusual electronic structure of this little studied porphyrinoid . moreover , we show for the first time that the 5,5-dimethylphlorin platform can serve as a molecular receptor not only for fluoride but also for sufficiently electron - rich carboxylate anions . in addition to showing that phlorins can access a supramolecular chemistry that is unavailable to more typical porphyrinoids , we have also taken advantage of this carboxylate binding chemistry to help unmask the factors that drive effective anion recognition by the phlorin macrocycle . reactions were performed in oven - dried round - bottomed flasks unless otherwise noted . reactions that required an inert atmosphere were conducted under a positive pressure of n2 using flasks fitted with suba - seal rubber septa or in a nitrogen filled glovebox . air and moisture sensitive reagents were transferred using standard syringe or cannula techniques . reagents and solvents were purchased from sigma - aldrich , acros , fisher , strem , or cambridge isotopes laboratories . solvents for synthesis were of reagent grade or better and were dried by passage through activated alumina and then stored over 4 molecular sieves prior to use . column chromatography was preformed with 4063 m silica gel with the eluent reported in parentheses . analytical thin - layer chromatography ( tlc ) was performed on precoated glass plates and visualized by uv or by staining with kmno4 . h and c nuclear magnetic resonance ( nmr ) spectra were recorded at 25 c on a bruker 400 mhz spectrometer . proton spectra are referenced to the residual proton resonance of the deuterated solvent ( cdcl3 = 7.26 ) , and carbon spectra are referenced to the carbon resonances of the solvent ( cdcl3 = 77.16 ) . all chemical shifts are reported using the standard notation in parts - per - million ; positive chemical shifts are to higher frequency from the given reference . low - resolution gas chromatography mass spectroscopy ( lr - gcms ) data were obtained using an agilent gas chromatograph consisting of a 6850 series gc system equipped with a 5973 network mass selective detector . low resolution ms data was obtained using either a lcq advantage from thermofinnigan or a shimadzu lc / ms-2020 single quadrupole ms coupled with an high - performance liquid chromatography ( hplc ) system , with dual esi / apci source . high - resolution mass spectrometry analyses were either performed by the mass spectrometry laboratory in the department of chemistry and biochemistry at the university of delaware . vis spectrometer using screw cap quartz cuvettes ( 7q ) of 1 cm path length from starna . all samples for spectroscopic analysis were prepared in dry solvent within a n2 filled glovebox . tetrabutylammonium fluoride ( tbaf ) titrations were conducted by placing 2.0 ml of 10 m solutions of 3h(phl ) into a screw cap quartz cuvette . following the recording of an initial uv vis absorbance spectrum , 10 l aliquots of a 0.25 mm solution of tbaf and phlorin ( 10 m ) were added to the cuvette and changes in the uv vis profile were monitored . since the aliquots were all 10 m in 3h(phl ) , the concentration of phlorin did not change over the course of the experiment , which significantly simplifies analysis of the titration data . job analysis for fluoride binding to 3h(phl ) was carried out using solutions containing 10 m of total analyte ( tbaf + 3h(phl ) ) . the ratio of 3h(phl ) to fluoride was systematically varied by combining the appropriately sized aliquots of 10 m stock solutions of tbaf and phlorin . titrations and job analyses conducted for binding of 3h(phl ) to carboxylate salts were carried out using analogous methods . spectra were recorded on an automated photon technology international ( pti ) quantamaster 40 fluorometer equipped with a 75 w xenon arc lamp , a lps-220b lamp power supply , and a hamamatsu r2658 photomultiplier tube . samples for fluorescence analysis were prepared in an analogous method to that described above for the preparation of samples for uv vis spectroscopy . samples of 3h(phl ) were excited at = 650 nm and emission was monitored from 680850 nm with a step size of 0.5 nm and integration time of 0.25 s. reported spectra are the average of at least three individual acquisitions . emission quantum yields were calculated using nile blue in ethanol ( ref = 0.27 ) as the reference actinometer using the expression below , where em and ref are the emission quantum yield of the sample and the reference , respectively , aref and aem are the measured absorbance of the reference and sample at the excitation wavelength , respectively , iref and iem are the integrated emission intensities of the reference and sample , respectively , and ref and em are the refractive indices of the solvents of the reference and sample , respectively . the experimental setup for picosecond time - correlated single - photon - counting ( tcspc ) measurements has been described in detail previously and only a brief account will be given here . the detection system includes an actively quenched single photon avalanche photodiode ( pdm 50ct module , micro photon devices ) and a tcspc module ( picoharp 300 , picoquant ) . the light source was an optical parametric amplifier pumped by a 250 khz ti : sapphire regenerative amplifier . excitation was at = 650 nm with typically 50 fs ( full width at half - maximum , fwhm ) pulse duration and < 10 nj pulse energy . fluorescence emission was selected by using a 10 nm ( fwhm ) bandpass filter centered at 750 nm ( cvi , f10 - 750.0 - 4 - 1.00 ) , which were chosen according to the peak wavelength of the fluorescence emission spectra . the instrument response function ( irf ) showed a fwhm of 40 ps as recorded at the excitation wavelength using a dilute water suspension of coffee creamer . a 4.0 ps channel time was chosen and typically more than 10,000 counts were collected in the peak channel in order to obtain an acceptable signal - to - noise ratio . the polarization of the excitation beam was set to the magic angle ( 54.7 ) with respect to an emission linear polarizer , which enables us to eliminate any depolarization contribution . quantitative analysis of the time - resolved fluorescence data were performed by employing a least - squares deconvolution fitting algorithm with explicit consideration of the finite irf ( fluofit , picoquant ) , and a reduced chi - squared ( ) value is used to judge the quality of each fit . crystals of 3h(phl ) were mounted using viscous oil onto a plastic mesh and cooled to the data collection temperature . data were collected on a bruker - axs apex ccd diffractometer with graphite - monochromated mo k radiation ( = 0.71073 ) . unit cell parameters were obtained from 36 data frames , 0.3 , from three different sections of the ewald sphere . the systematic absences in the diffraction data are uniquely consistent with the reported space group . the data sets were treated with absorption corrections based on redundant multiscan data . the structures were solved using direct methods and refined with full - matrix , least - squares procedures on f. all non - hydrogen atoms were refined with anisotropic displacement parameters . all density functional calculations were performed using the gaussian 09 ( g09 ) program package , with the becke three - parameter hybrid exchange and lee yang all geometry optimizations were performed in c1 symmetry with subsequent vibrational frequency analysis to confirm that each stationary point was a minimum on the potential energy surface . a polarizable continuum model was utilized in the geometry optimization to model the solvent effects of the system . the vertical singlet transition energies of the complexes were computed at the time - dependent density functional theory ( tddft ) level in methylene chloride within g09 by using the optimized ground state structure . a new 5,5-dimethylphlorin construct containing pentafluorophenyl substituents at the 10- and 20-positions and a bis - trifluoromethylphenyl substituent at the 15-position was prepared using the modular synthetic methodology shown in scheme 1 . reduction of the diacylated dipyrromethane ( 1 ) with nabh4 in thf / meoh ( 3:1 ) generated the corresponding dicarbinol , which was condensed with 5-(3,5-bis - trifluoromethylphenyl)-dipyrromethane ( 2 ) in the presence of trifluoroacetic acid ( tfa ) . subsequent oxidation with ddq delivered the desired phlorin ( 3h(phl ) ) in 41% yield . the solid - state structure of this compound is shown in figure 1 , with corresponding crystallographic parameters and structural metrics provided in the supporting information . compound 3h(phl ) represents only the second 5,5-dimethylphlorin derivative for which an x - ray diffraction structure has been determined . unlike typical porphyrinoids , the 3h(phl ) h protons on the side of the phlorin containing the 5,5-dimethyl substituents is displaced by 1.3 above the plane approximated by the opposite dipyrrole unit of the macrocycle . this structure is reminiscent of that observed for a homologous phlorin containing pentafluorophenyl groups at all three sp hybridized meso - carbons . solid - state structure of 3h(phl ) shown from ( a ) above the plane of the macrocycle and ( b ) side on . solutions of 3h(phl ) in ch2cl2 are emerald in color and are characterized by the blue uv vis absorption profile shown in figure 2a . in order to gain insight about the nature of the electronic transitions observed for this porphyrinoid , density functional theory ( dft ) and time - dependent dft ( tddft ) calculations were undertaken for 3h(phl ) . these calculations revealed that the dominant transitions involve frontier molecular orbitals with significant electron density across all four pyrroles of the phlorin ( figures 2c and s1 , supporting information ) . these molecular orbitals are reminiscent of those described by gouterman in his standard four orbital model of porphyrin electronic structure , with some distortion due to reduction of symmetry from d4h . calculations showed a notable exception in this regard , as the orbital density of the lumo+1 of 3h(phl ) is not equally distributed about the entire tetrapyrrole framework . instead , the lumo+1 is polarized with increased electron density on the side of the phlorin opposite the sp hybridized meso - carbon . ( a ) ( b ) extent to which solvent polarity perturbs max of the soret and q - bands for 3h(phl ) . ( c ) representation of the molecular orbitals involved in the major soret and q - band transitions . since the lumo+1 shows distinct asymmetry with respect to electron density about the phlorin periphery , we rationalized that the electronic transitions of 3h(phl ) between states that involve the lumo+1 should display charge transfer character and therefore be sensitive to the polarity of the surrounding environment . vis absorbance profiles obtained for 3h(phl ) in a variety of solvents clearly shows that the phlorin displays solvatochroism ( figure 2a ) . since the major transitions at 440 nm involve excited state population of the lumo+1 , changes in the solvent polarity would be expected to perturb the energy of these bands . as shown in figure 2b , as the polarity of the solvent is increased , the soret absorbance shifts from 442 nm in benzene , which has a dielectric constant of = 2.3 to 435 nm in acetonitrile ( = 36.6 ) . the low energy transitions at 665 nm show little variation as a function of solvent polarity ( figure 2b ) since this band is attributable to transitions between states involving the homo and lumo of 3h(phl ) , and these frontier orbitals are not appreciably polarized . additional photophysical measurements recorded for 3h(phl ) revealed that this phlorin is weakly emissive with a fluorescence quantum yield of fl = 5.70 10 and associated excited - state lifetime of fl = 45 ps in deaerated ch2cl2 . both these values are in line with those observed for other electron deficient phlorin derivatives . many polypyrrole platforms display a pronounced supramolecular chemistry via formation of hydrogen bonds between the pyrrole n titration of ch2cl2 solutions of 3h(phl ) with aliquots of tbaf is accompanied by the spectral changes shown in figure s2a , supporting information . well - anchored isosbestic points are maintained during the course of the tbaf titration , suggesting a direct conversion of freebase phlorin to the fluoride bound species . as has been observed for other phlorin architectures , job analysis showed that 3h(phl ) is capable of binding up to two equivalents of f to form 3h(phl)2f ( figure s2b , supporting information ) . moreover , binding of f to this phlorin is highly cooperative , as a hill analysis ( figure s2c , supporting information ) of the titration data produced a well - fit linear regression , which yields a cooperativity constant of 2 = 1.6 10 m in ch2cl2 . binding of f to 3h(phl ) is very strong and persists in polar aprotic solvents . titration of 3h(phl ) in mecn with tbaf leads to similar spectral changes in the visible and near - ir regions to those observed in ch2cl2 ( figure s3a , supporting information ) . while job and hill analyses ( figure s3 , supporting information ) revealed that f binding is cooperative in mecn , the termolecular association constant is reduced to 2 = 6.4 10 m in this more polar solvent . the observation that fluoride binding to 3h(phl ) is still rapid and highly cooperative in a solvent as polar as mecn is notable , as hydrogen - bonding of halides to the pyrrole n h groups of porphyrinoids is typically only observed in less polar solvents such as thf and ch2cl2 . 3h(phl ) does not bind less basic halides such as cl or br . that fluoride is the only halide to associate via hydrogen - bonding to the phlorin n h residues suggesting that the strength of this host guest interaction may be sensitive to the anion s size and/or basicity . in order to shed light on the factors that drive anion association with the phlorin scaffold , we sought a hydrogen - bond acceptor for which the steric properties and acidity could be independently varied . on the basis of the physical structure of 3h(phl ) , we hypothesized that the phlorin would be an excellent receptor for carboxylate anions via formation of a two point hydrogen - bond between the carboxylate oxygen atoms and the pyrrole n h residues on the side of the phlorin bearing the 5,5-dimethyl substituents ( scheme 2 ) . noting that some expanded and reduced polypyrrole macrocycles can bind oxygen anions , we set out to determine if a similar supramolecular chemistry exists for 3h(phl ) . note : the bottom half of 3h(phl ) and the bis - trifluoromethylphenyl substituent at the 15-position of the phlorin macrocycle has been omitted for clarity . a solution of 3h(phl ) in mecn was titrated with tetrabutylammonium acetate ( tbaoac ) , which produced a series of spectral shifts across the uv vis and near - ir regions ( figure 3a ) that are similar to those observed for the tbaf titrations ( vide supra ) . the magnitude and intensity of these spectral shifts are much larger than those observed upon binding of carboxylates and other anions to porphyrinoids bearing protonic functionalities that are conjugated along the periphery of the chromophore -system . ( a ) changes in the uv vis absorbance spectrum of 3h(phl ) upon titration with tbaoac . ( b ) job plot constructed for titration of 3h(phl ) with tbaoac in mecn . in contrast to the fluoride binding experiments described above , job analysis conducted for association of tbaoac to 3h(phl ) showed that the phlorin only binds one equivalent of acetate to form 3h(phl)oac ( figure 3b ) . consistent with this 1:1 binding model , benesi hildebrand fitting of this titration data produced a well - fit linear regression ( figure 3a , inset ) yielding a formation constant of kf = 440 for 3h(phl)oac . these experiments represent the first demonstration that carboxylates can hydrogen - bond to the phlorin architecture . moreover , the observation that 3h(phl)oac forms in a significantly polar solvent such as mecn speaks to the strength of this hydrogen - bonding interaction . the magnitude of the association constant for 3h(phl)oac in mecn is similar to that observed for formation of amidinium - carboxylate hydrogen bonding networks . despite the appreciable formation constant for 3h(phl)oac , we note that binding of acetate to the phlorin n h residues is completely reversible ; the addition of small amounts of polar protic solvents such as meoh to mecn solutions of 3h(phl)oac disrupts these hydrogen - bonded assemblies , as evidenced by reversion of the uv vis profile to that of uncomplexed 3h(phl ) ( figure s4 , supporting information ) . to determine the extent to which the carboxylate anion s size impacts its ability to bind to the phlorin , we repeated the titration experiment shown in figure 3 using 4-dimethylaminobenzoate ( 3 ) as the hydrogen - bond acceptor . this carboxylate is significantly larger than acetate but , as shown in table 1 , has a pka in mecn that is very close in value to its smaller homologue ( pka of oac = 22.3 ; pka of 3 = 23.0 ) . analysis of the binding data obtained upon titration of 3h(phl ) with 3 reveals that the hydrogen - bonded assembly 3h(phl)3 forms with a formation constant of kf = 435 . this titration experiment not only confirms that larger anions can bind to 3h(phl ) but also indicates that carboxylate anions of similar basicity but disparate size bind to the phlorin to near equal extents . these results suggest that the larger halides such as cl or br should be able to associate with the phlorin based purely on sterics and that the lack of hydrogen - bonding observed for halides larger than f is due to the decreased basicity of these anions ( pka values for hf , hcl , and hbr in aprotic polar solvent are 15 , 1.8 , and 0.9 , respectively ) . pka values correspond to the conjugate acid of the anions listed and are reported in mecn as reproduced from ref ( 64 ) . the effect that anion basicity holds for formation of supramolecular phlorin assemblies was further probed by screening the ability of other carboxylates to hydrogen - bond to the pyrrole n h residues of 3h(phl ) . in addition to 4-dimethylaminobenzoate ( 3 ) , we surveyed the tba salts of benzoate ( 4 ) , 4-bromobenzoate ( 5 ) , and 4-nitrobenzoate ( 6 ) . vis spectral shifts observed upon association of these anions with 3h(phl ) showed that each of the carboxylates form 1:1 adducts with the phlorin macrocycle . table 1 summarizes the formation constants ( kf ) for the corresponding 1:1 hydrogen - bonded 3h(phl ) assemblies in mecn , along with the corresponding pka values for each of the carboxylates studied . this data clearly shows that the stability of the hydrogen bonded adducts is well correlated with the basicity of the carboxylate anions . we note that carboxylates that are more acidic than 4-nitrobenzoate do not form supramolecular assemblies with 3h(phl ) in mecn . for instance , the addition of up to 3500 equiv of tetrabutylammonium 3,5-dinitrobenzoate ( pka = 17.0 in mecn ) to a solution of phlorin did not alter the absorption spectrum of the mecn solution . although it is possible that steric interaction between the anion guest and phlorin macrocycle also impact formation of the supramolecular assemblies described above , we note that the addition of small , weakly coordinating anions such as methanesulfonate , perchlorate , or nitrate to mecn solutions of 3h(phl ) does not result in formation of hydrogen - bonded assemblies as judged by uv vis spectroscopy . phlorins display a rich redox chemistry , which can also be tuned via hydrogen - bonding of anions to the phlorin core . differential pulse voltammetry ( dpv ) was utilized to study the redox behavior of 3h(phl ) as this electrochemical technique offers higher sensitivity than more conventional cyclic voltammetry measurements for analysis of samples with low analyte concentrations . dpv experiments recorded for a 1.0 mm solution of 3h(phl ) in mecn containing 0.1 m tbapf6 showed that this porphyrinoid can be oxidized by up to three electrons . the dpv trace recorded for this phlorin ( figure 4 , blue trace ) shows oxidation waves at eox(1 ) = 0.42 v , eox(2 ) = 0.67 v , and eox(3 ) = 0.79 v versus ag / agcl . these values are in line with those observed for other electron deficient phlorins . just as hydrogen - bonding to the n h groups of 3h(phl ) perturbs the phorin spectral properties , the addition of either f or oac to an mecn solution of 3h(phl ) dramatically alters the phlorin redox properties . formation of the f and oac bound adducts ( 3h(phl)2f and 3h(phl)oac , respectively ) shifts all three phlorin oxidation waves to less positive potentials , which is expected upon going from the neutral phlorin to the negatively charged fluoride and acetate adducts . this potential shift is also consistent with raising the energy of the phlorin homo and is mirrored by the bathochromic shift observed for in the uv vis absorbance spectrum upon binding of anions to 3h(phl ) ( vide supra ) . in contrast to the electrochemical response observed upon binding of f to phlorins in ch2cl2 , association of f or oac with 3h(phl ) in mecn causes the first and second oxidation waves to coalesce into a two electron wave ( eox = 0.14 and 0.13 v for 3h(phl)2f and 3h(phl)oac , respectively ) . both these supramolecular assemblies can also be oxidized by a third electron at 0.28 v. differential pulse voltammetry ( dpv ) traces recorded for 3h(phl ) ( blue ) , 3h(phl)2f ( red ) , and 3h(phl)oac ( green ) in mecn containing 0.1 m tbapf6 . in summary , we have prepared a new 5,5-dimethylphlorin porphyrinoid . unlike conventional porphyrins , this phlorin is significantly distorted from planarity and displays solvatochroism in the soret region due to the polarized nature of the frontier orbital ( lumo+1 ) involved in the major electronic transitions clustered around 370420 nm . compound 3h(phl ) displays an intriguing supramolecular chemistry with sufficiently basic anions , as this phlorin can cooperatively hydrogen - bond to two equivalents of f to form 3h(phl)2f . binding of fluoride to the n h residues of 3h(phl ) is manifest in significant perturbation to the phlorin s electronic structure and drives significant changes to the phlorin s photophysical and redox properties . although 3h(phl ) is a selective receptor for fluoride over larger halides ( i.e. , cl and br ) , this porphyrinoid does support a robust supramolecular chemistry with other anions . in this work , we have demonstrated , for the first time , that the phlorin framework is capable of binding carboxylate anions . unlike the stoichiometry observed for the fluoride binding experiments , 3h(phl ) can reversibly hydrogen - bond to one equivalent of a suitably basic carboxylate . although the binding of carboxylates to the phlorin framework is not cooperative , it is difficult to make direct comparisons between these two supramolecular phenomena . nonetheless , distinct similarities observed upon association of carboxylates to the phlorin core , as formation of supramolecular assemblies such as 3h(phl)oac is manifest in comparable shifts to the phlorin uv vis absorbance and redox properties to those observed upon fluoride binding . association of fluoride and/or carboxylates with 3h(phl ) is observed in relatively polar solvents such as mecn , which attests to the strength of the hydrogen - bonding interactions that drive formation of these supramolecular assemblies . the ability to independently vary the size and pka of a series of carboxylates has also allowed us to probe how phlorin - anion association is influenced by the anion s size and/or basicity . by assessing the extent to which a series of carboxylates form hydrogen - bonded assemblies with the phlorin , we have demonstrated that only carboxylates that are more electron - rich than 4-nitrobenzoate form supramolecular assemblies with 3h(phl ) to an appreciable extent in mecn . furthermore , small anion guests such as nitrite and mesylate , which should be able to bind to the phlorin n h residues based soley on steric constraints , do not form supramolecular assemblies with 3h(phl ) as judged by uv vis spectroscopy . further , these experiments clearly show that carboxylate guests of similar basicity but disparate size bind to the phlorin host with near identical association constants . when taken together , these results suggest that the phlorin can selectively recognize fluoride over other halogens due to the dramatic drop in pka of the hydrohalic acids as one descends group 17 of the periodic table . the improved understanding of the factors that control hydrogen - bonding and anion recognition by the phlorin platform , which has been garnered by these studies , should aid the development of new detection schemes for fluoride and other sufficiently basic anions .

third molars have a high incidence of impaction and are associated with conditions such as pericoronitis , caries on the distal surface of the second molar , pain , external root resorption , and odontogenic cysts or tumors1 , which often necessitate their surgical removal . the surgical removal of impacted mandibular third molars is often associated with inferior alveolar nerve ( ian ) damage , the incidence of which is reported to be 0.4%-8.4%2,3,4,5 . to protect the nerve from mechanical injury during surgery , it is important to clearly assess the relative positions of the nerve and the root tip preoperatively3 . the complete radiographic assessment of impacted mandibular third molars includes morphology , its approximation to the ian canal and its bucco - lingual position . the most commonly used radiographic methods are intraoral periapical radiography ( iopar ) and panoramic radiography ( orthopantomography , opg ) . these methods depict the ian canal using superio - inferior and anterio - posterior relationships , but the bucco - lingual relationship or depth can not be assessed . computed tomography ( ct ) and cone - beam ct ( cbct ) are excellent methods for localizing the ian canal and its relationship to the lower third molar roots . however , owing to the cost , limited availability and radiation dose , cbct is usually not the first radiographic technique of choice for a preoperative radiographic evaluation of lower impacted third molars7 . localization techniques using conventional radiography can be used to assess the bucco - lingual dimension . jaju8 and morant et al.9 stressed the importance of assessing the relationship of the ian canal to the third molar root apex buccolingually8,9,10 . they suggested the use of richard 's vertical tube shift technique for localizing the ian canal to the third molar root apex . the vertical tube - shift method uses two iopars taken at different vertical angulations to delineate the buccolingual relationship of the ian canal to the mandibular third molar root apices . the purpose of this study was to validate the vertical tube - shift method in determining the relationship between the impacted mandibular third molar roots and the ian canal . the preoperative iopars taken at 0 and -20 angulations and cbct images of 50 impacted mandibular third molars of patients visiting the department of oral medicine and radiology from december 2012 to july 2014 , the oxford dental college ( bangalore , india ) were selected for the study . ethical clearance was granted from the oxford dental college ' s institutional review committee , and informed consent was obtained from all patients willing to participate in the present study . the inclusion criteria were 0-degree iopars of patients showing any one of the following signs of a close relationship of the mandibular third molar root to the ian canal : ( 1 ) darkening of the root , ( 2 ) narrowing of the ian canal , ( 3 ) diversion of the ian canal , or ( 4 ) interruption of the superior cortical line of the ian canal . patients not showing any close relationship between impacted mandibular third molar roots and the ian canal on 0-degree iopar and patients with neuromuscular disorders were excluded . two iopars of impacted mandibular third molars were made using richard 's vertical tube - shift method10 . an intraoral dental x - ray machine ( best - x - dc ; toshiba medical system corp . , tokyo , japan ) at 70 kvp , 10 ma , and 0.7 seconds was used along with intraoral kodak ultra speed films of size 2 ( 3141 mm ) , e - speed ( kodak h , new york , ny , usa ) . if any sign of a close relationship to the ian canal was observed , a second iopar was taken by directing the position - indicating device at a vertical angulation of -20. the processed radiographs were traced on the tracing paper . the relationship of the ian canal to an impacted mandibular third molar as determined by vertical tube - shift method was recorded as follows : ( 1 ) buccal , if the ian canal appeared to move upwards in relation to the root apex of the impacted mandibular third molar in the iopar taken at -20 vertical angulations as compared to iopar taken at 0 vertical angulations.(fig . a ) ; ( 2 ) lingual , if the ian canal appeared to move downwards in relation to the root apex of the impacted mandibular third molar in iopar taken at -20 vertical angulations as compared to iopar taken at 0 vertical angulations.(fig . a ) ; ( 3 ) in line with the apex , if no change was observed in the ian canal position in relation to the root apex of the impacted mandibular third molar in iopar taken at -20 vertical angulations as compared to iopar taken at 0 vertical angulations.(fig . a ) cbct examination ( cs 9300 ; kodak carestream , atlanta , ga , usa ) was performed with 90 kvp , 10 ma , 20 seconds as exposure parameters , and cross - sectional images of the mandibular third molar region ( fig . the relationship as determined by the vertical tube - shift method was further compared with the cbct images . sensitivity , specificity , positive predictive value ( ppv ) , and negative predictive value ( npv ) were calculated using cbct as the gold standard . a chi - square test was performed to evaluate the association between iopar localization and the cbct impression results . out of our sample size of 50 cases , 49 cases were considered for statistical analysis and one case was excluded as the patient appeared to have three roots in cbct . the ian canal presented buccal in 35 cases , lingual in four cases , and in line with the apex of the third molar root in 10 cases using the iopar vertical tube - shift method . for cbct , the canal was buccal in 36 cases , lingual in four cases and in line with the apex in nine cases . a chi - square test revealed a statistically significant association between iopar localization and the cbct impression results with a p - value<0.001.(table 1 ) the sensitivity , specificity , ppv , and npv of the iopar vertical tube - shift method was found to be 94.4% , 92.3% , 97.1% , and 85.7% , respectively , in localizing the ian canal buccal to root apex of the third molar tooth as compared to cbct.(table 2 ) for localizing the ian canal lingual to the root apex of the third molar tooth , the sensitivity , specificity , ppv , and npv of the iopar vertical tube - shift method was 100% compared to cbct.(table 3 ) sensitivity , specificity , ppv , and npv value of the iopar vertical tube - shift method was found to be 88.9% , 95.0% , 80.0% , and 97.4% , respectively , at localizing the ian canal in line with the root apex of the third molar tooth as compared to cbct.(table 4 ) the preoperative assessment of the third molar root apex and the ian canal can be done using conventional radiographs as well as advanced imaging modalities , including cbct and ct . in oral and maxillofacial surgery practice , opg is the most widely used technique for evaluating the lower third molar position and its relationship with the ian canal6 . several clinical studies have determined specific radiographic signs , such as darkening of the root , narrowing or diversion of the ian canal and interruption of the superior cortical line of the ian canal wall , being highly suggestive of the close proximity between the lower third molars and the ian canal1,2,3,6,11,12 . it only provides information regarding the position of the ian canal in the vertical plane . opg has variable magnification , and lingual - positioned structures are projected upward , producing a sharp image layer ( focal trough ) of limited width . moreover , the ian canal is frequently positioned at the periphery of this focal trough , located buccal or lingually2 . on the other hand , cbct provides better three - dimensional images , which show the relationship between the third molar roots and all adjacent structures with a high resolution4 . considering the high cost , limited availability , and higher radiation exposure , cbct is usually not the first radiographic technique of choice for all impacted lower third molars . moreover , not all cbct devices are alike . for example , the variation in resolution might affect the outcomes , and the results with one cbct system can not necessarily be generalized to all cbct systems . heurich et al.13 were able to reconstruct the course of the ian canal exactly with the help of cbct ( new tom , marburg , germany ) in only 75 cases out of 81 cases ( 93% ) before lower third molar extractions . in a study by neugebauer et al.3 the vertical and horizontal position of the root tip of the third molars relative to the ian canal could not be precisely identified in 1% and 2.8% of the cbct examinations , respectively . in another study , 3d accuitomo cbct was reported to give a high sensitivity ( 93% ) with a specificity of 77% in predicting exposure of the neurovascular bundle11 . in comparison with advanced imaging modalities , iopars are readily available at any basic dental set - up and provide excellent image details when performed efficiently . they involve minimum risk of exposure to ionizing radiation and are cost - effective . with the vertical tube - shift method , the precise location of the ian canal with respect to third molar roots can be assessed . no previous studies have validated the vertical tube shift method for establishing the bucco - lingual relationship of the ian canal with respect to the lower third molars . until now , only two studies have assessed the performance of the vertical tube shift method in localizing the ian canal bucco - lingually to third molar root apices . in 2010 , kositbowornchai et al.6 reported the performance of the shift tube method in comparison with cbct in identifying this relationship . the aim was to compare the ability of two radiographic methods : the opg in combination with a -20 angle iopar versus two iopars at 0 and -20. another study was reported by jasa et al.14 in 2014 and evaluated the use of lateral oblique radiography at two different angles ( 0 and -30 ) for the buccolingual topographic localization of the ian canal with respect to the lower third molars . in our study , a buccal relationship of the ian canal to the lower third molar root apex was found to be present in 35 cases by the iopa vertical tube - shift method as compared to 36 cases on cbct . the sensitivity , specificity , ppv , and npv of the vertical tube - shift method for buccal relation was calculated as 94.4% , 92.3% , 97.1% , and 85.7% , respectively . in contrast , the study by kositbowornchai et al.6 reported a much lower sensitivity ( 85.7% ) and specificity ( 38.9% ) , which included only 14 buccal placed ian canals . jasa et al.14 reported similar results as those found in our study , such as sensi tivity ( 91.3% ) , specificity ( 91.7% ) , ppv ( 95.8% ) , and npv ( 85.7% ) . the studies by kositbowornchai et al.6 and jasa et al.14 as well as the present study reported a sensitivity , specificity , ppv , and npv of the vertical tube - shift method as 100% for lingual relationships . these two previous studies had a minimal number of lingual placed ian canals 2 and 3 . even in our study , a lingual placed ian canal was present only in four cases . this small incidence could be because of a lower prevalence of lingual - placed ian canals to the third molar root apex15 . ten cases had an in line with apex relationship of the ian canal to the lower third molar root apex by the iopa vertical tube - shift method as compared to nine cases on cbct . the sensitivity , specificity , ppv , and npv of the vertical localization technique for the in line with apex relation was calculated as 88.9% , 95.0% , 80.0% , and 97.4% , respectively , whereas a 31.3% sensitivity and an 81.3% specificity was reported by kositbowornchai et al.6 as they evaluated 16 in line with apex ian canals in their study . in jasa 's study14 , the sensitivity , specificity , ppv , and npv were reported to be 88.9% , 92.3% , 96.3% , and 81.8% . the difference in results between the present study and kositbowornchai et al.6 could be attributed to the involvement of two observers in their study and also to the images being interpreted twice . in the present study , among buccal and in line with apex relations , the probability of diagnosing the ian canal buccal to the third molar root apex ( i.e. , the sensitivity ) was more than in line with apex . at the same time , the probability of the ian canal not being in line with the apex ( i.e. , specificity ) is 3% more than not being buccal to the third molar root apex . ppv was found to be highest for lingual relation followed by buccal and in line with apex , whereas npv was highest for lingual relation followed by in line with apex and buccal , respectively . therefore , the precision of diagnosing an ian canal as not being in line with the apex requires more than simply not being buccal . for the vertical tube - shift method to be efficient , the change in vertical angulation parameter must be followed . in order to observe the apparent movement of the ian canal in the radiographic image , it is necessary to change the vertical angle sufficiently as the distance between the ian canal and the third molar is less or they might be superimposed . in our study , -20 vertical angulations for iopa were found to be adequate to interpret the images . in contrast , jasa et al.14 stressed that the vertical angle should be changed to a minimum of -30. this desired alteration could be because of the lateral oblique radiograph used in their study , which can be associated with image distortion or magnification . 's study6 commented that a panoramic radiograph with vertical periapical tube shift and two different vertical angulation periapical radiographs provided a high potential for detecting the closeness of the relationship of the third molar root and the ian canal . in contrast , jasa et al.14 stressed that lateral oblique radiographs taken at 0 and -30 may be successfully used to determine the bucco - lingual relationship between the mandibular canal and the lower third molar . the present study showed that the iopa vertical tube - shift method can be relied upon at par with cbct to assess the relationship of the ian canal to the lower third molar root apex . a -20 tube shift is sufficient to apply richard 's technique for localization of the ian canal with the third molar root apex . the present study revealed a highly statistically significant association between the iopa vertical tube - shift method and the cbct results . thus , the vertical tube - shift method is a reliable diagnostic adjunct in determining the relationship of ian to the third molar root apex .

the use of video - laparoscopy has significantly contributed to urgent abdominal surgery , both as a diagnostic method in acute cases and as an alternative , and even preferred , procedure for treating certain diseases.1,2 for many years , the presence of peritonitis was considered to be a significant risk factor for laparoscopy . however , research examining the use of video - laparoscopy in the presence of peritoneal infection has reported favorable clinical results.2,3 the presence of bacteria in the peritoneal cavity and its septic consequences have motivated recent research.4 historically , the concept that bacterial clearance by the diaphragm is a negative rather than a positive prognostic factor was first suggested by the reduced mortality of peritonitis patients who were maintained in a semi - seated position that decreases diaphragmatic contact with peritoneal secretions.5 although this concept has faced opposition,6 it is supported by studies reporting improved survival in animal peritonitis models following procedures designed to prevent bacterial clearance , such as scarification of the diaphragmatic surface and using substances to block the diaphragmatic pores.7 other studies have observed that carbon particles injected into the mouse peritoneum are found in kupffer cells 20 min later , possibly after absorption by the diaphragm and migration through blood and lymphatic transport systems.8 thus , the possible role of the diaphragm in this process has remained unclear . more recent studies have shown that a co2 insufflation - induced pneumoperitoneum increases bacterial ( e. coli ) translocation in rats,9 and others have observed that a co2 pneumoperitoneum is associated with positive - end expiratory pressure and has neither a positive nor a negative impact on the systemic expansion of intra - abdominal e. coli infection.10 despite frequent and progressive clinical utilization of video - laparoscopy in urgent abdominal surgery , certain questions concerning the possible effects of pneumoperitoneum on patients with abdominal infections remain unanswered . it has been argued that the increase in abdominal pressure induced by the pneumoperitoneum could promote greater absorption of bacteria and toxins from the peritoneal cavity , which could increase the risk of septic shock if they enter the bloodstream.11 the distension of the peritoneal cavity produced by pneumoperitoneum causes alterations in diaphragmatic movements , intra - abdominal and intra - thoracic pressures , and respiratory dynamics , and these factors are usually considered to be involved in lymphatic drainage of the peritoneum . however , the true effect of pneumoperitoneum on the diaphragmatic lymphatic drainage system remains unclear . similarly , it is not known whether the combination of controlled ventilation and constant - pressure pneumoperitoneum , which is commonly employed in video - laparoscopic surgeries , increases or decreases the removal of substances from the peritoneal cavity . in many experimental animal studies involving sepsis and pneumoperitoneum , controversy concerning the repercussions of video - surgery in the presence of intra - abdominal infection remains.12 - 15 thus , the objective of this study was to use an experimental rat peritoneal contamination model to evaluate the influence of pneumoperitoneum , both alone and in combination with controlled ventilation , on lymphatic bacterial clearance from the peritoneal cavity . a total of 69 adult male wistar rats , weighing 200 - 300 g , was maintained in the laboratory on ad libitum water and standard diet for less than seven days . all of the animals were anesthetized using intramuscular injections of ketamine ( 100 mg / kg ) and xylazine ( 10 mg / kg ) in the medial face of the thigh , and a 0.5-cm incision was made beneath the umbilical cicatrix to expose the delicate aponeurotic muscle layer . while light traction was maintained on the abdominal wall , a peritoneal puncture was performed with an 18-g teflon catheter - embedded needle . after removing the metallic needle , the peritoneal cavity was inoculated with 1 ml of 10 colony forming units ( cfu)/ml e. coli ( atcc pattern ) solution . the teflon catheter was maintained in all of the groups , with and without pneumoperitoneum , until the end of the experiment . after anesthesia and asepsis , the group a rats were maintained under spontaneous respiration for a period of 30 min , the group b rats were maintained under spontaneous respiration and pneumoperitoneum for a period of 30 min , and the group c rats were intubated and maintained under controlled respiration and pneumoperitoneum for a period of 30 min . instead of the usual tracheotomy , the orotracheal intubation in group c used a technique to produce airways in small animals that was developed specifically for this experiment . to induce less surgical trauma , the laryngoscopy used an optical video - laparoscope with a 5-mm diameter and a 30 angulated lens . the video - laparoscope was connected to a micro - camera system , light fountain , and video monitor . the anesthetized animal was maintained in the dorsal decubitus position , and its snout was lightly tractioned and lifted to create a space to introduce the optics . the optical system was used to correctly orient a number six levine tube with a 5-cm extension in the transglottic position . following the endotracheal intubation , the rats in group c were maintained under controlled respiration with a minute volume of 400 ml and an average respiratory frequency of 40 incursions per minute . animal electronic insufflators were used to distend the peritoneal cavity at a constant 5-mmhg pressure and a flux of 0.2 - 0.5 ml / min . the pneumoperitoneum was then interrupted in groups b and c , and the animals were sacrificed using a lethal dose of anesthesia . blood cultures were grown on a hemolisobac ( probac ) medium , and organ tissue cultures were grown on cysteine lactose electrolyte - deficient agar ( cled - agar ) . the presence or absence of bacteria in the blood samples was expressed as the percentage of animals with positive cultures in each group , and the results were analyzed using the likelihood - ratio test . the kruskal - wallis test and an analysis of variance ( anova ) model were used to compare the mean number of cfu in the cultures per gram of tissue collected between the groups . the presence or absence of bacteria in the blood samples was expressed as the percentage of animals with positive cultures in each group , and the results were analyzed using the likelihood - ratio test . the kruskal - wallis test and an analysis of variance ( anova ) model were used to compare the mean number of cfu in the cultures per gram of tissue collected between the groups . the blood culture measurements were expressed as cfu / ml of blood and analyzed as the percentage ( % ) of animals with positive cultures in each group . the other culture results were expressed as the number of cfu / g of tissue collected ( table 1 ) . no significant differences between groups a , b , and c were found for any of the cultures ( table 1 and figures 1 , 2 , and 3 ) . in the context of video - laparoscopic surgery , the role of co2 insufflation - induced pneumoperitoneum in combination with mechanical ventilation in the dissemination of peritoneal bacterial infection and sepsis remains controversial.5,16,17 when bacterial contamination is introduced into the peritoneal cavity , three major defense mechanisms are activated to remove the infection : bacterial clearance by the diaphragmatic lymphatic system , phagocytosis by local macrophages , and migration of neutrophils to the abdomen . lymphatic drainage and macrophage activity are the first lines of defense against bacteria following peritoneal contamination.5,18,19 due to its considerable level of communication with the rich lymphatic system , the diaphragmatic peritoneum confers the particular function of bacterial clearance from the peritoneum upon the diaphragm . bacteria are removed from the peritoneal cavity through this lymphatic system and reach the mediastinal lymph nodes through the retrosternal nodes.20,21 a decrease in diaphragmatic mobility causes a decline in bacterial clearance from the peritoneum.22,23 thus , the dampening effect of mechanical ventilation on diaphragmatic dynamics could be expected to attenuate this bacterial clearance mechanism.19 another factor that interferes with the absorption of substances by the diaphragmatic lymphatic system is abdominal pressure ; there is a direct correlation between abdominal pressure and diaphragmatic lymphatic bacterial clearance.24,25 the gaseous pneumoperitoneum used in laparoscopic surgery causes elevated intra - abdominal pressure and leads to increased diaphragmatic bacterial clearance from the peritoneal cavity . it also leads to peritoneal distension , which promotes diaphragmatic lengthening and interferes with diaphragmatic movement . this condition may reduce bacterial clearance from the peritoneal cavity.26 however , the combined effect of these two antagonistic factors on diaphragm - mediated bacterial removal remains unclear . in this context , we hypothesized that these two opposing factors compete to define the lymphatic bacterial clearance from the peritoneal cavity . on the one hand , the pneumoperitoneum increases the intra - abdominal pressure , which favors bacterial clearance via the lymphatic system . on the other hand , lengthening of the diaphragmatic surface and controlled respiration decrease the lymphatic pumping action of the diaphragm,22 which results in reduced bacterial clearance . the 30-min period used in this study was based on previous experiments showing that peritoneal lymphatic clearance of particulate matter is quickly initiated , becoming detectable in minutes , and absorbs most of the material in approximately 30 min.27,28 thus , controlled ventilation combined with pneumoperitoneum was used to simulate the conditions of laparoscopic surgical procedures that employ pneumoperitoneum and mechanical ventilation . we found no significant differences between the three groups based on blood , liver , lung , spleen , and peritoneum cultures . we also did not observe significant differences between the groups in the numbers of e. coli cfu in the diaphragmatic or mediastinal lymph nodes , which participate in the most relevant mechanism for bacterial clearance . the similarities between the three groups in this study may have resulted from complex , synergistic effects of the pneumoperitoneum and mechanical ventilation on the diaphragmatic lymphatic system , as discussed above . furthermore , no significant differences between the three groups were observed in our hemoculture results . similar hemoculture results have been observed in other studies.28,29 additionally , no evidence of hemodynamic alterations or increased bacteremia or endotoxemia have been reported in several other studies that examined the effect of pneumoperitoneum on the dissemination of peritoneal bacteria in animal models.12,29,30 however , other studies have reported an increased incidence of bacteremia one hour after insufflation of the peritoneal cavity.31,32 overall , no clear consensus can be obtained from the results of experiments that have investigated this issue . based on our results , we conclude that pneumoperitoneum , either alone or in combination with mechanical ventilation , does not modify the lymphatic clearance of peritoneal bacteria through diaphragmatic drainage . more studies are required to clarify the conflicting results observed in the literature on this topic .

systemic capillary leak syndrome ( scls ) is a disorder characterized by unexplained episodic capillary hyperpermeability , which causes the shift of fluid and protein from the intravascular space to the interstitial space1 ) . since no effective treatment has so far been found , this disease could lead to death if the blood pressure is not increased during the initial capillary leak phase . we experienced two cases where treatment with using 10% pentastarch elevated the blood pressure and eventually improved the patients , who were both in the acute phase of scls . a 37 year - old woman came to our hospital presenting with episodes of resting dyspnea , oliguria and anasarca , which had started one day previously . she had developed upper respiratory tract infection 3 days before admission , but she did n't get any medication . she was alert with a systolic blood pressure of 40 mmhg , heart rate : 110 beats / min , respiratory rate : 35 breaths / min and body temperature : 37. auscultation proved her breath sounds were normal . the laboratory finding showed hemoglobin : 19.2 g / dl , hematocrit : 53% , leukocytes : 17,400/mm , platelets : 147,000/mm , blood urea nitrogen / creatinine ( bun / cr ) : 32.8/1.9 mg / dl , total protein / albumin : 3.7/1.7 g / dl , c - reactive protein ( crp ) : 3.1 mg / l and the monoclonal igg - kappa was positive . the laboratory test performed later showed c3/c4 : 34.0/6.9 mg / dl and iga / g / m : 101/810/102 iu / ml , respectively . the c1 esterase inhibitor level was normal and bone marrow biopsy showed no evidence of multiple myeloma . despite intravenous injection of a combination of 9 l of normal saline solution and inotropic drugs , her systolic blood pressure did not increase and she developed respiratory failure resulting from pulmonary edema . the central venous pressure ( cvp ) we stopped using normal saline solution and started using 10% pentastarch ( pentaspan inj , jeilpharm , korea ) . after we started infusing 10% pentastarch 500 ml every 8 hours , her blood pressure began to increase . the hemoglobin level measured at that time was 16.8 g / dl , with a hematocrit of 47% , leukocytes : 26,200/mm , platelets : 93,000/mm , bun / cr : 35.4/1.2 mg / dl and prothrombin time ( pt ) : 2.8 inr . we thought that pt prolongation was a side effect of pentastarch , based on some previous reports . the pulmonary edema and bilateral pleural effusion due to the massive injection of normal saline solution were treated with diuretics . there was no long - term complication and no more attacks during 1 year follow - up . a 36 year - old female came to the hospital complaining of dyspnea and generalized edema that had started that very day . she developed upper respiratory infection 3 days before admission , but she did n't get any medication . she had a past history of 5 admissions at another hospital for the same symptoms ; she underwent various examinations at that time but did n't get the proper diagnosis . she finally turned out to have scls at our hospital 2 years before this admission and was being followed up . she was alert and the systolic blood pressure was 40 mmhg , heart rate : 130 beats / min , respiratory rate : 30 breaths / min and a temperature of 36. her breath sounds were normal . according to the laboratory finding taken on admission , her hemoglobin level was 21.1 g / dl , hematocrit : 62.7% , leukocytes : 49,700/mm , platelets : 297,000/mm , bun / cr : 22.6/2.7 mg / dl , total protein / albumin : 4.4/2.5 g / dl , crp : 4.9 mg / l and cvp : 2 cmh2o . the c1 esterase inhibitor level was normal and the bone marrow biopsy had no evidence of multiple myeloma . we started injecting 2 l of 10% pentastarch , along with inotropic drugs , instead of normal saline solution . one hour after pentastarch injection , her blood pressure began to rise and the cvp was 11 cmh2o , but no improvements were seen in the laboratory data that was checked at that time . later , we injected methylprednisolone , calcium , aminophylline and after that , her blood pressure did n't drop and the patient 's condition gradually got better . because she did not undergo massive fluid therapy , she did not suffer from respiratory failure resulting from pulmonary edema . during her 5 day hospital stay , the patient showed improved an hemoglobin level : 10.5 g / dl , hematocrit : 31.0% , bun / cr : 11.4/0.4 mg / dl and protein / albumin : 5.2/3.4 g / dl . a 37 year - old woman came to our hospital presenting with episodes of resting dyspnea , oliguria and anasarca , which had started one day previously . she had developed upper respiratory tract infection 3 days before admission , but she did n't get any medication . she was alert with a systolic blood pressure of 40 mmhg , heart rate : 110 beats / min , respiratory rate : 35 breaths / min and body temperature : 37. auscultation proved her breath sounds were normal . the laboratory finding showed hemoglobin : 19.2 g / dl , hematocrit : 53% , leukocytes : 17,400/mm , platelets : 147,000/mm , blood urea nitrogen / creatinine ( bun / cr ) : 32.8/1.9 mg / dl , total protein / albumin : 3.7/1.7 g / dl , c - reactive protein ( crp ) : 3.1 mg / l and the monoclonal igg - kappa was positive . the laboratory test performed later showed c3/c4 : 34.0/6.9 mg / dl and iga / g / m : 101/810/102 iu / ml , respectively . the c1 esterase inhibitor level was normal and bone marrow biopsy showed no evidence of multiple myeloma . despite intravenous injection of a combination of 9 l of normal saline solution and inotropic drugs , her systolic blood pressure did not increase and she developed respiratory failure resulting from pulmonary edema . the central venous pressure ( cvp ) we stopped using normal saline solution and started using 10% pentastarch ( pentaspan inj , jeilpharm , korea ) . after we started infusing 10% pentastarch 500 ml every 8 hours , her blood pressure began to increase . the hemoglobin level measured at that time was 16.8 g / dl , with a hematocrit of 47% , leukocytes : 26,200/mm , platelets : 93,000/mm , bun / cr : 35.4/1.2 mg / dl and prothrombin time ( pt ) : 2.8 inr . we thought that pt prolongation was a side effect of pentastarch , based on some previous reports . the pulmonary edema and bilateral pleural effusion due to the massive injection of normal saline solution were treated with diuretics . there was no long - term complication and no more attacks during 1 year follow - up . a 36 year - old female came to the hospital complaining of dyspnea and generalized edema that had started that very day . she developed upper respiratory infection 3 days before admission , but she did n't get any medication . she had a past history of 5 admissions at another hospital for the same symptoms ; she underwent various examinations at that time but did n't get the proper diagnosis . she finally turned out to have scls at our hospital 2 years before this admission and was being followed up . she was alert and the systolic blood pressure was 40 mmhg , heart rate : 130 beats / min , respiratory rate : 30 breaths / min and a temperature of 36. her breath sounds were normal . according to the laboratory finding taken on admission , her hemoglobin level was 21.1 g / dl , hematocrit : 62.7% , leukocytes : 49,700/mm , platelets : 297,000/mm , bun / cr : 22.6/2.7 mg / dl , total protein / albumin : 4.4/2.5 g / dl , crp : 4.9 mg / l and cvp : 2 cmh2o . the c1 esterase inhibitor level was normal and the bone marrow biopsy had no evidence of multiple myeloma . we started injecting 2 l of 10% pentastarch , along with inotropic drugs , instead of normal saline solution . one hour after pentastarch injection , her blood pressure began to rise and the cvp was 11 cmh2o , but no improvements were seen in the laboratory data that was checked at that time . later , we injected methylprednisolone , calcium , aminophylline and after that , her blood pressure did n't drop and the patient 's condition gradually got better . because she did not undergo massive fluid therapy , she did not suffer from respiratory failure resulting from pulmonary edema . during her 5 day hospital stay , the patient showed improved an hemoglobin level : 10.5 g / dl , hematocrit : 31.0% , bun / cr : 11.4/0.4 mg / dl and protein / albumin : 5.2/3.4 g / dl . systemic capillary leak syndrome is a rare condition that was discovered by clarkson et al in 19601 ) . it can also present with decreased blood pressure , rhabdomyolysis , generalized edema and acute tubular necrosis - induced renal failure2 , 3 ) . the initial capillary leak phase may last 1 to 4 days and this is the essential phase of acute hypovolemia that 's due to marked extravasation of intravascular fluids and macromolecules . therefore , hemoconcentration , leukocytosis , an increased igm concentration and a decreased concentration of albumin , igg , c3 and c4 may occur , as well as extravasation of up to 70% of the plasma3 ) . in the recruitment phase , the initially extravasated fluids and macromolecules shift into blood vessels , causing a severe acute intravascular fluid overload . the disappearance of renal shut - down and an increased urine output are the main characteristics of this stage . but fluid overload can also cause pulmonary edema , as in the case of the first patient , who suffered from pulmonary edema in the recruitment phase and she was treated by diuretics3 ) . though some of these patients have been diagnosed with multiple myeloma during follow - up , this syndrome is supposed to have something to do with monoclonal gammopathy without any evidence of multiple myeloma3 ) . according to amoura et al . among 29 scls patients who had monoclonal antibody , 16 people of them had igg kappa , 6 of them had igg lambda , 1 of them had iga lambda , and one had mixed a form of igg kappa and igg lambda4 ) . as seen from above , most of these patients had igg kappa , like our own patients . assaly et al attributed the mechanism of endothelial cell leak first to widening of the intercellular gaps resulting from increased intracellular calcium , and secondarily to endothelial cell damage and destruction . they also described apoptosis that was caused by various inflammatory responses as a mechanism of this damage to the endothelial cells . they also emphasized the importance of il-2 , tnf - a , and leukotrien metabolites , according to the literature5 ) . considering the fact that not only our own patients , but also the ones in various reports suffered from upper respiratory infection , there 's no denying that an inflammatory response is a major triggering factor for this disease . several trials have been done with using theophylline , diuretics , terbutaline , steroids , calcium antagonist , ginkgo biloba extracts and plasmapheresis as medication for scls , yet none of them have proven to be effective6 ) . considering that this disease is self - limiting , conservative treatment in the acute phase this syndrome can be a fatal disease because cardiovascular collapse can occur in the initial capillary leak phase . because shifting of fluid and protein by capillary hyperpermeability is the pathophysiology of this syndrome , massive crystalloid fluid therapy would not be effective during the acute attack and it exacerbates the pulmonary edema . according to fishel et al , in case of capillary leak caused by infection or inflammation , using excessive crystalloid solution is not a good option because it could impede the oxygen supply to tissue by creating pulmonary edema , and too much normal saline could cause metabolic acidosis ; therefore , using colloid solution such as albumin could be more efficient in this type of case7 ) . when used with an equal amount with normal saline solution , albumin could reduce the inflammatory responses and help create an efficient oxygen supply in tissue . but albumin could be less effective if it 's leaked , so pentastarch is more recommendable7 ) . though we do n't exactly know how a big molecule gets out of the capillary at the acute phase of scls , injecting a higher molecular weight material than albumin could be effective , considering that hypoalbuminemia is present in scls . according to atkinson et al , materials with a molecular weight less than 200,000 daltons can get out of the capillary8 ) . considering the fact that the mean molecular weight of pentastarch is 264,000 daltons , injecting pentastarch as the initial fluid in the initial capillary leak stage could be efficient to prevent the cardiovascular collapse and pulmonary edema that 's due to massive fluid therapy . we actually did see reduced edema and elevated blood pressure in our patients when they were supplied with 10% pentastarch . therefore , pentastarch could be very effective for the patients in their acute phase , but only if it 's used cautiously enough to avoid a prolonged pt . scls is a very rare syndrome with only 60 cases having been worldwide , and only 1 case has been reported in korea9 ) . however the incidence rates are climbing and we have experienced 2 cases in the short term . we think this indicates that scls could be misdiagnosed as other disease such as idiopathic edema or polycythemia vera , and so it is treated in a wrong way that could lead to death from repetitive attacks . in conclusion , physicians must be aware of this illness and be well prepared to treat this effectively when finding one of these patients , and the opportunity for conservative management must not be missed . using 10% pentastarch during the acute phase of scls may be a key to a good prognosis and this treatment will eventually make the patients ' lives better .

osteoporosis is a systemic skeletal disease characterized by low bone mass and microarchitectural deterioration of bone tissue . osteoporotic bones have same size and appearance as the normal bone from the outside but have a thin layer of cortical bone and trabecular bone loss inside and are more fragile than normal bone . serum estradiol levels remain fixed at under 30 pg / ml 1 year after menopause . lower estrogen levels increased osteoclastic activity , reduced osteoblastic activity in the bone , and are responsible for rapid bone loss in women . the most common symptom is bone pain in patients with postmenopausal osteoporosis ( po ) . the most common physical complaints are pain due to fractures , reduced mobility , spinal deformity , and shortened height . older age , low - income levels , lack of activity , sedentary lifestyle , duration of menopause , and history of fractures are associated with a decrease in bmd . several methods have been developed to assess health status and quality of life ( qol ) associated with osteoporosis , including a qol questionnaire from the european foundation for osteoporosis-41 ( qualeffo-41 ) . major depression has been repeatedly reported to be associated with low bmd in the spine and hip . excessive activity of the hypothalamic - pituitary - adrenocortical axis has been consistently demonstrated in major depressive disorder , whereas depressive symptoms have been reported in patients with osteoporosis , especially in the postmenopausal period . reported that depression has frequently been associated with osteoporosis . however , the nature of this link , and whether it is direct or indirect , remains to be explored . bisphosphonates are the most commonly used drugs for the prevention and treatment of osteoporosis . once - yearly zoledronic acid ( za ) 5 mg is a type of bisphosphonate . the purpose of this study was to investigate the effectiveness of once - yearly za 5 mg on depression and qol in the women with po . a total of 88 newly diagnosed women in 2 years between 2012 and 2014 with po referred to the endocrinology clinic of samsun ondokuz mays university medicine faculty and treated with once - yearly za 5 mg ( aclasta novartis ) were included in this self - controlled prospective cohort study . za was chosen for po treatment because of proven efficacy , ease of use , low cost of treatment , and not requiring follow - up . bmd levels were measured by dual - energy x - ray absorptiometry ( dxa ) from the lumbar ( l1l4 ) and femoral neck regions . osteoporosis is 2.5 standard deviations below the mean bmd of healthy adults of the same sex and race . a qol questionnaire from the qualeffo and beck depression inventory ( bdi ) was given to patients at baseline and 12 months . the qualeffo-41 questionnaire has five domains , with 41 items in total : pain ( 5 - items ) ; physical function ( 17 - items ) ; social function ( 7 - items ) ; general health perception ( 3 - items ) ; and mental function ( 9 - items ) . exclusion criteria were as follows : active psychiatric diseasesactive hematological , oncological cancerssecondary osteoporosisactive metabolic bone diseasespreviously received treatment for osteoporosisfractures ( osteoporotic , traumatic)stage 45 renal failure ( creatinine clearance 30 ml / min)hypercalcemia ( 11 mg / dl ) or hypocalcemia ( 8 mg / dl)bone and joint deformities affecting static standing alone . active psychiatric diseases active hematological , oncological cancers secondary osteoporosis active metabolic bone diseases previously received treatment for osteoporosis fractures ( osteoporotic , traumatic ) stage 45 renal failure ( creatinine clearance 30 ml / min ) hypercalcemia ( 11 mg / dl ) or hypocalcemia ( 8 mg / dl ) bone and joint deformities affecting static standing alone . written informed consent was obtained from each participant following a detailed explanation of the objectives and protocol of the study , which was conducted in accordance with the ethical principles stated in the declaration of helsinki and approved by the institutional ethics university committee approval number is 71522473.050.02.05/54 . all patients were supported with daily oral vitamin d ( 880 iu ) and oral calcium ( 1000 mg ) . mean differences of continuous data were measured through t - test , and median differences of categorical data were measured by mann whitney u and fisher 's exact tests . differences between parameters before and after treatment were assessed by paired sample t - test . mean differences of continuous data were measured through t - test , and median differences of categorical data were measured by mann differences between parameters before and after treatment were assessed by paired sample t - test . demographic characteristics once - yearly za 5 mg treatment was found to be effective for treating po . baseline mean l14 t - scores and femoral neck region were measured at 3.30 and 2.39 in dxa . l14 t - scores increased 2.60 and for the femoral neck region increased 2.09 after treatment at 12 months ( p = 0.001 ) [ table 2 ] . the effects of once - yearly zoledronic acid 5 ( mg ) pain scores decreased from 17.44 to 13.95 ( p = 0.001 ) ; physical function scores decreased from 47.29 to 40.51 ( p = 0.001 ) ; social function scores decreased from 20.4 to 16.67 ( p = 0.001 ) ; general health perception scores decreased from 20.19 to 16.22 ( p = 0.001 ) ; mental function scores decreased from 32.1 to 30.9 ( p = 0.001 ) ; and total scores decreased from 27.48 to 23.65 ( p = 0.001 ) after once - yearly za treatment [ table 3 ] . changes in domains of quality of life questionnaire from the european foundation for osteoporosis-41 and beck depression inventory the bdi includes 21 items . a maximum of three points are obtained from one item . bdi points decreased from 16.51 to 13.42 ( p = 0.001 ) after once - yearly za treatment [ table 3 ] . both bdi point levels are consistent with mild depressive symptoms , but the decrease in bdi points was statistically significant . once - yearly za treatment is an effective treatment for po . once - yearly za treatment improved qol and reduced depression . our study is the first demonstrating the relationship between once - yearly za treatment and both qol and depression in the literature . it has a prolonged dosing interval and fewer side effects than other bisphosphonates . once - yearly za can be used in treatment and prevention of po and glucocorticoid - induced osteoporosis as well as treatment of male osteoporosis . a meta - analysis of nine clinical trial showed that za is an effective treatment for osteoporosis . significantly , higher bmd and lower fractures were found . in our study , za treatment was found to be effective in terms of bmd levels as in 9 's clinical trial . some of these studies were conducted with patients with osteoporosis , and some were conducted with patients with osteoporotic fractures . in all of these studies , osteoporosis with or without fracture was found to be related with low qol . in the literature , we found only one study demonstrating the relationship between once - yearly za treatment and qol . za treatments were found to be effective in po and increase qol , but the qualeffo-41 questionnaire was not used in that study . ours is the first study showing the relationship between once - yearly za treatment and qol using the qualeffo-41 questionnaire in terms of depression . depression is associated with several chronic conditions such as diabetes mellitus , cardiovascular diseases , menopause , and osteoporosis . these limitations in movement , as well as pain , lead to breaks in daily activity , and patients may become isolated . our patients scored 16.51 points for bdi at the beginning of the once - yearly za treatment . these results are consistent with some mild depressive symptoms as well , but the decrease in bdi points was statistically significant . the most important one is the small number of participants and the short study duration . the other is that we did not compare our participants with participants who not using za treatment for osteoporosis once - yearly za treatment is effective in po while also increasing qol and decreasing depression . once - yearly za treatment is easy to use and has fewer side effects . fg ; found the subject and the patientscv wrote the articleaa ; made the statistical analysismha ; made the tablesrc ; made the last corrections . fg ; found the subject and the patients aa ; made the statistical analysis rc ; made the last corrections .

a 74-year - old male patient receiving ventilatory support due to aspiration pneumonia was transferred to the or from the icu for an emergency operation of the sigmoid colon volvulus . in the icu , the preoperative vital signs were blood pressure ( bp ) of 120/70 mmhg , heart rate ( hr ) of 70 beats / min , and percutaneous oxygen saturation ( spo2 ) of 98% on a fractional inspired oxygen concentration ( fio2 ) 0.4 . the preoperative chest x - ray revealed diffuse ground glass opacity in middle lower lung suggesting aspiration pneumonia ( fig . the patient had been ventilated mechanically using synchronized intermittent mandatory ventilation mode with a tidal volume of 450 ml at a respiratory rate of 16 breaths / min , inspiratory : expiratory ratio of 1 : 2 , positive end - expiratory pressure ( peep ) of 6 cmh2o , and fio2 of 0.4 . arterial blood gas analysis on a fio2 of 0.4 revealed a ph , po2 , pco2 and spo2 of 7.42 , 125.9 mmhg , 43 mmhg and 98% , respectively . the patient received manual ventilation with a self - inflated resuscitator bag ( ambu bag ) during transport . upon entrance into the or , he suffered cyanosis and showed a delirious mental state . electrocardiogram revealed tachycardia ( hr 130 beats / min ) and the bp was 100/70 mmhg . manual ventilation was difficult and an adequate tidal volume was not delivered , even with considerable effort . the ett was secured at 22 cm from the ett tip and was found to be patent . it was then withdrawn slowly to 20 cm . however , the breath sounds and spo2 did not change . at that moment , accordingly , rapid insertion of a 16 gauge angiocatheter into the left side of the chest was performed and the air was released immediately . immediately , a 28-french chest tube was inserted into the left side of the thorax . a chest x - ray was taken , which revealed bilateral pneumothorax , pneumomediastinum , pneumopericardium , pneumoretroperitoneum , and subcutaneous emphysema ( fig . however , the patient expired because of an aggravation of pneumonia and residual pneumothorax on the 12th postoperative day . the most widely recognized form of barotrauma is the presence of extra - alveolar air . the most common mechanism for extra - alveolar gas formation is a disruption of the alveolar epithelium , leading to the entry of gas into the perivascular sheath . the gas then dissects within this sheath toward the mediastinum where it decompresses through other fascial planes producing the radiographic and clinical manifestations of pneumothorax , subcutaneous emphysema , subpleural air cysts , pneumomediastinum , pneumopericardium and pneumoperitoneum . the risk of barotrauma is increased by excessive peak inspiratory pressure , high peep , high transalveolar pressure , alveolar overdistention and underlying lung injury . the incidences of pneumothorax in patients receiving mechanical ventilation varies from 4 to 15% but might be significantly higher in patients with adult respiratory distress syndrome , status asthmaticus , and aspiration pneumonia . in the present case , underlying aspiration pneumonia might have predisposed the patient to the development of barotrauma . manual ventilation is frequently required during intrahospital transpor t. because clinicians are relatively unconstrained in manual ventilation , the ventilatory patterns can differ significantly among clinicians , and may be inappropriate and deleterious in certain circumstances . a high airway pressure with excessive or inappropriate manual ventilation can cause a pneumothorax and/or other pulmonary air leak problems . in this case , it is likely that the inappropriate manual ventilation induced a high airway pressure or alveolar overdistension , resulting in these complications . the accuracy and stability of manual ventilation can contribute to the quality of ventilation and prevent barotrauma . accurate and stable manual ventilation can be provided by appropriate training and when a manometer is used in conjunction with the bag . therefore , physicians should train with a test lung in order to help them realize the ventilation patterns they may generate during manual ventilation . in this case , the possibility of a preoperative pneumothorax that might have developed in the icu and remained undetected in the preoperative chest x - ray could not be excluded . it is difficult to make a radiographic diagnosis of a pneumothorax on a portable chest x - ray film taken in the icu . the traditional radiographic hallmark of a pneumothorax may not manifest in portable supine films of patients with a pneumothorax . in addition , concurrent lung disease might lead to different distributions of free air in the pleural space than in patients with relatively normal lungs . despite the supine chest x - ray film being reviewed carefully , a pneumothorax can be missed without using other imaging modalities or techniques . several studies reported that computed tomography ( ct ) scans of the chest may be more sensitive in detecting a pneumothorax in icu patients than portable chest radiographs [ 8 - 10 ] . however , it is not always practical or safe to transport critically ill patients for a ct scan to exclude a latent pneumothorax , particularly when the patient is hemodynamically unstable . therefore , the migration of an already marginally acceptable ett position by manual ventilation during transport is believed to be the cause of these complications . the ett tip was sited near the carina in the preoperative chest x - ray . during transport , migration of the ett tip to the endobronchial position might lead to a high airway pressure that can result in barotrauma . in the present case , . demonstrated normal breath sounds with endobronchial depths of 1.5 - 2.0 cm , and did not detect the disappearance of breath sounds until a depth of 3.2 cm . reported there were no signs of a change in spo2 in the cases of endobronchial intubation . tension pneumothorax is believed to occur when the communication between the lung parenchyma and pleural space acts as a one - way valve , allowing air to enter the pleural cavity during inspiration but trapping air during expiration . the development of tension is dependent on the pressure gradient between the intrapleural pressure and alveolar pressure . ventilation will increase the gas flow through the pleural defect , allowing more air to pass per unit time and a more rapid increase in intrapleural pressure with earlier mechanical compressive effects and rapid progress to cardiorespiratory collapse . therefore , tension pneumothorax develops more commonly in patients on mechanical ventilation than in spontaneously breathing patients . moreover , ventilated patients with tension pneumothorax deteriorate much more rapidly , and sudden cardiac arrest is more likely . the immediate treatment for tension pneumothorax is needle decompression , which is only a temporary measure until tube thoracostomy can be performed . strange reported that a clinical diagnosis could be made immediately in 61% of patients with a tension pneumothorax , of which 7% had died . a mortality of 31% was recorded in a group of patients in which clinical signs preceded the diagnosis by 30 minutes to 8 hours . tension pneumothorax occurred more frequently in patients with an initially misdiagnosed pneumothorax than in patients with a correctly diagnosed . the risk factors predisposing a patient to a misdiagnosis of a pneumothorax in the icu include mechanical ventilation required at the time of development of a pneumothorax , atypical radiographic location of the pneumothorax , altered mental status exhibited at the time of pneumothorax presentation and the development of a pneumothorax after peak physician staffing hours . in this case , the development of a pneumothorax was not recognized during transport . the intubation state and transport without a specially trained transport team might have contributed to the failure to make an early diagnosis of a pneumothorax during transfer . knowledge of the factors predisposing the patient to this problem should allow a higher index of suspicion for a diagnosis of a pneumothorax in critically ill patients and possibly improve the early recognition of a pneumothorax . in conclusion , inappropriate manual ventilation , deep placement of an ett and aggravation of an undetected preoperative pneumothorax are likely to have contributed to these complications . accurate and stable manual ventilation , appropriate placement and thorough management of an ett , as well as an immediate diagnosis and correct treatment can prevent this outcome . in addition , the ability of continual monitoring and appropriate patient care during transport is essential for preventing transport - related morbidity and mortality .

the visual cortex has been traditionally considered as a stimulus - driven , unimodal system with a hierarchical organization , in which the early visual areas ( v1 , v2 ) tune to general features while the higher - tier ones ( v3a , v4v , v7 , hmt+ , and v8 ) respond selectively to the specific features of a visual stimulus [ 15 ] . two parallel visual streams have been proposed to generalize the hierarchical organization of the visual processing [ 68 ] . the dorsal stream or where pathway serves to analyze visual spatial information about object location , motion , and visuomotor planning . in this pathway , visual signals are conveyed to the posterior parietal cortex through the dorsal part of the visual cortex ( such as the v3d , v3a , v7 , and hmt+ ) and finally reach the prefrontal cortex . the ventral stream or pathway has been associated with the processing of form , object identity , and color . this pathway conveys visual signals along the ventral part of visual cortex ( such as vp , v4 , and v8 ) , the inferior temporal ( it ) areas , and finally to the prefrontal cortex . the structural and functional organization of the visual areas is supposed to develop through a combination of genetic instruction [ 911 ] and experience - dependent refinement [ 12 , 13 ] . the role of visual experience in the development of the visual areas is supported by a large number of neuroimaging studies revealing that the visual areas of congenitally blind ( cb ) and early blind ( eb ) subjects have increased cortical thickness [ 1417 ] , local brain spontaneous activity , metabolism , and blood flow [ 1922 ] and decreased regional volume [ 2325 ] , white matter integrity [ 26 , 27 ] , anatomical network efficiency [ 28 , 29 ] , and altered resting - state functional connectivity ( rsfc ) [ 30 , 31 ] . moreover , converging evidence suggests that both the early and higher - tier visual areas in cb subjects are recruited during performing a variety of tasks given through nonvisual sensory modalities , as detailed in previous reviews [ 3236 ] . however , the notion of the visual cortex as a unimodal system molded only by visual experience has recently been challenged because the visual cortex of both the sighted controls ( sc ) and the cb responded to a variety of nonvisual perceptive stimuli , including tactile , auditory , and olfactory . furthermore , the visual cortex of the cb was also involved in cognitive processes , such as linguistic processing , working memory , and attention . although the extent and magnitude of the activation in the visual areas depend on the tasks and subjects ' characteristics [ 37 , 38 ] , the coactivation of several visual areas by nonvisual tasks in sc and cb highly indicates that the development of the functional organization of these visual areas does not require visual experience . the main topic of this review is to elucidate how the nonvisual signals recruit the visual cortex . we firstly provide evidence if the visual cortex is supramodal in nature , and then we reviewed how the nonvisual signals reach the visual cortex . finally , we also discussed about the nature ( stimulus - driven or top - down ) of nonvisual signals . unimodal theory supposes that the visual cortex is specifically allocated to process visual stimuli in sighted people ; however , this hypothesis has recently been challenged . using the positron emission tomography ( pet ) , sathian et al . first reported that the extrastriate area close to the parietooccipital fissure ( v6 ) was activated during discrimination of grating orientation compared with discrimination of grating groove width , suggesting this visual area is recruited in the processing spatial information of tactile signals . to further confirm that the occipital area is functionally involved in nonvisual processing , the transcranial magnetic stimulation ( tms ) technique was used to transiently disrupt the functioning of this area . the authors found impaired tactile discrimination of grating orientation after exerting tms on this occipital area and concluded that this occipital area is really functionally involved in tactile spatial perception . since then , many studies have reported the involvement of visual areas in a series of tactile processing , including the hmt+ complex for tactile motion perception [ 37 , 41 ] and the ventral visual pathway for tactile object discrimination [ 4249 ] . it is interesting to note that the hmt+ is capable of processing motion - related information even when the stimulus is delivered to the tongue . furthermore , several studies using both visual and tactile stimuli showed that these two modalities drive the same visual areas for motion and object processing , supporting the cross - modal involvement of visual areas in the abstract representation of the concepts of objects , space , and motion [ 38 , 42 ] . the cross - modal recruitment of the visual cortex has also been reported in auditory domain . as early as 1972 , morrell found that up to 41% of recorded neurons in extrastriate cortex of adult cats were modulated by both visual and auditory stimuli and that the receptive fields for both responses typically overlapped in space . recent studies in humans have also provided evidence of occipital activation in auditory processing [ 52 , 53 ] . for example , the hmt+ complex was activated in sighted subjects while listening to auditory motion stimuli [ 52 , 54 , 55 ] . in accordance with the neuroimaging findings , several tms studies showed that transient disruption of the specific occipital regions can impair the auditory perception in sighted subjects , such as inhibition of the extrastriate cortex induced a systematic error in auditory spatial perception , and disruption of the dorsal extrastriate cortex impaired the sound localization [ 57 , 58 ] . the tms evidence supports that the visual cortex is involved in spatial hearing in sighted subjects . it is also interesting to note that the visual cortex in sighted subjects can not only percept the sound itself but also response to abstract auditory information such as action sounds . relative to the sighted subjects , cross - modal processing of nonvisual signals in the visual cortex has been more extensively reported in the cb and eb subjects when they perform nonvisual perception and high - order cognitive tasks . numerous studies reported that the visual cortex was recruited during diverse tactile tasks , such as the early and higher visual areas were activated in vibrotactile frequency discrimination , the hmt+ in tactile motion perception [ 37 , 50 , 61 ] , and the ventral visual pathway in tactile object perception . the visual cortex is also involved in tactile perception of the tongue [ 42 , 62 , 63 ] . using the tongue display device ( tdu ) , a tactile - to - vision sensory substitution device that translates a visual image into electrotactile stimulation , several studies have shown that the specific visual areas were recruited to process different types of tongue tactile stimuli , such as the ventral stream for tactile - form recognition , the hmt+ complex for tactile motion discrimination , and the ventral lateral occipitotemporal cortex for virtual route recognition . moreover , rtms inhibition of the human hmt+ impaired the tactile speed discrimination , indicating that the recruitment of hmt+ is necessary for tactile motion processing . interestingly , tms stimulation of the visual cortex can induce subjective tongue - tactile sensations in the cb who is proficient at the use of the tdu , which indicates that the perceptual correlate of activity in the visual cortex reflects the characteristics of its novel sensory input source . similar with the tactile perception , the activation of the visual cortex by auditory perception was also frequently reported in cb subjects [ 54 , 65 , 66 ] . in an early pet study , weeks et al . reported that the right dorsal visual cortex was activated by auditory perception task in the cb but not in the sc . this region was also activated in eb subjects by an auditory spatial processing task using a sensory substitution prosthesis translating visual information into sounds . the activation pattern in eb was also confirmed by recent studies [ 66 , 68 , 69 ] . accordingly , the visual areas previously considered to be involved in visual motion processing ( such as the hmt+ ) were specifically recruited in the eb by motion stimuli presented through the auditory modality [ 50 , 54 , 55 , 70 , 71 ] . the ventral pathway can be recruited to process auditory object recognition [ 72 , 73 ] in the cb . in a recent study , striem - amit et al . showed that the dorsal stream processed the location information , whereas the ventral stream responded to shape information via the vision - to - sound substitutes in cb subjects . the dorsal and ventral pathway recruited by auditory perception was further confirmed by electrophysiological and tms evidence . using erp , several groups showed greater amplitude of the n1 component at the visual region in sound localization , suggesting the involvement of the visual cortex in early auditory processing in the eb [ 7577 ] . tms inhibition of the visual area can impair specific auditory performance in the eb [ 57 , 78 , 79 ] . for example , rtms delivered to right dorsal extrastriate cortex disrupted the spatial processing of sounds in the eb [ 57 , 78 ] , and rtms over the loc can impair a eb subject 's ability to identify objects . in the cb , besides auditory and tactile perception , the visual cortex was also recruited in olfactory processing . in this study , a simple odor detection task , the authors found that cb subjects not only showed strong activation in the olfactory cortex , but also showed widespread activation in the visual cortex . combining earlier studies reported that superior olfactory perception in the cb [ 81 , 82 ] ; the recruitment of the visual cortex during odor detection suggests a preferential access of olfactory stimuli to this area in the cb . the visual cortex in eb subjects is not only involved in nonvisual perception , but also takes part in the process of higher - level cognitive tasks , such as language , attention , and working memory . converging evidence supports the involvement of the visual cortex in language processing in the cb or eb subjects . the medial visual cortex was recruited during braille reading [ 8385 ] and the occipitotemporal visual areas were activated during covert verb generation in the eb [ 86 , 87 ] . further studies reveal that the visual cortex is preferentially recruited by semantic relative to phonological processing , and the magnitude of fmri activation is associated with both semantic and syntactic complexity . a recent study showed that the visual word form area ( vwfa ) , a component of the ventral stream that develops expertise for visual reading , can also process braille reading in the eb . further evidence for the involvement of the visual cortex in language processing in the eb has been provided by a combination of task activation and functional connectivity analyses . the authors found that ( 1 ) the responses of the visual regions and classic language regions across conditions were similar ; ( 2 ) language sensitivity was restricted to the left visual cortex ; ( 3 ) the left visual regions that responded to language had increased functional connectivity with classic language regions . besides the neuroimaging findings , in the cb , disruption of the visual cortex by tms or lesions impairs the performance of braille reading and verb generation [ 84 , 9295 ] . besides the language processing , the visual cortex that normally subserves vision is activated in the cb subjects when performing nonvisual attention - demanding tasks , such as spatial attention discrimination [ 32 , 35 , 36 ] . more importantly , the amplitude of the occipital activation in the cb was correlated with the spatial attention performance [ 66 , 96 , 97 ] . these findings suggest that the occipital activation is associated with the enhanced nonvisual attention abilities in the cb . the visual cortex can also be activated by memory task with nonvisual stimuli or without any sensory input [ 98101 ] . the posterior occipital region ( including v1 ) was recruited during a verbal memory task even without real sensory stimulation in the cb , and the activation magnitude of this region was correlated with verbal memory performance . reported that tactile spatial working memory task activated the dorsal extrastriate areas in the cb individuals . moreover , using three different kinds of working memory tasks ( verbal , tactile , and auditory ) , a recent study showed that the visual cortex of the eb subjects responded to all types of stimuli . two neural mechanisms have been proposed to explain the involvement of the visual cortex in the processing of nonvisual stimuli . one hypothesis holds that the visual cortex is supramodal in nature , which means that an occipital area relies on a common , abstract representation of the perceived stimuli irrespective of the sensory modality . another hypothesis is the cross - modal plasticity . in the cb or eb , the visual cortex that normally serves to process visual input shifts to cross - modal process nonvisual information via plastic reorganization of the inner structure and function . however , the two mechanisms are not mutually exclusive , and they might coexist in the eb . as discussed above , many pieces of evidence that showed the involvement of the visual areas in processing nonvisual inputs in both the sc and eb may support the supramodal hypothesis ( see sections 2.1 and 2.2 ) . the cross - modal involvement of the visual cortex in processing nonvisual stimuli means that the functional specialization of the visual areas is task - dependent rather than sensory modality - dependent . furthermore , this pattern can not be fully explained by visual imagery [ 102108 ] because the cb subjects who never have visual experience also show occipital response to the nonvisual stimuli [ 69 , 80 ] . the supramodal hypothesis can explain that visual experience is not necessary to develop the normal functional organization of the visual areas , which has been confirmed in a variety of previous studies on the cb [ 74 , 90 , 109 , 110 ] , because the development of the functional organization may be driven by inputs from other sensory modalities . the cb subjects commonly showed superior performance during auditory or tactile perception than normal sighted subjects [ 97 , 101 , 111115 ] . the superior performance has also been associated with the occipital activation in the cb [ 96 , 97 , 101 ] , suggesting the hypothesis of the cross - modal plasticity . this mechanism can also be applied to explain the involvement of the visual cortex in the higher - level cognitive tasks in the cb but not in the sc [ 84 , 9295 ] . furthermore , the plasticity mechanism may also partly explain the increased cortical thickness [ 1417 ] , local brain spontaneous activity , metabolism and blood flow [ 1922 ] , and rsfc [ 30 , 31 ] in the eb . studies on the functional characteristics of the hmt+ have well described the coexistence of the two mechanisms in the eb . in sighted subjects , the hmt+ complex is segregated into an anterior part ( supramodal region ) , that is , involved in processing both visual and tactile motion , and a posterior part ( unimodal region ) , which is only involved in processing visual information . in the eb , however , the entire hmt+ is involved in the representation of tactile motion , suggesting the coexistence of the supramodal ( anterior part ) and plastic ( posterior part ) mechanisms in this region . these results represent competitive interactions between visual and nonvisual inputs in the reshape of hmt+ complex [ 37 , 116 ] . it should be noted that the improved nonvisual perception performance in the early blind subjects can also be the consequences of the experience - dependent plasticity of their auditory or somatosensory related cortices . for example , the mice that are binocularly enucleated from birth demonstrate remarkable expansion of their barrel cortex , which may be interpreted by increased usage of the whiskers after visual deprivation . cats that were deprived of vision from birth also show expanded primary somatosensory and auditory areas ; furthermore , the neurons in the anterior ectosylvian visual area ( aev ) that normally respond to visual stimuli are replaced by neurons of neighboring auditory ectosylvian area ( aea ) , which is accompanied by the improvement of auditory spatial tuning of this region than sighted controls [ 118 , 119 ] . as a result , the improved auditory / tactile perceptive performance might both be caused by the experience - dependent plasticity of the classic auditory / tactile regions with expanded cortical area , and by classic visual regions that turn to subserve the nonvisual information . caution should be paid that some cortical regions such as the aev in the congenitally blind subjects are actually replaced by expanded auditory cortices and their activation by auditory stimuli can not be interpreted as cross - modal involvement of visual areas any more . as discussed above , much evidence supports the cross - modal processing of nonvisual signals in the visual cortex . it is then important to understand how the nonvisual sensory information reaches the occipital areas , especially in the cb subjects who have no visual experience about the external world . the candidate pathways include the thalamooccipital and corticooccipital pathway , which is categorized in figures 1 and 2 . the thalamus is an important relay that receives afferents from different sensory organs and sends efferents to the primary sensory cortex . under normal condition , the thalamic nuclei are relay stations via which sensory information from the peripheral sensory receptors can reach the primary sensory cortex . for example , the lateral geniculate nucleus ( lgn ) , the visual thalamic relay , mainly transfers visual signals to the primary visual cortex ( v1 ) ; the medial geniculate nucleus ( mgn ) is the auditory thalamic relay that connects the inferior colliculus ( ic ) and the primary auditory cortex ( a1 ) ; and the ventral posterior nuclei ( vp ) is the somatosensory thalamic relay that receives tactile signals and transmits them to the primary somatosensory cortex ( s1 ) [ 120 , 121 ] . furthermore , the thalamus can also receive feedback signals from the sensory cortex [ 122125 ] and the associate cortex [ 126132 ] to modulate the input signals . it is hypothesized that nonvisual signals may bypass the traditional sensory pathway and rewire into the visual thalamus and project to the v1 . this hypothesis is supported by the findings that the lgn receives rewired auditory projections from the inferior colliculus [ 133139 ] and the mgn , receives rewired somatosensory projections from the vp [ 140 , 141 ] , and then projects efferent fibers to the visual areas in enucleated animals since birth . recent findings have shown that the lgn and its output projections to the v1 are atrophied in early blind subjects [ 24 , 26 , 27 ] , which seems to contradict with this hypothesis . one putative explanation is that the atrophy of the lgn and the retinofugal pathway is the consequence of the interaction between disused neurodegeneration of the visual part of the pathway and cross - modal plasticity of the rewired nonvisual part of the pathway . in fact , pervious animal experiments have shown that the visual projections to the dorsal lateral geniculate nucleus are dramatically reduced in blind animals , while the auditory projections to the same region are strengthened [ 133 , 142 ] . another possibility is that the nonvisual signals bypass traditional retinofugal pathway ( from the lgn to the v1 ) and pass through the pulvinar - occipital pathway [ 143146 ] , or from the lgn to the higher visual areas ( such as the hmt+ and v4 ) [ 147150 ] . in agreement with this interpretation , a recent fmri study in monkeys demonstrates that direct lgn projections to the extrastriate cortex have a critical functional contribution to blindsight with v1 lesions ; a human study shows a direct anatomical connection between the thalamus and the hmt+ complex , that would directly convey motion information to the hmt+ , thereby bypassing the v1 . an alternative pathway is that the visual areas receive nonvisual sensory information through corticooccipital connections between these sensory modalities [ 140 , 152 , 153 ] . these corticooccipital connections can be further subdivided into direct corticooccipital connections and indirect polysynaptic corticooccipital connections . the former has been found between the a1 and visual cortex in adult mongolian gerbils , cats , primates [ 153 , 156 , 157 ] , humans , and congenitally blind opossums , and between s1 and v1 in enucleated opossums . the latter has been indicated by studies showing multisensory processing in the association cortices , such as the posterior parietal area ( ppa ) [ 160 , 161 ] , superior temporal sulcus ( sts ) [ 162164 ] , ventral lateral prefrontal cortex ( vlpfc ) [ 165167 ] , and extrastriate areas [ 155 , 168 , 169 ] . the dense anatomical connections between multisensory areas and both the visual and nonvisual sensory cortices have been identified in both animal and human studies [ 155 , 159 , 163 , 170 , 171 ] . the corticooccipital pathway hypothesis is also supported by task - based fmri studies [ 165 , 172 ] and a resting - state fmri study in sighted subjects , an effective connectivity study , and tms studies in sighted and eb subjects [ 23 , 78 , 175 , 176 ] . in a recent study by our group , we found the rsfc between the early visual areas and s1 was dramatically decreased , while those between the higher - tier visual areas and s1 , and between the early and higher - tier visual areas , were relatively preserved or even strengthened in the cb . our findings support the hypothesis of the indirect corticooccipital pathway mediating nonvisual sensory information to the early visual areas via the relay of higher - tier ones . it should be noted that these two pathways can not be absolutely segregated in the brain network . they are interacted with each other by feed forward and feed back projections . for example , the auditory signals can first feed forward to the a1 for initial processing , and then feed back to the mgn and multimodal thalamic nuclei ( e.g. , the pulvinar ) , and finally project to the v1 ( cortico - thalamooccipital pathway ) . the multisensory areas such as the ppa and vlpfc also project efferents to the multimodal thalamus ( the pulvinar and medial dorsal nucleus ) [ 127131 ] , so they can convey the modulated nonvisual signals to the occipital area via the thalamus ( figure 1 ) . the existing thalamo - cortical and corticooccipital pathways found in the normal adult animals and humans provide anatomical evidence of the supramodal nature of the visual cortex . auditory and tactile information this anatomical connections pattern can explain the cross - modal involvement of visual cortex by nonvisual sensory tasks ; furthermore , it can explain the development of a portion of the visual areas does not depend on the visual experience because inputs from other sensory modalities are sufficient to support the development of these functional patterns . two competing hypotheses have been proposed to explain the neural mechanisms of cross - modal plasticity after early visual deprivation . according to the rewiring hypothesis , cross - modal brain responses are mediated by the formation of new pathways in the sensory deprived brain . for example , after experimental destruction of the superior colliculi and the visual cortex in neonatal hamsters , the authors observed a strong projection from the retina to the a1 , which can perceive the visual information [ 178 , 179 ] . studies in animals have also shown that when the brain is deprived of peripheral visual input at an early age , auditory inputs are re - routed to the visual cortex via the thalamooccipital pathway [ 133 , 139141 ] . however , this subcortical rewired pathway is questioned because of the lack of in vivo evidence . in contrast , there are considerable studies showed that the whole segments of retinofugal pathway , including the optic tract , the lgn , and optic radiation , suffered atrophy and loss of integrity in humans after early visual deprivation [ 16 , 23 , 27 ] . the unmasking hypothesis proposed that the loss of a sensory input induces unmasking and/or strengthening of the existing neural pathways . as discussed in sections 3.1 and 3.2 , the tactile and auditory inputs can be conveyed to the visual cortex via the existing thalamooccipital pathway or corticooccipital pathway that have been confirmed in normal adult animals and humans . generally , these nonvisual signals can modulate the processing of visual information in sighted subjects ; however , they can not induce subjective nonvisual sensations and occipital activation due to being masked by the dominant visual input [ 40 , 64 , 176 ] . the occasional findings of occipital processing nonvisual signals might be task - dependent that dramatically reduced the masking effects of the visual input [ 40 , 52 , 55 ] . however , after early visual deprivation , nonvisual processing in the visual cortex is strengthened or unmasked because of the lack of visual input . the unmasking hypothesis is also supported by the cross - modal responses after short - term visual deprivation ( blindfolding ) . several hours to days blindfolding resulted in rapid , reversible improvement in task performance and recruitment of the visual cortex in nonvisual processing , such as tactile discrimination [ 181 , 182 ] , braille reading , and sound localization [ 184 , 185 ] . rapid cross - modal responses exclude the possibility that these are mediated by the establishment of new anatomical connections . this claim was also supported by sensory substitution devices ( ssd ) studies that the visual cortex was also involved in processing nonvisual tasks after a short period of ssd training in sighted subject [ 50 , 72 , 186 ] . it is possible that a short period of blindfolding and ssd training unmasks and strengthens pre - existing connections between the nonvisual and the occipital cortices . as shown in figure 1 , nonvisual signals can reach the visual cortex via thalamooccipital pathway , corticooccipital pathway , or combinations of these two pathways . an important but unsolved question is the nature of these nonvisual signals : stimulus - driven or top - down . the stimulus - driven signals refer to those from sensory organs or early sensory cortex , whereas the top - down signals are refer to those who came from the higher - level cortical regions . clarifying this question can help us to understand the neural mechanisms underlying cross - modal recruitment of the visual cortex and to design appropriate interventions to improve the adaptive capacity of blind subjects to the external environments . the following evidence supports stimulus - driven nature of the nonvisual signals that reach the visual cortex . these nonvisual signals can be conveyed from sensory organs to the visual cortex via rewired thalamic - cortical pathway [ 133139 ] and those from the nonvisual primary sensory cortices via the direct corticooccipital connections ( such as from a1 to v1 ) [ 153 , 156 , 157 ] , which bypass the higher - tier cognitive cortex , so the inputted nonvisual signals may not be modulated and reflect the pure stimulus - driven information . the involvement of the visual cortex in nonvisual perception in both sighted [ 45 , 46 , 72 ] and eb [ 37 , 42 , 50 , 6163 , 66 , 68 , 69 , 80 ] subjects also suggests the stimulus - driven nature of these nonvisual signals because the top - down effects such as visual imagery and attention were well controlled in these studies . the event - related potentials ( erps ) studies demonstrated that the n1 component of occipital response following nonvisual stimulation was as early as the typical component of the visual perception in eb subjects [ 76 , 77 , 187 ] . for example , a recent report showed that the shape - selective activity in the loc was present as early as 150 ms following the onset of tactile stimulation , which support the stimulus - driven somatosensory input to the loc . according to the top - down mechanism , the peripheral auditory / tactile signals are firstly modulated and refined by the higher - level cortical regions , such as the multisensory associate areas ( vlpfc , ppa , and sts ) , and then feed back to the visual cortex through the indirect corticooccipital pathway and cortico - thalamooccipital pathway ( figure 1 ) . the existing anatomical feedback projections from higher - level cortical regions to the thalamus and visual cortex support this top - down mechanism [ 132 , 155 , 159 , 163 , 170 , 171 ] . furthermore , many task - evoked and lesion studies have demonstrated the modulation effects of the fronto - parietal network on the thalamus and visual cortex [ 165 , 188191 ] . it seems that in cb subjects , the top - down attention modulation of the occipital activity was strengthened [ 75 , 96 , 192195 ] . visual imagery , a complex mental process , can also activate the specific visual areas that are usually recruited by certain visual properties ( shape , space , and color ) , which supports the top - down controlling the visual activities [ 102108 ] . it should be noted that the earlier erp response can not exclude the effects of top - down modulation , because top - down attention can also module the early components of erp , for example , the n1 negativity or even earlier peak [ 196 , 197 ] . furthermore , a erp study demonstrated that the top - down attention modulation of the occipital activity was significantly strengthened in eb subjects . the following paragraphs state the two popular cognitive processes ( visual imagery and attention ) that might contribute to the top - down recruitment of the visual cortex . visual imagery mechanism supports the hypothesis of top - down recruitment of the visual cortex because the mental progress can recruit the visual cortex [ 102108 ] . for example , kosslyn et al . showed that the visual areas 17 and 18/19 were activated by a stripe imagery task , and rtms delivered to area 17 did disrupt both visual perception and imagery performance . this study indicates that the early visual areas are involved in at least some forms of visual imagery as well as in visual perception . it is interesting to noted that not only the early visual area , but also the higher - tier ones can specifically respond to the visual imagery task , including the ventral stream for shape imagery [ 47 , 198200 ] , and the dorsal stream for motion and spatial imagery [ 107 , 108 , 201203 ] , which highly corresponded with the hierarchy representation of the visual perception . de volder showed that in both sighted and eb subjects , auditory triggered mental imagery of shape can also activate the ventral occipitotemporal and visual association areas . top - down attention may be the most extensively studied cognitive process that can modulate the activation of the visual cortex [ 204208 ] . it is proposed that visual attention modulates visual processing even at an early stage ; it not only modulates the gain on incoming visual information , but also adds a pure top - down signal that increases baseline activity in the visual cortex ; moreover , attentional modulation can exert on different aspects of visual perception , such as locations , features , objects , or a combination . furthermore , not only the visual attention , but also the nonvisual attention can also activate the visual cortex [ 207 , 209211 ] . in the cb subjects , electrophysiological or neuroimaging studies have revealed that the top - down attention modulation was strengthened when they performing tactile / auditory attention - demanding tasks [ 75 , 111 , 112 , 212215 ] . additionally , the occipital cortical areas were activated in the cb subjects by attention tasks through nonvisual modalities [ 60 , 96 , 194 , 216 , 217 ] . in combination with evidence of attention modulation on visual perception in the sc [ 218220 ] , these findings indicate increased top - down attention modulation of occipital activity in the cb . in summary , the nature of the nonvisual signals to the visual cortex may be either stimulus - driven or top - down , or both . indeed , effective connectivity analysis offers evidence for the coexistence of both bottom - up and top - down information flows during nonvisual perception [ 221223 ] . the cross - modal processing of nonvisual signals in the occipital areas in both sighted and eb subjects suggests that the functional organization of the visual cortex is supramodal in nature . the cross - modal plasticity can also account for parts of the findings in the eb subjects . the normally existing thalamo - cortical and corticooccipital pathways provide anatomical evidence for the supramodal nature of the visual cortex . the cross - modal plasticity in the eb might be driven by two neural mechanisms : rewiring and unmasking , although there is lack of in vivo evidence for the former . further studies with more advanced in vivo imaging techniques should be implemented to clarify this issue . finally , the nature of the nonvisual signals to the visual cortex may be either stimulus - driven or top - down , or both . further understanding the issue may help us to design appropriate interventions to improve the adaptive capacity of blind subjects to the external environments .

germ cell tumors are congenital tumors frequently seen in gonads , containing derivatives of all the 3 germinal layers . the first omental dermoid cyst was described by lebert in 1734 . to date , only 29 cases of teratoma of the omentum have been published . the present report describes such a case of primary omental teratoma encountered in a young patient which was managed by surgical resection . a 9-year old girl presented with a dull aching , huge lump in the right flank which had been noticed by her mother three months before . general physical examination and systemic examination was unremarkable . on abdominal examination , a large , non - tender lump measuring 2016 cm on the right side involving almost half of abdomen with a nodular surface , cystic consistency , felt mobile , and was free from intraperitoneal viscera and abdominal wall . the hematologic , coagulation , biochemical parameters , including tumor marker tests , revealed no elevation of cancer antigen ( ca125 , ca199 , carcinoembryonic antigen and alpha - fetoprotein ) . plain abdominal x - ray showed a large soft - tissue mass with foci of calcification in the right lumbar region . abdominal ultrasonogrphy showed a 171310 cm intraperitoneal mass in the right lumbar area extending into the hypochondriac , umbilical , iliac region , and pushing the kidney laterally . contrast enhanced computed tomography ( cect ) of the abdomen revealed a variable - density intraperitoneal mass with solid , cystic , and fatty components and evidence of foci of calcification in the same location , free from all the viscera with a vascular pedicle arising from internal iliac artery . the mass was pushing the kidney and the abdominal aorta laterally , the inferior vena cava anteriorly , and was seen to cross the midline ( figure 1 ) . fnac from the mass had shown large lenticular cells of embryonal origin suggestive of germ cell tumor . figure 1cect study of abdomen reveals ( a , b ) a large heterogenous moderately enhancing interperitoneal mass showing solid and cystic component with a vascular pedicle from internal iliac vessel as noted on ( c ) coronal reconstruction images . cect study of abdomen reveals ( a , b ) a large heterogenous moderately enhancing interperitoneal mass showing solid and cystic component with a vascular pedicle from internal iliac vessel as noted on ( c ) coronal reconstruction images . at laparotomy , a huge intraperitoneal , boseleted / nodular , highly vascular mobile lump free from surrounding tissue except vascular pedicle from omentum to which it was attached ( figure 2 ) . the uterus was normal in size as were ovarian tubes and ovaries . the cut section of the specimen showing pultaceous material and evidence of focal calcifications ( figure 3b ) . the histopathology report revealed mature cystic teratoma keratinized stratified squamous lining epithelium with a variety of fat cells , collagen , muscular blood vessels and glial tissue ( figure 4a ) . psamoma bodies encircling the vessel wall were suggestive of endodermal sinus tumor ( figure 4b ) . figure 2a huge , nodular , highly vascular mass ; arrows indicate feeders from omentum to which it was attached . after transfixation of pedicle with other feeders tumor was completely excised . a huge , nodular , highly vascular mass ; arrows indicate feeders from omentum to which it was attached . ( b ) cut surface shows a variable consistency with pultaceous material and evidence of focal calcifications . gross specimen . ( b ) cut surface shows a variable consistency with pultaceous material and evidence of focal calcifications . the migratory capacity of germ cells may account for the anatomic variety seen with these tumors , which explains the occurrence of teratoma in the gonads and the midline structures . extragonadal teratomas are thought to arise from primordial germ cells or early embryonic cells , or from totipotential cells . solid and cystic varieties have been identified macroscopically ; the former tends to be malignant while the latter is usually benign . they are typically found in women of reproductive age , but may also appear in young girls and in older women . the etiology of omental teratomas is poorly understood , but three main theories have been proposed to explain their location : i ) primary teratomas of the omentum may originate from displaced germ cells ; ii ) teratomas may develop in a supernumerary ovary of the omentum ; iii ) teratomas may result from autoamputation of an ovarian dermoid cyst with secondary implantation into the greater omentum . although benign teratomas are usually asymptomatic and often diagnosed on routine investigation , as the tumor mass increases , obstructive symptoms can develop . common presenting symptoms include back or abdominal pain , genitourinary symptoms , gastrointestinal symptoms , as well as lower extremity or genital edema secondary to lymphatic obstruction teratomas can cause secondary infection leading to abscess formation ; traumatic rupture with chemical peritonitis has been reported . calcification can be demonstrable in abdominal x - rays in 61.5% of cases , as in our patient . computed tomogram provides better delineation of fat and calcification . magnetic resonance imaging ( mri ) allows for improved soft - tissue resolution and is useful in assessing the local extent of the disease . tumor markers such as cea , ca19 - 9 , and alpha - fetoprotein are expressive for retroperitoneal teratomas . , the differential diagnosis of a cystic mesenteric mass includes duplication cysts , cystic mesothelioma , cystic lymphangioma and liposarcoma . teratomas of the greater omentum are benign lesions , but malignant transformation of cystic teratomas has been described . however , the malignant lesions are managed with a similar approach to their gonadal counterparts . prognosis of benign retroperitoneal teratoma is good after complete resection and recurrences have not been reported , while malignant varieties require chemo- and radiotherapy . teratoma is the most commonly encountered germ cell tumor among the most common ovarian tumors . however , teratomas of the omentum and mesentery are extremely rare . they are usually asymptomatic or can produce compressive symptoms . complete excision is warranted to prevent recurrences and is curative for benign lesions , while malignant lesions are managed with a similar approach to their gonadal counterparts with adjuvant chemo- and radiotherapy .

entomophthoromycosis ( subcutaneous zygomycosis ) is a sporadic subcutaneous infection that is largely restricted to tropical areas of africa , asia , and south america . neither of these two forms occur preferentially in patients with underlying disease or defective immunity . entomophthoromycosis is characterized by the formation of firm and nontender swellings , generally on the extremities , trunk , and rarely other parts of the body . we present a case of a 3-year - old asian boy with a large , rapid - growing zygomycotic lesion of the left thigh which was initially misdiagnosed as a soft tissue tumor , emphasizing the importance of rapid and thorough diagnosis with a high index of suspicion , especially in endemic areas . a three - year - old male child was admitted with the complains of a gradually increasing painless swelling over the left thigh of 6 months duration . there was a history of trauma to the site three months prior to the onset of the present swelling . local examination showed a 14 8 cm nontender indurated subcutaneous swelling on the left thigh over the anterolateral , medial , and posterior aspect . the swelling was firm in consistency with smooth and rounded edges and was freely mobile over the underlying structures . the overlying skin was lobulated and hyperpigmented and showed a 2 cm linear scar . based on the history and clinical presentation , a diagnosis of soft tissue tumor was considered . x - ray of the thigh revealed a soft tissue swelling without any bone involvement . fine needle aspiration cytology of the swelling was suggestive of a spindle cell lesion with few inflammatory cells . the haematoxylin- and eosin- stained sections revealed normal skin with subcutaneous tissue showing inflammatory granulomatous reaction with diffuse and dense infiltration by eosinophils , polymorphs , histiocytes , plasma cells , lymphocytes , and few multinucleated giant cells . the central portion showed fragments of aseptate hyphae surrounded by a peculiar eosinophilic mass and the splendore - hoeppli phenomenon ( figures 1 and 2 ) . periodic acid schiff ( figure 3 ) and gomori methenamine silver ( figure 4 ) stain for fungus showed few , broad , thinwalled , and aseptate fungal hyphae . culture on sabouraud 's dextrose agar after three days of incubation showed furrowed creamy - brown radially folded colonies . lactophenol cotton blue wet mount demonstrated aseptate hyphae and smooth - walled zygospores with characteristic conjugation beaks , which confirmed the fungus to be basidiobolus ranarum . after complete excision and in view of the histopathological report , the patient was started on oral potassium iodide 40 mg / kg per day . after one week of treatment with potassium iodide , oral itraconazole was added in a dose of 100 mg / day and the entire treatment continued for six months . in 1956 in indonesia , lei - kian joe described the first case of entomophthoromycosis in humans ; the infectious agent was basidiobolus ranarum . in 1965 bras reported a case in a jamaican native caused by conidiobolus coronatus . entomophthoromycosis ( subcutaneous zygomycosis ) caused by basidiobolus ranarum manifests clinically as a firm , painless , disciform nodule on the trunk or extremities , which if untreated may enlarge and spread locally , but systemic dissemination is extremely uncommon . rhinofacial zygomycosis caused by conidiobolus coronatus is a locally progressive infection of the nasal cavity , paranasal sinuses , and soft tissues of the face . the microscopic features of both forms of entomophthoromycosis are similar and give rise to an eosinophilic granuloma situated in the subcutaneous tissues . the disease usually occurs in children , less often in adolescents , and rarely in adults . chiewchanvit et al . , studied eight cases of entomophthoromycosis out of which five patients were diagnosed as subcutaneous zygomycosis ( females aged 777 years ) , two rhinofacial zygomycosis ( 26 and 39 years , males ) and one case was of gastrointestinal entomophthoromycosis ( 34 year , male ) . in a study of ten cases of entomophthoromycosis by krishnan et al . , eight were caused by basidiobolus haptosporus , predominantly in children below ten years of age , and thigh was the most commonly involved site , as in our case . entomophthoromycosis has been known as a saprophytic fungus present in soil , decaying fruit , and vegetable matter as well as in the gut of amphibians and reptiles . the mode of infection is not known but it is assumed that traumatic implantation may play a role . the presence of an irregular scar over the swelling in our patient indicated that the infection was probably initiated by penetrating trauma . the infection can be transmitted by insect bites or by transepidermal inoculation with contaminated vegetable matter . cases have been reported in the literature , where subcutaneous zygomycosis presented as a mimicker of soft tissue tumor , synovial sarcoma , and burkitt 's lymphoma [ 1012 ] . in our patient also , such a large size of the swelling , its duration and clinical presentation misguided the clinician to diagnose it as a soft tissue tumor . histologically , basidiobolomycosis is associated with eosinophilic infiltration which was also the case in our patient . this has been postulated to be due to a mixture of th1 ( granuloma ) and th2 type of immune response . this causes the release of cytokines like il-4 and il-10 which in turn are helpful in recruiting eosinophils to the affected site . the other histological features are presence of broad thin walled infrequently septate hyphal fragments enveloped by eosinophilic splendore - hoeppli material . in the past , clinical isolates of basidiobolus were classified as b. ranarum , b. meristosporus , and b. haptosporus . but recent taxonomic studies based on antigenic analysis , isoenzyme banding , and restriction enzyme analysis of rdna indicate that all human pathogens belong to b. ranarum . most patients with entomophthoromycosis respond very well to oral potassium iodide therapy as well to azoles , particularly itraconazole . to summarise , subcutaneous zygomycosis presents as a painless subcutaneous swelling usually in young age . it is usually seen in the natives of asia , africa , and south america . demonstration of the aseptate fungal hyphae on histopathology and confirmation by culture clinches the diagnosis . our experience with this case highlights the importance of awareness and early recognition of this condition to prevent disfigurement produced by advanced disease , misdiagnosis , and unnecessary surgical intervention .

spinocerebellar degeneration or olivopontocerebellar degeneration denotes a group of disorders of varied etiologies manifesting as degenerative changes of various part of the central nervous system . the cerebellum , cerebral cortex , inferior olives , basal ganglia , substantia nigra and the spinal cord are involved . the predominant areas to be affected are the cerebellum and its afferent and efferent pathways including spinocerebellar pathways and fronto - ponto - cerebellar pathways . in severe cases , the degeneration is also seen in the cerebral cortex , basal ganglia and substantia nigra . we describe the anesthetic management of a patient with severe olivopontocerebellar degeneration posted for vaginal hysterectomy . a 45-year - old woman with history of progressive ataxia , dysarthria and intentional tremors presented with complete uterine prolapse . she had difficulty getting up from squatting position , difficulty in swallowing and had episodes of coughing on rapid oral fluid intake . she complained of progressive increase in difficulty in walking and speaking in the last three years . she exhibited signs of recent memory loss but her long - term memory was intact . other signs of autonomic imbalance like postural hypotension , absence of heart rate variability were absent . magnetic resonance imaging ( mri ) of the brain showed atrophy of cerebellar hemispheres , vermis , pons and cerebellar peduncles . prominence and widening of sulci and basilar cisterns were noted with partial atrophy of the frontal , temporal and cerebral lobes . prominence of transverse and sylvian fissures was also noted . no focal mass lesion or hyperintensity the patient was not on any medications , and the treating physician opined that her clinical condition was stable and did not require any intervention till the surgery . electrocardiogram ( ecg ) and routine blood investigations were normal . considering the possibility of erratic response to neuromuscular blockade and risk of aspiration and delayed recovery of airway reflexes , a combined epidural - spinal technique was planned . routine monitoring with 5-lead ecg , nibp and pulse oximetry was started and patient preloaded with 500 ml of lactated ringer 's solution . combined spinal - epidural anesthesia was administered via l2-l3 interspace , 2.5 ml of 0.5% bupivacaine heavy was administered intrathecally and 18 g epidural catheter was passed and fixed at 9 cm ( space located at 5 cm ) . her blood pressure fell to 90/60 mmhg from 130/80 mmhg after 15 min of the procedure . she responded to 6 mg of intravenous ephedrine , and did not require any other vasopressors . epidural top - up of 5 ml of 0.5% bupivacaine was given after two - segment regression after a negative test dose . the surgical procedure lasted for 3 h and was uneventful . at the end of the procedure , her motor recovery was complete within approximately one hour of the surgery with return of her original spasticity and power . there was no progression of her neurological symptoms in one month of follow - up . spinocerebellar atrophy or olivopontocerebellar degeneration belongs to a group of ataxic disorders characterized by diverse neurological symptoms depending on the anatomical site of lesions . the common signs include ataxia , progressing to static and kinetic motion disorders and dysarthria gradually rendering the speech unintelligible . later in the course of the disease the patient can develop other motion abnormalities , signs of parkinsonism , ocular disturbances , autonomic neuropathy and mental deterioration . the etiology of the ataxic disorders can be classified according to the onset and progress of the disease . symmetric ataxias can be classified as acute ( hours or days ) , subacute ( weeks or months ) or chronic ( months to years ) [ table 1 ] . classification of ataxic disorders more than 30 types of ataxias are identified with various mutations . the predominant being spinocerebellar ataxias type 1 through type 22 , friedreich 's ataxia , kearns - sayre syndrome , melas ( mitochondrial encephalopathy , lactic acidosis and stroke syndrome ) , leigh 's disease and ataxia telangiectasia . the clinical features of most of the ataxias overlap , and genotypic evaluation is the basis of classification and predicting the course of the disease . it is important to note that certain ataxias are associated with other disorders relevant to the anesthesiologist like seizures , cardiomyopathy , various heart blocks , diabetes mellitus , scoliosis , and immune disorders like iga and igg deficiency . although difficult to perform , central neuraxial blockade helps in proper positioning of patients with spasticity . the patient had intentional tremors but was comfortable at rest and able to lie down in supine position without discomfort . a comparison of regional and general anesthesia for spinocerebellar disorders autonomic neuropathy and involvement of spinocerebellar tracts pose a threat of unpredictable responses to central neuraxial blockade . autonomic neuropathy has been shown to cause hypotension during positive pressure ventilation . our patient had history of difficulty in deglutition , choking and regurgitation on fluid intake which indicated bulbar muscle dysfunction . scoliosis and muscular dystrophies , though not present in this case , should be ruled out . exaggerated response to barbiturates , and both depolarizing and nondepolarizing muscle relaxants may exist in patients with spinocerebellar atrophy , increasing the potential for prolonged neuromuscular paralysis and mechanical ventilation . circulatory collapse after administering succinylcholine in a patient with diffuse motor neuron disorder has been reported . conversely , resistance to atracurium and increased number of acetylcholine receptors has been demonstrated in patients with multiple sclerosis , who also have spastic paraparesis . peripheral nerves may also be involved in the form of axonopathy , neuronopathy , reduction of number of neurons in anterior horns and dorsal root ganglions . this might cause postoperative neuropathies which may be attributed to the regional technique . unlike diseases like multiple sclerosis which exhibit a relapse pattern , spinocerebellar degeneration there is no evidence of exacerbation of the pathological process in spinocerebellar degeneration after neuraxial anesthesia as judged from the recent case reports . case reports of successful anesthetic management of patients with olivopontocerebellar degeneration in both general and regional anesthesia exists . schmitt et al . , reported use of rocuronium in two children with friedreich 's ataxia posted for scoliosis correction with no appreciable increase in onset and recovery timings . various atrioventricular blocks , attributed to myocardial degeneration and hypertonicity of the vagus nerve , have been reported after general anesthesia . kazunori and zuigan reported two cases of spinocerebellar degeneration managed under regional anesthesia and propofol infusion uneventfully . epidural anaethesia combined with general anesthesia has been administered for abdominal aortic aneurysm repair in a patient with spinocerebellar degeneration . inspite of the concerns for aspiration , laryngeal mask airway has been used uneventfully with propofol and nitrous oxide combination . if intravascular volume is maintained exaggerated hypotension after spinal or epidural - induced further autonomic blockade is unlikely in patients with preexisting autonomic neuropathy . our patient did not exhibit refractory hypotension after regional blockade ( sensory level t8 ) as she did not exhibit other signs of autonomic instability . a combined spinal - epidural technique was preferred to provide adequate muscle relaxation and effective postoperative analgesia .

exstrophy of the bladder is a rare congenital anomaly . with the development of new techniques for repair , the quality of life of patients with exstrophy of the bladder has been markedly improved . however , it is now well recognized that exstrophy of the bladder is associated with an increased risk of bladder cancer . here we present a case in which squamous cell carcinoma developed in the exstrophied bladder mucosa . the patient , a 36-year - old woman with a known case of exstrophy of the bladder had undergone repair of the defect 17 years previously . however , dehiscence of the repair had occurred and the patient continued to leak urine from the lower abdominal wall . six months following this , an ileal conduit urinary diversion was done to prevent the continuous leakage of urine . six month prior to presentation , the patient had noticed an irregular mass arising from the exposed bladder mucosa that was rapidly increasing in size . on examination , a hemispherical growth with an irregular surface was seen in the region of the exposed bladder mucosa ( fig . 1 ) . the computed tomography scan showed a mildly enhancing nodular lesion on the right side of the lower abdomen superficially . a wedge biopsy was taken from the growth , and the results were suggestive of squamous cell carcinoma . the results of a routine hematological evaluation , liver function tests , and a chest radiograph were normal . the patient thus underwent removal of the urinary bladder along with a cuff of the surrounding abdominal wall and pelvic lymph node dissection ( radical cystectomy ) . after resection , there was a full thickness defect of the lower abdomen about 8 cm9 cm in size . to cover this defect , the skin defect was resurfaced with an extended groin flap from the left side and the secondary defect thus created was covered by a split thickness skin graft ( figs . 2 , 3 ) . histopathological examination of the resected specimen was suggestive of well - differentiated squamous cell carcinoma infiltrating the underlying muscle ( stage pt2a ) with dense lymphocytic infiltration of the stroma . all the resected margins and deeper plane of resection were free of tumor ( fig . the patient developed a small collection beneath the flap that was drained by removal of two stitches , and daily dressings were done . the patient is on regular follow - up and is doing well without any evidence of recurrence to date ( 5 months postoperatively ) ( fig . exstrophy of the bladder is a rare congenital anomaly , with an estimated incidence of 1 in 50,000 live births . it is more common in males ( male : female , 5:1 to 6:1 ) . currently , exstrophy of the bladder can be diagnosed antenatally with the use of high - resolution real - time ultrasound . with advances in pediatric medicine and reconstructive surgery , the morbidity and mortality associated with this disease has decreased drastically . in the developing world , however , one may come across these patients at an older age , because there is often a delay before they seek medical advice . chronic irritation and infection leading to metaplastic transformation of the urothelium resulting in malignant changes is the most likely possibility . adenocarcinoma is the most common type in cases of exstrophy of the bladder , accounting for 95% of cases , whereas squamous cell carcinoma accounts for only 3% to 5% cases [ 2 - 4 ] . the treatment of squamous cell carcinoma of the urinary bladder remains similar to the treatment of transitional cell carcinoma . the gold standard of treatment of squamous cell carcinoma of the bladder is radical cystectomy , with no established guidelines for any adjuvant or neoadjuvant therapy . radiation therapy is offered to inoperable cases or those who refuse surgery . in our case , the histopathological examination report confirmed the localized disease ; thus , no consideration to chemo - radiation was given . . the guidelines for follow - up of bladder cancer in general are applied also for patients with squamous cell carcinoma . . recommended annual screening with a physical examination , measurement of serum chemistry indexes , and chest radiograph for patients with pt1 disease ; semiannual evaluation for patients with pt2 disease ; and quarterly evaluation for patients with pt3 disease . repair of the abdominal wall defect created is also an issue when dealing with such cases , because repair under tension may lead to wound dehiscence and accompanying morbidity . the use of mesh for the repair for abdominal wall defects has been well described . another method is the use of a tensor fascia lata flap . in our case , because the defect was smaller , it was covered by mobilizing the rectus sheath on both sides , and skin coverage was done with the extended groin flap . the help of plastic surgery colleagues may be sought when closure of the defect is done . the prognosis of squamous cell carcinoma of the bladder is reported to be poor with an advanced stage at detection . reported a 2-year overall survival of 47.6% with a median recurrence - free survival of 5.1 months . in conclusion , the fact that exstrophy of the bladder is a predisposing factor for the development of bladder malignancies is well known . treatment of such cases , especially the reconstructive part , is difficult , but good results can be obtained in patients who present early with localized disease , especially when a multidisciplinary approach to treatment is adopted .

in the past , the cost and effort of developing a new drug has largely confined successes to large pharmaceutical companies or otherwise well - funded research institutions . although development and use of computer - aided drug design ( cadd ) techniques has provided numerous benefits to the overall process , the expertise required to create powerful commercial software packages has resulted in high licensing costs , thus limiting access to academic groups . fortunately , this trend has started to shift with the emergence of freely available software , such as autodock and several other packages , largely developed by the academic computational chemistry community . however , for the most part , these software packages require familiarity with cadd methodologies and are better suited for computer savvy users that are at least comfortable if not familiar with the computational component of drug discovery . this has hampered the proliferation of cadd tools into less computationally minded drug discovery laboratories . the need for intuitive and easy to use cadd solutions has largely been met by the commercial software companies such as accelrys , schrdinger , and others that have incorporated full - featured graphical user interfaces ( gui ) into their programs . however , as alluded to above , the cost of these packages is typically prohibitive to academic groups and/or institutions . further , it has proven increasingly difficult to strike a balance between software that is user - friendly yet incorporates a wide range of advanced functionality and customizability . for example stand - alone software that requires local installation on every computer may find less use in today s world where researchers expect both the application and the data to be accessible from any machine on any platform from any location . another hurdle , faced by the nonexpert , to incorporating computational modeling into drug discovery efforts is the difficulty of obtaining reliable small molecule parameters . most widely used and well - tested force fields have been developed with proteins and nucleic acids rather than small molecules in mind . until recently this has meant that drug - like molecule parameters have been less reliable , with assignment often arbitrary . lately , however , there has been a significant amount of effort devoted to improving the reliability of small molecule parameters and developing efficient protocols to generate them for a much greater and more diverse chemical space . the charmm interface and graphics ( charmming ) is a web interface to the popular macromolecular modeling package charmm . the goal of the charmming project is to provide a platform - independent web - based front - end that allows its users to set up and perform a wide variety of molecular modeling tasks . charmming s users range from small academic laboratories that benefit from the portal s functionality to educators that include molecular modeling in their curricula and use the portal to facilitate their teaching . moreover , the open source nature of the project allows outside developers to utilize the framework and build on the existing infrastructure , further expanding the range of features it includes . the framework can be easily installed on a private network or adopted into a new web - based interface ; this approach was utilized when developing a virtual target screening ( vts ) server . herein , we describe a similar effort using the charmming infrastructure ( i.e. , built on a python - based django framework with a mysql database ) ; the implementation of a new drug design module that incorporates a fragment - based docking protocol includes a diverse set of drug - like compounds and facilitates creation of charmm friendly protein small molecule systems for further modeling studies . we also assess the performance of the newly implemented docking protocol coupled to charmm s new generalized force field ( cgenff ) by reproducing a series of co - crystallized protein ligand complexes and comparing the results against a leading commercially available docking package . target proteins begin their preparation via charmming s structure submission section . here , tasks such as the addition of hydrogens , identification of any nonprotein moieties , and assignment of final parameters are carried out ( using the latest charmm36 protein force field ) . co - crystallized small molecules ( i.e. , ligands ) are automatically parametrized using the cgenff . specifically , ligand atom - typing and parametrization is performed by sequentially attempting several automated parametrization tools . the default order is ( 1 ) paramchem , ( 2 ) match , ( 3 ) antechamber , and ( 4 ) genrtf . as an alternative to the default order , a user can specify the exact build procedure to use for parametrization . ligand set details page allows the user to manage custom ligand sets . the user can define and describe a custom ligand set as well as add ligands to it from any of the other sets including the preloaded public library . charmming docking module provides a preloaded library of drug - like compounds for virtual screening experiments . the library consists of approximately 8000 molecules from the maybridge hitfinder set ( www.maybridge.com ) . all of the provided molecules have been atom typed according to cgenff convention to comply with charmm requirements and confirmed to decompose into at least three sufficiently sized fragments to meet the fragment - based docking criteria . charmming also allows users to upload ligands by providing a coordinate file in mol2 format . upon uploading , the ligand and corresponding parameter , topology , and structure files are then saved on a disk as well as cataloged in the database . unlike the preloaded compound library , any user - uploaded ligands are restricted to their account only and are not visible to other users . the user is also given the ability to create custom sets of molecules based on any preloaded or user - uploaded compounds . this can be done via the ligand sets section ( figure 1 ) of the docking module . any custom or preloaded set can be docked in its entirety or by selecting individual molecules on the docking submission page ( figure 2 ) . to provide maximum flexibility with respect to job setup , the first approach identifies the binding pocket using the position of a co - crystallized ligand that may be present . in this case , when launching a docking job , a user is presented with a list of all co - crystallized small molecules along with their 2d structural representations . once the desired small molecule is chosen , the binding site is defined via proximity to the aforementioned small molecule . in cases where no co - crystallized ligand is present , or if a user simply wishes to investigate alternative binding sites , we have implemented an interactive and graphical binding site definition tool ( figure 3 ) . to use this tool , two residues should be selected that roughly correspond to the edges of the desired binding region . the midpoint between these residues is then determined and defined as the approximate center of the binding site . on the basis of a user - defined radius , a list of all residues within this distance is compiled and both visually highlighted and presented as a list . the user can then add or remove residues to / from this list by either modifying the text of the residue list , changing the specified search radius , or modifying it via graphical selection ( i.e. , clicking ) . ultimately , all user - defined binding sites are saved and presented as options with any existing co - crystallized ligands at the docking job setup page . page presents the user with the ability to select the target coordinates for docking , define the binding pocket ( vide infra ) , and select ligands to dock from the list of available small molecules . native ligands and ligands available for docking can be visualized in 3d using the embedded visualization application . docking algorithms used in this protocol are based on the popular grid - based paradigm used by most current docking programs . in this approach , the solvent accessible surface area of the target and the ligand as well as the target s binding site the lattice then either stores information about the atoms enclosed by a cubic unit of the grid or contains the potential contributions projected onto the grid s vertices . precomputed grids allow for efficient calculation of both van der waals and electrostatic contributions to the scoring function , facilitating rapid evaluation of ligand placements within the binding site . binding site selection page provides the user multiple ways to select a custom binding site . this can be done either by manually typing in the residue numbers , graphically selecting residues , or defining the centroid and specifying the radius in . the docking procedure consists of several steps where different programs perform distinct tasks . to streamline the communication between the programs and ensure compatibility of input and output data , a series of scripts were written in python , perl , and linux shell scripting languages . the openbabel file conversion utility was used to interconvert between different representations of the protein and compound structures . the program match was used to generate cgenff compatible topologies and parameters . the fragment - based docking protocol implemented in charmming is outlined in figure 4 and described as follows : ( 1 ) each compound to be docked is first broken down into fragments . a fingerprint describing chemical richness is generated for each fragment and its parent compound . the three most chemically rich , but not necessarily different , fragments are identified to serve as anchors for docking . these steps are carried out by the program daim ( decomposition and identification of molecules ) . the user then identifies the binding site to be used in the docking job . all nonprotein nonsolvent compounds present in the submitted target structure are displayed on the submit docking job the user selected compound , the proximal residues are identified and the binding site defined . ( 3 ) the previously identified anchor fragments ( step 1 ) are then docked into the binding site using the program seed ( solvation energy for exhaustive docking ) . the placement of fragments within the binding site is determined by matching either the direction of polar vectors between ligand and receptor atoms to form a hydrogen bond or the apolar vectors on the solvent accessible surface area of the receptor . the seed score , used in fragment placement , accounts for the solvent effects by including terms for both receptor and fragment desolvation as well as a solvent - screened receptor - fragment electrostatic interaction term . ( 4 ) the docked fragments are reconnected into the original ligand while undergoing refinement using the ffld ( fragment - based flexible ligand docking ) program . ffld uses a genetic algorithm that generates and evaluates populations of conformations and positions them within the binding site , as guided by fragment anchor locations . the fitness of a placed conformation is evaluated using a scoring function that is aimed at approximating the steric effects as well as hydrogen bonding contributions of the protein ligand van der waals interaction terms as well as polar contributions based on the number of hydrogen bonds and unfavorable donor donor and acceptor acceptor interactions . ( 5 ) poses generated by ffld that are within a user - defined energy cutoff ( 10 kcal / mol by default ) are then clustered using a leader clustering algorithm implemented in the program flea ( ffld leader clustering ) . ( 6 ) following the clustering , the protein ligand complex is converted to native charmm format and saved . using these files , in addition to the charmm protein and generalized force fields ( i.e. , charmm36 and cgenff ) , protein structure ( psf ) and coordinate ( crd ) the minimized protein ligand complexes are then scored using seed and ffld in their evaluation only mode , producing their own estimation of electrostatic , van der waals , and total energy contributions for each pose . the final ranking of the docked poses is performed using a consensus approach . for this , energies ( i.e. , interaction energy from charmm and total energies from seed and ffld ) are used to create three lists in which individual poses are sorted and ranked . the final rank of each pose is then set to the median of the three ranks as assigned in the individual lists . the consensus approach to scoring or ranking compounds when performing molecular docking or virtual screening studies has been shown to be more accurate than single scoring methods . schematic of the fragment - based docking protocol implemented into the charmming web user interface . depicted are the three main stages of the docking : decomposition by daim , fragment docking by seed , and ligand placement by ffld . when a docking job is launched , the pbs ( portable batch system)-based queuing system torque accepts the job as a wrapper shell script that controls the entire docking procedure . using the interface , a job can be monitored in real time as it progresses and generates final poses for each docked compound . basic job statistics such as submission time and job status can be monitored along with the output file reflecting the job progression ( figure 5 ) . in addition , important files associated with job progress and results ( e.g. , final docked ligand poses , job output , etc . ) protein , ligands , compounds in the library , and final docked poses can all be visualized directly in charmming . the 3d structure of each of the above elements can be rendered with the jsmol or glmol visualization tools . structures can be visualized using a variety of representations to highlight important structural features or interactions of the molecules and their complexes . page provides general job information as well as the list of docked poses and their respective scores . the docked poses can be visualized in 3d within the binding pocket of the protein using the embedded visualization application . an archive of the job directory can also be downloaded from this page for execution on local resources . a walk - through outlining the entire process of performing a redock on a sample system is included in the tutorial covering basic charmm and charmming functionality at www.charmmtutorial.org . additionally , a docking lesson that guides a user through the redocking procedure has been added to the lessons section of the charmming web site . currently , all docking jobs executed via the web interface are carried out sequentially . however , after initial setup of the docking job , all necessary files are available for download and execution on local computational resources . to improve performance of this procedure , we have developed a protocol that can be carried out in parallel as outlined in figure 6 . this is achieved by spawning a new execution branch for each of the most time - consuming steps in the protocol via a user - modifiable job queuing command . for example , each fragment of each molecule is docked ( step 3 , vide supra ) as a separate submitted job . once all of a molecule s anchor fragments are docked , the placement of a ligand within the binding site by ffld is also spawned as a series of separate jobs . furthermore , to increase sampling by ffld and improve performance , the protocol performs multiple docking iterations per ligand , again each as a separate job . thus , instead of one docking job that attempts to sequentially sample a large conformational space per ligand , multiple shorter iterations with different random seeds are run in parallel , taking less real time and still sufficiently sampling ligand conformational space . the number of iterations per ligand as well as the amount of energy evaluations per iteration are all user modifiable parameters . parallelization of the docking protocol is achieved by spawning new job execution threads at both the fragment docking ( i.e. , one per fragment ) and ligand placement ( i.e. , one per iteration per ligand ) steps . clustering and scoring threads are also spawned for each docked ligand . in order to execute a job on local resources , the following programs need to be downloaded and installed : vmd , daim , seed , ffld , flea , match , and charmm . except for charmm , daim , seed , ffld , and flea can be obtained from the university of zurich s computational structural biology lab ( www.biochem-caflisch.uzh.ch/download ) . further , a more general description of the installation process is included as part of the charmm tutorial and can be found at the following web address : www.charmmtutorial.org/index.php/installation_of_charmming . once the job directory is downloaded and the software is installed on local resources , the provided settings file should be used to specify the location of program executables . in addition , job details ( e.g. , protein file name , number of docking iterations , clustering energy cutoff , etc . ) can be modified via the settings file . this file is also where pbs / torque commands can be modified for local resources . because there is no limit to the number of possible parallel processes spawned , the protocol checks for available resources and will wait for current processes to complete if the queue is full . the protocol will automatically take advantage of all available resources to speed up job completion while at the same time adhering to the local queuing system policies . to assess the performance of the docking protocol , a diversity set was constructed from the publicly available ccdc / astex test set containing high - resolution x - ray complexes and an augmented version of that set , which has been used to compare the performance of a number of docking programs . our final set contained 24 protein ligand complexes with x - ray resolutions ranging from 1.502.30 . in particular , we selected complexes where the ligand could be decomposed into three fragments ( i.e. , at least three rotatable bonds ) using the default settings of daim , as the ultimate goal was to evaluate the implementation of the decomposition - based approach . redock validation involved removing the co - crystallized ligand from the complex , redocking it via the fragment - based protocol , and comparing the docked pose to that of the original crystal structure . each complex was processed using charmming s submit structure section that downloads the structure based on the pdb code , adds hydrogen atoms , and prepares the structure for modeling using charmm . further , each system containing the protein , solvent , and ligand molecules was briefly minimized for 100 steps using the steepest descent method followed by 1000 steps of abnr using charmming s calculations module . using the ligand upload section of charmming s docking module , the previously downloaded ligand was processed . the docking calculation for each minimized system was set up by selecting a native ligand to define a binding pocket and user - uploaded ligand for docking , all from the the progress of each job was monitored using the job monitoring section of the docking module . to assess the performance of the dockings , root - mean - square deviation ( rmsd ) between the heavy atoms of the docked poses and the crystal structures redockings were performed using schrdinger s glide standard precision ( sp ) docking protocol . glide s sp protocol attempts to dock multiple conformations of a ligand into a receptor grid , subsequently calculating the effective ligand conformational sampling of the ligand is achieved via varying torsion angles around rotatable bonds . prior to docking , each target the preparation included removal of solvent molecules , addition of hydrogens , and brief minimization . as glide is also a grid - based docking protocol , the grids , similar to charmming s procedure , were built using the co - crystal ligand to define the binding region . the native ligand was removed and redocked using default parameters of the sp docking protocol . the poses with the best docking scores were used to calculate their respective rmsd from the crystal structure using vmd . table 1 reports the rmsd of poses generated by charmming s fragment - based docking protocol and glide sp docking ( w.r.t . results reported from charmming s fragment - based docking protocol correspond to the pose closest to the crystal structure . this set yields a 71% success rate using rmsd < 2.0 as the metric ; this criteria is commonly employed for evaluating the performance of docking algorithms . this clearly shows that the protocol can successfully recover the crystal pose in the majority of the cases . we are currently optimizing a consensus scoring function based on this diversity set ; results of that effort will be reported in a subsequent publication . nevertheless , virtual screening is known to suffer from a high false - positive rate , which does not diminish its value in drug discovery as the unfit compounds are screened out during the experimental stages of the discovery campaigns . regardless , we are encouraged by the success of fragment - based docking , which shows approximately the same performance as widely used docking programs , i.e. , within the range of 4090% . best rmsd glide sp rmsd is of the top scoring pose of glide s standard precision docking . the fragment - based approach that was implemented into charmming yields a substantial amount of information about the characteristics of each docked pose . at each step , from decomposition to minimization of docked poses , users have the ability to closely analyze results . the binding modes of each individual fragment can be inspected , and a number of modifiable parameters , such as decomposition criteria , can be used to optimize the protocol . moreover , information gained from docking a fragment library into a particular target can be used to mine large libraries for compounds containing those fragments that form the most favorable interactions with the target . there are potentially a number of improvements that can be made to improve the performance and usability of charmming s docking protocol . the most obvious limitation is the current requirement of three fragments to be used as anchors . as shown by the number of ligands eliminated from the original benchmarking set , this limits the applicability of this protocol in its current form to medium- to large - sized molecules with a sufficient number of rotatable bonds . although partially this problem can be alleviated by decreasing the fragment richness threshold at the decomposition step , this will only increase the eligibility rate of molecules by a small margin . alternatively , when docking these small and/or rigid molecules is desired , the decomposition step could be omitted , at which point the molecules would undergo docking only by seed . this however will require prior conformation sampling step as seed currently does not sample the internal conformation of docked fragments . the conformational sampling of the fragments is an obvious improvement to the docking protocol even in its current state . this addition will help ensure that larger fragments sample their orientations within the binding site while varying their internal geometry , thus ensuring greater enrichment of anchor positions for the final ligand placement . we have implemented a fragment - based docking protocol into the charmming web interface . the protocol allows users to perform docking and virtual screening calculations online as well as generates self - contained scripts to execute these in parallel on local hpc resources . the performance of the docking protocol was evaluated by carrying out a series of redockings and comparing the results against a top commercial docking package . the fragment - based docking protocol yielded results comparable to both the commercial package used herein and a wide variety of additional docking software . specifically , the rate of recovering the correct x - ray pose with charmming s protocol was 71% , well within the 4090% range that numerous benchmarking studies have reported . while the scoring function can still be improved , the tool lays substantial groundwork for allowing academic laboratories to set up and perform molecular docking and virtual screening studies . it is important to note that the protocol is able to create charmm - formatted protein ligand systems giving users the ability to access the wide range of functionality that exists in charmm . for example , docked poses can easily be refined with md simulations , and predocked proteins can be coupled with simulations or normal - mode analysis to proceed via an ensemble docking approach .

the ehlers - danlos syndrome type vi ( edsvi ) is an autosomal recessive connective tissue disease which is characterized by severe hypotonia at birth , progressive kyphoscoliosis , skin hyperelasticity and fragility , joint hypermobility and ( sub-)luxations , microcornea , rupture of arteries and the eye globe , and osteopenia . the enzyme collagen lysyl hydroxylase ( lh1 ) is deficient in these patients due to mutations in the plod1 gene . we report a 17-year - old boy , born to related parents , with severe kyphoscoliosis , scar formation , joint hypermobility and multiple dislocations , muscular weakness , rupture of an ocular globe , and a history of severe infantile hypotonia . eds vi was suspected clinically and confirmed by an elevated ratio of urinary total lysyl pyridinoline to hydroxylysyl pyridinoline , abnormal electrophoretic mobility of the -collagen chains , and mutation analysis . because of the high rate of consanguineous marriages in iran and , as a consequence thereof , an increased rate of autosomal recessive disorders , we urge physicians to consider eds vi in the differential diagnosis of severe infantile hypotonia and muscular weakness , a disorder which can easily be confirmed by the analysis of urinary pyridinolines that is highly specific , sensitive , robust , fast , non - invasive , and inexpensive . the ehlers - danlos syndrome is a heterogeneous group of inherited connective tissue disorders characterized by skin hyperelasticity and fragility , and joint hypermobility . they have been classified into types i ( omim 130000 ) , ii ( omim 130010 ) , iii ( omim 130020 ) , iv ( omim 130050 ) , viia and viib ( omim 130060 ) with autosomal dominant inheritance and types vi ( omim 225400 ) , viic ( omim 225410 ) , and other types ( omim 606408 and 612350 ) with autosomal recessive inheritance[1 , 2 , 3 ] . the ehlers - danlos syndrome type vi ( eds vi ) , also called the kyphoscoliotic type , is characterized by severe hypotonia at birth , joint laxity , hyperextensible and fragile skin , severe progressive kyphoscoliosis , osteopenia , and rupture of arteries and of the eye globe[1 , 2 ] . the exact prevalence of eds vi is unknown but estimated to be world - wide approximately 1:100,000 live births . eds vi is caused by deficient lysyl hydroxylase ( lh1 ) , an important posttranslational modifying enzyme of collagen synthesis due to mutations in the plod1 gene . this enzyme catalyzes the hydroxylation of collagen lysyl residues to hydroxylysyl residues which are essential for the formation of stable collagen cross links , thus confining collagen its tensile strength ; furthermore they are necessary for the attachment of galactosyl and glucosyl - galactosyl residues . a second , rarer form of eds vi has been described , eds vib ( as opposed to eds via ) , in which patients have a similar clinical phenotype of eds vi but with normal levels of lh1 activity , absence of mutations in plod1 , and normal cross links . deficiency of lh1 gives rise to an abnormal pattern of lysyl pyridinoline ( lp ) and hydroxy - lysyl pyridinoline ( hp ) cross links formed in vivo and excreted in the urine . the ratio of urinary total lp to hp in patients with eds vi is much higher compared to normal controls[2 , 3 , 8 ] . hence , we can take advantage of this finding and use it as an inexpensive tool for the diagnosis of eds vi . at least 30 different mutations in the plod1 gene have been identified ( giunta et al , in preparation ) . here we report a 17-year - old boy with typical clinical features , and biochemical and molecular findings of eds vi , and emphasize the differential diagnosis of muscular disorders . the second and third children , a boy and girl , died at 1 year and 5 days of age , respectively , of unrelated cause . pregnancy , delivery at term , and neonatal adaptation were uneventful ; his weight was 3,000 grams but length and head circumference were not recorded . severe hypotonia was noticed since birth and kyphoscoliosis developed during the first months of life . because of muscular weakness he had to be bottle - fed with a large - holed teat . he could stand without support at 2 years and started to walk at 2.5 years . he also had speech delay and could say his first words at the age of 20 months . he went to school for 5 years but did not continue because of his motor disabilities . although intelligence has not been formally evaluated , based on his relative good performance at school we believe that there is no mental retardation . he had a history of rupture of the ocular globe at age 15 years after his father 's elbow accidentally hit his face , and of multiple dislocations of both wrists and ankles . on physical examination at the age of 17 , his height , weight and head circumference were 165 cm , 70 kg , and 55 cm , respectively . 1a ) , microcornea ( 9 mm in diameter as opposed to 1112.5 mm in controls ) , ptosis , prosthetic left eye , and slightly bluish sclera . the skin was soft , with multiple scars on knees due to poor healing , and with hyperkeratosis follicularis ( fig . he also had hypermobile joints ; however , hyperelasticity of the skin was not prominent . muscle force was estimated to be 34 ( had active movement against gravity and some movement against resistance ) ; however , reflexes and muscle bulk were normal . 2a ) as well as distraction of the symphysis pubis and protrusio acetabuli ( fig . 2b ) , and downward slanting and thinning of the ribs ( not shown ) . bone mineral density ( norland xr-36 ) was normal in spine ( 0.991 mg / cm ) and hip ( 0.991 mg / cm ) but decreased in the femur ( i.e. , 0.810 mg / cm which is 1.2 sd below the age - matched reference ) . clinical aspects of the patient a : face with down - slanting axis of the eyes ( left ) ; b : kyphoscoliosis , hypotonic posture , and adiposity which is unrelated to eds vi ( middle ) ; c : skin over the right knee with scars and hyperkeratosis follicularis ( right ) radiograms ; a : spine with scoliosis , osteopenia , and platyspondyly of l3 b : pelvis with distraction of the symphysis pubis and protrusio acetabuli creatine phosphokinase , electromyogram , and nerve conduction velocity were normal . the ratio of urinary total pyridinolines , lysyl pyridinoline to hydroxylysyl pyridinoline , in the patient was 7.1 ( controls : 0.200.03 ; eds vi : 5.991.00 ) and slightly increased ( 0.25 and 0.23 ) in the father and the mother , respectively , as also observed in other obligate heterozygotes . electrophoretic mobility of the - and -collagen chains of the various collagen types produced by cultured fibroblasts , performed as reported , was faster than normal which indicated that the lysyl residues were not hydroxylated and that there were no galactosyl and glucosyl - galactosyl residues attached . mutation analysis , performed as described , on dna of the patient showed a novel homozygous non - sense mutation in exon 12 of the plod1 gene at position 1302 of the cdna sequence ( c.1302 c > g ) which leads to a premature stop at amino acid position 434 ( p.y434x ; see also ) . severe muscular hypotonia and kyphoscoliosis at birth , generalized joint laxity , and rupture of the ocular globes are considered major diagnostic criteria for eds vi whereas tissue fragility including atrophic scarring , easy bruising , arterial rupture , marfanoid habitus , microcornea , radiographically considerable osteopenia , and positive family history are classified as minor diagnostic criteria for the disease . since severe muscular hypotonia , joint laxity and kyphoscoliosis which are three of the major criteria for eds vi are also common findings in neuromuscular disorders such as ullrich muscular dystrophy and bethlem myopathy , physicians are often misled to suspect them in eds vi patients . bethlem myopathy ( omim 158810 ) and ullrich muscular dystrophy ( omim 254090 ) present with muscular weakness , hyperextensiblity of joints , and kyphoscoliosis and are caused by mutations in collagen type vi . bethlem myopathy is an autosomal dominant disease characterized by proximal muscular weakness and joint contractures mainly involving the elbows , ankles and fingers whereas ullrich congenital muscular dystrophy is transmitted in an autosomal recessive mode and is characterized by severe muscular weakness of early onset so that children usually never develop the ability to walk because of contractures of proximal joints and hypermobility of distal joints . scar formation due to poor healing is also evident in these patients[15 , 16 ] . the similarities of these conditions and eds vi are striking and comprise severe hypotonia , kyphoscoliosis , hypermobility of joints and fragile skin causing scar formation . hence , extensive neuromuscular work - ups are performed usually in these patients yielding normal results before the diagnosis of eds vi is considered . the clue that could help physicians distinguish between eds vi and neuromuscular disorders , specifically ullrich muscular dystrophy , is the presence of microcornea , a possible history of rupture of arteries and of ocular globe , and osteopenia . the hypermobility of ullrich dystrophy is limited to distal joints while in eds vi all joints are involved . our patient had remained undiagnosed until the age of 17 , despite the presence of all four major , as well as all minor criteria ( except for arterial rupture ) . multiple organ involvements , such as skin , muscle , bone and eye , made a diagnosis difficult . indeed , a neuromuscular disorder was initially suspected based on the combination of severe hypotonia , delayed motor development , kyphoscoliosis and multiple dislocations . however , the presence of a positive history for ocular globe rupture , of velvety skin , microcornea and osteopenia a pattern specific for eds vi helped us to reach the correct diagnosis without having to perform an invasive neuromuscular workup . despite being considered a minor criterion , microcornea is a common finding in many of the previously reported eds vi cases as well as in our patient ; osteopenia and recurrent joint dislocations are common findings , too , and were recorded in our patient as well . ocular fragility is found in a minority of eds vi individuals and may lead to rupture of the globe after minor trauma as occurred in our patient . vascular rupture , which is a life threatening complication , is absent in our patient at this age , and his parents were made aware of this potential complication later in life and were given advice in case of emergency for timely attending a hospital . we suggest that physicians should consider eds vi as one of the differential diagnoses in floppy infants and muscular weakness . the presence of positive findings such as microcornea , osteopenia , ocular rupture , arterial rupture is specific for eds vi and can lead to the correct diagnosis . if eds vi is suspected analysis of urinary pyridinolines should be performed next to confirm the diagnosis . the pyridinoline analysis is a sensitive , specific , robust , quick , and inexpensive method that reliably rules in or out eds vi and helps to avoid an invasive neuromuscular work - up . in case of positive results further molecular testing is available to identify the disease causing mutation(s ) and thus allows offering prenatal diagnosis for future pregnancies . to the best of our knowledge although the world - wide prevalence is estimated as low ( 1 in 100.000 live births ) it might be more frequent in iran because many of the reported and unreported ( giunta et al . in prep . ) cases originate from turkey , greece , and middle east countries in which consanguineous marriages are frequent . with this case report we hope to increase the awareness of this connective tissue disorder and to help in the work - up of muscular weakness .

the vis - oct system enables the quantification of both retinal so2 and retinal blood flow in vivo . using a supercontinuum laser as a light source ( center wavelength : 568.5 nm ; bandwidth : 107 nm ; superk nkt photonics , birkerd , denmark ) , we built a free - space spectral - domain ( sd)-oct ( fig . 1a ) with the theoretical axial resolution being 1.3 m in air . to quantify retinal so2 , we raster - scanned 256 256 a - lines onto the mouse retina to acquire a retinal fundus image , covering a 1.05 1.05 mm area centered at the optic disc ( fig . by analyzing the reflected light spectrum from each retinal vessel , we determined the corresponding so2 value ( fig . 2 ) . to quantify the retinal blood flow , we measured the phase shifts , vessel size , and doppler angles ( fig . , 16 pairs of small - big rings were scanned onto a mouse retina centered at the optic disc . the radius was 0.31 mm for the big scanning ring , and 0.21 mm for the small scanning ring , with 4096 a - lines in each ring . during the experiments , we first performed the raster - scanning , and then the dual - ring scanning protocol . the a - line rate was 25 khz for both scanning protocols . experimental setup and scanning protocols . ( b ) raster - scanning protocol to acquire the retinal fundus image and measure retinal oxygen saturation ( so2 ) . l1 to l5 are lenses ; bs , beam splitter ; dc , dispersion compensation . ( b ) sample b - scan from the red dashed line in ( a ) . ( c ) short - time fourier transforms with different center frequencies ( green , light green , and red ) performed on the spectral interferogram ( blue line ) . ( d ) sub - band b - scans of the vessel in ( b ) denoted by the red dashed circle . ( c ) sample phase - shift b - scan image from the small scanning ring . ( h ) total blood flow rate in the retinal arterial and venous vascular system . scale bar : 200 m . the procedure for retinal oximetry with vis - oct was reported in great detail previously . 2a ) , and reconstructed the cross - sectional b - scan using the full band of the spectral interferogram . from the cross - sectional b - scan 2b ) . as illustrated in figure 2c , short - time fourier transforms ( stft ) , with different band center frequencies ( depicted as the gaussian - shaped colored curves ) , were performed on the spectral interferogram ( blue line ) to reconstruct sub - band b - scans . examples of the obtained sub - band b - scans , for the circled vessel in figure 2b , are shown in figure 2d . the bandwidth for each of the stfts was 15 nm , which reduced the axial resolution of each sub - band b - scan to 9.5 m . although the axial resolution was reduced , it is still sufficient to resolve the major murine retinal vessels , which have vessel diameters of 40 m or more . using the already determined vessel coordinates , we extracted the oct signal from the bottom of the vessel across all the sub - band b - scans , as highlighted by the arrows in figure 2d . examples of the obtained oct signal spectra , for an artery and a vein , are shown in figure 2e . to obtain the so2 from the oct signal spectra , we needed to model the reflectance and attenuation of the oct signal by using the optical attenuation coefficient of oxygenated hemoglobin ( hbo2 ) and deoxygenated hemoglobin ( hb ) as follows : here i0 is the incident intensity on the retina , and r0 is the reflectance of the reference arm . the spectral behavior of r was as scattering under first - order born approximation , which is given by the power law function : r( ) = a. here , a and are constants . the exponential term in equation 1 is attenuation according to beer - lambert 's law , where n is the mean refractive index of the blood ( 1.35 ) , and hbo2 and hb denote the attenuation coefficients . the backscattered light experiences two - way ( round - trip ) attenuation through the blood vessel diameter , d [ m ] , hence the factor of 2 in the exponential expression . the wavelength - dependent attenuation coefficients ( hbo2 and hb ) incorporate both the absorption coefficient ( a ) and scattering coefficients ( s ) of the whole blood ( figs . our previous investigation suggested the relationship between the attenuation coefficient , absorption coefficient , and scattering coefficient as follows : to obtain so2 , the oct signal spectra for each vessel was fit to a modified form of equation 1 ( see appendix ) using least - squares ( ls ) fitting . this retinal oximetry technique using vis - oct has been validated in silico with monte carlo simulations , in vitro with artificially oxygenated bovine blood and a commercial blood gas analyzer , and in vivo with systemic hypoxia experiments and a commercial pulse oximeter . doppler sd - oct can measure only the projected flow along the probing beam . to achieve the absolute flow measurements , the doppler angle , which is the angle between the probing beam and blood flow , we used the dual - ring scanning protocol to simultaneously extract the projected flow and doppler angle . figure 3a shows the geometry of the dual - ring scanning protocol . using this geometry , equations for the doppler angle , we see that the doppler angle requires the three - dimensional vessel axis coordinates , hence the requirement for two circular rings in the dual - ring method . figure 3b shows an example of a mouse fundus with the scanning paths of the dual rings . figure 3d shows the calculated doppler angles of all the vessels in this example retina . after acquiring the doppler angles , we calculated the absolute retinal blood flow velocity v ( m / s ) as follows : where fsample ( khz ) is the a - line rate ; 0 ( nm ) is the center wavelength of the sd - oct ; is the phase shift ( rad ) ( fig . 3c ) between adjacent a - lines after bulk motion correction ; n is the refractive index of the sample ( n = 1.35 ) ; and [ degree ] is the doppler angle . 3c ) in experiments ; to correct this , the axial blood flow direction is necessary . the flow direction is recognizable from the phase shifts near the vessel border , where low flow velocity prevents phase - wrapping . assuming the actual phase < 0 , we corrected the phase - wrapping as follows : for the actual phase that is > 0 , we corrected the phase - wrapping as in this study , we had 16 pairs of big - small ring scanning , providing 32 continuous b - scans . we tested the measured velocity stability by averaging the velocity results across different cumulative b - scans and comparing the mean velocity difference between adjacent cumulative b - scans . we considered the velocity stable if the velocity difference was smaller than 0.1 mm / s between adjacent cumulative b - scans . after averaging results across 20 b - scans ( fig . the velocities for the sample retina are shown in figure 3f , where the arterial flow has positive velocities running from the optic disc to the peripheral retina , and the venous flow has negative velocities draining blood from the peripheral retina to the optic disk . we measured the vessel diameter dia ( m ) in the axial direction in the oct b - scan structural , the actual vessel diameter dia_r ( m ) was : where ( radians ) is the doppler angle . the vessel cross - sectional area z ( m ) was : with the absolute velocity and vessel size , the corresponding blood flow in the ith vessel was determined : where vi is the average velocity and ai is the vessel cross - sectional area . we calculated the total blood flow ( f [ l / min ] ) by summing all blood flow in the retinal arterial / vein vascular system , as shown in equation 9 : where n is the total number of retinal arteries or veins . we calculated the irmro2 as follows : where wo2 and whbo2 are the molecular weights of o2 and oxygenated hemoglobin , which were 32 and 68,000 ( g / mol ) , respectively . [ hbt ] is the hemoglobin concentration in the mouse , which was measured to be 150 ( g / l ) ; so2a and so2v are the mean so2 values in the artery and vein vascular system , respectively . we can convert ng / min to l / min as : where v is the volume of gas ; ng is the number of moles of gas ; r is 8.3145 ( jmolek ) ; t is the blood temperature ( 311.15 k ) ; and p is the standard atmospheric pressure ( 101,325 pa ) . statistic results were obtained from seven akita/+ , tsp1 dr mice and seven tsp1 control mice , respectively . retinal vessel sample preparation and ec , pc quantification can be found in our previous article . in this study , all retinal vessel preparations , ec and pc number counting were performed on 13-week - old mice . we fixed mouse eyes in 4% paraformaldehyde for 24 hours , bisected equatorially , and removed the entire retina . the retinas were washed overnight in distilled water and incubated in 3% trypsin ( trypsin 1:250 ; difco , bd diagnostic systems , sparks , md , usa ) prepared in 0.1 m tris , 0.1 m maleic acid , 0.2 m naf for approximately 1.0 to 1.5 hours at 37c . there was 0.2 m sodium fluoride in the digestion buffer to inhibit dnases from contaminating the crude trypsin preparation . after digestion , the retinal vessels were flattened by four radial cuts and mounted on glass slides for periodic acid - schiff and hematoxylin staining . the nuclei of ecs are oval or elongated in shape , laid within the vessel wall , and extended along the axis of the capillary ; in comparison , pericyte nuclei are typically small , spherical in shape , and stain densely . generally , the pericyte nuclei is characterized by a protuberant position on the capillary wall . we determined the number of ecs and pcs by counting nuclei under the microscope with 400 magnification , where the mounting reticle ( 10 10 m ) was placed in one of the viewing oculars to facilitate counting . we included only retinal capillaries in the mid - zone for the cell count , and measured the number of ecs and pcs in four reticles from the four quadrants of each retina . the mean value of ecs and pcs for each retina was determined by averaging the values from the four reticles . briefly , we counted acellular capillaries in five field areas in the middle of the retina samples ( 200 magnification ) . acellular capillaries were defined as capillary - sized vessel tubes without nuclei anywhere along their length . tubes with a diameter < 20% of the diameter of adjacent capillaries were identified as strands and were not counted . we weighed each mouse before imaging , and anesthetized them by intraperitoneal injection with a cocktail of ketamine ( 87 mg / kg body weight ) and xylazine ( 13 mg / kg body weight ) . during the experiment , we applied 0.5% tetracaine hydrochloride ophthalmic solution to paralyze the iris sphincter muscle and 1% tropicamide ophthalmic solution to dilate the pupil . fort worth , tx , usa ) were added every minute to the mouse cornea to prevent dehydration and cataract formation . the blood so2 were measured to be approximately 98 and the heart rate was approximately 320 beats per minute ( pulse oximetry , model 8500av ; nonin medical , inc . , all experimental procedures were in compliance with the arvo statement for the use of animals in ophthalmic and vision research , and the laboratory animal protocol approved by the institutional animal care and use committee at northwestern university . blood glucose levels were measured with a commercial available glucometer ( glucometer elite ; bayer , inc . , whippany , nj , usa ) by using a drop of tail blood collected from mice models . the vis - oct system enables the quantification of both retinal so2 and retinal blood flow in vivo . using a supercontinuum laser as a light source ( center wavelength : 568.5 nm ; bandwidth : 107 nm ; superk nkt photonics , birkerd , denmark ) , we built a free - space spectral - domain ( sd)-oct ( fig . 1a ) with the theoretical axial resolution being 1.3 m in air . to quantify retinal so2 , we raster - scanned 256 256 a - lines onto the mouse retina to acquire a retinal fundus image , covering a 1.05 1.05 mm area centered at the optic disc ( fig . by analyzing the reflected light spectrum from each retinal vessel , we determined the corresponding so2 value ( fig . 2 ) . to quantify the retinal blood flow , we measured the phase shifts , vessel size , and doppler angles ( fig . , 16 pairs of small - big rings were scanned onto a mouse retina centered at the optic disc . the radius was 0.31 mm for the big scanning ring , and 0.21 mm for the small scanning ring , with 4096 a - lines in each ring . during the experiments , we first performed the raster - scanning , and then the dual - ring scanning protocol . the a - line rate was 25 khz for both scanning protocols . experimental setup and scanning protocols . ( b ) raster - scanning protocol to acquire the retinal fundus image and measure retinal oxygen saturation ( so2 ) . l1 to l5 are lenses ; bs , beam splitter ; dc , dispersion compensation . ( b ) sample b - scan from the red dashed line in ( a ) . ( c ) short - time fourier transforms with different center frequencies ( green , light green , and red ) performed on the spectral interferogram ( blue line ) . ( d ) sub - band b - scans of the vessel in ( b ) denoted by the red dashed circle . ( c ) sample phase - shift b - scan image from the small scanning ring . ( h ) total blood flow rate in the retinal arterial and venous vascular system . the procedure for retinal oximetry with vis - oct was reported in great detail previously . 2a ) , and reconstructed the cross - sectional b - scan using the full band of the spectral interferogram . from the cross - sectional b - scan 2b ) . as illustrated in figure 2c , short - time fourier transforms ( stft ) , with different band center frequencies ( depicted as the gaussian - shaped colored curves ) , were performed on the spectral interferogram ( blue line ) to reconstruct sub - band b - scans . examples of the obtained sub - band b - scans , for the circled vessel in figure 2b , are shown in figure 2d . the bandwidth for each of the stfts was 15 nm , which reduced the axial resolution of each sub - band b - scan to 9.5 m . although the axial resolution was reduced , it is still sufficient to resolve the major murine retinal vessels , which have vessel diameters of 40 m or more . using the already determined vessel coordinates , we extracted the oct signal from the bottom of the vessel across all the sub - band b - scans , as highlighted by the arrows in figure 2d . examples of the obtained oct signal spectra , for an artery and a vein , are shown in figure 2e . to obtain the so2 from the oct signal spectra , we needed to model the reflectance and attenuation of the oct signal by using the optical attenuation coefficient of oxygenated hemoglobin ( hbo2 ) and deoxygenated hemoglobin ( hb ) as follows : here i0 is the incident intensity on the retina , and r0 is the reflectance of the reference arm . the spectral behavior of r was as scattering under first - order born approximation , which is given by the power law function : r( ) = a. here , a and are constants . the exponential term in equation 1 is attenuation according to beer - lambert 's law , where n is the mean refractive index of the blood ( 1.35 ) , and hbo2 and hb denote the attenuation coefficients . the backscattered light experiences two - way ( round - trip ) attenuation through the blood vessel diameter , d [ m ] , hence the factor of 2 in the exponential expression . the wavelength - dependent attenuation coefficients ( hbo2 and hb ) incorporate both the absorption coefficient ( a ) and scattering coefficients ( s ) of the whole blood ( figs . our previous investigation suggested the relationship between the attenuation coefficient , absorption coefficient , and scattering coefficient as follows : to obtain so2 , the oct signal spectra for each vessel was fit to a modified form of equation 1 ( see appendix ) using least - squares ( ls ) fitting . this retinal oximetry technique using vis - oct has been validated in silico with monte carlo simulations , in vitro with artificially oxygenated bovine blood and a commercial blood gas analyzer , and in vivo with systemic hypoxia experiments and a commercial pulse oximeter . doppler sd - oct can measure only the projected flow along the probing beam . to achieve the absolute flow measurements , the doppler angle , which is the angle between the probing beam and blood flow , we used the dual - ring scanning protocol to simultaneously extract the projected flow and doppler angle . figure 3a shows the geometry of the dual - ring scanning protocol . using this geometry , equations for the doppler angle , we see that the doppler angle requires the three - dimensional vessel axis coordinates , hence the requirement for two circular rings in the dual - ring method . figure 3b shows an example of a mouse fundus with the scanning paths of the dual rings . figure 3d shows the calculated doppler angles of all the vessels in this example retina . after acquiring the doppler angles , we calculated the absolute retinal blood flow velocity v ( m / s ) as follows : where fsample ( khz ) is the a - line rate ; 0 ( nm ) is the center wavelength of the sd - oct ; is the phase shift ( rad ) ( fig . 3c ) between adjacent a - lines after bulk motion correction ; n is the refractive index of the sample ( n = 1.35 ) ; and [ degree ] is the doppler angle . 3c ) in experiments ; to correct this , the axial blood flow direction is necessary . the flow direction is recognizable from the phase shifts near the vessel border , where low flow velocity prevents phase - wrapping . assuming the actual phase < 0 , we corrected the phase - wrapping as follows : for the actual phase that is > 0 , we corrected the phase - wrapping as in this study , we had 16 pairs of big - small ring scanning , providing 32 continuous b - scans . we tested the measured velocity stability by averaging the velocity results across different cumulative b - scans and comparing the mean velocity difference between adjacent cumulative b - scans . we considered the velocity stable if the velocity difference was smaller than 0.1 mm / s between adjacent cumulative b - scans . after averaging results across 20 b - scans ( fig . the velocities for the sample retina are shown in figure 3f , where the arterial flow has positive velocities running from the optic disc to the peripheral retina , and the venous flow has negative velocities draining blood from the peripheral retina to the optic disk . we measured the vessel diameter dia ( m ) in the axial direction in the oct b - scan structural , the actual vessel diameter dia_r ( m ) was : where ( radians ) is the doppler angle . the vessel cross - sectional area z ( m ) was : with the absolute velocity and vessel size , the corresponding blood flow in the ith vessel was determined : where vi is the average velocity and ai is the vessel cross - sectional area . we calculated the total blood flow ( f [ l / min ] ) by summing all blood flow in the retinal arterial / vein vascular system , as shown in equation 9 : where n is the total number of retinal arteries or veins . we calculated the irmro2 as follows : where wo2 and whbo2 are the molecular weights of o2 and oxygenated hemoglobin , which were 32 and 68,000 ( g / mol ) , respectively . [ hbt ] is the hemoglobin concentration in the mouse , which was measured to be 150 ( g / l ) ; so2a and so2v are the mean so2 values in the artery and vein vascular system , respectively . we can convert ng / min to l / min as : where v is the volume of gas ; ng is the number of moles of gas ; r is 8.3145 ( jmolek ) ; t is the blood temperature ( 311.15 k ) ; and p is the standard atmospheric pressure ( 101,325 pa ) . statistic results were obtained from seven akita/+ , tsp1 dr mice and seven tsp1 control mice , respectively . retinal vessel sample preparation and ec , pc quantification can be found in our previous article . in this study , all retinal vessel preparations , ec and pc number counting were performed on 13-week - old mice . we fixed mouse eyes in 4% paraformaldehyde for 24 hours , bisected equatorially , and removed the entire retina . the retinas were washed overnight in distilled water and incubated in 3% trypsin ( trypsin 1:250 ; difco , bd diagnostic systems , sparks , md , usa ) prepared in 0.1 m tris , 0.1 m maleic acid , 0.2 m naf for approximately 1.0 to 1.5 hours at 37c . there was 0.2 m sodium fluoride in the digestion buffer to inhibit dnases from contaminating the crude trypsin preparation . after digestion , the retinal vessels were flattened by four radial cuts and mounted on glass slides for periodic acid - schiff and hematoxylin staining . the nuclei of ecs are oval or elongated in shape , laid within the vessel wall , and extended along the axis of the capillary ; in comparison , pericyte nuclei are typically small , spherical in shape , and stain densely . generally , the pericyte nuclei is characterized by a protuberant position on the capillary wall . we determined the number of ecs and pcs by counting nuclei under the microscope with 400 magnification , where the mounting reticle ( 10 10 m ) was placed in one of the viewing oculars to facilitate counting . we included only retinal capillaries in the mid - zone for the cell count , and measured the number of ecs and pcs in four reticles from the four quadrants of each retina . the mean value of ecs and pcs for each retina was determined by averaging the values from the four reticles . briefly , we counted acellular capillaries in five field areas in the middle of the retina samples ( 200 magnification ) . acellular capillaries were defined as capillary - sized vessel tubes without nuclei anywhere along their length . tubes with a diameter < 20% of the diameter of adjacent capillaries were identified as strands and were not counted . we weighed each mouse before imaging , and anesthetized them by intraperitoneal injection with a cocktail of ketamine ( 87 mg / kg body weight ) and xylazine ( 13 mg / kg body weight ) . during the experiment , we applied 0.5% tetracaine hydrochloride ophthalmic solution to paralyze the iris sphincter muscle and 1% tropicamide ophthalmic solution to dilate the pupil . commercial artificial tears ( systane ; alcon laboratories , inc . , fort worth , tx , usa ) were added every minute to the mouse cornea to prevent dehydration and cataract formation . the blood so2 were measured to be approximately 98 and the heart rate was approximately 320 beats per minute ( pulse oximetry , model 8500av ; nonin medical , inc . , all experimental procedures were in compliance with the arvo statement for the use of animals in ophthalmic and vision research , and the laboratory animal protocol approved by the institutional animal care and use committee at northwestern university . blood glucose levels were measured with a commercial available glucometer ( glucometer elite ; bayer , inc . , whippany , nj , usa ) by using a drop of tail blood collected from mice models . we monitored the body weight and blood glucose levels for both diabetic and control nondiabetic mice from 5 weeks to 13 weeks of age , as shown in figure 4 . during the imaging window , we also noted that at 13 weeks of age , the weights of the diabetic mice were slightly less than the control mice ( 25.1 1.0 vs. 28.5 2.0 g ) ( fig . 4b ) were observed in the diabetic mice at 5 weeks of age compared with normal blood glucose levels in the control mice ( 205 7 vs. 132 6.5 mg / dl ) . after the final imaging at 13 weeks of age , we examined histology of the retinal microvasculature in both the diabetic and control mice . we found no retinal acellular capillaries or pc loss in the diabetic mice ( figs . 4c , 4d ) ; both the diabetic and control mice had similar retinal ec density and pc density ( fig . comparison of body weights , blood glucose levels , and ec and pc densities between diabetic and control groups . ( a ) body weight comparison between diabetic and control mice from 5 to 13 weeks of age . ( b ) comparison of blood glucose between diabetic and control mice from 4 to 13 weeks of age . ( c ) sample retinal vessels from diabetic mouse group at 13 weeks of age . ( d ) sample retinal vessels from control mouse group at 13 weeks of age . ( e ) we used vis - oct to quantify the retinal so2 , blood flow rate , and irmro2 simultaneously ( fig . 1 ) . to resolve the retinal so2 , we first extracted the light reflectance spectrum from each vessel , and then fitted the extracted light reflectance spectrum with the known absorption / scattering spectra of both oxygenated and deoxygenated hemoglobin based on a modified beer - lambert law ( fig . to calculate retinal blood flow rate , we first extracted flow - induced phase shifts , then calculated the doppler angle for each retinal vessel and measured the corresponding vessel diameter . finally , with these measurements , the absolute flow rate was quantified ( see fig . longitudinal retinal imaging for both the diabetic and control groups was performed every other week , from 5 to 13 weeks of age . at each imaging time point , we measured seven physiological parameters , including blood velocity , vessel diameter , blood flow rate , arterial so2 , venous so2 , artery - vein so2 difference , and irmro2 , as shown in figures 5b through 5h . by comparing results between the diabetic group and control group first , we did not find significant differences in blood velocity or arterial so2 between the diabetic mice and control mice ( p 0.128 for velocity , and 0.09 for arterial so2 ; see supplementary table s1 ) ( figs . 5b , 5d ) . these two parameters , blood velocity and arterial so2 , were also stable ( less than 4% variation ) over the course of the experiment within both the diabetic mice and control mice . second , we did not find significant differences in vessel diameter or blood flow rate between the diabetic mice and control mice ( p 0.128 for diameter , and 0.26 for flow rate ; see supplementary table s1 ) . however , we observed a moderate increase in vessel diameter ( 4 [ m ] in absolute value or 10% in relative percentage increase ) and blood flow rate ( 0.2 [ l / min ] in absolute value or 13% in relative percentage increase ) in the diabetic mice over the course of experiments . such increases were not present in the control mice ( less than 3% in relative percentage change ) ( figs . 5c , 5f ) . third , between the diabetic mice and control mice , we observed significant differences in venous so2 and artery - vein so2 difference from 9 weeks of age ( p = 0.006 ; see supplementary table s1 ) , and significant differences in irmro2 from 11 weeks of age ( p = 0.001 ; see supplementary table s1 ) . across the course of experiments in diabetic mice , we also found significant changes in the venous so2 ( 9.6 [ % ] in absolute decrease or 16% in relative percentage decrease ) , artery - vein so2 difference ( 9.0 [ % ] in absolute increase or 27.9% in relative percentage increase ) and irmro2 ( 54.45 [ nl / min ] in absolute increase or 41.3% in relative percentage increase ) . in comparison , during the course of experiments in the control mice , we found stable values among venous so2 , artery - vein so2 difference , and irmro2 ( less than 5% in relative percentage change ) ( figs . 5e , 5 g , 5h ) . longitudinal monitoring retinal flow , so2 , and irmro2 for both dr mice and control mice from 5 to 13 weeks of age . ( b ) longitudinal monitoring results of mean retinal arterial blood velocity . ( c ) we monitored the body weight and blood glucose levels for both diabetic and control nondiabetic mice from 5 weeks to 13 weeks of age , as shown in figure 4 . during the imaging window , we also noted that at 13 weeks of age , the weights of the diabetic mice were slightly less than the control mice ( 25.1 1.0 vs. 28.5 2.0 g ) ( fig . 4b ) were observed in the diabetic mice at 5 weeks of age compared with normal blood glucose levels in the control mice ( 205 7 vs. 132 6.5 mg / dl ) . after the final imaging at 13 weeks of age , we examined histology of the retinal microvasculature in both the diabetic and control mice . we found no retinal acellular capillaries or pc loss in the diabetic mice ( figs . 4c , 4d ) ; both the diabetic and control mice had similar retinal ec density and pc density ( fig . comparison of body weights , blood glucose levels , and ec and pc densities between diabetic and control groups . ( a ) body weight comparison between diabetic and control mice from 5 to 13 weeks of age . ( b ) comparison of blood glucose between diabetic and control mice from 4 to 13 weeks of age . ( c ) sample retinal vessels from diabetic mouse group at 13 weeks of age . ( d ) sample retinal vessels from control mouse group at 13 weeks of age . ( e ) we used vis - oct to quantify the retinal so2 , blood flow rate , and irmro2 simultaneously ( fig . 1 ) . to resolve the retinal so2 , we first extracted the light reflectance spectrum from each vessel , and then fitted the extracted light reflectance spectrum with the known absorption / scattering spectra of both oxygenated and deoxygenated hemoglobin based on a modified beer - lambert law ( fig . to calculate retinal blood flow rate , we first extracted flow - induced phase shifts , then calculated the doppler angle for each retinal vessel and measured the corresponding vessel diameter . finally , with these measurements , the absolute flow rate was quantified ( see fig . longitudinal retinal imaging for both the diabetic and control groups was performed every other week , from 5 to 13 weeks of age . at each imaging time point , we measured seven physiological parameters , including blood velocity , vessel diameter , blood flow rate , arterial so2 , venous so2 , artery - vein so2 difference , and irmro2 , as shown in figures 5b through 5h . by comparing results between the diabetic group and control group first , we did not find significant differences in blood velocity or arterial so2 between the diabetic mice and control mice ( p 0.128 for velocity , and 0.09 for arterial so2 ; see supplementary table s1 ) ( figs . these two parameters , blood velocity and arterial so2 , were also stable ( less than 4% variation ) over the course of the experiment within both the diabetic mice and control mice . second , we did not find significant differences in vessel diameter or blood flow rate between the diabetic mice and control mice ( p 0.128 for diameter , and 0.26 for flow rate ; see supplementary table s1 ) . however , we observed a moderate increase in vessel diameter ( 4 [ m ] in absolute value or 10% in relative percentage increase ) and blood flow rate ( 0.2 [ l / min ] in absolute value or 13% in relative percentage increase ) in the diabetic mice over the course of experiments . such increases were not present in the control mice ( less than 3% in relative percentage change ) ( figs . 5c , 5f ) . third , between the diabetic mice and control mice , we observed significant differences in venous so2 and artery - vein so2 difference from 9 weeks of age ( p = 0.006 ; see supplementary table s1 ) , and significant differences in irmro2 from 11 weeks of age ( p = 0.001 ; see supplementary table s1 ) . across the course of experiments in diabetic mice , we also found significant changes in the venous so2 ( 9.6 [ % ] in absolute decrease or 16% in relative percentage decrease ) , artery - vein so2 difference ( 9.0 [ % ] in absolute increase or 27.9% in relative percentage increase ) and irmro2 ( 54.45 [ nl / min ] in absolute increase or 41.3% in relative percentage increase ) during the course of experiments in the control mice , we found stable values among venous so2 , artery - vein so2 difference , and irmro2 ( less than 5% in relative percentage change ) ( figs . 5e , 5 g , 5h ) . longitudinal monitoring retinal flow , so2 , and irmro2 for both dr mice and control mice from 5 to 13 weeks of age . ( b ) longitudinal monitoring results of mean retinal arterial blood velocity . ( c ) in this study , we found increased irmro2 at early diabetes when there were no detectable anatomical retinal vascular complications . first , retinal and choroidal circulations together provide retinal tissue oxygen and nutrients , with choroidal circulation nourishing the outer retina and retinal circulation supporting inner retina . reduced choroidal blood flow rate was reported in early - stage diabetic mice ( 1-month - old akita/+ , tsp1 mice ) , when no retinal structural changes were observable . decreased choroidal flow can lower the choroidal oxygen supply for photoreceptors ; however , to maintain the normal function of photoreceptors , enough oxygen is necessary . to compensate for decreased supply from the choroid in early - stage diabetes , photoreceptors have to extract more oxygen from the retinal circulation . in this view , the increased irmro2 would reflect increased extraction to supply the outer retina , rather than an increase in the utilization of oxygen in the inner retina . second , high blood glucose in early diabetes prompts mitochondria to generate more reactive oxygen species ( ros ) . in the presence of high ros , mitochondrial uncoupling is activated to reduce ros production ; however , increased mitochondrial uncoupling will contribute to increased oxygen consumption . our results also imply that the increased irmro2 at early diabetes is mainly from the decreased retinal venous so2 levels associated with the increased retinal artery - vein so2 differences , instead of the variation of retinal blood flow rate . this may be reasonable for early diabetes in which no retinal microvasculature complications were observable . in early diabetes , the unchanged blood flow can be explained by the hagen - poiseuille law . according to the hagen - poiseuille law , blood flow rate is determined by the pressure drop across the vessel and the vessel diameter . for one thing , the pressure drop across inner retinal vasculature depends on the systemic arterial and venous pressures as well as the intermediate resistance of the capillary network . the systemic arterial and venous pressures are likely the same between early - stage diabetic mice and control mice . histologic examination in our experiments found no microvascular changes in diabetic mice , which may indicate normal retinal intermediate resistance . in such a scenario , the pressure drop across the inner retina should be normal for diabetic mice . thus , the retinal blood flow rate was expected to be normal in early diabetes , as we observed in the longitudinal monitoring experiments . with unchanged blood flow rate , the elevated inner retinal oxygen metabolism in diabetic mice is due to the decrease in venous so2 and increase in the artery - vein so2 difference . previous studies have reported retinal tissue hypoxia in dr , which , however , are different from the increased irmro2 we observed . dr is a dynamic disease , in which retinal oxygen metabolism may change with dr development . in this study , we focused on early diabetes when there are no observable microvascular complications . in comparison , the reported studies targeted dr , when retinal capillary dysfunctions are already present ; nonperfused retinal capillaries in dr can cause hypoxia . for another , reported studies applied multi - wavelength fundus photography or hyperspectral photography to measure retinal so2 in dr . because of lack of depth resolution , performance of both fundus photography and hyperspectral photography are sensitive to light scattering in retinal tissue and variation of local retinal geometrical parameters , including retinal vessel diameter , which usually generate biased so2 results . in comparison , as a depth - resolved imaging technique , vis - oct can precisely extract light absorption spectra from retinal blood vessels and accurately quantify so2 . first , there is a possibility that the volume of the retina in diabetic mice could have increased , resulting in the measured increase of irmro2 . quantifying the whole retinal volume was not feasible with our current techniques and is a limitation to all present in vivo oxygen consumption studies . moreover , several groups have studied the retinal thickness of akita/+ mice , as a surrogate to the cell count , and found no significant changes in the thickness . second , because we focused on measuring the functional state of the retina with vis - oct , we did not acquire oct angiograms as part of our imaging protocol . optical coherence tomography angiography has been recently reported using vis - oct to study the capillary network in rodents . structural changes in the vasculature would be useful information to obtain , in addition to the measured functional parameters that we collected . however , it has been shown that the akita/+ mouse does not develop retinal vascular changes until at least 6 months . future studies with vis - oct will likely correlate longitudinal changes in vascular structure with functional oxygenation parameters . last , a concern with vis - oct is that the illumination beam , being visible , might activate retinal neurons and , through neurovascular coupling , alter the measured so2 or blood flow rate . studies of retinal flicker in rodents suggest that this is unlikely , because the peak response for blood flow due to whole - eye retinal flicker in rodents is at 10 hz . in vis - oct , a - lines are collected at 25 khz , which is several orders of magnitude higher than in flicker studies . moreover , the vis - oct beam is focused by the lens of the rodent eye to a small spot on the retina , which is much smaller than the whole - eye illumination used in flicker experiments . despite these facts , further studies are required to further investigate this issue . in conclusion , we have applied vis - oct to measure irmro2 in akita/+ , tsp1 mice and controls . this is the first attempt to measure irmro2 in a diabetic mouse model using oct . we found that irmro2 in diabetic mice was elevated from weeks 5 to 13 as compared with the controls . the elevation was primarily due to a measured decrease in venous so2 , because arterial so2 and total blood flow rate remained insignificantly changed . during this same study period , we also found that pc and ec densities were the same between diabetic mice and control mice , which shows that the changes in irmro2 occurred before vascular alterations . using vis - oct , future studies in human dr by substituting equation 2 in equation 1 and taking the natural log , equation 1 can be rewritten as follows : using this modified equation a1 , an ls fit can be performed to fit the oct signal spectrum from a vessel , resulting in values for ln(ar0 ) , so2 , and . the doppler angle can be calculated by inverting the cosine in the equation : which results from the geometry shown in figure 3a . the denotes the vector dot product ; and are the direction of blood flow and the probing light , respectively . the and were determined by the coordinates of e , s , and n. the e and s represent the center points of the sample vessel within the small and big circular b - scan images ; n signifies the nodal point of the eye . coordinates of e , s , and n were derived from vessel centers within the circular b - scan images , as shown in figure 3b . for simplicity 3a ) were ( 1 , d1 ) and ( 2 , d2 ) within the inner and outer circular b - scans ; we also assumed the mouse eyeball diameter was h ( the reported value is approximately 3 mm ) , which was the length of no . the diameters of the big ring and the small ring on the retina were r1 and r2 . the coordinates of e , s , and n were estimated as follows : with these equations , the doppler angles were calculated .

acute disseminated encephalomyelitis ( adem ) is an immune - mediated , acute severe , demyelinating disorder involving central nervous system ( cns ) white matter , characterized by diffuse neurologic signs and symptoms coupled with evidence of multifocal lesions of demyelination on neuroimaging . adem is commonly seen following exanthematous viral infections ( measles , small pox , chickenpox , epstein - barr virus , influenza , mumps , rubella , hepatitis , herpes simplex , coxsackie , mycoplasma , campylobacter , streptococcus , legionella , rickettsia ) , systemic infections , or vaccinations . two pediatric and four adult cases reports of adem in hiv - infection have been reported . a 10-year - old male child , first in order of birth , presented with weakness in both lower limbs and left upper limb since 1-month . weakness was first noticed in left lower limb which progressed to right lower limb and left upper limb leading to complete loss of limb movements . child did not have fever , exanthematous illness in recent past , seizures , vision disturbances , altered sensorium , vomiting or headache . child was born by home delivery , had average birth weight with uneventful postnatal period and was never immunized . of the two younger siblings , an 8-year - old male child is well and asymptomatic , but a younger female child had expired due to pneumonia at the age of 2 years . child had normal developmental milestones , and his weight was 27.5 kg ( 25 centile ) , height was 138 cm ( 50 centile ) , head circumference was 50.5 cm ( 50 centile ) , underweight for his age . child was admitted to our hospital on 28 day of illness with evaluation and investigations done at another hospital where he was admitted for 2 weeks . investigations done there were hb-10.8 gm / dl , leucocytes 4800 ( polymorphs 56% , lymphocytes 44% , platelets 3.5 lakhs / mm , malarial antigen was negative and regulatory focus theory was normal . cerebrospinal fluid ( csf ) study had 61 cells , all lymphocytes , proteins ( 43.61 mg / dl ) sugar ( 36 mg / dl ) , and no growth on culture . magnetic resonance imaging ( mri ) spine ( probably suspecting lower motor neuron lesion ) and screening of brain revealed features of adem not correlating with clinical history [ figures 1 and 2 ] . child developed high grade fever and diarrhea following which parents got him discharged against medical advice . on admission to our hospital , patient was averagely built and nourished , pale , conscious , oriented and had multiple healed pyoderma lesions . neurological examination revealed left sided upper motor neuron ( umn ) facial palsy , grade i power in right lower limb and grade ii power in left upper and left lower limb , bilateral extensor plantars s / o left hemiparesis with umn facial palsy which progressed to triplegia in next 36 h. signs of meningeal irritation were absent , and fundus examination was normal . flair axial image reveals large hyperintensity in genu and posterior limb of internal capsule , ventral thalamus and part of lentiform nucules flair coronal image reveals large area of hyperintense signal in right gangliocapsular region ( right > left ) in view of clinical presentation not correlating with examination , investigations and mri findings , possibility of immunocompromised state was suspected . present clinical status of aids in a child , demanded early initiation of highly active antiretroviral therapy ( haart ) . due to unavailability of art center at our hospital patient serological igm titers for torch , mantoux test , hbsag , and hepatitis c virus were negative . cd3 cd4 count was 28 ( range of 410 - 1590 ) , and cd45 absolute count was 478 . patient was treated with intravenous immunoglobulin ( ivig ) , methylprednisolone , antituberculous therapy , trimethoprim - sulfamethoxazole in therapeutic and prophylactic doses along with other supportive care . child was admitted to our hospital on 28 day of illness with evaluation and investigations done at another hospital where he was admitted for 2 weeks . investigations done there were hb-10.8 gm / dl , leucocytes 4800 ( polymorphs 56% , lymphocytes 44% , platelets 3.5 lakhs / mm , malarial antigen was negative and regulatory focus theory was normal . cerebrospinal fluid ( csf ) study had 61 cells , all lymphocytes , proteins ( 43.61 mg / dl ) sugar ( 36 mg / dl ) , and no growth on culture . magnetic resonance imaging ( mri ) spine ( probably suspecting lower motor neuron lesion ) and screening of brain revealed features of adem not correlating with clinical history [ figures 1 and 2 ] . child developed high grade fever and diarrhea following which parents got him discharged against medical advice . on admission to our hospital , patient was averagely built and nourished , pale , conscious , oriented and had multiple healed pyoderma lesions . neurological examination revealed left sided upper motor neuron ( umn ) facial palsy , grade i power in right lower limb and grade ii power in left upper and left lower limb , bilateral extensor plantars s / o left hemiparesis with umn facial palsy which progressed to triplegia in next 36 h. signs of meningeal irritation were absent , and fundus examination was normal . flair axial image reveals large hyperintensity in genu and posterior limb of internal capsule , ventral thalamus and part of lentiform nucules flair coronal image reveals large area of hyperintense signal in right gangliocapsular region ( right > left ) in view of clinical presentation not correlating with examination , investigations and mri findings , possibility of immunocompromised state was suspected . present clinical status of aids in a child , demanded early initiation of highly active antiretroviral therapy ( haart ) . due to unavailability of art center at our hospital patient serological igm titers for torch , mantoux test , hbsag , and hepatitis c virus were negative . cd3 cd4 count was 28 ( range of 410 - 1590 ) , and cd45 absolute count was 478 . patient was treated with intravenous immunoglobulin ( ivig ) , methylprednisolone , antituberculous therapy , trimethoprim - sulfamethoxazole in therapeutic and prophylactic doses along with other supportive care . acute disseminated encephalomyelitis is an extremely rare presenting feature of hiv - infection in children . there are two pediatric and four adult cases reported of adem in hiv - infection . reported an 8-year - old male child with paraparesis , focal seizures and mri brain suggestive of adem , hence treated with methyl prednisolone patient had transient improvement , followed by clinical deterioration . due to an unexpected response to therapy and presence of social risk factor , patient was tested for hiv . patient was detected positive for hiv and had rapid deterioration , followed by death due to concomitant herpes zoster on day 10 of art along with antiviral and antituberculosis drugs . this was the first case reported of perinatally transmitted hiv - infection presenting as adem . van toorn et al . have described a 7-years - old hiv - infected child who developed cryptococcal meningitis , with raised intracranial pressure , complicated by adem and disseminated herpes simplex infection 3 weeks after commencement of haart . had described a 27-year - old female with fever , clouding of consciousness , paraplegia , sensory loss , and blindness ( due to adem ) , as manifestations of primary hiv - infection . mogensen et al . have reported a 45-year - old bisexual male with clinical symptoms ( cognitive dysfunction and right hemiparesis ) , mri , and csf examination findings suggestive of acute demyelinating encephalomyelitis as the initial presentation of primary hiv - infection . allen et al . had reported a 32-year - old homosexual male presenting with behavioral changes and diagnosed as acute demyelinating encephalomyelitis with a 5 year - old history of hiv - infection . have described a 31-year - old woman diagnosed as hemorrhagic adem in an hiv - infected patient presenting solely with acute onset bilateral blindness ( with normal retina ) and hemiparesis . the prominent differences noted in our case were , delayed age of presentation , preserved nutritional status , absence of recent viral infection , clinical history , and examination had significant disparity . clinically , child remained the same without improvement following ivig and methyl prednisolone therapy and had rapid deterioration and death before initiation of haart . clinical manifestations of adem include alteration of sensorium , motor / sensory deficits , cranial neuropathies , seizures , and ophthalmoplegia . our patient had predominant motor and cranial nerve involvement not correlating with the previous pediatric and adult case reports . this can be a part of the clinical spectrum of hiv - induced adem and needs further evaluation and study of more cases . the opportunistic cns infections such as tuberculosis , toxoplasma , cytomegalovirus , cryptococcus , herpes simplex virus , john cunningham virus produce multifocal intracranial lesions in children . acute disseminated encephalomyelitis is being recognized more frequently with increasing use of mri as happened in our patient ; neurodiagnosis of adem was done at previous institute , without etiological diagnosis . mri spine and brain of our patient showed evidence of multiple ill - defined foci of t2-weighted image and fluid attenuated inversion recovery hyperintensity involving right thalamocapsular region , right posterior limb of the internal capsule , right globus pallidus , bilateral hippocampus and subcortical white mater of right parietal lobe suggestive of adem . areas of altered si showing heterogeneous contrast enhancement involving the dorsal cord with areas of cord expansion were also seen [ figures 1 and 2 ] . the mri findings of our patient were consistent with observations mentioned by murthy et al . we suspected and diagnosed hiv as a cause of adem in our patient based on history not correlating with clinical examination , presence of sociocultural risk factors like home delivery , prolonged breast feeding , poor health care awareness , younger siblings death due to pneumonia , which reflected significant ignorance in availing health care facilities for delivery and immunization for the child . furthermore , patient 's nutritional status , pallor , chronic healed pyoderma lesions with hyperpigmentation , nonspecific abdominal distension , mild tachypnea , past tuberculous lymphadenitis were significant contributory factors to suspect multisystem chronic infection with immunosuppression . though extremely rare , perinatally acquired hiv - infection must be suspected in a child with social risk factors , atypical clinical presentation with neurological examination and neuro - radiodiagnosis findings of adem .

pio del rio hortega , one of the greatest of all neuroscientists , established the basic foundation of neuroinflammation with his classic 1919 paper el tercer elemento de los centros nerviosis ( del rio hortega , 1919 ) . he had developed an ammoniacal silver carbonate modification of the golgi technique . with this new method he recognized that they were of mesodermal origin , and that they migrated to the brain in late embryonic life . he categorized their morphology as resting , ameboid , and reactive . by further modifying his technique , he later recognized another type of glial cell which was of epithelial origin and had a sparse cytoplasm . he named these cells oligodendroglia , perhaps because of the difficulty he encountered in staining them . cajal , hortega s mentor and employer , had clearly identified astrocytes with his methodology , and knew there were still unclassified glial cells . he thought the cells identified by hortega might be another astrocytic type that was resistant to staining . he objected to hortega s desire to publish his results on oligodendroglia , and when hortega went ahead , believing others would make the same discovery , cajal dismissed him . hortega s own account of these travails , which he never published , were obtained after his death , later appearing in part in haymaker and adams treatise on the histopathology of the nervous system ( haymaker and adams , 1980a , pp . 484485 ) . the madrid laboratory he had set up after his departure from cajal was bombed out in the spanish civil war . he moved for a time to paris , and then to oxford , but was uncomfortable in these locations . as a spaniard opposed to franco , he emigrated to buenos aires in 1938 where , in 1945 , he died of cancer . he described , in the first issue of the american journal of pathology , the various stages of microglia , going from resting to reactive ( penfield , 1925 ) . numerous others did differing experiments , interpreting microglia cells as being of epithelial origin with unknown function . a detailed account of the continuing controversy , which extended for over six decades , appears in haymaker and adams ( 1980b , chapter vi ) . this unjustified controversy may help to explain why hortega never received a nobel prize for his epic work . he elaborated the concept of a monocyte phagocytic system to explain the origin and function of resident phagocytes throughout the body . the memoranda endorsing the concept , which was introduced at the conference on mononuclear phagocytes held in lieden in 1969 , is available on the web chttp://www.ncbi.nlm.nih.gov / pmc / articles / pmc2480884/pdf / bullwho00193 - 0157.pdf . he and his colleagues had studied labeled monocytes and their marrow precursors and followed their appearance as typical macrophages in various organs , including brain ( van furth and cohn , 1968 ) . this concept replaced the vague theory of a reticulo - endothelial system introduced by aschoff ( 1924 ) which , despite its shortcomings , had become entrenched in medical teaching . while van furth s concept of a monocyte phagocytic system was widely accepted , its relationship to brain microglia was not . fujita in particular opposed the idea that microglia were the brain representatives of this system . he injected tritiated thymidine into chick embryos and identified labeled brain cells which he interpreted as glioblasts of subependymal origin ( fujita , 1965 ) . he did later studies of human embryonic brain tissue and reached a similar conclusion , that brain microglia were of epithelial and not mesenchymal origin ( fujita , 1973 ; fujita and kitamura , 1973 ) . ( 1979 ) also concluded that brain microglia could not be phagocytes of monocytic origin . the reason was that they could not detect the same surface antigens on microglial cells that they were able to detect on peripheral monocytes . the idea became established that inflammation of the brain did not involve microglia , and did not occur unless there was invasion of the brain by peripheral monocytes , which then became transformed into macrophages . several researchers had suggested that ad might result from a herpes infection entering through the nasal passages because of involvement of the rhinencephalon ( ball , 1982 ) . our effort over some years to detect herpes virus in the cns had failed , although we were able to detect it in some cases in the trigeminal nucleus , the source of herpes labialis ( walker et al . , 1989 ) . we sought the advice of local immunologists regarding what might be a broader indicator of a viral infection , and were counseled to look for hla - dr since this class ii glycoprotein would be responsible for presenting viral epitopes to t - cells . we were even presented with a gift of the hb-104 cell line , known to produce high levels of antibodies against hla - dr . a plethora of cells was visible in ad tissue with a morphology that was completely unfamiliar to us . however we were able to confirm that they were microglia by showing them to the founder of our laboratory , dr . william gibson , who had been a student and biographer of hortega ( prados and gibson , 1946 ) . the morphology was identical to that published by del rio hortega ( 1919 ) , permitting us to sense in a very small way the excitement he must have experienced . as many frustrated investigators well know , peer reviewers , whether evaluating applications for research grants , or papers submitted to journals , are typically well versed in the dogmas of the day . a pathological journal rejected our initial manuscript , reasoning that the absence of a neuropathologist as an author explained the faulty conclusions . a peer reviewer for a renewal of our grant dismissed it with the comment nevertheless , our first paper appeared as a brief report in neuroscience letters ( mcgeer et al . , 1987 ) . this final validation of hortega depended on the availability of hb-104 , a powerful and highly specific monoclonal antibody . the field of immunohistochemistry had been opened by cesar milstein s work on the technique for producing monoclonal antibodies . he was a co - winner of the nobel prize in 1984 for this accomplishment . then , as now , the ability to visualize brain biochemistry through the eyes of immunohistochemistry depends on the strength and specificity of the antibodies employed . hb-104 was a particularly good antibody , permitting us to make a clear distinction , which had eluded other investigators , between hla - dr positive microglia and gfap positive astrocytes . lampson and hickey ( 1986 ) had reported class ii activity in occasional cell bodies of human brain with the morphologic appearance of microglia or astrocytes . ( 1984 ) reported hla - dr positive cells in the white matter of normal brain which they interpreted as being astrocytes ( detribolet et al . , 1984 ) . rogers et al . reported hla - dr positive microglia and astrocytes in ad in an abstract at the society of neuroscience meeting in 1986 but , as in our case , formal publication was held up by disbelief in the findings . their work finally appeared in 1988 ( luber - narod and rogers , 1988 ; rogers et al . , 1988 ) . was it a special phenomenon or a general one that applied to many chronic neurological disorders ? if it was a general phenomenon , was it localized to the brain or did it involve the peripheral immune system ? was it helpful or harmful to ongoing degenerative processes ? what were the implications for treatment ? exploration of these questions led to the opening up of an important new field of neuroscience , namely neuroinflammation . the question as to whether or not the presence of activated microglia in brain was a special one applying to ad , or a general phenomenon was quickly answered . hla - dr activated microglia were observed in a variety of degenerative neurological conditions , including parkinson disease ( pd ) , pick disease , als , huntington disease , multiple sclerosis , aids encephalopathy , parkinsonism dementia of guam , and the shy drager syndrome ( mcgeer et al . , 1988a ) . their phagocytic function was easily demonstrated by melanin being observed within the hla - dr positive microglia of the sn ( mcgeer et al . , 1988b ) . each of these diseases has a differing etiology , so the activated microglial response had to be the consequence of initiating factors in each condition and not the fundamental cause . at this same time , the laboratory of kreutzberg in germany was carrying out work of a more fundamental nature . his team was utilizing the facial nerve axotomy model to examine the cns reaction to a sterile lesion outside of the cns . they found activated microglia enveloping damaged neurons of facial nerve cell bodies , with phagocytosis of dead cells taking place . they concluded that microglia might function as antigen presenting cells and thus be the effector cells responsible for recruitment of lymphocytes to the brain resulting in an inflammatory reaction . a review of their results appeared in the first volume of glia ( streit et al . further groundwork was laid by four key papers which appeared in a special issue of glia in 1993 devoted to microglia . they were by ling and wong ( 1993 ) describing the origin and nature of microglia ; dickson et al . ( 1993 ) detailing cytokines and microglia in alzheimer disease and aids ; banati et al . ( 1993 ) on microglia in neurodegenerative diseases generally . since our laboratory and that of joe rogers , who had founded the sun health research institute , had identified hla - dr activated microglia in ad , we joined forces for further investigation of the phenomenon , particularly the role of complement . the name complement was introduced by paul ehrlich in the 1890 s to explain the heat labile factor in serum which helped antibodies to kill microorganisms . as a result , complement was considered to be a peripherally generated system for assisting the activity of antibodies . it was therefore believed that complement factors would only be found as an accompaniment to immunoglobulin antibodies . eikelenboom and stam ( 1982 ) were the first to report the presence of complement factors in ad senile plaques . previously it had been reported that immunoglobulins were associated with amyloid deposits , which was consistent with prevailing theory ( ishii and haga , 1975 ) . our laboratory was able to detect the opsonizing components of the classical complement pathway in association with plaques , and the membrane attack complex in association with dystrophic neurites , consistent with bystander lysis occurring in ad ( mcgeer et al . , 1989 ) . working with joseph rogers , we were unable to detect immunoglobulins in ad tissue using a host of antibodies . then rogers explored the idea that beta amyloid protein itself might be an activator of complement . in a classic paper he and his colleagues demonstrated that immunoglobulin immunostaining did not colocalize with complement , and that beta amyloid protein and its n - terminal fragments bound to c1q directly , thus initiating the complement cascade independently of antibodies ( rogers et al . , 1992 ) . it was soon determined from rna studies that brain itself was the source ( johnson et al . , 1992 ; meanwhile evolutionary studies were underway , establishing that the complement system could be traced back at least as far as horseshoe crabs and that it was the mainstay of innate immunity in most primitive organisms ( zhu et al . , 2005 ) . it far predated the antibody producing adaptive immune system which is an invention of higher vertebrates . two principles which had broad implications for the developing field of neuroinflammation emerged from this joint endeavor . the first was establishing that complement was part of the innate immune system and further that it had the potential of exacerbating the pathology through formation of the membrane attack complex . we decided to explore whether patients on long term anti - inflammatory therapy were relatively spared from ad . we selected rheumatoid arthritic patients because onset of the disease typically appears at an earlier age than ad and involves aggressive anti - inflammatory therapy . the results showed an estimated sixfold sparing of ad in rheumatoid arthritic patients compared with age matched general populations ( mcgeer et al . , many subsequent epidemiological studies , in which consumption of nsaids in particular were targeted , confirmed these general findings ( mcgeer and mcgeer , 1995 ) . rogers was then motivated to establish a neuroinflammation working group of 37 investigators to assemble the rapidly accumulating data on inflammation in ad . the conclusion of the group was that the data represented a virtual textbook of inflammatory mediators . included were complement proteins and their regulators , inflammatory cytokines , chemokines , acute phase reactants , prostaglandins , proteases , protease inhibitors , coagulation factors , fibrinolytic factors , integrins , anaphylatoxins , free radical generators , and other unidentified neurotoxins ( akiyama et al . , 2000 ) . all are products of the innate immune system of brain , with major contributions coming from neurons , astrocytes , microglia , and endothelial cells . parkinson disease was another chronic degenerative disorder where activated microglia were detected in association with the sn lesions ( mcgeer et al . , 1988b ) . ( 1984 ) had identified a group of young drug users who suddenly developed a parkinsonian syndrome . the causative agent ( mpp+ ) was a metabolite of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine ( mptp ) , a contaminant in the street drug they were using . the condition was progressive , and autopsy studies on those who had died from this exposure years previously showed neuroinflammation of the sn similar to that observed in pd ( langston et al . , 1999 ) . they showed nigral degeneration and activated microglia in the sn 5.515 years after systemic exposure to mptp ( mcgeer et al . , 2003 ) . these findings represent the clearest example of how neuroinflammation , once initiated , can persist , and cause continuing neurodegeneration . activated microglia are the pivotal cells . their functioning in vivo has been remarkably demonstrated by the movies of nimmerjahn et al . they developed mice transgenic for a green fluorescent protein in microglial cells and used two - photon microscopy through a window in the skull to observe their behavior . microglial cells in the normal state were found not to be dormant , as implied by their traditional designation as resting , but were extremely active , continuously extending , and retracting their processes to sense their environment . when activated by a laser lesion of a capillary , they surrounded the lesion and phagocytosed the leaking blood . the innate immune system is the body s first line of defense . as the nimmerjahn movies demonstrate , it can act immediately . as shown in chronic degenerative diseases , as well as the mptp model , it can maintain its activity indefinitely without significant engagement of the adaptive immune system . the adaptive immune system is slower to react but more powerful and specific in attacking targets . it depends upon appropriate presentation of epitopes to lymphatic organs so that lymphocytes can be cloned to attack targets where that epitope is exposed . there is a long list of diseases where the adaptive immune system directs self attack on healthy tissues . they differ from ad and other chronic neurodegenerative disorders where the adaptive immune system does not become significantly engaged . to distinguish between the two , we have suggested that such diseases be described as autotoxic disorders ( mcgeer and mcgeer , 2000 ) . in theory , the self destruction in autotoxic disorders should be milder and more amenable to therapeutic intervention than the self destruction in autoimmune disorders . anti - inflammatory and anti - oxidant approaches have been the most widely utilized to date . that is to transform microglia from the attack mode , which has been so well characterized , to a healing mode . such a transformation might result in enhanced phagocytotic activity , coupled with a switch from expressing inflammatory cytokines such as il-1 and tnf to expressing anti - inflammatory cytokines such as il-4 and il-10 . in the process the beneficial effects of phagocytosis might be enhanced . for example , suppressing the cd-40/cd 40l interaction in transgenic mice enhances the phagocytic activity of microglia and increase a clearance ( tan et al . , 2002 ) . it can be said that , despite the huge expansion of activity that has taken place in recent years , it is still a field in its infancy . our understanding of the innate immune system in brain commenced with recognition of a single marker , hla - dr , on a single cell type , microglia , in a single disorder , alzheimer disease . twenty five years later , more than a thousand innate immune system markers have been identified which are associated with neurons , astrocytes , oligodendrocytes , and endothelial cells , as well as microglia . they include , but are not limited to , complement proteins and their regulators , cytokines , chemokines , acute phase reactants , prostaglandins , proteases , protease inhibitors , coagulation factors , fibrinolytic factors , anaphylatoxins , integrins , and free radical generators . some stimulate inflammation , others inhibit it . shifting the balance from a mode of attack to one of healing holds promise of having significant therapeutic benefit in a spectrum of degenerative diseases . it can be said that , despite the huge expansion of activity that has taken place in the last 25 years , it is still a field in its infancy . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

depression is very common in elderly people , with prevalence ranging from 1% to 16% in elderly living in private households or institutions . there is increasing evidence showing that depression is associated with cognitive impairment and even with dementia in later life . in a study of 61 depressed subjects over age 60 , obrien et al . reported that depressed subjects had multiple impairments in attention , working memory , visual memory , verbal memory , new learning , and executive function in relation to comparison subjects . in an age - stratified sample of 1982 community - dwelling individuals aged 65 + years , the number of depressive symptoms had strong , statistically significant associations with performance in most cognitive domains such as memory and visuospatial domains . similarly , another study found that increased depressive symptoms were associated with poor cognitive functioning in multiple domains . in the monongahela - youghiogheny healthy aging team study of 2036 individuals aged 65 + years , depressive symptoms remained associated with lower performance on all cognitive composites except attention , most strongly with executive function . in a study of chinese elderly with late - onset depression , tam and lam found that the depression group had a similar cognitive profile to those with mild cognitive impairment , except that its subjects had slightly better performance in the categorical verbal fluency test and delayed recall testing . in a companion report , they showed that increasingly severe depression was associated with lower scores in the mini - mental state examination and delayed recall , and poorer performance in the trail making test - part a . a strong association between depression and decreased cognition was found in 2 studies : rosenberg et al . observed scores on 6 examinations during a 9-year period and reported that higher geriatric depression scale ( gds ) baseline score was highly related to cognitive decline by , and a study of 501 women age 7074 years showed depression co - occurred with worse cognitive performance , but the cognitive performance did not decline in individuals with previous depression , suggesting that cognitive dysfunction is a state phenomenon in depression . in addition to depression , loneliness is also commonly found in elderly people ; this emotionally unpleasant experience is a crucial marker of social relationship deficits . studied elderly people from rural areas in sweden and showed that 35% of them reported they experienced loneliness ( by asking the simple question : do you experience loneliness ? ) . a study in israel , based on home interviews of 70-year - olds , showed that 46.3% of females and while loneliness can be a normative experience , it also has the potential to be pathological , with adverse health consequences and cognitive effects in older people . in an elderly population , it was found that feeling lonely is a predictor of significant cognitive decline . in 2007 , wilson et al . examined the risk of developing alzheimer s disease ( ad ) in a cohort of older adults over a 4-year period and found that the risk of developing ad was substantially increased in those who were lonely compared to those who were not lonely , even when controlling for the level of social activities . despite the apparent effects of loneliness on global cognitive function in the normal elderly , there are few studies exploring their effects on specific cognitive function . in a cross - sectional study of 466 elderly community - dwelling subjects , it was found that loneliness was significantly associated with impaired global cognition , independent of social networks and depression . the cognitive domains of psychomotor processing speed and delayed visual memory were particularly associated with self - reported loneliness . the study was done in a western population and loneliness was ascertained using the single question how often do you feel lonely ? , with participants selecting 1 of the following responses : never , rarely , sometimes , or often . the aim of this study was to investigate the impact of depression and loneliness on objective performance on tests of several cognitive domains in older chinese subjects without dementia . the loneliness was assessed by the loneliness scale . to minimize the confounding effects of gender , this study included a total of 189 participants recruited from a veteran s home in taiwan , as reported in our previous study . a trained research nurse checked initial evaluation data , including self - reported current and past medical status , as well as medical records of each participant . a board - certified psychiatrist evaluated every participant s neurological state and psychiatric diagnosis by structured interviewing with the mini - international neuropsychiatric interview ( mini ) . daily activities and cognitive functions were assessed by using the clinical dementia rating scale ( cdr ) . these criteria for recruiting a group of non - demented elderly subjects with normal daily activities included sufficient visual and auditory acuity for cognitive testing . therefore , exclusion criteria included the following : ( 1 ) presence of diagnoses on axis i of the dsm - iv ; ( 2 ) chronic medical illness under medical control ( e.g. , malignancy , heart failure , lung disease , diabetes ) ; ( 3 ) neurobiological disorders ( e.g. , stroke or parkinson s disease ) ; ( 4 ) subjects with cdr > 0.5 or mini - mental status examination ( mmse ) < 24 to exclude possible dementia . the cut - off point of 24/30 in mmse was chosen because of worldwide usage and as the best compromise between sensitivity and specificity for screening for dementia . this study was conducted in accordance with the declaration of helsinki and was approved by the institutional review board of taipei veterans general hospital . all participants were administered the cognitive abilities screening instrument chinese version ( ca2.si c-2.0 ) test and the wechsler digit span task test . the casi c-2.0 test , a 100-point cognitive test designed for cross - cultural studies and adapted in chinese for individuals with little or no formal education , also provided quantitative assessment in 9 domains of cognitive function ( long - term memory , short - term memory , attention , concentration / mental manipulation , orientation , abstraction and judgement , language , visual construction , and list - generating fluency ) . the wechsler digit span task test requires the examiner to verbally present digits at a rate of 1 digit per second . the forward test requires the participant to repeat the digits verbatim ; the backward test requires the participant to repeat the digits in reverse order . the number of digits increases by 1 until the participant consecutively fails 2 trials of the same digit span length . forward and backward digit span recall abilities have been widely used to assess short - term memory and working memory , respectively , in neuropsychological research and clinical evaluation . depression was assessed by the chinese version of the geriatric depression scale - short form ( gds - sf ) . scores on the gds - sf showed a high validity in accordance with the original version . we use the loneliness scale ( university of california , los angeles , ucla version 3 ) to assess loneliness . often ) to assess how often they felt the way described in the loneliness items . partial correlations were calculated to estimate the independent associations between the depression / loneliness and cognitive parameters . gds - s scores of depression and the cognitive parameters of cognitive function were used to explore their partial correlations after controlling for their mutual association with age and education years . for the partial correlations between loneliness and the cognitive functions , we also controlled the depression score in terms of age and education . to minimize chance occurrence of significant statistical difference with multiple comparisons ( 12 comparisons ) , bonferroni correction was applied to find the appropriate level of p value for statistical significance . the p value for significant statistical difference for each test was lowered to 0.0042 to bring the p value overall back to 0.05 for multiple comparisons performed in the present study . this study included a total of 189 participants recruited from a veteran s home in taiwan , as reported in our previous study . a trained research nurse checked initial evaluation data , including self - reported current and past medical status , as well as medical records of each participant . a board - certified psychiatrist evaluated every participant s neurological state and psychiatric diagnosis by structured interviewing with the mini - international neuropsychiatric interview ( mini ) . daily activities and cognitive functions were assessed by using the clinical dementia rating scale ( cdr ) . these criteria for recruiting a group of non - demented elderly subjects with normal daily activities included sufficient visual and auditory acuity for cognitive testing . therefore , exclusion criteria included the following : ( 1 ) presence of diagnoses on axis i of the dsm - iv ; ( 2 ) chronic medical illness under medical control ( e.g. , malignancy , heart failure , lung disease , diabetes ) ; ( 3 ) neurobiological disorders ( e.g. , stroke or parkinson s disease ) ; ( 4 ) subjects with cdr > 0.5 or mini - mental status examination ( mmse ) < 24 to exclude possible dementia . the cut - off point of 24/30 in mmse was chosen because of worldwide usage and as the best compromise between sensitivity and specificity for screening for dementia . this study was conducted in accordance with the declaration of helsinki and was approved by the institutional review board of taipei veterans general hospital . all participants were administered the cognitive abilities screening instrument chinese version ( ca2.si c-2.0 ) test and the wechsler digit span task test . the casi c-2.0 test , a 100-point cognitive test designed for cross - cultural studies and adapted in chinese for individuals with little or no formal education , also provided quantitative assessment in 9 domains of cognitive function ( long - term memory , short - term memory , attention , concentration / mental manipulation , orientation , abstraction and judgement , language , visual construction , and list - generating fluency ) . the wechsler digit span task test requires the examiner to verbally present digits at a rate of 1 digit per second . the forward test requires the participant to repeat the digits verbatim ; the backward test requires the participant to repeat the digits in reverse order . the number of digits increases by 1 until the participant consecutively fails 2 trials of the same digit span length . forward and backward digit span recall abilities have been widely used to assess short - term memory and working memory , respectively , in neuropsychological research and clinical evaluation . depression was assessed by the chinese version of the geriatric depression scale - short form ( gds - sf ) . scores on the gds - sf showed a high validity in accordance with the original version . we use the loneliness scale ( university of california , los angeles , ucla version 3 ) to assess loneliness . often ) to assess how often they felt the way described in the loneliness items . all participants were administered the cognitive abilities screening instrument chinese version ( ca2.si c-2.0 ) test and the wechsler digit span task test . the casi c-2.0 test , a 100-point cognitive test designed for cross - cultural studies and adapted in chinese for individuals with little or no formal education , also provided quantitative assessment in 9 domains of cognitive function ( long - term memory , short - term memory , attention , concentration / mental manipulation , orientation , abstraction and judgement , language , visual construction , and list - generating fluency ) . the wechsler digit span task test requires the examiner to verbally present digits at a rate of 1 digit per second . the forward test requires the participant to repeat the digits verbatim ; the backward test requires the participant to repeat the digits in reverse order . the number of digits increases by 1 until the participant consecutively fails 2 trials of the same digit span length . forward and backward digit span recall abilities have been widely used to assess short - term memory and working memory , respectively , in neuropsychological research and clinical evaluation . depression was assessed by the chinese version of the geriatric depression scale - short form ( gds - sf ) . scores on the gds - sf showed a high validity in accordance with the original version . we use the loneliness scale ( university of california , los angeles , ucla version 3 ) to assess loneliness . often ) to assess how often they felt the way described in the loneliness items . partial correlations were calculated to estimate the independent associations between the depression / loneliness and cognitive parameters . gds - s scores of depression and the cognitive parameters of cognitive function were used to explore their partial correlations after controlling for their mutual association with age and education years . for the partial correlations between loneliness and the cognitive functions , we also controlled the depression score in terms of age and education . to minimize chance occurrence of significant statistical difference with multiple comparisons ( 12 comparisons ) , bonferroni correction was applied to find the appropriate level of p value for statistical significance . the p value for significant statistical difference for each test was lowered to 0.0042 to bring the p value overall back to 0.05 for multiple comparisons performed in the present study . the subjects were 189 males , ages 6598 years ( mean=80.2 ; sd=4.5 ) , with an average of 5.2 years of education ( sd=4.2 ; range , 016 years of schooling ) . cognitive function tests showed that the mean casi score was 85.910.4 ( range , 57100 ) . partial correlations between depression , loneliness , and total / specific cognitive parameters are presented in table 1 . both depression and loneliness are negatively correlated with global cognitive function as evaluated with casi c-2.0 ( r=0.227 , p=0.002 ; r=0.214 , p=0.003 , respectively ) . further analysis of the 9 domains of casi scores demonstrated that depression is specifically negatively correlated with orientation . for loneliness , it is negatively correlated with attention , orientation , abstraction and judgment , and list - generating fluency ( table 1 ) . the principle finding of this study is that , in our sample of elderly chinese males , loneliness correlated negatively with global cognitive function ( total casi ) after controlling age , education , and depression scores ( table 1 ) . further analysis demonstrated that loneliness correlated negatively specifically with attention , orientation , abstraction and judgment , and list - generating fluency . these results replicate previous studies reporting that loneliness is negatively correlated with cognitive function , and extended prior findings that loneliness has impacts on specific cognitive domains . a previous study of loneliness and specific cognitive functions showed that cognitive domains of psychomotor processing speed and delayed visual memory were particularly associated with self - reported loneliness . the difference in findings between this study and our study could be due to differences in cognitive evaluation ( cognitive test battery vs. casi ) , loneliness evaluation ( single question vs. ucla loneliness scale ) , ethnicity ( irish vs. chinese ) and gender ( both genders vs. male gender ) . the mechanisms of the associations between specific cognitive functions and loneliness were unclear and warrant further investigation . in this study we also found that depression is negatively correlated with global cognition , which is in line with the findings in earlier studies . in further analysis of the correlations with specific casi domains , the strongest correlation was with the orientation domain . previous studies of older patients with depressive disorders suggest a consistent pattern of association with diminished processing speed and executive function [ 2830 ] . our results extend those of previous findings and suggest that depression may also affect orientation cognitive domains . a previous study of loneliness and depression in the elderly showed that the 2 strongly co - occur with each other , although another report suggested that both appear to be distinct phenomena . intense loneliness might result in diminished feelings of self - worth and lack of confidence in interpersonal relationships , thus leading to depression . in this study , after adjusting for depressive severity , the loneliness rating remained correlated with lower performance on global cognitive function and has more correlation with composites than depression ( 4 items vs. 1 item ) . our study demonstrates that the impact of loneliness on cognitive function is independent of depression and may have more effects than depression on specific cognitive domains . interventions to alleviate loneliness in the elderly , such as interventions addressing maladaptive social cognition , may be particularly beneficial to prevent cognitive impairment . the strengths of the study include use of a rather homogenous population - based sample and availability of multiple cognitive parameters . a prospective study would better address the causal relation between cognitive function and geriatric depressive symptoms and loneliness . an additional limitation is that our sample represents elderly male veterans living in veteran housing , and the findings of the association between the specific cognitive functions and depression / loneliness may need to be further validated in younger adults , females , or other populations . our findings suggest that loneliness and depression are negatively correlated with global as well as specific cognitive function in cognitively normal elderly males . both loneliness and depression should be actively recognized and appropriately treated because they are significant sources of cognitive impairment in the elderly .

the clinical presentation differ according to the anatomical variant and there are a variety of types and several classification systems , . y - type duplication is a special form of type iia2 urethral duplication , two urethras originating from the bladder neck . it has two variants ; the usual form of y - type duplication is characterised by a stenotic orthotopic ( dorsal ) urethra and a more functional accessory ( ventral ) urethra , which opens into the perineum , perianal region or the anal canal . the unusual form includes a normal dorsal urethra and hypoplastic ventral urethra . according to this classification we reported a 15 year old boy with unusual form of y - type urethral duplication and reviewed the literature . a 15 year old boy presented with perineal dripping during micturation and had recurrent urinary infection since childhood . the penis and meatal opening were normal but he had a 1x1 mm fistula in perineal area in physical examination . a wide investigation of radiology was made including renal sonography , intravenous pyelography , voiding cystourethrography , fistulography and retrograde urethrography . the fistulography and retrograde urethrography showed a y - shaped urethra , the second urethra was thin and coursing from the posterior urethra to the perineum ( figure 1a+b ( fig . methylene blue was injected into the perianal fistula and the flow was seen in the prostatic urethra ( figure 1c e ( fig . y - type urethral duplication was diagnosed and surgery approach was decided . after inserting an urethral catheter into the meatus of the accessory urethra , it was dissected through perineal incision until the posterior side of the prostatic urethra . the accessory urethra was ligated with a 3\0 vicryl and carried out ( figure 2a+b ( fig . histopathologic examination of the excised tract demonstrated a lining of transitional cell epithelium ( figure 2c ( fig . 2 ) ) , thus confirming that it was urethral duplication rather than urethral fistula . the embryology of urethral duplication is unclear because there are probably different causes for the various types of anomalies , and numerous theories have been postulated , . on the one side , two explanations have been offered for embryological development of complete duplication of bladder and urethra : ( i ) excessive constriction between the urogenital and vesicourethral portions of the ventral cloaca , and ( ii ) a supernumerary cloacal septum that indents the epithelial wall of the bladder . on the other side , possible mechanisms of embryologic development of y - type duplication are faulty closure of the urorectal membrane , impaired growth of the dorsoinferior wall of the urogenital sinus or fistula formation in the dorsal margin of the urogenital sinus due to possible vascular accident . there appears to be a misalignment of sorts between the termination of the cloacal membrane and its relationship with the developing genital tubercle and urogenital sinus . y - type duplication may be associated with disorders of midline development and other congenital anomalies such as cloacal exstrophy , conjoined twins , early amnion rupture syndrome , and hand - foot genital syndrome . a relationship between urethral duplication and disorders of midline development has been found such as vater ( vertebral defect , anus imperforate , tracheoesophageal fistula , radial and renal dysplasia ) and vacterl complex ( vertebral , anal , cardiac , tracheal , esophageal , renal , limb etc ) , . we did not find any other anomalies in our patient with detailed evaluation before beginning the treatment process . effmann classification includes all clinical aspects of urethral duplication and it is more useful for the surgeon in helping him make the decision for surgery ( figure 3 ( fig . 3 ) ) . according to effman classification , y - type urethral duplication ( typeaii 2 ) defines two urethras originating from a common bladder neck and states that the accessory urethra opens into the area perineum to rectum . y - type urethral duplication usually has a more functional ventral channel and a hypoplastic or stenotic dorsal ( orthotopic ) channel . some researchers / scholars suggest that this type of duplication exists only when the ventral urethra is the functional urethra . however , when the ventral urethra is hypoplastic , the anomaly is classified as a congenital urethroperineal fistula . on the other hand , wagner et al . these researchers / scholars believe that the presence of transitional cell epithelium lining the tract , as we observe in the case of our patient , is very supportive of a true urethral duplication . clinical significance of urethral duplication is various . urinary symptoms show a wide range , such as double stream , incontinence , urinary tract infection , or outflow obstruction . in most cases , patients with unusual form of urethral duplication present no symptoms , excluding the occasional double stream and urinary tract infection . our patient was not only suffering from recurrent urinary infections , but also experiencing dribbling of urine in perineal area since birth . diagnosis of y - type urethral duplication is made with voiding cystourethrography , retrograde urethrography and fistulography . imaging and viewing of the lower urinary tract is used to find out the other lower urinary tract abnormalities such as posterior urethral valve , bladder neck obstruction and megalourethra , which might be associated with y - type urthral duplication , , , . upper urinary tract should be carefully examined with renal ultrasonography and intravenous urography , because urethral duplication may be associated with upper urinary tract anomalies such as solitary kidney , hydronephrosis , multicystic dysplastic kidney and obstructive megaureter , . the treatment for duplicate urethra depends on the patient s symptoms and the type of anomaly . y - type duplications with hypoplastic dorsal urethra and stenotic meatus obviously require more complex intervention than other kinds of repair , . in cases in which the dorsal urethra is the normal channel , as observed in our patient , excision of the accessory anterior channel is the final surgical treatment and can be successful , . the alternative methods of sclerosis or fulguration of the accessory channel also have been reported . sclerosis is associated with risks of corporal thrombosis , fibrosis , impotency , and incontinence ; hence , it should be avoided . in our case , an unusual y - type urethral duplication should be suspected in any patient who has a history of recurrent urinary infection attacks and recurrent perineal dripping during micturation . we suggest that a simple resection of the ventral channel is curative for y - type duplication with a normal orthotopic urethra .

odontoma , complex type ( oc ) is a tumor - like malformation ( hamartoma ) in which enamel , dentin , and pulp , and sometimes cementum , is present in a disorganized form . the etiology of odontoma is unknown but genetic factors and environmental causes such as trauma and infection have been proposed . this developmental anomaly results from the growth of completely differentiated epithelial and mesenchymal cells that give rise to ameloblasts and odontoblasts . it occurs before the age of 30 with the peak in the second decade of life and - male : female ratio being 1.5:1 . dentigerous cyst is a developmental odontogenic cyst seen around the crown of unerupted tooth and attached to its neck . apparently , the dentigerous cyst arises by the accumulation of fluid between reduced enamel epithelium and the tooth crown . amongst all the jaw cysts its prevalence is 16.6% and the most common site is mandibular third molar region followed by maxillary permanent canine , mandibular premolars , and maxillary third molars . dentigerous cysts are seen in conjunction with odontomas in 27.6% of cases . in the present case , complex composite odontoma associated with an impacted maxillary lateral incisor was an incidental radiographic finding . histopathological examination revealed that the soft tissue was a dentigerous cyst associated with an odontoma . the association of a cyst arising from odontoma and an impacted permanent lateral incisor makes this case interesting . a 30-year - old male patient presented with the chief complaint of missing anterior teeth to the department of oral and maxillofacial pathology modern dental college and research centre , indore . patient gave history of meeting with an accident one month back in which his upper left central incisor was fractured and the retained part of the tooth was mobile , which was extracted by the dentist on the same day . intra oral examination revealed missing 21 , 22 , and lacerated wound , lateral to the extraction socket of 21 . single , intrabony , hard , and tender swelling was present in the anterior part of the hard palate . the swelling was extending from the mesial aspect of 23 to the mesial aspect of 11 with the dimension of 1.5 1 0.5 cm . small white globular structure was seen within the lacerated wound in 22 region , which was of 0.3 0.2 0.3 cm in size , hard in consistency , smooth textured , and shiny in appearance . iopa , occlusal view of anterior maxilla , and orthopantomogram were taken and radiographs revealed multiple , small globular to irregular radiopaque structures in 21 and 22 region and was surrounded by a thin radiolucent rim around it . on the occlusal side and adjacent to the radiopacities , a small well defined radiolucency was noted of approximately 1 0.5 cm . the 22 was impacted and placed palatally and horizontally superior to the radiopacities [ figure 1 ] . occlusal radiograph , iopa , and orthopantomogram show missing left central incisor , horizontally impacted left lateral incisor(red arrow ) and multiple radiopaque masses with a thin radiolucent rim(white arrow ) . the impacted permanent lateral incisor was also removed as it was horizontally placed [ figure 2 ] . on histopathological examination , h and e stained decalcified section showed distantly placed small areas of pulpal tissue of variable volume and few disorderly placed enamel spaces surrounded by dentin . some enamel spaces showed homogenous eosinophilic areas adjacent to them , suggestive of immature enamel . at places , cementum like tissue was admixed with the dentin . the cystic lumen was lined by 34 cell layers thick , flat , non keratinized stratified squamous epithelium . other soft tissue excised from the same area showed similar epithelial features as those seen in the lining attached to the odontoma . underlying connective tissue capsule was moderately dense fibrocellular , moderately vascular , and showed diffuse mild to moderate chronic inflammatory cell infiltration . few odontogenic islands were interspersed in the connective tissue capsule[figures 3 and 4 ] . decalcified h and e - stained section shows haphazard arrangement of enamel space , dentin , pulp , and cementum . a soft tissue adjacent to it showed cystic lining h and e - stained section shows cystic lumen lined by 34 layers thick nonkeratinized stratified squamous epithelium complex odontoma is most prevalent in the dental field superceded in frequency only by compound odontoma . these non - aggressive hamartomatous malformations consist of mixed lesions with epithelial and mesenchymal tissues , which show differentiation into odontogenic tissues such as enamel , dentin , cementum and pulp . compound odontomas consist of encapsulated , discrete , small tooth - like structures , or denticles in a fibrous connective tissue stroma , mostly located in anterior maxilla . complex odontomas on the other hand , consist of an irregular mixture or mass of mature hard and soft dental tissues , which has no resemblance to teeth . despite their unknown etiology , odontomas are usually discovered during the second and third decades of life as an incidental finding as they are asymptomatic.- sometimes it may present as bone expansion , pain , and tooth displacement or show association of unerupted normal teeth . intra - oral radiographs usually show well - defined borders of a similar density of calcified dental tissue , having a ground - glass appearance , and a radiopaque mass occupying the affected region , surrounded by a thin radiolucent halo . although they are usually tooth - sized or smaller , the complex variant can occasionally exhibit considerable size and can attain diameter upto 6 cm . the frequency of complex variant constitutes between 5% to 30 % of all odontogenic tumors . usually they are located in the posterior mandible and the second most common site is the anterior maxilla . the present case shows a complex odontoma in anterior maxilla , which is second common site for it and was associated with impacted lateral incisor . when the lesion was exposed surgically the soft tissue lining was attached to the odontoma and not the impacted tooth , which confirms the association of cyst with the odontoma only . large odontomas are associated with local disturbances such as the eruption delay of permanent teeth and the development of cystic lesions as dentigerous cysts . these cases of simultaneous pathologies are uncommon and diagnosis based on the radiographic appearance of such lesions is a challenge to dental professionals because huge lesions with solid features can mimic pathologies such as fibro - osseous lesions , for e.g. , fibrous dysplasia , ossifying fibroma . in addition to their potential for attaining large size and destroying the jaw bone , these cysts are capable of causing resorption of roots of adjacent teeth with neoplastic changes such as ameloblastoma , mucoepidermoid , and epidermoid carcinomas within isolated segments of the cyst wall . the potential for neoplastic change and invasion beyond the cyst wall justifies complete enucleation of the dentigerous cyst and its histopathological examination . odontoma is a common incidental finding when radiographic evaluation is performed and should be carefully analyzed . kaugars et al found that roughly half of all odontomas block the eruption of a tooth . this study demonstrated that 77% ( 62/81 ) of odontomas were located on the eruption pathway of a permanent or deciduous tooth . the association of this lesion with the unerupted tooth is high and three - quarters of impacted teeth related to odontomas can erupt after removal of the odontoma . this finding indicates that a careful consideration has to be made before removing the impacted tooth associated with the odontoma . another reason for removing odontomas is their association with the dentigerous cysts in significant number of cases ( 27.6% ) . looking at the association of these two lesions and the potential complications associated with the cyst , odontomas should be properly evaluated and removed in case of any suspicion of cystic transformation .

a 63-year - old man visited the emergency center of our hospital with epigastric pain and a fever . the diagnosis was gallbladder adenomyomatosis and he was scheduled for laparoscopic cholecystectomy ( lc ) . he had hypertension and atrial fibrillation . he had experienced unstable angina , which led to stent insertion in the left anterior descending ( lad ) coronary artery three times 12 , 10 , and 3 years earlier , respectively . his medical regimen at the time of admission for elective lc included : bisoprolol , nicorandil , cilazapril , aspirin , isosorbide mononitrate , fluvastatin , and diltiazem . the preoperative electrocardiogram ( ecg ) on this admission showed nonspecific st - t changes ( fig . 1a ) and coronary angiography performed after this admission showed total occlusion from the proximal to the distal parts of the circumflex artery with intracoronary collaterals , diffuse 30% stenosis of the proximal and middle parts of the lad with stents , 95% stenosis of the hypoplastic right coronary artery , and a patent left internal mammary artery to the obtuse marginal artery . his preoperative ast , alt , hemoglobin and hematocrit were 48 iu / l , 87 iu / l , 13.2 g / dl and 36.9% . the patient repeatedly refused a treadmill test . in the operating room , monitoring included a five - lead ecg with continuous st segment analysis , pulse oximetry , noninvasive blood pressure , end - tidal co2 , esophageal temperature , bispectral index , and an arterial catheter placed in the left radial artery . general anesthesia was induced uneventfully with a bolus of etomidate 21 mg and rocuronium 50 mg . anesthesia was maintained with 2 l / min oxygen , 2 l / min nitrous oxide , and isoflurane with the concentration adjusted to maintain hemodynamic stability . nitroglycerin ( ntg ) was given as a continuous intravenous dose of 0.5 g / kg / min for coronary vasodilation . the patient was ventilated by a semiclosed circular circuit with a tidal volume of 700 ml and respiratory rate 12 breaths per minute . the blood pressure and pulse rate were stable throughout the operation at 130/80 mmhg and 80 beats / min , respectively . intraoperative intra - abdominal pressure ( iap ) value of 13 mmhg was achieved by insufflating the abdominal cavity with a carbon dioxide ( co2 ) . intraoperative arterial blood gas analysis showed ph = 7.37 , paco2 = 39.1 mmhg , pao2 = 195 mmhg , hco3 = 22 meq / dl , hb = 13.6 g / dl , na = 135 meq / dl , and k = 4.0 meq / dl . , he received 520 ml of replacement fluid and the urine output was 80 ml . the initial blood pressure in the recovery room was 130/80 mm / hg and the three - lead ecg showed atrial fibrillation with 80 beats / min . in the recovery room , the patient still received the continuous ntg infusion that was started in the operating room . forty minutes after arriving at the recovery room , the patient complained of chest pain and dyspnea . his vital signs at that time were blood pressure 75/40 mmhg , heart rate 120 beats / min , and o2 saturation 85% . he was intubated promptly ; the ntg was stopped , and he was given an injection of phenylephrine 100 g . 1b ) and cardiac markers were checked , and a central venous catheter was inserted in the left subclavian vein . the initial central venous pressure ( cvp ) we called a cardiologist and a chest surgeon . soon afterward , the patient became asystolic on the ecg . cardiopulmonary resuscitation ( cpr ) was begun immediately and epinephrine 1 mg and atropine 0.5 mg were administered initially and at 3-min intervals . simultaneously , dopamine 20 g / min / kg was started . during cpr , a portable transthoracic echocardiogram was obtained , which showed hypokinesia of the inferior , lateral , and posterior walls and akinesia of the anterior wall . the patient was transferred to the angiography room for insertion of an intra - aortic balloon pump ( iabp ) . after the iabp was inserted , the patient 's condition did not change . immediately afterward , ecmo ( capiox emergency bypass system , terumoinc . , tokyo , japan ) was begun at flow rates between 2.8 and 4 l / min . g / l at the time of acute event in the recovery room to 12.52 g / l 3 h later the event ( normal range < 0.05 perioperative myocardial infarction is one of the most important predictors of short- and long - term morbidity and mortality associated with noncardiac surgery . the american college of cardiology and american heart association ( acc / aha ) practice guidelines recommend assessing patients ' comorbidities and exercise tolerance , as well as the type of surgery to be performed , to determine the overall risk of perioperative cardiac complications . based on this assessment , selected patients should undergo provocative cardiac testing ; others may require interventions . in our case , a patient who underwent cabg because of a mi 2 years earlier was undergoing an elective lc . according to the risk of various types of noncardiac surgical procedures stratified by the acc / aha practice guidelines , elective lc , which is intraperitoneal surgery , is a surgical procedure at intermediate cardiac risk . the reported cardiac risk of intermediate cardiac risk surgical procedures is generally less than 5% . however , during laparoscopic surgery , peritoneal insufflation to iaps higher than 10 mmhg induces significant alterations of hemodynamics . these disturbances are characterized by decreases in cardiac output , increased arterial pressures , and elevation of systemic and pulmonary vascular resistance . anesthesiologists should consider the hemodynamic changes associated with laparoscopic operation during preoperative surgical risk evaluation of cardiac patients . concerning the cardiac risk with a previous cabg , if the patient has had complete surgical revascularization in the previous 5 years , and if his or her clinical status has remained stable without recurrent signs or symptoms of ischemia in the interim , the likelihood of perioperative cardiac death or mi is extremely low . our patient had no recurrent signs and had preserved left ventricular function with an ejection fraction of 0.59 , and was predicted to be at low cardiac risk because of the previous cabg . hypertension is an important risk factor for ischemic heart disease and results in increased systemic vascular resistance , decreased intravascular volume , and an exaggerated pressor response . furthermore , hypertension is one of the etiologies most frequently associated with atrial fibrillation ( af ) , which can produce ischemia by increasing myocardial oxygen demand . in our case , the hypertension was well controlled during the preoperative and intraoperative periods , while the intraoperative and postoperative ecg showed af . considering our preoperative evaluations , we regret that the patient 's functional capacity was not checked with a treadmill test , although the patient refused the test to the last . ergometric measurements on a treadmill inducing ischemia at low - level exercise [ < 5 metabolic equivalents ( met ) or heart rate < 100/min ] identify a high - risk group , whereas the achievement of more than 7 met ( or heart rate > 130/min ) without ischemia identifies a low - risk group . another missed point of this case was the use of phenylephrine immediately after development of the symptoms considering low blood pressure and rapid heart rate . phenylephrine is a selective 1-agonist and commonly used when peripheral vasoconstriction is needed and cardiac output is adequate , as in patients with coronary artery disease to increase coronary perfusion pressure without chronotropic side effects . anesthesiologists should consider the cardiac output state before use of drug and we thought that norepinephrine might be better than phenylephrine in our case or similar case . most ischemic episodes tend to start at the end of surgery and during emergence from anesthesia . increased sympathetic tone can result in increases in arterial pressure , heart rate , and cardiac contractility , and these conditions might lead to subendocardial ischemia by increasing myocardial oxygen demand and eventual myocardial infarction . in addition , the intense procoagulant activity and sympathetic stimulation in the postoperative period have been implicated in the development of coronary vasospasm , thrombosis , and the rupture of atheromatous plaque , leading to myocardial ischemia and infarction . however , this mechanism is not very plausible because st - depression is the most common ecg change and the classic st - elevation marker of acute coronary occlusion is rare in the postoperative period . furthermore , postoperative mi has always been considered a relatively late complication , with the peak occurrence on the third day after surgery , and with an exceptionally high mortality of 30 - 70% . in our case , ischemic symptoms of chest pain and st - depression developed 40 min after surgery , while postoperative mi unusually occurs within 1 h after surgery in the recovery room . this case showed that postoperative mi can develop early after surgery , so anesthesiologists should cautiously monitor patients with coronary artery disease and cardiac problems in the recovery room . other factors of concern for anesthesiologists - postoperative pain and physiological and emotional stress - may all combine to cause tachycardia , hypertension , increased cardiac output , and fluid shifts , which might result in subendothelial ischemia and eventual mi in high - risk patients . although patient controlled analgesia ( pca ) was not applied routinely after lc in our hospital , in this case , pca should be considered and might be helpful to the patient . in conclusion , we described an acute , fatal postoperative mi in a cardiac patient with preserved left ventricular function after noncardiac surgery . anesthesiologists must be aware that this rare complication could happen in cardiac patients after surgery . anesthesiologists should always consider this complication when evaluating preoperative risk , performing anesthesia , and managing postoperative patient care , as well as the development of postoperative ischemic symptoms , including chest pain or st - depression .

atrichilemmal cyst also known as pilar cyst is a common cyst that forms from a hair follicle . the cysts are smooth filled with keratin , a protein component found in hair , nails , and skin . a 55-year - old female from south india of dravidian race presented with a history of gradually progressive , painless swelling in the left bulbar conjunctiva adjacent to the nasal limbus of 3 years duration . there was no history of trauma or history of any surgery performed in the past . , there was a nodular mass adjacent to the nasal limbus of left eye measuring 5 mm 5 mm , fixed to the underlying tissue , non - tender , lying within the pterygium [ figures 1a and b ] . a fold of subconjunctival tissue extending from the swelling to the caruncle was observed during wide excision biopsy of the lesion . ( a and b ) nodular mass at the limbus histopathology indicated the presence of sebaceous material . microscopic examination showed a cyst lined by stratified squamous epithelium with the absence of granular cell layer , focal basal cell hyperplasia , and flakes of keratin within the cyst [ figures 2a c ] . cyst cavity filled with keratin lacking a granular cell layer in its wall ( h and e , 400 ) focal basal cell hyperplasia in the cyst wall absence of granular cell layer in the cyst wall it poses a diagnostic challenge because most lesions are transitions between inflammation , inflammatory hypertrophies , and true neoplasms . a trichilemmal cyst , also known as wen , pilar cyst or isthmus - catagen cyst forms from a hair follicle . though most often found on the scalp , they can also occur on other parts of the body such as the upper lip , palpebral conjunctiva , caruncle , and pulp of the index finger . the rare location of bulbar conjunctiva in this case could be explained as originating from the caruncle and being pushed toward the nasal limbus . however histologically trichilemmal cysts lack a granular cell layer . approximately , 20% of the epithelial cysts are trichilemmal cysts and other 80% are epidermoid . there are a few reported cases of trichilemmal cyst and malignant trichilemmal tumor of the eyelid . however to the best of our knowledge , no cases of trichilemmal cysts involving the bulbar conjunctiva have been reported . this case report highlights the need for considering trichilemmal cyst as differential diagnosis of the limbal nodule .

hepatic encephalopathy ( he ) is a disturbance in the central nervous system ( cns ) function due to hepatic insufficiency or portal - systemic shunting . he causes a spectrum of neurologic manifestations that develop in association with different liver diseases . a common link is the potential reversibility of the neurologic manifestations once the abnormality of liver function is corrected . the shunting of blood from the portal venous bed into the systemic circulation is considered a key element of he . there are a series of neurological disorders associated with liver disease that are not considered he . this disorders may share a common pathogenetic mechanism , for example , brain and liver damage caused by alcohol or copper ( wilson 's disease ) . he must also be differentiated from neurologic disturbances caused directly by bilirubin accumulation ( kernicterus ) , cerebral hemorrhage secondary to disorders of coagulation caused by the liver disease , or other abnormalities that are not secondary to liver failure . for this reason several efforts have been made to reach a consensus , especially for the design of clinical trials . despite this limitation , from a clinical perspective , he is generally classified according to the underlying liver disease and the evolution of the neurological manifestations ( table 1 ) . the most frequent liver disease is cirrhosis , usually accompanied by extrahepatic portal - systemic shunts ( spontaneous or surgical ) . he also can be seen in acute liver failure , where it constitutes the hallmark of the disease . in rare cases , he develops in the absence of any sign of parenchyma liver disease and is caused solely by portal - systemic shunting of congenital or surgical origin . the most distinctive presentation is an acute episode characterized by the sudden onset of confusion that can evolve into coma . neuromuscular abnormalities are common , with the most characteristic one being the presence of asterixis ; pyramidal signs may also be present . the term chronic hepatic encephalopathy is reserved for patients who have frequent episodes of episodic encephalopathy or persistent cognitive ( memory loss , confusion , and disorientation ) or neuromuscular disturbances ( tremor , apraxia , and rarely paraplegia ) . minimal hepatic encephalopathy corresponds to those neurologic manifestations that are not obvious on clinical examination but are detected by the demonstration of abnormal neuropsychological or neurophysiological tests . different hypotheses have been proposed to explain the changes in mental state that occur in he . however , establishing such relations is difficult , in part , because of limitations in the methods available to study brain function in humans and also due to an insufficient knowledge of the neurobiological basis of behavior . nevertheless , there is a generalized consensus that the validation of a hypothesis should explain the mechanism of action of a precipitating factor and how specific therapies improve he . a common pathogenetic notion is that he is caused by substances that under normal circumstances are efficiently metabolized by the liver , rather than an insufficient production of substrates that could be essential for neurologic function . under this light , portal - systemic shunting plays a critical role , as the main impact of this circulatory disturbance is on the concentration of gut - derived substances that are highly cleared by the liver . studies of cross - perfusion in animals with experimental he and liver support systems in humans have shown that clearance of toxic substances present in the blood is more important to improve mental function than the synthetic capacity of the support system . in patients with liver disease , these toxic substances reach the systemic circulation as a result of portal - systemic shunting or reduced hepatic clearance and produce deleterious effects on brain function . once the toxic substances are in neural tissues , a large number of neurochemical changes occur that affect multiple neurochemical pathways , each affected to a variable extent . historical hypothesis have ranged from unifying theories to the notion of he as a multifactorial process . as in other metabolic encephalopathies , general neuronal dysfunction results in abnormalities of consciousness . however , in contrast to other conditions that affect consciousness ( such as hypoglycemia ) , where neuronal function is primarily affected , the cell that is abnormal in he corresponds to the astrocyte that shows characteristic changes in morphology and function . this feature has led to the interpretation that he is mostly a disturbance of consciousness secondary to altered communication between the astrocyte and the neuron . alternative views , such as the gaba ( -aminobutyric acid ) theory , explain the spectrum of he through the direct effect of one toxin on a key aspect of neurological function . other paradigms arise from the experimental observation that different toxins enhance the negative effects of ammonia on consciousness ( synergistic theory ) . this concept has been expanded to include the contribution of systemic inflammation to hepatic encephalopathy , as well as alterations in the cerebral blood flux and in the oxidative metabolism . ( a ) ammonia is produced by the gut , and an important amount is of bacterial origin . ( b ) the concentration of ammonia in portal blood is high , and a high degree of extraction occurs in the liver . ( c ) concentrations of ammonia are high in the systemic circulation and in the cerebrospinal fluid of patients with he . ( d ) precipitating factors cause elevations in the blood level of ammonia or result in exposure of brain tissue to ammonia . ammonia is generated in different tissues from the breakdown of amino acids and other nitrogenous substances . under normal physiological conditions , ammonia enters the portal circulation from the gastrointestinal tract , where it derives from colonic bacteria and from the deamidation of glutamine in the small bowel . traditionally , absorption was viewed as the result of passive diffusion ; more recent studies indicate the presence of specific ammonia transporters . regardless of the mechanism of absorption , ammonia reaches high concentration in the portal blood and undergoes a high first - pass hepatic extraction ( 80% ) . in the liver , ammonia is transformed in the periportal hepatocytes into urea ( a high - capacity and low - affinity system ) and in the centrovenular hepatocytes into glutamine ( a low - capacity and high - affinity system ) . urea is quantitatively the most important product of ammonia metabolism and elimination . circulating urea diffuses into the intestine ( 40% ) , where it undergoes hydrolysis into ammonia through ureases present in colonic bacteria . urinary elimination of nitrogen in the form of urea is a route of ammonia disposal from the organism . in addition to the intestine and the liver , kidney and muscle contribute to regulating the arterial ammonia level . experiments in normal volunteers showed that 50% of injected n - ammonia is removed by the muscles . the ability of the muscle to fix appreciable amounts of blood - borne ammonia becomes important to regulate arterial ammonia in case of liver failure and highlights the importance of maintaining an adequate muscular mass in patients with he . it is generally accepted that at rest skeletal muscle is an ammonia - consuming organ . however , during moderate to heavy exercise , the muscle releases ammonia . the kidneys generate ammonia from the deamination of glutamine , a step involved in the regulation of arterial and urinary ph . a small fraction of renal ammonia is released into the systemic circulation ; urinary ammonia excretion may be affected by dehydration and increases in conditions of hyperammonemia . notwithstanding the role of peripheral organs , the main factors resulting in the increase in blood ammonia in liver failure are a decrease in the capability of the liver to generate urea and glutamine and the bypass of first - pass hepatic metabolism via portal - systemic shunts . patients with he have an increased diffusion of ammonia into the brain , though recent studies using sophisticated pet techniques have questioned this tenet [ 13 , 21 ] . variations in the passage of ammonia across the blood brain barrier may explain the poor relationship between the level of arterial ammonia and the degree of he ; nonetheless , the relation between plasma ammonia levels and cerebral dysfunction seems to be clear in patients with acute liver failure in which plasma ammonia have a direct correlation with the presence of intracranial hypertension and death [ 22 , 23 ] ( figure 1 ) . this relation may be related to the induction of brain edema by ammonia or simply be an indicator of the severity of liver failure . during this may highlight the importance of additional factors that participate in the pathogenesis of he . among them , those more important appear to be inflammatory mediators . most recently , glutamine has been shown to have a key role in the brain toxicity induced by ammonia . it has long been accepted that the conversion of glutamate to glutamine , catalyzed by glutamine synthetase , a cytoplasmic enzyme largely localized in astrocytes in brain , represents the principal way of cerebral ammonia detoxification . much of the newly synthesized glutamine is subsequently metabolized in mitochondria by phosphate - activated glutaminase , yielding glutamate and ammonia . in this manner , glutamine is transported in excess from the cytoplasm to mitochondria serving as a carrier of ammonia . it has been proposed that the glutamine - derived ammonia interferes with mitochondrial function giving rise to excessive production of free radicals and induction of the mpt , two phenomena known to bring about astrocyte dysfunction , including cell swelling . this hypothesis is supported by neuroimaging studies that had shown increased levels of brain glutamine during the he episode that decreased when the episode had been recovered . one of the postulated mechanisms for this effect is the increased availability of agonist ligands of the gaba receptor complex , a key inhibitory neurotransmitter in the brain . the term natural benzodiazepines has been coined for a group of substances of nonpharmacological origin that bind to the benzodiazepine site of the gaba receptor , where they can act as agonist or antagonist . these substances , which are poorly characterized from a chemical and functional perspective , have been reported to be present in a variety of human tissues in normal conditions and to purportedly accumulate in the brain of patients with he . it has been proposed that natural benzodiazepines with agonist effects on the gaba receptor induce a decrease of consciousness in he . however , not all the benzodiazepine ligands found in he have agonist effects on the gaba receptor ( e.g. , diazepam binding inhibitor ) . these include direct and indirect effects of ammonia on the affinity of gaba receptors to its natural ligand . ammonia may also result in an increased density of peripheral - type benzodiazepine receptors ( ptbrs ) , present in astrocytic mitochondria and whose activation results in the synthesis of neurosteroids , powerful ligands of neuronal gaba receptors [ 28 , 29 ] . several arguments have been proposed in favor of a role for natural benzodiazepines in he . the most relevant is the observation of an improvement of mental state after the administration of flumazenil ( a benzodiazepine receptor antagonist ) in some patients with advanced stages of he that have not consumed benzodiazepines of pharmacological source . however , the beneficial effects of flumazenil , usually mild and transient , are only seen in a subgroup of patients . one of the main limitations of this theory is the lack of an explanation of the mechanism by which natural benzodiazepines increase in he . a study in rats with experimental he showed generation in the intestinal flora of precursors of natural benzodiazepines . these precursors would be transformed into natural benzodiazepines in the brain and accumulate secondarily to liver failure . however , additional studies in humans are lacking in order to confirm the link between intestinal flora , liver function , natural benzodiazepines , and he . an alternative source of natural benzodiazepines could be hemoglobin ; metabolites of hemoglobin that mimic benzodiazepines have been described . manganese is probably involved in the development of parkinsonian manifestations in he , but its role in other neurological manifestations is uncertain . the concentration of manganese is elevated in plasma of patients with cirrhosis and in the brain of patients who die with he . patients with cirrhosis typically exhibit a hyperintense signal in the globus pallidus that has been attributed to the preferential accumulation of manganese in basal ganglia . however , some studies have failed to show a good association between the intensity of the signal in basal ganglia and neurological manifestations of he . nevertheless , similarities to the clinical and radiological features of manganese intoxication suggest that the increase in manganese in cirrhosis causes the extrapyramidal signs of chronic he through mechanisms that impair dopaminergic neurotransmission . the effect of manganese removal on the neurological signs and symptoms of chronic he has not been evaluated . experimental and pathological evidence point at astrocytes as the main neurological cell affected in . the distinctive morphologic alteration is the alzheimer type ii astrocytic change , which is characterized by a cell with enlarged , pale nuclei with peripheral margination of chromatin and often prominent nucleoli . results of microscopic studies of specimens from humans and experimental preparations suggest that the astrocytic changes are due to cellular swelling . their foot processes surround brain capillaries , where they contribute to blood brain barrier function . this anatomical organization forms a syncytium , where critical metabolic supportive functions involved in the maintenance and regulation of the extracellular microenvironment , such as uptake of ions and neurotransmitters , influence neuronal excitability and neurotransmission . a specific astrocyte function is the detoxification of ammonia through the amidation of glutamate to glutamine . recent studies have emphasized a role for oxidative stress , including nitrosative stress , as a critical factor in ammonia - induced cell impairment through collapse of the inner mitochondrial membrane due to the opening of the permeability transition pore . the collapse leads to mitochondrial dysfunction , energy failure , and additional free radical production . the mitochondrial permeability transition is a ca2 + dependent , cyclosporine a ( csa ) sensitive process due to the opening of a pore in the inner mitochondrial membrane that leads to a collapse of ionic gradients and ultimately to mitochondrial dysfunction . through this mechanism the improvement of neurological manifestations after the administration of a drug that interacts with an individual transmitter system is an important argument to support a pathogenic role for that system . the first attempt to normalize the abnormalities of neurotransmission arose from the false neurotransmitter hypothesis . the notion was to restore the abnormalities in the profile of plasma amino acids and the transport of amino acids across the blood brain barrier by administering branched chain amino acids . subsequent therapeutic attempts have been focused on the brain itself and include stimulation of dopaminergic transmission with bromocriptine or levodopa and blockage of gaba inhibitory neurotransmission with flumazenil . the results have not been remarkable , highlighting the complexity of a paradigm where several neurotransmitter systems are simultaneously affected . still these attempts indicate that it may be possible to treat hepatic encephalopathy using drugs that act in the brain in addition to measures that decrease the plasma level of a putative toxin . glutamate neurotransmission , which is clearly disturbed in animal models of he , has been proposed to play a role in the pathogenesis of he . however , supportive human data arise mostly from autopsied samples and pharmacological manipulation of glutamatergic neurotransmission has not been attempted . decreasing the neurotransmitter activity will cause a decrease in consumption of oxygen and glucose is accompanied by a parallel decrease in cerebral blood flow . some studies with humans have shown focal reductions of glucose utilization that have been related to specific neurologic manifestations . however , the findings can not separate whether the decrease is the cause or the consequence of the encephalopathy . the current interpretation is that , as in other metabolic encephalopathies , the decrease in energy consumption is secondary to the decrease in demand . an increase in supply , as observed in some patients with high cerebral blood flow , especially among those with fulminant hepatic failure , does not improve the mental state . brain edema is a complication of fulminant hepatic failure , which can progress to intracranial hypertension and death . brain edema has been frequently regarded as a distinct entity , dissociated from the neurological features of he . although intracranial hypertension is a common problem in patients with fulminant hepatic failure in coma , the development of high intracranial pressure ( icp ) in patients with cirrhosis in deep coma is only occasionally documented . brain edema has been described in all situations of acute hyperammonemia and has been associated to plasma levels of ammonia in fulminant hepatic failure . in the experimental setting , brain swelling secondary to ammonia infusion can be prevented with the administration of an inhibitor of the synthesis of glutamine . other factors , such as hyponatremia , may enhance the effects of ammonia on brain swelling . in fulminant hepatic failure , an additional factor that plays an important role in the development of intracranial hypertension is the presence of abnormalities of cerebral circulation . indeed , measures that decrease cerebral vasodilatation are of clinical benefit for patients with severe intracranial hypertension . in addition to differences in the cerebral circulation and in the rate of exposure of the brain to ammonia , patients with cirrhosis may activate compensatory mechanisms that counteract osmotic changes in the brain . the first step in the approach of he is to establish the presence or absence of underlying hepatic injury as well as the degree of this injury . the absence of hepatic cirrhosis leads to rule out the presence of portal - systemic shunts being this vascular disorder the target of the treatment . he associated to acute liver failure confers a poor prognosis and it is the manifestation of the end stage of this clinical condition involving prognostic and therapeutic decisions . he associated with cirrhosis and portal hypertension can appear as an isolated episode with or without precipitating event if the episodes resort in time with a period free of event , it is defined as recurrent he ; if it persist over time , it is defined as chronic he . more recently , another type of he without apparent clinical disturbance that required psychometric test for diagnose was defined as minimum he ( table 1 ) . acute he can appear as an isolated decompensation without worsening of the hepatic function , as part as an acute - on - chronic liver failure or as part as an acute liver failure without previous hepatic disease . a special feature is the appearance of acute he in the context of portal - systemic shunts with or without liver disease . each specific case confers a different prognosis ; when the he episode appears in the context of acute - on - chronic liver failure a poor prognosis has been observed ( cumulative mortality of 55% in 9 month ) in contrast to when it occurs as a simple decompensation , the mortality was lower 25% . acute liver failure in the absence of cirrhosis , deserve a special mention , this entity has a high mortality and usually requires a liver transplant . the acute he episode could be associated with a precipitating factor but in the majority of cases no precipitating factor was identified . an acute episode of he is characterized by the development of an acute confusional syndrome that includes impaired mental state , neuromuscular abnormalities , fetor hepaticus , and hyperventilation . variability is an important feature ; the clinical manifestations may fluctuate very rapidly and oscillate from mild confusion to deep coma . most patients do not have significant neurological manifestations before the onset of the acute episode of he , unless they had persistent he . the evolution of an acute episode of he tends to parallel the course of liver function or the removal of the precipitating factor . patients usually recover from he without major neurological deficits and are able to return to previous activities . impairment of consciousness initially manifests as subtle changes of personality or disturbances in the circadian rhythm of sleep and wakefulness ( insomnia during the night and somnolence during the day ) . as he progresses , the manifestations include inappropriate behavior , disorientation , confusion , slurred speech , stupor , and coma . some patients may experience nausea and vomiting , especially if there is a rapid evolution into coma . asterixis is a characteristic feature of he that represents the failure to actively maintain posture or position . asterixis is caused by abnormal function of diencephalic motor centers that regulate the tone of agonist and antagonist muscles , normally involved in maintaining posture . the classic method of eliciting asterixis is by dorsiflexion of the patient 's hand with the arms outstretched and fingers separated . the postural lapse that occurs consists of a series of rapid , involuntary , flexion - extension movements of the wrist . asterixis may be observed during any sustained posture : tongue protrusion , dorsiflexion of the foot , or fist clenching . asterixis is not exclusive to he and can occur in other metabolic or structural encephalopathies ( renal failure , hypercapnia , and stroke affecting basal ganglia ) . , asterixis disappears , but the patient may exhibit signs of pyramidal involvement , such as exaggerated deep tendon reflexes , hypertonia , or extensor plantar responses . fetor hepaticus is a peculiar pungent odor of the breath that is often regarded as a component of he . this odor has been attributed to dimethylsulphide , a volatile sulfur compound that can be identified in the breath and serum of patients with cirrhosis . the presence of fetor hepaticus is not constant ; patients with cirrhosis without he can have this condition . hyperventilation has been interpreted as a compensatory mechanism that decreases the entrance of ammonia into the brain via a decrease in arterial ph . chronic encephalopathy encompasses two different situations : ( a ) the patient with relapsing episodes of he and ( b ) the patient with persistent neurological manifestations . this differentiation highlights the more prominent clinical presentation , but in practice both situations are difficult to separate . some patients initially have relapsing episodes and later have persistent symptoms . a patient with pure relapsing furthermore , symptoms tend to fluctuate after the institution of therapeutic measures or the occurrence of precipitating events . relapsing episodes may be due to precipitating factors , but in the majority of cases they are spontaneous or related to discontinuation of medication . the course of the acute episode does not differ from the one previously described , except for a tendency for an abrupt onset and resolution . between episodes , mild parkinsonian signs , characterized mostly by bradykinesia without tremor , are probably the most common manifestation between episodes . persistent he refers to those manifestations that do not reverse despite adequate treatment . in the majority of patients with cirrhosis and prior episodes of acute he and advanced liver failure , a careful neurological examination may reveal multiple mental and motor abnormalities . most of these abnormalities are subtle , such as increased muscle tone , reduced mental or motor speed , dysarthria , hypomimia , lack of attention , or apraxia . psychometric tests may be helpful in describing and quantifying the degree of impaired mental function . the most characteristic manifestations of severe chronic he are dementia , severe parkinsonism , or myelopathy in combination with other manifestations of neurological involvement ( ataxia , dysarthria , gait abnormalities , and tremor ) . this clinical picture is seldom seen nowadays , as a result of the availability of liver transplantation and the limited number of patients that undergo surgical portal - systemic shunts . patients with hepatic dementia tend to have fluctuating symptoms with periods of improvement and a subcortical pattern . the initial manifestations are attention deficits , visuopractic abnormalities , dysarthria , and apraxia . those with hepatic parkinsonism may resemble parkinson 's disease , except for a symmetrical presentation and lack of significant tremor . hepatic myelopathy is characterized by a progressive spastic paraparesis accompanied by hyperreflexia and extensor plantar responses . they have associated neuronal loss , in the case of dementia , and demyelination along the pyramidal tract in the case of myelopathy . although these lesions are difficult to reverse , there have been descriptions of improvements after liver transplantation , a challenge to the notion of irreversibility . the term hepatocerebral degeneration has been occasionally used to describe such patients . however , this is a neuropathological diagnosis applied to those brains that exhibit substantial and irreversible loss of gray matter in cortex and basal ganglia . the clinical picture of he in acute liver failure parallel that of an acute episode of he , an acute confusional syndrome that evolves into coma . however , in acute liver failure , brain edema leading to intracranial hypertension and abnormalities of brain perfusion is critical . brain edema does not result in clinical manifestations unless intracranial hypertension is present , as the displacement of brain tissue is the factor that results in neurological symptoms . intracranial hypertension may manifest as decerebrate rigidity , myoclonus , seizures , mydriasis , bradycardia , or arterial hypertension ( the cushing reflex ) . however , the diagnosis of intracranial hypertension based on clinical signs in unreliable , as they can be absent with pressures as high as 60 mm hg and difficult to monitor because these patients are intubated and paralyzed when they are in coma . the maintenance of cerebral blood flow is critical to assure an adequate supply of oxygen . the driving force in maintaining a stable blood flow is the cerebral perfusion pressure , the arithmetical difference between mean arterial pressure and icp . when cerebral perfusion pressure is less than 40 mm hg , structural tissue damage from brain ischemia may ensue . in spite of low cerebral blood flow the increase in pressure causes displacement of brain tissue , resulting in herniation and direct compression of the temporal lobe or the cerebellum . minimal he , also referred to by the terms latent or subclinical , is a mild dysfunction of brain function that can not be detected by standard clinical examination [ 2 , 3 , 58 ] . this label was originally applied to a group of individuals who performed abnormally on psychometric tests but had essentially normal findings at clinical examination . psychometric tests are more sensitive than clinical observation , as shown in other neuropsychiatric diseases , such as dementia . other techniques ( eeg , evoked potentials , and neuroimaging ) that are more sensitive than clinical examination to reveal neurological impairment have also shown a stage of minimal dysfunction . this stage is understood as part of a continuous disorder that has several levels of severity , with minimal he being the mildest expression of he . this interpretation is supported by the observation of improvements of minimal he after the same therapeutic measures that are addressed against overt he and the relationship between minimal he , ammonia levels , and liver function . the diagnosis of minimal he is arbitrary and can be performed with neuropsychological or neurophysiological tests . learning impairment , which has also been described in experimental models , appears to be the consequence of attention deficits . the depth of the psychometric and the clinical examination necessary to diagnose minimal he is not defined . the frequency of the diagnosis is very variable ( 30% to 84% of patients ) , depending on the characteristic of the population being studied and the extent of the psychometric evaluation . some attempts have been made to develop practical tools based on the design of short batteries of neuropsychological tests , such as the phes . however , these batteries have not been fully standardized and their use is still investigational . critical flicker frequency , a neurophysiological tool , has been proposed as a practical test to assess low grade encephalopathy . some studies have highlighted that minimal he may have an adverse impact on the ability to perform daily activities and on health - related quality of life [ 66 , 67 ] . however , many subjects are able to compensate for these deficits . from a practical point of view , a psychometric evaluation may be adequate in those individuals whose occupations demand attention and motor abilities . a report of impaired driving in patients with minimal he suggests the need to develop a therapeutic program for such individuals . benefits of the treatment , assessed by monitoring the neuropsychological response , should be weighed against secondary side effects . there are no data on the effects of therapy on health - related quality of life . patients with cirrhosis and minimal he have a clear tendency to develop overt he . whether the institution of preventive measures may decrease the risk of the progression to overt the presence of minimal he indicates worse prognosis , especially if associated with high blood ammonia after the administration of glutamine . grading of he is necessary to assess the evolution of the condition and the response to the effects of therapy . several methods are based on clinical findings or the combination of neurophysiological and neuropsychological tests , but the simplest grading of he is based on clinical findings . it is based on changes in consciousness , intellectual function , and behavior ( table 2 ) . the glasgow coma scale offers a system to monitor consciousness according to simple and more objective parameters . this scale was initially developed for traumatic coma but has gained widespread use for all forms of coma . it is probably more reliable than the west haven criteria but has the limitation that it is less sensitive in quantifying the mildest forms of he and is better suited for advanced he . there are other scales widely used like the clinical hepatic encephalopathy staging scale ( chess ) ; this scale evaluated nine different items with a dichotomic answer , giving a punctuation from 0 ( no he ) to 9 ( deep coma ) ; the principal disadvantage is the fact that the chess does not evaluate the asterixis ( table 3 ) . the portal - systemic encephalopathy index ( pse index ) has been used in many studies to assess the effects of therapeutic measures . this index combines the assessment for mental state , arterial ammonia , electroencephalography , the number connection test , and estimation of the degree of asterixis . an arbitrary weight of 3 is assigned to the mental state and the other parameters are weighted . concerns have been raised about the arbitrary scoring system , the inclusion of ammonia ( a putative toxin ) , the feasibility of an arterial puncture , and the assessment of the number connection test in the evaluation of advanced he . it is generally considered that blood levels of ammonia , though separating groups according to mean values , show wide dispersion in individual values and are not useful to predict the severity of he and to monitor the response to therapy . a consensus has been reached indicating that the pse index is not adequate for clinical follow - up and is not recommended for clinical trials . the main role of neuropsychological tests is the diagnosis of minimal he and the assessment of cognitive function in patients with persistent he . based on the most frequently found abnormalities , several psychometric tests have been proposed to be the most adequate for diagnosing he [ 58 , 60 ] . nomograms to compare the results should take into consideration age and ideally the degree of education . . an important limitation of the neuropsychological tests is the practice effect in follow - up evaluation . use of parallel versions can lessen this effect , but only few tests have well - standardized versions . some short batteries specifically developed for he may be useful for the detection of abnormal cognition . however , they do not substitute a formal neuropsychological evaluation performed by an experienced neuropsychologist . thephes is a battery of tests , specifically developed for the diagnosis of minimal he . similar to the mini - mental state examination for dementia the phes combines 5 paper - pencil tests ( line tracing tests , digit symbol test , serial dotting test , number connection test a , and number connection test b ) that examine motor speed and accuracy , visual perception , visual - spatial orientation , visual construction , concentration , attention , and to a lesser extent memory . the results of the battery are scored according to nomograms from a group of healthy controls . a pathological test result ( diagnosis of minimal another useful test is the critical flicker frequency ; this test has the advantage that it is not conditioned by the cultural or education level but it is necessary that the patient have nonvisual impairment . it consists of placing a flashing light in the visual field of the patient using specially designed glasses . the light flashes initially at a high frequency , so it seems a constant light . gradually , the frequency decreases , and the light becomes intermittent ; that moment has to be identified by the patient pressing a button [ 75 , 76 ] . a large number of different neurophysiological tests have been proposed for the diagnosis and quantification of he . reports for and against the specificity of electrophysiological changes have been published [ 77 , 78 ] . these tests are most useful in documenting cerebral dysfunction in difficult cases and possibly in monitoring response to therapy . thus , they may be better suited for assessing effects of treatment than neuropsychological tests , especially for advanced stages of he . for minimal to mild he , neurophysiological tests do not give information about behavioral consequences , in contrast to the insight provided by neuropsychological tests . the standard electroencephalogram ( eeg ) shows slowing of the frequency from the normal 813 hz to the delta range below 4 hz . high voltage , low - frequency ( 1.5 to 3 hz ) waves with triphasic appearance have been considered characteristic for he . however , they have been described in a variety of forms of metabolic encephalopathy and are not specific to he . several stages of evolution of eeg changes have been described in he and a fair correlation with clinical stages and ammonia levels has been observed . the simplest eeg assessment is to grade the degree of abnormality of the conventional tracing . computer - assisted frequency analysis of the eeg includes evaluation of the mean dominant frequency and the power of a particular eeg rhythm . evoked responses are externally recorded potentials reflecting discharges through neuronal networks after exposure to specific stimuli . depending on the type of stimulus and the pathway analyzed , they could be visual , somatosensory , or acoustic evoked potentials . event - related potentials using different stimuli represent endogenously task - related cortical response reflecting the neural pathway involved in awareness , learning , and decision - making processes . event - related potentials , such as the p300 evoked potential , requires patient cooperation and well - trained operators . evoked potentials and event - related potentials are considered more sensitive than the conventional eeg for the diagnosis of mild forms of he . they may be useful for assessing the presence of minimal or mild he in patients with cirrhosis who have memory loss or other mental symptoms . at autopsy , the brains of cirrhotic patients dying in he do not show major anatomic abnormalities , except for various degrees of atrophy . thus , neuroimaging studies that assess exclusively the morphologic structure of the brain , such as computed tomography ( ct ) , do not detect specific abnormalities in he . brain atrophy , which is depicted with ct , is more common in patients with longstanding cirrhosis and chronic he . however , brain atrophy is not a specific abnormality of he and may be related to other factors than he ( alcoholism , age , and comorbid conditions ) . furthermore , as in other neurodegenerative diseases , brain atrophy is not associated with neuropsychological performance . conventional neuroimaging techniques are insensitive in the detection of brain swelling that may develop in some patients with cirrhosis and frequently complicates he in acute liver failure . no studies have been able to find a neuroimaging correlation of hepatocerebral degeneration ( cortical laminar necrosis and polymicrocavitation at the corticomedullary junctions and in the striatum ) . magnetic resonance imaging ( mri ) and spectroscopy allow the acquisition of data on cerebral metabolic function that are otherwise not available . this abnormality is most frequently seen in patients with cirrhosis with severe liver failure or long - standing portal - systemic shunts and is absent or only minimally present in patients with well - compensated cirrhosis and unimpaired neuropsychiatric function . it can be also present in patients with congenital shunts or portal thrombosis and normal liver function . no direct correlation between the magnitude of pallidal hyperintensity and the grade of he have been found , but some studies have related pallidal hyperintensity to parkinsonian manifestations . because of radiologic similarities to manganese intoxication , it has been proposed that pallidal hyperintensity is the consequence of the preferential deposition of manganese in the basal ganglia . the deposition of manganese in brain tissue would be secondary to portal - systemic shunting and might be involved in the parkinsonian symptoms found in persistent he . proton magnetic resonance spectroscopy allows the assessment of several brain metabolites ( glutamine , glutamate , myoinositol ) that may be related to the pathogenesis of he . the level of glutamine , the product of ammonia metabolism in astrocytes , is characteristically increased in brain tissue . although glutamine is considered neuronally inactive , changes in its concentration may affect neuronal - astrocytic trafficking and interact with glutamate neurotransmission . the concentration of glutamine in cerebrospinal fluid , an indicator of its level in brain tissue , has been correlated to the stage of he . unfortunately , the standard available systems , in which magnetic fields of 1.5 teslas are used , do not allow a separation between the peaks of glutamine ( moderate to high increase in he ) and glutamate ( mild decrease in he ) . the decrease in brain myoinositol found by spectroscopy has been corroborated in experimental preparations and has been attributed to a compensatory response to the increase in intracellular osmolality caused by the increased concentration of glutamine . although the technique is insensitive to mild changes in the concentration of metabolites , the abnormalities found with spectroscopy have been related to neuropsychological impairment and to liver function . the role of proton magnetic resonance in the diagnosis of he has not been investigated . nevertheless , a completely normal study in a patient suspected to suffer from he is a strong argument against this diagnosis . regional distribution of radionuclides in the brain has been used to study cerebral blood flow , oxygen and glucose consumption , neurotransmitter utilization , and availability of neuronal receptors . although they may help in the understanding of the pathogenesis of he , radionuclide studies are not adequate for diagnostic purposes . due to the lack of a pathogenetic mechanism that explains the whole syndrome , therapy is focused on correcting the precipitating factors and decreasing plasma levels of ammonia and related metabolites . most data have not been evaluated in randomized clinical trials with large number of patients . study design is especially complex in this condition , as the clinical course of he tends to resolve and relapse spontaneously in many cases . the concurrence of other disorders ( anemia , electrolytic disturbances , fever , severe infection , and alcoholic injury ) is a confounding factor that complicates the assessment of the neurological manifestations . for these reasons , nevertheless , in recent years there have been several studies that render important data and that have changed the management of the patient that develops he . the approach to the patient with overt he must guarantee the vital support of the patient , correct the precipitating event , and withdraw diuretics . the treatment of he has different targets that are responsible for the plasma rise of toxic substances with potential effects on central nervous system , with ammonia being the most relevant . the best results have been obtained in studies focused on prevention of recurrence with lactulose , rifaximin , and hpn-100 . use of these drugs in the episode of overt he is extrapolated from preventive studies . classically , the recommendation for patients with he has been to restrict dietary protein intake , but this is a measure that nowadays is considered wrong . for several decades it was recommended withholding all protein intake and subsequently increasing the intake to maximal tolerance ; however , this recommendation has no solid support . only one randomized study has investigated the effects of protein restriction on the outcome of he . in this study , thirty patients admitted for an episode of he received progressive amounts of proteins ( from 0 to 1.2 gkgd ) or normal protein amounts ( 1.2 gkgd ) from the beginning . the diet was administered via nasogastric tube for 2 weeks and he was assessed blinded for group of treatment . the main result of the study was that there were no differences in the outcome of he , while the normal protein diet resulted metabolically to be more adequate . thus , restriction of proteins of the diet does not appear to have any beneficial effect for episodic he . from this although avoiding intake of large amounts of protein may be positive to reduce toxins that are involved in he , restriction may worsen liver function and increase the risk of death . a positive nitrogenous balance may improve encephalopathy by promoting hepatic regeneration and increasing the capacity of muscle to detoxify ammonia . patients are nowadays treated with nutritional support that provides at least a dose of protein of 0.8 gr / kg / d . branched chain amino acids were promoted as a mechanism to correct the imbalance in the plasma amino acid profile and thought to be involved in the pathogenesis of hepatic encephalopathy . however , clinical trials using branched chain amino acids have not shown dramatically beneficial effects for episodes of he . a new analysis of several published studies , including some more recent , supports a mild positive effect of bcaa on minimal he , whose clinical impact is debatable [ 89 , 90 ] . branched chain amino acids do not show significant effects on survival . critical reviews of the published studies highlight the inadequate design of the majority of studies . considerations of cost - effectiveness indicate that branched chain amino acids should not be used outside clinical trials . branched - chain amino acids show anticatabolic effects in patients with chronic liver diseases , probably due to their ability to serve as an energy substrate for muscle and because of their actions on muscle protein synthesis and degradation . this nutritional effect may result in an improvement of liver function and a better clinical outcome , as shown in a multicenter trial performed in italy that included patients with advanced cirrhosis , most of them without prior he , most recent articles has shown no improvement in recurrence of overt he but has been effective in increasing muscle mass and improving mhe . lactulose ( -galactosido - fructose ) and other nonabsorbable disaccharides were introduced with the goal of promoting the growth of lactobacillus bifidus , which contains little urease activity and via this mechanism could decrease the production of ammonia in the colon . this is not its mechanism of action , which is still complex and not fully understood . the bulk of evidence links the efficacy of lactulose to an interaction with the enteric flora and to a decrease in the generation of nitrogenous compounds in the intestine . administered orally , lactulose is not broken down by intestinal disaccharidases and reaches the cecum , where it is metabolized by enteric bacteria to lactate and acetate , causing a drop in cecal ph leading to an increase in fecal nitrogen excretion and a decrease in the amount of nitrogen that reaches portal blood . the efficacy of lactulose has been demonstrated in the primary and secondary prevention of hepatic encephalopathy . two studies conducted in india showed marked improvement in the recurrence of he after approximately one year of treatment with lactulose . the results of these studies have led to considering the use of lactulose as a standard of care . the efficacy is shown in the prevention , but its use has been generalized to its treatment . singularly , it is not known to what extent the effect of lactulose is simply as a laxative and whether other laxatives have similar benefits . there have been additional studies showing a positive effect of nonabsorbable disaccharides in he , which were reviewed by als nielsen et al . in 2004 . thus , while there are no doubts in using lactulose or lactitol for preventing he , it would be recommendable to perform new studies with nonabsorbable disaccharides to show their efficacy in the treatment of episodic he . the use of disaccharides is further supported on biological foundations and extensive experience of use . treatment of minimal he has shown in several studies an improvement of neuropsychological tests and quality of life indexes . however , the impact on clinically relevant endpoints is a matter of debate and treatment of minimal he is not firmly established . the use of antibiotics in the treatment of he is based on its action in the intestinal flora . apart from decreasing the bulk of intestinal flora , different mechanisms have been proposed ; they include inhibition of the activity of intestinal glutaminase ( enzyme that is activated in cirrhotic patients ) and through this mechanism decrease plasma ammonia . another action is decreasing bacterial translocation and downregulating the immune response triggered by these bacterial products . neomycin was the first antibiotic that was tested in the treatment of he that showed similar efficacy to lactulose in chronic he . since neomycin is an aminoglycoside , the major concern with its use is the potential of renal or auditory toxicity . absorption of neomycin is poor ( < 4% ) and the drug is considered potentially toxic only after long - term use . other antibiotics that were proposed were metronidazole and vancomycin ; their potential toxicity have led to abandon them , especially in long - term use . rifaximin is an antibiotic with wide antibacterial action and low intestinal absorption that is currently recommended for the prevention of he , especially because it has minimal toxic effects that allow prolonged use . studies that have compared rifaximin ( 1200 mg / d ) to nonabsorbable disaccharides ( lactulose 45 to 120 ml / day , lactitol 60 mg / day ) [ 100106 ] show a slightly better , but not significant , outcome for rifaximin . similar effects were also seen when comparing rifaximin to neomycin ( 4500 mg o 3000 mg ) [ 107110 ] or paromomycin ( 1500 mg / d ) . significantly , only three of these studies [ 100 , 104 , 106 ] were performed during an overt episode of he and none of them had a placebo group . included all these studies in a meta - analysis ; the comparison of rifaximin and disaccharides found that both groups reach the primary endpoint ( recovery of the he episode or clinically relevant improvement ) without differences ( or = 1.92 , 95% ic : 0.794.98 , and p = 0.15 ) . similar results were found when comparing rifaximin with other antibiotics ( or = 2.77 , 95% ic : 0.3521.83 , and p = 0.21 ) . no differences were also found comparing rifaximin to nonabsorbable disaccharides or to other antibiotics ( paromomycin or neomycin ) . nevertheless , there was a trend towards a better outcome in favor of rifaximin ( or = 1.96 , 95% ic : 0.944.08 , and p = 0.07 ) . again no statistical differences were observed in plasma ammonia [ 100 , 104 , 106 , 108111 ] or improvement of psychometric tests [ 102 , 106 , 110 ] but rifaximin exhibited a better safety profile ( or = 0.27 , 95% ic : 0.150.59 , and p < 0.01 ) based on a lower frequency of diarrhea . one study has compared rifaximin to placebo in the secondary prevention of recurrent he ( at least 2 episodes in 6 months ) . since these patients corresponded to a highly recurrent population , almost all patients ( 90% ) the more important result is that those that received rifaximin had a much lower number of new episodes of he in the following 6 months ( 22% versus 46% ) . hospitalizations associated with he was also lower in the rifaximin group ( 13% versus 22% ) . furthermore , an analysis of the quality of life of these patients showed that those with recurrent he had lower scores on daily life activities . based on these results , it is common to recommend the use of lactulose or lactitol after the first episode of he , in combination with rifaximin after the second episode . it is not known whether rifaximin will also be necessary in the prevention of recurrence in patients with well - defined precipitating events that have been resolved ( i.e. , severe infection , dehydration , and renal failure ) . in summary , rifaximin has been shown to be effective in the prophylaxis of new he episodes with dose 1200 mg / d combined with lactulose , but no studies comparing its efficacy to placebo have been performed for assessing its effectiveness during the episode of he and no difference with nonabsorbable disaccharides or other antibiotics has been demonstrated in this clinical situation . glycerol phenylbutyrate ( hpn-100 ) is a prodrug of phenylbutyric acid ( pba ) , which is absorbed from the intestine and converted by way of b - oxidation to the active moiety , phenylacetic acid ( paa ) . paa is conjugated with glutamine in the liver and kidney by way of n - acyl coenzyme a - l - glutamine n - acyltransferase to form phenylacetylglutamine ( pagn ) and hydrosoluble molecule that could be eliminated trough the urine . this molecule has proven its safety in cirrhotic patients . in a recent randomized double - blind study , the administration of a hpn-100 , which enhanced the urinary excretion of ammonia equivalents , resulted in a lower number of recurring he episodes . a significant number received rifaximin in addition to in this subgroup , the combination of rifaximin and hpn-100 did not show better results than isolated rifaximin . ornithine phenylacetate ( op ) is a new proposal for decreasing ammonia in cirrhosis trough the combined administration of pa and ornithine . this therapy is based on the capacity of ornithine to stimulate the activity of glutamine synthetase ; hence , incorporating ammonia into a the newly formed glutamine will combine with pa allowing the elimination of ammonia in the urine by its conversion into pagn . this strategy prevents the degradation of glutamine by intestinal glutaminase and avoids new formation of ammonia . this molecule has demonstrated to be safe in decompensate cirrhotic patients and the current data seems to confirm its efficacy in decreasing plasma ammonia . extracorporeal albumin dialysis has been proposed for improving the survival and treating cirrhotic patients with severe decompensation or acute or chronic liver failure ( aclf ) . there have been two trials with the goal of reducing mortality of severely decompensated cirrhosis : the relief trial and the helios trial . both were randomized studies that included a large number of patients ( n = 145 and n = 189 ) . however , there were some positive indicators ( bilirubin , renal function , and degree of hepatic encephalopathy ) that support that these therapies may have a niche in specific group of patients . a study using the molecular adsorbent recirculating system ( mars ) found a more rapid improvement in the severity of he , which has been the basis for its approval for patients with severe he . albumin has also been proposed for onset he in addition to laxatives and rifaximin ; however , recently , there were no differences in the outcome of he between albumin and placebo ; however , survival in the follow - up was better in the albumin group at 90 days . patients with a good liver function ( meld < 12 ) and large portal - systemic shunts should be evaluated for possible occlusion of the shunt using angioradiological embolization , which has been shown safe and effective . embolization is tolerated in cirrhotic associated shunts but should not be performed in congenital hypoplasia of the portal vein to avoid massive upper gastrointestinal bleeding post embolization . special attention must be given to patients who have undergone placement of a transjugular intrahepatic portosystemic shunt ( tips ) ; one of the most relevant adverse events is overt he , which usually appear in 33% of the patients during the first month after the placement . some factors have been associated with a higher he risk ( age over 65 years , previous episodes of overt he , and child - pugh c ) but prophylactic use of nonabsorbable disaccharides or rifaximin have not shown to be effective during the first month after tips .

there are two main types of cholinesterase with different biochemical properties : true or specific cholinesterase or acetylcholinesterase found in all excitable tissues ( central and peripheral nervous system and muscles ) and in erythrocytes . it is a high - turnover enzyme with high affinity for acetylcholine , inhibited at high concentrations of acetylcholine , and with low affinity for noncholine esters . the other one is the nonspecific or pseudocholinesterase or serum cholinesterase or butyrylcholinesterase which hydrolyses both choline and aliphatic esters . butyrylcholinesterase ( bche ) is an -glycoprotein found in the central and peripheral nervous system , in most tissues , and in the liver . it has lower affinity for acetylcholine and is not inhibited by high concentrations of acetylcholine . bche half - life is about 12 days [ 2 , 3 ] , and its normal value ranges between 5,900 and 13,200 an increased activity of this enzyme has been reported in obesity , diabetes , uremia , hyperthyroidism , and in hyperlipidemic subjects [ 46 ] . a small proportion of healthy population is lacking in plasma bche , due to a genotype aberration ; studies carried out in europe indicate a 34 % prevalence of congenital serum bche deficiency . bche is synthesized in the liver : a hepatocellular impairment will reflect a decreased enzyme activity . in fact , plasma levels fall in acute and chronic liver damage , cirrhosis , and liver metastases , being a biochemical marker of organ damage . low plasma bche levels have also been found in protein - energy malnutrition , during stress and ( chronic and acute ) inflammation , and in other clinical conditions . on the other hand , plasma bche activity was significantly elevated in both type 1 and 2 diabetes , compared with the control subjects . in addition , bche activity was positively associated with serum concentrations of cholesterol and triglycerides and with measures of overweight , obesity , and body fat distribution [ 9 , 10 ] . there are two main types of cholinesterase with different biochemical properties : true or specific cholinesterase or acetylcholinesterase found in all excitable tissues ( central and peripheral nervous system and muscles ) and in erythrocytes . it is a high - turnover enzyme with high affinity for acetylcholine , inhibited at high concentrations of acetylcholine , and with low affinity for noncholine esters . the other one is the nonspecific or pseudocholinesterase or serum cholinesterase or butyrylcholinesterase which hydrolyses both choline and aliphatic esters . butyrylcholinesterase ( bche ) is an -glycoprotein found in the central and peripheral nervous system , in most tissues , and in the liver . it has lower affinity for acetylcholine and is not inhibited by high concentrations of acetylcholine . bche half - life is about 12 days [ 2 , 3 ] , and its normal value ranges between 5,900 and 13,200 an increased activity of this enzyme has been reported in obesity , diabetes , uremia , hyperthyroidism , and in hyperlipidemic subjects [ 46 ] . a small proportion of healthy population is lacking in plasma bche , due to a genotype aberration ; studies carried out in europe indicate a 34 % prevalence of congenital serum bche deficiency . bche is synthesized in the liver : a hepatocellular impairment will reflect a decreased enzyme activity . in fact , plasma levels fall in acute and chronic liver damage , cirrhosis , and liver metastases , being a biochemical marker of organ damage . low plasma bche levels have also been found in protein - energy malnutrition , during stress and ( chronic and acute ) inflammation , and in other clinical conditions . on the other hand , plasma bche activity was significantly elevated in both type 1 and 2 diabetes , compared with the control subjects . in addition , bche activity was positively associated with serum concentrations of cholesterol and triglycerides and with measures of overweight , obesity , and body fat distribution [ 9 , 10 ] . there are few and not updated data in literature on the significance of bche variations according to some physiological and pathological conditions , but also according to our clinical experience , bche seems to have a prognostic role in different diseases . as it will be described in the text , the prognostic value of bche varies from disease to disease , being of outcome , discharge , survival , weaning off artificial nutrition , and disease progression . the review aims to collect the main , past , and recent evidences reported in the literature on the emerging role of bche as a prognostic marker in some liver and nonliver diseases , as well as in protein - energy malnutrition and obesity ( table 1).table 1serum bche levels in different physiological and pathological conditionsclinical conditionsubgroupsbche levelscommentsref . no.pem and inflammationmarasma / kwashiorkorbche levels increased after nutritional rehabilitation[16 , 17]hospitalizationbche levels low and significantly correlated with transferrin , albumin , and cholesterolhealthy geriatric populationage does not seem to be associated with reductions in bche activityfrail older people / acute illnessbche inversely related with cytokines il-6 and tnf-malignancyadvanced cancer patients with or without liver involvementpche predictive of survival together with albumin and karnofsky indexhospitalized cancer patientsbche levels < 1,900 iu / l related with negative prognostic outcomecancer patients during nutritional supportpancreatic cancer ( 75 patients)low bche levels represent a poor prognostic indexhemodialysischronically uremic patientsbche inversely related with il-6 levelsinflammatory bowel diseasepatients with crohn diseasebche marker of pem and inflammationcritical illnessin severely burnt and critically ill patients with sepsis[33 , 34]in patients receiving necessity oltserum bche levels are predictors of survivalanorexia nervosa97 an patients and 66 ed - nosenteral and parenteral nutritioncatheter - related infectionserum bche strictly correlated with serum albumin , increase with the resolution of infection and tpn restorationbefore starting pn / en ( 312 patient)low serum bche levels related with negative outcomeliver and nonliver diseasehepatocellular impairmentnonliver diseaseaidsaids patients with abnormal d - xylose test ( malabsorption)hellp syndromepregnant women with hellp syndrome[47 , 48]obesity and metabolic syndromemyocardial infarctionbche levels inversely related to cv mortality[50 , 51]protein content in the dietdyslipidemic insulin - treated type 2 diabetesserum bche activity positively correlated with serum triacylglycerol concentrations and decreased as a result of bezafibrate treatmentserum bche correlated with fasting insulin levels , homa - r , c - peptidelow caloric diet in obese patients with fatty liverbche activity decreased in parallel with improvement of hepatic steatosishigh cardiovascular mortality rateprobable bche 12gene variantsnegative outcomes mean : death or interruption of parenteral / enteral nutrition , due to the worsening of clinical conditionsconditions where the traditional liver function tests may result abnormal without liver dysfunction ( heart , muscle and bone diseases , increased erythrocyte breakdown , hypoalbuminemia due to nephritic syndrome , or protein - loosing entheropathy ) serum bche levels in different physiological and pathological conditions negative outcomes mean : death or interruption of parenteral / enteral nutrition , due to the worsening of clinical conditions conditions where the traditional liver function tests may result abnormal without liver dysfunction ( heart , muscle and bone diseases , increased erythrocyte breakdown , hypoalbuminemia due to nephritic syndrome , or protein - loosing entheropathy ) protein - energy malnutrition ( pem ) may have important adverse effects on clinical outcomes ; for this reason , nutritional assessment should regularly be part of diagnostic procedures in acute and chronic diseases . recent evidence suggests that either acute or chronic inflammatory diseases are key contributing factors in the pathophysiology of pem . in clinical practice , nutritional status may be compromised in conditions of ( 1 ) pure chronic starvation without inflammation ( e.g. , clinical conditions such as anorexia nervosa ) , ( 2 ) chronic diseases or conditions that impose sustained inflammation of a mild to moderate degree ( e.g. , organ failure , inflammatory bowel diseases , rheumatoid arthritis , advanced cancer , etc , ) , and ( 3 ) acute disease or injury states with marked inflammatory response ( e.g. , major infection , burns , trauma , or closed head injury ) . on the other hand , stress and inflammation can influence appetite and gastrointestinal motility , promoting through anorexia the vicious cycle : chronic acute disease and pem . as well known , critical illness or injury promotes an inflammatory response that has a rapid , catabolic effect on fat - free ( or lean ) body mass . on the other hand , loss of muscle mass and function may insidiously occur , and in the chronic disease state , even over months to years . the presence of inflammation often limits the effectiveness of nutritional interventions while the associated malnutrition may compromise the clinical response to medical therapy . the anorexic patient and/or chronic disease - related malnutrition is prone to quickly deteriorate with any additional acute inflammatory event and warrants close follow - up . positive acute - phase proteins , such as c - reactive protein ( crp ) , directly rise with inflammatory disease activity ; negative acute - phase proteins ( albumin , prealbumin , and transferrin ) inversely respond : their circulating levels decrease in response to injury and inflammation and increase during the recovery phase [ 13 , 14 ] . these proteins reflect either cytokine - induced stress , catabolism , and anorexia , which in turn affect patient 's clinical conditions and nutritional status . therefore , the evaluation and monitoring of the preexisting inflammatory status appears crucial . for its short half - life , some authors speculate on the usefulness of serum bche as a nutritional and prognostic marker , rapidly changing with general clinical conditions and nutritional status . bche levels are strongly influenced by inflammation , sensitively decreasing in the acute inflammatory phase and promptly increasing when inflammation improves . serum bche was already known to decrease in patients with pem , probably due to inadequate availability of substrates for its synthesis rather than to hepatocellular failure . in malnourished children with marasmus and edematous undernutrition ( or kwashiorkor ) , serum bche , total proteins , and albumin levels are lower than those measured in normal children ; these values tend to increase after 3 weeks of nutritional rehabilitation . in a similar study on 200 malnourished infants , the degree of edema resulted to be inversely related to bche and albumin levels ; a similar trend of serum bche values was observed in undernourished adults . in hospitalized patients diagnosed with protein - energy visceral or nonvisceral undernutrition , bche levels resulted low and significantly correlated with transferrin , albumin , and cholesterol , particularly in visceral malnutrition . visceral undernutrition is a condition strictly linked with low values of visceral proteins such as albumin , transferrin , and total lymphocyte count . in conclusion , bche levels seem to strictly correlate with the outcome of malnourished patients , being low during the inflammatory phases , in the case of inadequate availability of substrates , or in the presence of edema and recovering with the amelioration or resolution of these conditions . in particular , in case of malnutrition , bche activity seems a reliable indicator of patient conditions , better than albumin , for the latter is more strongly influenced by inflammation . as regard to the healthy geriatric population , no correlation has been found between bche levels and advanced age , suggesting that age per se does not seem to be associated with reductions in esterase enzyme activity . this finding is particularly useful if we consider that the older population is frequently under medical treatments and that esterases are primarily involved in drug metabolism . bche has also been considered as a useful biomarker for the diagnosis and monitoring of malnutrition and in general as a prognostic indicator in the elderly [ 20 , 21 ] . in literature , plasma esterases were found to decrease in frail older people and during acute illness : in 30 elderly patients , with increasing patient frailty , crp , interleukin-6 ( il-6 ) , and tumor necrosis factor alpha ( tnf- ) significantly increased , while bche activity significantly dropped ( p < 0.005 ) . in addition , bche activity resulted to be significantly and negatively correlated with the proinflammatory cytokines il-6 and tnf- . also , in geriatric patients , bche is a valid prognostic indicator , strictly related with nutritional status and inflammation . advanced cancer is a condition in which mild to moderate inflammation is frequent and interacts with various degree of pem . plasma bche levels resulted to be decreased in advanced cancer patients , with or without hepatic involvement : the lowest activity has been found in patients with hepatic metastases , despite the normality of other liver function tests . one of the possible mechanisms responsible for bche activity decrease in cancer patients could be secondary anorexia accompanying malignancy . in a study by our group in 152 terminal cancer patients with peritoneal carcinosis , bche serum levels resulted to be a survival predictive factor together with albumin and karnofsky index . in 126 hospitalized cancer patients , undergoing a nutritional assessment at admission and after 1 week , it was observed that , in case of a serum bche level below 1,900 iu / l at entry , the risk of developing relevant weight loss , hypoproteinemia , and hypoalbuminemia during hospitalization resulted to be significantly higher . in another study of patients with head and neck or uterine cervix cancer who are in radiation therapy , bche activity showed to be an affective prognostic marker : bche activity resulted to be lower in all patients before starting radiation therapy , increased as radiotherapy progressed , and remained in the normal range at 6 months of follow - up in those patients with no detectable disease activity . observed that serum bche , rapid turnover proteins ( transferrin , thyroxin - binding prealbumin , and retinol - binding protein ) , body weight , and nitrogen balance improved during nutritional support in cancer patients . according to recent evidences , in these conditions too , the improvement of serum proteins levels , more than a specific nutritional recovery , could primarily reflect the reduced inflammation and the improvement of general clinical conditions . in stress conditions , such as cancer cachexia , there are metabolic derangements where synthesis and catabolism are both higher than in unstressed malnourished patients or in fasted normal volunteers . in 246 patients with non - hodgkin s lymphoma , the same authors wondered about a possible relationship between nutritional status ( weight , weight loss , albumin , bche activity , lymphocyte count ) and tumor growth ( evaluated with the rate of incorporation of h - labeled thymidine in the tumor tissue ) . the only significant association was found between low serum bche activity ( index of a poor nutritional status and presence of inflammation ) and high incorporation of h - labeled thymidine , demonstrating also that the maintenance of a good nutritional status has no deleterious effect on tumor growth . finally , in 75 patients who underwent macroscopic curative resection for pancreatic cancer , low serum bche levels correlated with nerve plexus invasion of the primary tumor , thus representing a poor prognostic index . patients with low serum bche levels also manifested systemic disorders , including poor performance status , anemia , and hypoalbuminemia . in patients with cancer , bche levels seem to correlate with disease activity and nutritional status and could represent a valid survival predictive factor . uremic patients undergoing hemodialysis are often catabolic and malnourished ; they commonly feed on inadequate quantities of protein and calories and may be protein - depleted , with a mixed marasmus / kwashiorkor - like pattern of protein - energy malnutrition . malnutrition in uremia can be affected by many factors : uremic toxicity , infections , hypercatabolism , loss of amino acids during dialysis , abnormalities in amino acid and protein metabolism , and decreased protein synthesis in liver . also , in patients on chronic hemodialysis , bche was used as prognostic marker , in addition to the other traditional parameters ( anthropometric indices , serum protein content , immune response indexes ) [ 30 , 31 ] . serum protein , albumin , c3 , blood lymphocyte count , and bche generally resulted to be decreased in chronically uremic patients undergoing conservative or dialysis treatments . the short - term intravenous supplementation of essential amino acids during dialysis determined a significant ( p < 0.05 ) increase in body weight , arm muscle circumference , and serum albumin as well as bche levels . the circulating levels of il-6 , a proinflammatory cytokine inducing the production of acute - phase proteins and involved in weight loss , resulted to be significantly higher in patients undergoing hemodialysis than in healthy volunteers and significantly and inversely related with serum albumin ( r = 0.4 , p = 0.006 ) and bche ( r = 0.51 , p = 0.001 ) levels . also , in this case , bche is directly related with albumin and inversely related with inflammation . as previously discussed , in acute inflammatory diseases , both serum bche and albumin appeared to be inversely related with acute - phase proteins , due to the action of proinflammatory cytokines . together with serum albumin concentration , bche levels were also proposed as direct markers of malnutrition and indirect index of inflammatory activity in crohn s disease ( cd ) . in fact , bche activity and albumin concentration resulted to be significantly lower in patients with active cd than in those with quiescent disease ( p < 0.001 ) , and both proteins were significantly lower in malnourished than in well - nourished patients . in severely burnt patients and in critically ill patients , the absorption of nutrients in the upper regions of the intestine resulted to be slightly impaired for gastrointestinal dysmotility ; serum bche activity was found to be also decreased , suggesting subnormal biosynthetic processes . in septic patients , serum levels of albumin , cholesterol , and ( bche ) resulted to be significantly lower than in the control group . in 133 consecutive adult patients receiving necessity orthotopic liver transplantation ( olt ) , predictors of 12-month mortality included lower bche levels ( 2,900 1.880 versus 3,700 according to score - based medical urgency criteria pre - olt , bche is a predictor of short - term post - olt survival and may be helpful as a bedside score in pre - olt clinical management , outcome prediction , and decision making . anorexia nervosa ( an ) represents a pure form of marasmus - like malnutrition . in an , despite the occurrence of adaptive metabolic mechanisms due to chronic underfeeding , many organs and systems can negatively be affected . regarding liver function , available evidences suggest that abnormalities in serum liver enzymes may occur and some cases of acute liver failure have been described . in an , a mild to moderate increase in liver enzymes is expected to reflect a fatty liver , which is typical of several protein - energy malnutrition states . in these clinical circumstances , hepatic steatosis , among others , could have been the consequence of an imbalance between hepatic triacylglycerol synthesis and secretion and decreased lipoprotein synthesis , due to decreased amino acid availability . abnormal serum concentrations of bche and other liver enzymes have frequently been found , not only in the severe cases of hospitalized an patients but also in outpatients with either an or eating disorder not otherwise specified ( ed - nos ) . low bche activity was observed by our group in 97 underweight outpatients with an and in 66 with ed - nos when compared with 56 controls ; these results have been interpreted as a marker of the effects of primary malnutrition on liver function and lack of protein substrates . in two extreme cases of an , patients developed severe and acute liver failure with a marked increase of serum transaminases and a dramatic reduction of bche levels . in conclusion , in this study , low serum bche activity has been reported in an , independent of the age , weight , or bmi of patients , thus suggesting a predominant causal role for decreased nutrient availability rather than a relationship with changes in body composition . enteral and parenteral nutrition are medical therapies , often lifesaving for home and hospitalized patients . together with other anthropometric , biochemical ( serum albumin , prealbumin , transferrin , cholesterol , thyroxine - binding protein , retinol - binding protein ) and hematological ( lymphocyte count ) parameters , serum bche also appears to be a potential reliable prognostic marker , rapidly and sensitively changing with the variations of the patient s nutritional status and general clinical conditions . in four patients on long - term home total parenteral nutrition ( tpn ) , hospitalized in our clinical ward for catheter - related bloodstream infection , the septic state and tpn interruption , even when partially replaced by peripheral parenteral nutrition , induced a fast deterioration of the patient s general clinical conditions . in all patients , decreased blood levels of prealbumin , albumin , cholesterol , lymphocyte count , and bche levels were observed . in the same patients , after the resolution of infection and tpn restoration , bche levels promptly and sensitively increased ( from + 54.3 up to + 124.8 % ) . in these case reports , serum bche represents a useful and sensitive marker of the amelioration of patient s clinical conditions after the resolution of infection and the restoration of tpn through the central venous catheter . moreover , in these four patients , a close correlation between serum bche and albumin was found . the same correlation was found in 17 seriously ill surgical patients who received tpn for 421 days . in a retrospective examination of 312 clinical records of patients before undergoing enteral and parenteral nutrition , donini et al . found that the percentage of negative outcomes ( death or interruption of parenteral / enteral nutrition , due to the worsening of clinical conditions ) was higher in subjects > 80 years of age , with higher comorbidities ; reduced levels of albumin , prealbumin , lymphocyte count , and bche ; and higher levels of c - reactive protein . similarly to prealbumin , whose half - life is much shorter than albumin ( 23 versus 21 days ) , bche serum levels are not only reduced by malnutrition but also by inflammation and liver diseases and resulted to be significantly correlated with negative outcome . as regard to the healthy geriatric population , no correlation has been found between bche levels and advanced age , suggesting that age per se does not seem to be associated with reductions in esterase enzyme activity . this finding is particularly useful if we consider that the older population is frequently under medical treatments and that esterases are primarily involved in drug metabolism . bche has also been considered as a useful biomarker for the diagnosis and monitoring of malnutrition and in general as a prognostic indicator in the elderly [ 20 , 21 ] . in literature , plasma esterases were found to decrease in frail older people and during acute illness : in 30 elderly patients , with increasing patient frailty , crp , interleukin-6 ( il-6 ) , and tumor necrosis factor alpha ( tnf- ) significantly increased , while bche activity significantly dropped ( p < 0.005 ) . in addition , bche activity resulted to be significantly and negatively correlated with the proinflammatory cytokines il-6 and tnf- . also , in geriatric patients , bche is a valid prognostic indicator , strictly related with nutritional status and inflammation . advanced cancer is a condition in which mild to moderate inflammation is frequent and interacts with various degree of pem . plasma bche levels resulted to be decreased in advanced cancer patients , with or without hepatic involvement : the lowest activity has been found in patients with hepatic metastases , despite the normality of other liver function tests . one of the possible mechanisms responsible for bche activity decrease in cancer patients could be secondary anorexia accompanying malignancy . in a study by our group in 152 terminal cancer patients with peritoneal carcinosis , bche serum levels resulted to be a survival predictive factor together with albumin and karnofsky index . in 126 hospitalized cancer patients , undergoing a nutritional assessment at admission and after 1 week , it was observed that , in case of a serum bche level below 1,900 iu / l at entry , the risk of developing relevant weight loss , hypoproteinemia , and hypoalbuminemia during hospitalization resulted to be significantly higher . in another study of patients with head and neck or uterine cervix cancer who are in radiation therapy , bche activity showed to be an affective prognostic marker : bche activity resulted to be lower in all patients before starting radiation therapy , increased as radiotherapy progressed , and remained in the normal range at 6 months of follow - up in those patients with no detectable disease activity . observed that serum bche , rapid turnover proteins ( transferrin , thyroxin - binding prealbumin , and retinol - binding protein ) , body weight , and nitrogen balance improved during nutritional support in cancer patients . according to recent evidences , in these conditions too , the improvement of serum proteins levels , more than a specific nutritional recovery , could primarily reflect the reduced inflammation and the improvement of general clinical conditions . in stress conditions , such as cancer cachexia , there are metabolic derangements where synthesis and catabolism are both higher than in unstressed malnourished patients or in fasted normal volunteers . in 246 patients with non - hodgkin s lymphoma , the same authors wondered about a possible relationship between nutritional status ( weight , weight loss , albumin , bche activity , lymphocyte count ) and tumor growth ( evaluated with the rate of incorporation of h - labeled thymidine in the tumor tissue ) . the only significant association was found between low serum bche activity ( index of a poor nutritional status and presence of inflammation ) and high incorporation of h - labeled thymidine , demonstrating also that the maintenance of a good nutritional status has no deleterious effect on tumor growth . finally , in 75 patients who underwent macroscopic curative resection for pancreatic cancer , low serum bche levels correlated with nerve plexus invasion of the primary tumor , thus representing a poor prognostic index . patients with low serum bche levels also manifested systemic disorders , including poor performance status , anemia , and hypoalbuminemia . in patients with cancer , bche levels seem to correlate with disease activity and nutritional status and could represent a valid survival predictive factor . uremic patients undergoing hemodialysis are often catabolic and malnourished ; they commonly feed on inadequate quantities of protein and calories and may be protein - depleted , with a mixed marasmus / kwashiorkor - like pattern of protein - energy malnutrition . malnutrition in uremia can be affected by many factors : uremic toxicity , infections , hypercatabolism , loss of amino acids during dialysis , abnormalities in amino acid and protein metabolism , and decreased protein synthesis in liver . also , in patients on chronic hemodialysis , bche was used as prognostic marker , in addition to the other traditional parameters ( anthropometric indices , serum protein content , immune response indexes ) [ 30 , 31 ] . serum protein , albumin , c3 , blood lymphocyte count , and bche generally resulted to be decreased in chronically uremic patients undergoing conservative or dialysis treatments . the short - term intravenous supplementation of essential amino acids during dialysis determined a significant ( p < 0.05 ) increase in body weight , arm muscle circumference , and serum albumin as well as bche levels . the circulating levels of il-6 , a proinflammatory cytokine inducing the production of acute - phase proteins and involved in weight loss , resulted to be significantly higher in patients undergoing hemodialysis than in healthy volunteers and significantly and inversely related with serum albumin ( r = 0.4 , p = 0.006 ) and bche ( r = 0.51 , p = 0.001 ) levels . also , in this case , bche is directly related with albumin and inversely related with inflammation . as previously discussed , in acute inflammatory diseases , both serum bche and albumin appeared to be inversely related with acute - phase proteins , due to the action of proinflammatory cytokines . together with serum albumin concentration , bche levels were also proposed as direct markers of malnutrition and indirect index of inflammatory activity in crohn s disease ( cd ) . in fact , bche activity and albumin concentration resulted to be significantly lower in patients with active cd than in those with quiescent disease ( p < 0.001 ) , and both proteins were significantly lower in malnourished than in well - nourished patients . in severely burnt patients and in critically ill patients , the absorption of nutrients in the upper regions of the intestine resulted to be slightly impaired for gastrointestinal dysmotility ; serum bche activity was found to be also decreased , suggesting subnormal biosynthetic processes . in septic patients , serum levels of albumin , cholesterol , and ( bche ) resulted to be significantly lower than in the control group . in 133 consecutive adult patients receiving necessity orthotopic liver transplantation ( olt ) , predictors of 12-month mortality included lower bche levels ( 2,900 1.880 versus 3,700 2.020 iu / l , p = 0.026 ) . according to score - based medical urgency criteria pre - olt , bche is a predictor of short - term post - olt survival and may be helpful as a bedside score in pre - olt clinical management , outcome prediction , and decision making . anorexia nervosa ( an ) represents a pure form of marasmus - like malnutrition . in an , despite the occurrence of adaptive metabolic mechanisms due to chronic underfeeding , many organs and systems can negatively be affected . regarding liver function , available evidences suggest that abnormalities in serum liver enzymes may occur and some cases of acute liver failure have been described . in an , a mild to moderate increase in liver enzymes is expected to reflect a fatty liver , which is typical of several protein - energy malnutrition states . in these clinical circumstances , hepatic steatosis , among others , could have been the consequence of an imbalance between hepatic triacylglycerol synthesis and secretion and decreased lipoprotein synthesis , due to decreased amino acid availability . abnormal serum concentrations of bche and other liver enzymes have frequently been found , not only in the severe cases of hospitalized an patients but also in outpatients with either an or eating disorder not otherwise specified ( ed - nos ) . low bche activity was observed by our group in 97 underweight outpatients with an and in 66 with ed - nos when compared with 56 controls ; these results have been interpreted as a marker of the effects of primary malnutrition on liver function and lack of protein substrates . in two extreme cases of an , patients developed severe and acute liver failure with a marked increase of serum transaminases and a dramatic reduction of bche levels . following nutritional recovery , bche rapidly increased . in conclusion , in this study , low serum bche activity has been reported in an , independent of the age , weight , or bmi of patients , thus suggesting a predominant causal role for decreased nutrient availability rather than a relationship with changes in body composition . enteral and parenteral nutrition are medical therapies , often lifesaving for home and hospitalized patients . together with other anthropometric , biochemical ( serum albumin , prealbumin , transferrin , cholesterol , thyroxine - binding protein , retinol - binding protein ) and hematological ( lymphocyte count ) parameters , serum bche also appears to be a potential reliable prognostic marker , rapidly and sensitively changing with the variations of the patient s nutritional status and general clinical conditions . in four patients on long - term home total parenteral nutrition ( tpn ) , hospitalized in our clinical ward for catheter - related bloodstream infection , the septic state and tpn interruption , even when partially replaced by peripheral parenteral nutrition , induced a fast deterioration of the patient s general clinical conditions . in all patients , decreased blood levels of prealbumin , albumin , cholesterol , lymphocyte count , and bche levels were observed . in the same patients , after the resolution of infection and tpn restoration , bche levels promptly and sensitively increased ( from + 54.3 up to + 124.8 % ) . in these case reports , serum bche represents a useful and sensitive marker of the amelioration of patient s clinical conditions after the resolution of infection and the restoration of tpn through the central venous catheter . moreover , in these four patients , a close correlation between serum bche and albumin was found . the same correlation was found in 17 seriously ill surgical patients who received tpn for 421 days . in a retrospective examination of 312 clinical records of patients before undergoing enteral and parenteral nutrition , donini et al . found that the percentage of negative outcomes ( death or interruption of parenteral / enteral nutrition , due to the worsening of clinical conditions ) was higher in subjects > 80 years of age , with higher comorbidities ; reduced levels of albumin , prealbumin , lymphocyte count , and bche ; and higher levels of c - reactive protein . similarly to prealbumin , whose half - life is much shorter than albumin ( 23 versus 21 days ) , bche serum levels are not only reduced by malnutrition but also by inflammation and liver diseases and resulted to be significantly correlated with negative outcome . regarding liver diseases , a decreased bche activity reflects a hepatocellular impairment ; similarly , recovery was evidenced by a gradual increase of bche levels . during and after treatment with high dose interferon alpha performed in 101 patients with chronic hcv infection , total cholesterol levels gradually increased reaching normal values in responders . serum bche activity pattern paralleled that of serum cholesterol and was related with serum albumin , as already seen in chronic liver diseases [ 1 , 44 ] . serum bche levels decrease in liver dysfunction as a consequence of reduced synthesis , in comparison with other liver enzymes whose levels increase because of an increased release from damaged cell membranes . the traditional liver function tests may result abnormal in other diseases , not related with liver dysfunction . for example , high level of serum transaminases can be the consequence of their release by nonliver tissues ( i.e. , heart and muscles ) ; the increase of the serum alkaline phosphatase activity may result from physiological or pathological enzyme production from nonliver tissue ( i.e. , bone and placenta ) . in addition , serum bilirubin may rise because of increased erythrocyte breakdown and reduced albumin concentration due to increased renal or intestinal loss ( i.e. , nephrotic syndrome or protein - loosing entheropathy ) . ogunkeye et al . evaluated if serum bche activity could help in differentiating between liver and nonliver diseases in three groups of subjects : group 1 , liver disease with at least four out of five abnormal liver function tests ( aspartate transaminase ( ast ) , alanine transaminase ( alt ) , alkaline phosphatase , total bilirubin , and albumin ) ; group 2 , nonliver disease with at least two abnormal liver function tests , and group 3 , healthy subjects . group 2 patients presented serum bche activity within normal range for healthy individuals , but the mean bche value was lower compared to the control group ; however , the difference was not statistically significant . on the other hand , patients with liver diseases ( group 1 ) had serum bche activity well below the reference interval for healthy subjects . the predominant hepatic source of serum bche activity , the marked decreased synthesis with hepatocyte dysfunction , and its restoration with hepatocyte recovery suggested that serum bche activity might be a more specific marker of liver dysfunction than the more traditional liver function tests . in patients with aids and abnormal d - xylose test , due to small intestinal dysfunction , bche activity , total serum proteins , albumin , and cholesterol were significantly lower than in patients with a normal d - xylose absorptive test . also , in this condition , bche activity correlated with impairment of body composition and reflected protein - energy malnutrition . pseudocholinesterase activity was reduced in pregnant women with hellp syndrome and gradually increased with liver function recovery . there was a negative correlation between bche activity and inflammatory response intensity , as measured by granulocyte count , esr , body temperature , and iga levels [ 47 , 48 ] . bche takes part in the protidosynthetic pathway and regulates the degradation of butyrylcholine , an intermediate of lipid metabolism , as demonstrated also by the close relation between serum bche levels , cholesterol , and triacylglycerols . its enzymatic activity is positively associated with cardiovascular risk factors : it is higher in patients who have hypertension , hyperlipidemia , and high body weight . on the other hand , it is inversely related to cardiovascular mortality : individuals with very low bche activity have a higher mortality rate ; bche levels result low in patients who suffered acute myocardial infarction or underwent treatment with beta blockers [ 50 , 51 ] . in experimental studies , during fattening in pigs , bche activity significantly increased , probably due to an adaptive response of the hepatic synthesis of this enzyme to the increased lipid metabolism . mice fed on a restricted diet had significantly lower serum bche levels than mice fed a normal diet ad libitum ; at the same time , an increase in bche activity was observed in lean mice fed on a high carbohydrate diet . on the other hand , a marked reduction ( 40 % ) in bche activity occurred in the liver of genetically diabetic mice when starved for 24 h [ 6 , 52 , 53 ] . liver bche activity directly varied according to the protein content in the diet : high - protein diets produced the greatest increase in bche activity in the liver compared to high - carbohydrate or high - fat diets . bche activity was significantly elevated in both type 1 and type 2 diabetes compared with the control subjects ( p < 0.001 ) ; in these patients , serum bche was correlated with serum fasting triacylglycerol concentration ( p < 0.001 ) . bche may play a role in lipid metabolism , whether directly or through a synergistic action with cholesterol esterase . several investigators have found significant relationships between cholinesterase activity and triacylglycerols , hdl cholesterol , and ldl cholesterol [ 6 , 5559 ] . one important issue arising from these findings is whether higher bche activity is a cause or a consequence of dyslipidemia and metabolic syndrome . several published reports on animal and human studies did not give a clear answer [ 6064 ] . interventions that primarily increase or decrease blood lipids tend to have the same effect on bche , but inhibition of bche activity in vivo has been shown not to decrease lipid concentrations [ 61 , 6568 ] . bche activity was reduced after treatment with bezafibrate but did not significantly change after treatment with statins . in 1,097 healthy subjects , serum bche activity was measured and metabolic syndrome risk factors assessed . serum bche activity correlated with fasting insulin levels ( r = 0.266 , p < 0.001 ) and insulin resistance ( homa - r ) index ( r = 0.292 , p < 0.001 ) and resulted higher in individuals with risk factors for metabolic syndrome . in two other studies on diabetic patients , bche was found to be significantly correlated with serum insulin ( r = 0.622 , p < 0.001 ) , c - peptide ( r = 0.652 , p < 0.001 ) , and free fatty acid ( r = 0.821 , p < 0.001 ) . circumstantial evidence was provided demonstrating that insulin resistance and an increased flux of free fatty acids from adipose tissue to the liver stimulated the hepatic synthesis of serum bche ; these results suggest the involvement of pche in the pathophysiology of the metabolic syndrome . also , the association with ast , alt , and gamma - glutamyltransferase ( ggt ) activities , which are known to be associated with insulin resistance , probably reflects an association between bche activity and the metabolic syndrome , of which fatty liver is a feature . overweight patients with type 2 diabetes displayed significantly increased activities of serum alt ( 172 % of mean values in controls ) , ggt ( 253 % ) , and bche ( 139 % ) and a strong correlation of bche with serum triglycerides ( r = 0.760 , p < 0.001 ) . increased bche activity has been observed in nonobese as well as obese patients with fatty liver , whereas obese subjects without liver changes showed levels in the upper normal range . in subjects with fatty liver submitted to a low caloric diet , bche activity decreased in parallel with the improvement of hepatic steatosis . a striking parallel was also noted between plasma lecithin cholesterol acyltransferase and serum bche activity : both enzymes resulted to be lower than normal in liver disease and higher in endogenous hypertriglyceridemia and were also positively correlated with serum cholesterol and triglycerides , thus suggesting that both liver enzymes might be induced by an increased turnover of serum lipids and lipoproteins . blood pressure , as well , might be influenced causally by bche because its substrate acetylcholine induces vasodilation by triggering nitric oxide release via endothelial muscarinic cholinergic receptors . an excess of cholinesterase activity in the metabolic syndrome could also adversely affect endothelial function and ultimately increase blood pressure . the gene for plasma cholinesterase is on chromosome 3 ; in addition to the known gene variants leading to low enzyme activity , a proportion of individuals show an additional cholinesterase electrophoresis band associated with an increased enzyme activity . this occurs with a frequency of 8 to 10 % among europeans and is ascribed to the effects of another gene , cholinesterase ( serum ) 2 ( pche2 ) , located on chromosome 5 . it has been hypothesized that the region of chromosome 5 contains a gene for a protein that binds to bche and increases its activity . another explanation could be that high serum lipid concentrations may induce stereoscopic alteration in the enzymatic configuration that modifies bche activity or altered expression of the enzyme - encoding gene that determines bche concentration and activity . serum concentrations and bche activity seem to accurately reflect the availability of amino acidic substrates and/or a derangement in the protein synthesis due to hepatocellular damage ; additionally , it seems adequate to distinguish liver and nonliver diseases . in cancer , with or without liver impairment , stress starvation stimulates an inflammatory cascade which blocks the synthesis of bche , albumin , and other visceral proteins in favor of acute - phase protein synthesis . in these conditions , serum bche results an accurate functional and prognostic indicator , useful for monitoring the clinical and therapeutic intervention according to the patient s survival expectance . in the absence of inflammation , bche could be also a valid index of nutritional support effectiveness . in patients with primary malnutrition , either in excess or in defect , bche levels result strictly correlated with the classical indicators of the nutritional status such as albumin , lymphocyte count , cholesterol , and transferrin . due to the large range of normality of serum bche , this parameter is more suitable for repeated monitoring rather than single determination . clinical judgment certainly represents a fundamental hinge to combine with serum bche evaluation as indicator of the severity of disease and/or protein - energy malnutrition the necessity of a nutritional support . bche activity assay seems to be a valid biological marker of malnutrition , inflammation , and liver synthetic ability with a relatively low cost and high clinical informative power . serum bche determination is a routine clinical laboratory test , scheduled in all laboratory panels at hospital admission as well as for outpatient evaluation ; on demand , it is also possible to add this test in the urgent exams panels . its cost is similar to that of other routine exams ( serum glucose , urea , creatinine dosage , etc . ) , including the assay of albumin , prealbumin , transferrin , and lymphocyte count . bche may therefore enter in a cluster of selected prognostic parameters , useful to complete the clinical judgment . serum bche assessment should be included in routine clinical diagnostic procedures to evaluate patient clinical conditions , in particular in cases of inflammation and/or protein - energy malnutrition . this parameter has a prognostic value varying from disease to disease ; for example , it indicates inadequate availability of substrates for liver synthesis and positively correlates with the effectiveness of nutritional support in case of malnutrition ; bche has a survival predictive role in cancer patients and seems to correlate with disease progression . finally , reduced levels of bche suggested negative outcomes ( death or worsening of clinical conditions ) in patients on artificial nutrition . conversely to what happens in case of malnutrition , during metabolic syndrome ( diabetes , hypertension , hyperlipidemia ) and/or hepatic steatosis , bche positively correlates with the presence of mild inflammation in obesity , metabolic syndrome , lipid metabolism impairment , and fatty liver , bche activity can also provide information on the patient s metabolism , habitual diet , and finally on the specific response to treatment .

recombinant adenoviruses encoding the wild - type ( wt ) and mutant arf6 , as well as the clathrin hub , were produced as described 1 . levels of protein were regulated by the concentration of doxycycline ( dx ) , amount of virus , and length of time after removal of dx . cells were incubated for 1618 h to express recombinant proteins , except clathrin hub , for 2426 h. unless stated , we used 6070 pfu / cell for arf6wt and arf q67l , or 90100 pfu / cell for arf6t27n . these produced equal levels of the arf6 proteins , as assayed by immunoblotting . for assays with i - iga , using antibodies that specifically recognize the endogenous arf6 ( kind gift of v. hsu , harvard medical school , boston , ma ) the level of exogenous arf6 was approximately fivefold , relative to endogenous arf6 . for immunofluorescence , we omitted the dx to produce a ninefold overexpression relative to endogenous arf6 . these conditions minimized the possibility of toxic effects and produced an adequate signal for our localization and functional studies . controls in all experiments included cells that were : not infected ; infected but the expression of arf6 , dynamin - i k44a , or clathrin hub was fully repressed by 20 ng / ml dx ; or infected with a control virus encoding -galactosidase ( gal ) . these caused complete loss of the arf6 , dynamin - i , or hub - specific signal in immunofluorescence and biochemical studies . for colocalization of arf6 with iga , cells were washed with cold medium and incubated with 300 g / ml iga for 60 min . cells were observed at a magnification of 19,000 and every third cell was photographed and viewed at 80 kv . a total of 30 randomly selected cell profiles were photographed . clathrin - coated pits were easily and reproducibly discernible . a total of 148 images were used : control , 38 images ; arf6wt , 33 images ; arf6q67l , 39 images ; and arf6t27n , 38 images . the length of the apical pm was measured using a ruler on adobe photoshop , and the number of each type of coated pit was divided by the length . for endocytosis in the presence of clathrin hub , iga ( 300 g / ml ) was bound for 1 h at 4c and cells were washed over 45 min . cells expressing clathrin hub were stained with t7 antibody ( novagen , inc . ) . we used a recombinant adenovirus incorporating the tetracycline transactivator system to express wt arf6 and its mutants . confocal microscopy showed that arf6wt is associated with the ap region of the cell , and not the bl region . 1 a shows a vertical x - z section taken through the plane of a monolayer of cells expressing arf6wt . arf6 staining is in green , whereas zo-1 staining of the tight junctions is in red . 1 b shows horizontal x - y sections taken either at the level of the ap pm ( level of solid arrowhead in fig . 1 a ) or through the basal region of the cell ( level of open arrowhead in fig . 1 a ) . both arf6wt and arf6q67l were localized at , or close to , the ap pm . in contrast , arf6t27n gave staining in both the ap and bl regions of the cell . the ap pm tends to bulge upward in our mdck cells , forming a dome - like structure . we took advantage of this to utilize the higher x - y confocal resolution to determine if arf6 was entirely at the pm , or beneath the pm . 1 c were just above the level of the tight junction , at the level indicated by the arrow in fig . 1 a. in the arf6wt expressing cell , this x - y section shows the gp135 staining of the ap pm as a narrow ring ( fig . the arf6wt staining in the outer portion of the ring was coincident with the gp135 , indicating that this portion of the arf6wt is at the pm ( fig . the inner portion of the arf6wt ring is underneath the gp135 staining , i.e. , in the cytoplasm beneath the ap pm ( arrow ) . arf6t27n gave no ring , but rather , central staining that had little overlap with gp135 , indicating that it is mostly absent from ap pm . to examine the effects of arf6 on endocytosis , we used i - iga as an endocytic marker , which can be endocytosed via the polymeric immunoglobulin receptor ( pigr ) at either pm . strikingly , overexpression of either arf6q67l or arf6t27n stimulated endocytosis of i - iga from the ap pm ( fig . in contrast , ap endocytosis of iga in cells overexpressing arf6wt did not markedly differ from control cells infected with a virus encoding -gal or uninfected cells . overexpression of arf6wt or either mutant did not significantly alter the rate or extent of bl endocytosis , recycling back to the ap pm , bl to ap transcytosis , or bl to bl recycling ( our unpublished data ) . 2 b , levels of arf6q67l or arf6t27n were manipulated by infecting cells with varying amounts of virus . the stimulatory effect of arf6q67l was significantly greater than that of arf6t27n at all expression levels examined . in cells simultaneously expressing arf6q67l and arf6t27n ( achieved by double infection ) , we observed increased stimulation of endocytosis above levels induced by arf6q67l alone ( fig we next tested if arf6 could stimulate endocytosis of markers that are not internalized via clathrin - coated pits . mutation of both cytoplasmic tyr in pigr gave a pigr that is endocytosed at about five percent of the rate of the wt 15 . arf6 did not affect ap internalization of ricin or fluid phase markers ( our unpublished data ) , confirming that arf6 does not affect nonclathrin endocytosis . to test if arf6q67l stimulates clathrin - mediated endocytosis , we inhibited clathrin function by cytosol acidification or hypertonic media , and found that arf6q67l - stimulated endocytosis was blocked ( our unpublished results ) . we next tested the ability of the k44a mutant of tge dynamin - i mutant to inhibit arf6q67l - stimulated endocytosis 1 . coinfection with virus encoding dynamin - i k44a inhibited the endocytosis stimulated by arf6q67l , and this inhibition exhibited a dependence on the amount of dynamin - i k44a expressed ( fig . overexpression of a fragment of clathrin heavy chain , clathrin hub , acts as a dominant - negative inhibitor of clathrin - mediated endocytosis 10 . we made recombinant virus expressing the hub , and coexpressing both the clathrin hub and arf6 ( wt or mutants ) . uptake of iga was analyzed by immunofluorescence microscopy , using the t7 epitope tag on clathrin hub to detect transfected cells . we found an inverse correlation between expression of clathrin hub and internalization of iga ( fig . the inhibition of ap iga endocytosis by the clathrin hub was true for cells not overexpressing arf6 , as well as cells expressing arf6wt and the two mutants ( fig . 3 ) . therefore , ap endocytosis of iga promoted by arf6 mutants is clathrin - mediated . as arf6-stimulated endocytosis is clathrin - mediated , we asked if arf6 overexpression recruited clathrin to the ap pm . 1 a. cells expressing arf6wt have a small increase in ap pm clathrin ( fig . we next asked if the number or morphology of clathrin - coated pits was altered , using thin - section em under conditions where clathrin coats were easily identified . we classified clathrin - coated pit profiles as shallow ( width of pit > depth ) , or invaginated ( depth width ) . 4 c shows that overexpression of arf6wt gave a modest increase in coated pits , as compared with control . 4 a. consistent with this , we found that overexpression of arf6wt at a higher level than we routinely used stimulated ap endocytosis somewhat ( data not shown ) . overexpression of either arf6q67l or arf6t27n gave a much greater increase of coated pit profiles . in contrast , arf6q67l and arf6t27n gave nearly equal numbers of invaginated pits ( fig . these results further support the hypothesis that arf6 affects clathrin - mediated endocytosis at the ap pm . we next investigated if arf6 is present , even transiently , in coated pits by trapping arf6 in the deeply invaginated coated pits induced by dynamin - i k44a 9 . 5 , there was significant colocalization of arf6wt and arf6q67l with endogenous clathrin at the ap pm of cells expressing dynamin - i k44a . this indicates that arf6 may normally cycle through coated pits , and when coated pit pinching - off is prevented , a significant fraction of the arf6wt or arf6q67l can be trapped . we also investigated if iga bound to pigr at the ap pm would accumulate in clathrin - coated pits under these conditions . ordinarily , although endocytic receptors such as pigr and tfr are concentrated 510-fold in clathrin - coated pits , 8090% of these receptors are at steady state located outside of coated pits . like other small gtpases , arf6 probably has multiple effectors , and these might be responsible for the cell type - specific differences in arf6 function 12 . the actin cytoskeleton underlying the ap pm of epithelial cells has a unique organization , involving actin cores in microvilli and an underlying terminal web . cytochalasin d inhibits clathrin - mediated endocytosis at the ap pm of mdck cells 8 . arf6 may act on the ap actin cytoskeleton to regulate clathrin - mediated ap endocytosis . both arf6q67l and arf6t27n stimulate ap endocytosis , and coexpression of the two proteins produces an even greater stimulation . in macrophages , both arf6q67l and arf6t27n inhibit phagocytosis , providing a precedent for both mutant forms of arf6 , giving effects in the same direction 23 . although both arf6q67l and arf6t27n stimulate endocytosis , there are quantitative and qualitative differences in their effects , suggesting differences in their modes of action . although both arf6q67l and arf6t27n give equal increases in the number of clathrin - coated pits , arf6t27n gives a greater increase in shallow pits ( fig . this suggests that arf6t27n may preferentially increase the formation of shallow pits and/or decrease the rate of progression to invaginated pits . in contrast , the greater increase in endocytosis produced by arf6q67l suggests that it acts on a later step in endocytosis . arf6wt and arf6q67l can be trapped in clathrin - coated pits when pinching - off of the pits is prevented . arf6 may normally cycle through coated pits , but then leaves the pits so rapidly that an accumulation in coated pits is not ordinarily detectable . the large stimulation of endocytosis caused by arf6q67l could be due to a direct action on coated pits themselves . its modest stimulation of ap endocytosis may be due to an indirect effect , e.g. , via the actin cytoskeleton . our results illustrate the importance of comparing the localization and function of proteins in nonpolarized and polarized cells . arf6 may regulate a specialized endocytic pathway in nonpolarized cells that is cognate to ap endocytosis in epithelial cells ( 7 , 17 , 22 ) . as cells develop a polarized ap pm , arf6 and the specialized endocytic pathway may become restricted to that pm .

it is not unusual to find medially retracted or foreshortened handle of malleus ( manubrium ) during tympanoplasty . apart from posing difficulties in placement of graft during underlay technique , it can affect orientation during surgery as the manubrium is one of the important landmarks in middle ear . sectioning of the tensor tympani tendon near the neck of malleus would lateralize the manubrium to a significant extent and add to mobility of malleus as well . have studied adult crania without clinical otitis and concluded that foreshortened malleus is an anatomic variant , not a sign of pathology . the current study aims at evaluating results of type i tympanoplasty for central perforations where manubrium was found foreshortened preoperatively or during surgery and the tensor tympani tendon ( tt ) was cut during surgery and comparing these results with those cases where manubrium was foreshortened and tt was kept intact . a total of 84 cases were included in the study with inclusion criteria being a dry central perforation where the manubrium of malleus was found to be medially rotated and touching the medial wall of the middle ear . cases with perforation size more than 4 mm ( measured by placing graph paper on the perforation ) are included . cases where all the three ossicles were intact and mobile and where a type i tympanoplasty was performed were included . cases with ossicular erosion or with cholesteatoma or with a marginal perforation were excluded . all subjects with mucosal chronic otitis media were clinically evaluated thoroughly including tuning fork tests and otoendoscopy done when ear is dry for more than 2 weeks . a pure tone audiogram was done for all the subjects . in some of them , a medially rotated malleus could be found during otoendoscopy ( figure 1 ) whereas , in many others , it was found during surgery . odd numbered patients were included in group a where tt was cut during surgery ( figure 2 ) . vascular strip incision was used for canal wall skin and after middle ear contents were observed and after necessary disease removal , malleus was carefully made free of all attachments from remnant of tympanic membrane ( tm ) . if the subject met the inclusion criteria , decision of sectioning of tt was taken if the patient is in group a and tt was kept intact in patients of group b. temporalis fascia was used as the graft material and kept lateral to the handle of malleus and medial to the annulus [ 2 , 3 ] . it was made sure during surgery that the annulus at the anterior canal wall is reposited back in the original position in the sulcus . plenty of gelfoam was kept in middle ear , around ossicles especially medial to manubrium and also in the external ear canal in all cases . cases were followed up regularly for the next 6 months minimum and audiometry results were recorded at 6 months postoperatively . the same amplaid a177 dual channel audiometer with standard calibration was used in all the cases to avoid errors . parameters compared include graft uptake , medialisation suggested by graft touching the medial wall of middle ear , lateralisation suggested by blunting of anterior angle , air bone gap ( abg ) at 6 months , and occurrence of squamous pearls . 42 patients were included in group a where manubrium was found medialised and tt was cut near the neck of malleus and 42 patients belonged to group b where tt was not cut . all patients were between 20 and 40 years of age and there were 29 males and 13 females in group a and 27 males and 15 females in group b. there were 40 patients in group a where graft was successfully taken up and 2 cases where there was residual perforation at 8 weeks and they required revision surgery . in group b , graft uptake was complete in 39 patients and in one patient there was a tiny residual anterior perforation that healed with conservative management and two patients required revision surgery . so graft uptake rate is 95.24% for group a and 92.86% for group b. medialisation was not seen in any patients in group a whereas 2 cases in group b developed graft medialisation where the neotympanic membrane was touching the promontory at 6 months postoperatively as evident on otoendoscopy . blunting of anterior angle was not seen in any of the patients in both groups . hearing thresholds at 500 hz , 1000 hz , and 2000 hz were considered for hearing evaluation . the average preop abg in group a was 35.60 db whereas in group b it was 36.76 db ( p = 0.264 ) . average postop abg in group a was 14.92 db and in group b was 19.88 db with statistically significant difference between the two groups ( p < 0.000001 ) ( supplementary material , available online at http://dx.doi.org/10.1155/2015/531296 ) . three cases in group a and 14 cases in group b had postoperative abg more than 20 db . none of the patients in both groups had bone conduction threshold more than 15 db suggestive of sensorineural hearing loss . average hearing gain in group a is 20.68 db whereas in group b it is 16.88 db . this shows clearly that hearing improvement in group a is significantly better than in group b. statistical analysis was performed with application of student 's t - test for the abg values . handle of malleus is longer than the long process of incus and this provides additional impedance matching function of middle ear and adds to improved conduction of sound through middle ear . when the handle is retracted severely , this should affect conduction of sound as well . have used autologous interposition of incus to overcome severely retracted handle of malleus and stated that patients presenting with com ( chronic otitis media ) , a ( central ) perforation , a medially rotated malleus , and intact ossicular chain are a treatment challenge . lateralizing the malleus handle may require disconnection of the ossicular chain and an autologous incus interposition to bring back the reconstructed tympanic membrane in its original position and improve the hearing . have concluded that the section of the tensor tympani muscle tendon in canal wall - down tympanoplasty with ossiculoplasty had no statistically significant influence on sound transmission and can be a safe maneuver in middle ear surgery . it is well known , and we can see it in our cases ; after cutting the tensor tympani tendon , the anterior tympanic membrane remnant becomes pleated , so we need to completely separate it from the manubrium . the manubrium will support the graft from medial side , so the chances of medialisation should also be reduced . by cutting the tensor this will also help the ossicles to move more freely and it should improve hearing as adequate volume of middle ear is an important consideration for successful conduction of sound . the current study aims to evaluate effect of sectioning the tensor tympani tendon in type i tympanoplasty surgery without mastoidectomy where the canal wall was preserved and the results are compared . table 2 shows comparison of graft uptake rates of different authors . graft uptake rates are adequate if tensor tympani is cut or preserved , whereas hearing improvements are better in patients where tensor tendon was cut and the difference is statistically significant . sectioning of tensor tympani tendon is safe and effective procedure during tympanoplasty if manubrium is severely retracted and it brings good improvement in hearing also .

intraoperative diagnosis of space - occupying lesions of the central nervous system ( cns ) is of utmost importance in order to plan the treatment of patients . intraoperative cytologic techniques were introduced in the 1920s when eisenhardt and cushing reported squash smear cytology . very few centers continued the use of smears primarily in the rapid intraoperative diagnosis while other pathologists preferred frozen sections . however , in the past two decades , the increased need for rapid diagnosis and the advent of stereotactic procedures have resulted in either supplementing or replacing the use of frozen section study by the cytology technique in intraoperative consultations . this study was undertaken to evaluate the diagnostic utility of cytological techniques and frozen section study in the rapid intraoperative diagnosis of space occupying lesions of the cns . the material was subjected to cytological methods ( squash smears and touch imprints ) and frozen section study . a tiny bit of tissue was gently crushed on a labeled clean glass slide by a second slide held at right angle . the tissue was held by forceps and gently touched on to the clean glass slide . air dried smears and 95% ethyl alcohol fixed imprints were stained using toludine blue , may - grnwald - giemsa ( mgg ) , and hematoxylin and eosin ( h and e ) stains as for squash smears . the tissue was processed in cryostat at 10 c to 15 c. thin sections of 3 - 5 m thickness were cut and then stained using routine h and e. a tiny bit of tissue was gently crushed on a labeled clean glass slide by a second slide held at right angle . the tissue was held by forceps and gently touched on to the clean glass slide . air dried smears and 95% ethyl alcohol fixed imprints were stained using toludine blue , may - grnwald - giemsa ( mgg ) , and hematoxylin and eosin ( h and e ) stains as for squash smears . the tissue was processed in cryostat at 10 c to 15 c. thin sections of 3 - 5 m thickness were cut and then stained using routine h and e. during the study of the total 75 specimens , 73 were received intraoperatively while stereotactic biopsies were performed in two of the cases . the age of the patients ranged from 2 years to 84 years with a slight male predisposition ( male : female-1.1:1 ) . the majority of the cases ( 66.6% ) were seen in the cerebral hemispheres , with the frontotemporal region being the commonest site followed by the spinal cord in 10 cases ( 13.3% ) . neoplastic lesions formed the major group with 62 ( 82.7% ) cases while 13 ( 17.3% ) cases were nonneoplastic . the overall diagnostic accuracy of frozen section was found to be 75.7% , whereas that of cytological methods was 89.2% . frozen sections were considered better in diagnosing firmer lesions such as meningioma and schwannoma as poor cellular yield in cytological methods hampered the diagnosis . the two cases of tuberculosis showed granulomas , which were not evident on cytomorphology . in the individual lesions , the percentage accuracy was low in oligodendrogliomas ( 33.3% ) , astrocytomas ( 47.3% ) , metastatic tumors ( 60% ) , and pituitary adenomas ( 66.6% ) as compared to cytological methods , which showed a high accuracy in oligodendrogliomas ( 100% ) astrocytomas ( 100% ) , metastatic tumors ( 80% ) , and pituitary adenomas ( 100% ) . a combination of cytological methods , along with frozen sections , increased the percentage diagnostic accuracy to 96% . , 89.3% in squash smears , 78.4% in touch imprints , and 75.7 % in frozen sections [ table 1 and figures 13 ] . table showing the comparative diagnostic accuracy of squash smears , touch imprints , frozen section , and combined intraoperative methods in various cns lesions ( a ) low grade astrocytoma exhibiting cells with mild nuclear pleomorphism in fibrillary background ( h and e , 200 ) ( b ) squash smear of high grade astrocytoma show moderate to markedly pleomorphic tumor cells including giant forms ( arrow ) . [ h and e , 400 ] ( c ) frozen section of high grade astrocytoma exhibit prominent endothelial proliferation . ( h and e , 200 ) ( d ) paraffin section of the same case with pleomorphic tumor cells and bizarre forms ( arrow ) . ( h and e , 200 ) ( a ) meningothelial meningioma : smears show ovoid to elongated tumor cells with round to ovoid nuclei with fine chromatin and moderate cytoplasm . ( mgg , 400 ) ( c ) fibroblastic meningioma : crush smears show spindly cells with elongated nuclei and moderate cytoplasm . ( h and e , 200 ) ( a ) pituitary adenoma : squash smear : monomorphic tumor cells with round nuclei and moderate cytoplasm . numerous red blood cells ( rbcs ) in the background ( h and e , 400 ) ( b ) frozen section : round cells with moderate cytoplasm ( h and e , 400 ) ( c ) frozen section : columnar tumor cells arranged in sinusoidal pattern ( h and e , 400 ) ( d ) paraffin section of the above case showing similar cells in sinusoidal pattern ( h and e , 200 ) the diagnosis was deferred in 17 cases on frozen section , 12 cases on touch imprints , and 4 cases on squash smears as no opinion was possible . freezing artifacts was the main reason on frozen sections , which affected the morphology of different lesions . poor cellular yield and sampling error were the main factors in squash smears and touch imprints . wrong diagnosis was made in one case of anaplastic meningioma on frozen section due to the presence of only rare mitotic figures . a wrong diagnosis was given on squash smear and touch imprints in four cases , which included two cases of tuberculosis ( diagnosed as inflammatory lesions due to the absence of definite granulomas ) , one case of anaplastic meningioma ( diagnosed as atypical meningioma as only rare mitotic figures could be identified ) , and a case of low grade oligoastrocytoma ( diagnosed as high grade glioma probably due to thick smear giving wrong impression of high cellularity and nuclear pleomorphism on squash smears ) . intraoperative diagnosis of space occupying lesions of the cns helps neurosurgeons to modify the approach at surgery . the ideal intraoperative method used should be accurate , rapid , and should allow the preservation of tissue for paraffin section study . however , the inherent soft nature and high water content of the nervous tissue often renders poor quality frozen sections . hence , alternative methods such as squash smears and touch imprint cytology are often resorted to . squash smear and touch imprints are cheap and technically easier to make . no special equipment is required and a very small amount of tissue can be utilized , which allows enough tissue to be preserved for paraffin section study . inability to control thickness , crushing artifacts , and difficult smearing were some of the drawbacks of squash smears . lesions such as meningiomas and schwannomas were difficult to smear due to the increased fibrous component or calcification often rendering smears of poor quality . folkerth and asha et al . also mentioned in their study that cytology techniques are inferior to frozen sections in meningiomas and schwannomas . touch imprints exhibit better morphological details without any smearing artifact as compared to squash smears , especially in cases of metastatic adenocarcinoma and lymphoma . however , overall in this study touch imprints had poorer cellular yield , which hampered their diagnostic accuracy . frozen sections are better in diagnosing firmer lesions and offered better architectural features as compared to cytology . in the present study , no opinion was made in 22.9% cases due to marked freezing artifacts . it was also stated in other studies that frozen section was more suitable for firmer lesions and that freezing artifacts usually hampered its diagnostic utility . the diagnostic accuracy of squash smears and touch imprints was found to be in concordance with other authors . however , diagnostic accuracy of frozen section in the present study was 75.7% , which was far lower than that of other studies [ table 2 ] . comparison of diagnostic accuracy of squash smear , touch imprint , and frozen section study in various studies low grade astrocytoma exhibited moderate cellularity with mild nuclear pleomorphism on cytology . low grade astroctyomas are sometimes difficult to differentiate from reactive gliosis but features such as low cellularity and low nucleocytoplasmic ratio are more in favor of reactive gliosis . high grade astrocytomas on cytology exhibited high cellularity and moderate - to - marked nuclear pleomorphism . an attempt was made to differentiate between grade iii ( anaplastic ) and grade iv [ glioblastoma multiforme ( gbm ) ] astrocytomas on the basis of the presence or absence of necrosis . asha et al . also emphasize that a high degree of caution should be taken before making an attempt to categorize gliomas into astrocytomas , oligodendrogliomas , or ependymomas as mixture of all these is very frequent . oligodendrogliomas exhibited characteristic monotonous round cells , mildly pleomorphic nucleus , and an absent fibrillary background . less distinct cytoplasmic processes and calcification are characteristic of oligodendroglioma , which help in differentiating it from low grade astrocytoma . lymphomas show dark nuclei , prominent nucleoli , chromatin clumping , and often nuclear indentation . it has been pointed out that sampling error can affect the grading of astrocytic neoplasms and the lesion can be over diagnosed or misdiagnosed . myxopapillary ependymoma showed characteristic cytology with cellular papillary processes laced by round to polygonal tumor cells and pale staining acellular globular material . differentiation from chordoma is done by the absence of physaliferous cells while metastatic adenocarcinoma can be differentiated on the basis of morphology . it is often difficult to differentiate between fibroblastic meningioma and schwannoma as both have spindly cells . kobayashi also pointed out that in schwannoma , the length to breadth ratio of nuclei is greater than 2 , whereas in fibroblastic meningioma it is less than 2 . the case of atypical meningioma could be diagnosed both on cytology and frozen section based on high cellularity , moderate nuclear pleomorphism , and presence of scattered mitotic figures . however , the case of anaplastic meningioma was diagnosed as atypical meningioma because only infrequent mitotic figures were noted in cytology and frozen section . state that it is usually difficult to grade meningiomas on cytology and suggests differentiation between atypical and anaplastic meningioma by features such as necrosis and mitosis . the characteristic features of fasciculating bundles of oval to elongated cells arranged in a parallel fashion having oval to elongated nuclei were well - seen in both cytology and frozen sections . the tumor cells in carcinomas have abundant dense cytoplasm and they lack the fibrillary background of glial tumors . powell states that the squamous and adenocarcinomatous nature of metastatic epithelial malignancies can be picked up better on frozen section . pituitary adenomas ( three cases ) were diagnosed with 100% accuracy on cytology as compared to 66% accuracy rate in frozen sections . smears and imprints revealed characteristic features of the papillary pattern of relatively monomorphic cells with nuclei having stippled chromatin and micronucleoli . in one case cells of normal parenchyma show greater variation in size due to presence of different populations of cells . cells of normal parenchyma show greater variation in size due to presence of different populations of cells . lesions such as rathke 's pouch , epidermoid cyst , and dermoid cyst lack the calcification seen in craniopharyngioma . melanocytoma on smears and frozen sections showed abundant extra and intracellular melanin , which obscured the finer details of the ovoid to spindly tumor cells . though these lesions are cellular even on histopathology , their benign nature is confirmed by the absence of mitosis , pleomorphism , and necrosis . scanty cellular smears and imprints in neurenteric cyst was a problem ; hence , the diagnosis of neurenteric cyst with differential dermoid cyst was given intraoperatively . the diagnosis of a case of arachnoid cyst was missed intraoperatively due to sampling error on cytology and freezing artifacts in frozen sections . epidermoid cyst can be confused with craniopharyngioma but characteristic cytology features and clinicoradiological data can help in the differentiation . nonneoplastic lesions comprised mainly abscess ( eight cases ) , tuberculosis ( two cases ) , and neurocysticercosis ( one case ) . all the cases of abscess except for one , which had a poor cellular yield were diagnosed on cytology . both the cases of tuberculosis were not diagnosed on cytology as no granulomas were evident while frozen sections did show definite granulomas . a case of neurocysticercosis moreover , the laminations in psammoma bodies are irregular and wavy , whereas calcareous corpuscles have uniform concentric rings . squash smears and touch imprints are rapid , cost - effective , and allow preservation of cellular details better than frozen section . although frozen sections offered the best architectural details , freezing artifacts was a major drawback . freezing artifacts can be avoided to a large extent by optimal temperature control and rapid freezing of tissue . overall , it can be said that cytology and frozen section are complimentary to each other and increased familiarity with cytomorphological features of the lesions , adequate clinical history , neuroimaging details , and intraoperative findings can help the pathologist to improve diagnostic accuracy .

polymyalgia rheumatica ( pmr ) is an inflammatory condition affecting elderly people and characterized by aching and stiffness in shoulder and pelvic girdles . its occurrence is not rare , and reported prevalence rates from european data range from 12.7 to 112.6 cases per 100,000 inhabitants , with a geographical gradient making the disease more frequent in the north ( 1 , 2 ) . although pmr is generally regarded as a benign disease with no adverse impact on long - term survival , most patients with pmr require long - term steroid therapy , which is associated with various side effects ( 3 , 4 ) . diagnosis of pmr is based on a combination of clinical symptoms , raised acute - phase reactants , exclusion of other disease , and response to steroids . clinical symptoms and laboratory results are not disease specific ; therefore , a differential diagnosis is needed in order to exclude neoplastic and other rheumatologic diseases , like elderly rheumatoid arthritis ( ra ) and seronegative symmetrical synovitis with pitting edema . therefore , a few sets of diagnostic criteria for pmr were proposed and have been used in clinical practice ( 2 , 5 - 7 ) . in most cases of pmr , an initial dose of 10 - 20 mg per day of prednisone or equivalent is adequate in the absence of associated giant cell arteritis . the response to steroid is usually rapid , with complete or nearly complete resolution of musculoskeletal aching and stiffness within a few days ( 5 , 8) . therefore , methotrexate has been proposed as a steroid - sparing drug in treatment of pmr , with conflicting results ( 9 - 11 ) . some studies have reported that anti - tumor necrosis factor ( tnf ) agents had a steroid - sparing effect in treatment of patients who are resistant to steroid therapy ( 12 - 14 ) . data on the disease course , clinical features , and outcome of pmr have been described in various parts of the world ( 15 - 18 ) . however , data on the disease course , ultimate outcome , and therapeutic response of pmr in korea are limited . we describe the clinical features of 51 korean patients with pmr who were treated in 10 tertiary hospitals , and analyze the therapeutic response and remission related factors . all patients with a diagnosis of pmr who had been followed up at the rheumatology clinics of 10 university - based tertiary hospitals were retrospectively evaluated . diagnosis was based on bird 's criteria for pmr ( 6 ) : 1 ) bilateral shoulder pain or stiffness , or both ; 2 ) onset of illness within 2 weeks ; 3 ) initial erythrocyte sedimentation rate ( esr ) greater than 40 mm / h ; 4 ) duration of morning stiffness greater than 1 h ; 5 ) age 65 yr or older ; 6 ) depression or weight loss , or both ; and 7 ) bilateral upper arm tenderness . a diagnosis of probable pmr was made if any three or more of these seven criteria were fulfilled . patients who had other connective tissue disorders like ra and fibromyalgia , systemic infection or abnormal levels of serum creatinine kinase or thyroid - stimulating hormone were excluded . after a detailed history and physical examinations , all patients underwent a series of laboratory tests , including complete blood count ( cbc ) , esr , c - reactive protein ( crp ) , rheumatoid factor ( rf ) , anti - nuclear antibody ( ana ) , liver function tests , and urinalysis . clinical characteristics , including demographic features , duration of illness before diagnosis , clinical features , treatment , length of follow - up , flares and complications were recorded using a standardized form . flares were defined as an increase in activity of pmr symptoms sufficient to warrant an increase in steroid dose ( 16 ) . remission was defined as the absence of articular and systemic laboratory evidence of disease activity for at least two consecutive months without any kind of drugs and no recurrence . statistical analyses were performed using the spss software , version 12.0 ( chicago , il , usa ) . all data were expressed as the mean sd and a p value of less than 0.05 was regarded as significant . predicting factors for remission were assessed using a chi - squared - test and mann - whitney u test . this study was approved by the institutional review board of ajou university hospital ( ajou - med - mdb-11 - 180 ) . this study was approved by the institutional review board of ajou university hospital ( ajou - med - mdb-11 - 180 ) . of a total of 51 patients with pmr , 36 patients ( 70.6% ) were female . age at disease onset ranged from 49 to 89 yr , with a mean of 67.4 10.6 yr . symptom duration before diagnosis was 4 11.7 months and the follow - up period was 27.6 30.5 months ( table 1 ) . symptoms of pmr developed in 10 patients ( 19.6% ) in spring , 13 ( 25.5% ) in summer , 5 ( 9.8% ) in fall , and 23 ( 45.1% ) in winter . shoulder girdle ache was observed in 45 patients among 50 patients ( 90% ) and pelvic girdle ache was present in 28 patients among 47 patients ( 59.6% ) . other manifestations , in order of decreasing frequency , included peripheral arthritis in 29 patients among 46 patients ( 64% ) , morning stiffness in 22 patients among 47 patients ( 46.8% ) , weight loss in 12 patients among 46 patients ( 26.1% ) , fever in 13 patients ( 25.5% ) , headache in 11 patients among 47 patients ( 23.4% ) , and depression in 10 patients among 47 patients ( 21.3% ) . specifically , an elevated esr ( > 40 mm / h ) was observed in 49 patients ( 96.1% ) , an elevated crp ( > 0.8 mg / dl ) in 47 patients ( 92.2% ) , leukocytosis ( 10,000/l ) in 13 patients ( 25.5% ) , thrombocytosis ( 400,000/l ) in 21 patients ( 41.2% ) , elevated alkaline phosphatase in 26 patients ( 51% ) , positive ana in 19 patients ( 38% ) , and positive rf in 14 patients ( 28% ) . rf titers of positive patients were low ( 14 - 27.3 iu / ml ) . the ana titer was < 1:320 , except for one case . for ana positive patients , the diagnosis of sle could be excluded according to american college of rheumatology criteria . drugs used singly or in combination included oral steroids ( 50 patients , 98% ) , non - steroid anti - inflammatory drugs ( 34 patients , 66.7% ) , and disease modifying antirheumatic drugs ( dmards ) ( 26 patients , 51% ) . methotrexate was the most commonly used dmard ( 16 patients , 31.4% ) ; however , other dmards were used , including hydroxychloroquine in 12 patients ( 23.5% ) and sulfasalazine in 3 patients ( 5.9% ) . malignancies preceded pmr in five patients ( three patients , stomach cancer 2 , 4 , and 10 yr ago ; one patient , prostatic cancer 7 yr ago and sigmoid cancer 4 months ago ; one patient , colon cancer 8 yr ago ) . one patient developed ovarian cancer 1 yr after diagnosis of pmr . during the follow - up period ( 27.6 30.5 months ) , only 8 patients had stopped steroids , 10 patients were lost to follow - up , and 33 patients still received steroids . of the 41 patients , 28 ( 68.3% ) had flare at least once during the follow - up period . follow - up duration of eight patients defined as remission was 26.5 17.9 months , and their flare frequency was 0.5 0.5 . although the number of patients with remission was small , we evaluated clinical features and treatment between patients with remission and patients without remission ( table 3 ) . in addition , no significant difference was observed in initial steroid dosage and cumulative dose of steroids between them . however , the frequency of flare was significantly higher in patients without remission ( p = 0.02 ) . evaluation of clinical features and treatment between patients treated with methotrexate and patients treated without methotrexate showed no difference in follow - up duration and clinical features . however , patients treated with methotrexate had higher cumulative steroid dosage ( p = 0.046 ) . given the lack of awareness and the absence of biomarkers to aid in clinical diagnosis , it is possible that we are under diagnosing pmr . therefore , in the present study , we described the clinical features of 51 korean patients with pmr and analyzed the therapeutic response and remission related factors . pmr is an inflammatory disease that characteristically affects old people and women more often than man . in this study , the mean age at disease onset was 67.4 yr , and 70.6% of patients were women , similar to previous studies ( 19 , 20 ) . table 4 shows a summary of the clinical and laboratory data of korean patients , compared to those reported in caucasian ( 21 ) , chinese ( 17 ) , and japanese patients ( 15 ) . shoulder girdle pain , weight loss , and depression were prevalent symptoms , similar to other reports ( 15 - 17 , 21 ) . incidences of morning stiffness and peripheral arthritis were lower ; however , the incidence of hip girdle pain was higher . these differences could be explained by racial differences and different natures of study . in this study , some patients with headache or fever were evaluated with temporal artery biopsy . giant cell arteritis is the most frequent type of vasculitis in western countries , and european population - based studies of pmr have demonstrated the presence of biopsy - proved giant - cell arteritis in 16 to 21 percent of patients ( 5 ) . the prevalence of giant cell arteritis in japan was only 1.47 per 100,000 populations ( 22 ) . there has been no study evaluating the incidence of giant cell arteritis in pmr patients in asia . elevated levels of esr , crp , and alkaline phosphatase were the most frequent laboratory findings . frequencies of positive rf and ana were higher than in previous reports ( 15 , 23 ) . previous findings related to seasonality have been somewhat inconsistent ; however , seasonal patterns of incidence of pmr have been proposed as evidence to support an infectious etiology ( 4 ) . clustering of diagnoses in the early summer months has been reported , while other studies have reported peaks in the winter months ( 4 , 24 , 25 ) . however , other studies have reported no seasonal pattern ( 26 , 27 ) . in this study , we observed higher rates in the winter . steroid is the drug of choice in treatment of pmr . in the absence of giant cell arteritis , an initial dosage of 10 - 20 mg / day of prednisone or equivalent is adequate in most cases ( 5 ) . steroids are often needed for two to three years , and a subset of patients may relapse within 10 yr and require longer courses of treatment ( 28 ) . a recent study reported that a higher plasma viscosity in pmr increases the risk of prolonged steroid therapy and late giant cell arteritis . the authors of the study also suggested that starting patients on > 15 mg prednisolone showed an association with prolonged steroid treatment ( 16 ) . adjuvant steroid sparing agents , such as methotrexate and anti - tnf agents , have been suggested for prevention of steroid related adverse events ( 9 - 13 ) . findings from a randomized controlled trial have suggested that methotrexate can be effective in treatment of pmr when the drug is started at disease onset and given for at least 1 yr at a dose of at least 10 mg per week ( 11 ) . two pilot studies reported on a steroid - sparing effect of anti - tnf agents ( infliximab and etanercept ) in patients who were resistant to steroid therapy ( 12 , 14 ) . however , a recent randomized controlled trial showed that infliximab was ineffective in newly diagnosed patients with pmr ( 29 ) . in this study , only one patient did not use steroid because of patient denial . initial steroid dose was 23.3 11.5 mg prednisolone equivalent and the response was good , with improvement of symptoms and normalization of esr in 4.1 5.4 months . patients treated with methotrexate showed a higher cumulative steroid dosage than those who were not ( p = 0.046 ) . these results could be explained by the fact that methotrexate was needed for control of disease activity in steroid dependent patients . some patients have a more chronic , relapsing course and may require low doses of steroid for several years . two recent studies reported a relapse frequency of 50% in patients with pmr ( 25 , 29 ) . another study showed that increased initial doses of steroids and faster tapering were substantial predictors of relapse . therefore , they recommended keeping the initial steroid dose as low as possible , and that it should be discontinued slowly ( 28 ) . other studies suggested that persistently raised concentrations of crp and interleukin 6 were helpful in identification of patients with relapsing disease ( 30 ) . in this study , 28 patients ( 68.8% ) had flare at least once during the follow - up period . ( 28 ) defined relapse as an exacerbation of pmr symptoms requiring an increase in steroid dose 5 mg / d occurring at least 30 days after the incidence rate . ( 30 ) defined relapse or recurrence as reappearance of clinical symptoms in association with elevated esr or crp in a patient receiving steroids or after discontinuation of treatment . the frequency of flare was significantly higher in patients without remission than those with remission ( p = 0.02 ) . these results suggest that whether flare develops or not during tapering of steroid could be an important predicting factor for remission . larger prospective studies are needed in order to reveal therapeutic responses and prognostic factors of pmr in korea . in conclusion , korean patients commonly develop pmr in the winter and show more seropositivity , although the titer is low . the response to steroid is fairly good ; however , tapering is not easy due to frequent flare . approximately 15.7% of patients went into remission and the frequency of flare was significantly lower than patients without remission . more than half of patients required second - line treatment in order to reduce the steroid dose , which is most commonly methotrexate . the course of pmr is not benign , because remission is rare and relapse occurs frequently with long - term steroid treatment .

plain radiography is the simplest , oldest , and cheapest technique for studying the salivary glands . conventional sialography , ultrasonography ( usg ) , and computed tomography ( ct ) can detect sialolithiasis with a high degree of sensitivity . sialolithiasis accounts for more than 50% of the diseases of the large salivary glands , and is hence the most common cause of acute and chronic infections ; however , it remains idiopathic in many instances . to our knowledge , recent literature has not yet reported the calcification of the salivary glands in chickenpox . in patients with chickenpox and those who present with radiological findings of calcification in the major salivary glands , close observation is mandatory for better control of recurrent sialadenitis and early recognition of gland mass . the purpose of this case report is to present the usg , ct , and clinical features related to calcifications within the submandibular gland of patients with chickenpox . a 15-year - old boy was referred to our hospital because of a 1-year history of swelling in the right submandibular region . he gave a history of pruritic vesicular rash , chest pain , and general malaise 1 year ago . his medical history was positive for dermatomyositis , diabetes mellitus , and hyperlipidemia , for which he has been on medication for the past 7 years . an examination of the right submandibular region revealed that it was swollen and well - circumscribed ; a firm mass was palpable . his laboratory findings were the following : white blood cell count , erythrocyte sedimentation rate , c - reactive protein level , and lymphocytes were 10400/mcl , 51 mm / h , 41 mg / l , and 3400/mcl , respectively . the gray scale ultrasonography showed enlargement , inflamed parenchymal , and calcification in the right submandibular gland [ figure 1 ] . in addition , the ct scan used for the differential diagnosis showed enlargement , inflammation , and calcification in the gland [ figure 2 ] . usg image showing acoustic shadow behind hyperechoic calcification ( arrowhead ) in the inflamed parenchyma of the right submandibular gland ( arrows ) , which appears hypoechoic and inhomogeneous contrast - enhanced ct scan of the neck area ( a axial , b coronal slices ) showing enlargement , mild increased density , medioinferior amorphous calcification with 13 mm diameters , and 1233 hu density in the right submandibular gland the patient was discharged and given supportive analgesics and advised to ingest fluids and use warm compresses . plain radiography is the simplest , oldest , and cheapest technique for studying the salivary glands . it is useful in detecting ductal calculi , calcifications ( as in hemangioma and lymph nodes ) , and adjacent osseous lesions . conventional sialography , usg , and ct can detect sialolithiasis with a high degree of sensitivity . usg is , however , inferior to ct in differentiating a solitary large ductal calculus from a cluster of small calculi . these studies are often performed after intravenous injection of the contrast media for better delineation of the anatomy and extent of lesion . calcification , a phenomenon often regarded by pathologists as little more than evidence of cell death , is becoming recognized to be important in the dynamics of a variety of diseases , from which millions of people suffer in all ages . there are thought to be a series of stages that lead to the formation of calculi in salivary glands . initially , factors such as abnormalities in calcium metabolism , dehydration , reduced salivary flow rate , altered acidity ( ph ) of saliva caused by oropharyngeal infections , and altered solubility of crystalloids , which lead to precipitation of mineral salts , are involved . obstructive salivary gland disease , or obstructive sialadenitis , may also occur due to fibromucinous plugs , duct stenosis , foreign bodies , anatomic variations , or malformations of the duct system . sialoliths occur in two - thirds of cases of chronic sialadenitis , although obstructive sialadenitis is often a consequence of sialolithiasis . chickenpox or varicella is an acute infectious disease of childhood caused by varicella - zoster virus ( vzv ) and belonging to the family herpesviridae ( herpes simplex , varicella - zoster , cytomegalovirus , and epstein - barr virus ) . the primary infection presents as fever and exanthematous rash but can affect almost any organ of the body . the disease is usually acute and self - limited , however , can occasionally lead to complications such as encephalitis , pneumonia , and secondary bacterial infections . however , in the neonatal period and in immunocompromised patients , rare and serious complications may be encountered . there is a long association between viral infections and diseases of the salivary gland . in general , viral infections of the salivary gland may result in reduced saliva production and/or swelling . however , there is not information available regarding the subclinical salivary gland involvement in the course of vzv infection . it can only be assumed that , were they looked for , more cases of covert salivary gland involvement might be found . the herpes group of viruses may cause focal cytopathic effects in either the airway or alveoli . after that , there also occurs edema , congestion , and endothelial damage in small vessels , along with focal hemorrhagic necrosis , mononuclear infiltration , and fibrinous exudates in the gland parenchyma . consequently , chickenpox disease may cause calcification in the submandibular gland through the same mechanism in the lungs . we thought that submandibular gland calcification may also occur by the same pathophysiological mechanisms caused by chickenpox sialadenitis . through the bloodstream , virutic sialadenitis caused by acute varicella and consisting of endothelial damage in small blood vessels , along with focal hemorrhagic necrosis , results in mononuclear infiltration , fibrinous exudates with macrophages in the gland , and calcifications . here , we first presented a discussion of an unusual diagnosis submandibular gland calcification in the chickenpox disease . a description and images are presented , followed by the diagnosis and an explanation of how the diagnosis was determined .

eukaryotic genomes are packaged into arrays of nucleosomes composed of 147-base - pair dna intervals wrapped around an octameric complex of the core histones h2a , h2b , h3 and h4 ( luger et al , 1997 ) . together with the h1-type linker histones , these proteins are termed canonical histones , as they constitute the vast majority of histone proteins in chromatin ( marzluff et al , 2008 ) . concomitant with genome duplication during s - phase of the cell cycle , disassembled parental nucleosomes and de novo synthesized histones are used as distinct sources for replication - coupled nucleosome assembly ( corpet & almouzni , 2009 ) . in a subset of nucleosomes , the canonical histones are subsequently replaced by histone variant proteins by replication - independent processes , which can specify functionally distinct chromatin regions ( henikoff & ahmad , 2005 ) . the complexity of chromatin diversification is further increased by the many post - translational modifications of histones , which are thought to constitute an epigenetic histone code ' ( jenuwein & allis , 2001 ; kouzarides , 2007 ) . despite the central role of histones in chromatin assembly and diversification , no experimental tools have been developed so far to directly address canonical histone divergence from replacement variants and the post - translational modifications in multicellular organisms . in fact , genetic analysis has been limited to lower eukaryotes , such as the yeast saccharomyces cerevisiae , in which histone genes are encoded by tandem repeats ( marzluff et al , 2008 ) . in all higher eukaryotes , however , canonical histones are encoded by multiple gene units of between 10 and 400 copies that are mostly distributed over several chromosomes ( marzluff et al , 2008 ) . the high number of histone genes and their distribution within the genome prevent straightforward functional genetics and explains the correlative nature of many previous studies in the field ( kouzarides , 2007 ) . as the yeast model system is clearly not suitable to address chromatin diversification and its function in the context of the complex multicellular development of higher organisms , we developed an experimental system for the model organism drosophila melanogaster that serves as a tool to directly assess histone functions by molecular genetics and by transgene - dependent rescue . d. melanogaster is an ideal model organism in which to develop an experimental system to address fundamental questions regarding histone function for several reasons . the genetic toolset in d. melanogaster is highly advanced , the fly undergoes a complex but well - characterized development and , most importantly , all canonical histone genes are clustered in a single chromosomal locus . this arrangement is distinct from that in other multicellular organisms , including genetically accessible systems such as the mouse and nematodes , in which the histone genes are distributed throughout the genomes ( marzluff et al , 2008 ) . according to the genome annotation , the histone gene complex of d. melanogaster is composed of 23 canonical histone gene repeat units ( his - gus ) , each bearing a gene array encoding the five canonical histones ( for simplicity we refer to them as histones ' ; for details of the histone complex see http://flybase.org ; fig 1a ) . owing to this arrangement , we were able to use the drosdel system ( ryder et al , 2004 ) to generate the deletion df(2l)his , which precisely uncovers the entire histone complex and thus all histone genes in the genome . we call this molecularly defined histone null mutation his ' ( fig 1a ) . this allows validation of a transgene - based histone - replacement system by its ability to rescue the lethality associated with the his deletion . we used the genuine his - gus for histone expression instead of an artificial expression system , thereby maintaining s - phase - specific histone expression and avoiding histone overexpression . multisite gateway ' system ( invitrogen ) for a modular transgene design from single his - gus ( supplementary fig s1 online ) . finally , we used the c31 site - specific recombination system ( bischof et al , 2007 ) , which allowed us to target transgene integrations to defined genomic locations ( landing sites ) , an essential prerequisite for drawing conclusions from comparing the effects of modified and wild - type histone transgenes that could suffer from variable position effects if transgenes were randomly integrated . lethality of his was not rescued by two or six transgene - encoded his - gus . the respective transgenes carried one or three his - gus integrated into the same landing site on chromosome 3r and were assayed as homozygous individuals . whereas his mutant embryos lacking his - gu transgenes did not develop a larval cuticle , individuals bearing two his - gu transgenes developed a defective cuticle , and individuals bearing six his - gu transgenes developed a wild - type cuticle pattern but failed to hatch ( supplementary fig s2 online ) . these results indicate a dose - dependent partial rescue with increasing copy numbers of his - gu transgenes . finally , we increased the his - gu copy numbers by integrating three his - gus into an additional landing site on chromosome 3l to generate flies that carried 12 transgene - encoded his - gus in their genome by recombination . his mutant individuals with 12 his - gus were rescued to become fertile adults with no visible morphological defects . furthermore , when we compared the protein expression of transgene - encoded histones from rescued flies with endogenous histones from wild - type flies , we did not find a significant difference ( supplementary fig s3 online ) . the complete rescue of the his mutation by 12 his - gu transgenes indicates that the deletion does not affect any essential genes other than the canonical histones . the combination of histone transgenesis with the his mutation is , therefore , an effective system in which to replace endogenous histones with transgene - encoded histones in a multicellular organism . to validate the system as a cellular assay for histone function , we characterized the embryonic lethal phenotype of the his mutation by studying cell cycle progression . for this , we used antibodies of the cyclin b protein as a cell cycle marker . cyclin b reaches peak levels in g2-phase , is degraded during the metaphase - to - anaphase transition in mitosis and re - accumulates gradually during the next s - phase ( lehner & o'farrell , 1990 ) . homozygous his mutant embryos lack zygotic histone synthesis , but as they derive from heterozygous females they receive maternal histone proteins and mrnas ( lanzotti et al , 2002 ) . these embryos complete the first 14 cell cycles of embryogenesis with no scorable defects and undergo mitosis 14 ( m14 ) similarly to the wild type ( fig 1b , e ) . thus , the maternal store of histone mrna and histone protein is sufficient to drive the early embryonic cell cycles and development up to the blastoderm stage . histone mrna is unstable outside the s - phase of the cell cycle ( marzluff et al , 2008 ) . therefore , the maternal store of histone mrna is degraded completely during the g2-phase of cell cycle 14 ( g214 ) in both wild - type embryos and the his mutants ( lanzotti et al , 2002 ) . hence , newly synthesized histone mrna was observed in s - phase 15 ( s15 ) of wild - type cells ( fig 1b d ) , whereas no histone mrna was present in the corresponding his mutant cells ( fig 1e g ; supplementary fig s4 online ) . the pattern of epidermal cell divisions is stereotyped in wild - type fly embryos ( supplementary fig s5 online ) . mitosis 15 ( m15 ) first takes place in the dorsal epidermis about 4.55 h after egg laying , as marked by cyclin b degradation in those cells ( fig 2a ) . by contrast , his mutants maintained uniformly high levels of cyclin b in all parts of the epidermis , both at this stage ( fig 2b ) and during the later stages of embryogenesis ( supplementary fig s6 online ) . these results indicate that loss of de novo synthesized histones abrogates the completion of cell cycle 15 in all epidermal cells . thus , a possible rescue of the mutant phenotype into a wild - type pattern by transgene - derived histone synthesis can be reliably scored . in fact , the presence of 12 transgenic his - gus in the genome of the his mutants causes a reversion of the mutant m15 pattern to that of wild - type embryos ( fig 2c ; supplementary fig s7 online ) . quantitative estimates on rescued his mutant embryos confirmed that not only the pattern , but also the timing of m15 was fully restored ( fig 2d ) . this result shows that multiple his - gus are required to ensure normal development of a multicellular organism , such as drosophila , when expressed under the control of endogenous regulatory elements . this finding is consistent with the phenomenon that all multicellular organisms contain multiple histone gene units , ranging from about 10 up to several hundred copies per genome ( marzluff et al , 2008 ) . previous studies , which targeted histone synthesis in higher organisms by reducing histone translation and transcript stability , have yielded pleiotropic effects ( lanzotti et al , 2002 ; pettitt et al , 2002 ; zhao et al , 2004 ) . in view of the clearly defined phenotype of the his mutation obtained here , these earlier observations might be due to incomplete deprivation of the newly synthesized histones or off - target effects , highlighting the value of the newly established mutation . in fact , the complete lack of de novo histone synthesis , similar to that in his mutants , is unprecedented for eukaryotes and will enable not only direct and detailed studies of chromatin assembly , but also the assessment of the function of histones in cell cycle progression . the functional replacement of endogenous histones by histone transgenes offers a unique opportunity to directly address the relevance of specific histone modification sites in a multicellular organism . such an approach requires that transgenes carrying histones with altered modification sites do not interfere with the development or viability of the his/+ heterozygous individuals bearing the modified his - gu transgenes . as a proof of principle , we targeted the methyl - modified lys 27 residue in histone h3 ( h3 k27 ) , a well - characterized epigenetic modification site involved in polycomb - dependent gene regulation ( mller & verrijzer , 2009 ) . we replaced a lysine with an arginine ( h3 k27r ) in a single his - gu to prevent lysine methylation , and subsequently generated transgenes containing three repeats of h3 k27r . the resulting transgenes were integrated into the same landing sites on chromosome 3l and r , which were used for the wild - type transgenes . after recombination and the necessary crosses to obtain his/+ heterozygous transgene - bearing flies , we investigated whether h3 k27r expression has any effects that would preclude the functional analysis of this specific modification site . no such effects were observed , indicating that the expression of h3 k27r would interfere in a dominant manner with fly development , viability and fertility . we note , however , that this result does not exclude the possibility that other histone modification mutations would not cause dominant effects . therefore , each histone modification mutation to be characterized needs to be tested as shown for h3 k27r here . in a similar approach with the unicellular organism yeast , dai et al ( 2008 ) used constitutive expression of mutated histones to study the relevance of individual histone modifications . of the 486 mutations targeting histones h3 and h4 , none caused a dominant effect against a background of reduced endogenous histone expression . thus , it seems unlikely that the experimental system introduced here will be limited by dominant effects from transgene - encoded mutated histones . the experimental system described in this study should extend beyond yeast studies and allow examination of the effects of designed histone mutants on the development and homeostasis of an entire multicellular organism . it will also benefit from the advanced genetic methodology and tools for stage and tissue assessment of histone functions and cell clone analysis by mitotic recombination that are available for the fly ( ashburner , 1998 ) . biological questions of high relevance , such as histone - dependent chromatin assembly , the effect of histone deprivation on transcriptional regulation , functional differences between canonical and replacement histones , as well as concepts including the histone code ' hypothesis , can now be examined and put to a critical test in vivo . d. melanogaster is an ideal model organism in which to develop an experimental system to address fundamental questions regarding histone function for several reasons . the genetic toolset in d. melanogaster is highly advanced , the fly undergoes a complex but well - characterized development and , most importantly , all canonical histone genes are clustered in a single chromosomal locus . this arrangement is distinct from that in other multicellular organisms , including genetically accessible systems such as the mouse and nematodes , in which the histone genes are distributed throughout the genomes ( marzluff et al , 2008 ) . according to the genome annotation , the histone gene complex of d. melanogaster is composed of 23 canonical histone gene repeat units ( his - gus ) , each bearing a gene array encoding the five canonical histones ( for simplicity we refer to them as histones ' ; for details of the histone complex see http://flybase.org ; fig 1a ) . owing to this arrangement , we were able to use the drosdel system ( ryder et al , 2004 ) to generate the deletion df(2l)his , which precisely uncovers the entire histone complex and thus all histone genes in the genome . we call this molecularly defined histone null mutation his ' ( fig 1a ) . this allows validation of a transgene - based histone - replacement system by its ability to rescue the lethality associated with the his deletion . we used the genuine his - gus for histone expression instead of an artificial expression system , thereby maintaining s - phase - specific histone expression and avoiding histone overexpression . multisite gateway ' system ( invitrogen ) for a modular transgene design from single his - gus ( supplementary fig s1 online ) . finally , we used the c31 site - specific recombination system ( bischof et al , 2007 ) , which allowed us to target transgene integrations to defined genomic locations ( landing sites ) , an essential prerequisite for drawing conclusions from comparing the effects of modified and wild - type histone transgenes that could suffer from variable position effects if transgenes were randomly integrated . lethality of his was not rescued by two or six transgene - encoded his - gus . the respective transgenes carried one or three his - gus integrated into the same landing site on chromosome 3r and were assayed as homozygous individuals . whereas his mutant embryos lacking his - gu transgenes did not develop a larval cuticle , individuals bearing two his - gu transgenes developed a defective cuticle , and individuals bearing six his - gu transgenes developed a wild - type cuticle pattern but failed to hatch ( supplementary fig s2 online ) . these results indicate a dose - dependent partial rescue with increasing copy numbers of his - gu transgenes . finally , we increased the his - gu copy numbers by integrating three his - gus into an additional landing site on chromosome 3l to generate flies that carried 12 transgene - encoded his - gus in their genome by recombination . his mutant individuals with 12 his - gus were rescued to become fertile adults with no visible morphological defects . furthermore , when we compared the protein expression of transgene - encoded histones from rescued flies with endogenous histones from wild - type flies , we did not find a significant difference ( supplementary fig s3 online ) . the complete rescue of the his mutation by 12 his - gu transgenes indicates that the deletion does not affect any essential genes other than the canonical histones . the combination of histone transgenesis with the his mutation is , therefore , an effective system in which to replace endogenous histones with transgene - encoded histones in a multicellular organism . to validate the system as a cellular assay for histone function , we characterized the embryonic lethal phenotype of the his mutation by studying cell cycle progression . for this , we used antibodies of the cyclin b protein as a cell cycle marker . cyclin b reaches peak levels in g2-phase , is degraded during the metaphase - to - anaphase transition in mitosis and re - accumulates gradually during the next s - phase ( lehner & o'farrell , 1990 ) . homozygous his mutant embryos lack zygotic histone synthesis , but as they derive from heterozygous females they receive maternal histone proteins and mrnas ( lanzotti et al , 2002 ) . these embryos complete the first 14 cell cycles of embryogenesis with no scorable defects and undergo mitosis 14 ( m14 ) similarly to the wild type ( fig 1b , e ) . thus , the maternal store of histone mrna and histone protein is sufficient to drive the early embryonic cell cycles and development up to the blastoderm stage . histone mrna is unstable outside the s - phase of the cell cycle ( marzluff et al , 2008 ) . therefore , the maternal store of histone mrna is degraded completely during the g2-phase of cell cycle 14 ( g214 ) in both wild - type embryos and the his mutants ( lanzotti et al , 2002 ) . hence , newly synthesized histone mrna was observed in s - phase 15 ( s15 ) of wild - type cells ( fig 1b d ) , whereas no histone mrna was present in the corresponding his mutant cells ( fig 1e g ; supplementary fig s4 online ) . the pattern of epidermal cell divisions is stereotyped in wild - type fly embryos ( supplementary fig s5 online ) . mitosis 15 ( m15 ) first takes place in the dorsal epidermis about 4.55 h after egg laying , as marked by cyclin b degradation in those cells ( fig 2a ) . by contrast , his mutants maintained uniformly high levels of cyclin b in all parts of the epidermis , both at this stage ( fig 2b ) and during the later stages of embryogenesis ( supplementary fig s6 online ) . these results indicate that loss of de novo synthesized histones abrogates the completion of cell cycle 15 in all epidermal cells . thus , a possible rescue of the mutant phenotype into a wild - type pattern by transgene - derived histone synthesis can be reliably scored . in fact , the presence of 12 transgenic his - gus in the genome of the his mutants causes a reversion of the mutant m15 pattern to that of wild - type embryos ( fig 2c ; supplementary fig s7 online ) . quantitative estimates on rescued his mutant embryos confirmed that not only the pattern , but also the timing of m15 was fully restored ( fig 2d ) . this result shows that multiple his - gus are required to ensure normal development of a multicellular organism , such as drosophila , when expressed under the control of endogenous regulatory elements . this finding is consistent with the phenomenon that all multicellular organisms contain multiple histone gene units , ranging from about 10 up to several hundred copies per genome ( marzluff et al , 2008 ) . previous studies , which targeted histone synthesis in higher organisms by reducing histone translation and transcript stability , have yielded pleiotropic effects ( lanzotti et al , 2002 ; pettitt et al , 2002 ; zhao et al , 2004 ) . in view of the clearly defined phenotype of the his mutation obtained here , these earlier observations might be due to incomplete deprivation of the newly synthesized histones or off - target effects , highlighting the value of the newly established mutation . in fact , the complete lack of de novo histone synthesis , similar to that in his mutants , is unprecedented for eukaryotes and will enable not only direct and detailed studies of chromatin assembly , but also the assessment of the function of histones in cell cycle progression . the functional replacement of endogenous histones by histone transgenes offers a unique opportunity to directly address the relevance of specific histone modification sites in a multicellular organism . such an approach requires that transgenes carrying histones with altered modification sites do not interfere with the development or viability of the his/+ heterozygous individuals bearing the modified his - gu transgenes . as a proof of principle , we targeted the methyl - modified lys 27 residue in histone h3 ( h3 k27 ) , a well - characterized epigenetic modification site involved in polycomb - dependent gene regulation ( mller & verrijzer , 2009 ) . we replaced a lysine with an arginine ( h3 k27r ) in a single his - gu to prevent lysine methylation , and subsequently generated transgenes containing three repeats of h3 k27r . the resulting transgenes were integrated into the same landing sites on chromosome 3l and r , which were used for the wild - type transgenes . after recombination and the necessary crosses to obtain his/+ heterozygous transgene - bearing flies , we investigated whether h3 k27r expression has any effects that would preclude the functional analysis of this specific modification site . no such effects were observed , indicating that the expression of h3 k27r would interfere in a dominant manner with fly development , viability and fertility . we note , however , that this result does not exclude the possibility that other histone modification mutations would not cause dominant effects . therefore , each histone modification mutation to be characterized needs to be tested as shown for h3 k27r here . in a similar approach with the unicellular organism yeast , dai et al ( 2008 ) used constitutive expression of mutated histones to study the relevance of individual histone modifications . of the 486 mutations targeting histones h3 and h4 , none caused a dominant effect against a background of reduced endogenous histone expression . thus , it seems unlikely that the experimental system introduced here will be limited by dominant effects from transgene - encoded mutated histones . the experimental system described in this study should extend beyond yeast studies and allow examination of the effects of designed histone mutants on the development and homeostasis of an entire multicellular organism . it will also benefit from the advanced genetic methodology and tools for stage and tissue assessment of histone functions and cell clone analysis by mitotic recombination that are available for the fly ( ashburner , 1998 ) . biological questions of high relevance , such as histone - dependent chromatin assembly , the effect of histone deprivation on transcriptional regulation , functional differences between canonical and replacement histones , as well as concepts including the histone code ' hypothesis , can now be examined and put to a critical test in vivo . plasmid construction . plasmid construction is schematically included in supplementary fig s1 online . using the oligonucleotides 5-ggggacaagtttgtacaaaaaagcaggctacggtaccggacaattgacactgtcccttcaaacgcctg-3 and 5-ggggaccactttgtacaagaaagctgggtaaccggtcgtacgacctcttcaataataacactttcttcagttaacacatg-3 as primers for pcr , the his - gu was amplified from w genomic dna , recombined into pdonr221 ( invitrogen ) leading to the gateway ' entry vector pentr221-hisgu and verified by dna sequencing . in addition , we generated pentrl4r1 - 504bpseq and pentrr2l3 - 504bpseq entry vectors by recombining a 504-bp noncoding pcr product into pdonrp4p1r and pdonrp2rp3 , respectively . the oligonucleotides used as pcr primers were 5-ggggacaactttgtatagaaaagttgacggtaccgcatagctaacgaatgtaactg-3 and 5-ggggactgcttttttgtacaaacttgcaccggtgcacacgaataagacggtc-3 for pdonrp4p1r ; 5-ggggacagctttcttgtacaaagtggacggtaccgcatagctaacgaatgtaactg-3 and 5-ggggacaactttgtataataaagttgaaccggtgcacacgaataagacggtc-3 for pdonrp2rp3 . pentrl4r1-hisgu and pentrr2l3-hisgu were generated by replacing the noncoding sequences in pentrl4r1 - 504bpseq and pentrr2l3 - 504bpseq with the his - gu from pentr221-hisgu through acc65i and agei . pentr221-hisgu.h3k27r was generated by replacing an ncoi / saci fragment in pentr221-hisgu with a synthetic fragment ( mr gene , regensburg , germany ) containing an aag into cgc codon exchange leading to the h3 k27r mutation . the pentrl4r1-hisgu.h3k27r and pentrr2l3-hisgu.h3k27r entry vectors were generated analogously to the wild - type variants . the pdestr3r4-c31attb destination vector was created from puastattb ( bischof et al , 2007 ) by replacing a bamhi fragment ( uas elements , basal promotor , multiple cloning site and sv40 ) with a bglii fragment containing the attr4-ccdb - cm - attr3 cassette for multisite gateway ' that was amplified from pdestr4-r3 using the oligonucleotides 5-gtcagatctacctaggagataccagcggataacaatttcac-3 and 5-accagatctatctagaggcaaggcgattaagttgggtaac-3 as primers for pcr . recombination of pentr221-hisgu , pentrl4r1-hisgu and pentrr2l3-hisgu with pdestr3r4-c31attb resulted in the transgene integration construct pc31attb3xhisgu . analogously , pentr221-hisgu , pentrl4r1 - 504bpseq and pentrr2l3 - 504bpseq led to pc31attb1xhisgu and pentr221-hisgu.h3k27r . df(2l)his was constructed from w ; p{frt , w}5-ha-1581 ( szeged stock center ) and w ; p{frt , w}cb5033 - 3 ( provided by g. reuter ) following a previously described scheme ( ryder et al , 2004 ) . df(2l)his was kept heterozygous over cyo , p{ftz / lacb}e3 to identify mutant embryos by lacking -galactosidase expression , or cyo , p{actgfp}jmr1 to identify mutant embryos lacking green fluorescent protein expression . wild - type controls were either nonmutant sibling embryos ( internal control ) or w embryos ( w control ) as indicated in the respective figure legends . c31-mediated transgenesis using landing sites m{3xp3-rfp.attp}zh-86fb or m{3xp3-rfp.attp}zh-68e ( bischof et al , 2007 ) was purchased from bestgene , chino hills , ca . pc31attb1xhisgu was used to obtain m{1xhisgu.wt}zh-86fb ; pc31attb3xhisgu for m{3xhisgu.wt}zh-86fb and m{3xhisgu.wt}zh-68e ; pc31attb3xhisgu.h3k27r for m{3xhisgu.h3k27r}zh-86fb and m{3xhisgu.h3k27r}zh-68e . time - matched embryonic collections were obtained by restricting egg deposition to 30 min with subsequent ageing at 25c . embryos were dechorionated with 50% bleach , fixed in 1:1 heptane/4% paraformaldehyde , 50 mm ethylene glycol tetraacetic acid ( ph 7.4 ) for 20 min and devitellinized in a 1:1 heptane / methanol followed by washes and storage in methanol . after staining , staining was visualized with tcs - sp2 aobs or tcs - sp5 aobsconfocal laser - scanning microscopes ( leica ) . dioxigenin - labelled anti - sense rna probes for his1 , his2a , his2b , his3 and his4 were prepared using standard methods and hybridized to embryos at 57c overnight as described previously ( lcuyer et al , 2008 ) . probes were detected by sheep anti - digoxigenin - pod fab fragments ( 1:300 ; roche ) and signal amplification with tsa cyanine3 reagent ( perkin elmer ) for 40 min . the incorporation of bromodeoxyuridine ( brdu ) was carried out as described previously ( lehner et al , 1991 ) . embryos were air - dried for 5 min , permeabilized in octane for 6 min and incubated in schneider 's medium ( gibco ) with 1 mg / ml brdu ( sigma ) for 15 min at 25c followed by fixation . the incorporation of brdu was included in the ageing period for time - matched embryonic collections . embryos were re - hydrated in phosphate - buffered saline ( pbs ) with 0.1% tween-20 ( pbs - t ) , treated with 2 n hcl for 40 min , washed twice with 0.1 m nabro3 for 2 min and with pbs - t for 15 min . embryos were re - hydrated in pbs with 0.1% triton x-100 ( pbtx ) , blocked for 30 min at room temperature and labelled with primary antibodies at 4c overnight in pbtx and 10% goat serum ( sigma ) . secondary antibody incubation was in pbtx , 10% goat serum for 2 h at 25c . primary antibodies were rabbit cyclin b ( jacobs et al , 1998 ; 1:3,000 ) and chicken -galactosidase ( 1:1,000 ; abcam ) . secondary antibodies were goat anti - mouse igg alexa fluor488 ( 1:400 ; invitrogen ) , goat anti - rabbit igg alexa fluor633 ( 1:400 ; invitrogen ) and goat anti - chicken igy cy3 ( 1:400 ; jackson immunoresearch ) . for fluorescence in situ hybridizations and brdu incorporations , chicken -galactosidase antibody was detected by donkey anti - chicken igy biotin - sp ( 1:500 ; jackson immunoresearch ) followed by vectastainabc ( vector laboratories ) incubation and tsa ( perkin elmer ) detection for 5 min . . pools of six male flies , aged 7 days , were frozen in liquid nitrogen , disrupted with a pestle in 75 l pbs with 0.1% tween-20 ( pbs - t ) containing complete protease inhibitor ( roche ) and lysed by adding 25 l of 4 sodium dodecyl sulphate sample buffer , 5-min incubation at 95c and sonication for 5 min at low power in a bioruptor ( diagenode ) . samples were centrifuged for 15 min , at 14,000 g at 25c and the supernatant was incubated for 10 min at 95c before loading onto 15% polyacrylamide tris / glycin gels . after blotting , nitrocellulose membranes were blocked with 1% bovine serum albumin and 3% dry milk powder in pbs - t at 4c overnight . incubation with primary or secondary antibodies was in blocking buffer for 2 h or 1 h , respectively , at 25c . primary antibodies were rabbit histone h4 ( 1:1,000 ; abcam ) , rabbit histone h2a ( 1:1,000 ; upstate ) , rabbit histone h3 ( 1:20,000 ; abcam ) , mouse histone h2b ( 1:1,000 , abcam ) and mouse -tubulin ( dm1a , 1:2,000 ; sigma ) . secondary antibodies were goat anti - rabbit igg horseradish peroxidase conjugated and goat anti - mouse igg horseradish peroxidase conjugated ( thermo scientific ) . membranes were re - used after stripping with the restore western blot stripping buffer ( thermo scientific ) . mutant embryos homozygous for df(2l)his and carrying two or six transgene - encoded his - gus were identified by lacking green fluorescent protein expression , selected from 22- to 24-h embryo collections , dechorionated , fixed for 10 min in 1:1 heptane / methanol and mounted in 1:1 hoyers medium / lactic acid .

effective patient self - management has been demonstrated to prevent adverse clinical outcomes from diabetes [ 1 , 2 ] . while research has examined factors that influence patient receptivity and use of self - management skills , there has been less attention to the delivery of diabetes education and support in primary care settings , where most patients receive this counseling [ 35 ] . in fact , the quality of diabetes self - management support delivered in primary care falls short of that demonstrated to improve outcomes . delivering even basic diabetes education is challenging to busy primary health clinics , much less providing ongoing support which addresses the many factors influencing patients ' ability to make significant lifestyle changes and integrate complex tasks into their daily lives such as problem - solving , collaboration , psychosocial issues , and behavior change skills [ 3 , 4 , 6 ] . collaborative goal - setting between health care providers and patients has been proposed as a strategy for providing diabetes - related self - management support in busy primary care settings [ 7 , 8 ] . because research suggests that goal - setting increases patients ' self - efficacy and motivation to continue developing and maintaining self - management behaviors [ 911 ] , goal - setting is now a common strategy in the more comprehensive diabetes self - management education curricula reimbursed by the centers for medicare and medicaid services [ 6 , 12 , 13 ] , is an element of quality improvement efforts in primary care , and has been proposed as a measure of clinical quality . however , goal - setting and followup support activities are seldom reported in primary care [ 8 , 15 ] , suggesting that finding cost - effective , feasible means of addressing gaps in goal - setting and followup indicate [ sic ] an important area for quality improvement and diabetes self - management research [ 15 , page 2660 ] . the relative effectiveness of various delivery models for delivering diabetes self - management support ( e.g. , group education and individual counseling ) [ 1619 ] suggests that any number of strategies for delivering diabetes - related goal - setting and followup may be successfully tailored to the resources of individual primary care settings . however , research from implementation science suggests that numerous factors varying between individuals and organizations influence clinicians'/organizations ' decisions to adopt and implement clinical interventions . these include a number of characteristics of the intervention itself such as the legitimacy of the intervention source , strength and quality of the evidence , relative advantage versus alternative solutions , adaptability , trialability , complexity , design quality and packaging , and costs . because of this , it has been argued that the gap between generation of effective interventions and widespread , sustained use in clinical practice can be addressed by strategies that consider how interventions themselves can be adapted to meet the needs of patient populations , structures , personnel , and financial incentives of individual clinic sites while also maintaining the fidelity , or consistent delivery of components necessary for an intervention to be effective [ 21 , 22 ] . since little is known about how best to integrate diabetes - related self - management support into the routine diabetes care provided in community ( versus academic ) health clinics , much less those serving vulnerable ( underserved and underrepresented ) populations , this study tested the usefulness of the replicating effective programs ( rep ) framework to develop a strategy for improving diabetes self - management support , particularly goal - setting and followup support , delivered to vulnerable patient populations in community primary care settings . this study capitalized on academic - community - based partnerships between the iowa center for clinical and translational science , the iowa primary care association ( ipca ) , and four geographically diverse federally qualified community health clinics ( chcs ) located across the state of iowa . in response to preliminary survey results documenting the need for simple strategies for providing diabetes - related self - management support in the four chcs , the development team , which consisted of a university - based research team and four clinic staff members acting as research coordinators in each of the chcs , engaged in a participatory process in order to develop a strategy for incorporating goal - setting and followup support in community primary care settings serving vulnerable patient populations . the process involved continuous discourse within the development team , in - depth interviews with six clinic staff members working in two of the chcs , feedback from local stakeholders and national experts , and development of materials with an instructional design professional ( table 1 ) . the study was approved by the community - based research institutional review board of the university of iowa . the replicating effective programs ( rep ) model , developed in 1996 by the centers for disease control and prevention ( cdc ) to implement hiv - aids behavioral and treatment programs in community - based settings , is an empirical framework combining strategies to maximize both intervention fidelity , or consistent delivery of components necessary for an intervention to be effective , and flexibility , or the ability for individual settings to adapt the intervention to their needs . the rep strategy has been successfully applied to other implementation efforts including violence , substance abuse , and delinquency prevention programs as well as packaging interventions for depression care , suggesting its applicability beyond its initial targeted prevention efforts . because the goal of the rep framework is to ensure successful adaptation and implementation of interventions into nonacademic , community - based settings , we believed it was particularly well - suited for efforts aiming to implement diabetes - related goal - setting and followup support in chcs . the rep model describes four key phases for researchers to consider while attempting to implement a program in nonacademic community settings : preconditions , preimplementation , implementation , and maintenance and evolution . satisfying preconditions entails establishing the need for an intervention , identifying an intervention that addresses the needs of settings ( e.g. , clinics ) as well as the targeted population ( e.g. , patients ) , and identifying barriers to implementation . after the needs of the setting and population have been identified , the rep model suggests implementers develop a strategy to assist sites as they attempt to use the intervention including ( 1 ) clear identification of the intervention 's core elements ( or factors that should not be changed in order for it to be effective ) as well as elements that may help appropriately tailor the intervention to the context of individual sites ( e.g. , the skill sets of available staff and technological resources ) and ( 2 ) an implementation package that , in everyday language , provides concrete information and resources to clinic sites about how to implement the intervention ( e.g. , setup procedures , underlying theory , and scripts ) . the next phase , preimplementation , begins with soliciting input from a community working group about the implementation strategy , which should also include training and technical assistance for clinic sites . based on the feedback of the community working group and experiences of the preliminary test , the implementation strategy is refined and finalized for full implementation ( figure 1 ) . this study focused on satisfying the preconditions and preimplementation phases of the rep in order to develop a strategy for implementing diabetes self - management support focused on providing goal setting and followup support , in primary care settings serving vulnerable populations . during the fall of 2010 , researchers at the university of iowa partnered with clinicians serving as research coordinators in each of the four clinics ( one physician , one nurse , and two health educators ) to begin planning for an intervention to address the needs related to diabetes self - management support in the chcs . guided by the rep framework , this process involved weekly telephone calls and development of a research study incorporating ( 1 ) the recruitment of clinic staff to participate in key - informant interviews focusing on identifying specific needs and barriers related to diabetes - related self - management support , including goal setting and follow - up , in the clinic settings ; ( 2 ) the drafting of a strategy , responsive to the needs of clinicians and staff , to overcome barriers to diabetes - related self - management support ; ( 3 ) the solicitation of input from national content experts related to the implementation strategy ; ( 4 ) the refinement of the strategy with the assistance of an instructional design professional . in 2006 , the university of iowa researchers partnered with the iowa primary care association ( ipca ) and chcs across the state to identify needs that might be addressed through academic - clinic research partnerships . among the topics identified as problematic by primary care leadership was the quality of care being provided to patients with diabetes . to further assess this issue , quality improvement surveys were distributed to both patients and health care providers and revealed a high level of diabetes burden in these clinics , variability in the nature of diabetes - related self - management support provided by clinicians , and a lack of self - management support perceived by patients . results of these surveys , as well as input from the ipca , clinic leadership , and research coordinators , suggested that the four chcs would be well - served by an intervention aiming to improve the consistency and quality of diabetes self - management support given to patients . informed with the aforementioned survey results , the university - based research team examined interventions aiming to facilitate diabetes self - management support in primary care settings . because of its reliance on a simple strategy for establishing goal - setting and followup support , the university - based research team believed that the previously developed living with diabetes patient materials and associated intervention [ 25 , 26 ] would fit the needs of the four clinic settings . the living with diabetes ( lwd ) intervention consisted of low literacy patient materials coupled with a goal - setting session and two followup calls by research assistants . both the guide and intervention were developed through a participatory process with diabetes patients and providers and were seen as responsive to the need for a simple , adaptable strategy for use in primary care . because the materials were developed with vulnerable patient populations and focused on providing information to those with limited literacy skills in both english and spanish , the intervention appeared well - suited for use in chcs . an evaluation of lwd showed that the intervention resulted in successful development of goals by patients , increased self - efficacy , self - care behaviors , diabetes - related knowledge , and reductions in diabetes - related distress [ 25 , 26 ] . because the intervention involved approximately 10 minutes of patient contact per session and sessions were successfully conducted by nonclinician research associates , the research team believed it might be readily adapted to the needs of different chc settings . the patient materials and associated information is available through the american college of physicians foundation ( see http://www.acpfoundation.org/materials-and-guides/patient-guides/guide-products/living-with-diabetes.html ) . in order to ensure that the objective of the lwd intervention met the needs of the chcs , the university - based research team presented the intervention and associated materials to the clinic research coordinators , chc medical directors , and ipca medical director and staff . this process was accomplished through in - person , telephone , and email conversations as well as during in - person presentations during which the tenets of the intervention and potential logistics were discussed . the research coordinators and ipca representatives responded enthusiastically to the potential intervention , believing it would help address the needs of their colleagues and provide a good resource for both english and spanish speaking patients . between april and may 2011 , six in - depth interviews were conducted with clinic staff members ( 2 arnps , 1 pa , 1 pharmd , 1 rd , and 1 mph - quality director ) to begin developing a strategy for implementing the lwd and in the four participating chcs . during these hour - long interviews , participants were asked about their practice and that of their colleagues related to diabetes self - management education , including the barriers and facilitators , materials and methods they use , and their feelings about the approach of the living with diabetes guide and goal - setting strategy . these interviews suggested ( 1 ) that clinicians do not use particular behavioral counseling strategies to facilitate goal - setting , ( 2 ) a belief that successfully communicating the nature of diabetes and its risks to patients is sufficient for patients to make behavior changes , and ( 3 ) that goal - setting has been a priority in the past but has not been maintained due to support staff turnover or completing duties for support staff assigned with the task . when asked about means of implementing the counseling into their practice settings , participants liked the idea of goal - setting but strongly believed that primary care providers had to play a major role in establishing and following up on patient goals rather than handing off responsibility for doing so to support staff . they all reported that the clinics were in the midst of implementing use of electronic health records ( ehrs ) , so that incorporating goal - setting might be seen as an overwhelming task by their colleagues . however , they also reported that , unlike paper - based systems that were not sustainable , ehrs could help facilitate tracking of patient goals and follow - up . finally , related to the training of healthcare providers in the use of the proposed lwd intervention , participants reported that the training would have to be engaging , time - limited , and presented in a way that would facilitate commitment . participants believed that the use of goal - setting in the past was met with variable enthusiasm and foresaw that making it clear that the intervention addressed their challenges rather than adding to them would be helpful in getting providers to participate . they reported that previous interventions were influenced by those charged with implementation and believed having an esteemed colleague presenting the intervention during a group meeting of primary care providers would be most effective at winning support . following the rep framework and based on the key informant interview findings , the opinions of the academic and community - based research team ( i.e. , the development team ) and expert opinion ( e.g. , nationally recognized diabetes education , practice change , and implementation experts ) , the rep preimplementation activities include orienting settings to the intervention , explaining core elements , customizing delivery , logistics planning , staff training , and ongoing technical assistance . the core research team decided to incorporate these activities into a participatory process of developing the implementation package . the implementation package includes content to be used by a program champion a clinician - colleague charged with the role of facilitating use of the intervention and training materials to be used by clinicians and support staff engaged in diabetes care . the content also includes setup procedure , underlying theory and logic flow , scripts , and options for adapting the delivery of intervention core elements to local organizations in a way that does not compromise core elements , or means of ensuring intervention fidelity . because of the desire to develop a package appropriate for larger scale dissemination efforts and because clinicians communicated the need for time limited and interactive elements , the university - based research team ( after confirming the availability of the technological capacity in the chcs ) embarked on a process of organizing , tailoring , and developing content that is primarily web - based , including informative videos , checklists , interactive tutorials , and means of facilitating ongoing contact and support by the university - based researchers ( table 2 ) . the first element to be addressed by the implementation package is to orient sites to the tenets of the intervention . a number of means of accomplishing this task were discussed . however , because clinic staff members reported a need to facilitate commitment through a group presentation , the university - based research team decided to develop a voiceover presentation which highlighted ( 1 ) that the intervention was developed by an interdisciplinary team of clinician - researchers to address the frustrations of clinicians and patients around diabetes management ; ( 2 ) the basic tenets of the intervention ; ( 3 ) how it might be adapted to different clinic resources . because clinician interviews communicated the potential of clinic sites to feel overwhelmed by changes introduced by the introduction of ehrs , the development team felt it particularly important to incorporate content strongly communicating that the intent of the intervention is to assist clinicians in their practice , particularly with their quality improvement efforts , rather than simply providing one more thing to do . the resulting product is a hybrid video - slide show introduction that is intended to be used by program champions during a group presentation to their colleagues . in addition , content about how to resolve possible technical difficulties that could be encountered when attempting to screen the presentation is included in the program champion materials . the second element to be addressed by the implementation package is to provide an explanation of the intervention 's core elements , or those key to its effectiveness . although the lwd intervention was intended to be adapted to the needs of individual settings , the research team concluded that its core elements included ( 1 ) an initial in - person goal - setting session for which the hardcopy living with diabetes guide reinforces and provides information for patients to take home and ( 2 ) two followup support sessions . followup support may be provided in - person or via telephone [ 2527 ] . because clinic staff members believed that supporting education and counseling by primary care providers was a key barrier to overcome but felt strongly that diabetes self - management support is most meaningful to patients if delivered by primary care providers and reinforced by other members of the health care team , the team focused on developing intervention trainings targeting primary care clinicians . however , the team also kept a broader audience in mind to facilitate use by other staff members should the clinic believe that others ( e.g. , nurses and health educators ) should be involved with the patient goal - setting and followup process . the result is a module called guiding principles that is used to begin ( and is used as a reference during ) interactive trainings instructing those involved in diabetes care in how to engage patients in goal - setting and in the use of the hardcopy living with diabetes patient booklet . according to the rep process , customizing delivery of an intervention involves tailoring it to the needs of specific patient populations and clinic settings . because the lwd materials and goal - setting process were developed and tested in academic settings serving vulnerable patient populations , both the academic research team and clinic - based coordinators felt it was well suited for both english - and spanish - speaking patients served by the chcs . further , because the goal - setting process is meant to facilitate the creation of personal goals with the help of care providers , the team felt the intervention was responsive to patients ' desire for interventions customized to their personal needs as well as to the needs of primary care clinicians who have communicated a high level of frustration with behavior change counseling [ 24 , 27 ] but as reported by the clinic staff members during interviews are without a formal strategy with which to engage and support patients . a key element of the rep process is attempting to maintain an intervention 's effectiveness upon dissemination to a new setting by preserving key elements of its success while allowing for adaptation to the context ( e.g. , staff , resources , competing priorities , and patient population ) of specific clinic settings . therefore , content in how the lwd intervention might be adapted to chc settings in a way that maintains elements key to its effectiveness was developed for those taking on the role of program champion . the content includes ( 1 ) how an initial goal - setting session might be conducted and ( 2 ) how followup contact by primary care provider and/or clinic support staff might be accomplished during routine care for patients with diabetes . however , after feedback of national experts and stakeholders , the university - based research team recognized that the logistics of implementing the intervention also involves the fine art of facilitating organizational change . therefore , the team sought additional resources to support program champions in the complex task of planning and implementing the intervention within their clinic settings . because of its public availability and comprehensive steps for program champions to consider when implementing an intervention in a new setting , the university - based research team decided to adapt the implementation tools put forth by the teamstepps program , which is a collective effort between the agency of healthcare research and quality and the department of defense to improve patient safety ( see http://teamstepps.ahrq.gov/about-2cl_3.htm ) . the teamstepps materials outline steps for planning and implementing a patient safety program , including sections on conducting a needs assessment , planning , training , and implementing . details regarding planning for change , gaining leadership commitment , communicating a plan , final preparation , training , and implementation were believed most germane to this phase of the rep framework and to implementing the lwp in the chcs . details for each of these steps were made specific for the goal - setting intervention and patient materials and described in ( 1 ) an in - depth online presentation and ( 2 ) a checklist , both of which are intended for program champions . program champion checklist : completion date map current information , processes , and available resources for diabetes self - management support in your clinic . identify methods of tracking patient goals in your clinic . in an emr , other tracking systems and/or . are there additional support needs related to functioning as a team ? are there areas where communication between team members needs to improve before patients ' behavioral goals can be tracked ? state in one sentence what will be achieved , who will be involved ( whose behavior will change ) , and when and where the change will occur . for example , all primary care clinicians will begin using the living with diabetes counseling strategy and materials with diabetes patients , and tracking behavioral goals in a new emr field , beginning on february 1 . 80% of patients with diabetes have a behavioral goal . of patients who have received the materials , action plans / goals set and/or progress recorded for 75% of diabetes patients seen during march . some examples of clinical outcome goals . when and how will the program be introduced to the clinic ( i.e. , during a group meeting ) ? determine how long clinicians and staff will be given to complete training and , after they are introduced to the training , when the patient materials can start being used ? map current information , processes , and available resources for diabetes self - management support in your clinic . identify methods of tracking patient goals in your clinic . in an emr , other tracking systems and/or . designating one person to followup on patient goals . in an emr , other tracking systems and/or . are there additional support needs related to functioning as a team ? are there areas where communication between team members needs to improve before patients ' behavioral goals can be tracked ? are there areas where communication between team members needs to improve before patients ' behavioral goals can be tracked ? state in one sentence what will be achieved , who will be involved ( whose behavior will change ) , and when and where the change will occur . for example , all primary care clinicians will begin using the living with diabetes counseling strategy and materials with diabetes patients , and tracking behavioral goals in a new emr field , beginning on february 1 . state in one sentence what will be achieved , who will be involved ( whose behavior will change ) , and when and where the change will occur . for example , all primary care clinicians will begin using the living with diabetes counseling strategy and materials with diabetes patients , and tracking behavioral goals in a new emr field , beginning on february 1 . 80% of patients with diabetes have a behavioral goal . of patients who have received the materials , action plans / goals set and/or progress recorded for 75% of diabetes patients seen during march . 80% of patients with diabetes have a behavioral goal . of patients who have received the materials , action plans / goals set and/or progress recorded for 75% of diabetes patients seen during march . 80% of patients with diabetes have a behavioral goal . of patients who have received the materials , action plans / goals set and/or progress recorded for 75% of diabetes patients seen during march . when and how will the program be introduced to the clinic ( i.e. , during a group meeting ) ? determine how long clinicians and staff will be given to complete training and , after they are introduced to the training , when the patient materials can start being used ? when and how will the program be introduced to the clinic ( i.e. , during a group meeting ) ? determine how long clinicians and staff will be given to complete training and , after they are introduced to the training , when the patient materials can start being used ? ( 2 ) gain leadership commitment completion date inform leaders of all facets of the plan . how will clinical processes be used to implement the living with diabetes counseling strategy ? how the living with diabetes program be introduced to the clinic ? who will be involved ? inform leaders of all facets of the plan . how will clinical processes be used to implement the living with diabetes counseling strategy ? how the living with diabetes program be introduced to the clinic ? who will be involved ? how they will be trained ? how will clinical processes be used to implement the living with diabetes counseling strategy ? how the living with diabetes program be introduced to the clinic ? who will be involved ? ( 3 ) communicate the plan completion date communicate the goals of the living with diabetes program during a group meeting . describe the detailed plan for using the patient materials during routine care , including concrete details of . where the materials will be located . who is involved what emr fields ( if any ) are used for tracking patient 's action plans . details of the online training modules outlining how to use the materials and set behavioral goals with patients . make use of the interactive tutorial . for example , if using clinical information systems , screen shots of new fields added or how to use existing fields are extremely helpful . clearly identify where colleagues should go if they are having difficulty using the online training , patient materials , or tracking patient action plans . describe the detailed plan for using the patient materials during routine care , including concrete details of . where the materials will be located . who is involved what emr fields ( if any ) are used for tracking patient 's action plans . details of the online training modules outlining how to use the materials and set behavioral goals with patients . make use of the interactive tutorial . describe the detailed plan for using the patient materials during routine care , including concrete details of . where the materials will be located . who is involved what emr fields ( if any ) are used for tracking patient 's action plans . where the materials will be located . what emr fields ( if any ) are used for tracking patient 's action plans . details of the online training modules outlining how to use the materials and set behavioral goals with patients . make use of the interactive tutorial . for example , if using clinical information systems , screen shots of new fields added or how to use existing fields are extremely helpful . for example , if using clinical information systems , screen shots of new fields added or how to use existing fields are extremely helpful . for example , if using clinical information systems , screen shots of new fields added or how to use existing fields are extremely helpful . clearly identify where colleagues should go if they are having difficulty using the online training , patient materials , or tracking patient action plans . refine the implementation plan regarding use of the patient materials , counseling strategy , followup of patient action plans , and training completion date send email invitations to targeted clinicians and staff directing them to the online training , including a reminder of . where materials are located . concrete deadlines for completing the training . send email invitations to targeted clinicians and staff directing them to the online training , including a reminder of . where materials are located . concrete deadlines for completing the training . where materials are located . how goals are tracked . the next step in the implementation package as suggested by the rep framework is the development of the staff training or , in this case , the training of clinicians and associated staff in how to couple the living with diabetes patient guide with a goal - setting process with patients . based on the need for short , relevant , and engaging trainings to fit into a hectic workday , the instructional designer developed an interactive , web - based tutorial based on the clinical experiences of ( 1 ) the clinician - researchers who developed the living with diabetes materials and intervention ; ( 2 ) the research assistants who conducted the original intervention study using the living with diabetes patient guide ; ( 3 ) the research coordinators working in the chc sites . the module , which is also informed by the intrinsic motivation model advanced by malone and lepper , interactively demonstrates how to work with low - literacy patients , common barriers to a successful goal - setting session ( e.g. , patients setting behavior change goals that are too large to fit into their lifestyle ) , and challenges clinician assumptions by using informal assessment techniques ( e.g. , feedback for incorrect choices ) . through this simulation , clinicians practice preferred intervention strategies and , more importantly , work past common barriers to support behavior change in patients . the interactive tutorial also simulates a role - playing exercise that could be practiced during an on - site workshop . moving through the modules takes approximately 20 minutes but , because of its interactive nature , the time required for training is highly variable and can be completed at once or incrementally . the interactivity of the tutorial also enables the development team to track clinician use of training materials and collect feedback from clinicians , with permission from the clinician , to help the team improve the web - based curriculum in future iterations . according to the rep framework , the final step in the preimplementation phase is to develop means of providing ongoing assistance to clinic sites regarding the use of the intervention . this process should be proactive , in which sites are contacted routinely and prompted for questions and concerns . for next steps related to this particular study , during the implementation phase , program champions in the four clinics involved in the development process will be routinely contacted for questions , concerns , and lessons learned . in broader dissemination efforts , this process could be facilitated by having those who use the online resources disclose their name , contact information , and the dates during which they intend to begin using the intervention . in addition , while not proactive , the web - based resources display the core research team 's email contact at all times . all correspondence occurring through this channel will be tracked by the research team , with the goal being a response within 48 hours . finally , while not a part of the definition of technical assistance as intended by the rep framework , two additional forms of needed support were identified and content was developed as a result of piloting the program champion and clinician - staff tutorials . this content relates to the possible technical problems that might be encountered while using the online resources and steps to address these should they arise and is readily accessible on the program champion and clinician - staff training websites . the rep offered a useful framework for providing guidance toward the development of a strategy to successfully implement a diabetes self - management support intervention incorporating goal - setting and followup support in chcs . using the rep to guide the development process called attention to several barriers and facilitators of implementation that may not have otherwise been explicitly addressed . that said , the process of engaging a diverse stakeholder group and soliciting in - depth opinions of clinic staff members not only added detail to the framework , but also uncovered additional areas in need of significant attention , particularly related to facilitating practice changes by program champions . an example of an area that might not have been emphasized without the rep framework , but one for which additional content was uncovered by the iterative development process , was the need to provide ongoing technical assistance on the web - based technology to clinic sites . according to the rep framework , technical assistance is expert support related to use of the intervention itself . to this end , a great deal of thought was put into prompting the program champions as well as tracking questions and suggestions as we move into the next rep phase of formally implementing the goal - setting and followup support intervention in clinic settings . however , an additional element of technical assistance was uncovered by the development team and stakeholders as they tested the web - based content and , at varying degrees , encountered difficulties using the technology . as a result , content providing instruction to both program champions and those using the tutorial about how to address potential technological issues was developed . as anticipated , interviews with clinic staff uncovered a number of areas that had to be addressed during training . first and foremost , the training needed to deliver key content in a way that was readily accessible , engaging , and time - limited . however , we were unclear whether this content should target primary care clinicians or support staff . results of interviews with clinic staff strongly suggested the need to target primary care providers themselves , with support staff taking a secondary role in the goal - setting and followup provided to patients . however , less obvious was the amount of effort that would have to be dedicated to support those who are largely charged with the role of implementing the intervention , or the program champions . while the rep process itself is meant to facilitate commitment from a number of stakeholders , it is less explicit about means of accomplishing this at the clinic level , where the program champion is attempting to influence change . finding methods of accomplishing the work of an intervention within busy primary care clinics is a primary challenge of any implementation effort , but interviews with clinic staff also supported a growing body of research documenting that gaining the support of those carrying out the intervention is a significant , if not the most significant , element in successfully implementing practice changes . it appeared to the development team that the teamstepps curriculum , if adapted to the particulars of the intervention , would add adequate structure to the training and support of program champions . interviews with clinic staff revealed that any implementation effort in primary care is done in the extremely hectic milieu of busy practice settings . in the case of this intervention , two factors appear to work in favor of the diabetes goal - setting intervention ( 1 ) that goal - setting is seen as a measure of clinical quality for a number of payers and accrediting bodies and ( 2 ) that , while implementation of electronic medical records is currently burdensome to clinic settings , they will likely provide means of implementing and sustaining goal - setting in the chcs . however , this speaks to the importance of steps outlined in the preconditions phase of the rep framework that help ensure that a given intervention addresses the needs of a population and that well - informed stakeholders ( i.e. , clinicians ) believe it can be implemented . there are numerous areas by which the process of developing the implementation strategy might be improved . the development process would have benefitted greatly from additional information regarding how to best support the role of program champion . this might have been accomplished by asking additional questions of the clinic staff members who were interviewed , or by recruiting additional participants who have been charged to making practice changes in the past . while we attempted to address this omission by incorporating and adapting content from the teamstepps program , which is based on extensive work conducted by ahrq and the dod , we are yet unclear whether this element will fully address the needs of the program champions as they attempt to implement this intervention . those examining the development process will also notice that the voice of patients is absent . while we believed that the formative work conducted during the lwd intervention itself adequately captured the opinions of patients , the clinic staff who were interviewed communicated that patients are likely to respond best to primary care providers emphasizing the creation of goals . because feasibility testing of the original lwd intervention used nonclinician research assistants for the counseling process , it is unclear how patients may respond to primary care clinicians using the intervention materials and process . we will better understand whether ( and how ) our efforts successfully support program champions and target the appropriate clinic personnel following the testing of the implementation process . increasing recognition of the translational gap between efficacious interventions and their widespread adaptation and use in routine clinical practice has led researchers to more systematically examine the contextual and organizational factors likely to influence implementation . in this study , we used the rep framework to guide the development of a strategy to implement a diabetes self - management intervention in community health center primary care settings . our findings , reported here in relation to the first two rep phases of preconditions and preimplementation , demonstrate the benefit of relying on a structured approach to guide this process . researchers considering the use of rep or other such frameworks may also consider the need to maintain flexibility as variations in contextual factors will likely influence both the approach and decisions about resource allocation . lastly , as the evolving field of implementation science matures , it will be important for researchers to report their experiences as a way to further refine both overall protocols and specific strategies to enhance translational efforts .

vocationally educated licensed practical nurses ( lpns ) who enter an online university to upgrade their credentials by earning a bachelor of nursing ( bn ) degree can find the experience of socializing into a new and more complex professional role challenging [ 1 , 2 ] . professional socialization is the process of learning a professional role and emerging as a member of an occupational culture . a key element within the overarching process of professional socialization is legitimation or the experience of gaining a sense of affirmation from socializing agents [ 4 , 5 ] . traditionally , opportunities for transitioning between vocational colleges and universities were limited [ 68 ] . although few universities offer bridging programs for licensed practical nurses , participants in the present study attended a new program where they were awarded prior academic credit for their previous nursing credential . graduates of the bridging program go on to write the canadian registered nurse ( rn ) qualifying exam . to date , educational research examining this group of nurses is limited . this paper describes findings from a qualitative descriptive study that investigated the professional socialization experiences of 27 post - lpn to bn students . although most of the nurses ' courses are offered online and are completed independently at their own pace , small groups of lpn to bn students do meet face to face for required practicum experiences . the practicum experiences are only offered in two canadian cities , and students are required to travel to these locations for four - week periods . over a period of two university terms , our project facilitators conducted focus group discussions with four different groups of students attending practicums . post - lpn to bn students are required to complete one year of full - time experience as lpns before they are admitted to the program . participants in our focus groups were in their final cluster of required courses . by explaining students ' perceptions of the legitimation experiences and socializing agents that helped them feel as though they were becoming registered nurses , we offer important insights for university educators who teach this new group of adult learners . insights into the experiences that post lpn to bn students themselves believe are affirming to their professional socialization can help educators facilitate clinical learning experiences that are relevant and meaningful . socialization is a process where individuals acquire a personal identity and learn the values , norms , behaviors , and social skills appropriate to their social positions . professional socialization is a process by which persons acquire the knowledge , skills and disposition that makes them more or less effective members ( of a profession ) and a subconscious process whereby persons internalize behavioral norms and standards and form a sense of identify and commitment to a professional field it includes the formation of an individual professional identity , where students come to view themselves as members of a profession with the knowledge and responsibilities which attend membership . the process includes both the intended and unintended consequences of an educational program , the informal implicit aspects of a hidden curriculum that can be more powerful than the manifest or official curriculum , and the preprogram attitudes that are important agents of socialization . in social work , the process can include only limited changes in students ' preprogram preferences and the value and attitude dimensions have been identified as difficult to measure . in physical therapy , the process is highly influenced by interactions with peers and faculty , by legitimation from socializing agents such as patients and clinical instructors , and by communication with practitioners . in nursing education , previous research has examined professional socialization among select groups of student nurses , for example , traditional undergraduate nursing students [ 19 , 20 ] , undergraduate students specializing in community nursing , accelerated after degree students , male students , and students in distance programs . further , the experiences of select groups of registered nurses who upgrade their credentials have been explored . for example , upgrading to nurse anaesthetist ; to nurse practitioner [ 26 , 27 ] , and to advanced practice nurse . finally , the legitimacy of nursing as an academic discipline has been examined . although an abundance of literature on professional socialization exists , there is a gap in our understanding of the experiences of vocationally educated nurses who attend university to earn their registered nurse ( rn ) credential . kearney - nunnery explained that licensed practical nurses are socialized to collect client data and decide who needs to be informed , while university educated registered nurses are socialized to synthesize client data and make independent decisions ( page 19 ) . given the differences in role socialization between these two groups of nurses , when lpn to bn students undertake a mainly self - paced online curriculum , it is particularly important to examine the socializing agents that strengthen their feelings of legitimation when they meet faculty , peers , and patients face to face . legitimation , a critical element within the process of professional socialization , occurs when those around learners affirm that they are actually developing an identity as a member of their chosen profession . ritual ordeals and people can all serve as valuable socializing agents during learners ' experiences of legitimation . as students are professionalized , they are initiated into a new culture wherein they gradually adopt those symbols which represent the profession and its generally accepted authority . these symbols ( language , tools , clothing and demeanour ) establish , identify and separate the bearer from the outsider , particularly from the client and the paraprofessional audience ( page 54 ) . in haas and shaffir 's view , early manipulation of these symbols of legitimization heightens identification and commitment to the profession ( page 70 ) and more importantly actually changes the neophytes ' own perception of ( self ) traditional symbols of legitimization in health care fields included white laboratory coats for medical students and white caps for nursing students . today , name badges remain one of the few symbols of authority and legitimation that health care professionals continue to use as socializing agents . it is important to note that in the post lpn to bn program , students ' name badges do not include the identifier of registered nurse . practitioners and patients who are not familiar with the program may not understand that post lpn to bn students are experienced licensed practical nurses developing new professional identities as registered nurses . ritual ordeals such as personal admission interviews , semester - based courses , and scheduled examinations for cohort groups also serve as socializing agents that bolster feelings of legitimation among learners in the health care fields . here again , students in the post lpn to bn program do not participate in these benchmarking rituals . their admission process did not include interviews , and they completed courses and examinations online at their own pace . their only opportunity to meet faculty in person and join a cohort group was during their clinical practicums . finally , people such as faculty , peers , patients , and practitioners are important socializing agents that reinforce legitimation [ 4 , 5 , 17 , 18 ] . faculty evaluations of student progress and learning experiences that are new and different provide students with affirmation that they are progressing towards being granted professional legitimation and status . as dall'alba emphasized learning to become a professional involves not only what we know and can do , but also who we are becoming ( page 34 ) . as part of an overarching program of research examining post lpn to bn transitions , our research team questioned how post lpn to bn students perceived their own processes of professional socialization and the kinds of formal and informal socializing agents of legitimation that contributed to or distracted from their growing identity as registered nurses . this qualitative descriptive project was framed from a constructivist worldview [ 3234 ] and haas and shaffir 's sociological theory of professionalization . haas and shaffir theorized that legitimation is a central concept in healthcare professionals ' process of socialization . participants were 27 post lpn to bn students from a canadian university who attended a practicum on an acute hospital unit . the main purpose of the research was to describe post lpn to bn student nurses ' experiences with professional socialization as they transitioned into a more complex nursing role . a secondary purpose of the research was to begin to understand how university faculty can best support and facilitate these students ' professional socialization as they learn to become registered nurses ( rns ) . data sources included four face - to - face digitally recorded , transcribed focus group discussions which were analyzed for themes . our rational for collecting and analyzing focus group data centered on our intention to invite our participants to converse and interact in ways that stimulated new insights . focus group methodology , with its emphasis on group interaction [ 3539 ] and goal of collaborative discussion [ 40 , 41 ] , allowed us to draw out participants ' views and to explore their ideas and conversational exchanges with one another in depth . focus groups are a rich source of information and a valid method of generating data within a constructionist epistemology where knowledge is created in situated , [ collective ] encounters when focus group data has been collected from multiple groups and multiple sites , researchers can have increased confidence in the reliability and validity of the findings . perceptions of professional socialization . what comes to mind when you hear the phrase professional socialization ? share memories of your experiences becoming socialized into the role of licensed practical nurse and developing your identity in this role . how is the experience of developing your new role and identity as a registered nurse the same ? how is it different ? what comes to mind when you hear the phrase professional socialization ? share memories of your experiences becoming socialized into the role of licensed practical nurse and developing your identity in this role . how is the experience of developing your new role and identity as a registered nurse the same ? how is it different ? talk about experiences you have had so far in your online university classes where you felt like a registered nurse and not a licensed practical nurse ? have there been times in your online university classes where you haven't been sure about what it feels like to be a registered nurse ? talk about experiences you have had so far in your practicums where you felt like a registered nurse and not a licensed practical nurse ? have there been times in your practicums where you haven't been sure about what it feels like to be a registered nurse ? talk about experiences you have had so far in your online university classes where you felt like a registered nurse and not a licensed practical nurse ? have there been times in your online university classes where you haven't been sure about what it feels like to be a registered nurse ? talk about experiences you have had so far in your practicums where you felt like a registered nurse and not a licensed practical nurse ? have there been times in your practicums where you haven't been sure about what it feels like to be a registered nurse ? informal experiences ( employer requirements , workplace interactions , and existing professional lpn commitments ) . what have employers and colleagues at your workplace said or done that contributed to your feeling like a registered nurse ? what distracted ? how do your existing professional licensed practical nurse commitments contribute to your process of becoming socialized into the role of registered nurse ? how do they distract ? talk about the sorts of things that are going on in your life with family and friends that impact your changing role and professional identity . what have employers and colleagues at your workplace said or done that contributed to your feeling like a registered nurse ? what distracted ? how do your existing professional licensed practical nurse commitments contribute to your process of becoming socialized into the role of registered nurse ? how do they distract ? talk about the sorts of things that are going on in your life with family and friends that impact your changing role and professional identity . our research team thoroughly read and reread the transcripts and met regularly to develop a systematic process of thematic analysis . we used investigator triangulation [ 49 , 50 ] to create and agree upon the categorizations and coding schemes that led to our themes . equivalence was achieved through the use of two experienced moderators with complementary styles to achieve flow , texture and context and to promote construct validity ( page 302 ) . credibility was strengthened through sustained engagement and observation over the course of four focus groups , researcher triangulation , debriefing as a research team , and member checking . reflexivity , where researchers strive to understand their own experiences as well as the research question , in order to remain objective , neutral , and nonbiased , was supported through regular face - to - face and teleconference meetings . dependability was attained by recording a log of our plans , meetings , and ongoing interpretations . using annotation and memo functions , tracking individual responses in addition to the group account assisted us in avoiding the risk of analyzing data from only vocally dominant members of the groups . field notes or descriptions of participants , impressions related to the discussion ( and ) observations related to group dynamics ( page 85 ) maintained by both moderators during and immediately following the sessions further increased the dependability of our findings . practical issues such as organizing groups at a time and place to minimize disruption and avoiding power differential dynamics were addressed . the groups were held when participants , who were normally separated by distance , were together in the same city for a required practicum experience . they were held at change of shift in lieu of a post conference . knowing the power differential between students and teachers , moderators who did not have teaching responsibilities in the post lpn to bn program were chosen to facilitate the focus groups . instructors were not present during any of the discussions and had no involvement with the transcript data . participants were recruited through a letter of invitation sent via email by a research assistant who was also not involved with the program . we reasoned that this may have been because they were all from out of town and appreciated an opportunity to interact and share their views . first , post lpn to bn students need little , if any , further legitimation to affirm their identities as nurse . second , practicum interactions with instructors and new clinical experiences are key socializing agents . without exception , participants in this project all commented on how they felt as though their identity as a nurse was well established before they entered the post lpn to bn program . when invited to discuss memories of times when they felt affirmed in their identity as a nurse , several participants commented on skills they mastered in their practice as lpns , for example : when i gave my first injection that was like i'm a nurse ! when i gave my first injection that was like i'm a nurse ! i know it 's the silliest thing , but doing the hospital corners for me was very sentimental i felt very nursy . the gross stuff - wounds . the gross stuff - wounds . participants discussed how others ' expressions of trust in their knowledge also legitimized their identity as nurse : collaborating with the physicians . at my work , i would say i need this ordered , dr and and then it seems like i make the decision and i just need his signature . collaborating with the physicians . at my work , i would say i need this ordered , dr and and then it seems like i make the decision and i just need his signature . when the client would appreciate the care that you provide them , and also the family . they will speak with you and then thank you for whatever you did . when the client would appreciate the care that you provide them , and also the family . they talked about opportunities where demonstrating professional authority in their workplace further established their identity as nurse : working your first night shift in your new role . the culture of night shift working your first night shift in your new role . the culture of night shift it 's different . the first time i cared for a palliative patient and was there when they passed . talking with the family . my first job that i had as an lpn , i was alone on the floor as the only official nurse for more than half of my shift . i had the full responsibility of all 60 residents in my care that all happened as an lpn . the first time i cared for a palliative patient and was there when they passed . talking with the family . my first job that i had as an lpn , i was alone on the floor as the only official nurse for more than half of my shift . i had the full responsibility of all 60 residents in my care that all happened as an lpn . from the post lpn to bn students ' perspective , the notion that socialization into the role of nurse would occur for them at this point in their career was insulting : i almost feel a little bit insulted to think that i would feel any less professional as an lpn than i do as an rn . i almost feel a little bit insulted to think that i would feel any less professional as an lpn than i do as an rn . my buddy nurse actually asked me if i ( implemented treatment ) and i was like , i have done this before ! my buddy nurse actually asked me if i ( implemented treatment ) and i was like , i have done this before ! ( it 's ) very frustrating and almost devalues the work that i 've already put into the profession . ( it 's ) very frustrating and almost devalues the work that i 've already put into the profession . ( in one course ) the textbook was the exact same textbook that i used in my lpn course . i found that so frustrating because i thought , i 've read this textbook already . ( in one course ) the textbook was the exact same textbook that i used in my lpn course . i found that so frustrating because i thought , i 've read this textbook already . in sum , post lpn to bn students in our study expressed that they already viewed themselves as professional nurses . one nurse offered this advice to those involved with educating this group of learners : it 's extremely important when you are an adult learner to be treated as such . when you disregard our previous skill and knowledge , it 's a blow to our ego , it 's degrading . when participants in this study reflected on changes and growth in their professional identity , it was the practicum interactions with instructors and the opportunities for new experiences that stood out for them as particularly meaningful . students consistently emphasized that they viewed the lpn and rn roles as similar during the focus group discussions . during the practical components of their program , it was especially important to receive legitimation from others that they were truly extending their existing nurse identity . many students expressed that they did not feel different : i think what 's changing is how other people look at you more than how i feel , how other people treat you and how willing they are to give you responsibility versus how i ever felt . i think what 's changing is how other people look at you more than how i feel , how other people treat you and how willing they are to give you responsibility versus how i ever felt . people are willing to give you more responsibility because you are going through the rn program . people are willing to give you more responsibility because you are going through the rn program . i 've noticed it 's more external in how people treat you versus how you feel . i 've noticed it 's more external in how people treat you versus how you feel . instructors expected students to demonstrate a capacity to seek out new and relevant information and frequently questioned them about their patients . when our participants felt that they responded well , they expressed a tentative willingness to risk identifying more with the rn role : i find coming into this program , you need to justify everything that you 're doing and explain the reason for it . it makes you think more about your reasons for doing something and whether you can justify them well enough to , you know , proceed to doing care . and i think maybe that 's because you have somebody who 's constantly challenging you to prepare . so if you can give a good answer , you know okay , i 'm on the way . what can i do better ? if you can not answer the questions , then you 're challenged to go and maybe research a little bit better so you do not feel , oh , i did not answer that question very well . i find coming into this program , you need to justify everything that you 're doing and explain the reason for it . it makes you think more about your reasons for doing something and whether you can justify them well enough to , you know , proceed to doing care . and i think maybe that 's because you have somebody who 's constantly challenging you to prepare . so if you can give a good answer , you know okay , i 'm on the way . if you can not answer the questions , then you 're challenged to go and maybe research a little bit better so you do not feel , oh , i did not answer that question very well . i think one thing that i find myself doing more just in this role is just researching because they put such an emphasis on that that i find myself looking everything up , so that 's one thing that i 've changed in my practice is i look things up more . i think one thing that i find myself doing more just in this role is just researching because they put such an emphasis on that that i find myself looking everything up , so that 's one thing that i 've changed in my practice is i look things up more . well , as an lpn and an rn , it 's our professional responsibility to have continuing competence and learning , so has taking the rn program taken me farther than i would have taken myself as an lpn ? i still should have and would have been doing that as an lpn . going through this program has forced me to [ research patient conditions ] because we have homework every night to do , so maybe it 's a little bit more forced learning but . well , as an lpn and an rn , it 's our professional responsibility to have continuing competence and learning , so has taking the rn program taken me farther than i would have taken myself as an lpn ? i still should have and would have been doing that as an lpn . going through this program has forced me to [ research patient conditions ] because we have homework every night to do , so maybe it 's a little bit more forced learning but . instructors have been really good about asking you questions and getting you to think or why is this being done , and why would you think that you would do this ? and what would you do if this happened ? ( they ) kind of encourage and draw out of me that way of looking at the whole picture . instructors have been really good about asking you questions and getting you to think or why is this being done , and why would you think that you would do this ? and what would you do if this happened ? ( they ) kind of encourage and draw out of me that way of looking at the whole picture . opportunities for new experiences supported participants ' sense of gaining a more complex nursing identity . they identified the topic areas where they gained the most new knowledge as acute care , research , leadership , psychiatric mental health , and community nursing . describing her opportunity to attend an intensive care unit ( icu ) , one participant described how the prospect of interacting more with this patient group contributed to her growing identity as an rn : i went to icu today , and like the whole day i was like wow ! i already work and feel confident in ( acute care ) i would have loved to ( complete the practicum in icu ) . similarly , another participant described how she learned of a community resource which distributed milk to the needy and was able to refer her patient : after seeing what 's out in the community . it 's nice to see that nursing is the ( profession ) that does that ! you help one person , but in community nursing , you 're talking whole communities and populations , and like a long life span too right ? they 're going to teach their kids , and their children 's children . participants consistently identified that the new experience of working alongside a registered nurse was also a powerful experience of legitimation : a good example today was ( procedure ) . i did ( procedure ) so i got to sort of walk through that with my rn that i was working with . ( this opportunity was ) definitely a new skill . where problems occurred in seeking new clinical experiences for post lpn to bn students was the variance in their previous experience . it was during these discussions that the interactive nature of our focus groups was most apparent . participants were interested in one another 's perspective , but they did not agree on what actually constituted a new experience . students who worked on acute care hospital units did not view some aspects of their university practicum as new . on the other hand , those who worked in long term care found the practicum very challenging . problems also occurred when institutional policies for undergraduate nursing students did not take into account that licensed practical nurses could also be members of this student group . participants mentioned instances where my buddy nurse was an lpn with less experience than me and i can not actually do some of the skills that i 've been trained to do as an lpn in this practicum so it 's kind of holding me back . the aforementioned two themes , developed from focus group discussions with licensed practical nurses attending university to become registered nurses , begin to illustrate the experience of legitimation among this group of learners . listening attentively as students described their experiences revealed useful ways to acknowledge their existing identity as nurses , to understand how important instructors ' questions were to them and to conceptualize the notion of new experiences through their eyes . 's research with dietetic students and klossner 's research with student athletic trainers , our project also revealed that professional socialization begins when instructors and patients accept students in their new professional role . this acceptance and acknowledgement by others generates confidence and a willingness to risk behaviours expected of those in the new role . similarly , our project echoes spoelstra and robbins research with registered nurses transitioning to an advanced practice role . like our participants , the practising nurses in spoelstra et al . 's study identified that implementing direct patient care was an essential component in their successful role transition . however , the experiences of legitimation that post lpn to bn students face are unique . traditionally , university programs did not offer bridging programs to vocationally educated nurses . in turn , questions about the legitimacy of their new program may be raised . scales measuring values new students acquire as part of their socialization into the role of nurse , such as weis and schank 's nursing professional values scale - revised npvs - r or shinyashiki et al . 's professional socialization questionnaire , are not fitting for this group of nursing students . licensed practical nurses begin their program already well socialized into the identity of nurse . participants in the present study felt insulted by the notion of becoming a nurse . given the similarities between the lpn and rn role in their workplaces , they did not always feel that they were doing anything affirmation from others that their professional identity was extending and changing was especially important to this unique group of learners . the authenticating experiences of completing courses and examinations in cohort groups that haas and shaffir considered foundational to professional socialization were not available to these students . their employment experiences as lpns did not usually support acting independently . on their practicum units , their name badges did not effectively communicate what their role was . in some instances , in essence , the typical legitimation agents that historically supported healthcare learners towards new professional identities are not fully available to post lpn bn students . therefore , both the time they spent with instructors and new clinical experiences were especially important . limitations of the study included recruiting a small homogenous sample of learners from only one program . as we were not previously acquainted with participants , group dynamics such as dominance by one or two members , power differentials , or established patterns of communication some participants may have simply agreed with others , not expressed their views fully , or commented only superficially . given these findings , implications for instructing post lpn to bn students include honoring the feelings of legitimacy they have already developed as practising professional nurses . educators must ensure that opportunities are available for these learners to meet with their instructors regularly and to engage them in learning topics and experiences that , in their view , are new . students expect and need the formal acknowledgement that they are progressing or not progressing as expected . further , the importance of encouraging students to identify individual learning goals should not be underestimated . traditional undergraduate placements can not be expected to accommodate all the needs of this diverse group of adult learners . experiences are likely to be different for each student . in conclusion , this paper presented findings from a descriptive study that explored post lpn to bn students ' experiences with professional socialization . the research investigated socializing agents that impacted students ' feelings of legitimacy as they developed new identities as registered nurses . in contrast to other studies , this project extends our understanding of healthcare learners ' professionalization by including the voices of licensed practical nurses who attended university . knowing the value that this group of adult learners place on instructor evaluation and new clinical experiences , implications for educators include ensuring that one - to - one time with their teachers is available and designing practicum experiences that build on their established identities as professional nurses .

evolution is a two - way pull between the generation of variation in types of individuals in populations and preferential proliferation ( selection ) of those variants best suited to the environment . this feedback between genome ( ultimately mutation ) and environment drives cancer proliferation , pathogen adaptation to host defenses , and antibiotic and cancer chemotherapy resistance , in addition to the origin of species . in contrast with initial assumptions that mutations accumulate constantly , gradually , and independently of selective environments ( 1 ) , microbial and other geneticists have discovered stress - inducible mutagenesis mechanisms in bacteria , yeast , and human cancer cells ( 2 ) . these mechanisms increase the mutation rate specifically when cells are maladapted to their environment , that is , when they are stressed , usually via the coupling of a mutation - generating pathway to one or more normal cellular stress responses . stress - inducible mutation mechanisms increase genetic variation and potentially the ability to evolve and do so in a manner responsive to changing environments . various stress - inducible mutation mechanisms produce point mutations , transpositions , gene amplifications , and copy number variations ( 2 ) . in a recent issue of mbio , they show that in the pathogenic yeast candida albicans , loss of heterozygosity ( loh ) is also induced by stress . because diploids have two copies of each gene and because most mutations are recessive , new mutations usually have little or no effect . e.g. , the mom chromosome , becomes identical to the other , e.g. , the dad , often over long stretches , unmasking the phenotypes of previously acquired mutations in that region . a frequent cause of loh is somatic homologous recombination ( hr ) used to repair dna double - strand breaks and ends ( dsbs / dses ) ( fig . 1 ) . three kinds of loh result from different hr / dse repair events : loh can occur in short chromosomal tracts by a gene conversion - like process ( not shown ) and in long tracts , including whole chromosome arms , by reciprocal recombination ( crossover ) or by break - induced replication ( bir ) . crossover between replicated mom and dad chromosomes generates loh because , in somatic cells , the recombined chromatids segregate randomly such that a recombined chromatid can end up in a cell with a wholly mom or wholly dad homologue ( fig . bir is a mechanism that repairs a single double - strand dna end ( dse ) that forms when a replication fork breaks or collapses ( fig . yeast , the dse usually finds the chromosome it broke from , pairs with it , and may copy the entire length of dna from the dse to the telomere . this is usually a genetically silent event , e.g. , a mom dna end copying the mom chromosome but occasionally a mom dna end pairs with the dad chromosome and then can copy very long tracts of dad sequence , from the dse to the telomere , producing loh ( fig . loh can also be caused by whole - chromosome loss , presumably by failure of segregation . lines represent strands of dna ; dashed lines indicate newly synthesized dna ; ovals indicate centromeres ; mom indicates one homologue , and dad indicates the other . ( a ) in somatic cells , reciprocal recombination between replicated homologous chromosomes causes loss of heterozygosity when recombined chromosomes segregate with unrecombined ones . ( b ) break - induced replication , or bir , can cause loss of heterozygosity . although the same chromosome is usually used in bir repair of a collapsed replication fork ( mom here ; not shown ) , occasional use of the other ( dad ) chromosome can cause loh . used elegant genetic assays to distinguish whole - chromosome loss ( non - hr ) and short- and long - tract ( hr ) loh events at very many different genomic sites in different genetically marked reporter strains ( 3 ) . they report that overall about 86% of spontaneous loh events in candida are long tract ( hr / dse repair type ) , 9% are short tract ( hr / dse repair type ) , and 5% are whole - chromosome loss ( not hr ) . hr rules the day . among the long - tract events at one locus , they used a sophisticated assay to capture the fates of all four chromatids after loh and showed that most are of the nonreciprocal bir type ( fig . the authors then applied three different host - relevant stressing treatments to six of the reporter strains and showed that loh events are increased dramatically and dose dependently with the stressors . the loh events were measured by loss of a moveable ura3 gene unrelated to the stresses applied . the stressors were heat stress , similar to what the organism encounters in a patient with fever ; oxidative stress , as is launched by host immune cells ; and the antifungal drug fluconazole , an ergosterol biosynthesis inhibitor used to treat candida infections . whereas heat increased loh 1- to 40-fold ( an uptick but not statistically significant ) , the oxidizing agent hydrogen peroxide ( h2o2 ) increased loh a statistically significant 3- to 72-fold , and fluconazole increased it a significant 285-fold . this finding , and their finding of increased loh at many different unrelated genomic sites , indicates that loh events were induced by the stress , not merely selected as better survivors of a particular stress . their results demonstrate stress - inducible loss of heterozygosity , which decreases genetic complexity of an individual but increases phenotypic diversity of the population . though often deleterious , loh can confer adaptive / proliferative outcomes ( 7 ) , including , as noted , cancer development ( 5 ) . thus , candida may have an enhanced ability to evolve specifically in an environmental / adaptive tight spot when it is stressed . each stressor increased some loh types more than other types , indicating that the different stressors stimulated different mechanisms of loh . h2o2 , which damages dna and proteins , increased short - tract and long - tract loh , implying that hr , most probably dse repair , was increased . h2o2 could have caused dses directly or might alter the cellular enzymatic milieu via induction of stress responses , and these might promote hr and bir . whether these stressors increased loh events via activating stress responses that upregulate loh - generating pathways is not known . identification of stress responses that might control loh - promoting mechanisms is an intriguing area for further exploration . there are obvious and less - obvious parallels between stress - induced loh in candida ( 3 ) and stress - induced mutagenesis mechanisms observed in bacteria , yeasts , and human cells ( 2 ) . obviously , regardless of how or why they evolved , both will generate variation in populations specifically when they are maladapted to their environments , that is , when cells become stressed . this paradigm , in which generation of variation can be environmentally responsive and variations temporally clustered ( 810 ) , differs fundamentally from previous purely probabilistic models in which mutations and phenotype variations occur constantly and gradually over time , uncorrelated with each other or environmental input ( 1 ) . see reference 11 for discussion of the environmentally responsive model , previous arguments against it , and recent work that supports it , and see reference 2 for a more extensive but less current review . ( 3 ) suggest a possible parallel with the best - understood stress - induced mutagenesis mechanism and a solution to a previous enigma . dsb - dependent mutagenesis was discovered in escherichia coli as a stress - associated pathway ( 12 , 13 ) , then demonstrated and elaborated in baker s yeast ( 1418 ) , where it appeared to be stress independent . in both organisms , dna polymerase errors made during acts of dse repair via hr persist and coli , dse repair synthesis is high fidelity ( nonmutagenic ) in unstressed cells but switches to a mutagenic mode , using specialized error - prone dna polymerases , dinb , pol v ( 19 ) , and pol ii ( 20 ) , during stress that activates the rpos - controlled general stress response or if the rpos transcriptional activator of the response is upregulated artificially in unstressed cells ( 11 , 21 ) . that is , the general stress response throws a switch that licenses the use of error - prone dna polymerases in dse / dsb repair , promoting mutations under stress , when cells are poorly adapted to their environment ( 11 , 21 ) . this switch is not needed for the repair itself ( 11 , 21 ) and might be an evolution - enhancing mechanism . in baker s yeast , however , essentially all acts of dsb repair via hr seem to be mutagenic independently of any known stressor other than the dsb . moreover , the kinds of dse repair events that provoke dsb - dependent mutagenesis in baker s yeast are the same as those that induce loh : gene conversions ( 14 , 16 , 17 ) , probably reciprocal recombination , and bir ( 18 ) , and they do so using either a specialized error - prone dna polymerase ( 15 ) or a housekeeping dna polymerase(s ) ( 17 , 18 ) . hence , yeast dsb / hr - dependent mutagenesis was not known to be stress inducible . the results obtained by forche et al . ( 3 ) suggest that dsb - dependent mutagenesis may be stress inducible in both bacteria and eukaryotes . they show that loh caused by hr ( probably dse repair ) is stress inducible , implying that dses and/or hr is stress inducible . thus , dse / hr - dependent mutagenesis seems likely to be stress inducible in yeast , as it is in e. coli , albeit with the stress inducibility controlled at a different step in the mechanism . if baker s yeast is like candida , then either dses or their apparently constitutively mutagenic repair would be expected to be stress inducible , whereas in e. coli , repair is constitutive but its mutagenicity is stress induced , controlled by rpos ( 11 , 21 ) . these apparently separate evolutions of mutagenic dse repair / hr may converge on a similar biological outcome , stress - inducible mutagenesis - associated dse repair . linking mutagenesis to dse repair in a stress - inducible process could provide two evolution accelerators : the ability to make mutations specifically when maladapted and the ability to make them locally in dsb repair zones , which could promote concerted evolution ( multiple changes ) within genes and linked genes ( 21 , 22 ) , a significant limiting factor in protein evolution . ( 3 ) introduces a new dimension to stress - induced generation of variation , which can potentially fuel evolution specifically when populations are poorly adapted to their environments : stress - induced diversification by loh . this adds to stress - induced mutagenesis ( 2 ) and stress - induced generation of phenotypic diversity by the unmasking of protein diversity during stress when chaperones become less available and by other protein - based mechanisms ( 23 ) . the authors note also that previous observation of aging - induced loh in yeast ( 24 ) may reflect accumulation of stressors in aging cells and stress - induced loh . their work begs many intriguing questions , including what role , if any , stress responses play in the loh mechanisms induced , which specific mechanisms underlie each specific loh type observed , and how stress or stress responses promote them . the two - way pull between genotype and environment that drives evolution appears to include feedback and responsiveness . the concepts of feedback and responsiveness were absent at the dawn of our understanding of genetic mechanisms underlying evolution ( 1 ) , which , after all , predated molecular biology . but these concepts make sense to students of biological mechanisms and their control . discerning underlying molecular mechanisms revealed this fluid , responsive view of mutagenesis and protein diversity ( 2 , 23 ) .

hydroxyapatite ( hap ) has a chemical composition similar to bones and teeth . methods to prepare it include reacting calcium nitrate with phosphoric acid , disodium creatine phosphate , ammonium hydrogen phosphate , and phosphorus pentoxide , as well as combining calcium hydroxide with phosphoric acid . temperature and ph may be adjusted to control physical properties , including mechanical strength , particle size , and pore size . during synthesis and drying , the calcium phosphate goes through intermediate amorphous stages until the thermodynamically stable phase is formed with a ca / p ratio of 1.67 . the ca / p ratio can vary between 1.51.67 and is affected by reaction time and reactant concentration . methods for drying hap include autoclaving , freeze - drying , and thermal treatment . the increasing effect of water pollution on disease has created a need to remove toxic metal ions , including copper , chromium , lead , mercury , and arsenic . hap has been modified to produce hybrids , microtubes , and ordered arrays and may have an important role in environmental remediation due to its ability to sequester metal ions . it is less expensive than ion exchange resins and can be valorized by combining with cement to build infrastructure after sorbing the ions . hap can sorb these ions by ion exchange , surface complexation , and dissolution / precipitation . the affinity for pb increased when increasing amounts of hap were incorporated into a polyacrylamide hydrogel and when coated onto polyurethane foam . this report focuses on hap and its modification with 1-hydroxyethane-1,1-diphosphonic acid ( hedp ) in order to enhance its affinity for metal ions from aqueous solutions . hap is prepared from ca(oh)2 rather than calcium nitrate and h3po4 thus obviating the need to wash the product free of nitrate ions . hedp is one of a group of bisphosphonates that adsorb onto hap at near - ambient temperatures and has a good affinity for metal ions . to identify the conditions that give the most hedp incorporation ( rather than only surface modification ) , calcined hap was suspended in 0.010.50 m hedp at moderate ( 20 c ) and high ( 80 c ) temperatures for short ( 4 h ) , long ( 168 h ) , and very long ( 720 h ) times . since ca(oh)2 is produced from lime , an inexpensive starting material , determining how hap can be modified to have significant selectivity for transition metal ions will provide a low - cost alternative to polystyrene - based ion exchange resins . hap was synthesized from calcium hydroxide and phosphoric acid at an initial ca : p molar ratio of 1.78 . in a typical experiment , 3.86 g of ca(oh)2 was combined with 140 ml of h2o and 2 ml of h3po4 , then stirred for 48 h while maintaining a ph of 8.08.2 with dilute h3po4 or koh solutions . the particles obtained by precipitation were isolated by filtration , dried at ambient conditions and then in a vacuum oven at 60 c , and calcined at 700 c for 3 h to obtain hap with a ca / p molar ratio of 1.52 . this differs from the structure with the stoichiometric value of 1.67 in having a greater quantity of free phosphorus acid sites . calcined hap was modified by suspending it in 0.010.50 m hedp with ph adjusted to 7.6 to prevent dissolution of the hap . in a typical experiment , 2.0 g of hap was added to 100 ml of an hedp solution , and the reaction was stirred at 20 or 80 c for 4 , 168 , or 720 h. the conditions for the different mhaps are given in table 1 . the final suspensions were filtered , washed with deionized water , and dried at ambient temperature for 48 h. control experiments of hap in water at the same modification times and temperatures were done . results for the sample prepared at 168 h and 80 c ( chap ) are reported . stoichiometric hap ( shap1 ) with a ca / p ratio of 1.67 was purchased from sigma - aldrich and modified with hedp for 168 h at 80 c ( shap2 ) in order to determine whether the ratio had an effect on the modification . the calcium salt of hedp was prepared by adding 1.47 g of ca(oh)2 to 100 ml of 0.50 m hedp , then stirring for 168 h at 80 c . fourier transform infrared ( ft - ir ) spectra were taken on a perkinelmer spectrum 65 spectrometer . the panalytical xpert pro x - ray powder diffraction system was used to obtain x - ray diffraction ( xrd ) patterns . scanning electron microscopy ( sem ) images and energy dispersive x - ray spectroscopy ( eds ) were obtained from a zeiss supra 55 vp field emission sem at city college . specific surface area ( ssa ) measurements were made using a micromeritics tristar 3000 surface area and porosity analyzer . inductively coupled plasma - optical emission spectrometry ( icp - oes ) analyses were carried out on acid digested hap and mhap samples as well as on metal ion solutions on a perkinelmer optima 7000 dv icp-oes.the thermogravimetric analysis ( tga ) was carried out on a ta instruments sdtq600 analyzer . twenty mg of each solid was used for each analysis . heat flow and weight changes associated with transitions and reaction - involved materials over the ambient - to-1000 c temperature range ( heating rate of 5 c / min ) under air atmosphere ( 100 ml / min ) were measured simultaneously . hap and mhap ( 0.25 g ) were stirred in 50 ml of 0.10 m naoh also containing 2.5 g of nacl for 17 h to determine their acid capacities . the mixture was filtered , and the filtrate was titrated with 0.10 m hcl to calculate the level of hedp incorporation . the effect of ph on stability and solubility was determined by measuring the concentration of calcium released into solution by contacting 20 ml of 0.10 m kno3 with 0.10 g of hap or mhap5a for 1 or 24 h at ph values adjusted between 2 and 8 with koh or hno3 . samples were digested in acid in order to determine their organic and inorganic phosphorus capacities . the organic phosphorus capacity was measured by dissolving 20 mg of hap or mhap in 10 ml of hot concentrated sulfuric acid in the presence of copper sulfate and potassium persulfate . for inorganic phosphate measurements , 0.10 digested samples were neutralized , combined with a vanadate - molybdate reagent to produce a yellow complex and analyzed with a spec 21 instrument . molybdate reagent was prepared by combining 2.50 g of ammonium heptamolybdate tetrahydrate in 30 ml of water to 0.128 g of ammonium metavanadate in 30 ml of water also containing 3.3 ml of concentrated hcl in a 100 ml volumetric flask , which was then diluted to the mark with water . the percent phosphorus contributed by hedp was calculated using eq 1.1where pt is the total phosphorus capacity and pinorg is the inorganic phosphorus capacity . eds determined the amounts of calcium and phosphorus to calculate ca / p ratios . these values were compared to those from icp measurements of acid - digested samples . binding affinities were measured for hap and mhap : 0.10 g were shaken with separate 10 n nitrate solutions of cu , ni , zn , cd , and pb for 5 h. to determine their selectivity in the presence of competing nontoxic ions , the solutions were also prepared containing 1 n ca(no3)2 . hap and mhap were contacted at ambient temperature ( 20 2 c ) for 5 h followed by centrifugation and microsyringe filtration ( 0.45 m pore ) . hap was initially modified with 0.01 , 0.05 , 0.10 , 0.20 , and 0.50 m hedp for 168 h at 80 c ( mhap15a , table 1 ) . as the concentration of hedp increased , there was a gradual split in the phosphate band between 1082 and 1144 cm as well as a new band at 993 cm . the intensity of the bands at 943 , 879 , and 825 cm also increased with increasing hedp concentration and the free oh band ( 3572 cm ) disappeared while a new band for intermolecular h - bonds appeared at 3204 cm ( figure 1 ) . modification was most pronounced with 0.50 m hedp ( mhap5a ) , and this concentration was used for all subsequent modifications . low temperature ( 20 c ) and high temperature ( 80 c ) conditions were combined with reaction times of 4 , 168 , and 720 h to generate six different mhaps ( mhap5a c and mhap6a c , table 1 ) . haps modified at 80 c or long reaction times ( 168 and 720 h ) showed the phosphate band split ( figure 2 and supporting information , figure s1 ) . mhap6b ( 4 h/20 c ) showed no band split and had a spectrum very similar to hap itself ( figure 1 ) as did chap ( supporting information , figure s2 ) . when shap1 was modified with hedp for 168 h at 80 c , the new shap2 had a spectrum similar to mhap5a but with a slightly broader phosphate band at 1083 cm ( figure s2 ) . ft - ir spectra of hap , and hap modified at 80 c for 168 h using 0.01 m ( mhap1 ) , 0.05 m ( mhap2 ) , 0.10 m ( mhap3 ) , 0.20 m ( mhap4 ) , and 0.50 m ( mhap5a ) hedp . ft - ir spectra of hap modified with 0.50 m hedp at 80 c for 168 h ( mhap5a ) , 4 h ( mhap5b ) , and 720 h ( mhap5c ) . hap modified at 80 c showed a new diffraction pattern when compared to unmodified hap ( figure 3 ) : reaction times of 168 h ( mhap5a ) and 720 h ( mhap5c ) produced sharper peaks indicating more crystallinity with no significant difference between them . at low temperature , new diffraction patterns were seen only in mhap6a ( 168 h ) and mhap6c ( 720 h ) ( supporting information , figure s3 ) . the xrd pattern of mhap6b ( 4 h ) was the same as hap . mhap6a and mhap6c had xrd patterns similar to mhap5b ( figure 3 ) indicating that crystallinity was favored at high temperature and long reaction time . there was no difference when comparing the xrd patterns of mhaps from that of the two long reaction times at high and low temperatures . the diffraction pattern of mhap5a was similar to that of mhap5c ( figure 3 ) and mhap6a resembled mhap6c ( supporting information , figure s3 ) . given that , subsequent analyses at the long reaction time were limited to the mhap5a and mhap6a conditions . the xrd of chap revealed that in the absence of hedp , no modification of the hap crystal occurred even when the hap was exposed to high temperature ( 80 c ) and long reaction time ( 168 h ) ( figure 4 ) . shap1 had a diffraction pattern similar to hap and chap but was more crystalline . this crystallinity did not affect the modification since the xrd pattern of shap2 had peaks identical to those for mhap5a . results show the same modification can occur at 168 h/80 c regardless of the initial ca / p ratio . sem revealed a microbead structure in the low temperature mhaps consistent with the sem of hap . there was also a trace appearance of a new particle morphology ( strands ) within mhap6a and mhap6b suggesting a new phase at low levels ( figure 5 ) . the strands were most evident and homogeneously distributed in mhap5a and mhap5b , both modified at 80 c . modification is confirmed by xrd patterns and ft - ir spectra for all mhaps except mhap6b which appeared identical to hap even though sem images revealed the new phase within it . all three analyses , however , supported an increasing level of modification at higher temperature and longer reaction time . xrd patterns of hap and hap modified with 0.50 m hedp at 80 c for 168 h ( mhap5a ) , 4 h ( mhap5b ) , and 720 h ( mhap5c ) . xrd of hap , stoichiometric hap ( shap1 ) , hap contacted in h2o for 168 h at 80 c ( chap ) , hap modified with 0.50 m hedp for 168 h at 80 c ( mhap5a ) , and stoichiometric hap modified with 0.50 m hedp for 168 h at 80 c ( shap2 ) . sem of hap modified with 0.50 m hedp at 80 c for 168 h ( mhap5a ) , 4 h ( mhap5b ) , and at 20 c for 168 h ( mhap6a ) and 4 h ( mhap6b ) as well as hap itself ( bottom left ) . b ( 80 c reaction ) had low ssa compared to hap and mhap6a b ( 20 c reaction ) ( supporting information , table s1 ) . the disappearance of microbeads in high temperature mhaps and the emergence of continuous strands may account for the ssa decrease . the acid capacities of hap , mhap , and chap are affected by reaction time , temperature , and the presence of hedp ( supporting information , table s2 ) : the higher the reaction temperature is ( mhap5a b ) , the greater is the acid capacity . longer reaction times led to higher acid capacities ( mhap5a and mhap6a ) compared to shorter times ( mhap5b and mhap6b ) . in the absence of hedp , the control hap ( chap ) contacting water for 168 h at 80 c showed no difference in its acid capacity compared to hap , which indicates hedp modification is evident by acid capacity . the effect of ph on particle stability was determined by placing hap and mhap5a in 0.10 m kno3 . both dissolved and released high levels of calcium ( 1.62.1 mmol / g ) at ph 2 , ( figures 6 and 7 ) and lower levels at ph 4 and 6 . however , they behaved differently when placed in solutions at ph 8 : hap released a low level of calcium , as expected since it is known to be stable at high ph , but mhap5a released almost as much ca as it did at ph 2 . calcium release for hap in kno3 solutions at ph 2 , 4 , 6 , and 8 at 1 and 24 h contact . ca release for mhap5a in kno3 solutions at ph 2 , 4 , 6 , and 8 at 1 and 24 h contact . the percent organic phosphorus in the mhaps was measured by using 0.10 m hcl to dissolve the inorganic phosphate and concentrated h2so4 to dissolve inorganic and organic phosphates . the amount of organic phosphate relative to inorganic phosphate was high at long reaction time ( mhap5a and mhap6a , table 2 ) and lower at short reaction time ( mhap5b and mhap6b ) . the same trend was seen at high temperature ( mhap5a b ) and low temperature ( mhap6a b ) . % porg = amount of organic p relative to the total p 100 . the % porg calculated in table 2 for each mhap gives the amount of organic p relative to the total p , not the wt % p per gram mhap . table 3 shows the wt % of hedp for mhap5a , mhap5b , mhap6a , and mhap6b . these calculations are consistent with the ft - ir spectra ( figure 2 and supporting information , figure s1 ) which reveal new bands for mhap5a , mhap5b , and mhap6a , but not for mhap6b which , with 5.7 wt % of hedp , is at the detection limit for ft - ir . the elemental analysis suggests that for mhap5a , mhap5b , and mhap6a , the modification is more than a surface phenomenon . this is consistent with the acid capacities for mhap5a , mhap5b , and mhap6a which were also greater than the amount that could be reasonable for only surface modification . mhap5a , with 100% porg , is therefore indicative of hap modified in the bulk phase and mhap6b , with 10.6% porg , may be only surface modified . p nmr spectra were obtained for mhap , mhap6b , mhap5b , mhap6a , and mhap5a ( figure 8) . the peak at 3 ppm arises from the inorganic p in hap . as reaction time and temperature increase , this peak decreases and a new peak at 19 ppm emerges due to hedp . the sample modified for 4 h at 20 c ( mhap6b ) has a spectrum that is almost identical to unmodified hap indicating little hedp present . mhap5a , modified for the longest time ( 168 h ) and the highest temperature ( 80 c ) , only has a peak corresponding to hedp . p nmr of unmodified hap , hap modified with 0.5 m hedp at 20 c for 4 h ( mhap6b ) , 80 c for 4 h ( mhap5b ) , 20 c for 168 h ( mhap6a ) , and 80 c for 168 h ( mhap5a ) . hap and mhap were heated to 1000 c at 20 c / min under air atmosphere in order to determine the weight loss ( % ) resulting from the incorporated hedp ( supporting information , figure s4 ) . the decline in weight occurred between 400 and 700 c after the loss of water , with the greatest loss evident between 400 and 570 c . hap and mhap6b ( 4 h/20 c ) had the least weight loss , 5.6% and 5.8% , respectively ( supporting information , table s3 ) . weight loss increased to 20.7% at longer reaction times ( 168 h/20 c , mhap6a ) , but an increase in temperature ( 4 h/80 c , mhap5b ) resulted in a loss of only 12.3% . the temperature range and weight loss values are consistent with what has been observed in similar systems ; for example , a 10% weight loss has been found for di(2,4,4-trimethylpentyl)phosphinic acid sorbed within clay . this is consistent with the p - elemental results , wherein mhap6a had 52.1% hedp compared to mhap5b with 32.6% . mhap5a modified for 168 h/80 c was expected to show the highest mass loss but it had a mass loss of only 14.8% , which is not consistent with its p - elemental result since it had the most hedp . hedp and mhap5a , as seen from the ft - ir of hedp alone ( figure 9 ) . ft - ir of hap , a calcium salt of hedp ( ca hedp ) , hap modified with 0.50 m hedp for 168 h at 80 c ( mhap5a ) and hedp alone . eds showed a decreasing ca / p ratio with increasing reaction time and temperature . results by icp were consistent with eds measurements . a decreased ca / p ratio was associated with a higher p content corresponding to hedp incorporation into the hap ( table 4 ) . the metal ion affinities of four mhaps : mhap6b ( 4 h at 20 c ) , mhap5b ( 4 h at 80 c ) , mhap6a ( 168 h at 20 c ) , and mhap5a ( 168 h at 80 c ) were determined by contacting them with lead(ii ) nitrate solutions . sorption of pb was highest for mhap6b , decreased for mhap5b and mhap6a , then increased for mhap5a ( supporting information , figure s5 ) . sorption by mhap6b and mhap5a was studied in more detail by contacting them with nitrate solutions of cu , ni , zn , and cd ( figure 10 ) . hap and mhap6b removed all metal ions from solution with high efficiency ( > 85% ) but showed no selectivity . mhap5a , however , removed high levels of pb ( 90% ) and cd ( 82% ) but < 25% of the other metal ions . its selectivity was tested in a solution containing a high level of calcium ( 1 n ) , where the presence of calcium simulates a nontoxic , aqueous environment . sorption for pb was still high ( 89% ) though cd decreased ( 16% ) . hap also showed decreased metal ion sorption in high calcium concentration for ni , zn , and cd ( figure 11 ) . that hap retains a high affinity for pb and cu while mhap5a is selective for pb points to an important difference in their sorption mechanism and this is discussed in the next section . metal ion sorption for hap , mhap6b , and mhap5a in nitrate solutions of cu(ii ) , ni(ii ) , zn(ii ) , cd(ii ) , and pb(ii ) . metal ion sorption for hap and mhap5a in nitrate solutions of cu(ii ) , ni(ii ) , zn(ii ) , cd(ii ) , and pb(ii ) with 1 n ca(no3)2 . hap has been modified by varying hedp concentration , reaction time , and reaction temperature . new phosphate bands appeared in the ft - ir spectra at 943 , 993 , 1082 , and 1144 cm as hedp concentration increased . this was seen in high temperature modifications for short and long reaction times ( figure 2 ) and the low temperature modification for the long reaction time ( supporting information , figure s1 ) . ft - ir spectra of both high temperature reactions were identical . at a low reaction temperature and short reaction time , mhap6b had no change in its ft - ir spectrum compared to hap . comparing figures 1 and 9 leads to the conclusion that the bands at 1082 and 1144 cm are due to the p o stretch of hedp and the band at 943 cm is due to the interaction between p o and ca in the hap . the new bands at 825 , 879 , and 993 cm are very weak and so can only be assigned to weak interactions between the hap and hedp since they are not present in either of the individual pure spectra . however , sem images revealed the presence of hap hedp strands and so the amount of hedp incorporated may be too low at 5.7 wt % to be detected by ft - ir . high temperature and long reaction time both have an effect on hedp incorporation and the combined effect is pronounced . the acid and phosphorus capacities indicate that there is more than surface modification and hedp is within the hap crystal . the spectra of mhap6b were the same as hap even though the presence of hedp was evident by elemental analysis ( 5.7 wt % p ) . the disappearance of the free oh band ( 3572 cm ) initially present in hap and the emergence of an intermolecular hydrogen - bond stretch at 3204 cm in the other mhaps suggest that oh groups in hap react with hedp in the modification reaction . a phosphorus elemental analysis was used to distinguish the organic from inorganic phosphorus in the mhaps and to quantify the extent of hap modification with hedp . the higher is the organic phosphorus capacity , the more hedp is incorporated into hap . there was a significant increase in the amount of hedp measured in mhap5a ( 61.4 wt % ) prepared at high temperature and long reaction time compared to that in mhap6b ( 5.7 wt % ) prepared at low temperature and short reaction time ( 20 c/4 h ) . mhap6a and mhap5b , prepared at low temperature / long time and high temperature / short time , respectively , give hedp levels of 52.1% and 32.6% , respectively , with the higher amount appearing at long reaction time . these results complement the instrumental analysis and confirm that high temperature / long reaction time allows the most hedp to be incorporated into hap . new diffraction patterns and sharp xrd peaks indicate an increase in crystallinity of the hap modified for the long reaction time at high temperature . mhaps produced by other conditions did not have the same high extent of crystallinity . sem images of the mhaps distinguished between hap microbeads and hedp - modified strands . eds analysis showed that the strands had more phosphorus ( i.e. , a lower ca / p ratio ) than samples containing more microbeads . the microbeads are expected to have a greater surface area than strands and this accords with data which showed a lower ssa for samples with more strands ( mhap5a b ) and a higher ssa for samples with more microbeads ( mhap6a b ) . ft - ir spectra confirmed that mhap5a was similar to modified stoichiometric hap ( shap2 ) but different from the calcium salt of hedp produced with ca(oh)2 and hedp in the absence of phosphoric acid . hedp salt having a 1:1 ca / hedp ratio gave four distinct peaks at 7 , 12 , 16 , and 17 degrees . as the ratio of ca to hedp increased , the xrds showed a more amorphous structure . a comparison of figures 3 and 12 confirms that mhap5a is different from ca hedp . hedp salts of different ca / hedp ratios . reprinted from ref ( 54 ) . modified hap behaved differently from hap during ph equilibration and metal ion sorption studies . at ph 8 , this can be explained by noting that mhap5a required the addition of a higher amount of koh to raise the ph and the resulting high concentration of k forced ion exchange with ca . although the complexation constant for potassium hedp is significantly lower ( log k = 1.8 ) than that of calcium hedp ( log k = 6.4 ) , these values derive from measurements with equal concentrations of k and ca . at very high k / ca ratios , the law of mass action favors potassium hedp and causes ca to be released into solution . mhap5a removed pb and cd from nitrate solutions with high efficiency compared to the sorption of other divalent ions ( pb > cd > zn > ni > cu ) . these results were comparable to those for the commercially available extractant di(2-ethylhexyl)phosphoric acid . its affinity for pb ( 90% ) and cd ( 60% ) are as high as found for hedp , while sorption of ni and cu is lowest . there was no selectivity among metal ions for mhap6b , confirming that the increased levels of hedp in mhap5a strongly correlate with its metal ion affinities . in a background of 1 n ca ions , mhap5a retained its selectivity for pb while its affinity for cd decreased ; hap also retained its high affinity for pb but had a high affinity for cu as well . this disparity in behavior between mhap5a and hap is due to hap operating via a relatively nonselective electrostatic ion - exchange mechanism while mhap5a is operating via a mechanism in which there is significant coordination that allows for metal ligand covalency . coordination implies a correlation with the polarizabilities of the metal ions and this is the case here . the misono softness parameter quantifies metal ion polarizabilities and has been used successfully to explain the affinities of polymer - supported phosphate ligands . the ions studied have the values 0.40 ( pb ) , 0.30 ( cd ) , 0.28 ( cu ) , 0.25 ( ni ) , and 0.24 ( zn ) . the degree to which the softness parameter agrees with the sorption results suggests that complexants operating by coordinating to metal ions will retain that mechanism once bound within hap . this widens the applicability of the technique described in this report by allowing a match between a given application and the complexant to be bound within hap . the aim of this study is to develop a technique whereby hap can be modified with ion - selective complexants and used in groundwater remediation . hedp can be incorporated into hap and the metal ion affinities expected from solvent extraction studies are maintained indicating that immobilization within the inorganic matrix does not affect its binding mechanism . subsequent studies will show how mhap5a can be fabricated as a membrane used to sorb metal ions that contaminate water , then thermally decomposed after sorption , leaving the toxic metal immobilized within the purely inorganic hap for subsequent valorization . furthermore , it is important to note that the polar nature of the complexants permits binding to molecules of importance in wastewater treatment . such molecules include estrogens and other hormones , endocrine disruptors , polyphenols , dyes and antibiotics . as with metal ions , the polar complexants incorporated into the hap will permit the selective removal of the targeted compound .

epidermal nevus syndrome ( ens ) is characterized by epidermal nevi associated with abnormalities involving the nervous , skeletal and other systems . rarely , hypophosphatemic rickets has also been observed in association with epidermal nevi . phosphatonins including fibroblast growth factor-23 ( fgf-23 ) , which may be secreted by an epidermal nevus . the congenital nevomelanocytic nevus ( cnn ) , commonly known as based on diameter , cnn are characterized as small ( < 1.5 cm ) , medium ( 1.5 - 19.5 cm ) and giant ( > 20 cm in adolescents and adults ) . studies report lifetime risk of developing a melanoma for patients with a large cnn ranging from 6.3% to 12.2% while for small cnn , risk rates have been reported between 0.8% and 4.9% . ens and linear sebaceous nevus have been associated with various abnormalities including hypophosphatemic rickets , but only one case of giant hairy nevus associated with hypophosphatemic rickets has been reported until date . we report here a case of giant cnn associated with severe hypophosphatemic rickets , probably due to secretion of fgf-23 . a 10-year - old boy presented with a difficulty in walking and progressive deformity of the lower limbs since 2 years of age . history of delayed milestones started walking at 2 years of age , history of poor height gain and history of difficulty in getting up from the squatting position . no history of seizures , carpopedal spasms , periodic muscle weakness , dental abscess , hearing loss , pain abdomen , hematuria , polyuria , diarrhea and pain abdomen . he had been on treatment with oral vitamin d and phosphate supplementation irregularly . on examination , his skin was remarkable for the presence of few hairy nevi , largest one covering his entire back and shoulders [ figure 1 ] . investigations revealed serum calcium 8.7 mg / dl ( normal 8.1 - 10.4 mg% ) , serum phosphate 2.1 mg / dl ( normal 2.1 - 4.5 mg% ) and serum alkaline phosphatase 2685 u / l ( normal 0 - 18 years : 240 - 840 iu ) . 24 h urine collection showed creatinine , calcium and phosphate excretion of 0.12 g , 0.01 g and 0.17 g respectively . serum intact parathormone levels was 127.7 pg / ml and serum 25(oh ) vitamin d levels was 69 ng / ml . urine examination for glucose and amino acids was negative and ruling out any possibility of proximal renal tubular acidosis . 99m - tc methylene - diphosphonate whole body scintigraphy revealed diffusely increased radiotracer uptake in the entire axial and peripheral skeleton , more prominent in calvarium , mandible and bilateral costochondral junctions suggestive of metabolic bone disease . serum fgf-23 levels were found to be raised ( 171 u / l ) [ figures 13 ] . patient was diagnosed as a case of cnn with hypophosphatemic rickets and started on phosphate supplement and calcitriol . giant hairy nevus on the back of patient with small nevi over left thigh 99m - tc methylene - diphosphonate whole body scintigraphy x - ray of both knees showing rachitic changes x - ray both hands with wrists showing rachitic changes hypophosphatemic rickets constitutes a group of disorders in metabolic bone disorders due to the defective renal phosphate resorption . acquired forms of hypophosphatemic rickets have been reported to be associated with various tumors including mesenchymal tumors , hemangiomas and soft - tissue tumors . however , the combination of hypophosphatemic rickets with ens or giant hairy nevus is rarely reported . other skin lesions that can occur in ens are vascular nevi , hypopigmented macules and caf au lait macules . the central nervous system abnormalities in patients with ens include seizures , hemiparesis , developmental delay , mental retardation , abnormal cerebral gyration , underdeveloped temporal lobe and sensorineural deafness . surgical excision of the nevus has been reported to improve or cure the metabolic derangement . injection of the supernate from homogenized portion of excised tissue into experimental animals has been shown to induce excessive phosphaturia suggestive of the causative role of epidermal nevus . the nature of the phosphaturic factor in ens is not well - understood , but elevated circulating fgf-23 levels has been reported in one patient with hypophosphatemic rickets . this case illustrates the rare association of hypophosphatemic rickets with giant hairy nevus and it also highlights the significance of clinical and biochemical examination of children with epidermal nevi . this association is hence important to recognize so that early surgical correction can be planned and permanent disability can be avoided .

the study was approved by the scientific - ethical committee of the capital region of denmark ( reg . h - d-2009 - 0078 ) , is registered with clinicaltrials.gov ( clinical trial reg . nct01048268 ) , and was conducted according to the principles of the helsinki declaration ii . all potential subjects ( n = 12 ) underwent a physical examination and had standard hematological and clinical biochemistry parameters measured . urine was sampled to determine the albumin - to - creatinine ratio . exclusion criteria were having acute or chronic illnesses , taking ongoing medication , having first - degree relatives with diabetes , and showing repeated paraclinical abnormalities in hemoglobin , plasma liver enzymes ( alanine or aspartate aminotransferases ) , creatinine concentration , or the urinary albumin - to - creatinine ratio . subject characteristics each subject underwent 6 experimental days ( carried out in randomized order following a prespecified random - numbers table ) within a 2-month period . thus , for each subject , gip or placebo ( saline ) was infused on 2 days during euglycemic clamps , on 2 days during 12 mmol / l hyperglycemic clamps , and on 2 days during hypoglycemic clamps , aiming at a pg level of 2.5 mmol / l . subjects were instructed to maintain a carbohydrate - rich diet ( at least 250 g of carbohydrate daily ) and avoid alcohol and excessive eating for 3 days before each experimental day . in the morning of each experimental day , gip or placebo ( saline ) was prepared ( by m.c . ) for infusion by mixing it with 1% human albumin in 0.9% saline . subjects arrived at the laboratory after an overnight ( 10-h ) fast having avoided strenuous physical activity the day before . subjects were placed in a recumbent position and had a cannula inserted into a dorsal hand vein . the hand was placed in a heating box ( 55c ) throughout the experiment for the collection of arterialized blood samples . another cannula was inserted into a contralateral cubital vein for glucose and hormone infusions through separate infusion lines . at time 0 min , a continuous intravenous infusion of either gip ( 4 pmol / kg / min ) or placebo ( saline ) was initiated . at time 15 min , the infusion rate was halved , and at time 60 min , the infusion was stopped . the variation in infusion rate was done with the intention to reproduce physiological concentrations of gip normally observed after the ingestion of a mixed meal . the bolus in ml 50% glucose ( wt / vol ) administered at time 0 of the hyperglycemic clamp to elevate pg to 12 mmol / l was calculated as follows : ( 12 mmol / l fasting plasma glucose ) 35 mg glucose body weight ( in kilograms ) . during the hypoglycemic clamp , insulin ( actrapid ; novo nordisk , bagsvrd , denmark ) mixed with 1% human albumin was infused at a rate of 1.5 mu / kg / min for the entire study period ( 90 min ) . pg was measured bedside every 5 min , allowing the pg level to be clamped by an adjustable continuous infusion of 20% glucose ( wt / vol ) . synthetic gip ( polypeptide laboratories , wolfenbttel , germany ) was prepared for infusion in humans by the independent capital region pharmacy in denmark . the peptide was dissolved in sterilized water containing 2% human albumin ( statens serum institut , copenhagen , denmark ) , subjected to sterile filtration , and dispensed into vials similarly labeled and containing the same volume as the placebo ( saline ) vials . all vials were subsequently blinded ( by l.v . ) by adding new labeling with numbers from the prespecified random - numbers table and stored frozen under sterile conditions until the day of the experiment . arterialized blood was drawn at times 10 , 0 , 5 , 10 , 20 , 30 , 45 , 60 , and 90 min and distributed into chilled tubes containing edta plus aprotinin ( 500 kiu / ml blood ; trasylol , bayer , leverkusen , germany ) and a specific dipeptidyl peptidase 4 inhibitor ( valine - pyrrolidide ; final concentration of 0.01 mmol / l ) for analyses of glucagon and intact gip . for analyses of insulin and c - peptide , all tubes were immediately cooled on ice and centrifuged for 20 min at 1,200 g and 4c . plasma for gip and glucagon analyses was stored at 20c , and plasma samples for insulin and c - peptide analyses were stored at 80c until analysis . for bedside measurement of pg , blood was distributed into fluoride tubes and centrifuged at room temperature immediately for 2 min at 7,400 g . pg concentrations were measured by the glucose oxidase method , using a glucose analyzer ( model 2300 stat plus analyzer ; ysi , yellow springs , oh ) . plasma concentrations of gip and glucagon were measured by specific radioimmunoassay , as previously described ( 11 ) . plasma insulin and c - peptide concentrations were measured using a two - sided electrochemiluminescence immunoassay ( roche / hitachi modular analytics ; roche diagnostic , mannheim , germany ) . when single p values were available , they were expressed instead of stating nonsignificance ( ns ) . statistical analyses were carried out using graphpad prism version 5.00 for windows ( graphpad software , san diego , ca ) . repeated - measures anova , followed by bonferroni posttests , were applied to test for differences in repeatedly measured values between days ( i.e. , absolute pg and hormone concentrations ) . area under the curve ( auc ) values and incremental auc ( iauc ) values ( i.e. , baseline levels subtracted ) were calculated using the trapezoidal rule . for paired comparisons between single values ( e.g. , between auc values and baseline values , respectively ) , we used paired t tests or one - way anova followed by bonferroni posttests , if applicable . the insulin secretion rate ( isr ) values were calculated by deconvolution of measured c - peptide concentrations and the application of population - based parameters for c - peptide kinetics , as previously described ( 1214 ) . the study was approved by the scientific - ethical committee of the capital region of denmark ( reg . h - d-2009 - 0078 ) , is registered with clinicaltrials.gov ( clinical trial reg . nct01048268 ) , and was conducted according to the principles of the helsinki declaration ii . all potential subjects ( n = 12 ) underwent a physical examination and had standard hematological and clinical biochemistry parameters measured . urine was sampled to determine the albumin - to - creatinine ratio . exclusion criteria were having acute or chronic illnesses , taking ongoing medication , having first - degree relatives with diabetes , and showing repeated paraclinical abnormalities in hemoglobin , plasma liver enzymes ( alanine or aspartate aminotransferases ) , creatinine concentration , or the urinary albumin - to - creatinine ratio . each subject underwent 6 experimental days ( carried out in randomized order following a prespecified random - numbers table ) within a 2-month period . thus , for each subject , gip or placebo ( saline ) was infused on 2 days during euglycemic clamps , on 2 days during 12 mmol / l hyperglycemic clamps , and on 2 days during hypoglycemic clamps , aiming at a pg level of 2.5 mmol / l . subjects were instructed to maintain a carbohydrate - rich diet ( at least 250 g of carbohydrate daily ) and avoid alcohol and excessive eating for 3 days before each experimental day . in the morning of each experimental day , gip or placebo ( saline ) was prepared ( by m.c . ) for infusion by mixing it with 1% human albumin in 0.9% saline . subjects arrived at the laboratory after an overnight ( 10-h ) fast having avoided strenuous physical activity the day before . subjects were placed in a recumbent position and had a cannula inserted into a dorsal hand vein . the hand was placed in a heating box ( 55c ) throughout the experiment for the collection of arterialized blood samples . another cannula was inserted into a contralateral cubital vein for glucose and hormone infusions through separate infusion lines . at time 0 min , a continuous intravenous infusion of either gip ( 4 pmol / kg / min ) or placebo ( saline ) was initiated . at time 15 min , the infusion rate was halved , and at time 60 min , the infusion was stopped . the variation in infusion rate was done with the intention to reproduce physiological concentrations of gip normally observed after the ingestion of a mixed meal . the bolus in ml 50% glucose ( wt / vol ) administered at time 0 of the hyperglycemic clamp to elevate pg to 12 mmol / l was calculated as follows : ( 12 mmol / l fasting plasma glucose ) 35 mg glucose body weight ( in kilograms ) . during the hypoglycemic clamp , insulin ( actrapid ; novo nordisk , bagsvrd , denmark ) mixed with 1% human albumin was infused at a rate of 1.5 mu / kg / min for the entire study period ( 90 min ) . pg was measured bedside every 5 min , allowing the pg level to be clamped by an adjustable continuous infusion of 20% glucose ( wt / vol ) . synthetic gip ( polypeptide laboratories , wolfenbttel , germany ) was prepared for infusion in humans by the independent capital region pharmacy in denmark . the peptide was dissolved in sterilized water containing 2% human albumin ( statens serum institut , copenhagen , denmark ) , subjected to sterile filtration , and dispensed into vials similarly labeled and containing the same volume as the placebo ( saline ) vials . all vials were subsequently blinded ( by l.v . ) by adding new labeling with numbers from the prespecified random - numbers table and stored frozen under sterile conditions until the day of the experiment . arterialized blood was drawn at times 10 , 0 , 5 , 10 , 20 , 30 , 45 , 60 , and 90 min and distributed into chilled tubes containing edta plus aprotinin ( 500 kiu / ml blood ; trasylol , bayer , leverkusen , germany ) and a specific dipeptidyl peptidase 4 inhibitor ( valine - pyrrolidide ; final concentration of 0.01 mmol / l ) for analyses of glucagon and intact gip . for analyses of insulin and c - peptide , all tubes were immediately cooled on ice and centrifuged for 20 min at 1,200 g and 4c . plasma for gip and glucagon analyses was stored at 20c , and plasma samples for insulin and c - peptide analyses were stored at 80c until analysis . for bedside measurement of pg , blood was distributed into fluoride tubes and centrifuged at room temperature immediately for 2 min at 7,400 g . pg concentrations were measured by the glucose oxidase method , using a glucose analyzer ( model 2300 stat plus analyzer ; ysi , yellow springs , oh ) . plasma concentrations of gip and glucagon were measured by specific radioimmunoassay , as previously described ( 11 ) . plasma insulin and c - peptide concentrations were measured using a two - sided electrochemiluminescence immunoassay ( roche / hitachi modular analytics ; roche diagnostic , mannheim , germany ) . when single p values were available , they were expressed instead of stating nonsignificance ( ns ) . statistical analyses were carried out using graphpad prism version 5.00 for windows ( graphpad software , san diego , ca ) . repeated - measures anova , followed by bonferroni posttests , were applied to test for differences in repeatedly measured values between days ( i.e. , absolute pg and hormone concentrations ) . area under the curve ( auc ) values and incremental auc ( iauc ) values ( i.e. , baseline levels subtracted ) were calculated using the trapezoidal rule . for paired comparisons between single values ( e.g. , between auc values and baseline values , respectively ) , we used paired t tests or one - way anova followed by bonferroni posttests , if applicable . the insulin secretion rate ( isr ) values were calculated by deconvolution of measured c - peptide concentrations and the application of population - based parameters for c - peptide kinetics , as previously described ( 1214 ) . mean pg concentrations during each of the 6 experimental days are displayed in fig . 1 , upper panel . baseline pg concentrations did not differ between study days , and the overall mean value amounted to 5.0 0.1 mmol / l . pg concentrations were similar during the paired days of similar glycemia ( p = ns ) . during the days with euglycemia , fasting pg levels were maintained throughout the study without glucose infusions . during the 2 days with hypoglycemia , mmol / l at 40 min , and similar amounts of glucose ( 51 and 53 mg glucose / kg for gip and saline , respectively , p = 0.95 ) were infused to clamp pg between 2 and 3 mmol / l ( days combined ) , which were maintained throughout the study days using 786 and 1,372 mg glucose / kg ( p = 0.01 ) on saline and gip infusion days , respectively . glucose and gip plasma concentrations of glucose ( upper panel ) and gip ( lower panel ) during euglycemia ( dark blue curves , circles ) , hypoglycemia ( blue curves , diamonds ) , and hyperglycemia ( turquoise curves , squares ) on days with gip infusions ( filled symbols ) and days with saline infusion ( open symbols ) . concomitant glucose infusions ( grams per body weight per 15-min time intervals ) are depicted as bar graphs in the upper panel . baseline values varied slightly between study days , with no significant difference between paired gip and saline days with similar glycemic levels ( p = ns ) . during gip infusions , plasma gip concentrations reached high physiological ( postprandial ) levels with similar ( p = 0.55 ) peak values of 121 8 pmol / l ( euglycemic clamp ) , 111 6 pmol / l ( hypoglycemic clamp ) , and 117 7 pmol / l ( hyperglycemic clamp ) . no significant changes in gip concentrations occurred during saline infusions ( p = ns ) . time courses for serum insulin , c - peptide concentrations , and isr values are presented in fig . similar fasting values of insulin and c - peptide were observed on all experimental days . gip infusion during euglycemic conditions resulted in a short - lasting ( 05 min ) increment in isr compared with saline ( 4.8 0.5 vs. 1.7 0.2 pmol / l per kg / min , p < 0.0002 ) . afterward , endogenous insulin secretion fell to , and remained at , basal levels . on the days of insulin - induced hypoglycemia , insulin levels rose similarly to plateau levels of ~600 pmol / l ( fig . initially ( 010 min ) , before pg started to decline , endogenous insulin secretion , assessed as isr , was greater during gip infusion compared with saline ( 3.5 0.7 vs. 1.6 0.2 pmol / l per kg / min , p < 0.02 ) , but thereafter endogenous insulin secretion was suppressed ( fig . 2 , establishment of the 12 mmol / l hyperglycemic clamp induced classical first- and second - phase insulin responses ( as assessed by serum insulin concentrations and isr values ) during saline infusion . during concomitant gip infusion , both first - phase isr ( time 5 min : 20.6 2.3 [ gip ] vs. 16.4 2.0 [ saline ] pmol / l per kg / min , p < 0.052 ) , and especially second - phase isr ( time 45 min : 18.7 1.8 [ gip ] vs. 7.9 0.9 [ saline ] pmol / l per kg / min , p < 0.00001 ) , were potentiated ( fig . 2 ) . insulin , c - peptide , and isr plasma concentrations of insulin ( upper panel ) , c - peptide ( middle panel ) , and isr derived by deconvolution analysis ( lower panel ) over 90 min of gip infusions ( filled symbols ) and saline infusions ( open symbols ) during euglycemia ( dark blue curves , circles ) , insulin - induced hypoglycemia ( blue curves , diamonds ) , and hyperglycemia ( turquoise curves , squares ) . time courses for plasma glucagon concentrations during the 6 experimental days are presented in fig . fasting levels of glucagon were similar on all study days . during the days of euglycemia , gip infusion resulted in greater plasma glucagon concentrations at all time points from 10 to 60 min compared with saline infusions , and iauc values amounted to 86 44 pmol / l per 90 min ( gip ) and 100 21 pmol / l per 90 min ( saline ) , respectively ( p = 0.003 ) . during the days of hypoglycemia , similar peak levels of glucagon were reached after 60 min ( mean cmax 38 5 [ gip ] and 37.7 5 [ saline ] pmol / l , respectively , p = 0.81 ) . the iaucs for the entire 90-min study period were similar ( 1,512 195 vs. 1,467 224 however , for the clinically relevant first half - hour of the hypoglycemic experiments ( fig . 3 ) , the iauc values during gip and saline infusion , respectively , differed significantly ( 76 15 and 28 14 pmol / l per 30 min , p = 0.02 ) . upon establishment of the hyperglycemic clamps , plasma glucagon was suppressed ( and remained so until the end of the experiments ) with no effect of gip compared with saline ( 461 81 vs. 371 glucagon plasma concentrations of glucagon during 90 min ( upper panel ) or the initial 30 min ( lower panel ) of gip infusions ( filled symbols ) or saline infusions ( open symbols ) during euglycemia ( dark blue curves , circles ) , insulin - induced hypoglycemia ( blue curves , diamonds ) , and hyperglycemia ( turquoise curves , squares ) . insets in lower panel are the iaucs of glucagon concentrations during the initial 30 min . statistical analysis was done by repeated - measures anova followed by bonferroni posttests or by paired t tests . mean pg concentrations during each of the 6 experimental days are displayed in fig . 1 , upper panel . baseline pg concentrations did not differ between study days , and the overall mean value amounted to 5.0 0.1 mmol / l . pg concentrations were similar during the paired days of similar glycemia ( p = ns ) . during the days with euglycemia , fasting pg levels were maintained throughout the study without glucose infusions . during the 2 days with hypoglycemia , mmol / l at 40 min , and similar amounts of glucose ( 51 and 53 mg glucose / kg for gip and saline , respectively , p = 0.95 ) were infused to clamp pg between 2 and 3 mmol / l ( days combined ) , which were maintained throughout the study days using 786 and 1,372 mg glucose / kg ( p = 0.01 ) on saline and gip infusion days , respectively . glucose and gip plasma concentrations of glucose ( upper panel ) and gip ( lower panel ) during euglycemia ( dark blue curves , circles ) , hypoglycemia ( blue curves , diamonds ) , and hyperglycemia ( turquoise curves , squares ) on days with gip infusions ( filled symbols ) and days with saline infusion ( open symbols ) . concomitant glucose infusions ( grams per body weight per 15-min time intervals ) are depicted as bar graphs in the upper panel . baseline values varied slightly between study days , with no significant difference between paired gip and saline days with similar glycemic levels ( p = ns ) . during gip infusions , plasma gip concentrations reached high physiological ( postprandial ) levels with similar ( p = 0.55 ) peak values of 121 8 pmol / l ( euglycemic clamp ) , 111 6 pmol / l ( hypoglycemic clamp ) , and 117 7 pmol / l ( hyperglycemic clamp ) . no significant changes in gip concentrations occurred during saline infusions ( p = ns ) . time courses for serum insulin , c - peptide concentrations , and isr values are presented in fig . similar fasting values of insulin and c - peptide were observed on all experimental days . gip infusion during euglycemic conditions resulted in a short - lasting ( 05 min ) increment in isr compared with saline ( 4.8 0.5 vs. 1.7 0.2 pmol / l per kg / min , p < 0.0002 ) . afterward , endogenous insulin secretion fell to , and remained at , basal levels . on the days of insulin - induced hypoglycemia , insulin levels rose similarly to plateau levels of ~600 pmol / l ( fig . ( 010 min ) , before pg started to decline , endogenous insulin secretion , assessed as isr , was greater during gip infusion compared with saline ( 3.5 0.7 vs. 1.6 0.2 pmol / l per kg / min , p < 0.02 ) , but thereafter endogenous insulin secretion was suppressed ( fig . 2 , establishment of the 12 mmol / l hyperglycemic clamp induced classical first- and second - phase insulin responses ( as assessed by serum insulin concentrations and isr values ) during saline infusion . during concomitant gip infusion , both first - phase isr ( time 5 min : 20.6 2.3 [ gip ] vs. 16.4 2.0 [ saline ] pmol / l per kg / min , p < 0.052 ) , and especially second - phase isr ( time 45 min : 18.7 1.8 [ gip ] vs. 7.9 0.9 [ saline ] pmol / l per kg / min , p < 0.00001 ) , were potentiated ( fig . 2 ) . insulin , c - peptide , and isr plasma concentrations of insulin ( upper panel ) , c - peptide ( middle panel ) , and isr derived by deconvolution analysis ( lower panel ) over 90 min of gip infusions ( filled symbols ) and saline infusions ( open symbols ) during euglycemia ( dark blue curves , circles ) , insulin - induced hypoglycemia ( blue curves , diamonds ) , and hyperglycemia ( turquoise curves , squares ) . time courses for plasma glucagon concentrations during the 6 experimental days are presented in fig . fasting levels of glucagon were similar on all study days . during the days of euglycemia , gip infusion resulted in greater plasma glucagon concentrations at all time points from 10 to 60 min compared with saline infusions , and iauc values amounted to 86 44 pmol / l per 90 min ( gip ) and 100 21 pmol / l per 90 min ( saline ) , respectively ( p = 0.003 ) . during the days of hypoglycemia , similar peak levels of glucagon were reached after 60 min ( mean cmax 38 5 [ gip ] and 37.7 5 [ saline ] the iaucs for the entire 90-min study period were similar ( 1,512 195 vs. 1,467 224 pmol / l per 90 min , p = 0.72 ) . however , for the clinically relevant first half - hour of the hypoglycemic experiments ( fig . 3 ) , the iauc values during gip and saline infusion , respectively , differed significantly ( 76 15 and 28 14 pmol / l per 30 min , p = 0.02 ) . upon establishment of the hyperglycemic clamps , plasma glucagon was suppressed ( and remained so until the end of the experiments ) with no effect of gip compared with saline ( 461 81 vs. 371 50 pmol / l per 90 min , p = 0.26 ) . glucagon plasma concentrations of glucagon during 90 min ( upper panel ) or the initial 30 min ( lower panel ) of gip infusions ( filled symbols ) or saline infusions ( open symbols ) during euglycemia ( dark blue curves , circles ) , insulin - induced hypoglycemia ( blue curves , diamonds ) , and hyperglycemia ( turquoise curves , squares ) . insets in lower panel are the iaucs of glucagon concentrations during the initial 30 min . statistical analysis was done by repeated - measures anova followed by bonferroni posttests or by paired t tests . we examined the actions of gip on the two main pancreatic hormones at three distinct glycemic levels and report the novel finding that gip has inverted glucose - dependent effects on insulin and glucagon secretion . thus , gip exhibits glucagonotropic effects during fasting and hypoglycemic conditions when little or no effect on insulin secretion is exerted by the hormone . in contrast , gip has no effect on glucagon secretion during hyperglycemia , when it robustly potentiates glucose - induced insulin secretion . these findings help to explain most of the controversies , which exist in the literature , regarding the glucagonotropic effect of gip . first , many of the negative results in healthy subjects could be related to the elevated glucose levels in studies using hyperglycemic clamping ( 9,10,15 ) . second , the low sensitivity of earlier glucagon assays could explain the negative glucagon responses seen in the earliest study ( 5,16 ) . third , in accordance with our results , a reexamination of the original data from the study by vilsbll et al . ( 8) revealed that short - duration gip infusions ( 30 min ) at a glycemic level of 5 mmol / l actually gave rise to significant glucagon responses compared with saline , but when the glucose levels were increased stepwise , first to 6 mmol / l , the glucagon response was increasingly suppressed , resulting in the nonsignificant differences in total glucagon responses ( gip versus saline ) reported in the original publication . thus , on the basis of the collective human data , a glycemic threshold of ~5.56 mmol / l could exist , below which gip mainly exerts glucagonotropic actions . figure 4 illustrates that the bifunctional glucose - dependent role of gip in vivo ( in humans ) at the physiological pg interval between 3 and 12 mmol / l bears resemblance to the results from perfused rat pancreas reported by pederson and brown ( 4 ) more than 30 years ago . glucagon and c - peptide . the in vivo relation of plasma glucagon ( dark blue curves , squares ) and serum c - peptide ( light blue curves , circles ) to selected pg values between 3 and 12 mmol / l in the presence of stimulated gip concentrations ( broken lines , filled symbols ) or basal levels ( full lines , open symbols ) . although the combined glucagonotropic and insulinotropic effects of gip seem to constitute a preserved physiological mechanism in rodents and humans alike , the physiological relevance of the dual hormonal regulating properties of gip still remains to be elucidated . gip release is stimulated dose dependently not only by glucose but also by protein and fat ingestion and is , under physiological ( postprandial ) circumstances , always present alongside the coincretin , glucagon - like peptide ( glp)-1 ( 17,18 ) . of interest , despite the glucose - dependent insulinotropic effects of both hormones , glp-1 , in contrast to gip , has well - established suppressive effects on glucagon ( 19,20 ) and seemingly also the capability to induce hypoglycemia ( 21 ) . another discerning factor is that gip signaling robustly has been demonstrated to be involved in fat metabolism in rodents and canine ( 2226 ) . yet , although secretion of gip is elevated in obese subjects ( 27 ) and enhanced by high - fat diets ( 28 ) , the relevance of gip in human fat metabolism remains more elusive ( 29 ) . as central nervous tissue rely on stable blood glucose levels , we hypothesize that a role of gip could be , through its glucagonotropic effect , to provide buffering against reactive hypoglycemia , especially after meals with high protein and fat content . a buffering effect on blood glucose levels is also highly compatible with a role for gip as an anabolic hormone for adipose tissue and bone ( 29,30 ) . with regard to the regulation of pancreatic islet hormone secretion , it is interesting that gip during euglycemia causes significant glucagon responses with concurrent insulin responses . in addition , during hyperinsulinemic hypoglycemia , glucagon levels were higher during the first 30 min with elevated levels of gip , despite concomitant higher peripheral and presumably pancreatic intraislet insulin levels . insulin is a well - known inhibitor of -cell secretion , but the mechanism by which this inhibition occurs is not well described ( 2 ) . a proposed mechanism is changes in paracrine -cell secretion ( i.e. , insulin , amylin , -aminobutyric acid , zinc ions , etc . ) as a director of glucagon secretion commonly referred to as the intraislet hypothesis ( 31 ) . thus , the current results demonstrate a dominant effect of gip stimulation on glucagon release ( presumably from pancreatic -cells ) over the proposed negative impact of insulin ( and other products ) secreted from neighboring -cells at euglycemia and hypoglycemia . this is in line with previous results from our group demonstrating that the suppression of glucagon responses during gip infusions at hyperglycemia does not depend on the concurrent rise in insulin responses , a conclusion drawn from studies in patients with type 1 diabetes who tested negative for c - peptide after an intravenous arginine test ( i.e. , without paracrine intraislet influence of insulin ) ( 11 ) . therefore , the prevailing glycemia , seems to be of greater importance in the regulation of glucagon secretion . the consequences of these parallel insulin and glucagon responses at euglycemic levels were a slight lowering effect on pg . this is a probable consequence of the peripheral ( i.e. , nonhepatic ) influence of insulin during these circumstances but certainly does not exclude some buffering effect of glucagon through hepatic glucose production . the influence of insulin on peripheral tissues was further demonstrated during the excursion toward hypoglycemia , where pg levels were almost completely superimposed on days with gip and saline . hence , in the presence of the rather nonphysiological hyperinsulinemia inherent to the clamp in these healthy individuals , the stimulated glucagon levels for the first 30 min were not sufficient to modify the course of the downward - sloping pg curve . during the hyperinsulinemic clamp , the glucagon levels were increased by concomitant gip infusion only in the physiological range of pg ( i.e. , in the range of 3.05.5 the maximal glucagon levels reached ( at the lowest pg levels ) were similar on days with gip and saline , probably as a result of maximal stimulation of glucagon secretion induced by hypoglycemia and activity in the autonomic nervous system ( observed clinically in most of the subjects by sweating ) . it is well established that excess secretion of glucagon ( weighed against a relative lack of insulin ) in the postprandial and fasting state is a major determinant of diabetic hyperglycemia ( 1,32 ) . furthermore , it is evident that the hyperglucagonemia in type 2 diabetes can not solely be explained by a lack of insulin ( 2 ) . intriguingly , in patients with type 2 diabetes the insulinotropic effect of gip is severely deficient ( 9,15 ) . therefore , in these patients a glucagonotropic effect of gip could be a factor adding to the mismatched insulin - to - glucagon ratio . the maximal difference in glucagon levels between gip and saline on the days of euglycemia in the current study amounts to ~4 pmol / l , a difference that could be of clinical relevance in type 2 diabetic patients with insufficient opposing insulin secretion . this is supported by the observation that there is a similar difference ( i.e. , ~4 pmol / l ) in fasting glucagon concentrations between individuals with type 2 diabetes and healthy control subjects ( 33 ) . in further support of this notion , recent studies have shown that gip infused in supraphysiological doses worsens postprandial hyperglycemia ( 34 ) and antagonizes the glucagon - suppressive effects of glp-1 ( 35,36 ) in patients with type 2 diabetes . on the other hand , enhanced gip action in type 2 diabetes could explain the improved glucagon response to hypoglycemia observed during treatment with the dipeptidyl peptidase-4 inhibitor , vildagliptin ( 37 ) . the proposed role of gip as a safeguard against hypoglycemia and its potential pathophysiological implications in type 2 diabetes could benefit from further exploration . in conclusion , thus , gip seems to be a physiological pancreatic islet regulator with diverging effects on the two main pancreatic glucoregulatory hormones insulin and glucagon .

cellular compartmentalization into and within organelles segregates biochemical reactions and increases local molecular concentrations , thereby promoting efficiency of cellular processes . at the plasma membrane , subdomains generate lateral heterogeneity that organizes the spatial distribution of glycoprotein receptors and membrane - proximal effectors . morphologically identifiable plasma membrane domains include the neuronal and immunological synapses , clathrin - coated pits , caveolae , focal adhesions , and cell cell junctions . lipid rafts , including cav1 oligomers or scaffolds , and galectin - glycoprotein lattices form classes of plasma membrane domains that are poorly defined morphologically . cav1 scaffolds are stabilized mesoscale ( 5100 nm ) raft domains , which likely contain at least 15 cav1 molecules . galectins bind and cross - link n - glycans on cell surface glycoproteins to form a heterogeneous lattice . the scaffolding function of caveolins and galectins promotes recruitment of proteins and lipids to domains where homotypic and heterotypic clustering modulates the dynamics and functionality of plasma membrane molecules . macromolecular complexes often exhibit restricted diffusion in membranes of living cells due to their reduced ability to cross barriers between membrane compartments ( kusumi et al . , 2005 ) . domain formation and dynamics are therefore tightly regulated by various cellular components including the actin cytoskeleton and scaffold proteins . in this mini - review , we describe how concerted and competitive interactions between rafts , scaffolds , and lattices regulate receptor dynamics and add another layer of complexity to receptor signaling at the cell surface . galectins are a family of lectins that bind gal - glcnac branches of n - glycans of glycoproteins . 1 ) with multivalent cell surface glycoproteins promotes lattice formation ( demetriou et al . , 2001 ; branched n - glycans , particularly tetraantennary structures generated by golgi 1 , 6n - acetylglucosaminyltransferase v ( glcnac - tv ; encoded by the mgat5 gene ) , represent higher affinity ligands for galectins ( hirabayashi et al . , the number of n - glycans present on glycoproteins also controls galectin affinity for glycosylated receptors ( lau et al . , 2007 ) . when added to the surface of neutrophils and endothelial cells , fluorescently conjugated galectin-3 ( gal-3 ) forms stable oligomers ( nieminen et al . , 2007 ) . gal-3 binding also regulates diffusion rates of cell surface glycoprotein receptors and integrins ( lajoie et al . . however , the dynamics and composition of galectin lattices in different cell types remain to be determined . plasma membrane domains . ( a ) depictions of lattices as multivalent interactions between pentameric gal-3 and glycoproteins , rafts as a component of stall by single particle tracking ( suzuki et al . , 2007b ) , and scaffolds as a minimum oligomer of 15 cav1 molecules . ( b ) cav1 domains include caveolae , cav1 scaffolds , and py14cav1 scaffold domains in focal adhesions . cav1 scaffolds may function to restrict signaling of cytokine receptors , such as egfr , through direct interactions . however , how stable cav1 domains regulate dynamic raft behavior , both within the plane of the membrane and in the endocytosis of various ligands such as ct - b , remains unclear . one potential role for the lattice might be to enhance crosstalk between integrins and signaling receptors . indeed , mgat5 expression regulates egf - dependent dephosphorylation of fak and activation of shp2 , key regulators of focal adhesion dynamics ( guo et al . , 2007 ) . integrin cross - linking by gal-1 recruits pre - b cell receptors into the immune synapse ( rossi et al . , for instance , terminal 2 - 6 sialylation of n - glycans on integrins and the trpv5 ca channel reduces binding to galectins ( cha et al . , 2008 ; zhuo et al . , . fluorescence resonance energy transfer , single particle tracking , and electron microscopy studies all support the concept of rafts as dynamic and transient nanoscale structures ( hancock , 2006 ) . lipid rafts may however fuse in response to signaling events into larger , more stable signal transduction platforms ( simons and toomre , 2000 ) . advances in temporal and spatial resolution using single particle tracking and stimulated emission depletion ( sted ) microscopy have highlighted the cholesterol - sensitive , subsecond ( 1020 ms in < 20-nm domains by sted ) transient anchoring of raft - associated sphingolipids and glycosylphosphatidylinositol ( gpi)-anchored proteins ( chen et al . the gpi - anchored cd59 receptor interacts frequently with its effector , lyn kinase ; but only after recruitment of g2 does the cd59lyn complex stabilize , forming a domain ( 50 nm in diameter ) termed stimulation - induced temporary arrest of lateral diffusion ( stall ) . stall is actin - dependent and cholesterol - sensitive , and replacing the gpi anchor of lyn with a nonraft transmembrane domain limits stall , implicating rafts in stall formation ( fig . cortical actin is also a critical determinant of the formation of cholesterol - sensitive gpi - anchored protein nanoclusters ( goswami et al . , 2008 ) . transient recruitment and stabilization of signaling complexes within rafts thereby generates quantal signals whose integration produces the bulk cellular signaling response . cav1 scaffold , represent stable raft structures that may exhibit many of the signaling regulatory properties associated with cav1 . cav1 is the major protein constituent of caveolae , smooth cholesterol - sensitive invaginations of the plasma membrane ( parton and simons , 2007 ) whose formation also requires a cytoplasmic protein , ptrf - cavin ( hill et al . , 2008 ; liu and pilch , 2008 ) . caveolae are predicted to contain between 100 and 200 cav1 molecules , but the minimal sds - stable cav1 oligomer contains only 15 cav1 molecules ( monier et al . , 1995 ; parton et al . , even when expressed at low levels independently of caveolae formation , cav1 still forms oligomers that are effectively immobile in the plasma membrane ( lajoie et al . , 2007 ) . as discussed below , noncaveolar functions of the cav1 scaffold may include regulation of growth factor receptor signaling , raft - dependent endocytosis , and focal adhesion dynamics . cav1 is a well - characterized inhibitor of growth factor receptor signaling ( goetz et al . , 2008b ) . for example , cav1 interacts with egf receptor ( egfr ) via its 20amino acid scaffolding domain and negatively regulates egf responsiveness and egfr lateral diffusion , even under conditions of reduced caveolae formation ( couet et al . , 1997 ; furthermore , egfr distribution to morphologically defined caveolae by electron microscopy is evident only in cells treated with high levels of egf ( sigismund et al . , this suggests that in the absence of ligand , egfr binds cav1 outside of caveolae . similarly , endothelial cell - specific expression of cav1 reduces endothelial nos activation but not plasma membrane caveolae , which suggests a functional role for noncaveolar cav1 ( bauer et al . , cav1 may function indirectly to regulate raft - dependent endocytosis by altering the lipid composition of raft domains ( lajoie and nabi , 2007 ) . cav1 inhibition of the raft - dependent endocytosis of cholera toxin b subunit ( ct - b ) and dysferlin occurs independently of direct interaction with cav1 or caveolae ( hernandez - deviez et al . , 2008 ; overexpression of glycosphingolipids and cholesterol overrides negative regulation of raft - dependent endocytosis by cav1 ( sharma et al . , 2004 ) . cav1 binding to cholesterol and recruitment of cholesterol to raft domains ( murata et al . , 1995 ; smart et al . , 1996 ) could induce both local and global changes in membrane lipid composition that impact on the dynamics , functionality , and endocytic potential of lipid rafts . cav1 is a substrate of src kinase , and its tyrosine 14 phosphorylation ( py14cav1 ) regulates its interaction with integrins , various signaling adapters , and protein tyrosine phosphatases ( goetz et al . , 2008b ) . the ability of py14cav1 to induce ordered microdomains within focal adhesions as well as stabilize focal adhesion associated fak implicates py14cav1-mediated domain organization in the promotion of focal adhesion signaling and turnover leading to increased tumor cell migration ( gaus et al . , 2006 ; goetz et al . structural differences between oligomerized cav1 and py14cav1 scaffold domains remain unclear ; however , both appear to regulate the formation of ordered lipid domains ( gaus et al . , 2006 ; parton and simons , 2007 ) . collectively , stable cav1 oligomers distinct from caveolae therefore form scaffolds that interact with proteins and lipids to regulate plasma membrane organization , cell surface signaling , and raft - dependent endocytosis ( fig . exchange of receptors between membrane domains is a critical aspect of cellular sensitivity to extracellular cues . reduced t cell activation and autoimmunity in mice lacking mgat5 and the galectin lattice is due to enhanced t cell receptor ( tcr ) clustering ( demetriou et al . , 2001 ) . in resting t cells , the mgat5/galectin lattice partitions cd45 inside the raft immune synapse and partitions tcr cd4-lck zap-70 complexes outside the raft immune synapse , opposing cytoplasmic interactions with the actin cytoskeleton and tcr activation ( chen et al . , 2007 ) . recruitment to the galectin lattice , promoted by metabolite flux through the hexosamine pathway ( grigorian et al . , 2007 ) , dampens tcr signaling and autoimmunity by sequestering tcr outside the immune synapse . for egfr and other cytokine receptors ( including tgfr , pdgfr , and insulin - like growth factor receptor [ igfr ] ) , receptor recruitment to the galectin lattice potentiates ligand - induced clustering and signaling ( partridge et al . , 2004 ) . in mammary tumor cells , the mgat5/galectin lattice sequesters egfr , protecting them from interacting with cav1 scaffolds , hence promoting growth factor signaling potential and tumor growth ( lajoie et al . , 2007 ) multivalent association of egfr with the galectin lattice under conditions of higher n - glycan branching ( i.e. , mgat5 activity ) appears to be dominant over stable interaction of the receptor with cav1 scaffolds . py14cav1 promotion of fak stabilization in focal adhesions is dependent on expression of mgat5 and gal-3 ( goetz et al . , 2008a ) . in light of the ability of py14cav1 to induce raft - like domains within focal adhesions ( gaus et al . , 2006 ) , this is a clear example of microdomain interaction where the extracellular galectin lattice works in concert with intracellular py14cav1 scaffold domains to regulate focal adhesion dynamics and cell motility . the ability of the lattice to relieve egfr suppression , to override cav1 tumor suppressor activity , and to function with py14cav1 to promote tumor cell migration provides an elegant example of how membrane domains interact to regulate complex cell behavior ( fig . 2 ) . the galectin lattice and raft domains therefore compete to regulate receptor signaling , with the lattice functioning as both a suppressor ( tcr ) and enhancer ( egfr , others ) of receptor availability to the ligand , but they also synergize to promote integrin - dependent focal adhesion dynamics . ( 1 ) in cells lacking the galectin lattice , cav1 scaffolds recruit receptors and inhibit signaling . ( 2 ) loss of cav1 enables receptor signaling , promoting tumor cell proliferation and tumor growth . ( 3 ) expression of mgat5-branched n - glycans and gal-3 and receptor recruitment to the galectin lattice limits receptor down - regulation via endocytosis , and promotes signaling potential . ( 4 ) receptor sequestration by the galectin lattice overrides cav1 suppressor activity , enabling elevated cav1 expression in advanced tumors . gal-3 and py14cav1 work together to promote focal adhesion turnover and enhance fak activation , tumor cell migration , and metastasis . competitive and coordinate action between cav1 scaffolds and the galectin lattice at various stages of tumor progression may explain how cav1 can act as both a tumor promoter and suppressor . at the plasma membrane , caveolins and galectins play important roles as molecular organizers that promote heterotypic protein and lipid interactions to modulate molecular diffusion and turnover of functional domains . the lattice and cav1 scaffold domains regulate recruitment , dynamics , and exchange of glycoproteins and lipids between membrane microdomains . crosstalk between lattices , scaffolds , and rafts represents an exciting new level of plasma membrane complexity that is likely to provide insight into the cell biology of development and disease . galectins are a family of lectins that bind gal - glcnac branches of n - glycans of glycoproteins . 1 ) with multivalent cell surface glycoproteins promotes lattice formation ( demetriou et al . , 2001 ; branched n - glycans , particularly tetraantennary structures generated by golgi 1 , 6n - acetylglucosaminyltransferase v ( glcnac - tv ; encoded by the mgat5 gene ) , represent higher affinity ligands for galectins ( hirabayashi et al . , 2002 ) . the number of n - glycans present on glycoproteins also controls galectin affinity for glycosylated receptors ( lau et al . , 2007 ) . when added to the surface of neutrophils and endothelial cells , fluorescently conjugated galectin-3 ( gal-3 ) forms stable oligomers ( nieminen et al . , 2007 ) . gal-3 binding also regulates diffusion rates of cell surface glycoprotein receptors and integrins ( lajoie et al . , 2007 ; goetz et al . , . however , the dynamics and composition of galectin lattices in different cell types remain to be determined . ( a ) depictions of lattices as multivalent interactions between pentameric gal-3 and glycoproteins , rafts as a component of stall by single particle tracking ( suzuki et al . , 2007b ) , and scaffolds as a minimum oligomer of 15 cav1 molecules . ( b ) cav1 domains include caveolae , cav1 scaffolds , and py14cav1 scaffold domains in focal adhesions . cav1 scaffolds may function to restrict signaling of cytokine receptors , such as egfr , through direct interactions . however , how stable cav1 domains regulate dynamic raft behavior , both within the plane of the membrane and in the endocytosis of various ligands such as ct - b , remains unclear . one potential role for the lattice might be to enhance crosstalk between integrins and signaling receptors . indeed , mgat5 expression regulates egf - dependent dephosphorylation of fak and activation of shp2 , key regulators of focal adhesion dynamics ( guo et al . , 2007 ) . integrin cross - linking by gal-1 recruits pre - b cell receptors into the immune synapse ( rossi et al . for instance , terminal 2 - 6 sialylation of n - glycans on integrins and the trpv5 ca channel reduces binding to galectins ( cha et al . , 2008 ; zhuo et al . , 2008 ) , and lipid rafts are dynamic cholesterol- and sphingolipid - rich membrane domains . fluorescence resonance energy transfer , single particle tracking , and electron microscopy studies all support the concept of rafts as dynamic and transient nanoscale structures ( hancock , 2006 ) . lipid rafts may however fuse in response to signaling events into larger , more stable signal transduction platforms ( simons and toomre , 2000 ) . advances in temporal and spatial resolution using single particle tracking and stimulated emission depletion ( sted ) microscopy have highlighted the cholesterol - sensitive , subsecond ( 1020 ms in < 20-nm domains by sted ) transient anchoring of raft - associated sphingolipids and glycosylphosphatidylinositol ( gpi)-anchored proteins ( chen et al . the gpi - anchored cd59 receptor interacts frequently with its effector , lyn kinase ; but only after recruitment of g2 does the cd59lyn complex stabilize , forming a domain ( 50 nm in diameter ) termed stimulation - induced temporary arrest of lateral diffusion ( stall ) . stall is actin - dependent and cholesterol - sensitive , and replacing the gpi anchor of lyn with a nonraft transmembrane domain limits stall , implicating rafts in stall formation ( fig . cortical actin is also a critical determinant of the formation of cholesterol - sensitive gpi - anchored protein nanoclusters ( goswami et al . , 2008 ) . transient recruitment and stabilization of signaling complexes within rafts thereby generates quantal signals whose integration produces the bulk cellular signaling response . oligomerized cav1 microdomains , for which we propose the name cav1 scaffold , represent stable raft structures that may exhibit many of the signaling regulatory properties associated with cav1 . cav1 is the major protein constituent of caveolae , smooth cholesterol - sensitive invaginations of the plasma membrane ( parton and simons , 2007 ) whose formation also requires a cytoplasmic protein , ptrf - cavin ( hill et al . , 2008 ; liu and pilch , 2008 ) . caveolae are predicted to contain between 100 and 200 cav1 molecules , but the minimal sds - stable cav1 oligomer contains only 15 cav1 molecules ( monier et al . , 1995 ; parton et al . , 2006 ) that may correspond to the cav1 scaffold domain ( fig . even when expressed at low levels independently of caveolae formation , cav1 still forms oligomers that are effectively immobile in the plasma membrane ( lajoie et al . , 2007 ) . as discussed below , noncaveolar functions of the cav1 scaffold may include regulation of growth factor receptor signaling , raft - dependent endocytosis , and focal adhesion dynamics . cav1 is a well - characterized inhibitor of growth factor receptor signaling ( goetz et al . for example , cav1 interacts with egf receptor ( egfr ) via its 20amino acid scaffolding domain and negatively regulates egf responsiveness and egfr lateral diffusion , even under conditions of reduced caveolae formation ( couet et al . , 1997 ; egfr distribution to morphologically defined caveolae by electron microscopy is evident only in cells treated with high levels of egf ( sigismund et al . this suggests that in the absence of ligand , egfr binds cav1 outside of caveolae . similarly , endothelial cell - specific expression of cav1 reduces endothelial nos activation but not plasma membrane caveolae , which suggests a functional role for noncaveolar cav1 ( bauer et al . , 2005 ) . cav1 may function indirectly to regulate raft - dependent endocytosis by altering the lipid composition of raft domains ( lajoie and nabi , 2007 ) . cav1 inhibition of the raft - dependent endocytosis of cholera toxin b subunit ( ct - b ) and dysferlin occurs independently of direct interaction with cav1 or caveolae ( hernandez - deviez et al . overexpression of glycosphingolipids and cholesterol overrides negative regulation of raft - dependent endocytosis by cav1 ( sharma et al . , 2004 ) . cav1 binding to cholesterol and recruitment of cholesterol to raft domains ( murata et al . , 1995 ; smart et al . , 1996 ) could induce both local and global changes in membrane lipid composition that impact on the dynamics , functionality , and endocytic potential of lipid rafts . cav1 is a substrate of src kinase , and its tyrosine 14 phosphorylation ( py14cav1 ) regulates its interaction with integrins , various signaling adapters , and protein tyrosine phosphatases ( goetz et al . , 2008b ) . the ability of py14cav1 to induce ordered microdomains within focal adhesions as well as stabilize focal adhesion associated fak implicates py14cav1-mediated domain organization in the promotion of focal adhesion signaling and turnover leading to increased tumor cell migration ( gaus et al . , 2006 ; goetz et al . , 2008a ; joshi et al , 2008 ) . structural differences between oligomerized cav1 and py14cav1 scaffold domains remain unclear ; however , both appear to regulate the formation of ordered lipid domains ( gaus et al . , 2006 ; parton and simons , 2007 ) . collectively , stable cav1 oligomers distinct from caveolae therefore form scaffolds that interact with proteins and lipids to regulate plasma membrane organization , cell surface signaling , and raft - dependent endocytosis ( fig . exchange of receptors between membrane domains is a critical aspect of cellular sensitivity to extracellular cues . reduced t cell activation and autoimmunity in mice lacking mgat5 and the galectin lattice is due to enhanced t cell receptor ( tcr ) clustering ( demetriou et al . , 2001 ) . in resting t cells , the mgat5/galectin lattice partitions cd45 inside the raft immune synapse and partitions tcr cd4-lck zap-70 complexes outside the raft immune synapse , opposing cytoplasmic interactions with the actin cytoskeleton and tcr activation ( chen et al . , 2007 ) . recruitment to the galectin lattice , promoted by metabolite flux through the hexosamine pathway ( grigorian et al . , 2007 ) , dampens tcr signaling and autoimmunity by sequestering tcr outside the immune synapse . for egfr and other cytokine receptors ( including tgfr , pdgfr , and insulin - like growth factor receptor [ igfr ] ) , receptor recruitment to the galectin lattice potentiates ligand - induced clustering and signaling ( partridge et al . , 2004 ) . in mammary tumor cells , the mgat5/galectin lattice sequesters egfr , protecting them from interacting with cav1 scaffolds , hence promoting growth factor signaling potential and tumor growth ( lajoie et al . , 2007 ) . multivalent association of egfr with the galectin lattice under conditions of higher n - glycan branching ( i.e. , mgat5 activity ) appears to be dominant over stable interaction of the receptor with cav1 scaffolds . py14cav1 promotion of fak stabilization in focal adhesions is dependent on expression of mgat5 and gal-3 ( goetz et al . , 2008a ) . in light of the ability of py14cav1 to induce raft - like domains within focal adhesions ( gaus et al . , 2006 ) , this is a clear example of microdomain interaction where the extracellular galectin lattice works in concert with intracellular py14cav1 scaffold domains to regulate focal adhesion dynamics and cell motility . the ability of the lattice to relieve egfr suppression , to override cav1 tumor suppressor activity , and to function with py14cav1 to promote tumor cell migration provides an elegant example of how membrane domains interact to regulate complex cell behavior ( fig . 2 ) . the galectin lattice and raft domains therefore compete to regulate receptor signaling , with the lattice functioning as both a suppressor ( tcr ) and enhancer ( egfr , others ) of receptor availability to the ligand , but they also synergize to promote integrin - dependent focal adhesion dynamics . ( 1 ) in cells lacking the galectin lattice , cav1 scaffolds recruit receptors and inhibit signaling . ( 2 ) loss of cav1 enables receptor signaling , promoting tumor cell proliferation and tumor growth . ( 3 ) expression of mgat5-branched n - glycans and gal-3 and receptor recruitment to the galectin lattice limits receptor down - regulation via endocytosis , and promotes signaling potential . ( 4 ) receptor sequestration by the galectin lattice overrides cav1 suppressor activity , enabling elevated cav1 expression in advanced tumors . gal-3 and py14cav1 work together to promote focal adhesion turnover and enhance fak activation , tumor cell migration , and metastasis . competitive and coordinate action between cav1 scaffolds and the galectin lattice at various stages of tumor progression may explain how cav1 can act as both a tumor promoter and suppressor . at the plasma membrane , caveolins and galectins play important roles as molecular organizers that promote heterotypic protein and lipid interactions to modulate molecular diffusion and turnover of functional domains . the lattice and cav1 scaffold domains regulate recruitment , dynamics , and exchange of glycoproteins and lipids between membrane microdomains . crosstalk between lattices , scaffolds , and rafts represents an exciting new level of plasma membrane complexity that is likely to provide insight into the cell biology of development and disease .

preterm birth ( ptb ) continues to be a leading cause of neonatal morbidity and mortality . defined as birth prior to 37 weeks of gestation , ptb accounts for over 35% of health care spending for infants and 10% of health care spending for children in the united states . the incidence of ptb has been estimated to be 12 - 13% in the united states or approximately 467,000 annual live births significantly higher compared to european and other developed countries with incidence at 59% [ 24 ] . in fact , from 1996 to 2006 , there was a steady increase in ptbs in the us to a peak at 12.8%with the first decline in 2007 with a ptb rate of 12.7% [ 5 , 6 ] . moreover , despite advances in management of preterm labor and care of preterm infants , ptb still constitutes 75% of neonatal mortality and 50% of long - term neurologic impairment in children . spontaneous ptb ( sptb ) accounts for the large majority ( 6585% ) of ptb and is strongly associated with infection . as a result , considerable effort has been dedicated to evaluate antimicrobial therapy as an intervention to prevent ptb . the purpose of this report is to review the role of infection in the epidemiology of ptb specifically focusing on the use antibiotics to prevent ptb . we implemented a descriptive and analytic literature review of antimicrobial therapy to prevent ptb ; our objective was not to conduct a synthetic meta - analysis ( with summary estimates ) . rather , it was to identify relevant contemporary articles on infection and antimicrobial therapy for ptb prevention . we searched the pubmed database restricted to clinical trials or meta - analyses published in english since 1990 . keywords for this search included antibiotics or antimicrobials and preterm yielding 67 abstracts for review by 2 authors . of these 67 abstracts , only 31 eligible clinical trials ( n = 26 ) or meta - analysis ( n = 5 ) evaluated the use of antimicrobials to prevent ptb , and this was retrieved for further full - text review . for each eligible study we present its specific inclusion criteria , the antibiotic regimen used , and the study results . the relative frequencies of the 3 major subcategories of preterm birth are the following : spontaneous preterm labor ( 50% ) , delivery for maternal or fetal indications ( 30% ) , and preterm premature rupture of membranes or pprom ( 20% ) [ 8 , 9 ] . compared with other ethnicities , black women are at disproportionately increased risk for ptb ; risks are generally lower among hispanic women . black women have double the rates of ptb as white women and women with a previous preterm delivery have a 1550% recurrence risk . increasing prevalence of assisted reproductive technology and multiple gestations , as well as maternal and fetal indications including hypertension , diabetes , and intrauterine growth restriction late preterm births ( defined as birth between 34 and 36 weeks ) contribute over 70% of ptb . while these births carry less risk of neonatal morbidity and mortality than earlier births , they still carry a greater risk of neonatal impairment compared to term births . overall , key risk factors for preterm birth include age , race , nutritional status , a history of a previous ptb , multiple gestation , smoking , altered vaginal bacterial flora , and presence of infection . obesity itself is associated with hypertension and preeclampsia leading to indicated preterm birth but has been noted to be protective of spontaneous preterm birth . how these risk factors contribute to the pathogenesis of spontaneous preterm labor and preterm premature rupture of membranes ( pprom ) is largely unknown . proposed mechanisms of term labor include progesterone withdrawal , oxytocin initiation , decidual activation , and activation of the fetal immune response . the first two pathways have not been clearly elicited in humans , but inflammation - mediated decidual activation seems plausible . in this theory , infection , inflammation , or hemorrhage stimulates the innate immune system ; chemokines and cytokines induce prostaglandins and other matrix degrading enzymes causing uterine contractility and degradation of extracellular matrix leading to labor and rupture of membranes [ 12 , 13 ] . while this could similarly be implicated in preterm labor and prom , other mechanisms include infection , inflammation , uteroplacental ischemia of hemorrhage , uterine overdistension , or psychosocial stress . intrauterine infection is estimated based on studies of amniotic fluid and cultures to be associated with approximately 2540% of ptb the association stronger , the earlier the gestation at birth . the different types of infection involving the maternal fetal interface include deciduitis , chorioamnionitis , villitis , and funisitis . although infection is noted to be extremely common in preterm delivery , it is often chronic , subclinical , and asymptomatic ( apart from labor ) . in one study of 602 women delivered by cesarean section prior to membrane rupture , 121 ( 20.1% ) had positive membrane culture ; 50% of these women also had positive amniotic fluid culture often with the same organism . in another study of the placentas of 446 mother - infant pairs , women with a sptb were significantly more likely to have acute inflammation of the membranes , chorionic plate , and the umbilical cord than women with indicated preterm births . these substances activate both a maternal response stimulating the release of cytokines such as tumor necrosis factor alpha ( tnf - alpha ) , interleukin-1alpha , interleukin-1 , interleukin-6 , interleukin-8 , granulocyte colony - stimulating factor ( g - csf ) , and other factors [ 12 , 1418 ] . these active substances stimulate the production and release of prostaglandins causing uterine contractility and neutrophil activity and thereby synthesis and release of metalloproteinases causing rupture of membranes and remodeling of collagen in the cervix [ 1921 ] . a fetal response also may occur , in which infection stimulates the production of corticotropin - releasing hormone ( from the fetal hypothalamus and placenta ) causing an increase in fetal corticotropin and thereby fetal cortisol also stimulating prostaglandins . multiple inflammatory markers have been noted to be elevated in amniotic fluid , the serum , or vaginal and cervical secretions . these include amniotic fluid interleukin-6 concentration interleukin-1 , interleukin-8 , g - csf , and tnf - alpha , ferritin , and fetal fibronectin ; however , none of these markers have been found useful in predicting preterm delivery in routine clinical practice [ 12 , 23 ] . given the strong association between sptb and infection , prophylactic antibiotics seem a logical preventative strategy for ptb . this review focuses on the specific infections associated with ptb and the effectiveness and safety of antibiotic prophylaxis . in order to evaluate the effectiveness of specific antibiotics used to prevent ptb , it is important to consider the microbes implicated in associated intrauterine infections . organisms most commonly gain access to the uterus and pregnancy by ascending from the vagina and cervix . less frequent pathways include iatrogenic inoculation during amniocentesis or chorionic villus sampling , hematogeneous spread through uterine and placental blood flow or through descending infection from the abdominal cavity and fallopian tubes to the chorioamnion . ascending infection extends to the choriodecidual space and may ultimately invade the membranes , amniotic fluid , and fetus . the exact timing of infection in relation to pregnancy is not fully elucidated but has been hypothesized to occur early in gestation or even in the preconceptional period . the most commonly isolated organisms include microbes with low virulence : ureaplasma urealyticum , mycoplasma hominis , gardnerella vaginalis , peptostreptococcus , and bacteroides species all organisms of vaginal flora [ 2528 ] . ureaplasma and mycoplasma species are the most common microbes cultured from placental tissue and fluids obtained from patients with histologic and clinical chorioamnionitis . in a study of umbilical cord blood in preterm 2332-week births , goldenberg et al . showed that ureaplasma urealyticum and/or mycoplasma hominis were present in 23% of cultures especially in women undergoing spontaneous compared to indicated preterm delivery ( 34.7% versus 3.2% , p < 0.001 ) . bacterial vaginosis ( bv ) is also commonly associated with ptb . due to an interruption in normal vaginal flora , it is characterized by a reduction in lactobacillus and an overgrowth of other anaerobic bacteria such as gardenerella , bacteroides , and mobiluncus . its diagnosis is based on either amsel 's criteria ( taking into account vaginal ph , presence of discharge , amine odor , or presence of clue cells ) or nugent 's score ( a gram stain scoring system ) . bacterial vaginosis is present in 1542% of pregnant women and confers a 2 to 4-fold independent increase in the risk of spontaneous preterm birth and prom [ 3033 ] . in a meta - analysis the alterations in vaginal flora by bacterial vaginosis may also increase susceptibility to other ascending genital tract infections . sexually transmitted infections including trichomonas vaginalis , neisseria gonorrhoeae , chlamydia trachomatis and syphilis have also been associated with preterm delivery and intrauterine infection [ 3436 ] . numerous small studies have shown adverse outcomes associated with trichomoniasis including ptb , prom , and low birth weight . in the largest study of trichomoniasis during pregnancy , cotch et al . studied over 12,000 women and noted a modest 1.3 odds ratio of preterm delivery ( 95% ci 1.11.4 ) . other genitourinary microbes such as group b streptococcus and escherichia coli have also been described in intrauterine infection and consequent preterm delivery . nongynecologic infections have also been studied in ptb including pneumonia , pyelonephritis , periodontitis , and gastrointestinal infections [ 37 , 38 ] . the mechanism of action of these infections is thought to be an acute inflammatory response , but for periodontal disease it is hypothesized to be transient bacteremia and hematogenous spread to the placenta , chorioamnion , and fetus . viral infections such as varicella and influenza have been associated with ptb ; however , the role of viral infection in ptb but has been inadequately studied [ 8 , 39 , 40 ] . given the abounding data associating various infections with ptb , it is natural to consider the use of antibiotic and other antimicrobial therapy to prevent ptb . studies have investigated the use of different antimicrobials both as empiric therapy providing broad coverage to prevent or treat infection and as targeted therapy against specific infections . in addition , the timing of antibiotic therapy in relation to pregnancy varies . characteristics and findings from individual studies macrolides ( commonly erythromycin , azithromycin ) , beta - lactams , clindamycin , and metronidazole have been used in isolation or in combination as empiric therapy to prevent ptb . macrolides and other bacteriostatic agents have been advocated since they suppress bacterial virulence as opposed to bactericidal agents such as penicillins , which theoretically may worsen outcomes for preterm infants by releasing bacterial endotoxins . combination antimicrobials provide empiric coverage against the common microbes including ureaplasmas , gram - negative rods , and anaerobes . beta - lactamsthree randomized controlled studies have focused solely on the penicillin family of antimicrobials and ptb . newton et al . failed to show any benefit in terms of days gained , neonatal outcome , or gestational age in a double - blind trial of the combination of ampicillin / sulbactam with indomethacin a nonsteroidal anti - inflammatory tocolytic in the setting of magnesium tocolysis . similarly , cox et al . randomized 78 women in preterm labor with intact membranes at 24 to 34 weeks of gestation to either parenteral ampicillin ( 2 grams ) + sulbactam ( 1 grams ) for 2 days followed by oral amoxicillin - clavulanic acid ( 250 mg ) for 5 days ( n = 39 ) , or to similar placebo ( n = 39 ) . steroids or there was no difference in the mean gestational age at delivery ( 34.2 0.7 versus 34.1 0.9 , not significant ) ; other perinatal outcomes were similar . finally , gordon described similar findings among 117 women in preterm labor randomized to receive 2 grams of parenteral ceftizoxime or placebo for 5 days . the primary outcome of interest , mean interval to delivery , was not significantly different between the two groups ( 34.5 21.1 days versus 34.6 24.5 days , p = 0.99 ) . in these three studies , regardless of the use of tocolysis or steroid administration , no significant benefit was associated with the use of penicillins . three randomized controlled studies have focused solely on the penicillin family of antimicrobials and ptb . newton et al . failed to show any benefit in terms of days gained , neonatal outcome , or gestational age in a double - blind trial of the combination of ampicillin / sulbactam with indomethacin a nonsteroidal anti - inflammatory tocolytic in the setting of magnesium tocolysis . randomized 78 women in preterm labor with intact membranes at 24 to 34 weeks of gestation to either parenteral ampicillin ( 2 grams ) + sulbactam ( 1 grams ) for 2 days followed by oral amoxicillin - clavulanic acid ( 250 mg ) for 5 days ( n = 39 ) , or to similar placebo ( n = 39 ) . steroids or tocolysis were not administered . there was no difference in the mean gestational age at delivery ( 34.2 0.7 versus 34.1 0.9 , not significant ) ; other perinatal outcomes were similar . finally , gordon described similar findings among 117 women in preterm labor randomized to receive 2 grams of parenteral ceftizoxime or placebo for 5 days . the primary outcome of interest , mean interval to delivery , was not significantly different between the two groups ( 34.5 21.1 days versus 34.6 24.5 days , p = 0.99 ) . in these three studies , regardless of the use of tocolysis or steroid administration , no significant benefit was associated with the use of penicillins . clindamycinwhile studies of beta - lactams have not been promising , a small - randomized trial by mcgregor et al . showed some benefit of clindamycin . women on tocolysis for preterm labor at gestational age less than 34 weeks were randomized to receive either placebo versus parenteral followed by oral clindamycin for 7 days . patients treated with clindamycin at gestational ages less than 32 weeks were more likely to have increased duration of pregnancies ( 35 versus 25 days , p = 0.02 ) . moreover , in a subgroup analysis , those women diagnosed with bacterial vaginosis and then treated with clindamycin were more likely to have longer pregnancy latency , increased birth weights , and increased gestational age at delivery . described up to a 60% reduction of ptb with the use of 2% clindamycin cream in patients with abnormal genetic flora ( 4% versus 10% ; p < 0.03 ) . however , other studies of vaginal clindamycin specifically for bacterial vaginosis discussed below have been contradictory . some studies have even suggested increased risk of bacterial resistance and neonatal morbidity [ 61 , 62 ] . given the disparity of findings , the role of clindamycin in ptb prevention remains inconclusive . while studies of beta - lactams have not been promising , a small - randomized trial by mcgregor et al . women on tocolysis for preterm labor at gestational age less than 34 weeks were randomized to receive either placebo versus parenteral followed by oral clindamycin for 7 days . patients treated with clindamycin at gestational ages less than 32 weeks were more likely to have increased duration of pregnancies ( 35 versus 25 days , p = 0.02 ) . moreover , in a subgroup analysis , those women diagnosed with bacterial vaginosis and then treated with clindamycin were more likely to have longer pregnancy latency , increased birth weights , and increased gestational age at delivery . described up to a 60% reduction of ptb with the use of 2% clindamycin cream in patients with abnormal genetic flora ( 4% versus 10% ; p < 0.03 ) . however , other studies of vaginal clindamycin specifically for bacterial vaginosis discussed below have been contradictory . some studies have even suggested increased risk of bacterial resistance and neonatal morbidity [ 61 , 62 ] . given the disparity of findings , the role of clindamycin in ptb prevention remains inconclusive . azithromycinfew studies have been performed solely on macrolides . in the large 2200 patient apple study conducted in southern malawi , van den broek et al . conducted a placebocontrolled trial of oral azithromycin ( 1 gram ) given at 1624 and again at 2832-weeks , gestation to unselected women . findings showed no significant differences in outcomes between the two groups regarding ptb ( 16.8% versus 17.4% , odds ratio 0.96 ( 0.761.21 ) ) or other perinatal outcomes including perinatal mortality . further inclusion of this study in a meta - analysis with seven other studies also failed to show any salutary effect on ptb . few studies have been performed solely on macrolides . in the large 2200 patient apple study conducted in southern malawi , van den broek et al . conducted a placebocontrolled trial of oral azithromycin ( 1 gram ) given at 1624 and again at 2832-weeks , gestation to unselected women . findings showed no significant differences in outcomes between the two groups regarding ptb ( 16.8% versus 17.4% , odds ratio 0.96 ( 0.761.21 ) ) or other perinatal outcomes including perinatal mortality . further inclusion of this study in a meta - analysis with seven other studies also failed to show any salutary effect on ptb . combination antibiotic regimensit seems that , regardless of the antibiotic of choice , gestational age at administration , route of administration , days of therapy , or repeat dosages of antibiotics , no single agent has been noted to be efficacious in the prevention of ptb . thus , trials involving empiric combination antibiotic regimens are more prevalent in the obstetric literature . it seems that , regardless of the antibiotic of choice , gestational age at administration , route of administration , days of therapy , or repeat dosages of antibiotics , no single agent has been noted to be efficacious in the prevention of ptb . thus , trials involving empiric combination antibiotic regimens are more prevalent in the obstetric literature . beta - lactams plus metronidazolenorman et al . randomized 81 women in preterm labor to receive parenteral ampicillin or oral amoxicillin and metronidazole for 5 days ( n = 43 ) versus no antibiotic treatment ( n = 38 ) . all women were treated with indomethacin and hexoprenaline for tocolysis and betamethasone for fetal lung maturity . women receiving antibiotics had significantly prolonged pregnancies ( median 15 versus 2.5 days , p = 0.04 ) . in addition , patients in the control group had significantly increased risks of necrotizing enterocolitis ( 5 versus 0 , p = 0.02 ) .similar benefit of ampicillin plus metronidazole was noted by svare et al . in a randomized study of 112 women in preterm labor with intact membranes between 26- and 34-weeks gestation . women receiving parenteral ampicillin for 24-hour followed by penicillin agent pivampicin 500 milligrams orally for 7 days ) and metronidazole for 7 days were compared to controls receiving placebo . those receiving antibiotics had prolonged pregnancy ( 47.5 days versus 27 days , p < 0.05 ) , higher mean gestational age at delivery ( 37 versus 34 weeks , p < 0.05 ) , decreased incidence of preterm birth < 37 weeks ( 42% versus 65% , p < 0.05 ) , and lower rates of admission to neonatal intensive care unit ( 40% versus 63% , p < 0.05 ) . although both studies noted some benefit with the beta - lactam plus metronidazole antibiotic regimens , no larger studies have been performed . moreover , improved outcomes could have been secondary to tocolysis and/or antenatal steroid therapy . norman et al . randomized 81 women in preterm labor to receive parenteral ampicillin or oral amoxicillin and metronidazole for 5 days ( n = 43 ) versus no antibiotic treatment ( n = 38 ) . all women were treated with indomethacin and hexoprenaline for tocolysis and betamethasone for fetal lung maturity . women receiving antibiotics had significantly prolonged pregnancies ( median 15 versus 2.5 days , p = 0.04 ) . in addition , patients in the control group had significantly increased risks of necrotizing enterocolitis ( 5 versus 0 , p = 0.02 ) . similar benefit of ampicillin plus metronidazole was noted by svare et al . in a randomized study of 112 women in preterm labor with intact membranes between 26- and 34-weeks gestation . women receiving parenteral ampicillin for 24-hour followed by penicillin agent pivampicin 500 milligrams orally for 7 days ) and metronidazole for 7 days were compared to controls receiving placebo . those receiving antibiotics had prolonged pregnancy ( 47.5 days versus 27 days , p < 0.05 ) , higher mean gestational age at delivery ( 37 versus 34 weeks , p < 0.05 ) , decreased incidence of preterm birth < 37 weeks ( 42% versus 65% , p < 0.05 ) , and lower rates of admission to neonatal intensive care unit ( 40% versus 63% , p < 0.05 ) . although both studies noted some benefit with the beta - lactam plus metronidazole antibiotic regimens , no larger studies have been performed . moreover , improved outcomes could have been secondary to tocolysis and/or antenatal steroid therapy . beta - lactams and macrolidestrials of beta - lactams combined with macrolides have yielded mixed results . in a blinded study by newton et al . , 103 women between 2435 weeks ' gestation in preterm labor undergoing tocolysis were randomized to receive either parenteral ampicillin and oral erythromycin for 7 days or placebo . no statistical differences were noted between groups in terms of time to delivery , frequency of preterm birth , or birth weight .similarly no differences were noted by romero et al . in a multicenter , randomized trial from the maternal fetal medicine units network . in this study of 277 women at six centers , 133 received intravenous ampicillin and erythromycin for 48 hours followed by oral amoxicillin and erythromycin for 5 days ; the control group received placebo . no statistically significant differences were noted in time to delivery , frequency of preterm delivery < 37 weeks , frequency of premature rupture of membranes , or neonatal outcomes including neonatal intensive care unit ( nicu ) admission , respiratory distress , and sepsis . have also failed to demonstrate benefit to penicillins combined with macrolides [ 63 , 64 ] . furthermore , in the oracle ii trial with over 6000 women in preterm labor , erythromycin , amoxicillin - clavulanic acid as compared with placebo was not associated with any maternal or fetal benefit . results of the longterm followup on women in the oracle ii trial suggest an increase in cerebral palsy indicating that routine beta - lactam and macrolide antibiotics solely for ptb prevention may be ill - advised . trials of beta - lactams combined with macrolides have yielded mixed results . in a blinded study by newton et al . , 103 women between 2435 weeks ' gestation in preterm labor undergoing tocolysis were randomized to receive either parenteral ampicillin and oral erythromycin for 7 days or placebo . no statistical differences were noted between groups in terms of time to delivery , frequency of preterm birth , or birth weight . similarly no differences were noted by romero et al . in a multicenter , randomized trial from the maternal fetal medicine units network . in this study of 277 women at six centers , 133 received intravenous ampicillin and erythromycin for 48 hours followed by oral amoxicillin and erythromycin for 5 days ; the control group received placebo . no statistically significant differences were noted in time to delivery , frequency of preterm delivery < 37 weeks , frequency of premature rupture of membranes , or neonatal outcomes including neonatal intensive care unit ( nicu ) admission , respiratory distress , and sepsis . oyarzn et al . have also failed to demonstrate benefit to penicillins combined with macrolides [ 63 , 64 ] . furthermore , in the oracle ii trial with over 6000 women in preterm labor , erythromycin , amoxicillin - clavulanic acid as compared with placebo was not associated with any maternal or fetal benefit . results of the longterm followup on women in the oracle ii trial suggest an increase in cerebral palsy indicating that routine beta - lactam and macrolide antibiotics solely for ptb prevention may be ill - advised . in a double blind , randomized controlled study evaluated the efficacy of treating patients with bacterial vaginosis in the 2nd trimester of pregnancy ( 2224 weeks ) . 624 women with a history of a prior spontaneous preterm birth were allocated in a 2 : 1 ratio in an antibiotic group ( n = 433 ) or placebo ( 191 ) . the antibiotic regimen consisted of metronidazole 250 milligrams three times a day for 7 days and erythromycin 333 milligrams three times a day for 14 days . patient receiving antibiotics had a lower rate of preterm delivery ( 26% versus 36% , p = 0.01 ) . among the women with bacterial vaginosis included in the hauth trial , antibiotics significantly reduced the incidence of ptb ( 31% versus 49% , p = 0.006 ) leading to the conclusion that antibiotic therapy may reduce preterm delivery in patients at risk for premature delivery with bacterial vaginosis . these patients , however , were treated earlier in pregnancy than any of the earlier discussed trials and were all known to have documented infection with bacterial vaginosis . in a double blind , randomized controlled study evaluated the efficacy of treating patients with bacterial vaginosis in the 2nd trimester of pregnancy ( 2224 weeks ) . 624 women with a history of a prior spontaneous preterm birth were allocated in a 2 : 1 ratio in an antibiotic group ( n = 433 ) or placebo ( 191 ) . the antibiotic regimen consisted of metronidazole 250 milligrams three times a day for 7 days and erythromycin 333 milligrams three times a day for 14 days . patient receiving antibiotics had a lower rate of preterm delivery ( 26% versus 36% , p = 0.01 ) . among the women with bacterial vaginosis included in the hauth trial , antibiotics significantly reduced the incidence of ptb ( 31% versus 49% , p = 0.006 ) leading to the conclusion that antibiotic therapy may reduce preterm delivery in patients at risk for premature delivery with bacterial vaginosis . these patients , however , were treated earlier in pregnancy than any of the earlier discussed trials and were all known to have documented infection with bacterial vaginosis . meta - analysesin a cochrane review , king et al . included 11 studies ( the largest of which was the oracle ii trial ) and a total of 7428 women . there was a reduction in maternal infection ( relative risk 0.74 , 95% ci 0.640.87 ) , but no statistically significant differences in mean gestational age at delivery , frequency of preterm birth , and neonatal outcomes including mortality . in addition , no differences were noted in a subgroup analysis between the types of antibiotics . furthermore , no subgroup analysis was presented for patients receiving metronidazole in the first half of pregnancy.similarly , a more recent meta - analysis performed by simcox et al . in 2007 identified 17 randomized controlled trials comparing antibiotics to placebo in asymptomatic nonlaboring women with a risk of ptb ( previous ptb , positive fetal fibronectin , or abnormal vaginal flora ) . no significant association was noted in the reduction of ptb , the antimicrobial administered , or gestational age at treatment . in summary , while small - scale studies have shown some benefit to antibiotic prophylaxis especially in the case of beta - lactams and metronidazole no advantages , efficacy , or prevention of ptb has been consistently presented to support routine antibiotic therapy . the question then arises if there is any efficacy to treating specific infections with targeted therapy . in a cochrane review , king et al . included 11 studies ( the largest of which was the oracle ii trial ) and a total of 7428 women . there was a reduction in maternal infection ( relative risk 0.74 , 95% ci 0.640.87 ) , but no statistically significant differences in mean gestational age at delivery , frequency of preterm birth , and neonatal outcomes including mortality . in addition , no differences were noted in a subgroup analysis between the types of antibiotics . furthermore , no subgroup analysis was presented for patients receiving metronidazole in the first half of pregnancy . similarly , a more recent meta - analysis performed by simcox et al . in 2007 identified 17 randomized controlled trials comparing antibiotics to placebo in asymptomatic nonlaboring women with a risk of ptb ( previous ptb , positive fetal fibronectin , or abnormal vaginal flora ) . no significant association was noted in the reduction of ptb , the antimicrobial administered , or gestational age at treatment . in summary , while small - scale studies have shown some benefit to antibiotic prophylaxis especially in the case of beta - lactams and metronidazole no advantages , efficacy , or prevention of ptb has been consistently presented to support routine antibiotic therapy . the question then arises if there is any efficacy to treating specific infections with targeted therapy . bacterial vaginosisseveral studies have specifically evaluated the role of antibiotics prophylaxis for preterm delivery in the setting of bacterial vaginosis . in a double blind , randomized controlled study described above concluded that antibiotic therapy may reduce preterm delivery in patients at risk for premature delivery with bacterial vaginosis .mcdonald et al . revisited the possibility of a reduction in the risk of sptb with metronidazole treatment of women with heavy growth of gardnerella during mid - pregnancy . patients identified with heavy growth of gardnerella or a gram stain indicative of bacterial vaginosis were randomized to receives oral metronidazole 400 milligrams or placebo twice daily for two days at 24-week gestation and then again at 29 weeks . no differences were noted in overall ptb or sptb ; however , in a subgroup analysis of women with a previous ptb , a significant reduction in sptb ( 9.1% versus 41.7% , or 0.14 ci 0.010.84 ) was noted .given these positive results , a larger maternal fetal medicine units network trial ( n = 1953 ) was performed using metronidazole to prevent ptb by treating asymptomatic bacterial vaginosis between 16 and 24 weeks of gestation . asymptomatic bacterial vaginosis ( absence of itching , odor or discharge ) was diagnosed by nugent 's criteria and treated with two doses of metronidazole ( 2 grams ) or placebo . there were no differences in the rates of preterm delivery ( 12.2% versus 12.5% , relative risk 1.0 , 95% ci 0.81.2 ) , spontaneous rupture of membranes ( 4.2% versus 3.7% ) , delivery before 32 weeks ( 2.3% versus 2.7% ) , or neonatal outcomes . a meta - analysis of 15 trials with over 5800 women with bacterial vaginosis that examined the effect of metronidazole to treat bacterial vaginosis on preterm birth < 37 weeks showed no risk reduction ( odds ratio 0.91 , 95% ci : 0.781.06 ) . in this meta - analysis , however , there were no results presented regarding comparison between patients with symptomatic versus asymptomatic infection.trials have also yielded mixed results regarding intravaginal clindamycin for bacterial vaginosis . while lamont showed some benefit regarding ptb in patients with abnormal vaginal flora , in a study of over 5000 women by kekki et al . , vaginal clindamycin did not decrease the rate of preterm deliveries ( or 1.3 , 95% ci 0.5,3.5 ) [ 45 , 46 ] . trials have similarly yielded mixed results on the role of oral clindamycin for antibiotic prophylaxis in the setting of bacterial vaginosis . studied patients at high risk for late miscarriage or sptb - randomized women between 12 and 22 weeks of gestation with bacterial vaginosis receiving oral clindamycin 300 mg twice daily for five days or placebo . women receiving clindamycin had significantly fewer late miscarriages or preterm deliveries ( 10.4% percentage difference , p < 0.001 ) . no subgroup analysis of solely preterm birth was reported.it is evident that there is no convincing data to support the routine use of metronidazole or clindamycin in the 2nd trimester of pregnancy in patients with bacterial vaginosis . while few small studies have shown some possible efficacy , larger trials have refuted any benefit . in fact , other trials have even noted deleterious effects of clindamycin on neonatal morbidity especially noted to be infectious morbidity [ 61 , 62 ] . several studies have specifically evaluated the role of antibiotics prophylaxis for preterm delivery in the setting of bacterial vaginosis . in a double blind , randomized controlled study described above concluded that antibiotic therapy may reduce preterm delivery in patients at risk for premature delivery with bacterial vaginosis . revisited the possibility of a reduction in the risk of sptb with metronidazole treatment of women with heavy growth of gardnerella during mid - pregnancy . patients identified with heavy growth of gardnerella or a gram stain indicative of bacterial vaginosis were randomized to receives oral metronidazole 400 milligrams or placebo twice daily for two days at 24-week gestation and then again at 29 weeks . no differences were noted in overall ptb or sptb ; however , in a subgroup analysis of women with a previous ptb , a significant reduction in sptb ( 9.1% versus 41.7% , or 0.14 ci 0.010.84 ) was noted . given these positive results , a larger maternal fetal medicine units network trial ( n = 1953 ) was performed using metronidazole to prevent ptb by treating asymptomatic bacterial vaginosis between 16 and 24 weeks of gestation . asymptomatic bacterial vaginosis ( absence of itching , odor or discharge ) was diagnosed by nugent 's criteria and treated with two doses of metronidazole ( 2 grams ) or placebo . there were no differences in the rates of preterm delivery ( 12.2% versus 12.5% , relative risk 1.0 , 95% ci 0.81.2 ) , spontaneous rupture of membranes ( 4.2% versus 3.7% ) , delivery before 32 weeks ( 2.3% versus 2.7% ) , or neonatal outcomes . a meta - analysis of 15 trials with over 5800 women with bacterial vaginosis that examined the effect of metronidazole to treat bacterial vaginosis on preterm birth < 37 weeks showed no risk reduction ( odds ratio 0.91 , 95% ci : 0.781.06 ) . in this meta - analysis , however , there were no results presented regarding comparison between patients with symptomatic versus asymptomatic infection . trials have also yielded mixed results regarding intravaginal clindamycin for bacterial vaginosis . while lamont showed some benefit regarding ptb in patients with abnormal vaginal flora , in a study of over 5000 women by kekki et al . , vaginal clindamycin did not decrease the rate of preterm deliveries ( or 1.3 , 95% ci 0.5,3.5 ) [ 45 , 46 ] . trials have similarly yielded mixed results on the role of oral clindamycin for antibiotic prophylaxis in the setting of bacterial vaginosis . studied patients at high risk for late miscarriage or sptb - randomized women between 12 and 22 weeks of gestation with bacterial vaginosis receiving oral clindamycin 300 mg twice daily for five days or placebo . women receiving clindamycin had significantly fewer late miscarriages or preterm deliveries ( 10.4% percentage difference , p < 0.001 ) . it is evident that there is no convincing data to support the routine use of metronidazole or clindamycin in the 2nd trimester of pregnancy in patients with bacterial vaginosis . while few small studies have shown some possible efficacy , larger trials have refuted any benefit . in fact , other trials have even noted deleterious effects of clindamycin on neonatal morbidity especially noted to be infectious morbidity [ 61 , 62 ] . trichomonas vaginalisno benefit for ptb prevention has been shown for treatment of asymptomatic or symptomatic trichomoniasis . klebanoff et al . randomly assigned 617 patients with asymptomatic trichomoniasis ( defined as trichomonas on culture of vaginal secretions ) to metronidazole ( two doses of 2 grams 48 hours apart ) versus placebo between 16 to 23 weeks of gestation and then again at 2429-week gestation . delivery prior to 37 weeks occurred in 19% of women treated with antibiotics and 10.7% of patients receiving placebo ( relative risk 1.8 , 95% ci : 1.22.7 , p = 0.004 ) . thus , not only did they observe no benefit for treatment of asymptomatic trichomoniasis , intervention was found to be harmful.kigozi et al . similarly noted no benefit to treatment of trichomonas during pregnancy . in their randomized controlled trial women presumptively diagnosed with trichomonas were randomized to receive oral 1 gram azithromycin , 400 milligrams cefixime , and 2 grams metronidazole . increased rates of low birth weight , preterm birth , and 2-year mortality were noted in patients treated for infection . however , it should be emphasized that these patients were treated at any gestational age at pregnancy and were not a high - risk population for ptb . no benefit for ptb prevention has been shown for treatment of asymptomatic or symptomatic trichomoniasis . klebanoff et al . randomly assigned 617 patients with asymptomatic trichomoniasis ( defined as trichomonas on culture of vaginal secretions ) to metronidazole ( two doses of 2 grams 48 hours apart ) versus placebo between 16 to 23 weeks of gestation and then again at 2429-week gestation . delivery prior to 37 weeks occurred in 19% of women treated with antibiotics and 10.7% of patients receiving placebo ( relative risk 1.8 , 95% ci : 1.22.7 , p = 0.004 ) . thus , not only did they observe no benefit for treatment of asymptomatic trichomoniasis , intervention was found to be harmful . similarly noted no benefit to treatment of trichomonas during pregnancy . in their randomized controlled trial women presumptively diagnosed with trichomonas were randomized to receive oral 1 gram azithromycin , 400 milligrams cefixime , and 2 grams metronidazole . increased rates of low birth weight , preterm birth , and 2-year mortality however , it should be emphasized that these patients were treated at any gestational age at pregnancy and were not a high - risk population for ptb . timing of antibiotic administrationin addition to type and specificity of antibiotic regimens , the timing of antibiotic administration is an important consideration . uterine infection may occur prior to conception , early in pregnancy or at later gestational age . therefore , it has been postulated that the lack of benefit in some trials , may in part be due to late treatment when the mechanisms leading to ptb may already be established . women with a sptb prior to 34 weeks were randomized four months postpartum to receive oral azithromycin 1 gram twice ( 4 days apart ) plus metronidazole 750 milligrams daily for 7 days ( n = 59 ) or placebo ( n = 65 ) . no statistical differences were observed between subsequent sptb at less than 37 , 35 , or 32 weeks . interestingly , patients in the antibiotic group were noted to have decreased mean birth weight and earlier mean delivery gestational age , albeit not statistically significant . therefore , in addition to type and specificity of antibiotic regimens , the timing of antibiotic administration is an important consideration . uterine infection may occur prior to conception , early in pregnancy or at later gestational age . therefore , it has been postulated that the lack of benefit in some trials , may in part be due to late treatment when the mechanisms leading to ptb may already be established . women with a sptb prior to 34 weeks were randomized four months postpartum to receive oral azithromycin 1 gram twice ( 4 days apart ) plus metronidazole 750 milligrams daily for 7 days ( n = 59 ) or placebo ( n = 65 ) . no statistical differences were observed between subsequent sptb at less than 37 , 35 , or 32 weeks . interestingly , patients in the antibiotic group were noted to have decreased mean birth weight and earlier mean delivery gestational age , albeit not statistically significant . therefore , additional well - tailored trials are needed to further clarify this issue . antibiotics for other indications associated with ptbptb may occur not only as a result of intrauterine subclinical infection , but also from systemic infection and prom . in a cochrane review of prom , antibiotics were associated with decreased rates of chorioamnionitis , delivery within 48 hours , and delivery within 7 days . a similar benefit was noted with the utilization of antibiotics for asymptomatic bacteriuria in a 14 study meta - analysis conducted by smail et al . while there was no clear reduction in preterm delivery , asymptomatic bacteriuria , pyelonephritis , and low birthweight were reduced . as a result of this evidence supporting antibiotic treatment for these two conditions as least for short - term outcomes antibiotic prophylaxis and treatment is now routinely employed.in addition , positive fetal fibronectin ( ffn ) is strongly associated with both infection and ptb . ffn leaks into the genital tract with disruption of the maternal - fetal interface through mechanisms such as infection , inflammation , and hemorrhage . therefore randomized trials have evaluated the potential benefit of antibiotic therapy among those with a positive fetal fibronectin test . no differences were noted in sptb < 37 weeks ( or 1.17 , 95% ci : 0.81.70 ) or at earlier gestational age cutoffs .in another trial by shennan et al . , asymptomatic women with positive fetal fibronectin were randomized to a one - week course of metronidazole or placebo . previous studies regarding metronidazole showed mixed results with regard to benefit in terms of preterm labor especially in patients with bacterial vaginosis . however , shennan chose to study the effect of this antimicrobial in patients between 2427 weeks of gestational age and with positive vaginal ffn . patients randomized to metronidazole had an increased risk of preterm delivery less than 30 weeks ( 21% versus 11% , odds ratio 1.9 , 95% ci : 0.725.09 , p = 0.18 ) as well as prior to 37 weeks ( 62% versus 39% , odds ratio 1.6 , 95% ci : 1.052.4 , p = 0.02 ) . thus , similar to the findings for bv , treatment may increase the risk of preterm delivery . ptb may occur not only as a result of intrauterine subclinical infection , but also from systemic infection and prom . in a cochrane review of prom , antibiotics were associated with decreased rates of chorioamnionitis , delivery within 48 hours , and delivery within 7 days . a similar benefit was noted with the utilization of antibiotics for asymptomatic bacteriuria in a 14 study meta - analysis conducted by smail et al . while there was no clear reduction in preterm delivery , asymptomatic bacteriuria , pyelonephritis , and low birthweight were reduced . as a result of this evidence supporting antibiotic treatment for these two conditions as least for short - term outcomes antibiotic prophylaxis and treatment in addition , positive fetal fibronectin ( ffn ) is strongly associated with both infection and ptb . ffn leaks into the genital tract with disruption of the maternal - fetal interface through mechanisms such as infection , inflammation , and hemorrhage . therefore randomized trials have evaluated the potential benefit of antibiotic therapy among those with a positive fetal fibronectin test . no differences were noted in sptb < 37 weeks ( or 1.17 , 95% ci : 0.81.70 ) or at earlier gestational age cutoffs . in another trial by shennan et al . , asymptomatic women with positive fetal fibronectin were randomized to a one - week course of metronidazole or placebo . previous studies regarding metronidazole showed mixed results with regard to benefit in terms of preterm labor especially in patients with bacterial vaginosis . however , shennan chose to study the effect of this antimicrobial in patients between 2427 weeks of gestational age and with positive vaginal ffn . patients randomized to metronidazole had an increased risk of preterm delivery less than 30 weeks ( 21% versus 11% , odds ratio 1.9 , 95% ci : 0.725.09 , p = 0.18 ) as well as prior to 37 weeks ( 62% versus 39% , odds ratio 1.6 , 95% ci : 1.052.4 , p = 0.02 ) . thus , similar to the findings for bv , treatment may increase the risk of preterm delivery . there is no doubt that preterm birth continues to be an obstetrical and neonatal priority in the 21st century with infection as a major cause . no identifiable patterns regarding timing of antibiotic administration , gestational age at administration , antibiotic of choice , repeat dosages of antibiotics , the presence of documented underlying infection , or positive fetal fibronectin have emerged to suggest a role for these prophylactic antibiotics at this time . moreover , a number of studies have suggested harm , and antibiotics should be avoided for prophylaxis for asymptomatic bacterial vaginosis and trichomoniasis . as such , routine antibiotic prophylaxis is not recommended for prevention of ptb . based on the review , there may be promise of further studying the timing of antibiotic administration even before conception as well as more directed antimicrobial therapy . studies targeted at timing of antibiotic therapy could be undertaken by treating patients not only during early pregnancy , but between pregnancies or shortly in the postpartum period with specific evaluation of the microbial = human flora interacrtion . further studies aimed at elucidating the exact mechanism of decidual activation and the most - implicated microbes may be helpful to delineate specific antimicrobial agents and their optimal mode of delivery ( oral versus vaginal versus parenteral ) . furthermore , molecular receptor analysis , genetics , and proteomics may be the other steps needed to elucidate the black box that occurs between infection and preterm delivery .

lanthanum carbonate ( lc ) has become an accepted phosphate binder in patients with chronic kidney disease ( ckd ) . after chewing and then swallowing the tablets , lc dissociates in the upper gastrointestinal tract into its trivalent cation . this cation then forms insoluble complexes with phosphate throughout a wide range of gastrointestinal ph [ 13 ] . these complexes are excreted fecally , resulting in reduced serum phosphorous levels . as a phosphate binder , lc is as good as aluminum hydroxide and possibly superior to other phosphate binders [ 4 , 5 ] . in 2011 , damment performed short - term animal studies using pharmacological doses of lc and other phosphate binders . no adverse pharmacological effects were observed in animals with normal renal function . in particular , no problems were seen within the gastrointestinal tract . however , a number of reports have emerged in which lc is possibly associated with complications associated with colonic diverticulosis [ 3 , 6 ] . recently , an elderly patient in our peritoneal dialysis ( pd ) unit was prescribed lc . shortly afterwards , the patient presented with peritonitis and perforation of a colonic diverticulum . in january 2012 , a 78-year - old woman was admitted with 3 days of abdominal pain and worsening constipation . other medical problems included recurrent gastrointestinal bleeding , left colonic diverticulosis and bone pain which necessitated the commencement of chronic narcotic therapy ( oxycodone 20 mg daily ) in september 2009 . during her 3 years on pd , hyperphosphatemia and a high calcium - phosphate product did not respond adequately to calcium - containing phosphate binders . subsequently , the patient was commenced on lc , at a daily dose of 3 g in september 2011 . serum white blood cell count ( wbc ) of 24 000/mm , as was hypoalbuminemia ( serum albumin level : 32 gm / l ) . the pd effluent had a wbc of 260/mm ( 38% neutrophils , 33% monocytes ) . a plain abdominal x - ray ( figure 1a ) was incorrectly interpreted as showing residual contrast dye within the gastrointestinal tract . what in fact the x - ray showed was widespread radio - opaque lc deposits , of varying sizes , within both the small and large bowels . 1.(a ) plain abdominal x - ray ( supine position ) showing multiple hyperdense deposits of varying sizes throughout the gastrointestinal tract . a diffuse number of deposits are seen in the large bowel . ( b ) abdominal ct examination ( coronal section ) , taken without the oral administration of positive contrast media . radio - opaque deposits with a very high density ( houndsfield units : 200600 ) are seen throughout the colon and also lodged within a colonic diverticulum ( arrow ) . ( a ) plain abdominal x - ray ( supine position ) showing multiple hyperdense deposits of varying sizes throughout the gastrointestinal tract . ( b ) abdominal ct examination ( coronal section ) , taken without the oral administration of positive contrast media . radio - opaque deposits with a very high density ( houndsfield units : 200600 ) are seen throughout the colon and also lodged within a colonic diverticulum ( arrow ) . intravenous ceftriaxone and metronidazole were commenced . over the following 24 h , abdominal tenderness increased , and the pd effluent wbc count rose to 720 cells / mm . an abdominal computed tomography ( ct ) , performed without the addition of oral contrast dye , demonstrated extensive radio - opaque deposits within the colonic lumen , and also within colonic diverticulae ( figure 1b ) . intravenous vancomycin and gentamycin were added to the therapeutic regime . over the next 2 days , the patient improved clinically and all blood and pd fluid cultures had remained negative . on the fifth day , the patient 's condition deteriorated . urgent open laparotomy disclosed a ruptured colonic diverticulum and free purulent peritoneal fluid . a hartsmann procedure with draining of the colostomy postoperative recovery was slow and necessitated hemodialysis and prolonged antibiotic therapy and intradialytic parenteral nutrition . the patient complained of constant abdominal pain and repeat ct examination , carried out 9 days after admission ( and 5 days postoperatively ) , still showed fragments of lc within the colon and within the colostomy ( figure 2 ) . 2.abdominal ct examination , taken 9 days after cessation of the lc and 5 days after the operative hartsmann procedure . radio - opaque deposits are still present within the colon and also visible within the colostomy ( arrow ) . abdominal ct examination , taken 9 days after cessation of the lc and 5 days after the operative hartsmann procedure . radio - opaque deposits are still present within the colon and also visible within the colostomy ( arrow ) . therapeutic options are varied and commonly include the use of phosphate bindersagents that decrease gastrointestinal absorption of dietary phosphate . lc is a fourth - generation phosphate binder . despite early fears as to bone , liver and brain toxicities , the drug has been used extensively , and successfully , in dialysis patients [ 9 , 10 ] . however , gastrointestinal side effects are common . indeed , a company pamphlet on the drug ( fosrenol , shire pharmaceuticals inc . ) warns about constipation , abdominal pain and diarrhea as possible adverse reactions associated with the drug . an increased prevalence of colonic diverticular disease is thought to be present in ckd patients , especially in patients with polycystic kidney disease [ 12 , 13 ] . three reports suggest caution in using lc in dialysis patients with diverticular disease [ 3 , 6 , 14 ] . in 2009 , muller et al . described an elderly woman on hemodialysis , who was receiving lc at a low dose . this patient recovered with conservative therapy . in 2012 , camarero - temino et al . described a 55-year - old hemodialysis patient who was taking 3 g lc daily . finally , kato et al . examined abdominal ct scans in nine asymptomatic hemodialysis patients on lc . not only were multiple calcium - like deposits seen throughout the digestive tract , but also digested lc tablets had accumulated within colonic diverticulae . as with all phosphate binders , constipation may become troublesome in patients taking lc , especially if they are on other medications known to cause constipation . traditionally , an association between constipation and diverticular disease exists . therefore , it seems prudent that phosphate binders should be used with caution in dialysis patients with colonic diverticulosis . if these drugs are to be given in such patients , then they should be initiated with ( i ) strict instructions on how to take the drug , ( ii ) low initial doses and slow dose titration , ( iii ) constant clinical supervision , so as to detect constipation at an early stage and ( iv ) the use of high fiber diet and/or laxatives . importantly , our patient had constipation which may have been aggravated by the simultaneous use of narcotics and the high dose of lc . lc tablets appear as radio - opaque deposits within the entire gastrointestinal tract , but especially in the colon [ 14 , 14 , 16 , 17 ] . this fact is irrefutable , and the presence of such deposits has been suggested as a way in which compliance to the drug can be ascertained ! lanthanum has an atomic weight nearly identical to that of barium , it absorbs x - ray and it has a density 4-fold greater than calcium . these properties lead to its contrast - agent like features and its ability to be seen as radio - opaque deposits , both on plain x - rays and on ct examinations [ 2 , 4 ] . stopping the use of lc and adding laxatives however , in this studied patient , repeat ct examination performed 9 days after stopping lc still showed widespread lanthanum deposits within the colon . radiologists must be informed if the patient is taking lc , and the drug should be stopped if elective abdominal radiological studies are to be performed [ 1 , 4 ] . the real problem arises when urgent radiological studies of the abdomen have to be performed in these patients . then , an incorrect interpretation of the radiological findings may lead to both erroneous diagnostic and therapeutic decisions . in 2005 , caution was advocated over the widespread use of lc . in 2007 , drueke emphasized that the long - term clinical implications in using lc must be continually monitored as the drug does accumulate within tissues and is poorly cleared . in 2008 , hutchison et al . detailed lc administration in dialysis patients for up to 6 years , without evidence of toxicity . however , in 2009 , hutchison further added that it would be wrong to be complacent , and continued clinical vigilance is essential. we concur completely with these statements .

pressure relief cushions range from a simple pillow - like to an individualized conforming cushion with gel or raised air - filled pockets . it is unclear which type of cushion is appropriate for the elderly to relieve interface pressure . a previous study by hong et al . compared and analyzed the form of air cushions , heights of air cells , and thickness of air cells in 7 , 7 , 9 , 10 , and 7 individuals with left hemiplegia , right hemiplegia , paraplegia , quadriplegia , and without disability , respectively1 , 2 . an et al . compared the sitting pressure distribution based on the type of cushion for pressure ulcer prevention in 26 healthy adults . an and gong also analyzed the effects of the type of cushion , air , marble , foam , and gel cushion , and backrest angle on the sitting interface pressure in 14 healthy adults3 , 4 . another study analyzed the sitting interface pressure while sitting on low - profile air , high - profile air , dual - compartment air , and gel and firm foam in a population with spinal cord injury5 . interface pressure studies when applying pressure relief cushions have investigated on healthy young adults less than 60 and people with disability , spinal cord injury and stroke . moreover , analyzed interface pressure variables and interface areas were limited and broad to use as reference data to recommend an appropriate cushion . so , recommending appropriate pressure relief cushion type for the elderly have been restricted . therefore , this study explored the changes in the interface pressure redistribution using various interface pressure variables of four interface areas when sitting on cushions , air , honeycomb , and foam in 60 years healthy adults of age or older and in their 20s . the present study was approved by the institutional review board ( irb ) of soonchunhyang university . the purpose of the present study was explained to all subjects and informed consent was obtained before their participation in the present study . the participants consisted of 49 men and 62 women in their 20s , and 50 elderly men and 50 elderly women who were 60 years or older and had no neurological disease , were able to sit by themselves , and had good visual acuity , hearing , and cognitive function to answer general questions ( table 1table 1.general information of subjectselderly men ( n=50)elderly women ( n=50)young men ( n=49)young women ( n=62)age * ( years)78.2 5.8**74.6 4.919.7 1.419.6 1.1weight * ( kg)64.3 8.657.9 10.069.1 10.557.1 7.8height * ( cm)159.8 21.3150.7 4.8173.8 5.6158.9 4.5seat to footplate * ( cm)40.1 2.236.0 1.644.0 3.139.0 4.238.4 3.3total contact area * ( cm)661.7 197.7728.1 182.1829.5 162.9813.0 135.2hip ( )93.4 7.692.4 8.198.5 3.995.1 6.2knee ( )97.0 5.997.0 6.091.8 3.790.7 4.9ankle ( )91.7 5.193.0 4.489.9 3.491.2 4.3*p<0.05 , * * mean sd ) . the conformat system was used for interface pressure mapping , and v.7.2 research software was used for data acquisition ( both from tecksan inc . , ma , usa ) . the horizontal axis comprised of sensors labeled 1 to 32 , with the vertical axis labeled a to ff ( 32 32 ) . the sitting interface pressure was measured in mmhg , and the number of frames was set to 60 per minute . after the participants height and weight were measured , the participants adjusted their posture in a sitting position by using a footstool . while sitting , participants were instructed to keep their chins tucked , spines straight , pelvis neutrally positioned , and hands placed on their thighs . they were also instructed to flex their hips , knees , and ankles to approximately 90 and to put their feet flat on the floor . height , weight , footing height , and seat height ( seat to footplate ) , width ( seat width ) , length ( seat depth ) , total contact area ( total contact area ) , hip joint , knee angle , and ankle joint were measured in the sitting position . the posture was readjusted to not exceed a joint range of motion ( rom ) of 8595 , knee ankle rom of 80100 , and hip joint rom of 80110 based on the angles from the no - cushion state . when each cushion was changed , the subjects posture was readjusted to avoid an angular difference of more than 10 in each rom . after the subject s general information was acquired , the sitting interface pressure - related variables were measured . the subjects were instructed to maintain their sitting state for 5 min , and the researchers saved the data for 90 s after the subjects sitting posture stabilized . the cushions were wrapped in black cloth after the measurements , and the subjects were instructed to sit on the wrapped cushions in the following order : honeycomb , air , and memory foam cushions . each cushion and sitting on firm surface were referred to as sitting state 1 , 2 , 3 , and 4 , and thus the subjects were informed only of the change in cushion and were provided no information regarding the specific cushion type . after all measurements were obtained , the cushion preference was measured by instructing the subjects to select the most preferred sitting state . after all measurements were obtained , the interface pressure map was divided into four quadrants ( left hip , left thigh , right hip , and right thigh ) on the screen . mergl s method was adapted for quadrant division and analysis of interface pressure on the cushion . a set of 60 frames was used for data analysis , excluding data for 10 s from both the beginning and end of the obtained data to protect the measurements used for interface pressure analysis from contamination by the surrounding environment6 . after the sitting interface pressures were measured , the mean and peak pressures in the four quadrants ( left hip / left thigh / right hip / right thigh ) were calculated . the peak pressure was the mean of the maximum pressures measured with four sensors in each quadrant during sitting . the mean pressure ratio was calculated as a ratio = a mean/(a mean + b mean + c mean + d mean ) 100 . a ratio indicates the mean pressure ratio , and a mean can be the mean pressure in the right or left hip area or the right or left thigh area , and b mean , c mean , and d mean are the mean pressures in the remaining areas . the pressure mean and mean pressure ratio was calculated by the same method of peak pressure and peak pressure ration with every sensors in each quadrant . the statistical package for the social sciences 22.0 one - way analysis of variance was used to determine differences among sitting states , and tukey s post - hoc test was performed . for all groups , statistically significant differences were found in the total mean pressure among sitting states ( p<0.05 ) ( table 2table 2.comparison of the total pressure means among cushions ( mmhg)elderly men ( n=50)elderly women ( n=50)young men ( n=49)young women ( n=62)mean sdtukey hsdmean sdtukey hsdmean sd tukeyhsdmean sdtukey hsdf47.5 7.0m > h a47.8 6.6m > h > a , f56.3 12.9m > h > a , f48.6 12.0m > h > a , fh37.6 4.535.2 5.942.3 9.236.6 10.7a48.2 14.645.5 5.455.0 11.047.4 10.0m30.1 3.027.5 3.134.9 8.129.6 7.2tpm : total pressure mean ; a : air cushion ; h : honeycomb cushion ; m : memory foam cushion ; f : firm surface ) . the total mean pressure was the lowest and the second lowest on memory foam and honeycomb cushions , respectively . no significant difference was found in the interface pressure while sitting without a cushion and on an air cushion . tpm : total pressure mean ; a : air cushion ; h : honeycomb cushion ; m : memory foam cushion ; f : firm surface when the hip and thigh interface pressures were compared among sitting state within each group , significant differences were found in the right hip pressure mean , left hip pressure mean , right hip pressure peak , left hip pressure peak , right hip pressure ratio , and left hip pressure ratio ( p<0.05 ) ( table 3table 3.comparison of hip interface pressure variables among cushions ( mmhg)elderly men ( n=50)elderly women ( n=50)young men ( n=49)young women ( n=62)mean sdtukey hsdmean sdtukey hsdmean sdtukey hsdmean sdtukey hsdrh pmf71.0 13.8f , a > ha > m65.7 10.9f > a , ha > m78.3 22.4f , a > h a > m64.8 16.2f > a > h > mh50.7 13.343.0 9.256.0 15.344.4 19.1a59.1 10.550.5 10.061.6 15.150.0 10.4m42.4 8.736.7 7.249.2 13.439.3 11.7lh pmf83.0 73.7f > a , h , m65.2 13.2f > a > h , m84.9 21.4f > a , h , m63.7 13.8f > a > h , mh45.4 11.941.9 17.557.8 18.443.4 13.6a47.9 11.148.9 11.362.6 15.050.9 11.6m42.0 9.235.5 8.254.1 15.740.1 11.5rh ppf276.0 72.5f > m , hm > a280.1 79.6f > m , a , h304.7 88.7f > m , hm > a229.9 84.6f > a , m , hh122.0 67.2100.2 37.4139.3 55.994.2 44.5a110.1 49.5146.3 40.5150.8 49.5114.3 35.7m143.7 64.1126.8 55.9170.3 76.1115.9 m > h , a269.0 77.1f > m , a , h325.8 80.2f > m 87.7f > m , am > hh100.6 43.486.6 35.8145.6 60.396.3 39.3a97.5 35.2104.3 43.4142.8 47.6118.0 44.2m144.3 61.4119.4 69.0192.8 83.8121.7 56.0rh prf36.4 6.3f , m , h > a34.6 4.9f , m > h > a34.7 4.7f , m , h > a33.6 3.9f , m > h > ah35.5 6.530.7 5.533.1 5.930.0 5.8a28.0 9.027.7 3.828.0 3.426.5 3.3m35.2 5.933.3 4.735.1 3.834.1 4.9lh prf38.8 8.5f , m > h , a34.1 4.9m , f > h > a37.7 4.1f , m > h , a33.2 4.7f , m > h , ah30.1 6.629.2 6.633.9 6.729.9 6.7a26.9 11.526.7 3.728.5 3.426.9 3.3m34.7 6.032.2 5.638.5 4.433.9 5.3r / lhpm : right / left hip pressure mean , r / lhpp : right / left hip pressure peak , rr / lhpr : right / left hip pressure mean ratio , a : air cushion , h : honeycomb cushion , m : memory foam cushion , f : firm surface ) . and the interface pressure was the highest on a firm surface and the ratio was the highest on the air cushion . the all - thigh interface pressure variables were the lowest on a memory foam cushion and the highest on an air cushion ( table 4table 4.comparison of thigh interface pressure variables among cushions ( mmhg)elderly men ( n=50)elderly women ( n=50)young men ( n=49)young women ( n=62)mean sdtukey hsdmean sdtukey hsdmean sdtukey hsdmean sdtukey hsdrt pmf27.9 29.5a > f , h > m29.8 9.1a > f , h > mh27.3 6.828.2 6.227.6 8.029.8 11.4a41.8 5.840.1 5.147.3 12.344.0 12.7m18.1 4.119.1 4.318.1 5.419.7 6.5lt pmf22.7 7.1a > f , h > m30.6 11.3a > f , h > m29.9 8.0a > h > f > m32.9 14.2a > f , h > mh26.9 6.327.5 6.327.8 10.228.9 10.3a43.9 5.942.3 6.148.4 10.644.8 12.0m17.9 4.018.6 3.418.1 3.819.2 6.0rt ppf54.7 29.9a > f > h , m72.3 42.6a > f , h , m77.7 47.1a > h , f , m81.6 53.7a > f , h , mh59.0 18.068.0 21.657.5 23.164.4 27.4a99.0 43.6100.7 34.0114.1 30.3117.0 49.8m48.9 28.062.6 51.749.7 41.660.2 59.0lt ppf48.0 50.8a > h , fh > m72.7 39.3a > f , h > mh56.9 17.757.0 18.659.4 28.765.9 37.0a99.2 28.394.2 23.2116.7 41.2112.9 58.0m39.7 20.943.3 19.246.6 29.649.1 29.4rt prf13.2 7.2a > h f16.6 4.0a > h > m > fh18.3 4.620.2 4.016.4 3.620.3 4.5a22.0 4.822.2 2.821.4 3.023.1 3.2m15.2 3.817.5 3.813.1 3.116.6 3.9lt prf11.6 3.4a > h m13.4 2.5a > h > m > f16.6 3.7a > h > m , fh18.1 4.319.8 4.616.5 4.119.8 4.1a23.1 5.023.4 3.022.1 2.723.5 2.9m14.9 3.217.0 3.213.3 thigh pressure mean ratio ; a : air cushion ; h : honeycomb cushion ; m : memory foam cushion ; f : firm surface ) . r / lhpm : right / left hip pressure mean , r / lhpp : right / left hip pressure peak , rr / lhpr : right / left hip pressure mean ratio , a : air cushion , h : honeycomb cushion , m : memory foam cushion , f : firm surface r / ltpm : rt./lt . thigh pressure mean ratio ; a : air cushion ; h : honeycomb cushion ; m : memory foam cushion ; f : firm surface 1 ) when the effects of sitting states were compared within each group of men in their 20s , women in their 20s , men 60 years or older , and women 60 years or older , the mean hip pressure was the highest when sitting on a firm surface , followed by air , honeycomb , and memory foam cushions , and the peak hip pressure was the highest without a cushion , followed by memory foam , air , and honeycomb cushions . the mean thigh pressure tended to be the highest when sitting on an air cushion , followed by without a cushion , honeycomb , and memory foam cushions . the peak thigh pressure was the highest for air cushions , followed by without , honeycomb , and memory foam cushions . these results were inconsistent with the results of previous studies that had indicated that the existing air cushion was more effective in reducing hip pressure compared with other cushions . in a study by an and gong analyzing the mean sitting pressure distribution based on mean pressure index in the contact area , the air - filled cushion showed a lower result compared with other cushions ( p<0.05)4 . however , in the present study , the mean pressure was found to be the second highest when sitting on an air cushion after sitting without a cushion . a study by an et al . indicated that the peak pressure index was statistically lower when sitting on an air cushion compared with other cushion types3 . considering studies in foreign countries , a study by bar showed that when applying foam , gel , and air cushions to 25 patients with spinal cord injury , the mean pressures were found to be 87.6 mmhg , 68.6 mmhg , and 54.6 mmhg , respectively , indicating that the mean pressure was lower sitting on an air cushion7 . in a previous study , comparing the effects of six sitting postures for foam and air cushions in six patients with spinal cord injury and eight able - bodied subjects , ischial pressure was found to be the lowest when sitting on an air cushion8 . tanimoto found in a study of 19 patients with spinal cord injury that an air cushion was the most effective for hip pressure redistribution among the five kinds of toilet seat cushions9 . eksteen confirmed that the lowest pressure was observed when using an air cushion among three toilet seat cushions in 10 patients with spinal cord injury10 . in a study by sharon et al . , 17 wheelchair users were instructed to perform pressure relief maneuvers while sitting on each of a wheelchair - air cushion , fluid pocket - type cushion enclosed with foam base ( j2 ) , and multi - layered foam cushion to determine the ischial pressure generated at the ischial tuberosity through within - subject measurements11 . as a result , the ischial pressure was found to be the lowest when using the air cushion during upright sitting and small leans except for full front / side leans and intermediate side leans . in contrast , some studies did not confirm a statistically superior performance of air cushions , although the pressure on the air cushion was lower when compared with other cushions . in a study by gilsdorf , a similar ischial pressure distribution was observed on roho and jay cushions in 10 normal subjects12 . in a study by digiovine et al . examining the mean pressure in the area , including the ischial tuberosity and sacrum , for seven patients with spinal cord injury , significant differences were found between air and foam cushions and significant differences were also found between foam and honeycomb cushions . however , a statistical superiority was not confirmed between air and honeycomb cushions13 . the results of this study showed that the mean sitting pressure of the air cushion was higher , unlike the results of previous studies . this may be because the cushion stiffness may have been higher from a failure to use standardized air pressure - controlled methods and monitor air pressure levels to ensure continuous air supply against any ongoing air leak . although the mean pressure was high in the present study , the hip pressure peak was the second lowest on the air cushion , and significant differences were found in the mean hip pressure ratio between air and other cushions . differences between air and other cushions appeared prominently in the mean pressure ratio . it is believed that when sitting on the air cushion , the mean hip pressure ratio was low and the mean thigh pressure ratio was high because the air cushion has a greater effect on redistributing the interface pressure toward the thighs compared with other cushions . for the memory foam cushion , the peak hip pressure was significantly higher in all groups except for the group of women 60 years or older . evaluated pressures on two standard commercial viscoelastic cushions , two foam cushions , and a rigid support in a study of 10 participants14 . the results of that study showed that the peak pressure on the memory foam cushion was higher than that on a foam cushion . the memory foam cushion has a good viscoelasticity to offer appropriate contact surface during sitting and has an excellent envelopment compared with using no cushion ; thus , the mean hip pressure and the mean total pressure were found to be low . however , the peak hip pressure was found to be the second highest on memory foam cushion behind sitting without a cushion . judging from these , the peak hip pressure is thought to be high because the soft polyurethane foam of the memory foam cushion is very soft , and thus , a bottomed - out condition can occur during sitting , generating high pressure . on the honeycomb cushion , the peak pressure in the hips was found to be the lowest . the honeycomb cushion is light , has a good support surface , absorbs shock well , cools the skin , easy to wash , and has no leakage risk , but related records are scarce because it is relatively new type of cushion compared with the other cushions . further studies involving new cushion materials and other physical elements , such as temperature , moisture , friction , and shearing force , should be conducted .

the metastasis of cancer cells hinges upon a series of successive events ; hence , interrupting any one step could halt the process . metastasis suppressors , defined by their abilities to inhibit metastasis without blocking orthotopic tumor growth , are attractive agents to treat metastasis1 . over a decade ago , a new metastasis suppressor gene was identified and named kiss1 in reference to its place of discovery - hershey , pennsylvania , the home of the famous hershey kisses2 . the kiss1 gene encodes a 145-amino acid protein , which is subsequently cleaved into a 54-amino acid fragment ( named metastin ) , this in turn is cleaved into even shorter , biologically active peptides ( 10 , 13 , 14 amino acids long ) , collectively referred to as kisspeptins ( kps)3 - 5 . kp-10 is the smallest active peptide comprised of the last ten amino acids of the full 145-amino acid peptide6 . in humans , reverse transcription polymerase chain reaction revealed kiss1 mrna to be expressed at high levels in the brain , breast , pancreas , placenta , testis , liver , heart and small intestine5 , 7 - 9 . although the sequence for the kiss1 gene has been known since its initial discovery , it was not until 2001 that the peptide products of the kiss1 gene were identified as the endogenous ligands for the kp receptor ( kiss1r ; formerly known as axor12 , gpr54 or hot7t175 ) by three independent groups3 , 5 , 8 . kiss1r mrna displays similar tissue distribution as its ligand , with high levels expressed in the placenta , pituitary gland , pancreas , breast and spinal cord3 , 5 , 8 , 9 . kiss1r mrna is also present in the heart , skeletal muscle , kidney , liver , placenta and central nervous system3 , 8 , 10 . radioligand binding of i - kp-14 was detected in aorta , coronary artery and umbilical vein4 , suggesting expression of the kiss1r in the vasculature . kiss1r is a g protein - coupled receptor ( gpcr ) that shares high sequence identity with the galanin receptor3 , 5 , 8 . kiss1r couples to the gq/11 signaling pathway and activates the primary effector phospholipase c ( plc ) . activation of the plc results in the formation of inositol-(1,4,5)-trisphosphate ( ip3 ) and diacylglycerol , mobilization of calcium and activation of protein kinase c ( pkc ) and extracellular signal - regulated kinases 1 and 2 ( erk1/2)11 - 13 ( fig . these secondary messengers are associated with kiss1r signaling in a variety of cell types and may be ubiquitous components of the kp / kiss1r signaling system3 , 5 , 8 . other secondary effectors of the kp / kiss1r signaling pathway which may prove to regulate kiss1r signaling in a cell - specific manner include p38 , phosphatidylinositol-3-kinase ( pi3k ) , akt and arachidonic acid3 , 8 , 14 , 15 ( fig . 1 ) . notably , emerging findings are showing that kiss1r activates a plethora of signaling molecules that have the potential to regulate a diverse array of biological processes , and that is in fact being observed and will be discussed later . one of the principal mechanisms for switching off gpcr signaling is homologous desensitization , a process that involves the co - ordinated actions of two families of proteins , the gpcr kinases ( grks ) and -arrestins16 , 17 . for the prototypical gpcr , such as the -adrenergic receptor , the ligand - bound receptor undergoes grk - dependent phosphorylation at residues on its intracellular loops and carboxyl terminus . phosphorylation of the receptor promotes the high - affinity binding of -arrestins-1 and -2 to the receptor , which physically blocks further coupling to g proteins16 , 17 . -arrestins also target many gpcrs for internalization in clathrin - coated vesicles ; once internalized , the receptor is either directed for degradation via lysosomes or recycling back to the cell surface via recycling endosomes16 , 17 . kiss1r has been shown to be constitutively associated with grk2 and -arrestins-1 and -2 , and as noted for many gpcrs , these interactions are mediated through residues in the second intracellular loop and cytoplasmic tail of kiss1r12 . the g protein - uncoupled receptor then undergoes -arrestin - dependent internalization via clathrin - coated pits12 . recent studies have shown that the bulk of internalized kiss1r is rapidly recycled back to the cell surface with little being targeted for degradation18 . this led to the recognition that through rapid recycling , the cell maintains an active pool of kiss1r at the cell surface permitting prolonged kp - dependent signaling in the presence of continuous receptor desensitization11 . this finding is crucial to the future development of any kp - based therapy . for a number of gpcrs , -arrestins also act as molecular adapters and recruit signaling proteins to the agonist - occupied gpcr19 . recently , members of our group have demonstrated that kiss1r also undergoes -arrestin - dependent signaling in several cell types including breast cancer mda - mb-231 cells12 , 13 . specifically , in the mda - mb-231 cell line , they demonstrated that arrestin-2 mediates a robust activation of erk1/212 . importantly , it is now demonstrated that kiss1r activates erk1/2 via both gq/11 and -arrestin-2 ; hence , erk1/2 represents a major regulator of the kp / kiss1r signaling12 . in many human cancers , erk1/2 activity is dysregulated and this altered activity is often implicated in tumorigenesis and resistance to anticancer therapies20 . physiologically , the kp / kiss1r signaling system potently triggers gonadotropin - releasing hormone release , thereby , acting a major regulator of the neuroendocrine reproductive axis22 , 23 ; negatively regulates trophoblast migration and invasion , thereby , being proposed as a major regulator of placentation and fetal development24 . in less investigated roles , the kp / kiss1r signaling system has also been proposed as a regulator of insulin secretion , cardiovascular function and kidney development ( reviewed in9 , 25 ) . the rest of this review article will focus on the roles of kps in regulating breast cancer biology . in many cancers , kp / kiss1r signals as a metastasis suppressor . however , we will focus on some controversial findings in breast cancer , where the role of kp / kiss1r has been difficult to discern and discuss the latest findings that shed light on the mechanisms by which kiss1r regulates breast cancer metastasis . since kiss1r is emerging as a gpcr of widespread clinical importance , understanding the molecular mechanisms that regulate kiss1r signaling upon receptor activation to date , the metastasis suppressor activity of kps have been identified in numerous cancers , including melanoma2,7,26 - 28 , thyroid29,30 , ovarian31 - 34 , bladder35,36 , gastric37,38 , esophageal39 , pancreatic40 , lung41 and pituitary42 cancers . the anti - cancer roles of kp / kiss1r have been recently discussed in excellent reviews9,43 - 45 . for several of these cancers , a unified emerging mechanism underlying kp / kiss1r - dependent metastatic suppression is the repression of matrix metalloproteinase ( mmp)-9 activity and subsequent inhibition of cancer cell migration and invasion44 , 46 , 47 . increased activation of focal adhesion kinase ( fak ) , leading to the formation of excessive focal adhesions and stress fibre formation have also been observed and believed to further contribute to reduced cancer cell motility3 , 48 . clinically , a reduction in kiss1 and/or kiss1r expression has been shown to be associated with poor prognosis in cancer patients and consequently , the expression of kiss1 and/or kiss1r could potentially prove to be powerful prognostic markers in clinical settings7 , 28 , 32 , 37 - 39 , 41 , 49 - 56 . for instance , in hepatocellular cancers , overexpression of kiss1 and kiss1r has been observed and correlates with cancer progression57 - 59 . furthermore , kiss1 expression level in hepatocellular carcinoma correlated with worsened clinical outcome , as an independent prognostic marker for the aggressiveness of hepatocellular carcinoma57 - 59 . initially , kiss1 was thought to functions as a metastasis suppressor gene in human breast cancer , similar to its anti - metastatic roles observed in melanoma60 . however , this study was done using human ' breast ' cancer mda - mb-435 cells , which have been shown to have gene expression profile more closely resembles that of melanoma cell lines , rather than that of other breast tumor cell lines61 . thus studies performed using this cell line must be interpreted with caution62 . a recent landmark study established a role for kp / kiss1r signaling in regulating breast cancer metastasis using a mouse mammary tumor virus - polyoma virus middle t antigen ( mmtv - pymt ) model63 . in this model , the transformation of the mammary epithelium leads to the development of multifocal mammary adenocarcinomas and metastatic lesions in the lymph nodes and in the lungs . cho and colleagues showed that kiss1r haploinsufficiency ( kiss1r ) delayed pymt - induced breast tumor initiation , latency , growth and metastasis63 . orthotopic injection of isolated mouse primary breast cancer mmtv - pymt / kiss1rcells into nod.scid/ncr immunocompromised mice showed reduced primary tumor growth , compared to mice injected with mmtv - pymt / kiss1r cells , indicating that reduced expression of the receptor inhibits tumor growth in vivo . additionally , the authors showed that kiss1r plays a vital role in ras - induced mcf10a cell tumorigenesis signaling via rhoa gtpase downstream of gq activation . although the authors did not provide any evidence that kiss1r regulates metastasis using a xenograft mouse model , this study clearly establishes that kiss1r positively regulates tumorigenesis and metastasis although the underlying molecular mechanism remain to be deciphered . the first evidence that kiss1 expression is elevated in patient breast tumors was shown in a study by martin and colleagues64 . they demonstrated that kiss1 mrna expression was elevated in node - positive tumors , compared to node - negative ones and that kiss1 mrna and protein expression increased with tumor grade as determined by quantitative - pcr analysis and immunohistochemistry , respectively . moreover , they found that patients with metastatic disease had elevated levels of kiss1 expression compared to healthy individuals , and that this associated with poor patient prognosis . a rise in kiss1r mrna expression in node - positive tumors this study also showed that the over - expression of kiss1 in mda - mb-231 human breast cancer cells increased their invasiveness and decreased their adhesive property using matrigel - coated transwell chamber invasion assays , thus , providing evidence that kiss1 may not be functioning as a metastasis suppressor in breast cancer cells64 . in sharp contrast to the study by martin and colleagues64 , other reports indicate that kiss1 mrna and protein expression is absent in node - positive tumors , and found a significant negative correlation with axillary lymph node involvement52 , 65 , 66 . no association of kiss1 expression was found with genes that regulate cell - cycle and proliferation such as her2 , vegf and p5352 . kiss1 mrna and protein expression was also found to be significantly higher in primary breast cancer compared with breast tumors that metastasized to the brain67 , 68 . in fact , a significant down - regulation of kiss1 expression has been reported in brain metastatic lesions , compared to primary ductal carcinomas and this correlated with immunohistochemical analysis of kiss1 protein levels64 . this suggests that a loss of kiss1 may contribute to the formation of distant metastases , since there was a down - regulation of kiss1 expression in the metastases compared to primary tumors 67 . the reason for these contradictory results remain unclear ; however , with the analysis of patient samples , factors have to be taken into consideration such as whether the patients had received chemotherapy , the age of the women ( pre- versus post - menopausal ) and the genetic diversity of the patient population . interestingly , these later studies did not examine kiss1r association with axillary lymph node involvement and thus , further studies are necessary to better understand changes in the expression profile of kiss1 and kiss1r in patients at the gene and protein level . furthermore , recent studies have shown that the estrogen receptor ( er ) status of breast tumors has to be taken into consideration since expression and function of both kiss1 and kiss1r are modulated by estrogen . the steroid hormone estrogen plays a critical role in the development of the mammary epithelium during puberty69 - 72 . estradiol ( e2 ) acting through er is required for the normal growth and development of the mammary ductal network71,73 . er activation is mitogenic in normal and transformed cells , but is able to suppress processes such as epithelial - mesenchymal transition ( emt)69 , 73 . it is well established through studies using mice and rats , that in the hypothalamus , kiss1 mrna level is directly regulated by e274 , 75 . er-mediated pathways play a crucial role in breast carcinogenesis ; moreover , er is an important prognostic indicator in breast cancer and of the response to endocrine therapy76 , 77 , with breast tumors typically categorized as being er - positive or er - negative71 . in a 2007 study , marot and colleagues investigated whether the expression of kiss1 and kiss1r is regulated by estrogen and whether this is clinically relevant . furthermore , among post - menopausal women with er-positive tumor samples who had been treated with the er antagonist , tamoxifen , patients with shorter relapse - free survival had elevated expression of kiss1 and kiss1r mrna compared to tumors expressing low mrna levels of these genes . they reported that kiss1 mrna levels were high in breast tumors , compared to normal mammary tissue , whereas kiss1r mrna levels were high in invasive tumors compared to normal tissue78 . in contrast to this study , jarzabek and others reported that er - positive tumors exhibited higher kiss1 and kiss1r levels than er - negative tumors50 . this study also revealed that kiss1r expression is negatively associated with her2 status in breast cancer50 . thus the expression profile and roles of kiss1 and kiss1r in breast cancer has been difficult to discern and this might simply reflect the great heterogeneity among breast tissue , in addition to the fact that mrna levels may not necessarily correlate to protein levels . to further study the regulation of kp / kiss1r by er , er was over - expressed in the er-negative mda - mb-231 breast cancer cells78 , 79 . treatment with e2-induced a decrease in kiss1 mrna levels as well as kiss1r protein levels , compared to controls78,79 . the expression of er ( in the absence of e2 ) inhibited kp-10-stimulated cell migration and invasion , and kp-10-stimulated epidermal growth factor receptor ( egfr ) transactivation , compared to vector control cells79 . however , kp-10 did not increase cell migration , invasion and motility , or stimulate egfr transactivaton in the er-positive t47d and mcf7 breast cancer cells79 . thus , in the presence of er , kp / kiss1r may function in an anti - metastatic capacity . in fact , olbrich and others have shown that kp-10 inhibits bone - directed migration of kiss1r - positive mcf7 cells by down - regulating the expression of chemokine receptor cxcr4 and its ligand stomal derived factor ( sdf)-180 . thus , one can speculate that in normal healthy mammary epithelia , estrogen signaling through er is responsible for maintaining normal breast epithelial growth and function , hence maintaining kp / kiss1r signaling in check through transcriptional regulation of kiss181 , and/or kiss1r ( figs . 2 , 3 ) . however , in certain cancers , where er expression is lost or silenced via dna methylation as is the case in er-negative cancers82 , 83 , the brake keeping kp / kiss1r signaling in check is removed . as a result , this disinhibition results in increased transcription of kiss1 and/or kiss1r , and consequently increases signaling through kiss1r leading to the induction of emt , ultimately allowing for the mammary epithelial cells to acquire a more migratory and invasive phenotype79 ( fig . overall , these studies have established that the er status of breast epithelia critically regulates the ability of kiss1r signaling to stimulate invasiveness . the mechanistic details by which er decreases kiss1r expression in breast cancer cells are currently unknown . a few studies have investigated how er regulates kiss1 . in melanoma , activator protein 2 alpha ( ap-2 ) has been described as a possible positive transcriptional regulator of kiss1 in melanoma cells via interaction with the transcription factor , specificity 1 protein ( sp1)84 . however , in mda - mb-231 breast cancer cells stably expressing er , e2 down - regulated the transcriptional activity of the kiss1 promoter independent of the er element and sp1 by modulating the binding of the active rna polymerase ii at the kiss1 promotor81 . clearly , more studies are required to better understand how er exerts its regulatory action in breast cancer cells ( er-positive versus negative ) , compared to its effects in some other cancers , where kiss1 functions as a metastasis - suppressor gene . however , kp-10 immunoreactivity has been shown in aggressive mda - mb-231 human breast cancer cells that are triple - negative ( lacking er , progesterone receptor and her2 ) , indicating that breast cancer cells can produce kps . the clinical data thus far suggests that kiss1 may be preferentially expressed in primary tumors , whereas kiss1r levels are higher in metastases64 , 78 . if this is the case , then the question arises as to how the receptor signals , independent of the ligand . one possibility is that kiss1r display constitutively activity12 , 85 , and this has been previously described in breast cancer cells86 . the mechanisms by which kp / kiss1r regulates breast cancer cell migration and invasion , two processes required for metastasis remain largely unknown . kp-10 can stimulate breast cancer cell migration and invasion of the er-negative mda - mb-231 and hs578 t that endogenously express kiss1r , via transactivation of the egfr86 . egfr is a well - known clinical target that is upregulated in numerous cancers , including breast cancer87 . kp-10 stimulates egfr transactivation and mmp-9 secretion and activity via a -arrestin 2-dependent pathway 86 . in contrast , in ht-1080 human fibrosarcoma cells , where kp / kiss1r signaling is anti - invasive , kiss1 expression reduces mmp-9 production88 . -arrestins have emerged as important regulators of kiss1r signaling , cancer progression , invasion and metastasis89 , 90 . currently we do not know if kiss1r activity regulates egf secretion ; nevertheless , egfr can also be activated independently of its ligand91 . furthermore , kiss1r is able to directly associate with egfr , and stimulation of breast cancer cells with either kp-10 or egf can regulate the endocytosis of both receptors86 , providing evidence of receptor crosstalk . one can speculate that kiss1r binds to egfr and promotes ligand - independent activation of egfr , and this may positively regulate breast cancer cell invasiveness ( fig . exogenous expression of kiss1r in er-negative skbr3 cells stimulates the extravasation of tumor cells , using the chick chorioallantoic membrane assay , providing the first evidence that kiss1r signaling regulates breast cancer invasion in vivo79 . kiss1r - mediated egfr transactivation and migration of breast cancer cells was inhibited by the kiss1r antagonist , p-234 , implicating a role for kiss1r activation in these processes79 . the actin cytoskeletal scaffolding protein iqgap1 has been identified as a kiss1r binding partner and is necessary for kiss1r - mediated transactivation of the egfr in breast cancer cells79 . iqgap1 plays a role in tumorigenesis and is considered to be an oncogene92 - 94 . iqgap1 is over - expressed in trastuzumab - resistant human breast epithelial cells and contributes to resistance to anti - her2 therapies93 . iqgap1 binds to a diverse array of signaling and structural proteins regulating multiple processes such as cell polarization , motility , invasion , maintenance of cytoskeletal architecture , and e - cadherin - mediated cell - cell adhesion94 . endogenous kiss1r is co - localized with endogenous iqgap1 in lamellipodia of motile breast cancer cells and regulates breast cancer cell motility79 . iqgap1 also interacts with -arrestin 2 , and both proteins can facilitate the scaffolding of the mapk signaling components95 . thus , the association of -arrestin 2 and iqgap1 may bring together individual signaling complexes within the same area of the cell to allow for the spatial regulation of multiple processes including cell migration . thus far , studies indicate that kiss1r signaling may correlate positively with breast tumor progression and metastatic potential63 , 78 , 96 . however , it appears that kp-10 does not affect proliferation of breast epithelial or breast cancer cell lines expressing the receptor endogenously or exogenously79 , 97 . kiss1r has been shown to be expressed in normal breast tissue5 , nevertheless , the role of kiss1r in the physiological development of mammary tissue is unknown . recently , the effect of kp signaling in the immortilized , non - transformed mammary epithelial cell line mcf10a was examined . mcf10a cells form acinar structures in three - dimensional ( 3d ) basement membrane cultures that retain characteristics of the glandular epithelium in vivo98 . interestingly , these cells are er-negative99 and endogenously express kiss1r 63 . treatment with kp-10 significantly stimulated mcf10a cells to form invasive structures compared to untreated cells in 3d matrigel cultures79 . furthermore , stable expression of kiss1r in mcf10a cells significantly stimulated invasiveness independent of exogenous kp-10 and induced a mesenchymal phenotype81 . hence , it is possible that under pathological conditions such as breast cancer and upon loss of er , there is an upregulation of kp and/or kiss1r . this would stimulate the mammary epithelial cells to undergo emt - like events , acquiring mesenchymal - like phenotypes and ultimately resulting in enhanced migration and invasion and thereby promoting metastasis ( fig . lastly , two recent papers have shown there is an inverse relationship between the expression of kiss1 functioning as a metastasis suppressor and wasf3 , an oncogene and a member of the wiskott - aldrich family of proteins101 , 102 . wasf3 promotes invasion and metastasis in breast cancer cells , which have undergone emt101 - 103 . overexpression of wasf3 in non - invasive mcf7 and t47d human breast cancer cells , which typically do not exhibit an emt - like phenotype , increases their invasiveness as a result of increased zeb1/2 levels , which specifically suppresses the anti - invasion chromosome 1 mir-200a/200b/429 cluster102 . this study showed that the upregulation of zeb1/2 by wasf3 occurs due to a decreased expression of kiss1102 . on the contrary , knockdown of wasf3 in breast cancer cells leads to reduced zeb1 levels and increased mir-200 and e - cadherin levels , resulting in the loss of invasion potential with concomitant loss of matrix mmp-9 activity101 , 102 . therefore , the loss of kiss1 which has been observed clinically in regional or distant breast cancer metastases52,65,66 could result via wasf3-mediated zeb1/2 upregulation , resulting in increased metastasis , implying that this signaling pathway may be a potential target to suppress invasion of breast cancer cells . in this review article , we provide information as to the state of our current knowledge on the role of kp/ kiss1r signaling pathway in breast cancer . the complexity and tissue specificity of this signaling pathway remains a challenge for understanding and targeting this pathway . emerging evidence clearly suggests that kiss1r plays critical roles in regulating signaling cascades that are involved in cell migration , invasion and metastasis , as in the case for breast cancer . the conflicting data for the role of the kiss1 and kiss1r in tumorigenesis could possibly be due the existence of an alternately spliced form(s ) of these genes or possibly due to the epigenetically regulation of these genes . currently , the methylation status of kiss1/kiss1r in breast cancer is unknown but this might potentially explain differences in expression patterns observed in the difference studies . a better understanding of the underlying mechanisms by which kiss1r signaling regulates cell invasiveness , cross - talks with other receptors such as growth factor receptors and the influence of the er status of breast epithelia on kiss1r signaling , could shed light on whether or not targeting kiss1r in breast cancer is a potentially useful therapy .

a case control study was conducted among patients with p. falciparum malaria diagnosed at bichat - claude bernard and saint - denis hospitals in paris , france . participants traveled to or lived in an area endemic for malaria and had a p. falciparum infection during 19962005 . falciparum trophozoites on a blood smear confirmed by the centre national de reference du paludisme ( cnrp ) in paris , without epidemiologic evidence of autochthonous , transfusion - transmitted , or occupational malaria . case - patients had p. falciparum infections detected > 59 days after their arrival in france . controls had p. falciparum infections detected < 30 days after their arrival . for each case - patient , 4 controls were matched by calendar year and hospital of diagnosis ( 70 cases and 280 controls ) . data were collected from the cnrp database in which all cases are prospectively included and medical records are checked . we only considered immigrants ( persons born in an area endemic for malaria and residing in france ) , which resulted in 61 case - patients and 197 controls . we distinguished first - arrival immigrants ( persons who emigrated to france and never returned to areas endemic for malaria ) from visiting friends and immigrant relatives ( persons who traveled back to areas endemic for malaria after immigration to france ) . logistic regression was used to identify factors associated with prolonged p. falciparum infection and estimate odds ratios ( ors ) and 95% confidence intervals ( cis ) . for multivariate analysis , variables with p values < 0.25 were introduced into the model and removed after a backward stepwise approach , which resulted in only values with p<0.05 in the final model ( except for age groups ) . statistical analysis was performed by using stata software version 8.2 ( stata corporation , college station , tx , usa ) . during the 10-year period , 61 ( 2.3% ) these infections included 10 patients ( 5 pregnant women , 2 hiv - positive patients , and 3 first - arrival immigrants ) with clinical malaria > 1 year after their arrival . four of them , all pregnant women , had clinical malaria > 3 years after their arrival . for the case control study , 197 controls were compared with 61 case - patients ( figure ) . case - patients were younger ( median age 30.6 years vs. 34.5 years , p = 0.04 ) and more often female ( 54.1% vs. 38.1% , p = 0.03 ) than controls . the mean parasitemia level was lower for case - patients than for controls ( 0.6% vs. 1.4% , p = 0.04 ) , including patients with 8 asymptomatic cases versus none of the controls ( in these cases , diagnosis of malaria was made through systematic checking ) . delay in days or years between arrival in france and diagnosis of imported plasmodium falciparum malaria , bichat - claude bernard hospital and saint denis hospital , paris , france , 19962005 . * or , parasitemia ( parasitized erythrocytes ) was considered high if > 4% and low if < 4% by world health organization criteria . among immigrant travelers , 3 groups had a higher risk for prolonged p. falciparum infection : pregnant women , first - arrival immigrants , and hiv - positive patients . a total of 27.9% ( n = 17 ) of the patients were pregnant women , with a median ( range ) age of 22 ( 1636 ) years . all were of african origin and had become pregnant in france ; 10 ( 58.8% ) were in their second trimester , 5 ( 29.4% ) were in their third trimester . first - arrival immigrants were younger than other patients ( mean age 26.2 vs. 37.6 years , p = 0.001 ) . hiv infection was associated with prolonged infection , but hiv status was not introduced into the final model because of missing data . although chemoprophylaxis with chloroquine - proguanil was less common among case - patients than controls ( 8.5% vs. 21.2% , p = 0.03 ) , the reverse was seen , although not significantly , with mefloquine use ( 4.9% vs. 1.5% , p = 0.15 ) . multivariate analysis ( table 2 ) showed that factors positively and independently associated with prolonged p. falciparum infection in immigrant travelers were being a first - arrival immigrant ( or 22.93 , 95% ci 9.7453.96 , p<0.001 ) , being a pregnant woman ( or 4.21 , 95% ci 1.1315.77 , p = 0.03 ) , and mefloquine prophylaxis ( or 11.55 , 95% ci 2.0664.78 , p<0.005 ) . * or , we also observed cases of malaria in a 26-year - old caucasian man and a 2-year - old african girl who were hospitalized with diagnosis delays of 221 days and 127 days , respectively . the man was a french expatriate who lived in madagascar for 2 years and took regular chloroquine - proguanil prophylaxis . he was hospitalized 7 months after his return with severe p. falciparum malaria ( impaired consciousness ) and responded to treatment . the girl had traveled in mali for 2 weeks and took regular chloroquine - proguanil prophylaxis . she was hospitalized 4 months after her return with uncomplicated p. falciparum malaria occurring concomitantly with a salmonella spp . three independent factors were positively associated with prolonged p. falciparum infection : being a first - arrival immigrant , being a pregnant woman , and taking mefloquine prophylaxis . persons living in areas with high transmission of malaria acquire this immunity during childhood . in these areas , p. falciparum infections in adults are mostly asymptomatic with transient low parasitemia levels ( 10 ) . chronic asymptomatic carriage of p. falciparum helps prevent symptomatic malaria attacks ( 11 ) . in a previous study , 29% of asymptomatic liberian children had detectable p. falciparum 4 weeks after immigration to the united states ( minnesota ) ( 12 ) . we postulate that many first - arrival immigrants are asymptomatic p. falciparum carriers upon their arrival in france . their immunity probably prevents clinical symptoms for a few months , but in the absence of reinfections their immunity would decrease and symptoms would occur . in some cases , p. falciparum infections may not be the cause of illness when patients come to a hospital . several immunologic mechanisms have been suggested to explain late manifestations of p. falciparum malaria in pregnant women . other authors have suggested that antigenic variability could be responsible for impaired control of parasitemia ( 13 ) . the role of mefloquine prophylaxis in delayed onset of malaria has been suggested ( 14 ) . we found a positive association between mefloquine use and prolonged p. falciparum infection , but this drug was seldom used by our study group . this association is probably caused by the long half - life of mefloquine ( > 3 weeks ) . this study also highlights the risk for blood transfusion transmitted malaria , a rare but serious complication . ( 15 ) reported 32 cases of transfusion - transmitted p. falciparum malaria in the united states during 19631999 ( mortality rate 18.8% ) . current us guidelines recommend obtaining a thorough travel history and deferring blood donation if potential donors have emigrated from areas endemic for malaria in the preceding 3 years . however , this measure may not prevent transmission if p. falciparum is present for > 3 years ( as in 4 pregnant women in our study ) . in france , our findings suggest that physicians should consider the risk for prolonged p. falciparum infection in immigrant pregnant women and first - arrival immigrants even without recent travel to a country endemic for malaria . the prevalence of asymptomatic p. falciparum carriers in france or other northern countries is unknown but could be high with the increase in immigration . public health authorities should be aware of the risk these persons represent for blood donations .

advances of scientific research have brought about better understanding of diseases and mechanism of action of allopathic medicines . however , a good proportion of the world 's population , even in developed countries , continue to depend on complementary and alternative medicines ( cam ; b chng y t di y xu ) which are a group of varying medical and health systems , practices and products not usually considered as part of conventional medicine . a study in the united states of america in 2007 reported that almost 4 out of 10 adults had used some form of cam within the previous year . also in 1998 , the us public is estimated to have spent between $ 36 and $ 47 billion on cam therapies . this increasing patronage of cam is driven by its perceived success in recovering , healing , improving health , and more importantly , perceived lack of side effects , lower cost , and prompt attention compared to conventional medicines and practice.3 , 4 in africa , it is estimated that one traditional healer takes care of the health needs of every 500 people especially in rural areas and up to 80% of the population use traditional medicine for their primary health care needs.5 , 6 in recognizing the role played by these traditional healers , who is encouraging countries to promote and integrate traditional medical practices in their health care systems . the success or otherwise of integrating cam and conventional medical practice into the future healthcare system worldwide largely depends on the knowledge and attitude that physicians and other health workers would have with regards to cam . assessing medical students ' attitude towards cam would measure the possibility of this integration since as future doctors ; they are both the future policy formulators and implementers . education on cam has been found to lead to the development of more positive attitudes towards cam , and this has enhanced the inclusion of cam into the curricula of medical schools in the usa.9 , 10 , 11 data from developing countries on knowledge and perception of medical students towards cam is limited . this study therefore assessed the knowledge , attitude towards , and usage of cam among medical students of the university for development studies , one of the four medical schools in ghana . currently , cam is not part of the problem based learning curriculum in uds , so the study would also assess the students ' attitude towards its inclusion into the medical curriculum . this was a cross sectional study involving all 2nd , 3rd and 4th year medical students of the university for development studies in tamale , ghana . using previously published data , a structured questionnaire was designed.12 , 13 , 14 the questionnaire gathered information on respondents ' demographic data , knowledge , attitude and usage of complementary and alternative medicine . a pilot study of the questionnaire involving six students from the 3rd and 4th year medical classes was undertaken to determine the face validity of the questionnaire and also correct ambiguities . second year students were not available on campus at the time of piloting the questionnaire . in addition to the students who took part in the piloting , all first year medical students who in this university read preparatory subjects were also excluded from the final study which took place between may and june , 2014 . whereas , the 2nd year class were administered the questionnaire after a block examination , the 3rd and 4th year students filled the questionnaire before a lecture session . prior approval for this study was obtained from the ethics committee of the school of medicine and health sciences of the university for development studies . no questions mostly scored one point if it was affirmative and zero for a negative answer . depending on the complexity of the open ended questions , points greater than one were awarded for correct answers . due to the subjectivity of self - reported levels of knowledge , a more objective procedure was used to assess the student 's knowledge by requesting respondents who claimed to possess knowledge on cam ( b chng y t di y xu ) or any of the modalities to define or describe them . the level of knowledge of respondents on cam was determined using 4 questions . the first question , which measured awareness , required a yes or no answer as to whether respondent knew what cam was . the second and third questions were open ended question asking respondent to define cam and list four examples . respondent 's definition of cam was compared with that of the national centre for complementary and alternative medicine ( nccam ) in the us , and a maximum of two points were scored for a right answer . question four , was a table of 17 cam modalities asking respondents if they had heard of each of the modalities , first source of information , and a brief definition of the cam if they had knowledge on each specific cam . the listed cam modalities were ; homeopathy , naturopathy , acupuncture ( zhn ji ) , ayurvedic medicine , aromatherapy , chiropractic , faith healing , massage therapy , traditional african healing , iridology , hypnosis , meditation , yoga , reflexology , energy medicine , herbal medicine and biofeedback . a respondent agreeing to have ever heard of any of the cam modalities scored 0.5 of a point , while one point was awarded for the correct description or definition of a listed cam modality . a total of 8.5 points was scored for being aware of all the cam modalities , while accurate definition or description of all the listed cam modalities scored 17 points . the mean knowledge scores were obtained for each class , gender and locality where a student grew up . attitude was measured using 9 close - ended questions requiring a yes or no answer . one open - ended question asked of the respondent 's reaction if a patient asked for recommendation of cam . a positive response scored one while a negative / indifferent answer scored zero . to assist respondents who had limited knowledge on cam to appropriately respond to questions that would measure their attitude , the nccam definition was provided and respondents informed that a previous table ( question 4 ) contained a list of various cam modalities . overall mean attitude score was obtained for each class , gender and locality of early life of the respondent . knowledge and attitude were further categorized as poor when scores were less than 50% or good , when scores were 50% or more . level of usage of cam was assessed using two questions ; if respondent had ever used cam , and whether they were satisfied with the cam used . data was entered into microsoft excel , and analyzed using graphpad prism , version 5.01 ( graphpad software inc . , san diego ca ) and statistical package for the social sciences ( spss ) , version 18 ( spss inc , ibm , chicago , il , usa ) . internal consistency of the questionnaire was assessed by cronbach 's alpha value . associations between participants ' demographic characteristics and both knowledge and attitude scores were assessed using the chi - square test . the mean scores of knowledge and attitudes were compared using the independent t - test and one - way analysis of variance ( anova ) , where appropriate . relationship between knowledge and attitude scores was determined by calculating the pearson 's correlation coefficient . statistical significance was assumed at p < 0.05 and at a confidence interval of 95% . a total of 284 questionnaires were administered out of which 203 were completed and returned giving a response rate of 71.5% ; ( 2nd year n = 97/124 , 78% ; 3rd year n = 62/83 , 75% ; 4th year n = 44/77 ; 57% ) . the mean age ( standard deviation ) of the respondents was 22.35 ( 2.248 ) years . as shown in table 1 , majority of respondents were males 125 ( 61.6% ) ; grew up in the urban areas of ghana , 116 ( 56.7% ) ; were followers of the christian religion , 159 ( 78.3% ) . the anova showed a statistically significant difference in overall knowledge among students of different year groups , with students at higher levels obtaining higher scores ( p = 0.006 ) as reported in table 2 . out of 32.5 knowledge score , the mean scores for the various year groups were ; 2nd year ( 4.99 ) , 3rd year ( 6.26 ) and 4th year ( 7.83 ) . awareness of cam , represented by ever heard of the listed cams scored highest with 39.0% but total scores for the definition of individual cams was 9.9% . the claim by the students of knowing what cam is , scored higher than the cam definition . although male students obtained higher knowledge score than the females , the differences were not significant ( 18.7% vs 17.9% ; p = 0.635 ) . students who grew up in the urban areas scored higher than those from rural areas , however , the differences were not significant when knowledge scores were stratified by locality in which participants grew up using one - way anova ( 18.6% vs 18.2% ; p = 0.838 ) . table 3 shows the detailed knowledge score of the 17 cams listed in this study . the cams that were ever heard of by less than 20% of the students and their corresponding levels of correct definition scores were as follows ; aromatherapy ( 15.5 ; 6.3 ) , biofeedback ( 9.4 ; 0.0 ) , naturopathy ( 8.5 ; 0.8 ) , reflexology ( 6.9 , 1.0 ) , ayurvedic medicine ( 6.1 ; 1.5 ) , energy medicine ( 5.8 ; 0 ) and iridology ( 2.3 ; 0.8 ) . the five most commonly heard cams and their corresponding correct definition scores were herbal medicine ( 88.1 ; 59.5 ) , traditional african healing ( 75.1 ; 27.1 ) , acupuncture ( zhn ji ) ( 73.4 ; 43.4 ) , massage therapy ( 70.1 ; 23.8 ) and yoga ( 66.1 ; 15.7 ) . with the exception of homeopathy , iridology , reflexology and biofeedback , a greater proportion of students in the higher years , especially the 4th year students had heard of all the other cam modalities with significant differences in relation to acupuncture ( p = 0.01 ) , hypnosis ( p = 0.007 ) and meditation ( p = 0.0004 ) . the association between year of study and correct definitions for the modalities was significant for several modalities including ayurvedic medicine ( p = 0.026 ) , aromatherapy ( p = 0.009 ) , traditional african healing ( p = 0.004 ) , faith healing ( p = 0.0009 ) , hypnosis ( p = 0.007 ) and meditation ( p = 0.009 ) . in relation to gender , male students heard of a greater number of modalities ( 9 ) than females ( 8) . whereas the male students were significantly aware of acupuncture ( p = 0.028 ) , the females were better aware of aromatherapy ( p = 0.046 ) and massage therapy ( p = 0.031 ) . students who grew up in urban locations were also aware of greater number of modalities ( 11 ) than their rurally located counterparts ( 6 ) . in terms of locality of growing up , awareness was only different for ayurvedic medicine , ( p = 0.043 ) where rural students had greater scores than their urban counterparts . as shown in table 4 , television was the most common source of first encounter with the following cam modalities ; acupuncture ( 50.0% ) , massage therapy ( 58.1% ) , yoga ( 54.9% ) , meditation ( 48.1% ) , hypnosis ( 47.2% ) and chiropractic ( 45.5% ) . relatives and friends at home first made respondents aware of herbal medicine ( 38.1% ) and traditional african healing ( 34.5% ) . for some students ; school was the first source of information on herbal medicine ( 17.5% ) , traditional african healing ( 26.7% ) and hypnosis ( 19.4% ) . books and journals were the sources of awareness for the following cams for some students ; yoga ( 15.4% ) , meditation ( 20.8% ) and hypnosis ( 19.4% ) . other media made up of radio , newsprint , and outdoor advert were the sources of awareness of acupuncture ( 20.3% ) , massage therapy ( 19.4% ) , yoga ( 16.5% ) , chiropractic ( 29.5% ) , and homeopathy ( 42.2% ) . in the case of faith healing , the church ( 33.8% ) and television ( 32.4% ) were the most common sources of information . chiropractic ( 4.5% ) and massage therapy ( 3.2% ) were the only cams students became aware of at health facilities such as hospitals and spas . the overall mean attitude score of the students in this study was 7.51 out of 10 ( 75.1% ) . table 5 shows the mean attitude scores of the students categorized according to their year of study , gender and locality of early life . the 3rd year class had the highest score of 7.694 , followed by the 4th year ( 7.659 ) with the 2nd year class scoring the lowest of 7.184 but these differences of attitude at the various levels of study were not significant ( p = 0.236 ) . the worst attitudes were poor encouragement of their future patients of combining cam modalities with orthodox medicines ( 33.1% ) and their negative responses or indifference when a patient asked them for recommendations on cams ( 57.0% ) . the best attitudes were in relation to necessity and readiness to ask patient of previous usage of cam ( 96.1% ) and belief that cam is beneficial to healthcare ( 87.9% ) . there was no difference in overall attitude between males and females ( 7.667 vs 7.304 , p = 0.225 ) , neither was there a significant difference in attitude towards cam between students growing up in rural or urban localities ( 7.420 vs 7.461 , p = 0.891 ) . majority of the students ( 89.2% ) in this study were never asked questions related to their previous use of cam by their physicians . the level of personal usage of and satisfaction with cam modalities is as shown in table 6 . the highest level of use of cam was among the 4th year students ( 65.9% ) and the lowest among the 2nd year students ( 54.6% ) . however , it was the 2nd year students who had a higher level of satisfaction ( 81.1% vs 72.4% ) . there was no significant difference in the level of usage based on the year of study ( = 1.626 , p = 0.4436 ) . more male students used cams ( 58.4% vs 56.4% ) than females ; however , the females were more satisfied with the results from their usage of cam ( 79.5% vs 75.3% ) . the difference between the usage and level of satisfaction after use , when stratified according to the gender , was not significant . although more rural dwellers used cams ( 62.5% vs 53.9% ) , they were less satisfied with the outcome of the cams used ( 74.5% vs 79.0% ) . majority of the students who had ever used cam ( 76.5% ) were encouraged by relatives and friends while 11.3 % were by herbalists . while some students stated they were currently using a cam modality for an ailment , the last time majority of them ( 55.4% ) had used a cam modality was more than 3 years which is responsible for up to 54.7% of the students unable to recollect the names of the cam modalities , herbal plants or their products used . for students who named the cam modality used , 88.6% used herbal medicine with the rest being other forms of cam . the most common ailments the cams were used to treat were malaria ( 43.6% ) and pains ( 12.8% ) . direct supervision by one of the authors who was involved with the respondents ' academic works might have contributed to the high response rate of 71.5% especially when compared with rates from some previous studies.12 , 15 , 16 , 17 in this study , there was no cam that at least a student had not heard of but in all cases , students were less knowledgeable when asked to define or describe the cam modality they claimed to have heard of . none of the students was able to define modalities such as biofeedback and energy medicine with 1% or less correctly describing naturopathy , iridology and reflexology . whereas in singapore and pakistan , acupuncture is the best known cam , american students consider massage , herbal medicine and meditation as their best known cams.12 , 15 , 18 the best heard of and known cam modality in this study was herbal medicine ( 88.1% ; 59.5% ) . a greater proportion of the students in this study ( 38.5% ) stated that their knowledge or use of herbal medicine was influenced by relatives and friends . also , in this study herbal medicine was the most commonly used cam . the level of cam usage in this study is higher compared to usage among medical students in pakistan but lesser than that reported in usa.12 , 19 these results and the fact that 80% of africans are known to use traditional medicine confirms the assumption that having a family member using a cam modality , among other factors such as the environment , personal interest , religious beliefs , and cultural background influence a person 's knowledge and attitude towards the use of cam.5 , 6 , 18 , 20 , 21 the knowledge score for traditional african medicine was lower than herbal medicine since most students overlooked the spiritual aspect of traditional african healing . although cams such as acupuncture ( zhn ji ) , hypnosis , massage therapy , yoga are not traditionally practiced in ghana , the students had a fair knowledge of them with television being their main source of information . this study showed that the overall knowledge of the medical students on cam was poor with majority ( 85.7% ) of them not even aware of the term cam , a result comparable to those from ireland , turkey and pakistan.12 , 14 , 21 the knowledge and usage of cam among medical students in usa was however better than students in this study possibly due to the integration of cam into their medical curriculum.23 , 24 there was no significant difference in knowledge of cam modalities with respect to gender and locality where a person grew up , although the males and the urban dwellers had better knowledge . in turkey the males this study , like others has demonstrated a highly significant association between advancing year of medical education and increased knowledge of students on cam.15 , 18 arguably , advancing year and knowledge are covariates , however , the effect of year of study on knowledge about cam observed in the current study could be attributed to the 3rd and 4th years having more years of a community based education and service ( cobes ) , an academic programme in this university during which students spend at least 4 weeks in a rural health facility where they effectively interact with the prevailing health systems . at the end of cobes , students are expected to present a report on the health care systems of the communities which are mostly herbal or traditional medicine and practices . there was a high overall attitude of the students towards the use of cam in this study ( 75.1% ) which was however lower than values recorded in countries such as usa ( > 80% ) and singapore ( 85.0%).12 , 21 , 23 students of higher years of study , females and urban dwelling students have better attitudes but the differences were not significant . attitude correlated positively with knowledge in this study ( r = 0.27 , p < 0.0001 ) , which agrees with earlier reports.13 , 14 , 15 , 20 almost all the students agreed that there was the need for the doctor to ask a patient about their previous usage of cam and that they will ask when they become doctors . this result is encouraging since patients ' cam usage information would assist the doctor to better manage the patient 's condition in relation to diagnosis , prescribing and counseling as indicated by 42.9% of the respondents . majority of the students ( 85.5% ) , just as reported in other studies were of the opinion that it is necessary for a doctor to have adequate knowledge on cam . most students in this study and other previous works clearly indicate that most medical students and physicians are desirous of the introduction of cam into the medical school curriculum.13 , 18 , 24 whereas previous studies have shown that majority of medical students support the combination of cam with conventional medicines , fewer students ( 33.1% ) in this study agreed to this combination.12 , 25 this attitude could possibly be due to the students ' limited knowledge on cam , with the apprehension of potential interactions between the herbal products and the conventional medicine being a reason , although several cams do not involve chemicals . a fifth of the students stated possible drug - drug interaction as a reason for which a doctor must ask patients of their previous use of cams during history taking . in this study , the television was the main source of information on most of the cams , with family relations , friends and schools also providing knowledge especially in relation to herbal medicine and traditional african medicine . the high level of knowledge of the students about acupuncture , hypnosis , and yoga might have been as a result of film shows originating from asian countries such as india and china where these practices are most prevalent.26 , 27 knowledge on homeopathy and chiropractic medicine was possibly acquired from adverts on television from spas , and clinics where these cams are practiced . the church and television being the main source of knowledge on faith healing was not surprising since most respondents are christians who believe in prayers and also several ghanaian television stations show healing sessions by miracle performing pastors . the rather lower knowledge on faith healing can be attributed to not using the term . just like in studies from other countries , most respondents were desirous of the introduction of cam into medical school curriculum in the form of lectures during the pre - clinical stage of the medical programme.12 , 15 , 21 , 28 this study is limited by the fact that it was conducted in one medical school and only at preclinical level and so can not be generalized to cover all medical students and at all levels of study in ghana . the challenge of giving retrospective accounts of knowledge and usage also introduced bias which could influence the results obtained in this study . at the preclinical level of a problem base learning curriculum which is followed in the university of the respondents , there is no substantial appreciation of disease and treatment mechanisms with their associated benefits and potential untoward effects , which could affect participants ' attitude towards the use of cams . although all the cams ( b chng y t di y xu)listed had ever been heard of by at least one student , their overall knowledge on cam modalities is poor . television played an important role in providing knowledge on cams but relatives and friends greatly influenced attitude towards the use of the best known cams especially herbal medicine . they are most likely to ask patients of their previous usage of cam ; recommend a cam to a patient ; and gladly accept the introduction of studies on cam into their medical curriculum since they believe it is beneficial to healthcare . majority of the students have used herbal medicine for an ailment and were satisfied with the results obtained . this means that with the integration of cam into medical curriculum , future physician 's attitude and usage of cams would see a tremendous increase which will go a long way to enable cams contribute towards the overall health needs of ghanaians . authors have no conflict of interests , and the work was not supported or funded by any person or organization .

it is a component of cookware , utensils , medicines such as antacids , cosmetics such as deodorants , and food additives . some foods , especially corn , yellow cheese , salt , herbs , spices , and tea , might also contain al [ 1 , 2 ] . in addition , industrialized civilizations use alum ( aluminum sulfate or aluminum potassium sulfate ) as flocculants in purification of drinking water . this enabled distribution of large volumes of drinking water to millions of urban consumers and allowed easy entrance of al into the body via gastrointestinal tract [ 1 , 2 ] . evidence has proved that chronic intake and metabolism of al compounds could account for alzheimer 's disease [ 1 , 2 ] . aluminum concentrations were found to be extensive in the hippocampal region and also frontal cortex of the alzheimer patients . nevertheless , a limited number of studies have assessed the effects of al on prefrontal cortex ( pfc ) . however , pfc is the cerebral cortex located in front of the frontal lobe . functionally , pfc is believed to be involved in monitoring of actions , decision making , memory , motor planning , movement , and reward . pfc is involved in cognition and seems to play a role in dementia associated with alzheimer . a previous study revealed reduction of glial fibrillary acidic protein levels and impairment of astrocytes function in the rats ' cerebral cortex after al - treatment . kim ( 2003 ) also showed impaired expression of neuronal nitric oxide synthase caused by exposure to al during the early developmental stage of the brain . although different neuroprotective agents have been evaluated after al - exposure , the present study aims to evaluate the effects of pioglitazone ( pio ) . evidence has suggested that these receptor agonists may improve some of the histopathological features of parkinson 's disease , optic nerve crush , and spinal nerve crush and cerebral ischemia [ 79 ] . it has been shown that activation of ppar induces anti - inflammatory and antioxidant properties in brain . ppar activation persuades a reduction in neuronal death by deterrence of oxidative or inflammatory processes involved in cerebral injury . it has been also reported that the vascular effects are the outcome of a decrease in oxidative stress and inhibition of function of adhesion proteins , including the molecules of vascular cell or intercellular adhesion proteins injury . moreover , ppar activation might be able to induce healing and regeneration of the vascular endothelium of the brain . expression of the ppar - gamma has been approved in many anatomical brain regions of the adult mouse including cerebral cortex , caudate , putamen , hippocampus , thalamus , hypothalamus , and brain stem . according to the above - mentioned rationales , evaluation of effectiveness of pio in protecting the vessels , neurons , and glia in the cortex after exposure to a neurodegenerative agent ( al ) can be useful for future clinical application . since the structure of pfc after al - exposure has received less attention , the medial pfc ( mpfc ) of the rats was evaluated in the first step of this study . in the second step , briefly , the study aimed to find responses to the following questions using stereological techniques : how much does the volume of the mpfc and its subdivisions change after al - treatment ? how many neurons and glial cells of the mpfc are lost after al - consumption ? does pio protect the vessels , neurons , and glial cells of mpfc after exposure to al ? in this study , 15 adult male sprague - dawley rats ( 165 15 g ) were obtained from the laboratory animal center of shiraz university of medical sciences . the ethics committee of the university approved the animal experiment ( approval number 92 - 6789 ) . the animals were housed under standard conditions , room temperature ( 2224c ) , and a 12:12 h light - dark schedule and had free access to water and food . five animals per group were sufficient for the stereological studies and were chosen according to hyde et al . injection of 1 ml normal saline ( as a vehicle ) daily , ( ii ) al group received i.p . injection of 1 ml of the vehicle containing 10 mg / kg / day aluminum chloride ( sigma aldrich , germany ) [ 13 , 14 ] , and ( iii ) al + pio group received 40 mg / kg / day of pioglitazone ( sigma aldrich , germany ) in addition to al . the rationale for selecting the al dose was the aluminum intake in adults which is usually 10 mg / kg / day , but it will increase to hundreds mg / kg / day when people receive foods with a high aluminum concentration or aluminum - containing drugs . therefore the exact intake of al can not be determined exactly in human being in different countries . the authority reported that the mean dietary contact from water and food in nonoccupational exposed human adults exhibited large variations between different countries and , within a country , between different studies . the measure was reported to range from 1.6 to 13 mg al per day [ 13 , 14 ] . in addition , it should be mentioned that the selected dose has been recommended in animal models to induce neuronal degeneration . it is important in the present research to evaluate the protective effects of pio on loss of neuronal and glial cells after exposure to the neurodegenerative dose . the rationale for choosing 40 mg / kg dose for pioglitazone was based on the research by almasi - nasrabadi et al . . they administrated 10 , 20 , and 40 mg / kg of pio to mice receiving scopolamine and found that dose of 40 mg / kg improved some behavioral performances of the mice . the rats were anesthetized with ketamine - xylazine ( 80 and 20 mg / kg , resp . ) . after transcardial perfusion of the rats with buffered formaldehyde , the brains were uncovered by an incision along the midline of the skull . after that , the right cerebral hemisphere was immersed in buffered formaldehyde for one week and then embedded in the paraffin block . it located at 4.702.70 mm ventral and 4.702.70 mm dorsal to the bregma . a complete series of coronal sections of 4 m followed by 26 m thickness were obtained and continued along the whole length of the mpfc . overall , about 812 sections with 4 m thickness and 812 sections with 26 m thickness were selected from each mpfc in a systematic random manner . the sections were stained with cresyl violet ( 0.1% in distilled water ) in order to estimate the volume of the mpfc and its subdivisions , volume of the vessels , and total number of the neurons and glial cells . it should be mentioned that the glial cells were distinguished from the neurons by their smaller size and lack of a nucleolus and stained cytoplasm . mpfc includes three subdivisions , namely , prelimbic ( pl ) , infralimbic ( il ) , and anterior cingulate cortex ( acc ) . using a projecting microscope , the live images of 4 m thickness sections were evaluated at the final magnification of 24x according to the rat brain atlas . the boundaries of the mpfc were considered from the most frontal section where the underlying white matter appeared and was sustained on every mounted section up to the presence of the genu of the corpus callosum where decussating fibers could be seen . briefly , a grid of points was overlaid on the pfc images and the volume of the mpfc was estimated by the following formula:(1)vmpfc=papd , where p was the total points hitting the mpfc sections ( here 99135 points per animal ) , a / p was the area associated with each point ( here was 0.1 mm ) , and vv(vessels / mpfc ) , was estimated using point - counting method and the following formula [ 18 , 19 ] : ( 2)vvvessels / mpfc = pvesselspmpfc , where p(vessels ) and p(mpfc ) represented the total number of the points on the vessels profile and the mpfc , respectively . the total volume was estimated by multiplying the vv(vessels / mpfc ) by v(mpfc ) [ 18 , 19 ] . the total number of the neurons and glial cells was determined using the optical disector method at the final magnification of 3400x on 26 m thickness sections [ 18 , 19 ] . the location of the microscopic fields was carefully chosen by systematic uniform random sampling while moving the stage in identical distances in x- and y - directions . an unbiased counting frame with inclusion and exclusion borders was overlaid on the images of the computer monitor to avoid the edge effect and biased counting of the cells ( figure 1 ) . a microcator was attached to the stage of the microscope to measure the z - axis movement in depth of the section . the upper and lower guard zones were considered to avoid counting the cutting artifacts located at the upper and lower surfaces of the tissue sections . the height of the disector was demarcated as the section thickness excluding the 4 m thick guard zones at the top and bottom of each section . any nucleolus ( neurons ) or nucleus ( glial cells ) coming into maximal focus within the height of the disector was selected if it lay completely or partly inside the counting frame and did not hit the exclusion lines ( figure 1 ) . the suitable guard zone was defined after estimating the percent of nuclei in the ten columns of the z - axis thickness . each column represented 10 percent of the section thickness . according to the histogram , the upper and lower 20% were considered as the guard zones . besides , the remaining columns were considered as the height of the disector ( figure 1 ) . the numerical density ( nv ) was estimated using the following formula [ 18 , 19]:(3)nv=qpa / fhtba , where q was the number of the neurons or glial cells nuclei coming into focus and counted ( on the average , 80101 neurons and 100136 glial cells were counted per mpfc ) , p was the total number of the counting frames in all fields , a / f was the area per frame ( 470 m ) , h was the height of the disector , t was the real section thickness measured using the microcator when the q was counted ( here ~20 m on the average ) , and ba was the block advance of the microtome which was set at 26 m . the total number of the neurons was estimated by multiplying the numerical density ( nv ) by v(mpfc ) [ 18 , 19 ] . the ce(v ) for the estimate of the mpfc volume was calculated using the following formula [ 18 , 19]:(4)cev=p112403pi2+pipi+24pipi+1 + 0.0724banpi1/2,where b and a represented the mean section boundary length and mean sectional area , respectively . the ce for the estimate of the total number of neurons , ce(n ) , was calculated using ce(v ) and ce(nv ) as follows:(5)cen = ce2nv+ce2v1/2cenv = nn1q2q2+p2p22qpqp1/2 . the study data were entered into the spss statistical software ( version 15.0 ) and analyzed using kruskal - wallis and mann - whitney u test with adjusted alpha level . ce was 0.03 for estimation of the volume of the mpfc that shows acceptable value . the study results revealed ~17% decrease in the volume of the mpfc in the al group in comparison to the control rats ( p < 0.02 ) ( figure 2 ) . however , no improvement was seen in al + pio group in comparison to the al ones . the volume of the acc reduced by 22% in the al - treated rats in comparison to the control ones ( p < 0.02 ) . however , no significant difference was observed between the al + pio and al groups regarding the volume of the acc ( figure 2 ) . the study findings showed ~13% reduction in the volume of the prelimbic region in the al group in comparison to the control animals ( p < 0.02 ) ( figure 2 ) . nonetheless , no amelioration was detected in the pl volume in the al + pio group in comparison to the al rats . the study results revealed ~38% decrease in the volume of the infralimbic region in the al - treated rats in comparison to the control ones ( p < 0.02 ) ( figure 2 ) . nevertheless , the volume of the infralimbic region remained unchanged in the al + pio - treated rats compared to the al - treated animals . the volume of the vessels reduced by 47% in the al - treated rats in comparison to the control ones ( p < 0.02 ) . however , no improvement was found in the vessels ' volume in the al + pio group compared to the al - treated rats ( figure 2 ) . ce was 0.11 and 0.12 for estimation of the number of neurons and number of glial cells , respectively , which shows acceptable values . the results showed that the total number of the neurons in the mpfc was significantly reduced by 40% in the al group in comparison to the control rats ( p < 0.02 ) . however , the number of the neurons was significantly higher in the al + pio group in comparison to the al - treated animals . although there was a difference between the control and al groups , pio ameliorated the effects of al on reduction of the number of neurons . in other words , the number of the neurons reduced in the al + pio group , but to a lesser extent compared to al alone ( p < 0.02 ) ( figure 2 ) . the results showed that the total number of the glial cells in the mpfc was significantly reduced by 25% in the al group in comparison to the control rats ( p < 0.02 ) . yet , further analysis revealed no improvement in the al + pio animals ( figure 2 ) . as figure 3 depicts , compared to the control rats , accumulation of the neurons and glia was lesser in the al - treated animals in both superficial and deep layers of the mpfc . more population of the cells was detected after the concomitant treatment of the rats with pio and al in comparison to administration of al in the layers of the cortex . the present study evaluated the effects of al on the structure of the mpfc of the rats using stereological methods . the protective effects of pio on the al - treated rats were investigated , as well . reduction of the volume of mpfc and its subdivisions was the finding of the first step of this survey . the cortex volume reduction is in coincidence with the work of stoeckel et al . , ( 2013 ) . cerebral cortex including mpfc is composed of neurons , glial cells , vessels , and neuropil . the vessels volume mainly reflects the blood volume that can fill the vessels and , therefore , the blood supply of the tissue . our study results showed that this parameter was decreased after al - treatment in the rats . ( 2013 ) who evaluated the brain changes using mri and estimation of cerebral blood flow . they reported that regional cerebral blood flow and the density of the vessels are reduced after alcl3-induced alzheimer disease in rats . their results showed that in these animals most vessels around the hippocampus and cortex could not be observed . ( 2013 ) suggested that the endothelial cells that lined the cerebral vasculature might have biochemical properties leading to binding of al to them . there are researches that suggested that cerebral hypoxia triggers the potential downstream inflammatory and pathogenic consequences [ 23 , 24 ] . therefore , the above - mentioned studies might explain the reduction of the vessels ' volume in the present study . these findings were in agreement with those obtained in the previous studies , demonstrating that al added to the diet was able to induce neuron and glia loss and alzheimer 's disease [ 25 , 26 ] . the evidences of walton ( 2009 ) suggested aluminum progressively collects in cortical and limbic areas of vulnerable subjects ' brains , eventually producing cell loss and disrupting afferent and efferent circuitry . previous studies claimed that glial cells might be one of the targets of al neurotoxicity . reduction of the vessels ' volume and consequently the blood supply might be one of the reasons for the cell loss in the al - exposed rats . ( 2014 ) reported disruption in the blood brain barrier in the vessels of the nervous system after al toxicity that might be followed by al distribution in the brain tissue . apoptosis and necrosis are the main mechanism of cell death in al toxicity [ 28 , 29 ] . up to now , a limited number of studies have indicated the structural protection of pio and most studies have focused on behavioral improvement by pio . the neuroprotective results of the current study were consistent with a previous evaluation of the neuroprotective effects of pio , in which 30 mg / kg pio administration in a rat model of parkinsonism protected the neurons 2014 ) conducted an in vitro study and demonstrated that pio could protect the rats ' cerebellar granule cells against nutrient deprivation . moreover , r. gupta and l. k. gupta ( 2012 ) demonstrated that pio offered protection against memory dysfunctions observed in alzheimer 's model . they suggested that the protective action of pio was possibly due to its antioxidant action . one other study also confirmed that pio had a neuroprotective effect against scopolamine - induced cholinergic system deficit and cognitive impairment . pio is essentially used for management of diabetes mellitus type 2 either alone or in combination with other drugs [ 3033 ] . the mechanism of action of pio might be due to its anti - inflammatory process . it has been suggested that pio inhibits the inflammatory response by attenuating the mediators of inflammation , including expression of cyclooxygenase-2 , ( an enzyme responsible for inflammation , cox-2 ) , prostaglandin e2 generation ( a bioactive lipid that provokes an extensive range of biological effects associated with inflammation , pge2 ) , and microglia activation , resulting in protection of neurons [ 3033 ] . in conclusion , al could induce structural changes in the rats ' mpfc . besides , pioglitazone showed beneficial effects on neuronal protection in the al - exposed animals .

certain guanine - rich dna sequences have the ability to form stable secondary structures , g - quadruplexes , comprising g - tetrad motifs that involve four guanines arranged in a planar array interacting via hoogsteen hydrogen bonds ( 1,2 ) . these g - tetrads are stable when a number are stacked on top of one another . there have been numerous topologies observed for g - quadruplexes ( 3 ) and a number of studies have mapped out potential quadruplex forming sequences in genomic dnas ( 411 ) . the search criteria for most of these surveys have been sequences , which contain four or more runs of g - tracts occurring close together on the same strand . these potential quadruplex structure sequences ( pqss ) have been found to occur with elevated frequency in regions directly upstream of the transcription start site of genes in species as diverse as escherichia coli ( 8) and humans ( 11 ) . there are also a number of specific promoter regions for which there is biophysical and structural evidence for the formation of pqsss ( for example , 1118 ) , at least in vitro . the zinc finger protein sp1 acts as a transcription factor , which has been shown to bind to the upstream element sequence this element has been found in many different promoters , often with a copy number > 1 ( 19,20 ) and often within the first 100 bp upstream of the transcription start site . the fact that it is guanine - rich , with consecutive guanines , gives it the ability to participate in pqsss , at least in principle . we show here that many of the pqsss found in the regions directly upstream of the transcription start site actually contain the sp1 consensus sequence and that there is a correlation between genes , which have the sp1 and pqss in upstream regions . another common upstream promoter element ccaat occurs in a similarly large number of promoters but does not contribute as much guanine - richness as the sp1-binding element and can be employed as a useful comparative group . the mysql tables for the ensembl human core database v45 ( 24 ) were downloaded from the ensembl web site ( www.ensembl.org ) and imported onto a local computer . the human genome was searched for pqsss in the same way as described earlier ( 5 ) and the pqss data was uploaded into mysql tables . the search criterion was four runs of guanine gm xn gm xo gm xp gm where m is between 3 and 5 , and x are any combination of bases where n , o and p are between 1 and 7 . using perl scripts and the ensembl perl api ( 25 ) , a list of all genes with ensembl status these were searched for the sequences gggcgg and ccaat as well as their complementary sequences and the genes were grouped into the following categories : genes with gggcgg in the region 500 bps upstream of their transcription start site ( 500usr).genes with gggcgg in the region 500 bps upstream of their transcription start site ( 500usr ) . the mysql table of pqsss was used to count the pqsss in the upstream regions of the genes in each category and their distances ( 1 bp to 500 bps ) from the transcription start sites were noted . in order to represent these graphically the positions of the quadruplex sequences were put into bins of 10 base pairs . when looking at the number of pqsss we counted each contiguous region of potential quadruplex region as a single sequence element i.e. if there were overlaps between more than one pqss , then these were counted as one sequence element . for example the sequence : gggaggcgggcggtgggggggtgggggtgggg , which is in the upstream region of the ensembl gene ensg00000204219 ( hgnc symbol tcea3 ) , was counted as one sequence element . even though it contains up to six runs of guanines , we assume that only one quadruplex structure at a time can be formed in this region . the number of cytosines and guanines in all known genes was also derived for each of the bins . the cytosine and guanine data were normalized as was the total quadruplex distribution so that a comparison of the relative distributions could be made , since the absolute number of cytosines and guanines was much higher . our database of pqsss was also searched for pqsss , which incorporated the sp1 consensus sequence and the distributions of pqsss containing the sp1 consensus sequence and those not containing the sp1 consensus sequence could then be determined . figure 1 shows the number of pqss elements per gene for a number of different grouping of genes . bars a and b show that pqsss in upstream regions of genes that contain sp1 elements are much more common than pqsss in upstream regions of genes without sp1 elements . in bars c and d we see that there is no such relationship in genes whose upstream regions contain ccaat elements . if anything the reverse is true and genes without ccaat elements contain more potential pqsss . this trend is repeated in bars e , f , g and h where e and g contain sp1 elements and contain many more pqsss per gene than bars f and h. the trend of fewer pqsss in the upstream regions with ccaat is also apparent here . in bar i the number of pqss elements per gene in the upstream region of all genes is much lower than those which contain sp1 sequence elements and higher than those which do not . figure 1.pqss sequence elements per gene for potential quadruplex sequences in upstream regions ( a ) containing sp1 elements , ( b ) not containing sp1 elements , ( c ) containing ccaat elements , ( d ) without ccaat elements , ( e ) containing ccaat and sp1 elements , ( f ) containing ccaat and no sp1 elements , ( g ) containing sp1 and no ccaat elements , ( h ) containing neither sp1 nor ccaat elements , ( i ) of all known ensembl genes . pqss sequence elements per gene for potential quadruplex sequences in upstream regions ( a ) containing sp1 elements , ( b ) not containing sp1 elements , ( c ) containing ccaat elements , ( d ) without ccaat elements , ( e ) containing ccaat and sp1 elements , ( f ) containing ccaat and no sp1 elements , ( g ) containing sp1 and no ccaat elements , ( h ) containing neither sp1 nor ccaat elements , ( i ) of all known ensembl genes . figure 2 shows the distribution of the promoter - binding elements sp1 ( gggcgg ) and ccaat with distance from the transcription start site . the shape of this graph shows that the frequency of sequence elements rises steeply , reaching a peak in the 50 to 41 range for sp1 and in the 70 to 61 range for ccaat before falling off gradually . figure 2.(a ) sp1 sequence elements , which occur in upstream regions , ( b ) ccaat sequence elements , which occur in upstream regions . ( a ) sp1 sequence elements , which occur in upstream regions , ( b ) ccaat sequence elements , which occur in upstream regions . the distribution of pqsss in the 500 bp upstream region of transcription start sites is very similar to that of the regulatory motifs in figure 2 . figure 3a shows the distribution for pqsss in the upstream region of all ensembl genes with status known ; the maximum peak is in the same region as the peak for the distribution of sp1-binding elements , 50 to 41 bases . a search for the sp1-binding site motif revealed that of the 22 633 known genes , just over half ( 52.5% ) contained the motif in their upstream region ( table 1 ) . however in figure 3b we can see that this set of genes accounts for the vast majority of pqsss in upstream regions ( 86.6% ) . not only are the absolute number of pqsss different , but the distribution of pqsss which are in the upstream regions of genes with and without the sp1 consensus sequence differ markedly , as seen in figure 3b and c , respectively . the pqsss in non - sp1 upstream regions have a much flatter distribution than that of the sp1 motif genes . figure 3.potential quadruplex sequences ( a ) occurring in upstream regions , ( b ) in upstream regions which contain sp1 sequence elements ( c ) in upstream regions which do not contain sp1 sequence elements , ( d ) which incorporate sp1 sequence elements and are within upstream regions , ( e ) which do not incorporate sp1 sequence elements and are within upstream regions . table 1.summary of quadruplex occurrences in upstream regions of the human genomequadruplex occurencesnumber of genesnumber of sequence elementssp1 sequence elements which occur in upstream regions11 87229 991pqsss in upstream regions which contain sp1 sequence elements54158660genes without sp1 consensus sequence in their upstream regions10 761pqsss in upstream regions which do not contain sp1 sequence elements10961335pqsss which incorporate sp1 sequence elements and are within upstream regions35964721pqsss which do not incorporate sp1 sequence elements and are within upstream regions41505274ccaat sequence elements which occur in upstream regions10 96317 574pqsss in upstream regions containing ccaat sequence elements27183948genes whose upstream regions contain no ccaat sequence elements11 670pqsss in upstream regions containing no ccaat sequence elements37946047genes whose upstream regions contain ccaat and sp15451pqsss in upstream regions containing sp1 and ccaat sequence elements22363368genes whose upstream regions contain ccaat and no sp15512pqsss in upstream regions containing ccaat and no sp1 sequence elements482580genes whose upstream regions contain sp1 and no ccaat6421pqsss in upstream regions containing sp1 and no ccaat elements31805292genes whose upstream regions contain neither sp1 nor ccaat5249pqsss in upstream regions containing neither sp1 nor ccaat elements614755all genes22 633pqsss in all upstream regions65129995 potential quadruplex sequences ( a ) occurring in upstream regions , ( b ) in upstream regions which contain sp1 sequence elements ( c ) in upstream regions which do not contain sp1 sequence elements , ( d ) which incorporate sp1 sequence elements and are within upstream regions , ( e ) which do not incorporate sp1 sequence elements and are within upstream regions . summary of quadruplex occurrences in upstream regions of the human genome since the sp1 consensus sequence is guanine - rich and can be incorporated into pqsss , we examined the number of pqsss , which contained the sp1 consensus sequence . the distribution of pqsss incorporating the sp1 sequence ( figure 3d ) and pqsss without the sp1 consensus sequence ( figure 3e ) is very different . figure 3d shows a distribution similar to the sp1 motif while that in figure 3e is much flatter . for a random sequence the probability of finding a pqss is related to its guanine content so we looked at the guanine density within upstream regions . in figure 4 we have the normalized distributions of pqsss ( a ) , guanine bases ( b ) and cytosine bases ( c ) . both guanine and cytosine do indeed get more frequent closer to the transcription start site although it is hard to say whether this is related to pqss distribution . figure 4.normalized distributions in the 500 bp upstream regions of ensembl genes with status known of ( a ) pqsss , ( b ) guanines , ( c ) cytosines . normalized distributions in the 500 bp upstream regions of ensembl genes with status known of ( a ) pqsss , ( b ) guanines , ( c ) cytosines . figure 5 shows the distributions of pqsss within genes that contain the regulatory element ccaat in their upstream region ( figure 5b ) and pqsss within genes , which do not contain ccaat in their upstream region ( figure 5c ) . the distribution of pqsss in ccaat , although having a maximum at the same place as the ccaat elements themselves ( 151 elements in the 70 to 61 region ) has virtually the same number ( 149 ) in the region of the peak of the sp1 consensus sequence distribution ( 70 to 61 bases ) . the pqsss that occur in genes without upstream ccaat elements have a peak in the same regions as the sp1 sequence elements . figure 6 shows the effect of the presence of sp1 and ccaat sequence elements on the pqss distribution , focusing on the distribution in additional groupings of genes . pqsss upstream of genes with upstream sp1 elements but no upstream ccaat elements have a distribution very similar to the sp1 element and the pqss distribution of all known ensembl genes ( figure 6a ) . there are very few pqsss in genes , which contain upstream ccaat sequences but no sp1 elements , and their distribution is very flat ( figure 6b ) . genes with both upstream sp1 and ccaat elements have many more pqss however not such a distinct maximum ( figure 6c ) and genes with neither upstream sp1 nor ccaat elements have very few pqsss and a rather flat distribution ( figure 6d ) . the distribution of pqsss resembles that of regulatory motifs such as sp1 and ccaat , although it would appear that upstream sp1 elements have a positive effect on the number of upstream pqsss while the presence of ccaat has a deleterious effect . thus we can demonstrate that pqsss linked to sp1 sequence motifs in the upstream regions is perhaps unsurprising but what is not necessarily so obvious is how dominant this effect is . it has been proposed that induction of quadruplex formation in promoter sequences by quadruplex - selective small molecules can be a viable therapeutics strategy ( 26 ) . the present study provides support for this approach , and suggests that effort could be focused on those genes in which pqsss are linked to sp1 sites , as is the case , for example , of the c - kit gene implicated in gastrointestinal cancers ( 15,27 ) . a very recent report ( 28 ) , in contrast , finds g - rich sequences in the first intron of many human genes , and considers that these are more likely to be pqsss suitable for therapeutic intervention , in part because of the potential for structural polymorphism in the upstream sites . it is not clear that this would be a problem since it is likely that small molecule binding would tend to drive the equilibrium towards discrete quadruplex species . in addition , some pqss sites such as those in the c - kit promoter ( 15,27 ) , comprise isolated runs of just four g - tracts each , and are much less likely to participate in quadruplex polymorphism . we also note that the presence of the zinc finger motif in sp1 may be significant in view of findings that the motif has been selected out from phage libraries to bind to quadruplex dnas ( 2931 ) , and that transcription factors containing zinc fingers have been reported to bind to g - tract promoter sequences , notably the insulin promoter factor pur-1/maz ( 32 ) .

fractures of the distal radius are commonly encountered in the upper extremity particularly in the elderly and constitute a major public health concern . while immobilization reduce pain , local soft tissue swelling exaggerates aching , decreases patient satisfaction , and results in poor clinical outcome due to delayed rehabilitation . analgesic medications are usually prescribed in these patients , aiming at the relief of the symptoms and a better quality of life . although that salmon calcitonin has been widely investigated and used for the treatment of osteoporosis , there are limited clinical studies investigating the orthopaedic indications of nasal calcitonin in post - fracture disease that leads to disability due to pain , resulting to a poorer quality of life . the purpose of the study is to investigate the effect of nasal salmon calcitonin in post - fracture pain in women with unilateral distal radius fracture . in this double - blind randomized prospective study , forty - one postmenopausal women aged 50 or above were included . these women were suffering from a fresh unilateral extra - articular distal radius fracture without ulnar styloid fracture based on ao classification with an indication of conservative treatment . all patients were treated with close reduction and cast immobilization for a period of 35 - 45 days and followed - up for a period of 6 months after the fracture . the first group consisted of 19 women received 200 iu of intranasal salmon calcitonin ( miacalcic , novartis pharma ag , basel , switzerland ) on a daily basis for 3 months whereas the second group composed of 22 women received intranasal daily dose of placebo for the same period of time . approval by the nstitutional review board ( irb ) and written informed consent , as well as any necessary health insurance portability and accountability act ( hipaa ) consent , was obtained from each patient . patients with known metabolic bone disease excluding osteoporosis , pathologic fracture in the examined body area or elsewhere , bilateral forearm fracture , poly - trauma , multiple - fracture patients , traffic - accident patients , unilateral distal forearm fracture with the indication of surgical treatment and re - fracture of the examined body area and any surgical procedure in the region of the studied extremity during the course of the study were excluded from the study . the assessment of pain at the site of fracture was recorded using the visual analogue scale ( vas ) , which rates pain with the use of a 10 cm long horizontal line , with 0 rated as no pain and 10 as very severe pain . pain severity was rated initially , on 10 day , the day that the cast was removed ( 35 - 45 day ) , 90 and 180 . data is expressed as meanstandard deviation ( s.d . ) or median ( in case of violation of normality ) for continuous variables and as percentages for categorical data . the comparison of variables at each time point was performed using the independent samples t - test or the mann - whitney test in case of violation of normality . to indicate the trend in the first 180 min of intervention , the mean percentage changes after 45 , 90 and 180 days respectively are calculated . comparison of percentage change from baseline of parameters during the observation period between two groups was analyzed using the mann - whitney test because of violation of normality . all tests are two - sided , statistical significance was set at p < 0.05 . all analyses were carried out using the statistical package spss vr 16.00 ( statistical package for the social sciences , spss inc . , data is expressed as meanstandard deviation ( s.d . ) or median ( in case of violation of normality ) for continuous variables and as percentages for categorical data . the comparison of variables at each time point was performed using the independent samples t - test or the mann - whitney test in case of violation of normality . to indicate the trend in the first 180 min of intervention , the mean percentage changes after 45 , 90 and 180 days respectively are calculated . comparison of percentage change from baseline of parameters during the observation period between two groups was analyzed using the mann - whitney test because of violation of normality . all tests are two - sided , statistical significance was set at p < 0.05 . all analyses were carried out using the statistical package spss vr 16.00 ( statistical package for the social sciences , spss inc . , data is expressed as meanstandard deviation ( s.d . ) or median ( in case of violation of normality ) for continuous variables and as percentages for categorical data . the comparison of variables at each time point was performed using the independent samples t - test or the mann - whitney test in case of violation of normality . to indicate the trend in the first 180 min of intervention , the mean percentage changes after 45 , 90 and 180 days respectively are calculated . comparison of percentage change from baseline of parameters during the observation period between two groups was analyzed using the mann - whitney test because of violation of normality . all tests are two - sided , statistical significance was set at p < 0.05 . all analyses were carried out using the statistical package spss vr 16.00 ( statistical package for the social sciences , spss inc . , the mean population age was 67.1 years ( sd , 8.68 years ) for calcitonin group and 64.9 years ( sd , 7.48 ) for the placebo group . visual analogue scale ( vas ) score was assessed at study entry , 10 , 45 , 90 , 180 day . there is no statistical difference between the two groups in demographics ( table 1 ) . the vas scores between the two groups at all time intervals are shown in table 2 . there is no statistical difference between the two groups at study entry , 10 , 90 , 180 day with vas evaluation . the vas score variance between two groups of specific time intervals is shown in table 3 . our findings demonstrate a higher decrease of pain during the first post - fracture period ( 10 days ) between calcitonin and placebo group ( calcitonin : -50% vs placebo : -16.7% p=0.028 ) ( figure 1 ) . a significant decrease of pain is observed during the first post - fracture period in the calcitonin group . vas scores over time ( vas initial 10 days : calcitonin : -50% vs placebo : -16.7% p=0.028 ) . looking at the remaining time intervals and the percentage change of pain , no statistical difference is observed ( table 3 ) . according to our results , the analgesic effect of calcitonin starts earlier than 10 days post - fracture and is maintained until 45 days have elapsed . the maximum analgesic effect in the treatment group takes place at 10 days post fracture ( 50% decrease in the vas system in pain in the calcitonin group , compared to 16.7% in the placebo group ) ( table 3 , figure 1 ) . apart from acute osteoporotic vertebral compression fractures , calcitonin has been used as an analgesic in the short term treatment of acute traumatic coccigeal fractures , rib fractures , post total hip arthroplasty ( for hip fractures ) and for the treatment of pain from bone metastases . the proposed mechanism of action is calcitonin inducing an increase of the level of endorphins in the central nervous system . though its prolonged use might lead to a decrease of therapeutic effect , due to formation of antibodies targeted against it . in a review and meta - analysis by knopp - sihota et al . in 2012 concerning analgesia from calcitonin in acute and chronic osteoporotic vertebral compression fractures , calcitonin significantly reduces the severity of acute pain in recent fractures , while having no effect on chronic ones . pain at rest was reduced by the 1 week , though improvement continued by 4 weeks post fracture . our results are in accordance with those by knopp - sihota et al . and other papers[10 - 17 ] dealing with the same subject . only that , in distal radius fracture pain treated with calcitonin , the maximum analgesic effect is achieved much earlier , in the 10 day post fracture . this leads to the hypothesis that an even shorter course of calcitonin might be effective in such fractures . calcitonin is a potent osteoclast inhibitor through receptors , and has been used in the treatment of established post - menopausal osteoporosis . nevertheless high dose and long term use might increase the risk for liver cancer and decrease the risk for breast cancer in females being treated for post - menopausal osteoporosis . this concern , has led the committee for medicinal products for human use ( chmp ) of the european medicine agency ( ema ) , to restrict the indications for calcitonin use and recommend only its short term use . thus benefits from using a short course of calcitonin in the treatment of distal radius fractures include adequate and timely pain relief , as well as earlier functional rehabilitation of the wrist joint . limitations to our study include the small sample size which nonetheless led to a homogenous patient sample with all the advantages that this could carry . further studies are required to establish the optimal , minimal duration of calcitonin treatment in osteoporotic low energy distal radius fractures . in the study , there is a statistically significant calcitonin mediated analgesic effect in the immediate post fracture period ( at 10 days ) when compared to placebo group . these results are in accordance with literature referring to the analgesic effect of calcitonin in the acute osteoporotic vertebral compression fracture . thus calcitonin administration could be recommended to a short term course in acute osteoporotic conservatively treated distal radius fractures .

hormone binding to nuclear receptors has long been known to activate gene expression . in the case of steroid hormone receptors , hormone triggers dissociation from cytoplasmic chaperones , nuclear localization , and dna binding . the related thyroid hormone receptor ( tr ) and retinoic acid receptor ( rar ) also activate gene expression in the presence of their cognate ligands but , by contrast , these receptors are constitutively nuclear and bind to dna in the absence of ligand [ samuels et al . , 1988 ] . molecular analysis has revealed that the ligand binding domains ( lbds ) of nuclear receptors ( nrs ) contain potent transcriptional repression functions [ brent et al . , 1989 ; graupner et al . , in addition to tr and rar , potent repression functions have been identified in the orphan receptors liver x receptor ( lxr ) [ hu et al . , 2003 ] and reverb [ harding and lazar , 1995 ] . the ability of nr lbds to transfer repression function to a heterologous dna binding domain , and the cross - squelching of repression by untethered lbds , suggested that repression was mediated by interactions with putative cellular corepressor proteins [ baniahmad et al . , 1995 ; qi et al . , 1995 ] . the yeast - two hybrid screen for protein interactors proved the key to the isolation and characterization of corepressors . the first corepressors identified were named n - cor ( nuclear receptor corepressor ) , first identified by rosenfeld and colleagues [ horlein et al . , 1995 ] , and smrt ( silencing mediator of retinoid and thyroid receptors , first identified by evans and colleagues [ chen and evans , 1995 ] ) . other molecules that may serve as corepressors for nuclear receptors include alien [ dressel et al . , 1999 ] , hairless [ potter et al . , 2001 ] , lcor [ fernandes et al . , 2003 ] , rip-140 [ cavailles et al . , 1995 ] , and sun - cor [ zamir et al . , this short review will focus on n - cor and smrt , which have received the most attention because they are structurally related molecules that fulfill two important criteria : 1 ) they bind to nrs in the absence of ligand , and 2 ) they possess autonomous , transferable repression domains . n - cor and smrt are large proteins , whose nr binding and repression functions are mediated by the carboxyl and amino terminal halves of the molecules , respectively ( figure 1 ) . the major structural change in the nr lbd upon ligand binding is the position of helix 12 ( h12 ) , whose importance for coactivator binding has been demonstrated biochemically as well as structurally [ wurtz et al . , deletion of h12 actually enhances repression and corepressor binding of several nrs , including tr [ damm et al . , 1989 ; sap et al . , 1989 ] , rar [ tsai et al . , 1992 ] , rxr [ schulman et al . , 1997 ; zhang et al . , 1999 ] and the orphans ppar [ gurnell et al . , 2000 ] and ror [ harding et al . , indeed , the orphan nr reverb is a very potent repressor and does not possess h12 at all [ harding and lazar , 1995 ] . the corepressors bind to a surface , composed of residues in nr helices 3 , 4 and 5 that is fundamentally similar to that bound by coactivator . this was predicted from biochemical studies , which demonstrated that a " cornr box " motif in corepressors , similar to the " nr box " motif in coactivators [ heery et al . , 1997 ; mcinerney et al . , 1998 ] , was required for nr interaction [ hu and lazar , 1999 ; nagy et al . , 1999 ; perissi et al . , 1999 ] . this has been recently proven by the first crystal structure of an nr bound to a cornr - box containing corepressor- derived peptide [ xu et al . , n - cor and smrt are predominantly nuclear proteins , but recent evidence suggests that changes in signaling at the cell surface can activate second messenger systems leading to protein phosphorylation and nuclear - cytoplasmic shuttling of the corepressors . in the case of smrt , map kinase directed phosphorylation has been implicated [ hong et al . , 2001 ] , for n - cor the phosphorylation of an associated protein , tab2 , by ikk kinase has been reported to induced nuclear exit [ baek et al . , 2002 ] . a large number of proteins have been suggested to interact with n - cor and smrt , based upon gst - pulldown and yeast two - hybrid studies . direct biochemical purification of the corepressors by three different groups has demonstrated a major complex involving a wd40-repeat protein called transducin 946;-like protein 1 ( tbl1 , or a related protein tbl1r ) and histone deacetylase 3 ( hdac3 ) [ guenther et al . , 2000 ; li et al . , 2000 ; zhang et al . , 2002 ] . the associated proteins are likely to mediate repression by n - cor and smrt , as will be discussed below . [ zhang et al . , 2002 ] and ir-10 [ yoon et al . , 2003 ] , as well as a tbl1-related protein ( figure 2 ) . alternative complexes that include the hdac1-sin3 corepressor complex have been reported [ jones et al . , 2001 ; underhill et al . , 2000 ] , although studies of hdac recruitment by nrs has implicated hdac3 but not hdacs 1 and 2 [ ishizuka and lazar , 2003 ; li et al . , class ii hdacs have also been shown to bind strongly to n - cor and smrt [ huang et al . , 2000 ; 2000 ] , but their cam - kinase dependent nuclear - cytoplasmic shuttle [ grozinger and schreiber , 2000 ; mckinsey et al . , gene expression is regulated by changes in chromatin structure that include dna unwinding and covalent modification of nucleosomal histones [ jenuwein and allis , 2001 ; kouzarides , 2000 ; schreiber and bernstein , 2002 ] . smrt and n - cor both exist in repression complexes with hdac enzyme activity , and hdac3 is largely responsible for this activity [ guenther et al . , 2000 ; li et al . , 2000 ; zhang et al . , 2002 ] remarkably , the enzyme activity of hdac3 requires smrt / n - cor , which interacts with and activates hdac3 via a region termed the deacetylase activation domain ( dad ) [ guenther et al . , 2001 ] . the dad activity of ncor and smrt requires the n - terminal sant1 motif [ guenther et al . , 2001 ; zhang et al . , 2002 ] , and the downstream sant2 is part of a histone interaction domain that enhances this activity [ yu et al . , hdac3 is required for repression by tr [ ishizuka and lazar , 2003 ; yoon et al . , 2003 ] , as is tbl1 which is also a histone binding protein that may function via an hdac - independent mechanism [ guenther et al . , there are clearly quantitative differences between n - cor and smrt binding to nrs both in solution , on dna , and on target genes in living cells [ hu et al . , 2001 ; ishizuka and lazar , 2003 ; makowski et al . , 2003 ; webb et al . , 2000 n - cor and smrt also function as corepressors for transcription factors other than nrs [ xu et al . , the best evidence that n - cor and smrt have non - redundant functions comes from the knockout of n - cor , which is embryonic lethal [ jepsen et al . , 2000 ] , indicating that smrt can not compensate for the lack of n - cor . nr corepressors have also been implicated in the mechanisms of human diseases , including acute promeyleocytic leukemia due to rar translocations [ grignani et al . , 1998 ; guidez et al . , 1998 ] , acute myeloid leukemia due to the aml1-eto translocation [ gelmetti et al . , 1998 ; lutterbach et al . , 1998 ; wang et al . , 1998 ] , thyroid hormone resistance [ tagami et al . , 1997 ; yoh et al . , 1997 ] , and insulin resistance due to mutation in ppar [ gurnell et al corepressors are complicated molecules , that mediate repression by nrs as well as other transcription factors . their interactions with nrs are highly specific , and they repress transcription in the context of large , multiprotein complexes with several potential effectors of repression , including potent hdac activity . these complexes are potential targets of therapy for leukemia , diabetes , and other diseases . corepressor function may be regulated by extracellular signals , intracellular localization , and cell - specific factors , in addition to the nrs to which they bind . we are rapidly learning more about the composition and regulation of corepressor complexes , and how this regulates nr physiology and function .

chronic renal failure is an aggravated and incorrectable condition in renal function in which the body will lose its ability to maintain electrolyte and metabolic balance leading to increased blood urea and its retention in the body ( 1 ) . dialysis is a method of removing unnecessary fluids and wastes when the kidneys are unable to perform their task due to impairment ( 2 ) . the number of patients with renal failure is doubled every 7 years ( 3 ) . according to the statistics of 1387 , 16600 patients are dialyzed in 355 hemodialysis units of the country and each year this figure is increased to approximately 20% ( 4 ) . the advancement of knowledge and treatment technologies as well as the increase in life expectancy has enhanced the longevity of many patients with chronic renal failure . chronic renal failure is among the chronic disease which due to persistence of the disease and long treatment process has various effects on the physiological , psychological , functional ability , lifestyle changes , and independence status of the patient and his family ( 5 ) . in longer terms , it will also cause the reduction of living standards , physical and psychological problems , as well as the restrictions in recreational , social and employment activities ( 6 ) . meanwhile , despite such challenges , caregivers often feel disappointment , isolation and failure due to the lack of support , training and experience ( 7 ) . caregivers are people who have the greatest involvement in patient care and assistance during the course of the disease in order to adapt and manage the patient ( 8) . families of patients with chronic renal failure should perform supportive and care functions at home or in outpatient centers , such as dialysis units of hospitals . frequent hospitalizations of the patients and factors associated with the disease can lead to the deterioration of depression and reduction of caregiver s quality of life ( 9 ) . therefore , the evaluation of caregiver s status and determination of their needs are very important . caregiver burden is a general term used to describe physical , emotional and financial cost of the care ( 10 ) . caregiver burden is defined as permanent difficulty , stress or negative experiences resulted from providing care by caregiver ( 11 ) . objective burden is defined as the changes and disruptions appeared in life as a result of care . subjective burden definition is the reaction or attitude of caregiver against care experience ( 12 ) . family is the best source for taking care of hemodialysis patients . considering the long process of chronic renal failure , various complications of hemodialysis , new requirements , and major changes in lifestyle , family members are experiencing great tensions ( 13 ) . timely identification of these pressures in caregivers plays a decisive role in the promotion of their mental health . the aim of this study was to assess the scale of caregiver burden in caregivers of hemodialysis patients . this is a descriptive study which was designed and completed in 2014 to assess caregiver burden in the caregivers of patients undergoing hemodialysis . research community was the caregivers of patients with chronic renal failure who referred to hemodialysis units of in two government hospitals in southern iran . a total of 69 patients were under hemodialysis . after obtaining approval of relevant authorities , the researcher referred to hemodialysis units and studied all caregivers of patients by census method ( caregiver is a person who lives with the patient and has the key role in patient care ) . after explaining the purpose of the study and obtaining the approval , questionnaire was completed at the presence of the researcher to answer the questions as needed ( illiterate caregivers answered the questionnaire verbally ) . research tools were consisted of two sections , including demographic data checklist of patients and their caregivers , and caregiver burden questionnaire . patients demographic data checklist was consisted of age , sex , marital status , education , job , history of the disease , duration of dialysis , weekly dialysis frequency and the ability to perform daily activities , comorbidities ( such as hypertension , diabetes , etc . ) , and caregivers demographic information was included age , sex , marital status , education , job , income , support from governmental agencies , and relativity with the patient . reliability and validity of the tool were verified by the research team at kerman razi school of nursing in order to be used in a thesis entitled as investigating the relationship between social support and caregiver burden feeling in mothers with premature babies hospitalized in nicu . its reliability ( 82% ) and reliability were obtained based on the internal correlation coefficient and using cronbach s alpha of 86% ( 15 ) . the instrument of caregiver burden contains 22 items ; this instrument evaluates the burden experience resulting from taking care of a patient with chronic disease . the average score of 22 items represents the total score of caregiver burden and the highest score represents the greatest caregiver burden . the total score of caregiver burden can be divided into three levels : low burden ( 1.00 - 1.99 ) , medium burden ( 2.00 - 2.99 ) , and severe caregiver burden ( 3.00 - 4.00 ) . therefore , the score of 22 - 43 is accounted as low burden , 44 - 65 as medium burden , and 65 - 88 is considered as severe burden . this instrument covers 5 areas including : * general strain ( 8 items ) , which indicates the lack of freedom for the caregiver and the burden of the care;*isolation ( 3 items ) , that shows the limited social interaction and the lack of special time for the caregiver himself;*disappointment ( 5 items ) which represents the isolation , physical pain tolerance , the impact of financial difficulties and the feeling that life is unfair;*emotional involvement ( 3 items ) that reflects the feelings of anger and shame because of the presence of the patient;*environmental ( 3 items ) , indicating the lack of caring experience and inability to deal with patient s problems . general strain ( 8 items ) , which indicates the lack of freedom for the caregiver and the burden of the care ; isolation ( 3 items ) , that shows the limited social interaction and the lack of special time for the caregiver himself ; disappointment ( 5 items ) which represents the isolation , physical pain tolerance , the impact of financial difficulties and the feeling that life is unfair ; emotional involvement ( 3 items ) that reflects the feelings of anger and shame because of the presence of the patient ; environmental ( 3 items ) , indicating the lack of caring experience and inability to deal with patient s problems . scoring system is based on the likert approach ( never , rarely , sometimes , often ) receiving the scores of 1 , 2 , 3 , and 4 , respectively ( 16 ) . descriptive statistics in the forms of frequency tables and some indicators such as mean and standard deviation were used to describe the demographic characteristics and caregiver burden . t - test and anova were used to determine the relationship between caregiver burden and demographic characteristics . research tools were consisted of two sections , including demographic data checklist of patients and their caregivers , and caregiver burden questionnaire . patients demographic data checklist was consisted of age , sex , marital status , education , job , history of the disease , duration of dialysis , weekly dialysis frequency and the ability to perform daily activities , comorbidities ( such as hypertension , diabetes , etc . ) , and caregivers demographic information was included age , sex , marital status , education , job , income , support from governmental agencies , and relativity with the patient . reliability and validity of the tool were verified by the research team at kerman razi school of nursing in order to be used in a thesis entitled as investigating the relationship between social support and caregiver burden feeling in mothers with premature babies hospitalized in nicu . its reliability ( 82% ) and reliability were obtained based on the internal correlation coefficient and using cronbach s alpha of 86% ( 15 ) . the instrument of caregiver burden contains 22 items ; this instrument evaluates the burden experience resulting from taking care of a patient with chronic disease . the average score of 22 items represents the total score of caregiver burden and the highest score represents the greatest caregiver burden . the total score of caregiver burden can be divided into three levels : low burden ( 1.00 - 1.99 ) , medium burden ( 2.00 - 2.99 ) , and severe caregiver burden ( 3.00 - 4.00 ) . therefore , the score of 22 - 43 is accounted as low burden , 44 - 65 as medium burden , and 65 - 88 is considered as severe burden . this instrument covers 5 areas including : * general strain ( 8 items ) , which indicates the lack of freedom for the caregiver and the burden of the care;*isolation ( 3 items ) , that shows the limited social interaction and the lack of special time for the caregiver himself;*disappointment ( 5 items ) which represents the isolation , physical pain tolerance , the impact of financial difficulties and the feeling that life is unfair;*emotional involvement ( 3 items ) that reflects the feelings of anger and shame because of the presence of the patient;*environmental ( 3 items ) , indicating the lack of caring experience and inability to deal with patient s problems . general strain ( 8 items ) , which indicates the lack of freedom for the caregiver and the burden of the care ; isolation ( 3 items ) , that shows the limited social interaction and the lack of special time for the caregiver himself ; disappointment ( 5 items ) which represents the isolation , physical pain tolerance , the impact of financial difficulties and the feeling that life is unfair ; emotional involvement ( 3 items ) that reflects the feelings of anger and shame because of the presence of the patient ; environmental ( 3 items ) , indicating the lack of caring experience and inability to deal with patient s problems . scoring system is based on the likert approach ( never , rarely , sometimes , often ) receiving the scores of 1 , 2 , 3 , and 4 , respectively ( 16 ) . descriptive statistics in the forms of frequency tables and some indicators such as mean and standard deviation were used to describe the demographic characteristics and caregiver burden . t - test and anova were used to determine the relationship between caregiver burden and demographic characteristics . in this study , 69 caregivers of the patients with chronic renal failure undergoing hemodialysis in iranian population were investigated . because 10 caregivers were not willing to cooperate , and also 8 incomplete questionnaires were excluded from the study , thus 51 caregivers were entered to the study . minimum and maximum age of the patients was 22 and 87 years with the mean age of 53.07 and standard deviation of 17.90 . caregivers minimum and maximum age were 18 and 80 years with an average age of 42.11 and sd of 14.78 . tables 1 and 2 show demographic data for the patients and their caregivers . demographic data of patients demographic data of caregiver s when investigating the total score of caregiver burden and the areas of ( general strain , isolation , emotional involvement , disappointment , and environmental ) , the results showed that 12 caregivers ( 23.5% ) reported high levels of caregiver burden . also 25 caregivers ( 49% ) expressed medium and 14 persons ( 27.5% ) reported low levels of caregiver burden , respectively ( table 3 ) . frequency and present of caregiver burden in caregiver s table 4 presents mean and standard deviation of the scores for the caregivers of hemodialysis patients in the caregiver burden test and its areas . anova and t - test were used to determine the relationship between demographic variables and the caregiver burden score . the mean scores and standard deviation of caregiver s on the test caregiver burden the results show that there is a significant relationship between the patient s gender with caregiver burden score of ( p=0.031 ) and the type of income with caregiver burden score of ( p=0.000 ) . such that caregivers of male patients and patients with insufficient income had higher caregiver burden scores . in the relationship between demographic variables with the areas of caregiver burden results showed that there is a relationship between the patient s gender and the areas of general strain ( p=0.016 ) and disappointment ( p=0.004 ) . there is a relationship between income and the areas of general strain ( p=0.000 ) , isolation ( p=0.022 ) , disappointment ( p=0.039 ) , and emotional involvement ( p=0.003 ) . no relationship was found between other demographic variables of patients and caregivers and the caregiver burden score and its areas ( p>0.05 ) . most of the research has been focused on the hemodialysis patients , while their caregivers , spouse and partners who help in their treatment , and experience losses and potential changes were neglected ( 17 ) . the results of this study showed that 72.5% of caregivers had moderate to severe caregiver burden . paradiso proposed that the incidence of changes in family functions is inevitable due to the chronic nature and long - term treatment of progressive renal failure ( 18 ) . belasco and sesso study showed that taking care of dialysis patients may cause the feeling of stress and destructive effects in the caregivers . thus , social support and psychological interventions should be executed in order to improve the lives of the caregivers and subsequently the patients ( 19 ) . belasco and his colleagues in a study entitled the caregiver burden and quality of life of caregivers to hemodialysis patients reported that a significant relationship exists between caregiver burden and the quality of life , and caregivers of patients experience the burden resulted from caring which affects their quality of life ( 19 ) . in a study matsuu et al . proposed that caregivers of hemodialysis patients might have a very important responsibility , because they have to play an important role in supporting dialysis patients ( 20 ) . habibzadeh and his colleagues in a survey to assess the level of life quality of caregivers of patients in khoy reported that 52.5% of caregivers had moderate to low quality of life , 85% believed that society support is insufficient , and 65% found their lives devoid of recreation and entertainment ( 21 ) . abbasi and his colleagues reviewed the caregiver stress and its related factors in caregivers of hemodialysis patients in gorgan and reported that 74.2% of caregivers suffered from extreme caregiver burden ( 13 ) . therefore realizing the psychological characteristics and burden feeling resulted from care in caregivers is very important in planning and providing effective treatment interventions based on the findings of this study it can be concluded that hemodialysis at different levels cause moderate to severe burden in the caregivers of patients . thus , the provision of care plans to improve the mental health of these patients is necessary . it can be also concluded that considering the caring needs of other caregivers can have positive impacts on their mental health .

one goal of this ' update on genome completion and annotations ' series has been to select a gene , or gene family , check for accuracy in the databases , and then help to suggest ways to correct any nomenclature problems that might exist . the glutathione s - transferases ( gsts ) represent an important group of enzymes which detoxify both endogenous compounds and foreign chemicals such as pharmaceuticals and environmental pollutants . although a large number of reviews about this important enzyme family have appeared,[3 - 11 ] there continues to be considerable confusion in the field with regard to the naming and classification of these genes and gene products . homologous genes , having a common ancestral origin 2 billion years ago or more , can be identified more readily , if they are designated with a stem ( or root ) symbol . a root symbol is very much encouraged by the human gene nomenclature committee ( hgnc ) as the basis for a hierarchical series of genes ( eg for the abc family , subfamily a , abca1 , abca2 , abca3 , abca4 ) that are either the result of evolutionary divergence of an ancient ancestral gene , or have conserved functions -- via pathways , interactions or protein domains . such a root symbol allows the easy identification of other related members in both database searches and the literature . homologous regions of 15 - 25 per cent of nucleotides or amino acids can be detected by the various alignment programs , denoting divergence from an ancestral gene ; a small almost - invariant dna motif or protein domain -- functioning as an enzyme active - site , cofactor docking site or ligand - binding site -- is further evidence of divergence from an ancestral gene . one of the earliest examples of this nomenclature approach for homologous genes was the cytochrome p450 ( cyp ) gene superfamily , in which it was agreed that approximately 40 per cent or more amino acid similarity allows two members to be placed in the same family and about 55 per cent or greater similarity allows two members to be assigned to the same subfamily . at present , more than 130 additional gene superfamilies and large gene families have since followed this same format . the fundamental basis for all gst catalytic activities is the capacity of these enzymes to lower the pka of the sulfhydryl group of reduced glutathione ( gsh ) from 9.0 in aqueous solution to about 6.5 when gsh is bound in the active site . gsh exists as the thiolate ( gs ) anion at neutral ph when complexed with the gst enzyme . catalysis by gstoccurs through the combined capacity of the enzyme to promote gsformation and to bind hydrophobic electrophilic compounds at a closely adjacent site . the gsh - binding and the hydrophobic substrate - binding sites have been called the g- and h - sites , respectively . in the case of certain substrates ( eg benzyl and phenethyl isothiocyanates , alkyl dihalides ) , gst can catalyse both the forward and reverse reactions , leading to increased toxicity rather than detoxication . gsts are widely distributed in nature -- from bacteria and yeast to plants and animals . plant gsts include the phi , tau , theta , zeta and lambda classes ; the theta and zeta have counterparts in animals . there is significant homology between a class theta gst and a dichloromethane dehalogenase enzyme from the prokaryote methylobacterium , suggesting that the ancestral progenitor for mammalian gsts probably arose from the theta class . numerous polymorphisms exist in the human gst genes , including the complete absence of the gstm1 or the gst theta 1 gene -- at frequencies as high as 20 per cent to 50 per cent in some populations . given the absence in certain gst activities , one can see how this might lead to decreased detoxication of environmental carcinogens or chemotherapeutic agents and thus to clinical problems in patients lacking these genes . evidence is also emerging that gst genes from some pathogens might exert immunomodulatory functions towards the immune system , involving separate profiles of cytokine gene transcription and different patterns of cell growth . antioxidants , as well as oxidative stress , induce transcription of many of the gst genes , leading to increased protection of the cell against insult by environmental chemicals and drugs . microsomal gst and leukotriene c4 synthase have been described as members of the gst family , although it has been noted that neither shares sequence identity with the cytosolic gsts . it would therefore appear likely that these membrane - bound gst enzymes represent examples of convergent , rather than divergent , evolution ; at a particular point in time during evolution , mother nature required an enzyme to carry out such a membrane - bound catalytic reaction and assigned that task to an enzyme class different from that of the cytosolic gsts . a quick search of the gst gene database ( table 1 ) showed 22 putatively functional genes and five pseudogenes . upon closer inspection , it was determined that gstm1l is a pseudogene -- which changes the number to 21 functional genes and six pseudogenes . there is a cluster of five gsta genes located at chr 6p12 ; a cluster of five gstm genes at 1p13 ; two gst - omega genes at 10q25.1 ; gstp1 at 11q13-qter ; two gst - theta genes at 22q11.2 ; and a single gene gstz1 at 14q24.3 . pseudogenes are often found at different chromosomal locations from the cluster of functional genes from which the pseudogenes originated . interestingly , gstz1 is identical to maleylacetoacetate isomerase , a key enzyme in tyrosine catabolism , catalysing the gsh - dependent isomerisation of maleylacetoacetate to fumarylacetoacetate . * correct gene name , according to the rules listed under http://www.gene.ucl.ac.uk / nomenclature/. it will be shown that the remaining five genes -- gstk1 , ptges and the three microsomal gsts -- are not evolutionarily part of the gst gene family . phylogenetic analysis ( figure 1 ) places these five genes at one edge of the putative evolutionary tree , at almost the same distance as the gstw , gstz1 and gstq genes at the other edge . the tree - making algorithm , however , scores sequence similarity between each pair of protein sequences . what the tree shows is that the omega , zeta and theta gsts are almost as dissimilar to the other more typical gsts as are the gstk1 , ptges and three microsomal gst proteins . dendrogram of the 21 genes under discussion . in order to decrease clutter and confusion , it has been chosen not to include three alternative splice variants of gstm4 , two variants of gstm1 and three variants of gstz1 in construction of this tree . the x - axis denotes evolutionary time , which is not precise but extends over hundreds of millions of years . by means of clustal alignment , consensus gst_n and gst_c domains were found , plus significant stretches of sequence alignment , for the above - mentioned 16 gst genes ( figure 2 ) , but none of these were found in the other five genes ( data not illustrated ) . upon further analysis , it was discovered that the microsomal gsts , as well as prostaglandin e synthase , belong to the membrane - associated proteins in eicosanoid and glutathione metabolism ( mapeg ) gene family ( pfam01124 ) . due to structural similarities in the active sites of 5-lipoxygenase - activating protein ( flap ) , leukotriene c4 synthase and prostaglandin e synthase , substrates for by contrast , gstk1 has a bacterial disulphide - bond - a ( dsba)-like thioredoxin domain ( pfam01323 ) and is a member of a diverse set of proteins with a thioredoxin - like structure ( pfam00085 ) . it therefore appears that gst - kappa has been misnamed in protein sequence databases , because it is clearly not a member of the gst gene family . evolutionarily speaking , neither are the ptges nor the three microsomal gst genes members of the gst gene family . dendrogram of the 16 gst genes that are bona fide members of the gst family . again , for the sake of simplicity , the additional splice variants of gstm4 , gstm1 and gstz1 have been excluded . the x - axis denotes evolutionary time , which is not precise but extends over hundreds of millions of years . finally , of the six gst subfamilies , two of these are misnamed in the hgnc database , according to its own guidelines ( table 1 ) . the two functional genes and one pseudogene of the omega class should correctly be named gstw1 , gstw2 and gstw3p1 , respectively ; the symbol ' w ' stands for ' omega ' , whereas the symbol ' o ' stands for ' omicron ' . similarly , the two functional genes of the theta class should correctly be named gstq1 and gstq2 , because the symbol ' q ' stands for ' theta ' , whereas the symbol ' t ' stands for ' tau ' . the hgnc addressed this ' greek letter ' issue in relation to the gst genes . gstt1 and gstt2 were approved in 1994 , in line with a request from board 's laboratory and have been widely used ever since , with gstt1 especially appearing in hundreds of references listed in pubmed . likewise , board 's group published work about the gsto1 , gsto2 and gstop3 genes , which were approved by the hgnc in 2003 . hgnc therefore concluded : ' although we do indeed have guidelines for greek letter conversions , we also aim to serve the community by providing a useable and used nomenclature . it would seem to us to be somewhat pedantic to change the symbols for these five genes , all of which are being widely used in publications , simply because they did not conform to a guidance conversion table . in a similar manner , we usually use ' g ' for gamma , but sometimes ' c ' has been used instead , because this is taken as the third - letter - of - the - alphabet equivalent , eg laminin gamma-2 encoded by the lamc2 gene . hence , we do not see a need to change these glutathione s - transferase symbols . we realize that people can become upset by nomenclature changes , and we believe that a working nomenclature system is more desirable than a perfect one ' . since mouse nomenclature follows that of human , the mouse genomic nomenclature committee ( mgnc ) will similarly stay with these same symbols for the orthologous genes . both hgnc and mgnc continue to work closely with experts in the field , and the committees certainly make changes to the nomenclature , based on information from the experts when necessary . in most instances , changes will be made if they are necessary in order to promote accuracy and consistency . several problems were found in the hgnc listings and nomenclature for the gst gene family . secondly , there are five additional genes included ( gstk1 , mgst1 , mgst2 , mgst3 and ptges ) that encode membrane - bound enzymes having gst - like activity but which are not evolutionarily related to the 16 true gst genes . thirdly , according to the human genome organization hgnc 's own rules , the gst - omega subfamily should include ' w ' for omega -- instead of ' o ' , which is reserved for omicron -- and the gst - theta subfamily should include ' q ' for theta -- instead of ' t ' , which is reserved for tau . the present authors ' analysis of the gst gene family simply underscores some of the problems encountered in the various databases . the authors estimate that it will take many years before all of the bumps and wrinkles can be ironed out of the nomenclature systems for human and mouse genes and gene families . the writing of this article was funded , in part , by nih grants p30 es06096 ( d.w.n . ) and r01 ey11490 ( v.v . ) .

the current standard of care for femoral fractures is the intramedullary nail , but there are situations in which the use of plates is indicated , like narrow medullary cavity , bone deformities , and open growth plate . metal plates have been used for the fixation of fractures since the end of the 19th century . the dcp , designed with oblong holes to provide interfragmentary compression when tightening the screws , was introduced in 1969 . at that time stability was the best method for treating long bone diaphyseal fractures , but a high rate of nonunions and postoperative infections questioned this concept only a few decades later [ 24 ] . as opposed to the wide surgical approach required by this technique , it has been suggested that less manipulation of the bone fragments would result in faster bone healing by preserving the fracture site vasculature . consequently , osteosynthesis techniques were modified [ 2 , 4 , 68 ] to minimize damage to the soft tissue and periosteum in order to preserve the fracture vascularization [ 2 , 7 ] . the authoritative work of heitemeyer et al . demonstrated that this new protocol improved complex fracture healing of the femur diaphysis . appropriate stress distribution is fundamental to proper bone remodeling during fracture healing . within a certain range of values , compressive stresses drive bone growth , whereas tensile stresses favor connective tissue or fibrocartilage formation . fracture and plate geometries affect the stress distribution and stiffness of the bone / plate system and must be taken into account when considering an osteosynthesis repair . studied the influence of the medial cortex on the stress distribution within the bone / plate system . they found that fracture sites were experiencing high stresses and plate fatigue failure in the absence of medial support . these findings led to the creation of the wave - dynamic compression plate ( dcp ) . by bending a straight - dcp in a controlled manner ( forming the wave ) the wave plate shifts the neutral axis toward the lateral cortical region , so that the bone is in compression , while the plate is in tension [ 11 , 12 ] . used the wave plate and reported bone consolidation in 41 of 42 patients with pseudoarthrosis of the femur diaphysis . the locking compression plate ( lcp ) is a more recent improvement to the straight - dcp technology that shares similar characteristics and mechanical performance to external fixators . in this system the lcp design minimizes contact with the bone , which reduces the damage to the periosteum and the resulting bone necrosis as well . the introduction of the lcp made the dcp plate obsolete , although the latter continues to be used in developing countries because of its lower cost ( about 10%20% of the lcp cost ) . currently , there are no studies comparing directly the effectiveness of these three plate systems within the same model . to assess whether patients receiving the dcp plate are receiving adequate fracture care , the stiffness of each plate design was tested in simulated models of types a , b , and c diaphyseal femoral fractures ( ao classification ) . four - point static bending tests were conducted on 14-hole 4.5 mm wide straight- and wave - dcps ( synthes number 226.140 ) and lcps ( synthes number 226.641 ) , according to astm f382 - 99(2008 ) ( standard specification and test method for metallic bone plates ) . the wave plates were shaped from straight plates as described by blatter et al . . briefly , the plate was bent at the third and fourth screw holes on either side of the plate center to form a 5 mm high wave ( figure 1 ) . the tests were conducted in an emic ( curitiba , brazil ) dl2000 testing machine at a speed of 2.0 mm / sec . a special apparatus was used to support and load the plates . according to astm f382 - 99(2008 ) , the loading rollers should be positioned so that two plate screw holes would be located between them , while the support rollers should be placed two screw holes away from the loading rollers . for testing the wave - dcp , however , the distance between the two loading rollers had to be increased to eight screw holes to encompass the whole wave between them , while the support rollers were still positioned two screw holes away from the loading rollers ( figure 1 ) . the straight - dcps and lcp were tested under the same conditions as the wave - dcps , because testing results are only directly comparable to each other when using the same loading / support roller locations . according to astm f382 - 99(2008 ) , the plate bending structural stiffness eie can be calculated according to ( 1 ) : ( 1)eie=(2h+3a)kh212 , where : k is the bending stiffness ( slope of the linear region of the load versus load - point displacement curve ) ; h is the distance between the loading rollers ; a is the distance between a loading roller and an adjacent support roller . four specimens of straight - dcps ( n = 4 ) , four of lcps ( n = 4 ) and seven of wave - dcps ( n = 7 ) were tested . the average stiffness and standard deviation were calculated for each plate model , and the results were compared by using kruskal - wallis test with a significance level of 5% . the test specimens were divided into three simulation groups , corresponding to types a , b , and c diaphyseal femur fractures ( ao classification ) . test specimens consisted of two dense wooden rods ( pouteria pachycarpa pires ) , 200 mm long and 26 mm in diameter , attached with a different type of osteosynthesis plate . the model used for the static compression tests has been used previously to simulate the physiological axes of the femur to approximate physiological loading conditions in experimental compression tests [ 2022 ] . wood has been a material of choice for such kind of tests [ 2325 ] and was chosen , because it presents more uniform mechanical properties than human cadaveric bone and serves as a good anchor for the fixation screws . although the wooden rods do not mimic the real bone , they were used because the interest was in the relative stiffness among the montages , not in the absolute stiffness . 226.140 ) were affixed to the rods using cortical screws ( synthes number . 214.034 ) , whereas the lcps were affixed using locking screws ( synthes number . the first four holes relative to the plate end were used to anchor the osteosynthesis plates to the test specimens ( figure 2 ) . the fracture type was defined by the shape of the wooden rods and the distance between them . type a fractures were simulated by attaching the two rods without any gap between them ( figure 2(a ) ) . for type b fractures , the rods were obliquely sectioned at each end ( 75% of diameter ) to simulate medial cortical bone loss , and the remaining areas were attached close together ( figure 2(b ) ) . type c fractures were simulated by creating a 50 mm gap between the two rods ( figure 2(c ) ) . samples using the wave plates had a slight valgus alignment due to the plate shape . the tests were conducted in an mts ( eden prairie , mn ) sintech 5 g testing machine . the test specimens were externally positioned using an apparatus to reproduce physiologically relevant force axes within the sagittal - only loading condition in the mts ( figure 3 ) . the apparatus allowed for concomitant application of compression and flexion forces on the test specimens , similar to human femoral loading . to simulate the knee joint , a 34 mm diameter semisphere was attached to the distal end of each specimen . before beginning the test , the test was conducted at a displacement rate of 5 mm / sec , and the load was applied until there was an evident plate deformation or a fracture of the wooden rod . the specimen stiffness was calculated from the slope of the linear region of the load versus displacement curve . six specimens of each plate were tested within the types a and b fracture groups ( n = 6 ) , and five specimens of each plate were tested within the type c fracture group ( n = 5 ) . two - way analysis of variance ( anova ) was used to compare the stiffness of the montages considering both fracture type and plate model . a rank transformation was applied due to the small number of samples within each group . the analysis was performed by the sas software ( sas institute inc . , cary , nc , usa ) . figure 4 compares the average structural stiffness of the straight - dcps , wave - dcps and lcps . the kruskal - wallis test showed no significant difference between the three plate models ( p = 0.0765 ) . figure 5 shows the average values of stiffness obtained for the different montages simulating fractures . rank - transformed two - way anova showed significant influence of plate type ( p = 0.0002 ) , fracture type ( p < 0.0001 ) , and interaction plate versus fracture ( p = 0.0260 ) on the stiffness of the montages . table 1 shows the tukey test results for pairwise comparison of the fracture types according to plate type , and table 2 shows the pairwise comparison of the plate types according to fracture type . the structural stiffness measured by astm f382 - 99(2008 ) is the most appropriate parameter for comparing the bending stiffness of different bone plates . our results showed no significant difference between the structural stiffness of the plates ( p = 0.0765 ) , although the straight - dcps and the lcps appeared to be , in average , stiffer than the wave - dcp ( figure 4 ) . this lack of significance could be attributed mainly to the fact that the wave - dcp shaping process was done by hand , which could have led to an important dimensional variability within the measured samples and could have biased the statistical analysis . the dimensional variation inherent to the manufacturing process of the plates is another this statistical dispersion would obviously not exist on a theoretical calculation of the stiffnesses , based on the nominal dimensions of the plates . in such case , the calculated values should approximate the average stiffnesses obtained from the bending tests , and the wave - dcp would be the less stiff . but the experimental results reflected the real situation in surgical practice , where the differences in stiffness between the plates may become undistinguishable due to the statistical variability . table 1 and figure 5 show that the fracture type exerts the most influence on the stiffness of the models regardless of the plate type ( p < 0.0001 ) . type a fracture models exhibited average stiffness two to ten times higher than that of either type b or type c. within each fracture group , the variation of stiffness among the models was considerably smaller than the variation between fracture types . no significant differences could be found between the plates for type a fractures ( p = 0.3456 , table 2 ) . the straight - dcp produced the greatest stiffness for fractures types b and c. the standard deviation bars in figure 5 show that the contact between the wooden rods ( types a and b fractures ) contributes to increased variation of the results , since these two fracture types exhibited greater statistical dispersion . the straight - dcp plate produced significantly stiffer type b fracture models than lcp ( p = 0.0007 , table 2 ) , but no significant difference was found between straight - dcp and wave - dcp and between lcps and wave - dcps straight - dcps produced also the stiffest montages for type c fracture ( p = 0.0011 , table 2 ) . the stiffness of an osteosynthesis used to be considered important , because it determines the primary stability . however , a highly stiff system may not be advantageous . according to claes and heigele , intramembranous ossification occurs at strains under 5% , whereas endochondral ossification occurs at strains between 5% and 15% . , remarked that an absence of strain would prevent callus formation , whereas very little strain would induce it ; strain up to 2% would be tolerated by lamellar bone tissue and up to 10% by three - dimensional woven bone . strains between 10% and 30% would induce bone resorption . moreover , under these higher strains , the gap distance between bone fragments would increase because of osteoclast - mediated resorption of the fracture ends until the strain on the repair tissue decreased enough to allow bone formation . increased stiffness would lower the strain , but it would still be large enough to inhibit direct ossification . these strain - mediated changes could slow resorption of the fracture ends and callus formation , thereby increasing the risk of implant fatigue . thus , relative stability is more advantageous than absolute stability for an osteosynthesis in a highly stressed lower limb fracture . in our study , no statistically significant differences were found between the plates for type a fractures , which is in agreement with the conclusion of karnezis , who compared the rigidity characteristics of bridging and wave plating . in spite of this , clinical results obtained by angelini et al . ( union rate of 95% , average time of consolidation of 12.8 weeks ) suggest that wave - dcps have a potential advantage in this fracture type and further support the use of these plates for pseudoarthrosis of the femoral shaft . the tendency of the wave - dcp in producing less stiff osteosyntheses ( despite the lack of statistical significance ) , the preservation of the periosteum provided by the wave shape , and the fact that the wave - dcp design subjects most of the fracture focus to compressive stress , while the straight - dcp puts a substantial part of the focus in tensile stress could have contributed to the good results obtained by angelini et al . . although , according to blatter et al . , the wave - dcp is initially subjected to higher stresses , in the cited study it probably could have relieved plate stress faster by allowing faster callus formation and bone consolidation and could have protected it against fatigue failure . if callus formation is delayed , the plate may eventually suffer fatigue failure , but the wave plate would still last longer than a straight plate of the same dimensions . factors like heterogeneity and anisotropy of the fragment 's material , misalignment between the fragments and hand - shaping of the wave plates are unavoidable in surgical practice . accounting for these factors , it is possible that the wave - dcp may not always produce better results than the straight - dcp , as found by angelini et al . . the straight - dcp exhibited the highest stiffness in the compression testing of the type c fracture models . in opposition to simple fractures , higher primary stability ( or , in this case , lower instability ) , the use of a wave plate would not be advantageous . for type b fractures , the straight - dcp provided also the stiffest fixation , but the deformation pattern differed from that of types a and c fractures , because the lateral contact between the fragments acted as a pivoting point . this most likely occurs in clinical practice , but it is very difficult to generalize across type b fractures due to their almost infinite geometric variability , which can influence the performance of different implants . in our model , the more modern lcp should be chosen if there is no cost restriction , then it minimizes the injury to the tissue . the wave - dcp , which also produces less tissue damage and exhibited good clinical results , could be used if cost is an important issue . the straight - dcp provided the highest primary stability for fractures types b and c. this higher stability suggests that , for healthy bones , the straight - dcp is the most suitable for fixing complex type c fractures that need to minimize mobility in the fracture focus . these considerations made here are valid only for healthy bones where the cortical screws can be tightened enough to prevent relative slippage between the screw head and the plate . otherwise , the low cost advantage could be eliminated by the fail of the treatment . for osteosynthesis of osteoporotic bone , when it is not possible to apply the required 5 nmm torque employed in this study , the lcp with locking screws is the most appropriate choice . from the point of view of the stiffness , the dcp can still be safely used for the osteosynthesis the of healthy ( non - osteoporotic ) bones , either as wave plate for simple fractures or as straight plate for complex fractures , in situations where the high cost of the lcp is a problem for the patient or the local welfare system .

in 2008 , we published unique work addressing the question of whether canada 's public pensions , old age security and the canada pension plan , provide adequate income for four hypothetical senior households living in nova scotia ( ns ) to afford a basic nutritious diet . this was the first published study using food costing data to investigate the sufficiency of public financial programs targeted at seniors . results showed that single - member households in ns in 2008 lacked the necessary funds , with monthly deficits estimated to be as high as $ 224.18 if they were to purchase a basic nutritious diet . the province of ns is home to the oldest population in canada , with 16.5% of its residents over the age of 65 years ; the majority of which are women . as elsewhere , senior women in ns are disproportionally impacted by poverty . in 2006 , almost one - third of lone senior women lived below the before - tax low - income cutoff ( lico ) canada 's unofficial poverty line , compared to one in five men who lived alone . in ns , the purpose of this paper is to explore the phenomenon of food insecurity for low - income lone senior women living in ns . this study used in - depth interviews to explore lone senior women 's experiences accessing food with limited financial resources . we explored their perceived ability to access a nutritionally adequate and personally acceptable diet , and the barriers and enablers to do so ; as well in light of our previous quantitative research , we explored their perceptions related to adequacy of income , essential expenses , and their strategies to manage personal finances . the united nations ' food and agricultural organization states that food security exists when all people , at all times , have physical and economical access to sufficient , safe , and nutritious food that meets their dietary needs and food preferences for an active and healthy life an assured ability to acquire acceptable foods in socially acceptable ways is also considered a key component of being food secure . the easiest way to understand food insecurity is lack of financial resources to purchase food needed and wanted ; however , in some of the pioneering research , which came out of cornell university , on hunger and food insecurity , radimer and colleagues found that two dimensions of food insecurity existed : an individual dimension and a household dimension with each dimension containing four components : quantitative , qualitative , psychological , and social . the quantitative and qualitative components of food insecurity are the most easily measured : experiencing hunger , going without food , or having to eat less food than usual , and consumption of nutritionally inadequate meals . individuals reporting food insecurity are significantly more likely to consume less energy and other key nutrients than those self - reporting as having sufficient food [ 9 , 10 ] . the psychological component to food insecurity is exemplified by an individual 's anxiety over their food situation , such as wondering where their next meal will come , while the social component is manifested by socially or culturally less normative patterns of eating ( e.g. , skipping meals ) , and acquiring food in socially unacceptable ways ( e.g. , using a food bank ) . while these characteristics have been documented among senior populations in the us by wolfe et al . , they also found that having the right foods for health and anxiety over not having these specific health - related foods are phenomena within the qualitative and psychological components of food insecurity that are unique to seniors . other food security research focusing on seniors has also found that finances are not the only limiting factor for seniors to access acceptable and adequate food . upon analyzing in - depth interviews with 145 adults , age 70 years and older , living in rural north carolina , quandt and rao revealed that barriers to food security in rural american seniors were associated with material ( e.g. , low - income ) , social ( e.g. , limited family network ) , and health ( e.g. , presence of disease or disability ) related factors . report that among older and senior adults in a largely rural area of central texas , food insecurity is associated with diminished social capital ( limited access to community and familial resources ) and perceptions of personal disparity in comparison with others . single , widowed , or divorced persons also reported higher levels of food insecurity , related in part to limited familial social capital . reliance on others for help with food - related activities such as grocery shopping and meal preparation can influence food intake and can be considered part of the concept of food insecurity among older adults . other work completed by quandt and colleagues suggests that pride , self - sufficiency , and you can not always get what you want attitude are aspects of the generational lens that colour the nature of food security for seniors . these senior - relevant factors highlighted by researchers in the us suggest that what food security means to seniors , and therefore how they manage their ability to access food is different than younger populations ' views of food security . given the different history and health and social systems in the us , it is not clear whether pride and a self - sufficient attitude would play the same role in a canadian senior 's meaning of food security . these newer senior - relevant factors also suggest the possibility that canada 's current food security measurement tools , which focus on low - income as the most significant determinant of food insecurity , may not accurately capture the other major enablers and barriers seniors face in accessing sufficient , quality foods in socially acceptable ways . it is possible we are not understanding and therefore not capturing the full picture of food insecurity among seniors . the negative relationship between food insecurity and one 's ability to access a nutritious diet and mitigate risk for chronic disease is well understood . chronic diseases commonly impacting seniors such as cardiovascular disease and cancer are used to exemplify the relationship between insufficient access to nutritious food and the resulting poor health outcomes [ 1618 ] . therefore , understanding how a particular group of seniors lower income senior women living alone in nova scotia attempt to maintain food security , can provide insights to the necessary policies and programs needed to reduce the nutritional health inequities among this vulnerable subset of the senior population . an ecological model was used to frame the participants ' perceived realities regarding their ability to access a nutritionally adequate and personally acceptable diet , the barriers and enablers to do so ; as well their perceptions related to adequacy of income , essential expenses , and their strategies to manage personal finances , guiding our approach to addressing our research purpose . ecological models reveal that individual behaviours such as food procurement patterns are influenced by biological , demographic , psychological , social / cultural , environmental , and policy variables . bronfenbrenner 's ecological systems theory [ 19 , 20 ] was used as a framework to examine the many different areas in the seniors ' environment where these variables exert their influence . first , individuals are characterized as embodied within a system comprising a nested arrangement of structures . the first of these structures , the microsystem refers to the face - to - face interactions within immediate settings such as home , neighbourhood , and informal social networks . the mesosystem comprises the relationships between and among the immediate settings , for example , family , seniors ' centres , and community facilities . the exosystem consists of the social structures , both formal and informal , removed from the individual but yet functioning at the local level to regulate and control their everyday lives within the microsystem . these structures include the major institutions within society rendered visible through the implementation of policies and practices at the local level . macrosystems such as religious , political , legal , economic , health , and social systems are understood in ecological theory not just as reified structures but also as carriers of ideology that construct a world view that , both implicitly and explicitly , shapes experience at all other levels of the environment [ 21 , 22 ] . second , the conceptualization of the levels of the environment as a nested arrangement of structures implies that they are not mutually exclusive . rather , it is assumed that a system can not be understood when broken into its component parts or when separated from its context . transactions flow bidirectionally from the outer level ( macrosystem ) inward , and conversely , from the inner level ( microsystem ) outward . these reciprocal exchanges are vital to maintaining the equilibrium of individuals , a proposition that has significance for this research . third , ecological theory brings into view the interdependencies that exist between immediate environments and broader systems . an ecological approach facilitates and emphasizes consideration of the impact of multiple and overlapping influences in addressing food security issues . eligible participants were women 65 years of age or older , who lived by themselves in a noninstitutionalized setting ( i.e. , independent ) in urban ns , and who were in receipt of the guaranteed income supplement ( gis ) . women living by themselves who had a spouse in a nursing home , hospital , or other type of institution were ineligible to participate . lone senior women were the focus of this research as national statistics show this subgroup of the senior population at greatest risk for poverty and the most likely to not access all the financial benefits available [ 4 , 23 ] , and our previous research suggest seniors living alone are more likely to be unable to afford a nutritious diet than those living with a partner . sampling was done using purposive and snowball methods , using site - based recruitment through health care agencies and seniors ' centres . the interview guide used to facilitate the interview was formulated using radimer 's conceptualization of food insecurity and hunger with its individual and household dimensions and four components : quantitative , qualitative , psychological , and social . the intent was to use this framework to draw out health and world view as distinguishing features of food security in the elderly . the interview guide also contained questions developed by the institute for research on poverty dealing with how study participants procured and prepared food , their typical daily food routine , and asked questions about a time ( if relevant ) when they had difficulty getting enough food . lastly , the interview guide asked participants to review hypothetical affordability scenarios comparing monthly income to expenses constructed in our earlier work to gain their perspective on adequacy of canadian public pensions to afford the food they needed and wanted , as well as other essential expenses . interviews took place in participants ' homes or a location of the participant 's choosing . interviews were conducted in english , lasted between 60 and 120 minutes , were digitally recorded and transcribed verbatim . study procedures were approved by mount saint vincent university 's ethics review board . during the analysis , a phenomenological approach , in combination with a conceptual framework based on bronfenbrenner 's ecological model , phenomenology is used to uncover the meaning behind a phenomenon , it goes beyond simply describing an experience , seeking to arrive at a structural description of the experience and expose the underlying and precipitating factors that account for what is being experienced . transcribed interviews , journal and field notes were imported into nvivo 7.0 , a qualitative data analysis software program ( qsr international , 2007 ) . one of the authors ( rgl ) analyzed transcripts by systematically coding text , informed by the interview guide topics and themes that emerged from the data corresponding to environmental levels in brofenbrenner 's ecological systems theory ( microsystem , mesosystem , exosystem , and macrosystem ) [ 19 , 20 ] . of the eight women who participated , four were 6574 years of age and four were 75 years or older . all women rented their dwelling : one lived in a duplex , one in a townhouse complex , one in an apartment building , and five lived in senior - geared apartments . seven of the eight women lived in subsidized housing , meaning their rent was based on a percentage of their income , while the eighth participant paid market rent for her duplex . one woman was never married while the other participants lived alone because they were either widowed or divorced . four women received a canada pension , the result of their contribution to the pension plan when they were previously employed . only one woman reported receiving a private pension , although it only amounted to $ 73/month after working almost 25 years . none of the women owned a car ; health reasons and finances were the main impetuses for giving up their vehicle . as the women talked about their experiences managing finances , accessing the food they needed and wanted , and how they viewed their situation , seven main themes emerged depicting their perception of their food security status . these themes can be placed within the four interconnected layers of the seniors ' environment as defined by bronfenbrenner : ( 1 ) at the macrosystem level , world view , ( 2 ) within the exosystem , income adequacy , ( 3 ) at both the exo- and mesosystems levels , transportation related factors , ( 4 ) at both the exo- and microsystem levels , health / health problems , ( 5 ) within the mesosystem , community program use , ( 6 ) at the meso- and microsystems , availability of family and friends , and ( 7 ) within the microsystem , personal food management strategies . figure 1 provides a visual map of the meaning of food security to these women , organized according to bronfenbrenner 's ecological framework . all of the women in this study met the criteria ( according to its definition ) to be classified as food insecure . they all used various coping skills to bring food into the house , such as accessing food banks , stretching meals , relying on credit ; however , interestingly , none of them perceived themselves to be food insecure . at one or more points in the interview , participants were asked if they could recall a time in their life since they were a senior and living on their own when they had difficulty getting the food they needed and wanted . some shared stories of going hungry in the past , such as when they were caring for their children or when they were first on their own without their spouse , but none considered their current situation as food insecure . a world view , or generational lens , develops as a result of past life experiences , cultural and religious beliefs and personal belief systems , and contribute , to the women 's self - perceived food security status . these women had a general contentedness about their diet , their life , and general circumstances . as stated by one participant : no , because as i say i 've been doing good the way i 've been doing now for many years and i 've got no complaints with any of it . i 've got a roof over my head and i 've got food to put in my stomach and my doctors tell me i 'm doing good so there 's nothing else i could want . although this woman was content with her life , she accessed a nearby food bank frequently , sometimes weekly . despite needing to access food in a socially unacceptable way on a regular basis she perceived nothing problematic with her situation a sense of resilient self - sufficiency was detected in the women interviewed , as most spoke about needing to be vigilant about their spending to assure that bills could be paid and assuring they had enough for the expenses they needed versus what they wanted . it was evident in talking with them that they had been through a lot and could manage most things that might come their way . i had a hard time bringing up my children , and you learn from your knocks in life eh ? do n't want to go through those again , i got to look after me , and i am , i 'm looking after me . the lives all of these women were impacted in some way by the depression and world war ii so they understood the need to be resourceful and not wasteful . some were lone parents , as were these two participants : no i 've never ever went hungry , the only time i 've ever went hungry when i was with my children . because i went for quite a few years where i didnt get enough to eat because i had to make sure my children were eating . experiencing hunger earlier in life shaped how they saw their current situations ; by definition , the participants experienced food insecurity within the quantitative component . all eight women acknowledged factors hindering their access to food ; however , they perceived the strategies they took to overcome the obstacles as either acceptable or just a fact of life ; just something you do if you 're old , poor , and so forth . none of the participants identified themselves as living in poverty or being in great need , or even want . the generational lens through which they viewed their situation allowed them to compare their current situation to situations in the past where they faced extreme financial difficulties ; relative to more difficult times , they perceived their current income to be adequate , in other words , their perspectives were colored by their prior experiences and resultant world view . as the women reviewed the affordability scenarios created in our previous work that compared monthly income to monthly basic expenses for two hypothetical lone senior households , the women were very candid in disclosing how much income they received each month and what bills their income went towards . the biggest lesson from their stories was the role of gis and income - geared housing in protecting the funds remaining for food , and the importance of a med - alert type device and cable tv , two expenses which the participants deemed to be essential . in general , the women were appreciative of the pensions they received , they were thankful to have a reliable monthly income ; however , there were notions that they could use a bit more . old age pensions and that ? of course , now this is a god send , what i get now compared to what i got then when i was on mothers ' allowance . another participant shared : oh , i 'm always just about at the end of it at the end of the month nobody 's gon na get rich when i go , there 'll be no fighting over my money ! public pensions programs exist at the exosystem level , they are formal programs removed from the individual , but yet functioning at the local level to regulate and control their everyday lives and ability to access food . another significant example of a social structure directly impacting seven of the eight interviewed women 's lives was the provincial senior social housing program . two of the participants explain : every year you have to call ottawa and get them to send you a letter saying exactly what you 're getting then you give that to housing and they figure out 30% of it , they take . and the rest you 've got for your tv and your phone and your groceries and to live on . before you get your old age pension you only pay 25% of what you 're getting , but once you hit 65 you pay 30% [ housing ] always take a third because that 's their share of the rent . every time rent comes up they take a third of that , whatever you get , so they ca n't put any more on for rent , because it 's subsidized housing . this controlled rent expense meant despite the adequacy or inadequacy of their overall income , seven of the eight women never had to pay a disproportionate amount on shelter ; thus their funds could be better distributed to other necessary expenses . while none of the women conveyed that their food intake suffered because of inadequate income , due to their various coping strategies , what did seem to suffer was their social life . like i never go to movies , the last time i went to a movie i took my children by their hands to see herbie the love bug . they 're now 46 and 43 . because i ca n't afford to go to movies . or no i ca n't afford to go out [ to dinner ] , unless one of my children , my daughter she generally takes me out on mother 's day and on christmas i generally go down to her place but no i eat by myself . although admittedly it was n't a necessity , cable tv was viewed as an important component of their daily routine and helped to address the isolation these women experienced . many watched television while eating their meals alone , and many would watch their favourite shows to help pass the time . if you do n't have cable you ca n't watch tv i mean the girls will come in to play cards and sometimes we 'll go to bingo every once and a while but that [ cable ] is the only enjoyment i have , know what i mean ? within the context of these low - income lone seniors ' lives , cable was essential to help them cope with their situation , to help improve their quality of life . none of the women owned cars , many had mobility issues , and all depended on family , friends , or neighbours to access grocery stores , medical appointments , or church . even the municipal accessible bus service did not meet the needs of some of the participants to access the foods they needed and wanted . changes in the bus routes and a policy stating the accessible bus would only venture a certain number of meters off the urban transit ( nonaccessible ) route meant one participant could no longer rely on this service . you have to give exactly two weeks notice and then they 'll work you in . so therefore you have to make your appointments [ well in advance ] and you [ referring to interviewer ] can get up in the morning and say i think i 'll go get groceries today we ca n't do that . within the mesosystem layer of the women 's environment , family and friends provided the transportation to enable access to food for six of the eight women . the senior woman is involved in her mesosystem environment albeit not as intensely , as she will not have as much control at this level because it will always involve influence from another party ( e.g. , the family member or friend ) . while family and friends were the primary source of transportation for six of the women , for others family members were dispersed across the country , or of those that lived nearby some were unable or unwilling to provide this service for the participants on a consistent , reliable basis . a myriad of health problems affected this group of women : five suffered from arthritis or joint pain , four had type 2 diabetes , four had hypertension , three had some type of digestive disorder , three had full or partial dentures , two were on medication for dyslipidemia , and two were cancer survivors . stroke , thyroid problems , cardiovascular disease , and severe food allergies were reported once each . overall , the main health problems contributing to food insecurity were physical and mobility limitations . the participants ' multiple health issues required various medications , thus resulting in these women being regulated by drug plan policies . for six of the women enrolled in the provincial seniors ' pharmacare program , they greatly benefited from the policy that exempted all seniors in receipt of the gis from paying the annual premium associated with pharmacare . the copayment policy also protected them from paying extreme costs at the pharmacy the plan is structured so seniors pay a certain percentage of the total prescription cost at the pharmacy up to a maximum amount of ( at the time of study ) $ 30 for each prescription , with an annual maximum of $ 382 . one participant explains : we got ta pay 30% it does n't matter how much my medication comes to , you still only pay $ 30 . now this here [ referring to a prescription ] , it 's $ 96.95 but you still only pay $ 30 . it does n't matter if they were $ 500 , you 'd still only pay $ 30 . saving money on medications and health benefits was important so that money could be better distributed to other parts of the budget , despite loss of services . one of the participants , formerly with her deceased husband 's employer 's insurance company , shared that once she turned 65 years of age and was eligible for pharmacare she took advantage of the cheaper drug insurance plan , despite losing some health services . but i used to be able to get some therapy for my arthritis , they 'd pay for that but pharmacare do n't pay for that . throughout the interviews , as the women reviewed the affordability scenarios created in our previous work , an emergency response - type service was often mentioned as an essential expense , where the client wears a button , as a pendant or bracelet , which activates a speakerphone putting them in touch with the operator who in turn phones a first responder . a couple of the participants shared stories of how this service has alleviated the fear of having a fall when living alone one woman was adamant that it should be built into the pharmacare program . i think that should be a basic thing that you should have to have . some before they turn 65 if they have any type of medical problem and it should be required when you turn 65 . grocery stores were another social structure which the women had minimal control over as store location and layout greatly impacted their food access . while grocery shopping had previously been viewed as a social outing for some of the women , mobility limitations turned it into a chore . the stores are too big and my foot 's too sore , i could never get around it . you know , just like going to the mall , you know , the mall is so awful , you know about that , the mall , it 's so big by the time you get around and get home it 's just like , ahhhh . you feel like you 're dead . and grocery stores are just the same , they 're too big and i do n't want to get in no wheelchair , where am i gon na put the groceries at ? health and health problems were also a direct part of the women 's microsystem , a part of their everyday experiences interacting with their diet . for example , needing to avoid food because of allergies , sensitivities or because it was contraindicated with a medication was an issue for some of the women . one participant had nine different ingredients listed on her allergy information card , meaning sometimes she was left with little choice for meal options available through the congregate dining program at her seniors ' manor . a lot of foods i 'm allergic to and they used to substitute but now the new the director 's decided no no , no more substitution . i 'm allergic to hamburg , which ( participants of the congregate dining program ) eat a lot . and things like peas , and carrots and bananas , and all kinds of nuts the reality for this particular woman was that her health issues dictated whether she could participate in a meal or not , thus comprising her nutritional intake , her social interactions from being part of a congregate dining program , and her finances as she lived at a manor where she opted for her monthly rent to include the dining program . all eight women described how they regularly accessed community - based food resources , including food banks , congregate seniors ' dining programs , and meal delivery programs . while home - delivered meal programs have potential to make a significant contribution to the nutrient intake of seniors , it was common for the women in this study to stretch one meal to make it into two , as this participant shared : well at first when i first was getting [ a home meal delivery service ] they were wonderful . and i always had the soup for my lunch and i could make the dinner do two dinners . three of our participants regularly accessed a food bank , these women talked casually about their use of food banks with no sense of shame detected , perhaps attributable to life experiences and world view . they spoke accolades about the staff and volunteers at the food banks they attended and were so appreciative of the food they received . not only could they receive food when in need , their food banks also delivered to them , which was considered a well sometimes like if i need , say if i need onions or anything like that , i 'll phone up and see if they 've got any and if they have well [ volunteer ] will bring it down . they were careful to point out that they only received food when it really needed it and took strides to make their food last as long as possible . i just get the food once a month , they give me quite a bit , it lasts , i 'm not that big of an eater they give me stuff that i make on my own , and i make enough that it lasts me for almost the week throughout the interviews it was clear these women used community food resources when needed and were thankful for the increased access to food they provided . all participants were asked what the biggest factor in their lives was influencing their ability to access food ; four of the women immediately responded with family . the role that family members played varied amongst the participants , but critical roles were seen in providing transportation to shopping and medical appointments , housework , caring for them if they were sick , tending to legal matters , paying certain bills if necessary , and offering love and company . one of the women when asked what was the biggest factor influencing her ability to access food she quickly responded well actually i 'm in a very lucky situation , because a downstairs neighbour takes another neighbour for groceries every month and she said to me one day i might as well get your groceries while i 'm walking around with her . and i just give her my debit card and my list and she does my shopping and she not only goes and gets my groceries , but she brings them back and she puts them away for me . it was unclear if this strong trust between these two individuals existed prior to the woman being unable to shop for her own groceries , or if the trusting relationship was created out of necessity so the participant could bring food into her house . one brought up the point several times throughout the interview that when you have no family , no one to fall back on , you have to be financially prepared for the unexpected . it 's good to have a little bit of money , it does n't matter how young you are [ and ] it do n't matter how old you are , you do n't know what 's going to come up that you 're not counting on , and then when you 've got nobody to come back on . [ i 've made wise choices ] with the money , it 's because i 've got nobody to come back on . you 've got to have some money or somebody to help you out you know . social capital , the number of people who can be expected to provide support and the resources those people have at their disposal , seemed essential for all women to help them complete various activities of daily living . as age brought about increases in health and mobility issues , reliance on others also increased . additional to using organized community - based programs , the women in this study employed other food management strategies at the individual level to buffer food insecurity . strategies included tight budgeting , stretching food , stock - piling nonperishables , eating poor quality ( old ) produce , purchasing food or medications on credit , and using various resources available at grocery stores . a unique shopping practice carried out by one of the women included asking produce department staff to chop or peel vegetables , particularly hard root vegetables like squash and turnip . she would also request staff to cut whole vegetables in half . for example , she knew she could n't eat a whole bunch of celery and did n't want to pay for something that was going to rot in her fridge . i 'll say ( to produce department staff ) i really do n't want to buy that great big bunch of celery , because it 'll rot on me . and i 'll say , cut it in half ! and if i buy a squash i 'll say will you cut my squash , and he 'll say how do you want it ? and i 'll say in quarters . and they 'll cut it for me . and if i buy a turnip because my hands ca n't do it anymore and i 'll say will you cut that ? how do you want it ? cut it in chunks so i can just peel it and that 's what i do i thought , what 's the sense of me buying it if i ca n't cut it ? when you 're a senior and you 're living alone you got to , economically you got to do it . well i 'm not doing it anymore , because i do n't have the money . the women interviewed were all very resourceful , and perhaps due to their past experiences , current financial restraints and world view , they have developed unique strategies to cope with hunger . the purpose of this work was to explore the phenomenon of food insecurity for low - income lone senior women living in ns . to help us examine the meanings behind these women 's experiences of accessing food , bronfenbrenner 's ecological systems theory provided a model to observe the women in their immediate environments and then examine their situations more broadly so as to determine how their everyday actions ( e.g. , food acquisition and consumption ) are mediated by more distal aspects of their physical and social milieus . of particular interest was the generational lens that was cast over all the participants ' perceptions of their food security status . despite participants clearly meeting criteria for food insecurity , for example , some reported having difficulty accessing food because they are in too much pain to shop , needing to use food banks or other charitable food models , or having difficulty accessing food that meets special dietary requirements . they also reported needing to make sacrifices such as switching insurance plans or sacrificing social outings so that they can maintain enough self - sufficiency to consider themselves food secure . yet overwhelmingly , the participants did not self - identify as having any real problem accessing food . this finding may be a product of their world view , a macrosystem factor , which reflects their experiences of living through more difficult , or food insecure periods of life . in contrast to findings by hamelin et al . and our previous work with low - income lone mothers [ 2931 ] , the shame often associated with food insecurity and accessing food banks does not seem to be part of the experience for these senior women . american researchers have suggested that experiences are colored by the world view or generational lens which enables seniors to endure hardships , this may be due to the impact of remembering the great depression or the world wars [ 32 , 33 ] . similar to findings among seniors in the us , our research suggests that while food insecurity among lone senior women in canada does exist , senior women 's self - perceptions of food insecurity are influenced by a macrosystem cultural lens from an older generation , which may be at odds with current cultural understandings of food insecurity . the finding that senior women in this study have skills and perceptions that enable them to cope with food insecurity raises questions about how future generations will experience food insecurity and how this will impact their health and well - being if they do not share a similar world view or generational lens then that of their parents or grandparents . while an argument can be made that senior women of the future will not be as vulnerable to food insecurity because many more will have worked ( may have greater access to cpp or personal savings ) and can drive ( may not be as isolated ) , there is a risk that food insecurity among seniors will become a more prominent social issue if we do not have the proper mechanisms in place to support seniors ' ability to access a nutritious diet . at the exosystem level , the participants identified several policies and programs such as oas , cpp , and pharmacare that influenced access to food . consistent with findings of our previous research , participants described the protective effect of the gis , the oas program for low - income seniors . if a low - income senior has no other source of income besides the oas basic pension ( i.e. , did not pay into cpp or have a private pension plan ) , they can receive up to an additional $ 738.96 ( effective july 2012 ) in monthly income on top of the basic oas pension , this additional gis benefit is nontaxable income . as of july 2012 , canada 's universal health care has a protective effect on the food security status of seniors . in ns , no senior need absorb the full cost of their medications because of the compulsory drug insurance plan , pharmacare . recipients of the gis also do not have to pay the annual premium associated with the insurance plan . although pharmacare is an exosystem factor its existence speaks to canadians ' values and beliefs at the macrosystem level that healthcare should be accessible to every citizen . unfortunately , a recent evaluation of the gis shows that many seniors who are eligible to receive gis are not doing so ; it is speculated that a large proportion of eligible nonrecipients consists of seniors in vulnerable communities , such as aboriginal people , homeless or near homeless , and immigrants . while increasing the accessibility of gis would help to address food insecurity among vulnerable seniors , the findings from our provincial food costing research consistently show that even with the gis , not a great deal of money is left at the end of the month , which can leave lone seniors vulnerable to food insecurity if emergency or unforeseen expenses arise [ 1 , 37 , 38 ] . also at the exosystem level , is the protective role subsidized housing plays on freeing up money to be made available for food . seven of the eight participants lived in subsidized housing ; affordable and accessible housing is necessary to help low - income persons , including seniors , achieve food security . our findings suggest that housing costs absorb the lion 's share of seniors ' monthly pensions ; this has been shown in other research in ns [ 1 , 37 ] and elsewhere . finding and maintaining housing on limited income can be a major challenge for seniors , as heard in two of the stories from the women interviewed who spoke of excessively long wait lists to get an apartment in a seniors ' manor in urban ns . in 2006 , 4% of seniors in ns were able to access the provincial government 's seniors rental housing program ; many more seniors would benefit from the income - protection subsidized housing offers but there are not enough spaces allocated for the 11% of seniors ( 13,715 ) , living below the low - income cutoff . it could be speculated that the voices of seniors paying market rent would reflect more food insecure experiences than the women interviewed here . at a more local level , our qualitative results suggest that reliable and accessible transportation is an issue for senior women in urban ns . statistics canada shows that relatively few seniors use public transit , and our participants clearly shared their challenges with transit systems . most seniors in ns live in areas without public transit meaning volunteer drivers , private transportation services , and reliance of family and friends become more and more important to help gain access to groceries . unfortunately , the trend in ns is migratory as youth and adults leave the province in search of employment and as the volunteer sector dwindles . it is quite plausible the ns senior 's microsystem is shrinking as the structures with which the senior has direct contact become fewer and fewer . this is of concern in light of the world view , we notice today 's seniors working within ; will seniors in need reach out to community resources if they 've been raised to weather hard times ? who , if not a family member , will notice a lone senior women stretching or skipping meals , or eating nutritionally inadequately ? the finding that seniors may be experiencing food insecurity , relying heavily on social networks and personal coping strategies suggests existing data of food insecurity in seniors may not be comprehensive ; current indicators and measures do not capture the whole experience of how seniors experience food insecurity . in addition , with their generational lens and experience of previous hardships such as the great depression and world wars , food insecurity amongst seniors is not viewed as a serious problem by seniors themselves . this may help to explain why rates of food insecurity among seniors in canada are reported to be low ( 3.2% ) , while poverty rates as determined by the lico are much higher ( 11.8% ) . it is unclear whether food insecurity among seniors is truly being captured by current means of data collection . if the results from this study are any indication , there may be a great many seniors with similar generational views who are silently coping , effectively rendering the issue of food insecurity among seniors invisible . the results from this study are timely , as in canada , policies in place to protect vulnerable populations such as seniors may be at risk . during the announcement of canada 's economic action plan 2012 ( the federal budget ) , significant changes to the oas program were proposed : starting in 2023 , the age of entitlement for all oas benefits would gradually increase by two years from 65 to 67 , with full implementation by 2029 . this proposed policy change may mean more seniors will be relying on provincial social assistance and disability programs longer , especially given that statistics are showing that the canadian population is aging , with population projections suggesting that by 2051 seniors will form 24.7% of the canadian population compared to 14.4% in 2011 , and 9.6% in 1981 . in light of this , our findings raise concerns that the risk of poverty and food insecurity among lone senior women may be significant into the future . these findings and our earlier work suggest that oas and gis benefits are essential to ensuring food security for seniors . however , even with these public pensions , seniors incorporate a variety of strategies to ensure access to food , as observed by the eight women interviewed . given the anticipated increase in the aging population in canada , as well as the changing world view of the next generation , the coping strategies employed by these women may be lost and thus , food insecurity rates in future generations will likely increase . this demonstrates the importance of ensuring that progressive and sustainable social policies are implemented at multiple levels . we close with the following recommendations to better monitor and address food insecurity in the canadian senior population ; however , lessons learned can be extended beyond our political borders.currently , tools used to capture the prevalence of food insecurity , for example , the food security survey module used as part of the canadian community health survey since 2004 only use income security as an indicator for food security . other indicators such as health status , social inclusion , availability of affordable and accessible housing and transportation are important influencers on seniors ' ability to achieve food security and therefore measurement tools which incorporate consideration of these factors should be developed and validated.adequate funding should be allocated to community programs that provide nutritious food to seniors ( e.g. , meals on wheels , etc . ) to better protect those seniors from malnutrition who are unable to cook or travel due to health / mobility limitations and those with unavailable personal social supports . accessible and affordable housing ( e.g. , subsidized housing ) must be available and reflective of the level of need among community dwelling seniors.accessible municipal transportation , with adequate scheduling and routes , should be available in urban centres , with various methods of community input available to ensure the system is meeting the needs of its users / community residents . in terms of further reaching policy implications , federal and provincial governments in canada should develop and implement a poverty reduction strategy that aims to lift people out of poverty . in relation to seniors , this would include continuing to review and implement changes to public pension systems to ensure income adequacy among canadian seniors and increasing access and awareness of programs , services , and support , such as guaranteed income supplement for low - income seniors . currently , tools used to capture the prevalence of food insecurity , for example , the food security survey module used as part of the canadian community health survey since 2004 only use income security as an indicator for food security . other indicators such as health status , social inclusion , availability of affordable and accessible housing and transportation are important influencers on seniors ' ability to achieve food security and therefore measurement tools which incorporate consideration of these factors should be developed and validated . adequate funding should be allocated to community programs that provide nutritious food to seniors ( e.g. , meals on wheels , etc . ) to better protect those seniors from malnutrition who are unable to cook or travel due to health / mobility limitations and those with unavailable personal social supports . accessible and affordable housing ( e.g. , subsidized housing ) must be available and reflective of the level of need among community dwelling seniors . accessible municipal transportation , with adequate scheduling and routes , should be available in urban centres , with various methods of community input available to ensure the system is meeting the needs of its users / community residents . in terms of further reaching policy implications , federal and provincial governments in canada should develop and implement a poverty reduction strategy that aims to lift people out of poverty . in relation to seniors , this would include continuing to review and implement changes to public pension systems to ensure income adequacy among canadian seniors and increasing access and awareness of programs , services , and support , such as guaranteed income supplement for low - income seniors .

we recently discovered that ( )hopeaphenol ( 1 ) , a tetramer of resveratrol ( 2 ) ( figure 1 ) isolated from the stem bark of hopea hainanensis , inhibits the type iii secretion system1 ( t3ss ) in yersinia pseudotuberculosis and pseudomonas aeruginosa.2 the conserved3 t3ss is critical for these pathogens to cause disease and therefore constitutes an attractive target for the development of new antibacterials.4 while large amounts of ( )hopeaphenol can be obtained from natural sources,5 structure activity relationships can not be elucidated since structural isomers are not readily available . we became intrigued by the threedimensional structure of trans dihydrobenzofurans and decided to investigate whether the entire hopeaphenol structure is required , or if it can be reduced to a resveratrol dimer such as ampelopsin b ( 4 ) ( figure 1 ) . the scientific community 's interest in the chemistry and biology of polyphenols is increasing6 and the total syntheses of several related natural products have been reported.7 this includes the biomimetic synthesis of ampelopsin b via viniferin ( 3 ) by an oxidative dimerization of resveratrol8 followed by a final cyclization . however , a flexible and divergent synthetic strategy that allows alterations to the substitution pattern of , for example , ampelopsin b does not exist . the structures of ( )hopeaphenol ( 1 ) , a tetramer of resveratrol ( 2 ) , and ( + ) viniferin ( 3 ) and ( + ) ampelopsin b ( 4 ) , both dimers of resveratrol we hypothesized that if a suitable protecting group could be found it should be possible to obtain ampelopsin b ( 4 ) in a threestep , onepot deprotection a model experiment was first executed to investigate whether the epimerization of c2 was feasible . after investigating several options9 cisdihydrobenzofuran 6 was prepared10 in five steps using methods inspired by kim 's synthesis of pentamethylated viniferifuran.11 by treating compound 6 with the moderately strong acid trifluoroacetic acid ( tfa ) in ch2cl2 , trans epimer 7 was obtained in excellent yields ( scheme 2 ) . the next step was to investigate if a onestep deprotection cyclization could be realized on protected viniferin . pentamethylated viniferin was first prepared by methylating viniferin ( 3 ) obtained through dimerization of resveratrol ( 2).8 however , despite our best efforts we did not manage to find conditions for this reaction with phenols protected as methyl ethers . most well established techniques for ether cleavage were investigated but none could remove the methyl groups and cyclize to produce ampelopsin b in acceptable yields . the envisioned threestep , onepot formation of ampelopsin b ( 4 ) from compound 5 . hence , we realized that a different protecting group was needed and theorized that cyclopropylmethyl groups ( cprme ) should be suitable since they are reported as being relatively easy to remove under acidic conditions using , for example , hcl ( aq ) in methanol.12 synthesis of the cprmeprotected compound 24 commenced according to scheme 3 . unfortunately , benzofuran 16 ( scheme 3 ) could not be prepared directly as the cprme protecting groups were incompatible with the benzofuranforming conditions.13 also , we failed to deprotect the methylated analog of 16 since it proved prone to cyclization ( see the supporting information).14 thus , the ester functionality had to be installed after the protecting group switch . starting from ketone 8 ( scheme 3 ) , which was brominated using cubr2,10 and aryl bromide 11 , which was obtained by monodeprotection of 10 by using bbr3 , compound 12 was formed and consecutively cyclized to benzofuran 13 using bi(otf)3 . the methyl groups could then be removed by using bbr3 and replaced with cprme groups to form 15 . reagents and conditions : ( a ) cubr2 , etoac / chcl3 ( 1:1 ) , reflux , 23 h ; ( b ) bbr3 , ch2cl2 , 020 c , 23 h ; ( c ) k2co3 , acetone , reflux , 2 h ; ( d ) bi(otf)3 , ch2cl2 , reflux , 22 h ; ( e ) bbr3 , ch2cl2 , 7820 c , 18 h ; ( f ) ( bromomethyl)cyclopropane , k2co3 , acetone , reflux , 22 h ; ( g ) pd(oac)2 , k2co3 , mo(co)6 , meoh , dppf , dmf , 120 c , 15 h ; ( h ) 4bromophenol , ( bromomethyl)cyclopropane , k2co3 , acetone , reflux , 24 h ; ( i ) pd(oac)2 , tricyclohexylphosphonium tetrafluoroborate , k2co3 , pivalic acid , dma , 100 c , 20 h ; ( j ) pd / c 10 % , h2 , etoac / meoh ( 1:9 ) , 20 c , 3 d ; ( k ) dibal , ch2cl2 , 78 c , 1 h ; ( l ) dmp , ch2cl2 , 20 c , 90 min ; ( m ) 4hydroxybenzaldehyde , ( bromomethyl)cyclopropane , k2co3 , acetone , reflux , 24 h ; ( n ) nabh4 , meoh , 20 c , 1 h ; ( o ) socl2 , et2o , 20 c , 2 h ; ( p ) p(oet)3 , 130 c , 22 h ; ( q ) kotbu , thf , 78 c , 16 h ; ( r ) 12 m hcl ( aq ) , thf , 80 c , 1 h. all chiral compounds are racemic mixtures . dppf = 1,1bis(diphenylphosphino)ferrocene ; dma = dimethylacetamide ; dmp = dess martin periodinane . after screening a range of conditions ( see the supporting information ) the methyl ester could be installed by using a pd(oac)2/dppf catalyzed carbonylation with mo(co)6 as the co source to give 16.15,16 this was followed by a direct arylation at c2 by using pd(oac)2 and p(cy)3 hbf4 to obtain compound 19.13,17 the furan ring in 19 was then reduced by catalytic transfer hydrogenation to form the racemic dihydrobenzofuran 20 in excellent yield considering that this transformation typically is difficult and there are only a handful reports in which 2,3disubstituted benzofurans are hydrogenated.18 the methyl ester in 20 was first reduced to alcohol 21 with dibal and then reoxidized to aldehyde 22 by using dess martin periodinane.19 the final benzene ring was then connected by using a horner ampelopsin b ( 4 ) could then be obtained by treating compound 24 with 12 m hcl in thf . this is , to the best of our knowledge , the first total synthesis of ampelopsin b that does not involve a dimerization of resveratrol ( 2 ) . ampelopsin b ( 4 ) was obtained in 5 % overall yield over 12 steps in the longest linear sequence and the synthesis concludes with a noteworthy threestep , onepot deprotection cyclization epimerization that proceeds in 21 % yield . we hypothesized that it should be possible to identify conditions that would provide a delicate balance where deprotection and epimerization is achieved but the cyclization , which presumably proceeds via a quinone intermediate , does not take place . despite rigorous screening we never managed to find conditions where viniferin ( 3 ) could be isolated from the final multistep reaction . it became apparent that the cyclization to form ampelopsin b ( 4 ) took place at milder conditions than what was required to remove the cprme protecting groups . alternative paths to reach viniferin were thus investigated and it was decided to replace cprme with acetyl groups in a second protecting group switch . upon treating 20 with hcl ( aq ) a one pot deprotection epimerization could be achieved to form compound 25 ( scheme 4).21,22 reprotection of 25 led to an observed change in coupling constant between the protons at c2 and c3 from 8.0 to 4.8 hz proving the reversed stereochemistry at c2 ( figure 2 ) . reagents and conditions : ( a ) 12 m hcl , ch2cl2 , meoh , 100 c , 1 h ; ( b ) lialh4 , 7820 c , 5 d ; ( c ) pdc , thf , 20 c , 17 h ; ( d ) ac2o , tea , thf , 20 c , 17 h ; ( e ) methyltriphenylphosphonium bromide , k2co3 , thf , reflux , 20 h ; ( f ) 4iodophenol , ac2o , pyrdine , 20 c , 18 h ; ( g ) tritertbutylphosphonium tetrafluoroborate , pd(oac)2 , tea , mecn , 120 c , 3 h ; ( h ) koh , meoh , 0 c , 70 min . h coupling constant ( j ) is 8.0 and 4.8 hz for the cis and transepimer of 20 , respectively . the methyl ester in 25 was subsequently reduced by using lialh4 to form alcohol 26 and then reoxidized with pdc to form aldehyde 27 , which was acetyl protected by using ac2o and tea to form 28 [ compound 26 has previously been reported7 as an uncharacterized cis / trans ( 1:10 ) mixture ] . subsequent attempts to transform 28 to 32 in one step by using horner wadsworth a single carbon atom was instead added by using standard wittig23 conditions to form olefin 29 . compound 32 could then be prepared by using a heck coupling.24 after screening a range of reaction conditions ( see the supporting information ) it was found that pd(oac)2 , p(tbu)3 hbf4 , and tea in mecn produced full conversion within three hours at 120 c . unfortunately , compound 32 and regioisomer 33 were formed in a 78:22 ratio that we were unable to improve . the two regioisomers were inseparable by column chromatography on silica gel but could be easily separated by preparative thinlayer chromatography . removal of the acetyl protecting groups by using koh proceeded smoothly and produced ( )viniferin ( 3 ) in 5 % overall yield over 15 steps in the longest linear sequence starting from 8 . in conclusion , a successful strategy for the total synthesis of ampelopsin b ( 4 ) and viniferin ( 3 ) is reported . through this approach the two natural products were prepared in 12 and 15 steps , respectively , starting with commercially available 3,3dimethoxyacetophenone . an important benefit of our approach vs. the previously reported dimerization of resveratrol is that specific alterations to the substitution patterns are possible . in addition we explore the unconventional cprme group for protection of phenols and our data suggest that this group , due to its greater acid sensitivity compared with methyl groups , should have potential for wider application in the synthesis of polyphenolic compounds . we are currently in the process of synthesizing a library of analogs to these two natural products to establish structure activity relationships and identify potent inhibitors of bacterial pathogens .

the effect of residual renal function ( rrf ) in patients with end stage renal disease in peritoneal dialysis is extensively studied and is associated with lower morbidity and mortality . the canusa study has proven that for every 0.5 ml / min additional glomerular filtration rate ( gfr ) there was a 9% lower risk of death in peritoneal dialysis patients with rrf . in hemodialysis patients also , the pivotal role of residual renal function is well documented [ 2 , 3 ] . it has a major contribution in total solute clearance , especially in removing middle as well as small solute proteins [ 4 , 5 ] . one of rrf major benefits is the optimal control of fluid balance , with extreme importance in blood pressure control , decreased left ventricular hypertrophy , and reduction of cardiovascular disease . it also reflects the residual homeostasis mechanism for calcium and phosphorus balance and erythropoietin residual synthesis . patients with rrf have higher levels of hemoglobin due to higher levels of endogenous erythropoietin . rrf has an overall beneficial effect on quality of life mainly because it offers better fluid balance , higher haemoglobin , better nutritional status , better phosphate control , and lower accumulation of 2-microglobulin . various studies have proven that peritoneal dialysis is better in preserving rrf than hemodialysis but very few studies have investigated in therapeutic interventions for preserving rrf in hemodialysis patients . the effect of angiotensin - converting enzyme inhibitor ( acei ) on reducing the rate of decline of gfr in proteinuric nephropathies and its clinical implications are well established . there is a considerable amount of evidence that acei preserve renal function , independently of blood pressure control [ 11 , 12 ] . these studies show that perhaps the benefit of slowing progression of rrf loss might be a continuum even when dialysis was initiated . the aim of our study was to investigate whether enalapril , an ace inhibitor , given in dialysis patients would preserve rrf and the eventual side effects of such treatment . a prospective , randomized open - label study was designed and approved by our hospital ethical committee . within 3 years , 53 patients were screened ; 42 met the inclusion criteria and were enrolled after obtaining their written consent . if patients were under treatment with acei and/or angiotensin ii receptor blockers ( arbs ) , these medicines were discontinued 3 months prior to enrolment . demographic data were recorded prior to randomization , including age , sex , body weight , body surface area , systemic blood pressure , 24 h urine output , gfr ( rrf ) , proteinuria , predialysis biochemistry , and underlying kidney disease . rrf was estimated by calculating gfr expressed in ml / min/1.73 m. gfr was estimated as the mean of urea and creatinine clearance using urine collections made over the entire interdialytic period ( starting with empty bladder at the start of one dialysis session and ending at the start of the next ) . the mean blood urea and creatinine plasma concentrations during the collection period were estimated as the mean of the posthemodialysis concentration immediately after dialysis ( we have used the slow flow / stop pump sampling technique ) ; at the completion of hemodialysis , we turned off the dialysate flow and decrease the ultrafiltration rate ( ufr ) to 50 ml / h the transmembrane pressure ( tmp)/ufr was set to the lowest value or set to zero if the dialysis machine allow it . if the dialysis machine did not allow to turn off the dialysate flow , we have decreased the dialysate flow to its minimum setting . then we have decreased the blood flow to 50 to 100 ml / min for 15 seconds and the prehemodialysis value immediately before the following dialysis session . gfr was calculated according to the formula : gfr = uvol / t { uurea[(preurea + posturea)/2 ] + ucreat/[(precreat + postcreat)/2 ] } 1.73/sa ( sa : surface area in m , t : duration of collection between dialyses in minutes ) uvol : urine collection volume in ml , preurea and precreat : predialysis urea and creat concentration in blood sample at the end of the collection , posturea and postcreat : postdialysis urea and creatinine concentration in blood sample at beginning of collection , uurea and ucreat : urea and creatinine urine concentrations ) . the surface area was estimated by the gehan 's and george 's formula : sa = 0.007184 wt ht ( sa in m , weight in kg , height in cm ) . inclusion criteria were residual gfr 5 ml / min/1.73 m , urine output 100 ml / day , not taking acei or arbs for more than 3 months . exclusion criteria were pd as a previous dialysis mode , failing from transplantation , known history of congestive heart failure , history of cardiovascular disease , known history of bilateral or unilateral renal artery stenosis , intolerance of acei , and blood pressure < 120/70 mm hg . these 42 patients were randomized in two groups either in treatment with enalapril or no treatment at all . in 21 patients both groups received the same treatment concerning the dialysis procedure according to the department protocols ( dialysis adequacy , anemia treatment , and secondary hyperparathyroidism ) . the type of dialyzer used was high - flux polysulfone in order to avoid inflammatory nephrotoxic mediators due to bioincompatible dialysis membranes . each dialysis session lasted 4 hours with blood flow rates between 250 and 320 ml / min and dialysate flow set at 500 ml / min . dialysis prescription was independent of the study and was decided according to the dialysis unit standard procedures based on individual patient assessment . a urea clearance ( kt / v ) equal or greater than 1.2 using single - pool kinetic model was the target for thrice weekly dialysis . all confirmed readings exceeding the target blood pressure ( the target blood pressure of 135/85 mm hg or to avoid symptomatic hypotension ) were controlled first by adjusting the patient 's optimal dry weight , and then if the target was not achieved , we introduced an antihypertensive medication , except acei and arbs . baseline characteristics were compared between the two randomized groups by using chi - square tests and wilcoxon 's signed tests . primary outcome measures were decline of urinary volume and urea and creatinine clearance over 12-month period . anuria was defined as urine output of < 100 ml/24 h. secondary outcome measures were hyperkalemia , urinary protein excretion , cardiovascular events ( myocardial infarction , sudden death due to cardiovascular cause , and cerebrovascular events ) , duration of hospitalization , and death . multiple regression analysis was performed in order to investigate the relationship between rrf and various independent variables ( age , gender , blood pressure , and etiology of esrd ) . there were no significant differences in sex distribution , age , body weight , body mass index ( bmi ) , and primary kidney disease . there were also no significant differences in basic clinical and laboratory parameters between the two groups at recruitment and at the end of the study ( table 2 ) . 17 patients needed hospitalization for primary av fistula creation , 8 patients for vascular access complications , 5 patients had coronary angiography , 2 had percutaneous transluminal coronary angioplasty ( ptca ) , and 9 of them had to receive intravenous contrast media for computed tomography . however the number of these patients did not differ among the two groups ( table 3 ) . evolution with time of rrf expressed in gfr and of urine volume is shown in table 4 . at the end of study period , gfr was 2.9 1.2 ml / min/1.73 m at enalapril group and 1.1 0.5 at control group . urine volume was 690 270 ml/24 h at treatment group and 330 160 at control group . although substantial effort is made on preserving renal function in patients with chronic renal disease , much less is being done in patients with esrd initiating dialysis . first reported the benefit of survival of the residual renal function in peritoneal dialysis patients . similar results came from the netherlands cooperative study on the adequacy of dialysis ( necosad ) . they proved that the contribution of rrf to the overall survival of hemodialysis patients is significant . these data support that any therapeutic intervention which contributes to preserving rrf for longer period must be taken into consideration . in our work we studied the effect of an ace inhibitor , enalapril on rrf in patients on hd . the role of ace inhibitors in reducing the decline rate of renal function in various kidney diseases is well documented [ 1618 ] . the results of our study support that treatment with enalapril is an effective and safe measure in order to slow the loss of residual renal function in patients with end stage renal disease starting hemodialysis . at the end of the study period , patients receiving enalapril had a slower and less significant loss of their gfr and had a higher daily urine output than the control group . the reduction of rrf loss in patients receiving enalapril could not be attributed to demographic and clinical characteristics . the two groups were matched in all parameters that could affect rrf ( age , gender , bmi , systemic blood pressure , dialysis modality , primary kidney disease , use of diuretics , and inflammation status ) . the effect enalapril had on rrf seems to be independent of systemic blood pressure reduction because reduction of bp was similar in both groups . our observation was consistent with previous studies [ 19 , 20 ] , showing that the beneficial effect of ace inhibition was independent of its effect on systemic blood pressure . a reduction in proteinuria was not shown in patients with enalapril compared with the control group probably because of the extend damage of the glomerulus in esrd and the incapacity of the haemodynamic changes conferred by ace inhibitors to reduce it . it is still controversial whether biocompatible membranes preserve renal function in dialysis patients better than bioincompatible membranes [ 21 , 22 ] . in order to avoid ulterior renal injury from the activation of the complement and the inflammatory cascade by bioincompatible dialyzer we used high - flux polysulfone membrane in our study . during dialysis , blood contact with synthetic surfaces provokes a cascade of events which involves activation of peripheral blood mononuclear cells . via complement activation , a whole range of inflammatory mediators ( il-1 , il-6 , tnf , reactive oxygen species ( ros ) , no ) . the resulting acute inflammatory response is marked by the release of acute phase proteins such as c - reactive protein . in hd patients , furthermore , elevated levels of inflammatory markers such as c - reactive protein and interleukin-6 are reported to be inversely related to serum creatinine in predialysis patients . there was a significant rise in the c - reactive protein levels observed in the control group after 12 months of hd , which instead did not change in the treatment group . our suggestion is that the anti - inflammatory action of acei reduced the inflammation mediators of increased oxidative stress and preserved better rrf in dialysis patients . follow - up period of 12 months was adequate but longer follow - up period is needed in order to draw safe conclusions upon the effect of ace inhibitors on mortality and morbidity in patients starting hemodialysis . our study has proven that enalapril , given in a single morning dose , has a significant effect on preserving residual renal function in patients starting dialysis at least during the first 12 months from the initiation of the hemodialysis . further studies are necessary in order to investigate the potential long - term effect of acei on residual renal function and on morbidity and mortality in patients starting hemodialysis .

one mechanism used by cells to prevent the overexpression of genes is to target their mrna for decay . although several destabilizing elements have been described to alter mrna stability , the most widely studied is the adenine / uridine - rich element ( are ) , which often includes a repeat of the auuua pentamer . ares are found in the 3 untranslated region of certain mrnas and have been shown to severely decrease the stability of the mrna in which they reside . the involvement of ares in the decay of mrna is described as are - mediated decay ( amd ; barreau et al . , 2005 ) . in recent years , many advances have been made in the field of amd relating to its effectors , regulators , and location . the physiological significance of ares and amd has also been revealed through several studies ( gingerich et al . , 2004 ) another form of mrna degradation that has received much attention lately involves micrornas ( mirnas ) . mirnas are derived from short hairpin rna fragments , which are processed through a specific pathway to yield oligomers complementary to specific messages . when these oligomers then interact with their targets , one of two outcomes is observed : either translation is repressed or the target mrna molecule is sentenced to degradation ( filipowicz et al . , 2008 ) . interestingly , recent studies have indicated that some players in the mirna pathway may interact with and affect the fate of are - containing messages ( jing et al . , 2005 ; vasudevan et al . , 2007 ) . in this mini - review , we will highlight what is known regarding amd , how the rapidly evolving mirna field may tie in , and where recent work may lead . given the fact that amd allows control over protein expression , it is not surprising that the various are binding proteins ( aubps ) play entirely different roles in regulating the stability of are mrnas ( bevilacqua et al . some direct are mrnas toward rapid decay by amd ( e.g. tristetraprolin [ ttp ] ; lai et al . , 1999 ; lykke - andersen and wagner , 2005 ) , others increase the stability of their mrna ligands ( e.g. hur ; brennan and steitz , 2001 ) , and still others may do both ( e.g. auf-1/hnrnp d ; barreau et al . , 2005 ) . a series of studies have also shown that certain aubps , such as tia-1/tiar and hur , are capable of influencing mrna translation ( barreau et al . , 2005 ) , and although it is not known if this activity of aubps is related to amd , it certainly merits further attention . interestingly , most aubps have not yet been shown to be the direct executors of amd but rather recruit and regulate effectors of this process ( table i , aubps ) . there exist only a limited number of known enzymes capable of degrading mrna , and so it is not surprising that many of them have been linked to amd ( table i , degradation machineries ; chen et al . , 2001 ; the most prominent of these are the ribonucleases ( rnases ) , of which there exist two types : exo- and endoribonucleases . the most common exoribonucleases , performing 3 to 5 degradation , exist in a large complex known as the exosome ( bousquet - antonelli et al . this complex , with various exonuclease subunits , also contains proteins that may be capable of binding directly to ares . it was found that the subunits pm - scl-75 , oip2 , and rrp41 can specifically bind to ares via their rnase ph domain ( mukherjee et al . this table lists the aubps ( for a more thorough listing of the stabilizing and destabilizing roles of aubps , see barreau et al . ) and degradation enzymes that have been implicated in amd . the links that these proteins have to amd , as well as to mirna - based processes , are highlighted , with select references ( those underlined are in relation to mirna and those not underlined are in relation to amd ) . recent studies have demonstrated that in some cases , 5 to 3 mrna decay is also significant ( stoecklin et al . , 2006 ) . the major player responsible for this nonexosomal ribonuclease activity is xrn1 ( larimer and stevens , 1990 ) . intriguingly , both xrn1 and pm - scl-75 have been shown to be essential for adequate amd ( yang et al . 2006 ) , suggesting that more than one pathway is being used by this process ( fig . 1 ) . regardless of the direction exonuclease cleavage occurs in , other factors , such as decapping enzymes and deadenylases , are also typically implicated , and these have also been shown to associate with aubps ( table i ) . gap - sh3 binding protein and the erythroid cell enriched endoribonuclease have actually been shown to target the 3 untranslated regions of are mrna ( wang and kiledjian , 2000 ; tourriere et al . , 2001 ; schoenberg , 2007 ) , making them possible suspects in amd . , aubps promoting degradation ( e.g. ttp ) may bind the are of the target mrna and help recruit decapping enzymes such as dcp1/2 . after decapping , the 5 to 3 exoribonuclease xrn1 may then carry out 5 to 3 decay . in the second some data implicate mirnas in this aubp interaction , such as the mir16ago2ttp complex ( jing et al . , 2005 ) . in the third , aubps may recruit deadenylases ( such as parn or ccr4 ) to remove the poly ( a ) tail from the 3 terminus of the mrna , and 3 to 5 degradation may then occur by way of the exosome . stabilizing aubps , such as hur , may be implicated in one or more of these pathways by competing with binding of destabilizing aubps or by preventing mirna mrna interactions . another class of endoribonucleases that has also received much attention lately is the argonaute ( ago ) proteins . these endonucleases are clearly linked to mirna - mediated gene silencing , and growing evidence supports that this newfound pathway of gene expression regulation is somehow related to amd . mirnas have been shown to influence gene expression both by modulating translation and by causing the degradation of target mrnas , although it is uncertain if the latter of these effects is a consequence of the former ( filipowicz et al . , 2008 ) . mirnas are typically found associated with various factors , which together form micrornps ( mirnps ) . a core component of mirnps is the ago protein , which exists in various isoforms , some of which are capable of interfering with translation and of degrading mrna by way of their endonuclease activity ( filipowicz et al . , 2008 ; it is intriguing to note that these two effects of mirna mirror those linked to aubps , suggesting that perhaps the amd and translational roles of aubps are mediated , or at least influenced , by mirna . amd and mirna - mediated decay involve some of the same players , such as the ccr4 deadenylase complex and the decapping enzymes dcp1/2 ( behm - ansmant et al . , 2006 ) . beyond this , a few important studies have actually shown interactions between the two processes . jing et al . ( 2005 ) found that dicer , a key player in the biogenesis of mirnas , is a required component for the degradation via amd of the are - containing message tnf. they reported that mir16 targets a sequence located outside the 34-nt are region ( vasudevan and steitz , 2007 ) that is needed for amd of tnf mrna and that this mirna indirectly associates with ttp through the ago complex . the authors speculated that are recognition by ttp aids mir16 in binding to a target sequence and that the mir16-associated complex components , such as ago2 , can then mediate the amd effect . could this be an example of a collaborative effort between a mirna and an aubp , permitting a more stable interaction with the target mrna , which then allows the recruitment of the degradation machinery ? although most mirna - mediated regulation requires perfect complementarity in the seed sequence of the mirna ( bases 28 ; filipowicz et al . , 2008 ) , the complementarity between mir16 and its target mrna does not exist in this region . perhaps the collaboration between mir16 and ttp is a means of regulating the effects of mir16 . if a known destabilizing aubp , such as ttp , can assist the mirna - mediated degradation of a target message , then it would be reasonable to speculate that a stabilizing aubp , such as hur , could interfere with mirna binding . ( 2006 ) found that hur was capable of rescuing translationally repressed mrna , most likely by interfering with the association of mir122 with are mrna . if ttp can assist a mirna in carrying out decay , then having aubps either interfere with or support the translational effect of mirna is just as likely . this supports the idea that rna binding proteins and mirnas may regulate each other 's effects by competing for binding or complementing the binding of one another ( george and tenenbaum , 2006 ) . they showed that a well - known aubp , fragile x mental retardation related protein 1 ( fxr1 ) , binds to the are of tnf mrna to promote translation during serum starvation in an ago2-dependent manner ( vasudevan and steitz , 2007 ) . for translation of the are mrna to increase , both fxr1 and ago2 had to be present , showing that it is both the cellular environment and an interplay between aubps and mirna factors that influence gene expression . a subsequent study demonstrated that this translational up - regulation depended on mir369 - 3 to bring fxr1 and ago2 to the are and that mirnas enable the transition between the repression and promotion of translation ( vasudevan et al . , 2007 ) . collectively , these studies show that translation may be influenced by players associated with both amd and mirnas and that only through cooperation can the desired outcome be obtained . their players have been shown to operate codependently , and the studies showing these relationships suggest that they work together in a variety of situations . another commonality between these two involves where in the cell they carry out their roles , and , not surprisingly , uncertainty surrounds these details of amd as well . as mentioned earlier , the decapping enzyme complex has been linked to both amd and mirna function . it was noticed that these enzymes , along with several other factors that promote decapping , localized to cytoplasmic foci , and these have since been named processing bodies ( pbs ; eulalio et al . in addition , several mrna degradation enzymes have been found to aggregate in another species of cytoplasmic granule , which specifically form under stressful conditions , named stress granules ( sgs ; anderson and kedersha , 2006 ) . both of these cytoplasmic bodies have raised interest because of their link to amd and to mirna - mediated effects , with the potential of being the specific loci where these processes are modulated . the interaction between certain aubps and pb - associated proteins raised the possibility of a direct link between amd and pbs . ttp has been shown to interact with dcp2 and other components of the decapping complex ( fenger - grn et al . , 2005 ) . ttp , as well as several aubps , has also been shown to associate with various other pb - associated factors , including xrn1 , ccr4 ( lykke - andersen and wagner , 2005 ; hau et al . , 2007 ) , and the exosome ( chen et al . , 2001 ) , particularly the pm - scl-75 subunit ( hau et al . , 2007 ) . these observations suggest that ttp and other aubps help recruit degradation factors to are mrnas . this , and the result that exosome components can directly bind ares ( mukherjee et al . , 2002 ; anderson and kedersha , 2006 ) , support the hypothesis of van hoof and parker ( 2002 ) that the exosome and , perhaps , other components of the degradation machinery are recruited both by aubps bound to the target mrna and by the rnas themselves . several knockdown studies have been done to assess the influence of different factors on the existence of pbs and on amd . for example , knockdown of xrn1 or dcp2 caused an accumulation of are mrnas in pbs and a decrease in degradation ( franks and lykke - andersen , 2007 ) , whereas the down - regulation of various components of 5 to 3 and 3 to 5 exonuclease systems also diminished the amount of amd ( lin et al . , 2007 ) . nevertheless , the results of these studies are not always complementary . gw182 is documented to be required for both pb formation ( yang et al . , 2004b ) and mirna activity ( rehwinkel et al . , when the expression of gw182 is reduced , however , there is no observable effect on amd , even when a significant decrease in the number of visibly detectable pbs is seen ( stoecklin and anderson , 2007 ) . this highlights the fact that despite the ability of some aubps to interact with pb - associated decay enzymes , there is not adequate information to confirm a functional link between amd and the recruitment of are mrnas by pbs . there is also a mounting discussion over the role pbs play in repressing translation ( coller and parker , 2005 ; parker and sheth , 2007 ) , which is significant for both mirna effects and the roles of aubps . equally intriguing are observations showing that pbs can interact with sgs and that this interaction may be responsible for deciding the amd fate of target mrna ( kedersha et al . , 2005 ) . sgs were originally observed as localization centers for specific mrnas in cells exposed to heat shock ( nover et al . , 1989 ) . in mammalian cells , various environmental stressors can induce the formation of sgs ( anderson and kedersha , 2006 ) . sgs are believed to stabilize and block the translation of certain mrnas ( kedersha et al . , 2005 ; mazroui et al . , 2007 ) and then , when the stress is relieved , sgs may direct these mrnas either back to the polysome or to machineries responsible for their degradation ( anderson and kedersha , 2006 ; kedersha and anderson , 2007 ) . several rna binding proteins that have been shown to be essential for sg formation localize to sgs such as tia-1/tiar ( kedersha and anderson , 2002 ) . hur , ttp , and gap - sh3 binding protein , among other aubps , also accumulate in these foci ( gallouzi et al . , 2000 ; tourriere et al . , 2003 ; stoecklin et al . , 2004 ) . although several pb components , such as dcp1/2 and gw182 , are not present in sgs , others , such as xrn1 , are ( anderson and kedersha , 2006 ) . additionally , overexpressing ttp and brf1 has been shown to cause stable interaction between pbs and sgs . is it possible that under stressful conditions , aubp - bound mrnas first localize to sgs and are then directed to pbs for decay ? the pb sg relationship has been further complicated after observations that the formation of pbs and sgs are independent ( kedersha et al . , moreover , some stresses that induce sg formation actually prevent both pb development and the decay of mrna ( mazroui et al . , 2007 ) . these results make it difficult to develop an unambiguous model regarding the cellular location of amd . similar localization issues are also a problem in developing a unified model for mirna - mediated repression ( filipowicz et al . , 2008 ) . when hur rescues mirna - repressed mrna , it does so by causing the mrna to leave pbs ( bhattacharyya et al . , it was also reported that in the presence of mirnas , ago proteins are capable of dynamically associating with sgs , where these enzymes play a role in translation silencing but not in message decay ( leung et al . , 2006 ) . although the compositions and proposed functions of pbs and sgs may differ , there is much evidence that they are both involved in both amd and in mirna - mediated repression . the interaction between certain aubps and pb - associated proteins raised the possibility of a direct link between amd and pbs . ttp has been shown to interact with dcp2 and other components of the decapping complex ( fenger - grn et al . , 2005 ) . ttp , as well as several aubps , has also been shown to associate with various other pb - associated factors , including xrn1 , ccr4 ( lykke - andersen and wagner , 2005 ; hau et al . , 2007 ) , and the exosome ( chen et al . , 2001 ) , particularly the pm - scl-75 subunit ( hau et al . , 2007 ) . these observations suggest that ttp and other aubps help recruit degradation factors to are mrnas . this , and the result that exosome components can directly bind ares ( mukherjee et al . , 2002 ; anderson and kedersha , 2006 ) , support the hypothesis of van hoof and parker ( 2002 ) that the exosome and , perhaps , other components of the degradation machinery are recruited both by aubps bound to the target mrna and by the rnas themselves . several knockdown studies have been done to assess the influence of different factors on the existence of pbs and on amd . for example , knockdown of xrn1 or dcp2 caused an accumulation of are mrnas in pbs and a decrease in degradation ( franks and lykke - andersen , 2007 ) , whereas the down - regulation of various components of 5 to 3 and 3 to 5 exonuclease systems also diminished the amount of amd ( lin et al . , 2007 ) . nevertheless , the results of these studies are not always complementary . gw182 is documented to be required for both pb formation ( yang et al . , 2004b ) and mirna activity ( rehwinkel et al . , 2005 ) . when the expression of gw182 is reduced , however , there is no observable effect on amd , even when a significant decrease in the number of visibly detectable pbs is seen ( stoecklin and anderson , 2007 ) . this highlights the fact that despite the ability of some aubps to interact with pb - associated decay enzymes , there is not adequate information to confirm a functional link between amd and the recruitment of are mrnas by pbs . there is also a mounting discussion over the role pbs play in repressing translation ( coller and parker , 2005 ; parker and sheth , 2007 ) , which is significant for both mirna effects and the roles of aubps . equally intriguing are observations showing that pbs can interact with sgs and that this interaction may be responsible for deciding the amd fate of target mrna ( kedersha et al . , 2005 ) . sgs were originally observed as localization centers for specific mrnas in cells exposed to heat shock ( nover et al . , 1989 ) . in mammalian cells , various environmental stressors can induce the formation of sgs ( anderson and kedersha , 2006 ) . sgs are believed to stabilize and block the translation of certain mrnas ( kedersha et al . , 2005 ; mazroui et al . , 2007 ) and then , when the stress is relieved , sgs may direct these mrnas either back to the polysome or to machineries responsible for their degradation ( anderson and kedersha , 2006 ; kedersha and anderson , 2007 ) . several rna binding proteins that have been shown to be essential for sg formation hur , ttp , and gap - sh3 binding protein , among other aubps , also accumulate in these foci ( gallouzi et al . , 2000 ; tourriere et al . , 2003 ; stoecklin et al . , 2004 although several pb components , such as dcp1/2 and gw182 , are not present in sgs , others , such as xrn1 , are ( anderson and kedersha , 2006 ) . additionally , overexpressing ttp and brf1 has been shown to cause stable interaction between pbs and sgs . is it possible that under stressful conditions , aubp - bound mrnas first localize to sgs and are then directed to pbs for decay ? the pb sg relationship has been further complicated after observations that the formation of pbs and sgs are independent ( kedersha et al . , moreover , some stresses that induce sg formation actually prevent both pb development and the decay of mrna ( mazroui et al . , 2007 ) . these results make it difficult to develop an unambiguous model regarding the cellular location of amd . similar localization issues are also a problem in developing a unified model for mirna - mediated repression ( filipowicz et al . , 2008 ) . when hur rescues mirna - repressed mrna , it does so by causing the mrna to leave pbs ( bhattacharyya et al . , 2006 ) . it was also reported that in the presence of mirnas , ago proteins are capable of dynamically associating with sgs , where these enzymes play a role in translation silencing but not in message decay ( leung et al . , 2006 ) . although the compositions and proposed functions of pbs and sgs may differ , there is much evidence that they are both involved in both amd and in mirna - mediated repression . as advances in the field of mrna decay are made , it is apparent that aubps are a crucial component of amd and that modification of aubps may regulate are mrna decay ( stoecklin et al . , 2004 ) . at the same time , the localization of amd - linked players is of great importance , and another potential complication in constructing a model for amd is the possibility that the granules discussed are more complex than they appear . with the observations that the formation of sgs can be initiated in an eif2 phosphorylation - dependent and -independent manner , it was proposed that different types of sgs may exist ( anderson and kedersha , 2006 ; mazroui et al . , 2006 ) . if true , then it is reasonable to hypothesize that different sgs can direct messages differently . this theory actually supports the various ways that sgs and pbs have been shown to interact . if there are various classes of sgs , then it would be reasonable to suspect that some support pb formation and amd , whereas others promote alternative functions . what are taken to be a type of sg at this time could ultimately be shown to exist primarily for the purpose of reinitiating translation of mrnas . ultimately , sgs may be implicated in the balance a cell mediates between survival and death after stress , and differing granule classes and interactions may transiently exist as the cell gauges its fate ( mazroui et al . , 2007 ) . similarly , although pbs and gw bodies were considered to be the same entity after their discovery , this conclusion may have been premature , as they may ultimately be distinct subsets of cytoplasmic bodies . it has been observed that gw bodies disappear with cell cycle arrest ( eulalio et al . , 2007 ) , whereas pbs remain ( vasudevan and steitz , 2007 ) . moreover , amd - linked players , such as the fxr1 and ago2 members of the mirna pathway , were originally thought to be components of pbs but have been shown to colocalize to gw bodies rather than dcp1-containing cytoplasmic foci ( vasudevan and steitz , 2007 ) . this may explain why pbs could be seen in yeast even though they do not have an analogue of gw182 ( ding and han , 2007 ) . even the recently proposed exosome granules , which may serve as a major site for amd , could be distinct from pbs ( lin et al . , 2007 ) . another important consideration is whether are mrnas are brought to these preexisting cytoplasmic granules or whether a concentration of amd - targeted mrna , bound to its various factors , is necessary for the formation of sgs or pbs . these discrepancies invite further investigation into the localization of amd . meanwhile , the relationship between amd and mirna - mediated decay warrants attention . not only are there similar aspects to the processes but the colocalization of certain players strongly supports an underlying coordination . ultimately , the details surrounding amd , that is , the players involved in mediating such decay , the mechanism , the timing , the localization , and its regulation , leave much mystery regarding this process . investigation into amd has so far demonstrated quite well the validity of the adage that the more one knows , the more one learns is left unknown . for a process linked to so many evolving fields , there is little doubt that the existing facts about amd may drastically evolve , all the while bringing us closer to appreciating exactly how such tight regulation of cell function can be dictated by a series of adenine / uridine repeats .

resistance exercise helps improve the strength of all the muscles of the body and can be performed continuously at any location . well - designed resistance exercise programs have been reported to effectively improve muscle strength and the ability to perform exercise , increase fat - free mass , and decrease body fat1 . the most important aspect of resistance exercise is identifying the appropriate intensity for the exercise , and repetition maximum ( rm ) is most frequently determined for identifying the appropriate intensity . during resistance exercises , 1rm should be changed depending on exercise intensities in order for the exercise to be effective2 . resistance exercise at 80% rm or higher are classified as muscle strengthening exercise , that at 75% rm as muscle strength exercise , and that at 60% rm as muscle endurance exercise . although resistance exercises at 7080% rm are effective for muscle strength enhancement in beginners , those at 85% rm or higher are effective for muscle strength enhancement in experts3 . however , resistance exercises performed without considering a participant s ability can result in injury . the degrees of muscle damage are similar during high- , medium- , and low - intensity resistance exercises4 . however , different degrees of muscle damage have been reported to occur according to the type of muscle resistance exercise , the degree of muscle contraction , and exercise load5 . based on the findings of studies on muscle damage , muscle fatigue , and changes in hormone levels after muscle resistance exercise , studies that aim to minimize side effects after exercise should be performed . vibrations of muscles before exercise have positive effects on motor skill improvement , and are used to increase the metabolic and blood flow rates of individuals in the fields of sports and rehabilitation6 . the effects of vibrations vary with frequency , and frequencies of 1550 hz have been reported to promote oxidation , increase oxygen uptake , help blood circulation , and raise skin temperature7 . one study reported that muscle pain reduced after stretching on a machine vibrating at a frequency of 35 hz before resistance exercises8 . another study with 20 adults showed that blood flow through the quadriceps femoris and gastrocnemius increased with the application of vibrations , which caused the inflow of blood into the muscles9 . additionally , a study reported that muscle pain and creatine phosphokinase ( cpk ) level decreased significantly with the application of vibrations at a frequency of 50 hz before treadmill exercise10 . although studies on the positive effects of vibrations on muscles have been performed , no study has evaluated the effects of vibrations before resistance exercise at different intensities on the levels of stress hormones . therefore , the purpose of the present study was to determine whether vibrations should be applied before resistance exercise by examining changes in stress hormones levels with the application of vibrations resistance exercises at different intensities . the present study included 18 healthy male subjects in their 20s , having less than 6 months of experience in weight training and residing in k city , south korea . the subjects were randomly divided into 1rm 50% group ( 50%rmg , n = 6 ) , 1rm 70% group ( 70%rmg , n = 6 ) , and 1rm 90% group ( 90%rmg , n = 6 ) . subjects in the 50%rmg had a mean age , height , and weight of 21.5 2.42 years , 170.2 6.68 cm , and 71.1 14.11 kg , respectively . those in the 70%rmg had a mean age , height , and weight of 22.3 2.40 years , 172.9 6.14 cm , and 70.5 7.23 kg , respectively . additionally , those in the 90%rmg had a mean age , height , and weight of 21.12 2.13 years , 172.1 5.35 cm , and 70.38 6.35 kg , respectively . the subjects voluntarily participated in the study after receiving explanations about the intent and purpose of the study . the three groups had no statistically significant differences of physical characteristic of subjects such as age , height , body weight and body fat ( p < 0.05 ) ; therefore , the groups were homogeneous . the smith squat exercise for resistance training was used to examine changes in the levels of stress hormones with the application of vibrations before resistance exercises at the following intensities : 1rm 50% ( maximum number of repetitions 30 ) , 1rm 70% ( maximum number of repetitions 1215 ) , and 1rm 90% ( maximum number of repetitions 34 ) . the subjects performed three sets of smith squats , and vibrations were applied for 1 min before each set . a vibratory apparatus sky life - sm290 ( maxton , korea ) capable of frequencies of 260 hz was used . the frequency was fixed at 30 hz , and vibrations were applied at knee flexion to sufficiently stimulate the quadriceps femoris and gastrocnemius . blood was collected at rest , immediately after exercise , and 24 h after recovery from exercise to analyze levels of the stress hormones epinephrine , norepinephrine , and dopamine . to examine changes in the levels of the stress hormones in each group , one - way repeated anova was performed using spss 20.0 for windows on the basis of the levels at rest in each group . all of the subjects understood the purpose of this study and provided written informed consent prior to their participation in the study in accordance with the ethical standards of the declaration of helsinki . epinephrine levels were significantly higher immediately after exercise than at rest in the 50%rmg ( p < 0.05 ) ; however , no significant changes were noted in these levels in the 70%rmg and 90%rmg . the levels of norepinephrine were significantly higher immediately after exercise than at rest in all the three groups ( p < 0.05 ) . however , no significant changes in the levels of dopamine were noted in any of the three groups ( table 1table 1.changes in stress hormones ( in pg / ml ) after the application of vibrations during resistance exercises at different intensitiesgroupat restimmediately after exerciseat 24 hours after exerciseepinephrine50%rm44.7 16.599.9 30.0 * 52.2 28.470%rm70.2 27.3112.3 48.062.7 20.390%rm56.5 13.868.5 26.659.6 30.4norepinephrine50%rm403.8 192.31196.1 659.6 * 362.0 156.670%rm466.9 174.01219.7 542.4 * 336.9 93.390%rm489.7 255.4815.6 434.4 * 295.6 89.5dopamine50%rm32.7 6.045.4 12.431.7 3.270%rm33.6 5.932.0 3.232.2 3.590%rm34.8 5.839.1 15.531.5 2.6 * statistically significant difference between rest ( p<0.05 ) ) . physiological stress in the body is determined by assessing changes in catecholamines and cortisol levels , and epinephrine and norepinephrine are considered representative catecholamines11 . epinephrine and norepinephrine levels increase when the sympathetic system is activated by physical activities . during exercise , epinephrine is secreted from the adrenal medulla and norepinephrine from the sympathetic terminal12 . the major function of epinephrine includes promoting glycogenolysis and lipolysis during energy metabolism , and norepinephrine is a precursor of epinephrine , which is secreted from the sympathetic terminal to function as a neurotransmitter . the arterial plasma levels of these two hormones are known to continuously increase with exercise time and intensity . epinephrine levels do not increase during low - intensity exercise not involving mental stress , and its levels increase when oxygen uptake rises to at least 60% of the maximum oxygen uptake . norepinephrine levels increase at exercise intensities that increase oxygen uptake to > 50% of the maximum oxygen uptake , and its levels have been reported to increase by up to six times those at rest during maximum intensity exercise13 . therefore , measurement of the levels of stress hormones help evaluate the degree of physiological stress in the body according to the intensity of resistance exercise , and enable the identification of changes in the levels after vibrations are applied . in the present study , epinephrine levels were significantly higher immediately after exercises than at rest in the 50%rmg ( p < 0.05 ) , and no significant changes in these levels were noted in the 70%rmg and 90%rmg . therefore , the application of vibrations at a frequency of 30 hz before the 70%rm and 90%rm resistance exercises did not result in significant changes in epinephrine levels immediately after exercise . the use of vibrations at frequencies of 2050 hz is recommended because vibrations at frequencies below 20 hz induce excessive relaxation of muscles and those at frequencies over 50 hz cause muscle pain14 . in general , vibration of muscles at 2545 hz is used to increase muscle strength and mass15 , and the application of vibrations has been reported to have positive effects on the muscle function recovery of delayed - onset muscle soreness16 . vibrations suppress interneuronal activities of the skin and spinal cord receptors that reduce pain signals crossing -exercise nerves and c fibers and instead cause the migration of these signals to the spinal cord and brain8 . in addition , vibrations have been shown to affect capillary vessels and reduce lactic acid levels9 , and a study has presented the mechanism underlying the activation of the neuromuscular system that may improve the ability of the neuromuscular system to function appropriately18 . the activation of muscle spindle receptors with vibrations has been reported to have positive effects not only on the directly stimulated muscles but also on the surrounding muscles.19 a study of 29 male subjects who ran downhill for 40 min reported that the levels of the inflammatory markers il-6 and histamine , as well as muscle pain in the femoral region decreased significantly in the group in which vibrations were applied before the run20 . on the basis of the results , vibrations of muscles before activities may help reduce epinephrine levels . in the present study , vibrations applied at a frequency of 30 hz before 70%rm and 90%rm resistance exercises suppressed increases in epinephrine levels immediately after exercise . in the future , studies on the effects of vibrations on muscles and the areas of application should be performed by using different intensities of resistance , frequencies of vibration , and physiological variables .

transient ischemic attacks ( tia ) typically present with neurological deficits such as loss of muscle power , reduced sensation , or loss of vision . symptoms such as involuntary movements are not generally regarded to be a feature of cerebral ischemic episodes . limb shaking tias are a rare form of tias that present as involuntary movements and often confused with focal motor seizures.[16 ] this distinction , however , is crucial as this form of tia is often an indicator of severe carotid occlusive disease and patients are at high risk of future stroke.[58 ] moreover , such attacks may be relieved by surgical revascularization procedures in selected cases . we present a case of limb shaking tia which responded to optimization of blood pressure control and discuss the clinical manifestations , diagnosis , and management of this condition . in april 2009 , a 71-year - old gentleman presented with a four - month history of difficulty in walking . while walking for short distances , which would vary , he used to develop involuntary jerky movements in his right leg . the episodes would last for 1 - 2 minutes and were relieved by rest either by sitting or lying down . during his visit he was having 3 - 4 episodes per day with significant disability . additionally , he also had two episodes of transient right hemiparesis lasting for 20 minutes with spontaneous improvement . his medical history revealed relatively well controlled diabetes and hypertension for last 20 years and he was a chronic smoker ( two packs per day for last 30 years ) . on examination his pulses were regular with blood pressure of 120/70 mm hg without any orthostatic hypotension . the carotid pulses were feeble bilaterally without any bruit and he had subtle right hemiparesis . walking for a short distance , he developed sudden tremulousness of the right leg with a tendency to fall towards his right . magnetic resonance imaging ( mri ) of brain revealed sub - acute infarcts in left periventricular region and centrum semiovale . mr angiography showed bilateral proximal internal carotid artery ( ica , 80 - 90% ) and bilateral vertebral artery stenosis [ figure 1 ] . these features suggested a diagnosis of limb - shaking transient ischemic attack ( tia ) or low flow tia . ( a - b ) mri brain ( axial section flair sequence ) showing infarcts in left periventricular region and centrum semiovale , ( c ) contrast mr angiography showing bilateral proximal internal carotid artery stenosis [ ( r ) ica arrowhead , ( l ) ica arrow ] the patient refused to undergo cerebral angiography and further intervention due to personal reservations about the risk of procedures . he was treated conservatively with anti - platelet and lipid - lowering medications . in view of possible low flow state he had significant reduction in the severity and frequency of attacks at resting blood pressure of 130 - 140/80 - 90 mm hg . recurrent , transient attacks of repetitive limb shaking are uncommon manifestations of cerebrovascular disease first described by miller - fisher in1962 . these are characterized by brief , arrhythmic , flailing or jerking movements of the leg or arm , and often misdiagnosed as focal seizures or movement disorder . as tias are traditionally believed to be associated with negative neurological symptoms , a diagnosis of tia is usually not considered in a patient presenting with episodic abnormal movements . however , there are important clinical clues which help in differentiating these episodes from the seizure : absence of loss of consciousness ; lack of aura ; absence of incontinence ; absence of tongue bite or a jacksonian march . the most important clinical clue is the precipitation of symptoms by maneuvers causing cerebral hypoperfusion ; such as arising from a bed or a chair , hyperextending the neck or hyperventilation ; and cessation after sitting or lying down . these features also help to differentiate it from various hyperkinetic movement disorders such as hemichorea - hemiballism , hemidystonia and focal myoclonus that may occur in association with ischemic vascular disease . limb shaking tias are associated with severe unilateral , and , more often , bilateral occlusive internal carotid artery disease resulting in low cerebral perfusion and ischemia - especially in the border zone areas of vascular territories . with activities that precipitate further the management involves improving cerebral blood flow by careful control of blood pressure and/or surgical revascularization . in several cases an improvement of symptoms has been reported after raising blood pressure only , like in our case . it is worthwhile to recognize this classical but rare neurological symptom and differentiate it from conditions like focal seizures or ischemic movement disorders . importantly , the timely treatment of the associated carotid artery occlusion may not only abolish the attacks in the patients but also reduce their risk of future stroke .

the late sodium current ( ina ) present in chf causes an intramyocardial calcium ( ca ) overload that results in diastolic dysfunction and microvascular compression that can worsen lv function ( 7 ) . ran binds to amino acid f1760 of the cardiac sodium channel 1.5 ( nav1.5 ) , thereby reducing the late ina . in a therapeutic concentration ( 6 mol ) , intramyocardial ca overload is reduced 50% . additionally , ran blocks neuronal sodium channel 1.7 ( nav1.7 ) in a strongly use - dependent manner via the local anesthetic receptor ( 8 , 9 ) . therefore , ran may directly alter function of the parasympathetic and sympathetic ( p&s ) branches of the autonomic nervous system ( ans ) . we postulated these actions of ran should result in favorable changes in lv function and p&s measures in chf . one hundred and nine systolic or diastolic , new york heart association ( nyha ) class 2 - 4 chf patients were included in this study . they were treated according to standard heart failure guidelines ( 10 ) . in an open - label fashion , patients were prescribed ranolazine ( ran , 1000 mg po - bid ) in addition to standard heart failure therapy ( ranchf , 41 systolic , 13 diastolic ) or no adjuvant therapy ( control , noranchf , 43 systolic , 12 diastolic ) , in an unblinded fashion . patient demographics are presented in table i. since patients were on maximally tolerated doses of beta - blocker and angiotensin - converting enzyme inhibitor ( ace - i ) or angiotensin receptor blockers ( arbs ) , only the diuretic dose was adjusted as needed . baseline 2d - echocardiograms were obtained and the lvef calculated as the average of the apical 2 and 4 chamber simpson s method ( 11 ) , and studies were repeated within 36 months ( mean follow - up for ranchf patients is 24.5 months and for noranchf 22.8 months , tab . the accuracy of the initial echocardiographic lvef was confirmed by being within 5 ejection fraction units ( efus ) of the lvef as measured by nuclear multigated acquisition . serial changes in any patient of 7 efus are considered clinically significant ( 12 ) . chf is classified as systolic or diastolic , rather than chf with preserved ( normal ) lvef or reduced lvef , because the ranchf group only had one subject with a normal lvef . p&s function in response to ewing challenges ( 14 ) was assessed noninvasively using the ansar medical technologies , inc . , p&s activity was computed simultaneously and independently based on concurrent , continuous time - frequency analyses of respiratory activity ( ra ) and heart rate variability ( hrv ) ( 15 - 16 - 17 - 18 - 19 ) . parasympathetic activity ( measured as the respiratory frequency area , rfa ) is defined as the spectral power within a 0.12 hz - wide window centered on the fundamental respiratory frequency ( frf ) in the hrv spectrum . frf is identified as the peak spectral mode from time - frequency analysis of ra . effectively , frf is a measure of vagal outflow as it effects the heart ( a measure of cardiovagal activity ) . sympathetic activity ( low - frequency area , lfa ) is defined as the remaining spectral power , after computation of rfa , in the low - frequency window ( 0.04 - 0.15 hz ) of the hrv spectrum . high sympathovagal balance ( sb = lfa / rfa ) is defined as a resting lfa / rfa ratio > 3.0 ( established in our laboratory by evaluating 260 healthy volunteers ) ( 11 ) . p&s activity was recorded from a standard autonomic test , including 5 minutes rest , 1 minute paced breathing ( 6 breaths / min ) , a valsalva challenge ( including a 15-sec valsalva maneuver ) and a quick stand followed by 5 minutes of quiet stand . the average sb reported is the average of the ratios recorded during the sampling period , not a ratio of averages ( 11 ) . cardiovascular autonomic neuropathy ( can ) was defined in standard fashion ( 20 , 21 ) , reflecting very low , resting rfa ( < 0.1 bpm ) ( 22 ) . high sb ( > 3.0 ) and can define a high mortality risk , including silent mi , sudden cardiac death and acute coronary syndrome ( acs ) ( 15 , 16 , 23 - 24 - 25 ) . p&s and hrv measures are correlated with outcomes . while the patient population is underpowered to make final health outcome assessments , we determined the occurrence of major adverse cardiac events ( mace ) , defined as cardiac death ( determined from hospital records or death certificates ) , heart failure hospitalization and ventricular tachycardia or fibrillation ( as determined by defibrillator therapy , or administration of intravenous amiodarone for arrhythmia termination ) alone or as a composite endpoint . continuous data were assessed for normality with normally distributed data analyzed using student t - tests and non - normally distributed data assessed using a mann - whitney test . dichotomous data were analyzed using the chi - square test or fischer s exact test . we determined that we needed 50 patients per group to have a sufficient sample size using an alpha of 0.05 , difference of means of 6 units and expected standard deviation of 15 units with a power of 80% . significance values are determined on the null hypothesis that pre- and posttreatment values are equal . one hundred and nine systolic or diastolic , new york heart association ( nyha ) class 2 - 4 chf patients were included in this study . they were treated according to standard heart failure guidelines ( 10 ) . in an open - label fashion , patients were prescribed ranolazine ( ran , 1000 mg po - bid ) in addition to standard heart failure therapy ( ranchf , 41 systolic , 13 diastolic ) or no adjuvant therapy ( control , noranchf , 43 systolic , 12 diastolic ) , in an unblinded fashion . patient demographics are presented in table i. since patients were on maximally tolerated doses of beta - blocker and angiotensin - converting enzyme inhibitor ( ace - i ) or angiotensin receptor blockers ( arbs ) , only the diuretic dose was adjusted as needed . baseline 2d - echocardiograms were obtained and the lvef calculated as the average of the apical 2 and 4 chamber simpson s method ( 11 ) , and studies were repeated within 36 months ( mean follow - up for ranchf patients is 24.5 months and for noranchf 22.8 months , tab . the accuracy of the initial echocardiographic lvef was confirmed by being within 5 ejection fraction units ( efus ) of the lvef as measured by nuclear multigated acquisition . serial changes in any patient of 7 efus are considered clinically significant ( 12 ) . chf is classified as systolic or diastolic , rather than chf with preserved ( normal ) lvef or reduced lvef , because the ranchf group only had one subject with a normal lvef . p&s function in response to ewing challenges ( 14 ) was assessed noninvasively using the ansar medical technologies , inc . , p&s activity was computed simultaneously and independently based on concurrent , continuous time - frequency analyses of respiratory activity ( ra ) and heart rate variability ( hrv ) ( 15 - 16 - 17 - 18 - 19 ) . parasympathetic activity ( measured as the respiratory frequency area , rfa ) is defined as the spectral power within a 0.12 hz - wide window centered on the fundamental respiratory frequency ( frf ) in the hrv spectrum . frf is identified as the peak spectral mode from time - frequency analysis of ra . effectively , frf is a measure of vagal outflow as it effects the heart ( a measure of cardiovagal activity ) . sympathetic activity ( low - frequency area , lfa ) is defined as the remaining spectral power , after computation of rfa , in the low - frequency window ( 0.04 - 0.15 hz ) of the hrv spectrum . high sympathovagal balance ( sb = lfa / rfa ) is defined as a resting lfa / rfa ratio > 3.0 ( established in our laboratory by evaluating 260 healthy volunteers ) ( 11 ) . p&s activity was recorded from a standard autonomic test , including 5 minutes rest , 1 minute paced breathing ( 6 breaths / min ) , a valsalva challenge ( including a 15-sec valsalva maneuver ) and a quick stand followed by 5 minutes of quiet stand . the average sb reported is the average of the ratios recorded during the sampling period , not a ratio of averages ( 11 ) . cardiovascular autonomic neuropathy ( can ) was defined in standard fashion ( 20 , 21 ) , reflecting very low , resting rfa ( < 0.1 bpm ) ( 22 ) . high sb ( > 3.0 ) and can define a high mortality risk , including silent mi , sudden cardiac death and acute coronary syndrome ( acs ) ( 15 , 16 , 23 - 24 - 25 ) . p&s and hrv measures are correlated with outcomes . while the patient population is underpowered to make final health outcome assessments , we determined the occurrence of major adverse cardiac events ( mace ) , defined as cardiac death ( determined from hospital records or death certificates ) , heart failure hospitalization and ventricular tachycardia or fibrillation ( as determined by defibrillator therapy , or administration of intravenous amiodarone for arrhythmia termination ) alone or as a composite endpoint . continuous data were assessed for normality with normally distributed data analyzed using student t - tests and non - normally distributed data assessed using a mann - whitney test . dichotomous data were analyzed using the chi - square test or fischer s exact test . we determined that we needed 50 patients per group to have a sufficient sample size using an alpha of 0.05 , difference of means of 6 units and expected standard deviation of 15 units with a power of 80% . significance values are determined on the null hypothesis that pre- and posttreatment values are equal . overall , 109 age- , gender- and history - matched chf patients already treated according to standard heart failure guidelines ( 10 ) were included in the study , with 54 patients receiving ran and 55 patients in the control group . demographic comparisons are provided in table i and are similar between groups : 93% of the patients are evenly divided between nyha class 2 and 3 ; 98% are on a beta - blocker ( noranchf subjects at a slightly higher dose ) . controls had no significant change in the mean lvef . when viewed dichotomously ( tab . iii ) , 26/54 ( 48% ) ranchf patients experienced a clinically significant increase in lvef ( +7 efu ) as compared to 4/55 controls ( 7% , p<0.001 , tab . 17/41 ( 41% ) subjects experienced a clinically significant increase ( > 7 efus ) in lvef as compared to 9/13 ( 69% ) diastolic ranchf patients ( p<0.001 ) . final lvef in cohort patients experiencing mace was significantly lower than in those who were mace - free ( tabs . iv and v , p = 0.005 ) . in the ranchf group mace subpopulation , the initial to final lvef increase was less than in patients without mace , 6 efus vs. 9 efus ( tab . systolic ranchf patients demonstrated a decrease in left ventricular internal dimension in systole ( lvids ) . diastolic ranchf patients demonstrated a slight increase in lvid - diastole ( lvidd ) coupled with a slight decrease in lvids . lvidd averaged 5.88 and 6.09 cm for systolic ranchf and noranchf patients , and 5.16 and 5.28 cm for diastolic ranchf and noranchf patients , respectively . lvids averaged 4.94 and 5.21 cm for systolic ranchf and noranchf patients , and 4.08 and 4.03 cm for diastolic ranchf and noranchf patients , respectively . ranchf vs. noranchf patients had significantly lower lvids at follow - up ( > 0.36 cm , p<0.001 , tab . ii ) . no significant differences ( p>0.050 ) in baseline or follow - up lvidd or lad occurred between experimental groups , although lad tended to decrease in the systolic ranchf cohort ( 4.6 to 4.3 cm , tab . arrhythmia - free , p&s studies were accomplished every 6 months for 95/109 ( 87% ) patients ; 13% of the patients ( 8 ranchf and 6 noranchf ) had arrhythmias precluding a complete assessment . while p&s measures are readable ( 26 ) , hrv analyses are contraindicated for arrhythmia ( 27 ) . the average ranchf patient demonstrated significant p&s responses to ran ( p0.050 ) , except for paced breathing rfa ( a parasympathetic stimulus ; p = 0.065 ) . the absolute and relative resting sympathetic changes from baseline to follow - up in the control patients were also significant . sympathetic activity remained high for cohort patients with events ( tabs . iv and v ) , even though sb demonstrated a relative decrease from 6.25 to 4.86 ( unitless ) . the high pre - ran sb ( higher than the ratio of the averages might suggest , tab . post - ran , these patients were found to no longer be in can and demonstrated an increase of 7 efus , on average ( p = 0.0002 ) . the change in rfa is well correlated with the changes in lvef ( p<0.001 ) . the exhalation to inhalation ( e / i ) ratio decreases ( not significant ) . the valsalva challenge responses are well correlated with the changes in lvef ( p<0.001 ) . follow - up , these patients demonstrated an average increase in sympathetic activity ( a normalized response ) as compared with rest , with improved standing bp . the stand responses are well correlated with changes in lvef ( p<0.001 ) . for noranchf cohort patients ( tab . v ) , the relative sympathetic measure ( sb ) increased ( p<0.05 ) . in the ranchf group without events ( tab . the patients without events started in balance ( normal sb ) and remained in balance . the pre- and post - ran resting p&s responses in both the subpopulations with and without events are significant ( p0.025 ) . the pre- and post - ran deep breathing parasympathetic measures ( rfa ) in both the subpopulations with and without events are significant ( p0.011 ) , but not the increases in e / i ratio ( p>0.321 ) . nearly half ( 14/27 ) of the pre - ran event patients demonstrated sw in response to stand , indicating orthostatic dysfunction . the pre- and post - ran autonomic responses to stand in both subpopulations are significant ( p0.045 ) . table v presents baseline and follow - up p&s measures and lvef in the noranchf patients with and without events . however , the net result was an increase in sb to above normal . only the e / i ratio change for the patients with events was significant ( p = 0.013 ) . the composite mace endpoint occurred in 17/54 ( 31.5% ) ranchf patients and 21/55 ( 38.2% ) control patients . when evaluated separately , each mace endpoint was lower in the ranchf patients . controls had no significant change in the mean lvef . when viewed dichotomously ( tab . iii ) , 26/54 ( 48% ) ranchf patients experienced a clinically significant increase in lvef ( +7 efu ) as compared to 4/55 controls ( 7% , p<0.001 , tab . 17/41 ( 41% ) subjects experienced a clinically significant increase ( > 7 efus ) in lvef as compared to 9/13 ( 69% ) diastolic ranchf patients ( p<0.001 ) . final lvef in cohort patients experiencing mace was significantly lower than in those who were mace - free ( tabs . iv and v , p = 0.005 ) . in the ranchf group mace subpopulation , the initial to final lvef increase was less than in patients without mace , 6 efus vs. 9 efus ( tab . systolic ranchf patients demonstrated a decrease in left ventricular internal dimension in systole ( lvids ) . diastolic ranchf patients demonstrated a slight increase in lvid - diastole ( lvidd ) coupled with a slight decrease in lvids . lvidd averaged 5.88 and 6.09 cm for systolic ranchf and noranchf patients , and 5.16 and 5.28 cm for diastolic ranchf and noranchf patients , respectively . lvids averaged 4.94 and 5.21 cm for systolic ranchf and noranchf patients , and 4.08 and 4.03 cm for diastolic ranchf and noranchf patients , respectively . ranchf vs. noranchf patients had significantly lower lvids at follow - up ( > 0.36 cm , p<0.001 , tab . no significant differences ( p>0.050 ) in baseline or follow - up lvidd or lad occurred between experimental groups , although lad tended to decrease in the systolic ranchf cohort ( 4.6 to 4.3 cm , tab . arrhythmia - free , p&s studies were accomplished every 6 months for 95/109 ( 87% ) patients ; 13% of the patients ( 8 ranchf and 6 noranchf ) had arrhythmias precluding a complete assessment . while p&s measures are readable ( 26 ) , hrv analyses are contraindicated for arrhythmia ( 27 ) . the average ranchf patient demonstrated significant p&s responses to ran ( p0.050 ) , except for paced breathing rfa ( a parasympathetic stimulus ; p = 0.065 ) . the absolute and relative resting sympathetic changes from baseline to follow - up in the control patients were also significant . sympathetic activity remained high for cohort patients with events ( tabs . iv and v ) , even though sb demonstrated a relative decrease from 6.25 to 4.86 ( unitless ) . the high pre - ran sb ( higher than the ratio of the averages might suggest , tab . post - ran , these patients were found to no longer be in can and demonstrated an increase of 7 efus , on average ( p = 0.0002 ) . the parasympathetic response to deep the change in rfa is well correlated with the changes in lvef ( p<0.001 ) . the exhalation to inhalation ( e / i ) ratio decreases ( not significant ) . the valsalva challenge responses are well correlated with the changes in lvef ( p<0.001 ) . follow - up , these patients demonstrated an average increase in sympathetic activity ( a normalized response ) as compared with rest , with improved standing bp . the stand responses are well correlated with changes in lvef ( p<0.001 ) . for noranchf cohort patients ( tab . v ) , the relative sympathetic measure ( sb ) increased ( p<0.05 ) . in the ranchf group without events ( tab . the patients without events started in balance ( normal sb ) and remained in balance . the pre- and post - ran resting p&s responses in both the subpopulations with and without events are significant ( p0.025 ) . the pre- and post - ran deep breathing parasympathetic measures ( rfa ) in both the subpopulations with and without events are significant ( p0.011 ) , but not the increases in e / i ratio ( p>0.321 ) . nearly half ( 14/27 ) of the pre - ran event patients demonstrated sw in response to stand , indicating orthostatic dysfunction . only six patients continued to demonstrate sw after history of ran . the pre- and post - ran autonomic responses to stand in both subpopulations are significant ( p0.045 ) . table v presents baseline and follow - up p&s measures and lvef in the noranchf patients with and without events . however , the net result was an increase in sb to above normal . only the e / i ratio change for the patients with events was significant ( p = 0.013 ) . the composite mace endpoint occurred in 17/54 ( 31.5% ) ranchf patients and 21/55 ( 38.2% ) control patients . when evaluated separately , each mace endpoint was lower in the ranchf patients . in the past 30 years , improvements in lv function and outcomes in systolic chf have been attributed to pharmacologic therapy addressing the neurohumoral paradigm , together with the advent of device therapy ( 1 - 2 - 3 - 4 - 5 - 6 ) . however , even more improvement is needed . this has triggered stem cell trials ( 28 ) and a search for new pharmacologic agents . it reduces the late sodium current ( ina ) resulting in a 50% reduction of the intramyocellular ca overload caused by the late ina via the na / ca exchanger ( 7 ) . this improves diastolic and microvascular dysfunction , and should result in improved lv systolic function ( 29 ) . since lvef is widely accepted as one of the most important prognostic indicators in chf ( 30 ) , we focused on its changes after ran was added to guideline - driven therapy . in therapeutic concentrations ( 2 - 6 mol ) , ran also inhibits neuronal nav1.7 via the local anesthetic receptor in a use - dependent fashion ( 8 , 9 ) . high sympathetic tone ( high sb ) with critically low parasympathetic activity ( can ) indicates high mortality risk , and has been associated with sudden cardiac death , chf and acs ( 15 - 16 - 17 - 18 - 19 , 31 ) . this study is the first to correlate chf outcomes with changes in both lvef and p&s measures . we found ran significantly increased lvef by 6.4 efus in systolic chf patients and 9.5 efus in diastolic chf ( tab . , final lvef fell 1 efu in the systolic chf patients and 0.5 efu in the diastolic chf patients ( tab . ranchf patients , the increase in lvef was solely due to a decrease in lvids ( tab . ranchf patients , the increase in lvef was due to a slight increase in lvidd ( suggesting increased diastolic filling ) coupled with a slight decrease in lvids ( suggesting improved systolic emptying ; tab . , only 1/54 ( 2% ) ranchf patients decreased lvef by 7 efus , and 26/54 ( 48% ) ranchf patients increased lvef by +7 efus , with the remaining 50% of patients showing little lvef change ( p<0.001 , tab . iii ) . increases in the ranchf patients lvef were sufficient to avoid defibrillator implantation in 10 subjects , resulting in substantial cost savings . in the control group , 8/55 ( 15% ) decreased lvef by 7efus , and only 4/55 ( 7% ) patients increased lvef by +7efus , with the remaining 43/55 ( 78% ) demonstrating little change ( tab . , lvef is more than 6 times as likely to increase and 1/8th as likely to decrease following ran therapy in chf patients . ran increased lvef by +7 efus in 17/41 ( 41.5% ) systolic chf patients vs. 9/13 ( 69% ) diastolic chf patients ( p<0.001 ) . furthermore , when ran increased lvef by +7 efus , 9/26 ( 35% ) patients had a history of cad , whereas 17/26 ( 65% ) did not ( p<0.001 ) . since almost 80% of the cad patients were revascularized , and only 14% had a positive stress test , we feel the smaller increases in lvef in cad patients were due to lv scarring secondary to remote myocardial infarctions . finally , whether or not lvef increased by +7 efus did not depend upon the maximum tolerated dose of beta - blocker ( 94% took carvedilol ) , as the mean daily dose differed by only 0.5 mg . autonomic ( p&s and hrv ) measures have been documented to be associated with lvef and cardiovascular risk ( 32 ) . ranchf patients demonstrated a decrease in sb from 2.42 to 1.98 ( p = 0.019 ) mainly resulting from a reduction in lfa , for example , a sympatholytic effect . this protection is at least in part due to a decrease in sb ( balance ) toward 1.0 indicating less sympathetic activity and a relative increase in parasympathetic activity ( 33 ) . and noranchf patients almost doubled their initially high - normal sb as a result of a marked increase in lfa with only a small increase in rfa , increasing the risk for mace . the ans responses to standing were more normal after ran , indicating improved ans function and reduced risk of orthostasis . orthostasis not uncommonly limits the doses of beta - blockers and ace - is / arbs chf patients can tolerate . conversely , noranchf patients on average displayed a more abnormal standing response during follow - up , resulting from a decrease in lfa ( sw ) consistent with worsening of ans function , increasing the risk for orthostasis . in contrast to the dramatic lfa changes noted in both groups , rfa ( parasympathetic ) activity changes were very small , consistent with the lack of significant changes in the time domain ratios , and can was not , on average , improved . the lack of a significant impact upon can means ran s reduction of sb might be an important mitigating factor reducing the cv risk of can . differences in ans measures in patients with or without events are presented in tables iv and v. while this study was an open enrollment ( nonrandomized ) trial and underpowered to make final health outcome assessments , we found a qualitative reduction in the composite endpoint of cardiac death , chf admissions and therapies for ventricular tachycardia and ventricular fibrillation ( vt / vf ) in the ranchf group . there was a 40% event reduction , with 57% fewer deaths , 60% fewer vt / vf therapies and 20% fewer chf hospitalizations . the initial lvef was lower in mace patients than in non - mace patients ( tabs . v and vi ) . only the ranchf group increased lvef during follow - up , and the increase was more in patients without events . iv ) was the same as the lvef increase of the entire systolic ranchf group ( tab . high sympathetic activity as indicated by high sb was more predictive of mace than a change in lvef . when sb was 2.5 or lvef was 0.32 , 81% or 79% of subjects , respectively , were mace - free ; when sb was > 2.5 , 59% of patients suffered mace vs. 50% of patients when lvef was < 0.32 . recently , it was proposed that diastolic chf be defined as chf with lvef0.50 ( 10 ) . had we used this definition , only one of our diastolic ranchf patients would have remained , increasing the systolic ranchf group to 50 patients . with a new definition of systolic chf requiring an lvef<0.50 ( instead of 0.40 ) , ran would have increased lvef +7 efus in 26/53 ( 49% ) systolic chf patients , an increase from the 14/41 ( 34% ) herein reported ( p<0.001 ) , with ran being the last add - on therapy . using spectral analysis of hrv to estimate cardiac sympathetic activity in chf has its limitations . the sinoatrial node becomes less responsive to norepinephrine and acetylcholine , so hrv decreases despite high norepinephrine levels ( 34 ) . sb reflects this modulation , and an sb>2.5 has a positive predictive value of 61% for mace . in comparison to iodine , metaiodobenzylguanidine ( mibg ) imaging to assess cardiac sympathetic activity , only 29% of chf patients with high mibg washout suffered mace within a mean follow - up of 31 months ( 35 ) . ran preserved or improved lvef during a 24 month follow - up period when added to guideline - driven therapy in chf . since lvef has long been considered one of the most important prognostic indicators in chf , and since ran seems free of the potentially harmful side effects of some of the agents that increase lvef ( such as catecholamines and phosphodiesterase inhibitors ) , ran has the potential to improve chf mortality and morbidity without significant adverse effects . reduced sympathetic tone ( lfa ) and sb were present in ranchf patients ; the lowest measures of both were in ran - treated patients without mace . when sb was 2.5 , only 19% of subjects experienced mace . high sb with low rfa ( < 0.1 bpm , defined as can ) is associated with increased mortality and morbidity risk . therefore measuring p&s function should improve our ability to risk - stratify our patients and adjust their management accordingly . periodic p&s measures have become just as a routine management tool in our chf patients as assessment of lvef or measurement of ( pro-)brain natriuretic peptide .

it is generally accepted that genomic instability , whether inherent or induced by external agents , is a primary event leading to neoplastic transformation in the multistep path of carcinogenesis . genomic instability in women with cervical carcinoma has been demonstrated using chromosomal abnormalities , sister chromatid exchange , micronuclei , single - cell gel electrophoresis assays , also known as the comet assay [ 4 , 5 ] . studies relying on the comet assay are of particular interest , because this method is simple and has been used extensively to detect dna damage at the single - cell level in genotoxic testing and biomonitoring under various circumstances . the comet assay in combination with fluorescence in situ hybridization is a tool for assessing the distribution of region- or locus - specific dna damage in the whole genome . although software - based analysis is the recommended method for the assessment of dna damage , visual scoring is also acceptable , as significant correlations have been detected between visual scoring and computer - based image analysis . moreover , visual scoring continues to be the method of choice for laboratories involved in the analysis of large numbers of samples , for example , biomonitoring studies . the principle of the comet assay is based on alterations found in dna such as strand breaks resulting in the extension of dna loops from lysed and salt - extracted nuclei , which , in turn , form a comet - like tail after either alkaline electrophoresis , indicating global dna damage ( ssb + dsb ) , or neutral electrophoresis , indicating dsb . the procedure for detecting ssb has been improved by performing a strong alkaline incubation during lysis and/or before and during the electrophoresis step . the original comet assay was carried out under neutral conditions but using relatively low doses , so the comet images were dependent on the relaxation of dna supercoiling by ssb . since dsb are 2540 times less frequently induced than ssb , much higher doses and strong lysis are employed for their detection by the neutral comet assay [ 11 , 12 ] . it is known that ssb can be induced by a number of agents , such as ultraviolet light , reactive oxygen species , and many mutagens , and that they can be easily and rapidly repaired , but do not pose a major threat to genomic integrity . by contrast , dsb represent the most dangerous damage inflicted by mutagens , because they are potent inducers of mutations and chromosomal abnormalities . this type of dna damage has not been studied comprehensively in women with cervical neoplasia . the aim of this hospital - based unmatched case - control study was to evaluate the global dna damage ( ssb + dsb ) and dna dsb in cervical epithelial cells in mexican women with low - grade squamous intraepithelial lesions ( lg - sil ) and with high - grade squamous intraepithelial lesions ( hg - sil ) using alkaline and neutral comet assays . this information helps build a better picture of the degree and type of dna damage present in these patients . the data analyzed in this study were collected during 2010 from unidad mdica de alta especialidad ( umae ) no . 23 of the instituto mexicano del seguro social ( imss ) in monterrey , mexico . written informed consent was obtained from all subjects and approval was given by the local centro de investigacin biomdica del noreste ( cibin ) , imss ethical committee . the study included 20 women diagnosed with different stages of cervical neoplasia and 10 control women . the average age of the patients was 39 11 years ( range , 2459 years ) , and that of the controls was 43 10 years ( range , 2957 years ) ; no significant age difference was found ( p > 0.05 ) . all women received a gynecological examination , at which time a papanicolaou ( pap ) smear was obtained using a cytobrush . a biopsy was taken if the examination revealed the presence of a macroscopic cancer lesion . all women who did not have macroscopic cancer lesions were examined using a colposcope and a biopsy was performed if indicated during the examination . pap smears were read and interpreted by a single pathologist according to the bethesda system of pap smear classification . another pathologist examined the biopsy according to the criteria of the international federation of gynecology and obstetrics ( figo ) . based on the results of the pap smears and colposcopy / biopsy , the women were classified into the following categories : 10 had lg - sil , 10 had hg - sil , and 10 were controls . none had a clinical history of chronic disease , such as diabetes mellitus , arterial hypertension , or another type of cancer . women with chronic infection , drug use ( including contraceptives ) , cigarette smoking , antioxidant intake , or radiation exposure ( within the preceding month ) were excluded from the study . hpv was detected and genotyped using the innolipa hpv genotyping kit ( microgen bioproducts ltd , surrey , uk ) . this kit detect all currently known high - risk hpv genotypes and probable high - risk hpv genotypes ( 16 , 18 , 26 , 31 , 33 , 35 , 39 , 45 , 51 , 52 , 53 , 56 , 58 , 59 , 66 , 68 , 73 , 82 ) as well as a number of low - risk hpv genotypes ( 6 , 11 , 40 , 43 , 44 , 54 , 70 ) and some additional types ( 69 , 71 , 74 ) . cytological specimens were collected from colposcopically abnormal areas ( patients ) and normal areas ( controls ) using a cytobrush . the samples were brought to the laboratory under cold conditions and were processed within 1 h of sampling to avoid artifact damage to dna . to perform the comet assay , the cell suspension of cervical epithelial cells was mixed with low melting - point agarose at 37c , to a final concentration of 0.7% . the mixture ( 15 l ) was pipetted onto slides pretreated with 0.5% normal - melting - point agarose , to retain the agarose cell suspension . the drop containing the cells was covered with a glass cover slip ( 24 mm 24 mm ) and left at 4c for 5 min . the slides were treated with a lysis solution containing 2 m nacl , 0.4 m tris - base , 1% sodium dodecyl sulfate , and 0.05 m edta , at room temperature for 30 min . after protein removal , the resultant nucleoids were washed in tbe buffer ( 89 mm tris , 89 mm boric acid , 2.5 mm edta , ph 8.3 ) for 10 min . the slides were treated with fresh alkaline solution ( 0.03 m naoh and 1 m nacl 0.9% ) for 2.5 min , to cleave the alkali - labile sites . the slides were placed horizontally on an electrophoresis tray that was filled with fresh alkaline electrophoresis solution ( 0.03 m naoh , ph 13 ) . electrophoresis was then performed on ice using an electric field of 23 v / cm for 12.5 min . after electrophoresis , the slides were gently removed from the tray and washed with neutralizing buffer ( 0.4 m tris - hcl , ph 7.5 ) for 5 min , and in tbe for 2 min . to detect dsb , the comet assay was adapted to neutral electrophoresis in tbe buffer at 23 v / cm for 2 min . all steps described previously were carried out in a dark room , to prevent the interference of additional dna damage . the slides were dehydrated in sequential baths of 70% , 90% , and 100% ethanol ( 2 min each ) and were then air dried . finally , the slides were stained with propidium iodide ( 1 g / ml ) in vectashield ( vector laboratories , burlingame , ca , usa ) . comets in the alkali assay revealed dna ssb + dsb and those in the neutral nondenaturing assay exhibited dna dsb . each experiment included two positive controls of sample from one woman without cancer ; cells treated with hydrogen peroxide at 20 m as dna ssb control and cells treated with the alui restriction enzyme as dna dsb control . hydrogen peroxide and alui produced pronounced dna ssb and dsb damage ( 92% and 84% of comet resp . ) , which confirmed the accessibility of the cells to the tested chemicals . the slides were examined at 400x magnification using an inverted fluorescence microscope ( ix70 ; olympus , tokyo , japan ) equipped with an excitation filter at 549 nm and a barrier filter at 590 nm and attached to a video camera ( olympus , tokyo , japan ) . the arbitrary units were obtained by one hundred comets scored , and for each comet was assigned a value of 0 to 3 according to its class ; 0 representing undamaged cells ( comets with no or barely detectable tails ) and 13 representing increasing relative tail intensities ( figure 1 ) . summing the scores ( 03 ) of 100 comets gives an overall score of between 0 and 300 arbitrary units . dna dsb were confirmed by dna breakage detection - fish ( dbd - fish ) on neutral comets . in this technique , cells are embedded in agarose microgels , lysed , and subjected to electrophoresis under nondenaturing conditions . subsequently , the neutral comets produced are exposed to a controlled denaturation step that transforms dna breaks into single - stranded dna regions , which are detected via hybridization with whole - genome fluorescent probes dna . for ssdna production , protein - depleted slides were incubated in an alkaline unwinding solution ( 0.03 m naoh , 1 m nacl ) for 2.5 min at room temperature . after neutralizing with 0.4 m tris - hcl , ph 7.5 , for 5 min , nucleoids were washed in tbe ( 89 mm tris , 89 mm boric acid , 2.5 mm edta , ph = 8.3 ) buffer for 2 min . for ssdna stabilization , slides were dehydrated in sequential 70% , 90% , and 100% ethanol baths for 2 min each , and then air - dried . whole - genome dna probes were obtained from lymphocyte pellets of women without cancer used a dna isolation kit for mammalian blood ( roche diagnostics corporation , indianapolis , in , usa ) . one microgram from dna sample was labeled with biotin-14 - 2-deoxyuridine 5-triphosphate ( dutp ) employing a commercial nick - translation kit ( roche diagnostics corporation , indianapolis , in , usa ) . after overnight incubation at room temperature , slides were washed twice at room temperature in each of 50% formamide/2 ssc , ph 7 , for 5 min , and then in 2 ssc , ph 7 , for 3 min . the hybridized dna probe was detected using 30 min incubation with rhodamine - labeled antidigoxigenin antibody ( roche diagnostics corporation , indianapolis , in , usa ) . the slides were counterstained with dapi ( 1 g / ml ) in vectashield ( vector laboratories , burlingame , ca ) . the fluorescence intensity and migration length values were calculated using image j version 1.4.3.67 image analysis software . the migration length of the dbd - fish signal is proportional to the number of dsb , whereas its fluorescence intensity depends on the number of ssb ( figure 2 ) . first , data were analyzed using levene 's test for variance , and one - way anova with the student - newmank - keuls test for multiple comparisons at the interpopulation level was used to investigate any possible differences between global dna damage and dsb damage in the three groups of women ( lg - sil , hg - sil , and control ) . second , a pearson correlation coefficient was using to determine the grade of relation between global dna damage and dsb damage levels and progression of cervical neoplasia . the sample size used for anova comparison of means was estimated using the minitab software ( version 15 ) for dna ssb damage ( = 0.05 , 1 = 0.80 , corrected sum of the squares of means = 371.85 , and sigma = 17.11 ) and dna dsb damage ( = 0.05 , 1 = 0.80 , = 3.43 , corrected sum of the squares of means = 171.17 , and sigma = 11.77 ) . the comet assay allowed the clear visualization of cervical epithelial cells with dna damage and of cells with no dna damage . the alkaline denaturing comet assay allowed migration of global dna damage ( ssb + dsb ) , whereas the neutral nondenaturing method permits the preferential migration of dna dsb . the morphology , percentage , and length of the tails of comets showed marked differences between the two methods used . tails were longer with the neutral method , and the percentage of cells showing comet formation was higher in the alkaline assay . the global dna damage ( ssd + dsb ) and dna dsb in the cervical epithelial cells of lg - sil , hg - sil , and controls , as assessed using alkaline and neutral comet assays , are presented in table 1 . anova one - way test revealed a significant increase in global dna damage and dna dsb was observed in patients with hg - sil compared with lg - sil and controls . the dna damage observed in controls was considered as normal - level or constitutive damage . pearson correlation coefficient revealed a strong relation between the levels of ssb and dsb ( r = 0.99 , p = 0.03 , and r = 0.94 , p = 0.16 resp . ) and progression of neoplasia ( tables 2 and 3 ) . dbd - fish signal on neutral comet is proportional to the number of dsb , whereas it depends on the number of ssb ( table 4 ) . all patients presented a high risk for hpv , with hpv-16 , hpv-52 , and hpv-51 being the more frequent . genetic instability in women with cervical cancer has been demonstrated previously based on chromosomal abnormalities , sister chromatid exchange , micronuclei , and single - cell gel electrophoresis assays [ 4 , 5 ] . evaluate the relationship between instability genetic and susceptibitly towards in cervical neoplasia patients with the alkaline comet assay . a significant increased was founded in the mean tail length in peripheral blood leukocytes and cervical epithelial cells of patients with dysplasia and cervical cancer respect to control group . recently we studied the association between the progressive stages of neoplasia cervical and dna damage by alkaline comet assay using visual scorning . an increase of high dna damage in cervical epithelial cells was found according to neoplasia development . the present study confirmed these observations , as it revealed significantly higher level of dna damage compared with control . in addition , we demonstrated a similar elevation in dna dsb in women with cervical neoplasia than was confirmed by dbd - fish . dbd - fish had a much higher resolution , showing a hybridization signal at the end of the tail that was not detected by dapi staining ( comet ) . thus , dbd - fish on neutral comets allows the easy and simultaneous estimation of both dna break types in the same nucleus . in fact , the present study was performed , analyzing the overall genome , using a whole genome probe . however , many different specific probes could be hybridized , with the possibility of simultaneous analysis of ssb and dsb induction . dna ssb are considered an indicator of early damage . moreover , dna ssb are intermediate processing products of dna damage , which , if left unrepaired , may develop into mutagenic and lethal dsb . by contrast , dna dsb are a more disruptive form of strand break , as , if left unrepaired , they can lead to either cell death or loss of genetic information , or , if the repair process is compromised , they may cause neoplastic progression . it is well established that inaccurate repair or lack of repair of dsb can lead to mutations or to larger - scale genomic instability via the generation of dicentric or acentric chromosomal fragments . furthermore , the loss and/or amplification of chromosomal material that is characteristic of many cancer cells is explained most easily as having arisen via inappropriate dsb repair events . defects in cellular responses to dsb may be a frequent initiating event of carcinogenesis . in view of these facts , our results confirmed other observations of a higher number of deletions , breaks , and gaps in these patients . one previous study suggests that inflammation may be involved in directing the course of disease progression by accumulating higher levels of dna lesions . the p-1 , pl-1 , pl-2 and l-1 ( p , polarity ; l , lipophilicity ; pl , adducts that are neither very polar nor lipophilic ; number , descending order of polarities ) adducts were elevated 3- to 13-fold in inflammation compared with normal cervix , and were also higher in dysplasia and cancer . perhaps , the association of hpv in dna breaks in patients with neoplasia , with and without hpv infection was not possible determinate . however in one previous study we demonstrated this association evaluated by micronuclei test . in this context , the possible mechanisms that could explain the progressive increase in genetic instability in these patients are related directly to hpv-16 infection . the hpv-16 e7 oncoprotein induces centrosome abnormalities , thereby disrupting mitotic fidelity and increasing the risk for chromosome missegregation and aneuploidy . in addition , expression of the high - risk hpv e7 oncoprotein stimulates dna replication stress , which is a potential source of dna breakage and structural chromosomal instability . an increase in the number of dsb , mediated by ku70 depletion , is associated with hpv-16 episomal loss in cervical keratinocytes and with a new integration event . normal levels of host dna repair proteins , including ku70 , may protect against such events by preventing the generation of host dsb and linearized virus . interestingly , the hpv-16 e7 protein may play a direct role in inducing integration by interference with the nonhomologous end joining ( nhej ) pathway . expression of hpv-16 e7 in the hpv - negative cervical keratinocyte cell line c33a resulted in the upregulation of the ku70-binding protein , which may interfere with normal nhej and increase the frequency of dsb . , 2009 reported that cigarette smoke condensate - mediated dna strand breaks are highly persistent , and suggest that persistence of cigarette smoke - associated dna damage in the presence of hpv infection may lead to increased mutations in cervical cells and ultimately higher cancer risk , however , in our study the status of smoking was not ascertained . from a clinical perspective , the presence of dna dsb , as assessed using the comet assay in neutral conditions , may differentiate patients with clinically significant cervical lesions from those with insignificant lesions , thus discriminating lesions with a high risk of progression from those with a low risk of progression . in conclusion , our results argue in favor of the presence of a real genomic instability in women with cervical neoplasia , which was strengthened by our finding of a higher proportion of dsb . this information should provide additional data to determine whether the comet assay is a useful early diagnostic and prognostic biomarker for cervical cancer .

periodontitis is defined as an inflammatory disease of the supporting tissues of the teeth caused by specific microorganisms or groups of specific microorganisms , resulting in progressive destruction of the periodontal ligament and alveolar bone with pocket formation , recession , or both . periodontal diseases are infections caused by dental plaque , but risk factors can modify the host response to microbial aggression . some of the known risk factors are diabetes , tobacco smoking , pathogenic bacteria , and microbial tooth deposits . smoking is a known risk factor for many diseases , and increasing evidence suggests that smoking adversely affects periodontal health . in fact , pindborg observed an association between acute necrotizing ulcerative gingivitis and smoking nearly 60 years ago . since then , various investigators have attempted to identify the role of tobacco smoking in the etiology of periodontal diseases . these studies suggest that smoking is a single , modifiable environmental risk factor responsible for excess prevalence of periodontal disease in the population and has a direct influence on periodontal variables . the 1996 world workshop in periodontics reviewed a number of studies and confirmed that smoking entailed an overall increased risk for severe periodontal disease and estimated overall odds ratio 2.82 . earlier investigators had attributed the increased prevalence and severity of periodontal disease seen in smokers to the greater presence of plaque and calculus than compared to nonsmokers . however , with the better understanding of the host response , evidence suggests that the effect of smoking on periodontal status is independent from the plaque index and oral hygiene of individual . smokers have been associated with deeper pockets and greater attachment loss , more pronounced radiographic evidence of furcation involvement , and increased alveolar bone loss . there is an established biologic rationale for the negative effect of smoking on periodontal tissues . it has an immunosuppressive effect on the host , adversely affecting host - bacterial interactions , and this alteration may be due to changes in the composition of subgingival plaque . smoking may also provide a conducive environment for some of the periodontopathic species in the plaque and may be one reason why smoking is a risk factor in periodontal disease development . smoking exerts a strong , chronic , and dose - dependent suppressive effect on gingival bleeding on probing . bleeding on probing was less evident in smokers than nonsmokers , indicating its effect on gingival blood vessels . the mechanism by which smoking suppresses gingival bleeding is not understood exactly . on the basis of the observation that smokers may present with a lower level of gingival inflammation , it has been speculated that the gingival blood flow in smokers may be less in comparison to nonsmokers . so , smoking is thought mainly to affect the periodontal tissues by way of the vascular and immunological response of the body . while there is overwhelming clinical evidence to associate smoking with destructive periodontal disease , the mechanisms that may predispose smokers to periodontitis remain to be fully elucidated . to explore more into the above facts , this study evaluated the clinical , microbiological and histopathologic changes in smokers and compared these to the nonsmokers . two hundred dentate male patients comprising hundred smokers and hundred nonsmokers all in the age group ranging between 2550 years were selected from among the patients referred to the department of periodontics at the oxford dental college hospital and research centre , bangalore . the subjects for the study were selected randomly taking into consideration only their smoking history . ethical clearance for the study was obtained from the research and ethical committee of the oxford dental college hospital and research center , bangalore . the following criteria were applied while selecting patients under smokers group ( test group ) : patient should have been smoking since three years or more . patient should not have been subjected to periodontal therapy or any antibiotic medication during the last 6 months . the criteria for choosing patients under nonsmokers group ( control group ) were as follows : subjects should not have smoked at anytime in their lives . patient should not have been subjected to periodontal therapy or any antibiotic medication during the last 6 months . exclusion criteria for both groups include female patients , former smokers , and aggressive periodontitis patients . the following data was also obtained from subjects belonging to smokers group : number of cigarettes or beedies consumed daily . a thorough periodontal examination was carried out under good artificial light , and parameters selected for the study were carefully recorded . however , the consistency and accuracy of measurement were randomly checked by another examiner so as to keep interexaminer variation negligible . plaque index of silness and loe , gingival index of loe and silness , bleeding index , and nidr calculus index were initially recorded . parameters such as pocket depth , clinical attachment loss , mobility , and furcation were recorded . the periodontal pocket depth and clinical attachment loss were recorded using a william 's periodontal probe . periodontal disease has often been described as site specific . since the mean scores may not reflect the severity of the problem clearly , it was decided to classify the probing depth sites into three groups as follows : sites showing < 4 mm of probing depth , sites showing 47 mm of probing depth , sites showing > 7 mm of probing depth . clinical attachment was classified under three groups as follows : sites showing attachment loss < 4 mm , sites showing attachment loss between 47 mm , sites showing attachment loss > 7 mm . numbers of teeth showing mobility , recession , and teeth with furcation were calculated separately . supragingival plaque in this site was carefully removed , and then , a curette is used to collect subgingival plaque . the adherent plaque from the curette is wiped onto the bana - impregnated strip found at the lower edge of the bana reagent card . an upper reagent strip containing evan 's black dye was then activated through dampening with distilled water , and the strip was folded at the perforation mark so that the lower and upper reagent strips come in direct contact with each other . after folding , the card was inserted into a slot on top of the bana incubator and incubated for 5 min at 35c . the light would operate during incubation and would automatically shut off once the heating cycle was completed . naphthylamide released due to the presence of any one of the bana - hydrolyzing bacterial species diffused into the upper reagent strip , where it reacted with the evan 's black dye to form a permanent blue - black colour . the test was considered positive if blue colour was visible on the upper reagent strip after incubation and was considered negative if no blue colour was visible . after the clinical examination and microbiological test , preparation was done to take biopsy of the interdental papilla between the lateral incisor and canine of the left side of the upper arch . the biopsy specimen was immediately transferred to a bottle containing 50% formo - alcohol ( 50 ml of 10% formalin and 50 ml of alcohol ) and kept for 24 hours for fixation . all the slides were viewed under compound microscope attached with a micrometer scale at 20x ( objective ) magnification to which a camera was attached . four views of each slide was then photographed with the scale adjusted for each photograph . numbers of inflammatory cells and blood vessel density ( number of blood vessels ) were estimated , and then , diameter of each vessel was measured using calipers . the diameter of blood vessels measured was then divided into three groups as : diameter < 4 mm ; 48 mm and > 8 mm . all the observations made were recorded on tables as per the criteria laid out and the data thus collected was subjected to extensive statistical analysis . chi - square and fisher exact test have been used to test the proportions of study parameters between nonsmokers and smokers . students t test ( two tailed , independent ) and mann - whitney u test have been used to find the significance of study parameters between nonsmokers and smokers . analysis of variance has been used to find the significant association of pack years and the study parameters . kruskal - wallis test ( a nonparametric ) has been used to find the significant association of pd and cal with pack years . the statistical software , namely , spss 11.0 and systat 8.0 were used for the analysis of the data and microsoft word and excel have been used to generate graphs , tables , and so forth . the mean age of nonsmokers was 35.10 7.14 and the mean age of smokers was 35.13 7.05 . 12 subjects had a smoking history of < 1 pack year , 50 subjects had a history of smoking for about 15 pack years , 24 of them for about 515 pack years , and 14 of them had a smoking history of > 15 years ( table 2 ) . the mean plaque index in smokers was 1.11 0.44 , whereas in nonsmokers it was 1.04 0.44 with p value of 0.258 . nonsmokers had a higher gingival index score of 0.86 0.41 than smokers who had a mean score of 0.62 0.31 . the difference was found to be statistically significant ( p 0.001 ) ( table 3 ) . the mean bleeding index in nonsmokers was 39.54 23.03 and of smokers was 28.53 17.52 . the mean calculus index in smokers was 1.62 0.36 as compared to 1.40 0.55 in nonsmokers . this difference showed statistical difference between the two groups ( p = 0.001 ) ( table 3 ) . comparison of pd between nonsmokers and smokers showed that 98.57% of sites in nonsmoker group had probing depth < 4 mm , whereas this was 97.22% in smokers group . the percentage of sites showing pd of 47 mm was 1.29 in nonsmokers and 2.58 in smokers . again , this was also statistically significant with p value of 0.009 . in both nonsmokers and smokers , few sites showed pd > 7 mm which was not statistically significant at p = 0.859 ( table 4 ) . the percentage of sites showing cal < 4 mm in nonsmokers was 3.52 and in smokers was 6.78 with p value of 0.004 which was highly significant . 3.29% of sites had cal of 47 mm in nonsmokers , and the same was 7.99% in smokers . the mean percentage of sites in nonsmokers with cal > 7 mm was 0.09 , and this value was higher in smokers of about 3.39% , which was again significant with p = 0.030 . the above results indicate that there was an increased attachment loss in smokers when compared to nonsmokers ( table 5 ) . smokers had significantly more teeth with mobility ( 29% ) when compared to nonsmokers ( 16.0% ) with p = 0.030 which was statistically significant ( table 6 ) . smokers had significantly more teeth with recession ( 79.0% ) when compared to nonsmokers ( 59.0% ) with p = 0.003 which was significant ( table 7 ) . smokers had significantly more teeth with furcation ( 68.0% ) when compared to nonsmokers ( 84.0% ) with p = 0.013 ( table 8) . the test was positive in 38% of subjects in nonsmokers and 36% of subjects who were smoking . the results showed no difference in microbiota in both the groups with p = 0.836 ( table 9 ) . number of inflammatory cells in nonsmokers was 64.70 12.68 and 52.00 9.79 in smokers . even though smokers had less cells than nonsmokers , this was not statistically significant ( p = 0.319 ) ( table 10 ) . blood vessel density in nonsmokers was 11.12 1.23 , and the density reduced in smokers , where it was 8.84 0.96 . this showed statistically similar results between the two groups ( p > 0.05 ) ( table 11 ) . so , blood vessel diameter 48 mm was significantly less in smokers ( p = 0.073 ) ( table 12 ) . vessels with this diameter were significantly similar in both the groups , as both the groups had 10 vessels in this category ( p > 0.05 ) ( table 13 ) . the periodontal parameters in smokers were then correlated with the number of pack years to evaluate the effects of chronic smoking . plaque index increased significantly with the increase in number of pack years ( p = 0.002 ) ( table 14 ) . gingival index did show a decrease as pack years increased to 15 years but later increased as pack years increased to more than 15 years with ( p = 0.577 ) ( table 14 ) . bleeding index decreased up to 515 years and then showed an increase when the pack years was > 15 years ( p = 0.237 ) ( table 14 ) . calculus index showed an increased value as pack years increased , which is suggestive of significance ( p = 0.058 ) ( table 14 ) . probing depth < 4 mm significantly decreased as pack years increased with p value of < 0.001 . probing depth of 48 mm significantly increased as pack years increased with p value of < 0.001 ( table 15 ) . clinical attachment loss < 4 mm , 48 mm and > 8 mm significantly increased as pack years increased with p = 0.005 , < 0.001 and < 0.001 , respectively ( table 15 ) . the global rise in the number of people addicted to smoking , and mortality and morbidity associated with it , has made smoking a major public health hazard . but the exact mechanism how smoking increases the severity for periodontitis is not fully understood . whether smoking causes a local effect on the periodontium or the systemic effects of smoking that causes periodontal disease is not known . this study was done to know the effects of smoking on the periodontium by studying the clinical , microbial , and histopathological parameters . to equate and nullify the effect of all other possible contributing factors , patients belonging to same age group ( 2550 yrs ) with no other known systemic problems were selected for the study . although some of the previous studies [ 3 , 7 , 14 , 15 ] included subjects who had quit smoking for a period of 25 yrs or more under the nonsmokers category , it was decided in this study to exclude former smokers in order to eliminate any long - term effect of smoking on periodontal tissues . females were purposely excluded from the study for the main purpose that it would have been difficult to recruit females who admit that they smoke . the other reason for excluding them was to avoid potential hormone - induced microcirculatory changes [ 1618 ] . since patients with any known systemic problems were not included , it was considered reasonable that comparisons made between smokers and nonsmokers group accurately reflected the influence of smoking on periodontium . patients were selected only on the basis of their smoking status and not depending on their periodontal status , as some previous studies [ 2 , 1921 ] selected patients who were diagnosed with periodontitis . this selection was mainly done as it was decided to study the relationship of smoking to periodontal health . the duration of smoking in the cases ranged from 3 to 30 yrs , which was later calculated into pack years . the oral hygiene status as depicted by plaque scores were almost similar in both the groups even though smokers had slightly higher scores that were not significant and this finding is in agreement with the other previous studies [ 2 , 3 , 2224 ] . contradicting these studies , one study concluded that poorer cleanliness found in smokers both before and after toothbrushing may be explained , in part at least , by their shorter tooth brushing time . there was significantly less gingival inflammation in smokers , which is in agreement with the earlier studies [ 22 , 32 , 3537 ] . suppression in smokers of the normally developing gingival inflammatory reaction associated with plaque provocation may be due to tobacco smoke products interfering with the vascular inflammatory response . it is therefore conceivable that such a constrictive action on gingival vessels would result in the suppression of vascular properties of inflammation such as bleeding , redness , and exudation . smoking has previously been shown to affect oral pmn leukocytes , indicating an impairment of pmn - function [ 38 , 39 ] . thus , smoking seems to influence both vascular and cellular properties of the inflammatory reaction . the suppression of vascular inflammatory reaction under the influence of smoking might then indicate an impairment of the defense mechanisms within the tissues and possibly render them more susceptible to plaque infection . these results are not in agreement with other studies [ 4042 ] , showing increased inflammation . some studies showed no differences in the inflammatory status between smokers and nonsmoker [ 32 , 43 ] . if , however , it is hypothesized that the inflammatory response of the gingiva is a clinical manifestation of the degree or capacity of the host to respond to irritation ( a postulate which has also been proposed by others ( page ) , then the present findings may be explained in the following manner . in smokers , what has been termed the lowered incidence rate may , perhaps , be better understood as a reflection of a reduction of the capacity of the host to mount an effective defence through the inflammatory process . it is possible that substances in tobacco smoke can reduce the capacity of microorganisms in plaque to produce irritants . consequently , the extent to which gingival inflammation occurs , and the extent to which it is necessary for the host to maintain an inflammatory response , might be less marked , yielding a lowered incidence rate . decreased inflammatory signs in the present study can be attributed to decrease in the number of inflammatory cells as shown histopathologically . smoking can drastically alter the typical presentation of gingivitis and periodontitis by masking the signs of inflammation . thus , the diagnosis of these diseases is made more difficult , yet the disease effects are worse . regarding bleeding on probing , this study is in agreement with other studies [ 33 , 4547 ] showing decreased gingival bleeding in smokers . traditionally , the reduced bleeding in smokers has been attributed to gingival vasoconstriction induced by the actions of nicotine - stimulated adrenaline and noradrenaline on 1-adrenergic receptors . however , the available evidence support this hypothesis in humans is not concluded , as smoking can cause vasodilatation in some tissues . contradicting these results , the results of the present study showed more calculus deposition in smokers agreeing with the results of the other studies [ 29 , 41 , 48 , 50 ] . it seems likely , therefore , that smoking primarily affects the mineralization rate rather than the formation rate of supragingival plaque . the reason why smoking is associated with an elevated risk for supragingival calculus deposition remains incompletely understood . it may exert its influence systemically via the saliva or locally via a conditioning of tooth surfaces to deposition , or both . it may be speculated that smoking causes a modification of the saliva resulting in elevated levels of calcium and possibly phosphorous . further , it can be considered that a reduced flow may cause elevation of the calcium and phosphate concentrations . thus , paradoxically , smoking might promote the calcification of subgingival plaque notwithstanding its suppressive action on some inflammatory events . this may have accounted for greater calculus scores in smokers [ 51 , 52 ] . chen et al . have shown no difference in the calculus deposition in their 10-year longitudinal study . there were no significant difference in periopathogens in this study as confirmed by bana although this contradicts the study by kazor et al . who showed a positive relation between bana pathogens and smoking . but in the present study , only one plaque sample from deepest pocket depth irrespective of diseases activity was considered . this is in agreement with the other earlier studies showing no difference [ 5559 ] . few other studies showed difference in the subgingival microflora [ 18 , 43 , 60 , 61 ] , but the microbial analysis varied . there are problems associated with microbiological investigations of the oral flora that may affect the interpretation of the results of the studies . sampling methods vary widely , and , together with undoubted differences from site to site within the mouth , such variations may affect the results of studies . identification of organisms by different methods such as culture- , immunofluorescence- , and dna - based techniques gives rise to potentially different outcomes . under these circumstances , it was imperative that studies with adequate numbers of subjects were performed in order to overcome the background of extreme variation , which will potentially mask the effects of smoking on the oral microflora . of those that appear to satisfy these requirements , some early studies tended to show no differences however , there are now a number of studies that suggest a trend for smokers to harbour more or greater numbers of potential periodontalpathogens than nonsmokers without increasing the amount of plaque . this undoubtedly supports the attractive hypothesis that a significantly different subgingival environment in smokers , related to an altered immune response , should result in a different microflora . further investigation with the latest methods is still required to confirm that such differences are directly related to smoking . smokers showed a reduced blood vessel density compared to nonsmokers contradicting other studies [ 6264 ] who showed no difference . the suppressive effect on the vasculature can be observed through less gingival redness , lower bleeding on probing , and fewer vessels visible clinically and histologically . blood vessel diameter showed no difference in blood vessels with diameter of < 4 mm and > 8 mm . only the in - between categories 48 mm significantly were less in smokers , explaining the vasoconstrictive effect of smoking on few blood vessels . while it is difficult to compare the results of baab and oberg , meekin et al . , and mavropoulos et al . to the present study because of the variations in study design , including the smoking habits and other characteristics of the study population , the methods employed to analyse the data , and the lack of control group in studies by baab and oberg and mavropoulos et al . , it would be difficult to conclude that smoking causes gingival vasoconstriction . other studies have also shown deeper pockets [ 2 , 3 , 24 , 26 , 30 , 33 ] . the present study showed increased attachment loss and this increased as the years of smoking increased . studies by kamma et al . , calsina et al . , and gunsolley et al . are in agreement with the present study showing increased gingival recession in smokers , whereas the study by muller et al . found no difference and did not support the hypothesis that smokers have more gingival recession . smokers had more teeth furcation involvement and mobility , and this have been earlier confirmed by kerdovongbundit and wikesjo , bergstrm , and calsina et al . . the present study showed that smokers have more severe periodontal disease than non - smokers and that it has a strong , chronic , dose - dependent effect on periodontium . tobacco smoking , mostly in the form of cigarette smoking , was recognized as the important environmental risk factor in periodontitis . tobacco smoking affects the oral environment and ecology , the gingival tissues and vasculature , the inflammatory response , the immune response , and the homeostasis and healing potential of the periodontal connective tissues . while there is overwhelming clinical evidence to associate smoking with destructive periodontal disease , the mechanisms that may predispose smokers to periodontitis remain to be fully elucidated . it was also apparent that while smoking may suppress gingival angiogenesis , the mechanisms by which cigarette smoking dampens periodontal inflammation are not yet fully understood . the findings of the present study emphasizes that periodontal tissue in smokers are affected more than the controls with minimal signs of inflammation . the best way to prevent periodontitis in smokers is by enrolling the subjects in smoking cessation programmes , and so , it is an obvious implication that smoking prevention should be included in dental public health education by advocating , advising , and facilitating smoking cessation programmes among the patients .

health sector is labor intensive where service quality and efficiency are directly influenced by workers satisfaction , motivation and health worker 's willingness to apply resources to the task at work place . job satisfaction has been defined as a pleasurable emotional state resulting from the appraisal of one 's job , an affective reaction to one 's job and an attitude toward one 's job . according to locke 's range of affect theory ( 1976 ) satisfaction is determined by a discrepancy between what one wants in a job and what one has in a job . it is well - known fact that human resource management issues are the most essential component for better and effective implementation of health activities and providing the quality health - care . provision of adequate infrastructure , funds and health personnel to manage the health sector may not lead to desired results and output in the health sector . factors such as availability of resources and technical competency of staff are not sufficient in themselves to produce desired work behavior . it is felt that core components of information necessary for what satisfies and motivates the health work force in our country is missing at policy making at the government level . if health providers are not satisfied then desired goals and targets of health programs will not be achieved by the system . to achieve the quality health - care the provider 's level of satisfaction has to be achieved . the human resource ( hr ) in the health - care system is unique in the sense that they are not just employees , but the provider of quality health - care where the human touch is also required for patient care . therefore present study will help us to know the job satisfaction among primary health - care ( phc ) providers in the public sector dispensaries and primary urban health center 's ( puhcs ) in delhi . the findings would also raise policy makers and manager 's awareness level and may help them to improve the level of job satisfaction of phc providers . study was conducted in the public sector dispensaries / puhcs in state of delhi in 2011 . phc providers are those who are dealing with beneficiaries ( patients ) i.e. , the medical officers ( mos ) , auxiliary nurse midwives ( anms ) , pharmacists , lab assistants ( las)/lab technicians ( lts ) . after going through , the manpower patterns of dispensaries it is learnt that on average one mo , two pharmacists , 2 - 3 anms are posted in each dispensary , but lt or la are not available in each dispensary . out of which 20% dispensaries ( 45 dispensaries ) had been chosen randomly . from these health - care providers with more than 6 month of job are included in the study . the questionnaire was designed after intensive review of the literature for job satisfaction in the health sector and standard job satisfaction tools available from other countries , but tools developed in other countries were not culture free and fair . therefore , 25 item ( job satisfaction statements ) job satisfaction tool was developed based on indian conditions and tested in the field for the understanding by the study population . the questionnaire was divided into three parts ; part 1 : background characteristics of health - care provider ; part 2 : job satisfaction statements ( five point likert scale ) ; part 3 : intrinsic job motivation items ( five point likert scale ) . among 45 dispensaries questionnaire ; 39 moss ( response rate 78% ) , 106 anms ( response rate 70.6% ) , 45 pharmacists ( response rate 64.2% ) and 37 lts / las s ( response rate 67.2% ) had given the response . for internal consistency of job satisfaction scale crohnbach 's alpha was calculated ( 0.836 ) , according to george and mallery alpha value of more than 0.7 is acceptable for the scale . data was collected , computed , coded and analyzed by using spss version 18 developed by ibm corporation . scoring of job satisfaction items and intrinsic job motivation was carried out at a scale of 1 to 5 . score 1 was given to highly dissatisfied and score 5 was given to highly satisfied respondents . mean scores and standard deviation for the job satisfaction and intrinsic job motivation among the study populations was calculated . relevant statistical student 's t - test , analysis of variance and factor analysis was performed . study was conducted in the public sector dispensaries / puhcs in state of delhi in 2011 . are those who are dealing with beneficiaries ( patients ) i.e. , the medical officers ( mos ) , auxiliary nurse midwives ( anms ) , pharmacists , lab assistants ( las)/lab technicians ( lts ) . after going through , the manpower patterns of dispensaries it is learnt that on average one mo , two pharmacists , 2 - 3 anms are posted in each dispensary , but lt or la are not available in each dispensary . out of which 20% dispensaries ( 45 dispensaries ) had been chosen randomly . from these , health - care providers with more than 6 month of job are included in the study . the questionnaire was designed after intensive review of the literature for job satisfaction in the health sector and standard job satisfaction tools available from other countries , but tools developed in other countries were not culture free and fair . therefore , 25 item ( job satisfaction statements ) job satisfaction tool was developed based on indian conditions and tested in the field for the understanding by the study population . the questionnaire was divided into three parts ; part 1 : background characteristics of health - care provider ; part 2 : job satisfaction statements ( five point likert scale ) ; part 3 : intrinsic job motivation items ( five point likert scale ) . among 45 dispensaries questionnaire informed consent was taken . out of 45 dispensaries ; 39 moss ( response rate 78% ) , 106 anms ( response rate 70.6% ) , 45 pharmacists ( response rate 64.2% ) and 37 lts / las s ( response rate 67.2% ) had given the response . for internal consistency of job satisfaction scale crohnbach 's alpha was calculated ( 0.836 ) , according to george and mallery alpha value of more than 0.7 is acceptable for the scale . data was collected , computed , coded and analyzed by using spss version 18 developed by ibm corporation . scoring of job satisfaction items and intrinsic job motivation was carried out at a scale of 1 to 5 . score 1 was given to highly dissatisfied and score 5 was given to highly satisfied respondents . mean scores and standard deviation for the job satisfaction and intrinsic job motivation among the study populations was calculated . relevant statistical student 's t - test , analysis of variance and factor analysis was performed . the total health - care provider 's involved in the study are 227 , which includes 39 moss , 106 anms , 45 pharmacist and 37 are las / lts . as shown in the table 1 ; majority of mos ( 43.6% ) are in the age of 35 - 45 years whereas 51.4% las / lts are in the age group of 25 - 35 years . among the mos majority ( 71.8% ) are graduates and 28.2% are post - graduates . among the anms 67.9% are undergraduates and 29.2% are graduates . among the pharmacists 64.4% are graduates . among mos majority ( 46.2% ) have 5 - 15 years of job experience , whereas majority of anms ( 51.9% ) have up to 5 years of job experience [ table 1 ] . background characteristics of the health - care providers in dispensaries / puhcs job satisfaction is the degree , to which a health worker reports satisfaction with different features of their job in the dispensaries / puhcs . i am very much satisfied. analysis of study reveals that anms are more satisfied than mos , pharmacists and las / lts ; and the difference is significant ( p < 0.000 ) , mos and pharmacist have almost same level of job satisfaction ( mean score 3.0 ) but las / lts are more satisfied than mos ( mean score of las / lts is 3.1 and mos is 3.0 ) , but the difference is not significant . difference in job satisfaction between pharmacists and las / lts is also non - significant ( p = 0.725 ) [ tables 2 and 3 ] . job satisfaction mean score and sd in four groups of primary health - care providers t - test between job satisfactions of different groups of primary health - care providers age of health - care providers do nt show any significant difference in job satisfaction ( f = 1.213 ; p = 0.306 non - significant ) [ table 4 ] . one - way anova ; job satisfaction of health - care providers in different age group education level of health - care providers also not showing any significant difference in job satisfaction in the present study ( f = 1.876 ; p = 0.156 non - significant ) [ table 5 ] . one - way anova ; job satisfaction of health - care providers according to education level female health - care providers ( mean score 3.3 ) are more satisfied than male ( mean score 3.0 ) and the difference is significant at 0.01 level [ table 6 ] . t - test ; job satisfaction of health - care provider 's according to gender in the present study , duration of job ( experience ) has no effect on job satisfaction variation as f value is 0.772 , p is 0.468 ( non - significant ) [ table 7 ] . one - way anova ; job satisfaction of health - care providers according to duration of job ( experience ) as shown in table 8 ; the mean score of physical working condition of entire study population was 3.2 and the score were low among all the study population particularly pharmacists having a score of 2.8 . the mean score for salary and allowances for the entire population are 2.7 ( dissatisfied ) ; anms and las / lts are maximally dissatisfied with salary and allowances they get . all the health - care providers are dissatisfied from the material and means of working in the dispensary and facilities of water supply , condition of toilets , sitting space they get for working . all the health - care providers are dissatisfied from the training policies and practices in the organization . dissatisfaction is more among mos ( mean score 2.6 ) and las / lts ( mean score 2.5 ) . the way officers work and their work is not appreciated by seniors in the organization mean score for mos is 2.9 , means they are dissatisfied . score for the opportunity for professional advancement in the organization are low for all categories of health - care providers . majority of variables studied for job satisfaction has low scores [ table 8 ] . mean score of sub variables studied for job satisfaction in dispensaries / puhcs intrinsic job motivation defined as the degree to which a job holder is motivated to perform well in his work because of his inner drives . score 1 was given to response no , i strongly disagree , score 2 was given to no , i disagree , score 3 was given to i am not sure about this , score 4 was given to yes , i agree and score 5 was given to yes , i strongly agree . in the present study intrinsic job motivation was assessed by modified tool of warr , cook and wall ( 1979 ) and it is measured on a 5 point likert scale . however , score for individual providers are 4.0 for mos , anms and las / lts . this means intrinsic job motivation is present in the study population [ tables 9 and 10 ] . intrinsic job motivation among primary health - care providers in dispensaries / puhcs mean scores of sub variables for intrinsic job motivation of primary health - care providers factor analysis was done using spss package developed by ibm corporation version 18 . kaiser - meyer - olkin measure of sampling adequacy was 0.793 , which means sample size was adequate for factor analysis . method used for factor analysis was the principal component analysis and rotation method used was the varimax with kaiser normalization . five factor were identified concerned with job satisfaction in factor analysis as shown in table 11 . job satisfaction is the degree , to which a health worker reports satisfaction with different features of their job in the dispensaries / puhcs . i am very much satisfied. analysis of study reveals that anms are more satisfied than mos , pharmacists and las / lts ; and the difference is significant ( p < 0.000 ) , mos and pharmacist have almost same level of job satisfaction ( mean score 3.0 ) but las / lts are more satisfied than mos ( mean score of las / lts is 3.1 and mos is 3.0 ) , but the difference is not significant . difference in job satisfaction between pharmacists and las / lts is also non - significant ( p = 0.725 ) [ tables 2 and 3 ] . job satisfaction mean score and sd in four groups of primary health - care providers t - test between job satisfactions of different groups of primary health - care providers age of health - care providers do nt show any significant difference in job satisfaction ( f = 1.213 ; p = 0.306 non - significant ) [ table 4 ] . one - way anova ; job satisfaction of health - care providers in different age group education level of health - care providers also not showing any significant difference in job satisfaction in the present study ( f = 1.876 ; p = 0.156 non - significant ) [ table 5 ] . one - way anova ; job satisfaction of health - care providers according to education level female health - care providers ( mean score 3.3 ) are more satisfied than male ( mean score 3.0 ) and the difference is significant at 0.01 level [ table 6 ] . t - test ; job satisfaction of health - care provider 's according to gender in the present study , duration of job ( experience ) has no effect on job satisfaction variation as f value is 0.772 , p is 0.468 ( non - significant ) [ table 7 ] . one - way anova ; job satisfaction of health - care providers according to duration of job ( experience ) as shown in table 8 ; the mean score of physical working condition of entire study population was 3.2 and the score were low among all the study population particularly pharmacists having a score of 2.8 . the mean score for salary and allowances for the entire population are 2.7 ( dissatisfied ) ; anms and las / lts are maximally dissatisfied with salary and allowances they get . all the health - care providers are dissatisfied from the material and means of working in the dispensary and facilities of water supply , condition of toilets , sitting space they get for working . all the health - care providers are dissatisfied from the training policies and practices in the organization . dissatisfaction is more among mos ( mean score 2.6 ) and las / lts ( mean score 2.5 ) . the way officers work and their work is not appreciated by seniors in the organization mean score for mos is 2.9 , means they are dissatisfied . score for the opportunity for professional advancement in the organization are low for all categories of health - care providers . majority of variables studied for job satisfaction has low scores [ table 8 ] . mean score of sub variables studied for job satisfaction in dispensaries / puhcs intrinsic job motivation defined as the degree to which a job holder is motivated to perform well in his work because of his inner drives . score 1 was given to response no , i strongly disagree , score 2 was given to no , i disagree , score 3 was given to i am not sure about this , score 4 was given to yes , i agree and score 5 was given to yes , i strongly agree . in the present study intrinsic job motivation was assessed by modified tool of warr , cook and wall ( 1979 ) and it is measured on a 5 point likert scale . the mean score for intrinsic job motivation for the total study population is 3.9 . however , score for individual providers are 4.0 for mos , anms and las / lts . this means intrinsic job motivation is present in the study population [ tables 9 and 10 ] . intrinsic job motivation among primary health - care providers in dispensaries / puhcs mean scores of sub variables for intrinsic job motivation of primary health - care providers kaiser - meyer - olkin measure of sampling adequacy was 0.793 , which means sample size was adequate for factor analysis . method used for factor analysis was the principal component analysis and rotation method used was the varimax with kaiser normalization . five factor were identified concerned with job satisfaction in factor analysis as shown in table 11 . hr is the essential element of a health system and hr is an important organizational asset . the mean score of physical working condition for health - care providers were low among all the study population particularly pharmacist having a score of 2.8 . similar findings were reported in the study conducted in employees state insurance ( esi ) dispensaries where doctors were dissatisfied with working conditions of dispensaries . in the present study providers are dissatisfied with the salary and allowances they are getting in the organization . the response that job satisfaction is dependent on income has been suggested by kaur and singh . world health organization has also identified low salaries as a major reason for low motivation and job dissatisfaction and which can lead to migration in health - care providers . study by soeters and griffiths has focused that performance based financial incentives for health staff led to better health services , increased productivity in the health sector . health - care providers in the study population are dissatisfied from the material and means of working in the dispensary and facilities of water supply , condition of toilets , sitting space and also from the training policies and practices in the organization . providers are not getting appreciation of their work . according to herzberg theory recognition of work is a very important satisfier and motivator . workers at all levels of organization wish to be recognized for their achievement on the job . study by dieleman et al . suggested a positive correlation between recognition and job satisfaction . many earlier studies found recognition of work by seniors , peer group and patients as the major motivator for health - care providers . according to pestonjee and mishra organizations where people lack trust in co - workers pharmacists and las / lts do not have any scope for professional advancement in the organization leading to dissatisfaction . earlier studies state that promotions constitute important aspect of health - care provider 's career mobility . promotions results in increase in salary and raises health - care provider to a higher level . hertzberg in his two factor theory emphasized the fact that opportunities for growth and advancement are strong motivators and hence lead to job satisfaction . majority of providers reports that there is no learning for new skills at the work place , which leads to de - motivation of workforce . health - care providers are dissatisfied on the issue of getting official instruction and information about the job in time . earlier studies report that those organizations , which handled the grievances of their work force efficiently had more satisfied workforce . study conducted in gujarat by cbhi , mohfw also highlighted dissatisfaction in gujarat by medical staff . it can be stated that job satisfaction is a multidimensional phenomenon where it is not easy to assign a single factor as a sole determinant of satisfaction with the job . for job satisfaction number of factors operates at the same time . as suggested by maslow and hertzberg association exists between job satisfaction and motivation . in the present study , pearson correlation coefficient was calculated and it was found that no correlation exist between job satisfaction and intrinsic motivation of health - care providers ( r = 0.125 ; p = 0.06 ) . therefore , present findings are against the earlier theories . age of health - care providers does nt show any significant difference in job satisfaction . studies performed by bowen et al . reported that older staff tends to have more job satisfaction than younger ones . fulfillment of higher order need with increasing age and getting senior position can account for higher satisfaction levels reported by clark et al . education level of health - care providers does nt show any significant difference in job satisfaction in the present study . female health - care providers are more satisfied than male . in the present study , research carried out by bowen et al . , bretz and judge , boltes et al . [ table 11 ] reveals five factor , which have bearing on the job satisfaction ; which are ; organizational facilities , interpersonal relations in the organization , policies and practices of the organization , organizational working climate and job privileges . job satisfaction is poor for all the four groups of health - care providers in dispensaries / puhcs and it is not possible to assign a single factor as a sole determinant of dissatisfaction in the job . recommendations emerging out of the study are at the policy level as well as at the dispensary / puhc level . at the policy level ; improving the physical working conditions of dispensaries , introduction of performance based incentives , framing of transfer and training policy for the organization , job rotation of health - care providers from dispensaries to hospitals , career growth potential in the job are the required actions at the policy level . at the dispensary level ; proper distribution of work , job clarity , recognition and appreciation of good work performed by paramedical staff , job enrichment and timely dissemination of information / instructions in the dispensaries are the actions at the dispensary level . finally , it is recommended that appropriate changes are required at the policy level as well as at the dispensary / puhc level to keep the health work force motivated under public sector in delhi .

the authors ' affiliations were published as : neil z miller , independent researcher , santa fe , new mexico , usa gary s goldman , independent computer scientist , pearblossom , california , usa however , for the purposes of this publication the correct affiliations are as follows : neil z miller , think twice global vaccine institute , usa gary s goldman , computer scientist , pearblossom , california , usa the authors would like to make the following declaration at this time : neil z miller is associated with the think twice global vaccine institute. gary s goldman has not been associated with the world association for vaccine education ( wave ) for more than four years but was , at the time of publication of the article , still listed as a director for it on the wave website . the national vaccine information center ( nvic ) donated $ 2,500 and michael belkin made a personal donation of $ 500 in memory of his daughter lyla towards the sage choice open access fee for this article .

unilateral cerebral palsy ( u - cp ) is the most common type of cerebral palsy ( cp ) , with an incidence of 1 in 1000 live - births . typically , the upper limb ( ul ) is more involved than the lower , with impairments of spasticity , sensation , and reduced strength . effective use of the arm and hand to reach , grasp , release , and manipulate objects is often compromised . children with hemiplegia usually have the intellectual capacity to attend regular school ; however , impaired arm function restricts their participation in educational , leisure , and later vocational roles . u - cp can result from a wide variety of brain lesions , with respect to the timing of insults ( acquired during the pre- , peri- or postnatal period ) , and the type of structural pathology ( brain malformations , periventricular lesions , and corticosubcortical lesions ) . u - cp often leads to delays in motor development or deconditioning of the affected limb , as individuals are inclined to functional compensation with the intact limb rather than attempting to use the involved limb ; this may result in suppression of development of cortical representation of the affected limb , and it may further inhibit its functional use [ 5 , 6 ] . when the lesion occurs at an early stage of development , either during the intrauterine life or soon after birth , the mechanisms of plastic ( re-)organization of the sensory motor system can be different from those observed at later stages of development . primary motor control of the hemiplegic upper limb can be eventually maintained within the spared tissue of the affected hemisphere ( ipsilesional reorganization ) , or it can be reorganized within the unaffected hemisphere , as a result of the complete withdraw of the crossing fibers from the affected hemisphere and the survival of the fast - conducting ipsilateral motor projections from the unaffected one ( contralesional reorganization ) . the type of reorganization can be influenced by the size and site of damage , but it appears strongly influenced also by the experience following damage , that is , by the complex interaction between residual motor output from the affected hemisphere and somatosensory feedback from the affected limb . in general terms , adaptive plasticity of the central nervous system ( cns ) refers to functional and structural changes in the brain , which are advantageous to offset or improve functions ; the term denotes several capacities including the ability to adapt to changes in the environment and to store information in memory associated with learning . there is abundant evidence that the structure of certain brain circuits can change in response to environmental stimuli . recently , gauthier et al . have shown in stroke patients treated with cimt a significant increase in gray matter volume in several regions , including bilateral primary sensory and motor areas , both hippocampi , and anterior supplementary motor area contralateral to the motor deficit . in children with u - cp , several types of intervention have been used to improve abilities of the affected limb ( e.g. , neurodevelopmental treatment , neuromuscular electrical stimulation , constraint - induced movement therapy , etc . ) . compared to adult poststroke research , a relatively small number of studies investigated the effects of rehabilitation on brain reorganization . the purpose of this study has been to evaluate current evidence on brain reorganization in children with u - cp following noninvasive intervention strategies . articles were identified through comprehensive searches of computerized bibliographic databases : pubmed , medline ( 1973 to october 2013 ) , cinahl ( cumulative index to nursing and allied health literature ) ( up from 1994 to october 2013 ) , web of science ( 1992 to october 2013 ) , and eric ( pre-1966 to october 2013 ) . we also searched for reviews on this topic on the cochrane central register of controlled trials , with no result . the search explored medical subject headings ( mesh ) terms and text words:cerebral palsy or hemiplegia,child or adolescent or infant,therapy or training " or intervention,mri or fmri or eeg or tms or pet or meg or reorganization . cerebral palsy or adolescent or infant , therapy or training " or intervention , mri or fmri or eeg or tms or pet or meg or reorganization . selection criteria . to be included in this systematic review , studies had to meet the following criteria.participants were diagnosed with u-cp.interventions to improve outcome were noninvasive and did not include drugs.outcomes included functional activities and evidence of brain reorganization through neurophysiological experiments , carried out before and after the intervention . outcomes included functional activities and evidence of brain reorganization through neurophysiological experiments , carried out before and after the intervention . studies were excluded if theyreported only clinical measures as outcomes;were case reports;were not published in english . reported only clinical measures as outcomes ; were not published in english . the initial search yield was reviewed by only one reviewer on the basis of title and abstract . all the studies emerged from the search focused on upper limb ( ul ) intervention . the search strategy allowed to identify 12 articles that met our inclusion / exclusion criteria . the full - text articles were examined by 3 reviewers , and the eligibility for study inclusion was assessed independently ; in case of mismatched opinion between the 3 reviewers , the eligibility of the study was discussed together and consensus was reached . following our search in the different databases , only 5 eligible studies were identified while two additional ones were selected within their reference lists . the general purpose of the studies was to evaluate the effects of noninvasive rehabilitation strategies on brain reorganization and on functional improvement of affected upper limb ( ul ) in unilateral cerebral palsy . in figure 1 , flow chart describes study selection and reasons for exclusion . we found seven trials specifically targeted on children with unilateral cerebral palsy ; only in one case a participant had bilateral impairment with right arm sparing . the age range of participants was between 2.1 and 7.6 years in one study , between 7 and 14 years in two studies [ 13 , 15 ] , between 13 and 15 years in another study , and between 10 and 30 years in the others [ 1719 ] . some studies were performed by the same research group and some subjects participated in more than one study [ 1719 ] . the most frequently proposed intervention , in six of the seven studies , was the constraint - induced movement therapy ( cimt ) ; cimt was used in association with neurodevelopmental treatment ( ndt ) , in association with occupational therapy ( ot ) , in association with intensive motor training or during a training camp in association with individual and peer groups activities [ 1719 ] . standard cimt for children involves a restraint worn on the non - affected upper limb for 90% of waking hours and 6 hours / day of intensive intervention using shaping techniques and massed practice typically over a 2-week period . the standard cimt model has been adapted to be less intensive ( < 6 hours / day ) due to concerns that young children are unable to participate in such intensive therapy regimen . the remaining study employed an innovative treatment strategy : virtual reality ( vr ) , a virtual environment system that uses new technologies to make the patient perceptions similar to those coming from real - life activities . in none of the studies children received botulinum injections or upper limb surgery for the affected upper limb in the 6 months prior to intervention . studies aimed to evaluate the effects of noninvasive intervention on ( i ) functionality of ul , through scales and/or questionnaires and ( ii ) brain reorganization , through neuroimaging and neurophysiological techniques ( i.e. , mri , fmri , tms , meg ) . in three of the studies [ 1719 ] , the different patterns of corticospinal reorganization ( ipsilesional versus contralesional ) were determined by using tms . outcome measures were applied both before and after the intervention ; in a few studies , assessments were also recorded during followup [ 15 , 18 ] . the effects of noninvasive intervention on the functionality of the hemiplegic upper limb were monitored using different functional measures , scales , or questionnaires . the type of clinical assessments varied among studies ; we therefore grouped the functional motor outcomes in 3 categories , according to the dimensions of the international classification of functioning . disability and health ( icf - cy ) : ( a ) body functions and structures , ( b ) activities , and ( c ) participation . ( table 1s summarizes clinical assessment and corresponding results ; see table 1s in the supplementary material available online at http://dx.doi.org/10.1155/2013/356275 ) . most of the studies investigated functional motor outcomes according to at least one of the dimensions of the international classification of functioning , disability and health ( icf ) . the most frequently used outcomes measures were wmft [ 1719 ] in 3/7 papers and p - mal [ 13 , 14 , 18 ] in 3/7 papers . to evaluate the effects of the intervention on brain reorganization , 6 studies used functional magnetic resonance imaging ( fmri ) [ 13 , 1519 ] . all mri experiments were performed on 1.5 t scanner , but the fmri procedure and the tasks performed during the examination were different among studies . half of the six studies used , as fmri task , active and passive movements of the paretic and the nonparetic hands , while the other half only performed an active task on the paretic hand . one study combined fmri with transcranial magnetic stimulation ( tms ) and another combined fmri , tms , and magnetoencephalography ( meg ) . tms procedure was the same in the two studies ; meps were recorded from the flexor pollicis brevis muscle from paretic and non - paretic hands by surface electromyography for amplitude and global transmission time [ 18 , 19 ] . for meg , somatosensory evoked magnetic fields ( sefs ) were elicited by tactile stimulation of the paretic and non - paretic hands . authors analyzed the tactile evoked magnetic field of the early sef ( amplitude and latency ) . only one study evaluated the effects of reorganization trough voxel - based morphometry ( vbm ) analysis to determine gray matter change . details of the findings are reported in table 3 . to explore the effects of intervention on brain reorganization , neurofunctional techniques were used in 6/7 studies ( fmri in 6 studies , tms in 2 , meg in 1 ) , while a neurostructural technique ( vbm ) was used in 1/7 studies . the main neurofunctional effect upon the ( most ) affected hemisphere , observed after intervention , consisted of an enlargement of m1 or m1/s1 activation during active motor tasks of the paretic hand , demonstrated either at the single subject level or at the group level [ 13 , 15 , 18 , 19 ] . less consistent findings were observed on fmri during passive motor tasks of the paretic hand with enlargement of m1/s1 activation at the single subject level in one study , not confirmed at a group level in another study . tasks performed by the non - paretic hand , both active and passive , did not seem to affect brain reorganization within the affected hemisphere . this general fmri pattern was confirmed also when stratifying subjects according to motor reorganization ( i.e. , ipsilesional versus contralesional ) . in studies using tms , a significant increase of m1-meps amplitude was observed , following the tms stimulation of the affected hemisphere . this finding was clearly not observed in subjects with contralesional reorganization of motor function , as no meps could be elicited in these subjects by stimulation of the affected hemisphere . in the study using meg , increased amplitude of the sefs was observed in the affected hemisphere following tactile finger stimulation of the paretic hand , irrespective of the type of motor reorganization , while a reduction in sefs latency was only observed in subjects with ipsilesional reorganization . the only study exploring neurostructural changes , through vbm analysis , found an increased volume of m1/s1 in the affected hemisphere , together with an increased volume of the hippocampus . no clear neurofunctional effects were observed upon the unaffected ( or least affected ) hemisphere . in a minority of cases , changes at the single subject level were observed on fmri , at the level of m1/s1 or the cerebellum . on tms , a small but significant decrease of m1-meps amplitude was observed , following tms stimulation of the unaffected hemisphere , limited to those subjects with a contralesional reorganization . no effects were observed using meg , with the exception of a reduction of sefs latency in the unaffected hemisphere following tactile finger stimulation of the non - paretic hand , limited to the subgroup of subjects with ipsilesional reorganization . the only study exploring neurostructural changes , through vbm analysis , found an increased volume of m1 in the unaffected hemisphere , together with an increased volume of the hippocampus . the correlation between functional motor improvement in the upper limb and degree of neuroplastic changes was explored in 4/7 studies and significant correlations were found . in 3 studies cimt was used and the training - related improvements were positively correlated with the extent of the area of activation , the laterality index and volume increase at vbm . in the study on vr , a correlation between motor function and fmri signal during active motor tasks was found . despite the high number of studies exploring the functional effects of neurorehabilitation in children with unilateral cerebral palsy , relatively little is known on the neurobiological underpinnings of such effects . the main common finding reported in the reviewed studies is the enlargement of the primary hand motor area contralateral to the paretic hand , following intervention . this was valid across different studies , both for cimt [ 1315 , 1719 ] and vr trainings , using various hand motor tasks such as finger tapping , hand opening / closing and rubber ball pressing [ 1719 ] . contralateral primary motor and sensory cortex were the most frequently involved but increased activation could be also found in the supplementary motor area , the premotor cortex and the cerebellum [ 16 , 17 ] . more in general , the effect results into a shift in the laterality index due to the increased activity in the ( most ) affected hemisphere after therapy , not counterbalanced by a similar effect in the unaffected ( or least affected ) one . of the three papers exploring this question [ 1719 ] , one showed significant enlargements in about half of the tested subjects , the second one found no significant changes , while the third one found changes only in the subgroup of subjects with contralesional reorganization . the three studies however used different statistical approaches ( single subject versus group analysis ) , making the three studies poorly comparable and potentially less conflicting . in two of the six studies [ 14 , 18 ] , used tms to determine the changes in corticospinal excitability following cimt training , and recorded increased amplitude meps in the paretic hand from the contralateral primary motor cortex . sterling et al . explored the effects of training on a structural level by using vbm analysis . this is also the only paper with an actual control condition consisting of a same - length interval pretraining used to explore brain changes unrelated to intervention . it is of interest that while no changes were observed from baseline to pretreatment , a significant volume increase was observed at a group level posttreatment in the primary motor cortex bilaterally , in the contralateral primary sensory area and in both hippocampi . not surprisingly , a key factor influencing treatment - related brain neuroplasticity appeared to be the type of reorganization of the corticospinal tract ( i.e. , ipsilesional or contralesional ) . type of reorganization was taken into account in 3/7 studies ; these studies came from the same research group , with the most recent one confirming and expanding the results of the previous two [ 17 , 18 ] . although the overall small figures do not allow for definite conclusions , there appears to be enough evidence supporting the existence of two types of treatment - related neuroplasticity with the main hallmark of an increase in m1 excitability in subjects with ipsilesional reorganization and of a decrease in m1 excitability in subjects with contralesional reorganization . positive effects of training on hand motor function , in the selected studies , were almost invariably reported , although the outcome measures used were very heterogeneous . when correlating functional improvements with the amount of plastic brain reorganization , significant results were generally observed after intervention , including enlarged area of m1s1 activation in fmri , increased m1-meps amplitude from stimulation of the affected hemisphere , and increased m1s1 brain volumes on vbm . however , data are too scattered and heterogeneous to allow for definite conclusions on the possible correlations between neurobiological changes and functional improvements . the main limitation of the findings of this review is related to the number and type of papers found in our systematic search . studies included in this review consist of quasi - experimental or descriptive pre - post designs . their level of evidence , based upon a modified sackett score adapted to include pedro ratings , is between 2b for cimt studies and 5 for vr . it is of great interest that none of the studies selected was a randomized controlled study . although several rcts have been performed comparing different trainings in children with unilateral cerebral palsy , some ethical problems might have hindered the possibility of testing control subjects with relatively invasive techniques such as tms . nevertheless , since mri , meg , and eeg techniques , when used without sedation , can be considered noninvasive , there is no obvious reason why rcts have not yet been performed using these methods . lack of rcts might be more simply justified by this field of research being relatively new and this type of study design being more complex . in summary , noninvasive rehabilitation strategies seem to produce measurable neuroplastic changes in sensory motor cortex associated with enhancement of motor skills in the affected limb . this conclusion is however largely restricted due to the strong limitations of the reviewed studies , the most relevant of which concerns their methodological characteristics . it is also important to underline that the selected studies only investigated the effects of two types of intervention , namely , cimt and vr , making therefore our conclusions not applicable to other approaches . for the same reason , this review can not provide any contribution to the definition of the type of intervention that should be recommended in children with u - cp . well - designed experimental studies with larger sample sizes should be carried out to strengthen the generalizability of these preliminary findings . moreover , for further studies it would be important to investigate the clinical outcomes according to the dimensions of icf with the best measures created for children with hemiplegia considering psychometric properties . more researches , and in particular rct studies , are needed to better understand the mechanism of brain plasticity in children with brain injury and to inform and fine - tune current or novel rehabilitation strategies in children with cerebral palsy .

chronic liver disease ( cld ) represents a significant public health problem world - wide . the current major ones , such as viral hepatitis and nonalcoholic fatty liver disease , were estimated to have a collective morbidity of up to 20% of the general population . without effective management , clds normally share a common pathological process of progressive fibrogenesis , resulting in increasing risk of cirrhosis and liver cancer . for example , 15%40% patients with chronic hepatitis b patients may progress to cirrhosis or hepatocellular carcinoma during their lifelong time . the fundamental aim of cld treatment is to halt or even reverse the development of hepatic fibrosis and cirrhosis . thus , it is invaluable to accurately diagnose and monitor hepatic fibrogenesis in the individual patient , for the purpose of timely and effective prevention , treatment and prognosis of cld . with recently mounting advances in therapeutics of cld , particularly the chronic viral hepatitis , it has been verified that regression of fibrosis or even cirrhosis can be attained with long - term effective causative therapies . accompanying the evolving treatment strategies , the needs for precise , accurate , and dynamic evaluation of hepatic fibrosis and cirrhosis are becoming more urgent than ever in the areas of both hepatic clinical treatment and the relevant drug development . it is now a burning question regarding how to achieve the holy grail of hepatic fibrosis assessment with the following characteristics , such as , being cld specific ; providing data less influenced by clinical biochemical parameters of liver or the other organs ; having precise , sensitive , and dynamic discriminability for analyzing adjacent fibrosis stages , progression and regression in any cld ; involving relevant etiological mechanisms , and being efficient to perform assessment . they can be generally classified into the invasive and noninvasive approaches . as there have been recently several systematic reviews on the noninvasive approaches , the present mini - review focuses on updating the progress in methodologies based on using liver biopsy . major causes for chronic liver injury consist of viral hepatitis , alcoholic and nonalcoholic steatohepatitis , hepatic biliary diseases , autoimmune hepatitis , drug - induced hepatitis , and metabolic genetic liver diseases . extracellular matrix ( ecm ) over - accumulates , remodels and forms into fibrous scar in liver tissue that is iteratively injured and suffers chronic inflammation of diverse etiology . fibrous scar changes the physiological architecture of hepatic tissue ; thus undermines the microenvironment which is fundamental for liver cells to function normally well . relevant clinical phenotype or syndrome will develop and become apparent accordingly with the evolving patterns of fibrous distribution . since 1980s , there has been great advances in identifying the biomolecular process underlying liver fibrogenesis ; in addition to basic knowledge , it was also revealed in in vivo models that different injuries of clds with distinct or even the same etiology can cause different processes of inflammation , and thus diverse histological patterns and progression of liver fibrosis , which in turn result in various phenotypes of liver functional performance and disease prognosis . most of the above knowledge was obtained from experimental research using animal or cell culture models . however , hepatic fibrogenesis in clinical cld usually takes a remarkably longer evolution duration ; for example , it takes about 1520 years for the occurrence of cirrhosis of chronic hepatitis b progressing from its initial stage of infection ; in addition , there exist long - lasting , dynamic , and multifactor - interlocked interactions between various etiological elements and patient 's individual phenotypic or genetic conditions . the involved pathological process is too complicated and hardly possible for any experimental model to faithfully recapitulate it . therefore , it is rational that research data from experimental studies are virtually lack of potency for substantively solving clinical issues regarding treatment and management of fibrosis . this may somehow explain why there is still hardly any antifibrosis treatment clinically approved and licensed as yet , even if significant progress in the identification of potential therapeutic targets has been achieved in the laboratory . in current clinical scenario , the results of liver function biochemistry and etiology testing are mainly referred to for therapeutic decision . however , these data can not provide any direct information regarding the exact landscape of a specific pathological progression , which is invaluable for making accurate treatment decision and prognostication of the clinical situation of a particular organ . one of the fundamental theories rooted in tissue engineering research , which is comprehensively observed and confirmed in the research of developmental biology , is that there exists close association between the physical structure and the functional behavior within any organisms . translated into the terms of biomedicine , from the particular view of fibrosis - dominant disease , the postulation could be that there exist ways of correlation between the information of fibrotic structural pattern and pathophysiological function phenotype of the fibrotic tissue . indeed , this point has been suggested by the findings in clinical practice , that is , the characteristics of the histological pattern are distinct among clds of different etiologies . at organ level , while the hepatic fibrosis caused by biliary disease normally has various display among different lobes , hepatic fibrosis of chronic viral hepatitis , alcoholic and nonalcoholic steatohepatitis , and autoimmune liver disease distributes in a relatively uniform way . thus , histopathological conditions of clds of the latter etiologies can be rationally represented by liver biopsy sampling with the appropriate adequacy following the relevant practice guideline . in observation at tissue cellular level , characteristics of fibrous ecm , such as morphology , quantity , and distribution trend , always change along the lines of different etiologies , inter - stages and intra - stages of the same etiology , and patient individuals . for example , it was found that while the fibrotic pattern normally starts and spreads from portal tract to surrounding vascular in chronic viral hepatitis ; in alcoholic and nonalcoholic steatohepatitis , fibrous ecm is dominantly accumulated in perisinusoidual and pericellular location . in addition , studies in natural history of chronic viral hepatitis indicated that the progression of pathophysiology conditions of patients with chronic hepatitis b is often accompanied with the histological changes of hepatic fibrosis instead of necroinflammation . thus , changes of fibrotic structure potentially could be more reliable and accurate for monitoring and predicting the pathophysiological conditions of cld than the other clinical parameters . now - a - days in terms of evidence - based medicine , among the achievements of pathological diagnostic systems established for chronic disease of other organs , the histological evaluation system built - up for cld , particularly the chronic viral hepatitis , is highly outstanding for its gold standard quality of widely - approved clinical application and its critical role in guiding practice . they proposed that change of fibrosis pattern could be more reliable for properly analyzing the disease condition at its chronic stage , which was verified by mounting clinical studies that there is definite association between the progression or regression of hepatic fibrosis and the conditions of out - of- or under - control of the cld . but as for the information of fibrosis that can be used for specific , precise and accurate evaluation of the cld progression , how to identify and derive them from the other tissue information ? given the evidence above , the strategy that can completely and precisely collect the clinical relevant architectural information of fibrous ecm ( i.e. , architectural fibrosis marker ) could be suitable to address the requirement . but have we got this strategy ? there have been numerous methodologies reported for the measurement of hepatic fibrosis using noninvasive and invasive technologies . in addition , considering current validated status of these technologies in clinical settings , there have been suggested various preferences for their application in distinct fibrotic situations [ figure 2 ] . these relevant applications are anticipated to evolve more rapidly and comprehensively , especially regarding how to define and monitor the regression of fibrosis and cirrhosis , owing to the increasing endeavors dedicated for them . comparison of current major approaches for hepatic fibrosis assessment and their roles in predicting progression of cld ( cld : chronic liver disease ) . application of the current technologies for assessing hepatic fibrosis at different stages of cld ( hvpg : hepatic vein pressure gradient ; cld : chronic liver disease ) . current commonly available approaches of noninvasive technologies mainly include blood test and liver stiffness ( ls ) measurement using transient elastography . noninvasive approaches have been attaining more interest in real life clinical practice , primarily due to their intrinsic advantageous applicability for screening and serially monitoring some special subgroups of patients . however , data generated by these noninvasive approaches do not contain any component of fibrotic architectural information . while blood test is an indirect measurement specifically designed to characterize the serum biochemical changes during different stages of liver fibrosis , ls is a novel parameter measured directly in the liver . though ls is an excellent surrogate marker of advanced fibrosis and cirrhosis , it is not only linked to hepatic fibrosis . as a matter of fact , it is also influenced by other clinical settings such as hepatic congestion , hepatic vessel pressure , mechanic cholestasis , and hepatic inflammation . therefore , its clinical relevance should always be translated in the context of etiology , imaging and laboratory findings . this somehow explains why the range of appropriate application and underlying meaning of these technologies are still being explored since they are entirely different parameters from the well - validated histological items . more longitudinal prospective studies are needed for the purpose that the noninvasive approaches could finally be substantially taken as an alternative surrogate for predicting cld outcomes . conventional histological evaluation systems , e.g. , the categorical assessment algorithm , belong to this subtype . due to the ability to directly provide morphological information of injured liver tissue , of which the clinical relevance has been validated in viral hepatitis , these approaches are regarded as the gold standard reference for fibrosis assessment in both clinical practice and studies , which supposedly may not be replaced by noninvasive approaches in a foreseeable future . since 1980s , the categorical histological assessment such as knodell , metavir , and ishak . these systems share the same principle of using semiquantitative scoring algorithm that assigns serial numerals to different histological patterns . note that these numerals are categorical labels other than quantitative variables , so that what they indicate is neither a degree nor amount of fibrosis , but the various pattern of fibrous architectural changes in liver tissue . because when these systems were established , there still lacked effective treatment for preventing cld progression , they had not included the diagnostic pattern of indication for fibrosis regression . that is to say , the objective to which the systems can be properly applied is the ones of progressing cld ; improper evaluation may occur if using these patterns for diagnosis of regressing cld . in addition , cirrhosis was simply assigned one or two stages in these categorical systems , since in 1980s cirrhosis almost equaled to inexorable death of end - stage liver disease . however , understanding of the pathophysiological changes underlying cirrhosis has been increasingly systematic , and regression of cirrhosis of viral hepatitis by long - term antiviral therapy has been verified in several multicenter clinical trials of large cohort , so that the simple one- or two - stage definition of cirrhosis is obviously outdated to adequately reflect the complexity and kinetics of cirrhotic condition . dynamic and etiology - based characterization of cirrhosis pathological process , including precisely defining cirrhotic progression / regression and discriminating cirrhosis substages , is now in a great need for monitoring the efficacy and facilitating accurate therapeutic decision . conventional histological assessment systems currently used in clinical practice normally employ a descriptive semi - quantitative way for staging fibrotic evolution . the procedure of assessment can be conceptually summarized as that , through reading by individual pathologist , the confluent and complex information of cld histology is minimized into several serial numerical scores when reaching the physician . in fact , although description of histological features always accompanies the reported ordinal digits , physicians can be more impressed by virtually nothing else but one of the four ( knodell ) , or five ( metavir ) , or seven ( ishak ) categorical labels . consequently , the semi - quantitative systems are widely complained against their inherent subjectivity and loss of information integrity , which result in the major issues such as observer variability and sampling error in its application , even performed strictly following the practice guideline for liver biopsy . for example , according to a study by regev et al . for observing the variances of chronic hepatitis c liver biopsy assessment , the basic frequency of sampling error of inter - lobes can be 9.7% , at least one - stage difference reading can be 24.2% , and the under - diagnosis of cirrhosis can happen in 14.5% patients . these digits may be worth attention of clinical researchers in liver biopsy assessment , due to their indicative information of system bias . ratios of histological change reported being around these numbers have to be interpreted with caution , since the numbers may be possibly attributable to sampling variances rather than the effectiveness of treatment intervention per se . misinterpretation of histological data can become even more serious when the size of biopsy sample lacks adequacy , that is , below the standard of 2025 mm in length and 1.2 mm in width with 11 complete portal tracts . it was repeatedly demonstrated that the shorter the sample is , the more possibly the fibrosis of it tends to be underestimated . generally speaking , although previous report on establishment of these systems claimed these methodologies both reproducible and accurate , it has been widely recognized that their pragmatic performance in assessment of hepatic fibrosis can be neither of the above positions . to overcome the limitation of being semi - quantitative , since the end of 1990s , researchers have been trying to fully quantitate fibrosis of liver biopsy based on the strategy of morphometric assessment . the methodology basically includes fibrous collagen - specific staining , digital imaging tissue section , and computer assist digital image analysis . it calculates the area ratio of fibrillar collagen ( fc ) ( ideally stained with picro - sirius red ) to its correspondent tissue section . cpa generates continuous variables in a theoretically objective way , although in a technical aspect , the measurement consistence still has to suffer greatly from the variances of staining procedures , operator experience , and software of image analysis . it also needs to note that cpa value is significantly vulnerable to sampling size variances . it is easy to understand that fibrosis amount in different subareas of even the same sample normally can not distribute evenly . therefore , it is suggested that cpa should not be directly used for evaluation of fibrosis in an individual patient , but may be taken as a statistical parameter for a large cohort . the fully quantitative methodology , which cpa employs , makes it feasible for researchers to detect the fine changes of fibrosis amount in liver tissue . cpa has been used in numerous clinical studies of cld fibrosis with different etiologies underlying since it is supposed to be helpful for substaging some conditions of hepatic fibrosis and cirrhosis . although recently there is increasing interest in exploring cpa 's role in fibrosis measurement of alcoholic and nonalcoholic liver diseases , most studies till now were performed with liver biopsies of chronic hepatitis c or b. among these studies , while some reported that cpa values correlated well with scoring of all histological categories from mild to advanced fibrosis ; the others found that change of cpa value was not sensitive enough to discriminate the mild and significant fibrosis , but almost linearly associated with the progression of advanced to end - stage fibrosis . the cpa performance in our recent studies of drug - induced fibrosis rat model and chronic hepatitis b liver biopsies agreed with the later ones . regarding using cpa for diagnosis and substaging of cirrhosis , a significant correlation between the values of cpa and ls or hepatic vein pressure gradient ( hvpg ) within the compensated phase was suggested by several recent studies ; the underlying rationale for it might be , since cirrhosis is histologically defined as a pathological condition that tissue architecture is distorted by diffuse fibrous ecm ( mainly consisting of fc i and iii ) , the amount of fc might start to play a major role in predicting progression of cirrhosis before the stage of advanced portal hypertension ( i.e. , hvpg 12 mmhg ) ; so that during the course of compensated cirrhosis , hvpg could be influenced significantly by fc quantity , which is what the values of cpa and ls mainly indicate . whether cpa could be used as another prognostic surrogate marker of the dynamic cirrhotic conditions is worth comprehensive investigation in more clinical settings . though cpa has the advantage of being fully quantitative and probably an independent marker in substaging compensated cirrhosis and prognostication of decompensation complications , the information it provides is limited to the amount of fibrosis without any spatial cue . it might be some sort of resource - wasting if tissue specimens are taken just for collecting the information of fibrosis amount since the tissue samples per se contain far more fibrosis - relevant information beyond this factor only . in addition , as a matter of fact , cpa does not solve the major drawbacks of conventional histological assessment , because it virtually takes a distinct underlying strategy from the one that histological assessment systems are commonly based on , emphasizing the morphological patterns of fibrotic changes . therefore , on one hand , study of cpa needs to move on further exploring and validating its potential role in cld applications ; on the other hand , innovative methodologies that can substantially improve the quality of current gold standard the conceptual meaning of hepatic fibrosis in cld contains the entire information of pathologically accumulated fibrous ecm , which is basically composed of biochemical vs. physical , and temporal vs. spatial elements . hepatopathologist innovators of conventional histological assessment systems perceived ( with their professional intuition ) the mechanistic essence underlying the specific cld conditions . the conventional systems established along this line were afterward validated of their efficacy in clinical settings . such an experience may somehow inspire us that the relatively complete information of fibrotic tissue with particular underlying pathological conditions could hold the potential to properly represent the pathophysiology state of the tissue . this point would rationally depend on the informative confluence of three elemental factors , that is , fibrous component , relevant morphology and quantity , to define whether the fibrotic histological information being complete or not . fibrillar collagen is commonly the major component of fibrous ecm in cld of different etiologies , or even different organs of fibrotic disease . then quantification of the architectural pattern of fc can be privileged as the target for study of the histological change of hepatic fibrosis at a particularly defined pathological condition . collagen specific color - metric stain and immunohistochemical stain in tissue section are widely used in both clinical and experimental laboratory ; however , considering the detection quality of standardization and sensitivity , these techniques are not the optimal solutions for in situ morphological and quantitative measurement . moreover , it needs a lot of preparation for the staining procedures , which is rather lousy and prone to batch - to - batch inconsistence , so that hard to be carried out routinely in clinics . recent advances in biophotonics application in tissue engineering provided unique techniques for fc detection . since the first report of nonlinear imaging of biosamples in 1990 , application of multiphoton microscopy , such as the second harmonic generation ( shg ) microscopy , has been actively explored in biomedical imaging research . the fundamental physical principle of shg imaging in fc molecule is illustrated in figure 3 . shg imaging of fc has distinct advantages compared to other imaging modalities , including that tissue samples for imaging can be label - free since shg signals are generated due to the intrinsic noncentrosymmetric structure of fc molecule ; the penetration depth can reach to 200 m because excitation wavelength for shg is usually adjusted in the near infrared range ; and the known excitation and emission spectral signatures of shg allows easily and sensitively separating signals of fc from other fluorophores . due to the unique strength of shg in fc imaging , combining another nonlinear optical technology of two - photon excited fluorescence ( tpef ) for tissue cell imaging , some research groups tried to use shg / tpef in animal models of liver fibrosis and validated its technical performance and feasibility for hepatic fibrosis imaging . the first reported clinical application of shg / tpef for cld hepatic fibrosis measurement was by guilbert et al . in 2010 . the study comprehensively validated the technical feasibility of shg / tpef using 107 tissue specimens of mixed etiology . although employing the special imaging technology , it took cpa for fibrosis analyses , so that in some sense it could be regarded as a technical report rather than a study for improving the accuracy of fibrosis assessment modality per se . basic physical principle of shg / tpef imaging ( a ) and its application in hepatic ( b ) and renal ( c ) tissue fibrosis imaging in tissue images ( b and c ) , green signal shows the fibrillar collagen imaged by shg ; red signal show the tissue cells imaged by tpef . ( shg : second harmonic generation ; tpef : two - photon excited fluorescence ) . focusing on improving the value of histological assessment , structure - based quantitation ( sbq ) the fundamental principle of sbq is to fully quantitate the features of the histological pattern of fc , e.g. , the number , length or texture of fc . combining the strength of shg technology , sbq translated the principle of metavir fibrosis scoring into a new tool of fully - quantitative algorithm , named qfibrosis , which was then demonstrated to be able to automatically , accurately and reliably score hepatic fibrosis and cirrhosis in both animal model and liver biopsies of chronic hepatitis b. the design of qfibrosis index encompassed three key morphological phenotypes of common pathological interest and had them quantified into three subindices by measuring the spatial parameters of fc within each individual location . qfibrosis can significantly identify differences between all metavir fibrosis stages , indicating that it can faithfully and reliably recapitulate metavir scoring principle . within the framework of histopathological categorization , qfibrosis provides scores of continuous variable attributed to its inherent full - quantification capability ; thus , it could potentially be used to precisely reflect the dynamics of fibrosis / cirrhosis progression or regression . in addition , tested with different sizes of biopsy samples , qfibrosis unprecedentedly and significantly alleviated the major issues of sampling error and inter - and intra - observer bias in conventional histological scoring systems . furthermore its validated high sensibility to the fine changes of fibrosis pattern in cirrhosis samples , in combination with its algorithm of inherent structural interpretation , can be promising for substaging and characterizing the dynamic process of cirrhosis , with the particular etiological features being defined as well . the establishment of qfibrosis could be exemplified as a successful and innovative integration of advances in medicine , biology and engineering . sqb assessment tool such as qfibrosis is expected to facilitate improving the gold standard there are many clinical needs , and academic mysteries as well , related to hepatic fibrosis and cirrhosis wanting for us to understand . given the introduction of the innovative sbq assessment strategy , there are generally two directions in which the relevant research could move on forward . for example , we need to further develop and validate our tools for defining the various surrogate markers for monitoring and predicting regression of hepatic fibrosis and cirrhosis ; even further , we could replace the categorical labels with the corresponding continuous variables which obviously can more precisely and dynamically reflect the particular changes of histological fibrotic pattern in individual patients . furthermore , there are some interesting areas in basic hepatology we may explore . for example , it has long been observed in clinical medicine that advanced fibrosis and cirrhosis is prone to be oncogenic in cld liver , however , there still lacks direct and systematic in situ observation at tissue level , mainly due to the roughness of current definition of pathological conditions of fibrotic tissue . keeping in mind that sbq tool is able to provide the architectural information of fibrotic fibers with high resolution of up to cellular level ; we may preset the variable panels of fine changes of hepatic fibrosis as a serial quantitative conditions to find out the critical tissue environmental parameters amiable for oncological genesis , development or metastasis . in conclusion , as histological examination will not be replaced of being one of the most important clinical references in a foreseeable future , by interfacing modern medicine with advanced bioengineering , innovative cutting edge technologies , such as sbq , hold the great potential to facilitate the good standard liver biopsy assessment to accelerate the rapid evolution of clinical practices and studies in cld .

chondrosarcoma of the larynx is quite rare , comprising 1% of all laryngeal primary tumors [ 1 , 2 , 3 ] . primary malignant lesions originating from the subglottis area are also rare and constitute between 1 and 3.6% of all laryngeal cancers [ 4 , 5 , 6 ] . in subglottic cancers , epidermoid carcinoma was found in 71.8% of the cases , the second most common type was chondrosarcoma in 10.3% of the cases . definite incidences are unknown and difficult to assess , as low - grade chondrosarcomas are frequently misinterpreted as chondromas . although surgical excision is still the mainstay of treatment , the operation extent for this relative slow progression cancer is still equivocal . in this article , we present a case of subglottic chondrosarcoma and a review of the literature . a 68-year - old asian male presented with a 1-year history of hoarseness , mild dysphagia , and a 1-month history of dyspnea . on examination , the patient had no stridor . half of the subglottic area was obstructed , and he also had left vocal cord paresis . a computed tomography ( ct ) scan of the neck revealed a solid mass in the supraglottic region , extending from the cricoid cartilage to the left thyroid cartilage area , with no neck lymphadenopathy ( fig . the ct scan showed gross expansion of the cricoid cartilage with marked reduction of the airway , but the overlying mucosa was smooth . on admission , the patient received laryngomicrosurgery for biopsy and tracheostomy to secure the airway . multiple biopsies were taken which revealed features consistent with low - grade chondrosarcoma ( fig . 3c ) . as the patient is running a company , he needs to talk frequently . in agreement with the patient and his family , and considering the low - grade nature of the tumor , the patient was well after removal of the tracheostomy tube 2 months later . during the 12-month follow - up , the lesion did not increase in size and no metastasis was detected on the ct image . the patient receives ambulatory treatment and is doing well , and transnasal flexible endoscopy revealed that his airway is relatively patent ( fig . the incidence of laryngeal chondrosarcoma has been underreported , as differentiation between chondroma and chondrosarcoma has been a topic of debate . chondrosarcoma is well known as the fourth most common tumor of the bone and tend to be bulky , lobular lesions that can be seen anywhere , although with a preponderance in the lower appendicular skeleton and the pelvis . compared to chondrosarcomas in other systems , only 210% of all chondrosarcomas arise in the head and neck , with the majority encountered in the maxilla . however , laryngeal chondrosarcomas , first described in the early 1800s , are rare tumors of the head and neck , accounting for < 0.2% of all head and neck malignancies and up to 1% of all laryngeal tumors [ 1 , 7 ] . the most common malignant neoplasm arising in the subglottis area is epidermoid carcinoma , which comprised 55% of tumors in one review . adenoid cystic carcinoma is the second most common type , followed by chondrosarcoma . in one study , patients with subglottic lesions are suffering from a tumor that slowly but progressively encroaches on the glottic lumen and causes hoarseness , airway obstruction or difficulty in breathing , a mass lesion , dysphagia or dysphonia , stridor or pain . many patients had more than one symptom at the time of initial presentation , but hoarseness was the most frequently identified symptom in 64.9% of the patients . the other complaints depend upon how quickly the lesion develops and the anatomic location of the primary tumor . the age of presentation varies between the fifth to seventh decades , the average age being 66 years . the tumor is seven times more common in caucasians , and three times more common in men compared to women . there was a significant decrease in overall survival for patients who were older than 60 years at initial presentation than those who were younger which may be accounted for by the advanced age of patients in general medical condition . the majority of tumors involved the cricoid cartilage with a mean size of 3.5 cm . some authors believe that idiopathic vocal fold paralysis is an exclusive sign of cricoid chondrosarcoma and may be related to the involvement of recurrent laryngeal nerve or cricoarytenoid joint fixation . furthermore , the overall size of the lesion did not significantly affect the overall outcome . the majority of lesions were presented as multiple , irregular fragments of bone and soft tissue . areas of ossification in hyaline cartilages show a predilection for the development of laryngeal chondrosarcomas . laryngeal chondrosarcomas usually arise from the posterior lamina of the cricoid cartilage ( 78% ) or the thyroid cartilage ( 18% ) , and rarely from the arytenoids and epiglottis . lesions arising from the cricoid cartilage usually present with dyspnea , hoarseness and dysphagia . in the larynx , chondrosarcoma causes local destruction due to a mass effect before it invades the surrounding tissues . radiologically , this tumor can present as a lesion of variable density , showing either endolaryngeal spread ( growing inwards , confined by the outer margin of the cartilage of origin ) or extralaryngeal spread ( growth extending beyond the confines of the larynx into the surrounding soft tissue ) . on ct scanning , chondrosarcomas demonstrate fine , punctuate , and stippled to coarse calcification within the tumor [ 1 , 8 ] . the diagnosis of chondrosarcoma is based on criteria devised by lichtenstein and joffe for malignant cartilaginous tumors of bony origin , published in 1943 ( see friedlander and lyons ) . when combined with patient outcome to yield a declining survival for higher - grade tumors , a 5-year survival of 90 , 81 , and 43% for grades i , ii , and iii , respectively , was reported . in the axial skeleton , mostly referred to as cammc ( chondrosarcoma or chondrosarcoma with additional malignant mesenchymal component ) , the median survival is of 6 months with an approximate 70% chance of metastases , usually to the lung or soft tissues [ 9 , 10 , 11 ] . in sharp contrast to cammc of the axial skeleton , patients with laryngeal cammc have a more favorable long - term prognosis , although a similar recurrence / metastatic potential is reported with a local recurrence rate of 62% for laryngeal cammc . depending on the degree of differentiation , chondrosarcomas are classified as low- , medium- or high - grade tumors . most of the reported chondrosarcomas of the larynx are low grade , although some high - grade tumors have been described . preservation of laryngeal function with surgical eradication of the neoplasm is the preferred option [ 12 , 13 , 14 ] . however , according to thome and colleagues , total resection of cricoid cartilage with thyrotracheal anastomosis over a stent is an alternative technique to total laryngectomy in patients with chondrosarcoma ( see finn et al . ) . neck dissections should include pretracheal , paratracheal , prelaryngeal or precricoid ( delphian ) nodes , lower and middle jugular nodes , and supraclavicular nodes . patients treated with combined treatment ( surgery and radiotherapy ) have the highest disease - free survival . however , a conservative approach to management of these tumors should be borne in mind , especially in patients with associated comorbid conditions .

vancomycin is a glycopeptide antibiotic used to treat infections caused by gram - positive organisms , most commonly methicillin - resistant staphylococcus aureus ( mrsa ) . it is used for a variety of infections including cellulitis , pneumonia , sepsis , and endocarditis . due to potential side effects such as nephrotoxicity , ototoxicity , and the potential for bacterial resistance with low troughs , vancomycin concentrations are routinely monitored to ensure appropriate dosing . previously , appropriate trough concentrations were considered to be between 515 mcg / ml [ 2 , 3 ] . however , due to the emergence of vancomycin resistance , recommended trough concentrations have increased . in 2009 , the american society of health - system pharmacists / infectious diseases society of america / society of infectious diseases pharmacists published a consensus statement , updating the guidelines for appropriate vancomycin trough concentrations . these guidelines recommend that troughs should remain above 10 mcg / ml at all times to limit treatment failures and resistance . for patients being treated for severe infections such as , bacteremia , endocarditis , meningitis , mrsa pneumonia , osteomyelitis , or sepsis these elevated trough concentrations are needed due to the emergence of vancomycin - resistant staphylococcus aureus classified as vancomycin - intermediate staphylococcus aureus ( visa ) or vancomycin - resistant staphylococcus aureus ( vrsa ) , based on reported minimum inhibitory concentrations ( mics ) . there is also a heteroresistant staph aureus ( hvisa ) that shows inducible resistance after exposure to vancomycin [ 2 , 4 ] . the purpose of elevated troughs is to prevent further emergence of resistance and provide better treatment of infection . in order to achieve these updated trough goals existing nomograms such as the matzke , lake and peterson , rotschafer , nielson , and moellering were not designed to achieve troughs greater than 15 mcg / ml , and most were actually designed to achieve troughs of 10 mcg / ml or less [ 59 ] . the use of these nomograms would result in subtherapeutic vancomycin levels , which makes these historical nomograms obsolete . therefore , there is a need to develop new nomograms , designed to achieve the updated trough guidelines . currently , several dosing strategies that have been published aimed at achieving these higher trough levels , each with varying limitations [ 1012 ] . the nomogram by kullar et al . was designed to achieve troughs between 15 and 20 mcg / ml and was found to be effective in 58% of patients in which it was studied . this study excluded patients if they weighed > 110 kg , had a creatinine clearance < 30 ml / min or > 110 ml / min , or were considered to be critically ill , limiting the broad application of this nomogram . the second dosing protocol by devabhakthumi et al . was a retrospective analysis utilizing the patient 's weight to determine dose and renal function to determine the dosing interval . although results showed that an increased number of patients were initiated on an appropriate vancomycin dose , which authors defined as 15 mg / kg / dose , the percentage of patients achieving appropriate trough concentrations was not improved with the implementation of the dosing protocol . also , no adjustment was made to the dosing protocol if the patient was obese or nonobese . utilized multiple regression analysis in order to provide equations for calculating a dosing interval , using age and serum creatinine as variables , which aimed at achieving a vancomycin trough of 1520 mcg / ml . this nomogram only addresses the vancomycin dosing interval that is required , and it can only be used to achieve trough concentrations between 15 and 20 mcg / ml . also , a majority of patients included in the development of the nomogram ( 86% ) had initial serum creatinine measurements between 0.5 and 1.6 mg / l , limiting the range of renal function to which the nomogram can be generalized . two retrospective investigations were previously completed at our institution to evaluate a novel vancomycin nomogram , designed to achieve the higher vancomycin trough goals . one investigation was completed for nonobese patients , and the second evaluated an obese population . obesity was defined as a weight 30% or more over ideal body weight ( ibw ) . based on results of these studies , the new vancomycin nomogram ( see ( 1 ) and tables 4 and 5 ) has been shown to have a high level of accuracy in predicting doses of vancomycin that are appropriately therapeutic and have been validated retrospectively . consider the following ( 1)ibwmale=50 + 2.3(inches over 5 tall),ibwfemale=45.5 + 2.3(inches over 5 tall),crcl=(140age)(ibw or dw if obese)(72)(scr)( 0.85 for females),percent over ibw = abwibwibw100%,dw = ibw+0.4(abwibw ) . the dosing intervals are based on the estimated crcl and are determined as shown in table 5 . the purpose of this study was to prospectively evaluate the novel vancomycin nomogram in both obese and nonobese patients . by further evaluation of this promising nomogram , we aimed to provide a tool for clinicians which may result in easier and more accurate dosing to achieve the updated trough goals and to reduce the time spent on pharmacokinetic dosing of vancomycin . the primary objective of this study was to determine if the novel vancomycin nomogram predicts dosing regimens that achieve target trough concentrations equal to or more accurate than dosing regimens calculated using traditional pharmacokinetic calculations by evaluating the percentage of patients achieving initial trough concentrations within the goal range based on the patient 's indication for therapy . secondary objectives of the study were to assess the incidence of subtherapeutic ( < 10 mcg / ml ) and supratherapeutic ( > 20 mcg / ml ) trough measurements and to assess pharmacist 's impressions of the nomogram . this prospective , open - label trial was performed at a 454-bed community hospital on patients who were newly started on vancomycin therapy . patients were included if they were greater than 18 years of age , less than or equal to 120 kg , and had a new order for vancomycin where pharmacy was consulted to dose and monitor therapy . exclusion criteria included age less than 18 years , pregnancy , end stage renal disease requiring dialysis or any renal replacement therapy , weight greater than 120 kg , an increase in serum creatinine of 50% or more from baseline during the course of therapy , and patients with anasarca . this study was approved and was compliant with the ethical standards of winchester medical center 's institutional review board and adhered to the pharmacy departments approved vancomycin dosing policy . pharmacists who received a vancomycin consult would determine a patient 's eligibility for study inclusion and randomize the patient , using a vancomycin randomization form provided . the treatment group was dosed using the novel nomogram and the control group was dosed using the traditional pharmacokinetic methods currently used for vancomycin dosing at the institution . traditional pharmacokinetics was defined as calculating a vancomycin dose in whichever manner the pharmacist utilized prior to the start of the study . this included using the dosing equations provided by the pharmacy department or a historical nomogram already used by the pharmacists ( see supplementary material appendix 1 available online at http://dx.doi.org/10.1155/2013/839456 ) . all pharmacists were educated on how to screen patients for inclusion , how to use the randomization form , and how to use the nomogram to include necessary monitoring and followup . all pharmacists were educated by a single investigator to ensure that the same content was relayed to each pharmacist . after randomization , a standard data collection and monitoring form was filled out for each patient . separate forms were used based on the patient 's study arm ( see supplementary material appendix 1 ) . each form was organized in a step - by - step scripted format to ensure the consistent use of the nomogram and pharmacokinetic calculations between pharmacists . in order to assess pharmacist 's impressions of the nomogram pharmacists were asked if they felt that the nomogram was easy to use , saved them time , could improve patient care , if they felt comfortable using the nomogram , and if they were satisfied with the nomogram . the baseline survey was administered during the first week of the study , and the final survey was administered at the conclusion of data collection . patients were enrolled from january 10 , 2011 to october 31 , 2011 . for patients to be included in the final analysis , they must have received three identical vancomycin doses and have a trough level drawn at steady state ( just prior to the fourth or subsequent doses ) , and the nomogram must have been used correctly if used in the active nomogram group . correct use of the nomogram was defined as accurately calculating the patient 's vancomycin dose and correctly selecting the dosing interval based on guidelines provided with the nomogram . doses were capped at 2,000 mg per dose based on our institutions standard practice . a trough could have been drawn prior to steady state , if deemed clinically indicated by the pharmacist , but any changes to the dosing regimen based on this trough measurement will result in the exclusion of that patient from data analysis . extrapolated vancomycin troughs were calculated for all measured troughs to be used in final analysis . an extrapolated trough was defined as the vancomycin trough measurement just before the next dose of vancomycin was due . in determining if a trough measurement was within the appropriate range , extrapolated troughs were calculated out to one decimal place , not rounded , and had to fall within the absolute limits of 10.015.0 or 15.020.0 mcg / ml , depending on the trough goal classification . to detect a 20% difference between the nomogram and traditional pharmacokinetic dosing methods , with an 80% power , 414 patients were needed in the final analysis . categorical data , the primary objective , occurrence of patients achieving target trough measurements , and the secondary objective , the occurrence of subtherapeutic and supratherapeutic troughs , were evaluated using the chi - square test . survey data , evaluating pharmacist 's opinions of the nomogram on a 5-point likert scale , were analyzed using the wilcoxon test . one thousand and two hundred ninety - six patients were randomized into the study , of which , 823 patients had to be withdrawn from data analysis . reasons for withdrawal included vancomycin therapy being discontinued prior to an initial trough draw , troughs drawn prior to steady state , and incorrect use of the nomogram ( figure 1 ) . the average age in the nomogram group was 58 18 years versus 61 17 years in the traditional group ( p = 0.040 ) . baseline renal function and change in renal function during vancomycin therapy were similar between groups . overall , the nomogram resulted in significantly more patients achieving an appropriate vancomycin trough concentration with their initial dosing regimen ( p = 0.014 ) , which was the primary endpoint of the study . in the nomogram group , 98 out of 221 patients ( 44% ) achieved a therapeutic vancomycin trough compared to 83 out of 252 patients ( 33% ) in the control group . patients were stratified based on if they were classified as obese or nonobese . in obese patients , the nomogram achieved a therapeutic vancomycin trough in 43 of 109 patients ( 39% ) compared to nonobese patients where the nomogram achieved therapeutic troughs in 55 out of 112 patients ( 49% ) . although the nomogram appears to have a higher level of accuracy among nonobese patients , the difference was not statistically significant ( p = 0.190 ) , and the study was not powered to detect a difference between these groups . data for vancomycin concentrations below 10 mcg / ml and above 20 mcg / ml are presented in table 2 . the nomogram group had significantly fewer trough concentrations less than 10 mcg / ml compared to the traditional group ( 20.8% versus 29.9% , resp . however , there was no significant difference between the groups for concentrations above 20 mcg / ml ( 8.1% in the nomogram group versus 9.6% in the traditional group , p = 0.706 ) . survey data representing pharmacist 's impressions of the nomogram are presented in table 3 . from baseline to the conclusion of the study , significant improvements were seen in the ease of use ( p = 0.033 ) and time saving ( p = 0.008 ) aspects of the nomogram . also , on the final survey , an additional question was added asking pharmacists if they would prefer the nomogram to be available for future use within the department . twelve of the fourteen pharmacists responded that yes they would like the nomogram to be available , while the remaining two did not answer the additional question . due to updates in the recommended vancomycin trough concentrations and the lack of validated nomograms designed to achieve these new recommendations , research is currently focused on developing new nomograms to assist clinicians in dosing vancomycin . one nomogram for nonobese patients , and one nomogram was specifically modified for obese patients . the present study was designed to prospectively evaluate the combined nomogram and found the nomogram to be significantly more accurate when compared to traditional dosing completed by pharmacists at our institution . nomogram dosing was able to achieve therapeutic vancomycin troughs in a greater percentage of patients compared to traditionally dosed patients . the nomogram was also able to significantly reduce the incidence of subtherapeutic ( < 10 mcg / ml ) vancomycin trough measurements . this trend for under dosing in the traditional group , which was especially prevalent in the 1520 mcg / ml group was decreased when the nomogram was used as depicted in figure 2 . since subtherapeutic vancomycin troughs are associated with treatment failure and the development of resistance , this finding supports the implementation and use of the nomogram to help reduce the incidence of these unwanted , serious , and costly outcomes . in demographic analysis patients were randomly assigned to study groups so the reason for this difference is unknown . however , the average three - year age difference between groups is not considered clinically significant by the authors and does not affect the interpretation of the results overall . the acceptance and ease of use of the nomogram were also evaluated by surveying pharmacist 's impressions . at baseline , pharmacists were neutral or agreed with all statements asked . at the conclusion of the study , the most significant change seen was with regard to saving the pharmacists ' time . at baseline , pharmacists were neutral on this point . however , after nine months of using the nomogram , they agreed that the nomogram did save them time when compared to traditional dosing . it is essential with any clinical tool that the end user feel confident when using it and that it enhances rather than hinders daily work and patient 's care . our findings , which show broad acceptance and support of the nomogram , indicate that the nomogram enhances the pharmacist 's workflow in addition to being accurate . the current study also found a trend of improved accuracy of the nomogram among nonobese patients compared to obese patients . this finding was not surprising due to the fact that it was consistent with findings from the retrospective validation of the nomogram . the nonobese nomogram had a higher correlation coefficient in the retrospective study in comparison to the obese nomogram , indicating that it would be more likely to predict doses with a higher level of accuracy . the results of this study add to the current literature on the topic , which consists of few validated nomograms designed to achieve the new higher vancomycin troughs . in comparison to the nomogram developed by kullar et al . , which can be used to achieve troughs of between 1520 mcg / ml , the present nomogram can be utilized to achieve troughs of 1015 mcg / ml or 1520 mcg / ml depending on the patients indication for vancomycin therapy . also , the nomogram in this study , investigated the populations excluded from the study conducted by kullar et al . as stated in their limitations , the nomogram by kullar et al . did not include patients > 110 kg or with a creatinine clearance of < 30 ml / min or > 110 ml / min . our nomogram was studied in patients up to 120 kg and did not have an upper creatinine clearance cutoff for excluding patients . only patients requiring renal replacement therapy or those with unstable renal function were excluded in the present study on the basis of renal function . in addition , kullar et al . excluded critically ill patients , studying generally stable patients , a majority of whom were receiving vancomycin for empiric coverage . critically ill patients were included in the current study and constituted approximately 20% of each group . in comparison to the nomogram developed by devabhakthumi et al . , our nomogram is similar in design , utilizing weight to determine the vancomycin dose and creatinine clearance to determine the dosing interval . however , the devabhakthumi nomogram did not differentiate between obese and nonobese patients and also did not separate trough goals . a therapeutic trough in the devabhakthumi et al . study was considered appropriate if it fell anywhere between 1020 mcg / ml regardless of the patients ' indication for therapy . in contrast , our nomogram allows the clinician to choose the appropriate trough goal , 1015 mcg / ml or 1520 mcg / ml , based on the patient 's indication for therapy . study , in which 44% versus 45% of subjects were in the therapeutic range , respectively , and this may be due to our similar inclusion criteria which was very broad with few exclusion criteria , making the nomograms broadly applicable . study , 44% versus 58% , respectively , and may be due to the fact that the patients included in the kullar et al . thus , it is difficult to generalize the findings of kullar et al . to these populations the nomogram developed by thalakada et al . was designed to achieve troughs between 15 and 20 mcg / ml only , and a majority ( 86% ) of patients included in the nomograms development had normal renal function , with serum creatinine measurements less than or equal to 1.6 it is also important to note that rounding was permitted within the thalakada et al . therefore , a trough measurement of 14.9 mg / dl was not considered to be at goal if the trough range was meant to be 1520 mcg / ml , based on the patients indication . the use of rounding would have affected our results if we expanded our acceptable trough ranges . however , we chose to be strict in determining if a trough was therapeutic in order to provide a conservative estimate of the nomogram 's accuracy and applied this method to both treatment groups . first , it was an open - label study and pharmacists were aware of the group assignment for each patient . pharmacists were also aware that the accuracy of their dosing would be evaluated through the study , which may have influenced the time and attention that pharmacists gave to traditional dosing responsibilities . we may have also experienced interclinician variability , particularly within our traditionally dosed group . whether the more or less experienced pharmacists dosed a greater number of patients in our traditional group is unknown . if less experienced pharmacists dosed a greater number of patients , it is possible that the accuracy rate was lower than that if more experienced pharmacists completed a majority of the dosing consults . this potential error should have been minimized through the use of our standardized , step - by - step traditional dosing guidelines ( see supplementary material appendix 1 ) . however , by providing this step - by - step dosing form , we may have also inadvertently improved the accuracy of our traditionally dosed group . the form was designed and provided to ensure that simplicity in incorporating the study into the pharmacist 's daily work as well as to ensure all necessary information was provided for data collection . nevertheless , by providing this scripted form , pharmacists were provided with all necessary equations needed to appropriately dose vancomycin for their patient . if we had not provided this form , accuracy within the traditionally dosed group may have been lower than what was observed . the timing of trough draws and the administration times of vancomycin doses were also not always correct . at our institution , doses may be administered within one hour from the scheduled time , but doses administered outside this time cutoff are not uncommon . to control this factor , extrapolated troughs were calculated for all patients to ensure that patients were classified appropriately as to be in or out of goal . it is also important to note that the current nomogram can not be generalized to all populations . based on our exclusion criteria , efficacy is unknown for patients weighing greater than 120 kg , pediatric patients , and those with rapidly changing renal function . also , although we did not have a creatinine clearance cutoff for exclusion , we had few patients with creatinine clearance measurements of less than 40 ml / min . the nomogram has been validated , proven effective , and accepted as easy to use and time saving . it has been studied in a wide range of diagnoses , renal function , and weights , making it broadly applicable . utilizing the nomogram for dosing could make completing pharmacokinetic consults more efficient thus freeing pharmacists for other clinical functions . based on our current findings future studies should be focused on further development of the obese nomogram due to our weight cap in this study and due to the fact that the obese nomogram did not perform as strongly as the nonobese nomogram in the subgroup analysis . a novel vancomycin nomogram was prospectively validated and found to be more effective than traditional pharmacokinetic dosing . the nomogram , based off of weight and creatinine clearance , is adaptable and can be used in nonobese and obese patients , up to 120 kg . also , the trough goal can be set at 1015 or 1520 mcg / ml based off of the patient 's indication for therapy , making this a broadly applicable nomogram . subtherapeutic trough measurements were significantly less common with nomogram dosing , and the nomogram was found to be easy to use and time saving by pharmacists . implementation of the nomogram as the standard dosing protocol is warranted for our institution , but should not be used independently of clinical judgment .

plants are constantly exposed to microbes and counteract them by activating an innate immune response , including mechanisms of basal and race - specific resistance . a contemporary view of plant immunity proposes a model where the first line of active plant defense involves plant pathogen recognition through specific receptors , the pattern recognition receptors ( prrs ) that in turn recognize pathogen - associated molecular patterns ( pamps ) . classical examples of bacterial pamps are structural molecules such as bacterial flagellins , peptidoglycans , and lipopolysaccharides [ 25 ] . another example of a pamp is the harpin protein hrpz of the bacterial pathogen pseudomonas syringae . pti involves signaling through the second messenger cgmp [ 7 , 8 ] , mitogen - activated protein kinases ( mapks ) , ca and h influx , early accumulation of reactive oxygen species ( ros ) , cell wall thickening leading to papillae formation , and altered expression of pathogenesis - related ( pr ) genes [ 1 , 9 ] . successful pathogens are able to overcome pti by means of secreted effectors that suppress pti responses , resulting in effector - triggered susceptibility ( ets ) . such effectors are injected by pathogenic bacteria into the host cytoplasm through their type three protein secretion system ( ttss ) . effectors promote pathogenicity , and the ttss is essential for the development of disease symptoms and bacterial multiplication . because of their collective action , effectors are hypothesized to alter plant homeostasis in susceptible hosts and thereby sustain pathogen growth . such effector responses are caused , for example , by p. syringae effectors avrpto , avrrpt2 , and avrrpm1 that inhibit defense responses elicited by pamp recognition [ 11 , 12 ] . bacterial effector proteins such as members of the xanthomonas avrbs3 effector family have also been implicated in activating plant transcription [ 13 , 14 ] . the effector proteins avrb , avrrpt2 , avrpphb , hopptok , and avrpphe have been shown to modulate host signaling via salicylic acid ( sa ) , jasmonic acid ( ja ) , and ethylene , all of which have a role in plant defense . in response to this threat , plants have evolved r proteins which typically are intracellular receptor proteins of the nb - lrr type that recognize effectors in the cytoplasm thereby activating the so - called effector - triggered immunity ( eti ) . typically , the ability to trigger eti is pathogen strain or race - specific and is associated with programmed cell death , a response which is referred to as the hypersensitive response ( hr ) , and systemic acquired resistance ( sar ) in the host [ 1 , 9 ] . some of the best characterized r proteins are rps2 , rpm1 , and rps5 . these arabidopsis r proteins confer resistance to p. syringae carrying the bacterial effectors avrrpt2 , avrrpm1/avrb , and avrpphb , respectively , . in a recent report , different experimental data are integrated and novel interactions in plant immunity responses are proposed . regarding the distinction of pamps and effectors , one aspect of the current model considers that while pamps are widely conserved , effectors are specific to single or only a few related species . another issue of the contemporary immunity model is that whereas pamps are considered essential for microbial fitness and survival , effectors are considered to specifically contribute to virulence . however , several pamps also have a role in pathogen virulence ; examples include the bacterial flagellum and the hrpz harpin that play a role in virulence by affecting host membrane integrity . in agreement with the current plant immunity model , pamp receptors and resistance proteins ( prrs ) are evolutionarily ancient surface receptors conserved between species , and most r proteins typically are intracellular receptors that are evolutionarily relatively young with novel members continuously being discovered . nevertheless , some of the characterized r proteins display the typical properties of prrs and some of them may be relatively recent acquisitions [ 19 , 20 ] . another consideration is that not all effectors are recognized inside host cells and not all extracellular pathogen receptors recognize pamps through direct physical interactions . lastly , as mentioned above , the current model of plant immunity defines that responses of eti occur more quickly , are more prolonged , and are stronger than those of pti , suggesting that pti is a weak variant of eti . typically , eti is associated with an hr and sar , while pti is not . however , some pamps such as the hrpz harpin can induce hr in plants , demonstrating that the induction of hr can occur in other reponses different from eti.additionally , it has been observed that pamps also trigger sar in plants . on the other hand , taking into account all these considerations , it was proposed that the distinction between pamps and effectors , between pamp receptors and resistance proteins , and therefore also between pti and eti can not be uphold strictly . instead , it was hypothesized that there is a continuum between pti and eti and argued that plant resistance is determined by immune receptors that recognize appropriate ligands to activate defense , the amplitude of which is likely determined by the level required for effective immunity . worldwide , the diseases caused by pathogens in important crops greatly and negatively impact agricultural production and the environment . consequently , an understanding of the mechanisms by which plants resist bacterial infection or mount a successful defense response is vital since a better and more detailed understanding of the molecular mechanism of these interactions will eventually enable transgenic approaches that will contribute to minimizing the effects of many of the most devastating diseases . to gain an in - depth understanding of plant defense systems , there is a need to identify the diverse and complex signaling cascades and the multiple and interacting biochemical pathways activated by the pathogen . a number of studies addressing this complexity utilizing dna microarrays or dna chips have already been carried out with view to investigate the global changes in the transcriptome caused by pathogens [ 2426 ] . however , transcriptional changes are only a part of the response since they do not inform on posttranscriptional and posttranslational processes , protein activation , and turnover . this vital information can come from proteomics that allows monitoring differences in abundance of proteins present at the time of sampling and offers a window to study protein trafficking and routes of communication between organelles . thus , complementary approaches such as proteome - based expression profiling are needed to obtain a more complete picture of the regulatory elements in plant - pathogen interactions . here , we shall concentrate on some of the recent progress made in the use of proteomics to enhance the understanding of basal and specific host defense responses elicited by bacterial pathogens , since a wide range of more general aspects of proteome changes during plant - microbial interactions have been detailed elsewhere [ 2729 ] . the typical experimental design ( figure 1 ) for evaluating the actual proteome of plants undergoing different types of interactions with pathogenic bacteria consists of a number of sequential steps . plant material used in proteomics studies includes leaves , roots , and stems as well as calli and cell suspensions . plant tissue is inoculated with pathogenic bacteria or with bacterial components that constitute pamps or elicitors . while bacterial pamps trigger a defense response in the plant ( pti ) , effectors cause disease in susceptible plants ( ets ) or trigger eti mediated by r genes . protein samples with appropriate biological replicates obtained are separated in two - dimensional gel electrophoresis ( 2-de ) , generally followed by protein staining . the most frequently used protein stains are coomassie brilliant blue , silver nitrate , sypro dyes ( orange , red , tangerine , and ruby ) , deep purple , proq emerald ( for glycoproteins ) , proq diamond ( for phosphoproteins ) , cydyes / dige ( cyanine dyes / difference in - gel electrophoresis ) , and immunological detection . less common methods include negative zn - stain and radioactive isotopes . for the choice of detection method , important aspects should be taken into account such as sensitivity ( detection limit ) , dynamic range , linearity , reproducibility , protein - to - protein variability , and compatibility with identification methods [ 30 , 31 ] . protein spots selected from these gels have to be picked , trypsin digested , and subjected to ionization by electrospray ionization ( esi ) or matrix - assisted laser desorption / ionization ( maldi ) , both coupled to mass spectrometric ( ms ) analyses . subsequently , the peptide masses are used to query peptide mass databases in order to identify the proteins . moreover , multiple fluorescent protein labels used in different in - gel electrophoresis ( dige ) offer the possibility to compare the protein composition and abundance of two different samples within a single gel [ 32 , 33 ] . proteins in two samples are labeled in vitro through cysteine or lysine residues using two different fluorescent cyanine dyes differing in their excitation and emission wavelengths , but with an identical relative mass . differences in the two samples are detected after consecutive excitation with both wavelengths , overlay , and normalization of the images . even though 2-de techniques allow high protein separation capacity and the possibility of making large - scale protein - profiling experiments , issues concerning reproducibility are still a drawback in these procedures . it has been reported that proteins with extreme physicochemical properties ( size , isoelectric point , and transmembrane domains ) and those of low abundance are underrepresented by this method . in order to overcome such difficulties , new techniques based on liquid these techniques consist of two - dimensional liquid - phase chromatography that is based on a high - performance chromatofocusing in the first dimension followed by high - resolution reversed - phase chromatography in the second and one - dimensional 1-de - nanoscale capillary lc - ms / ms , namely , gelc - ms / ms , that combines a size - based protein separation with an in - gel digestion of the resulting fractions . between the lc - based strategies , there is a particular methodology , multidimensional protein identification technology ( mudpit ) , that allows the detection of a much larger number of proteins compared to gel - based methods . plants recognize pamps molecules on the surface of the pathogens by pattern recognition receptor proteins that are able to transduce signals that give rise to the innate immune response . a key goal of plant - pathogen interaction research is to decipher how the coordinated changes that cause pti occur . proteomics studies have been performed in plants during pamp - induced responses and they have proven valuable in unraveling the mechanisms that mediate the early events leading to the basal immune response . two of the most studied pamps are the gram - negative bacterial lipopolysaccharide ( lps ) and flagellin and its elicitor - active epitope , flg22 . exhaustive proteomics analyses of nicotiana tabacum cells elicited with lps extracted from burkholderia cepacia were done to identify cellular targets of the signal components induced by this molecule towards understanding the process of lps perception and subsequent signal transduction [ 38 , 39 ] . b. cepacia is not a tobacco pathogen , but the bacteria have a protective effect against subsequent inoculations with the pathogenic fungus phytophthora nicotianae and thus are considered a good candidate for studying elicitation of the immune response and in particular the proteins involved in lps - induced signaling . results obtained with cell suspension cultures were similar to those achieved with leaf discs and intact young leaves and hence provide an experimentally simpler and more reproducible system to do proteomics studies . qualitative and quantitative changes in phosphoproteins were analyzed using two - dimensional electrophoresis in combination with a phosphoprotein - specific gel stain . the identified phosphoproteins indicate that lpsb.cep-induced signal perception / transduction involves g - protein - coupled receptor signaling , ca / calmodulin - dependent signaling pathways , h - atpase regulation of intracellular ph , thioredoxin - mediated signaling , and phosphorylation of 14 - 3 - 3 regulatory proteins as well as phosphorylation of heat shock proteins , chaperones , and protein involved in biosynthesis and maintenance of nucleotide pools . in order to obtain more information about the dynamic changes following perception of bacterial lipopolysaccharides , proteomic and phosphoproteomic analyses identified 88 differentially regulated proteins and phosphoproteins that belong to five functional categories : proteins related to metabolism and energy - related processes ( 36 ) , molecular chaperones and protein targeting ( 12 ) , cell structure and cytoskeletal rearrangement proteins ( 8) , proteins involved in rna binding , protein synthesis and degradation ( 11 ) , and cell transporters , ion homeostasis , and signal transduction - related proteins ( 9).notably , proteins with a role in the citric acid cycle , amino acid biosynthesis , sugar metabolism , and nucleotide synthesis were upregulated , as well as mitochondrial enzymes including atp synthases . molecular chaperones and proteins involved in protein synthesis and maturation such as hsp60 , calreticulin , luminal binding protein ( bip ) , and protein disulfide - isomerase were also upregulated as a result of lps elicitation . this is consistent with the requirement for stabilization of proteins at intermediate stages of folding , assembly , vesicle trafficking , and secretion during the immune response . tubulins and actin showed increased phosphorylation , and this agrees with the dynamic reorganization of actin filaments and rapid depolymerization of microtubules observed in plant - pathogen interactions . in addition , lps treatment led to an increase of vacuolar h - atpase subunits , and it has been reported that vacuolar h - atpase activity is required for endocytic secretory trafficking in arabidopsis thaliana . proteosome components also displayed increased phosphorylation that may account for changes in protein stability or activation during the response . in the category of cell transporters , ion homeostasis and signal transduction , two porins from the outer mitochondrial membrane , showed increased phosphorylation , and this may suggest that increased transport of small molecules such as atp and adp across the mitochondrial outer membrane is an important response to lps . in addition , two gtp - binding proteins showed increased abundance and a gtp - binding protein and a g - protein subunit - like protein displayed increased phosphorylation after lps treatment , and this further supports the link between pamp and signaling through g - protein - coupled receptors . the results emphasize the importance of the intricate interplay between reversible phosphorylation events , as catalyzed by protein kinases and phosphatases , and the eventual identification and analysis of the complete set of proteins differentially phosphorylated in response to lps elicitation will provide new insights into defense signal transduction . many of the identified lpsb.cep-responsive phosphoproteins are known to be interconnected at many levels through a complex web of activation / deactivation , complex formation , protein - protein interactions , and chaperoning reactions . these studies thus provide novel insights and further evidence for the biochemical mechanism of lpsb.cep as a resistance elicitor , a pamp , and triggering agent of defense responses associated with innate immunity [ 38 , 39 ] . with a view to better understand signaling events downstream of the pamp molecules , the most interesting proteomics study was performed analyzing detergent - resistant membranes ( drms ) from a. thaliana suspension culture cells fractionated after the incubation with flagellin ( flg22 ) . the approach assumed that biological membranes form rafts in which proteins are associated with membranes in a dynamic manner and that differential stimuli can alter the raft proteome . consequently , the most appropriate method to study these rafts was judged to be the isolation of drms . the analysis of the arabidopsis flg22-responsive drm proteome revealed 64 proteins that showed significant enrichment and characteristics such as transmembrane domains , glycosylphosphatidylinositol anchors , or lipid modifications that are diagnostic for membrane proteins . the enriched proteins include receptorlike kinases , and in particular the flagellin receptor fls2 , hercules1 , and feronia , involved in cell elongation . the identified proteins belonging to other categories include plasma membrane h - atpases , ca - atpases , vacuolar h - atpases , different transporters , cell wall - related proteins , and proteins involved in cellular trafficking , metabolism , and stress / redox - related proteins . these results support the idea that flagellin treatment induces changes in plant plasma membrane compartmentalization . harpins are glycine - rich , cysteine - lacking , heat - stable proteins , secreted by the bacterial type three protein secretion system , that are able to trigger a hypersensitive response when infiltrated into nonhost plants . some harpins can bind to lipid bilayers and form ion - conducting pores , and it has been reported that they are secreted by the pathogen but not translocated into the plant cell , suggesting that they exert their function from the outside of the plant cell . this fact and the ability to elicit innate immune responses in plants in a mapk - dependent manner [ 49 , 50 ] led to proposing that harpins resemble pamp molecules . the effect of pseudomonas syringae harpins on mitochondrial proteins of a. thaliana suspension culture cells was also analyzed by proteomics . twenty - eight proteins were identified , and in combination with genome - wide transcriptional profiling , it was inferred that proteins from the citric acid cycle were upregulated pointing to an involvement of the mitochondria in the response to the harpin elicitor and a requirement for increased energy production during the defense response . among the significantly upregulated proteins are the citrate synthase , nad isocitrate dehydrogenase , nad - dependent malate dehydrogenase , the e1 subunit of pyruvate dehydrogenase , the atp - dependent protease clpc2 , the actin depolimerizing factor adf3 , glutamine synthetase , and glutathione s - transferase . in an attempt to evaluate the differences between pti , disease , and eti in the host - pathogen interaction model a. thaliana and pseudomonas syringae pv . leaves were either infected with wild type dc3000 ( susceptibility ) , the bacteria expressing the effector protein avrrpm1 ( dc3000 ( avrrpm1 ) ) that elicits an eti mediated by the cognate r - gene rpm1 , or a hrp mutant that elicits only basal responses . the analysis was restricted to total soluble protein , chloroplast - enriched , and mitochondria - enriched fractions . two antioxidant enzyme groups : the glutathione s - transferases ( gsts f2 , f6 , f7 , and f8 ) and peroxiredoxins ( prxa , b , and iie ) showed differences in abundance after different times of bacteria infiltration implying that antioxidant enzymes play a critical role in modulating redox conditions of infected tissue with both pathogenic and nonpathogenic bacteria . members of both enzyme groups showed multiple spots on gels that are consistent with specific post - translational modifications of these enzymes . regarding the gst group , gstf2 , gstf6 , and gstf7 changed in abundance after bacterial inoculations independently of the strain used , while gstf8 was the only gst to show specificity for the r - gene response . regarding the peroxiredoxins proteins , differential changes were observed with prxiie and to a lesser extent prxb after bacteria challenge . prxa did not show significant changes , however a lower molecular weight form of prxa ( prxa - l ) was reduced in response to wild type bacteria . this spot was further reduced when the plant was inoculated with the hrp mutant , pointing to a targeted proteolysis of prxa after the interaction with the pathogen and the possibility that this process is inhibited during the basal defense response . taken together , it appears that prxs and the antioxidants gsts all respond to bacterial treatment and that specific post - translational modifications in different proteins depend on the bacterial strain and the type of interaction . the authors also compared the protein and expression profiles for the corresponding gst and prx genes by affymetrix genechip analysis . in general , a good correlation was observed between proteins and transcript levels for the prxs but not for the gst family that undergoes post - translational modifications . this therefore provides new insight into the role of early post - transcriptional modifications in the specific response against plant pathogens and underlines the importance of proteomics analyses in understanding host responses at the systems level . in a further study [ 53 , 54 ] , a more complete proteomics analysis using the same experimental system could separate components of the basal defense ( leaves inoculated with a mutant in the hypersensitive response and pathogenesis ( hrp ) cluster ) from disease and resistance responses following dc3000 and dc3000 ( avrrpm1 ) inoculations . moreover , since the proteomics of total soluble protein , chloroplast - enriched , and mitochondria - enriched fractions were analyzed , the experimental design also provided insights into the spatial dynamics of the response . in this study , a total of 73 differential spots representing 52 unique proteins were successfully identified . the authors also correlated proteome changes with a transcriptomics analysis of the same response and observed that many of the changes in protein spot density occurred before significant transcriptional reprogramming between treatments was evident . overall , the work showed that proteins that were subjected to significant changes after bacterial interactions were representative of two main functional groups , namely , defense - related antioxidants and metabolic enzymes . components of the mitochondrial permeability transition such as mitochondrial porins appear to be modified early as part of the basal defense . general trends emerging from this broad study indicate that defense - related enzymes such as gsts , peroxiredoxins and superoxide dismutase ( sod ) , and metabolic enzymes , including components of the citric acid cycle , rapidly alter their abundance during basal defense responses . to date , experimental evidence suggests that pamp - induced responses modify the host proteome and in particular proteins with a role in primary metabolism , redox modulation , molecular chaperones , cytoskeleton rearrangement , and signal transduction . in addition , the pamp stimulus modifies mitochondrial and chloroplast proteome and reconfigures proteins in membrane rafts to enable efficient host signal transduction and downstream responses after the initial recognition . to colonize their hosts , bacteria need to coordinate population behavior , and this is achieved by the secretion of n - acyl homoserine lactone ( ahl ) to enable quorum sensing . using proteomics , the changes in medicago truncatula proteins exposed to bacterial ahls from the pathogenic bacteria pseudomonas aeruginosa were determined . comparisons of the response to the symbiotic bacteria sinorhizobium meliloti revealed that the abundance of proteins depends on ahl structure , concentration , and time of exposure . ninety - nine proteins could be identified and based on homology were grouped into the following categories : energetics and various primary metabolic activities , plant defense or stress responses , protein degradation or processing , flavonoid synthesis , plant hormone responses or synthesis , regulatory functions , and cytoskeletal elements . cytoskeleton - associated proteins such as actin - depolimerizing factor 2 and tubulin increased in abundance after 48 h of ahl treatment , and the rubisco small subunit increased after 24 h , reaffirming an involvement of cytoskeleton rearrangement and changing energy requirements during host interaction with the bacterial pathogen . the interaction between xanthomonas axonopodis pv . citri and citrus plants , that causes citrus canker , has also been examined by proteomics . the proteome modifications observed in citrus leaves infected with the pathogen include proteins related to carbon metabolism and photosynthesis , antioxidant proteins , and proteins related to stress responses and to plant protein trafficking . the most significant changes were observed in sugar - regulated photosynthetic proteins such as rubisco and rubisco activase as well as of atp synthase that were downregulated , while nadh dehydrogenase was upregulated in infected leaves . furthermore , an increase of proteins related to plant defense against the pathogen was found in x. axonopodis pv . citri treated leaves affirming that de novo biosynthesis of defense - related compounds is essential for the host , while other cellular activities are reduced , thus permitting a reduction in photosynthetic rates until pathogenic growth has been slowed down or halted . it has been proposed that such a reduction in photosynthesis may starve biotrophic pathogens of nutrients , thereby benefitting the host . citri encodes a plant - natriuretic - peptide- ( pnp- ) like gene ( xacpnp ) . pnps are a class of extracellular , systemically mobile peptides that elicit a number of plant responses important in plant homeostasis and growth . when xacpnp deletion mutants were infiltrated in citrus plants , lesions became more necrotic than those observed in the wild type infection , indicating that xacpnp is able to modulate host homeostasis to its own benefit [ 62 , 63 ] . citri lacking xacpnp and they showed a more pronounced decrease in photosynthetic proteins , while no reduction in defense - related proteins as compared to leaves infected with the wild type pathogen occurred . this indicated that xacpnp can serve the pathogen to prevent host photosynthetic shutdown during pathogenesis . further support for this hypothesis comes from the observation that infiltration of citrus leaves with recombinant xacpnp protein causes an increase in photosynthesis - related proteins . in summary , the proteomics studies with wild type xac , xacpnp deletion mutant , and recombinant protein support a role for the bacterial pnp in counteracting the shutdown of host photosynthesis during infection and the consequent maintenance of the host carbohydrate supply enabling prolonged biotrophic pathogen survival and colonization . again , proteome studies have afforded valuable insight into changes during the early onset of host - pathogen interactions that include cytoskeleton rearrangement and changes in the primary metabolism and that have far reaching consequences for the establishment of the disease . we also learn that the changes at the first stages are pronounced enough to leave a distinct proteomic footprint as part of the unfolding biotic stress response . an interesting proteomics approach was undertaken to study the bacterial wilt of tomato caused by ralstonia solanacearum that colonizes leaves , stems , and roots . the fact that roots from both resistant and susceptible tomato genotypes infected with r. solanacearum contained high numbers of pathogenic bacteria , while the population in the stem was significantly reduced in the resistant plant would suggest that differences in the proteomes might yield information about key components that underlie these observations . in an attempt to understand differences in host susceptibility firstly , the stem proteomes of the healthy plants of both genotypes showed no differences . nevertheless , differentially regulated proteins in the susceptible genotype in response to r. solanacearum inoculation were understood to have a role in plant defense . they are sth-21 , which is part of a small multigene family that is transcriptionally activated in potato upon infection and tsi-1 ( tomato stress induced-1 ) , an intracellular pr protein and also part of a multigene family activated during the defense response . an enzyme involved in oxidative stress was also induced , a putative lactoyl - glutathione lyase which , in conjunction with glyoxalase i and ii , is responsible for the detoxification of methylglioxal and other compounds formed as byproducts of carbohydrate and lipid metabolism . further , fructokinase and an atp synthase 5 subunit , proteins involved in carbohydrate metabolism and energy production , respectively , were induced upon infection . on the other hand , no proteins appeared differentially regulated in response to the bacterial pathogen in the resistant genotype , although the authors stated that the technique used ( classical 2-d sds - page combined with coomassie staining ) has some limitations regarding detection of less abundant proteins and suggested that enrichment of fractionations and/or silver staining would increase the resolution . subsequently , a similar proteomics study expanded the analysis to subcellular fractions such as the stem cell wall proteome . this approach was undertaken to simultaneously analyze the large spectrum of the stem cell wall protein associated both with susceptible and resistant tomato lines in the interaction with r. solanacearum . it was reported that in resistant plants , the spots corresponding to subtilase , peroxidase , bip , fructokinase-2 , nucleoside diphosphate kinase , and pii - like protein were more abundant as compared to mock inoculations . the spots annotated as bip , stress - induced protein , catalase , enolase ( 2-phospho - d - glycerate hydrolase ) , vacuolar h - atpase , oxygen evolving protein ( oee ) 2 , eukaryotic translation initiation factor 5a ( etif 5a)-3 , and etif 5a-4 appear to be decreased . in turn , in the susceptible species , the increased spots were peroxidase , peroxidase cevi16 , basic 30 kda endochitinase , triose phosphate isomerase , and a pr-5-like protein , while the decreased ones were -galactosidase ( -d - galactoside galactohydrolase ) , disulphide isomerase - like protein , xyloglucan endotransglucosylase - hydrolase7 , two etif 5a-4 , one etif 5a-1 , and two glycine - rich proteins . the main differences observed between susceptible and resistant plants were bip , three enolase , fructokinase-2 , nascent polypeptide - associated complex ( nac)-a - like protein 3 , and oee2 that are more abundant in the resistant species . the proteins that occurred at higher abundance in the susceptible species were -galactosidase , peroxidase , a hypothetical protein , ferredoxin - nadp reductase , oee1 , and eif-5a-1 . we may therefore conclude that both genotypes responded to ralstonia by elevating the expression of pr and other defense related and glycolytic proteins , whereas in susceptible plants , cell wall and metabolic proteins appear downregulated , while in resistant lines , the same happens with antioxidant , stress - related , and energy metabolism proteins . since , beyond the cell wall , plasma membranes are the first point of contact with the pathogen , and the proteins localized therein play important roles in signal transduction ; a recent study on plasma membrane proteins of oryza sativa suspension cells challenged with two strains of the pathogen xanthomonas oryzae pv . oryzae was undertaken with a view to elucidate the proteomes of the susceptible and resistant response . differentially expressed pathogen - induced proteins included a vacuolar h - atpase subunit , protein phosphatases , quinone reductase , prohibitin ( osphb2 ) , hypersensitive induced response protein ( oshir1 ) , zinc finger , and c2 domain proteinlike , universal stress protein ( usp ) , and a small heat shock protein , all of them are membrane proteins or membrane - associated proteins . alcohol dehydrogenase 1 and ascorbate peroxidase were also identified in the assay since they may have been coisolated with the plasma membrane fraction . most of these proteins showed similar patterns in response to both strains , and only a few showed discernible differential regulations . however , differences in protein abundance observed in the resistance model point to specific , albeit not yet well - understood roles of plasma membrane components in resistance responses . quantitative differences in the arabidopsis proteome challenged with p. syringae pv . tomato dc3000 and dc3000 ( avrrpm1 ) were also used to determine components of the resistance response [ 53 , 54 ] . some protein - folding and protein - binding components like 14 - 3 - 3 and cyclophillins changed in response to the ttss , and many redox - related systems were also responsive to avrrpm1/rpm1 interactions , including defense - related proteins such a gsts . significant changes in photosystem ii ( psii ) components were observed in the rpm1-mediated resistance indicating that psii may be a specific target of resistance signaling in response to avrrpm1 [ 53 , 54 ] . the modifications in the arabidopsis response to the effector protein avrrpm1 secreted by the pathogen p. syringae pv . the arabidopsis genome encodes a cognate r protein for avrrpm1 and another effector protein avrb termed rpm1 . the protein phosphatase 2c renamed as pia1 ( pp2c induced by avrrpm1 ) was detected in the transgenic line after fractionation and silver staining unmasking low - abundance proteins . pia1 was also upregulated following infection with the bacteria , and its rapid appearance suggests a role in early rpm-1 , mediated signaling . although pia1 transcripts did accumulate in response to avrb- or avrrpm1-expressing strains ; protein accumulation only occurred when avrrpm1 was present . this result clearly highlights the value of a proteomics approach in elucidating mechanisms involved in defense signaling and responses to specific effectors in particular . in this case , pia1 has been discovered to be a protein marker that allows to distinguish avrrpm1- from avrb - dependent activation of rpm1 . a further proteomics approach was conducted leading to a better understanding of the difference between the susceptible and the resistant response . the susceptible model was based on the interaction between a. thaliana and p. syringae pv . tomato dc3000 , while in the resistant one , a. thaliana was challenged with the same bacteria expressing the effector protein avrrpt2 , dc3000 ( avrrpt2 ) . in the resistant model , the abundance of several proteins involved in photosynthetic processes , including the large and small subunits of rubisco and rubisco activase , was reduced , while a number of proteins associated with host defense were accumulated . these included redox - related proteins such as oxidoreductase , quinone reductase , and a massive production of glutathione peroxidase as well as several other defense - related proteins . overall , these changes reflect a switch from primary metabolism to defense metabolism . on the other hand , the virulent infection did not appear to affect the stress metabolism , and only a few redox - related proteins seem differentially regulated . furthermore , several of the accumulated proteins function in protein folding , for example , peptidyl - prolyl cis - trans isomerase . in the same series of experiments , an a. thaliana s - nitrosoglutathione reductase mutant , impaired in nitric oxide ( no ) signaling , was used to demonstrate the importance of no in plant defense responses at the proteomics level . although the protein pattern obtained showed overlapping defense responses with wild type plants , in the no altered signaling mutant ; the most striking difference is the lack of change of photosynthetic process proteins and a reduction in stress - related and redox - related proteins relative to the wild type . these results therefore further affirm that proteomics is the most valuable tool for the evaluation of the complex mechanisms involved in host defense responses . bacterial canker of tomato is caused by the gram - positive bacterium clavibacter michiganensis subsp . michiganensis and is a devastating disease that proliferates in the xylem vessels of infected plants . however , several wild tomato species possess resistance to this pathogen , in particular accessions of the species lycopersicon hirsutum and l. peruvianum . in order to identify proteins expressed in response to c. michiganensis , a proteomics experiment was conducted comparing protein profiles of introgression lines containing two quantitative trait loci ( qtl ) , rcm 2.0 , and rcm 5.1 from l. hirsutum accession la407 with a susceptible control line . the three lines tested share 93.75% of their genome with l. esculentum , which is a susceptible species . the protein pattern was evaluated at 72 and 144 h post - inoculation ( hpi ) with the pathogenic bacteria and the accumulation of specific proteins was dependent on the genotype and time post - inoculation . three distinct sod enzymes were differentially expressed among genotypes in response to c. michiganensis subsp . in addition to the sod enzymes , a number of proteins involved in defense and stress responses were differentially expressed in the different genotypes . in genotypes , remorin is present as a single - copy gene in l. esculentum and is involved in cell - to - cell signaling , molecular transport , and the disease and wound response . remorin and phospholipid glutathione peroxidase were detected in inoculated plants of the genotype rcm 2.0 at 72 hpi and in all inoculated genotypes at 144 hpi , although the induction was marginal for phospholipid glutathione peroxidase . the pathogenesis - related protein pr-3 was differentially upregulated in resistant genotypes rcm 2.0 at 144 hpi . therefore , lines containing rcm 2.0 responded uniquely to the presence of c. michiganensis subsp . two additional defense - related proteins , a gst and a carbonic anhydrase , were found to be upregulated in both rcm 5.1 genotypes and control line after pathogen inoculation . differential expression of regulatory proteins was also detected in response to pathogen inoculation . a protein translation inhibitor , rna - binding protein , and s - adenosylhomocysteine hydrolase several proteins involved in carbon metabolism were reported to be downregulated in lines containing rcm 2.0 and rcm 5.1 . ribulose - phosphate 3-epimerase , rubisco activase , triose phosphate isomerase , and sedoheptulose-1,7-bisphosphatase were all downregulated in resistant lines . proteomics was also applied to compare differences between compatible and incompatible interactions mediated by an r protein in rice . java 14 seedlings inoculated with compatible ( xo7435 ) and incompatible ( t7174 ) races of x. oryzae pv . these proteins were categorized into classes relating to energy , metabolism , and defense . among the 20 proteins , the rubisco large subunit was fragmented into two smaller proteins in inoculations with both pathogens . protein changes after the treatment with jasmonic acid revealed that it mediated changes in abundance of five of the identified proteins . in particular , a thaumatinlike protein and probenazole - inducible protein ( pbz ) were commonly upregulated by both bacterial inoculations as well as ja treatment confirming that ja - dependent processes are involved in the defense of rice against bacterial blight caused by bacteria x. oryzae pv . these proteomics - based investigations are consistent with the view that susceptible and resistant plants have biochemically distinct response signatures and that some of these signatures are clearly diagnostic for specific responses . pathogenesis - related proteins , glycolytic proteins , specific plasma membrane and plant cell wall proteins , antioxidant proteins and redox - related proteins , some protein - folding or protein - binding components , stress - related proteins , and energy metabolism proteins are differentially regulated in susceptible and resistant plants . sod and gst regulations in the resistance to tomato bacterial canker and the protein phosphatase 2c in the arabidopsis response to p. syringae pv . tomato are examples of differentially regulated proteins . we also note that psii may be a component of the host response highlighting the importance of psii in rpm1-mediated resistance . further to the differential expression directly observed , the results obtained in these studies support the hypothesis that resistance mechanisms involve complex multifaceted interactions of proteins where their specific modulation and activation kinetics may play important roles that await further molecular analyses . the use of model systems has both significant benefits and limitations . in the case of a. thaliana , the benefits include the availability of the complete genome , many well - defined mutants , large repositories of transcription data in both wild type and mutants in the public domain , and many publicly available computational analysis tools . these tools help to infer gene function based on coexpression studies and enrichments in ontological categories of positively and negatively expressed correlated genes [ 76 , 77 ] . the availability of the complete genome also enables computational analyses of the promoter sequences of expression - correlated genes which in turn allow identification of enriched - transcription - factor - binding sites . this type of sequential computational analysis has been applied previously to support the interpretation of the data obtained in proteomics studies . in this case , differentially expressed proteins in response to a signaling peptide in citrus were first identified with proteomics . subsequently , the orthologs in arabidopsis were identified and used for the computational analysis in the model organism . the expanded analyses will allow us to infer functions of individual proteins based on the principle of guilt by association and provide clues on the temporal , spatial , and stimulus - specific nature of the responses . in fact , the value of any proteomics result is enhanced if it is considered together with transcriptomic results since it is precisely the differences in these responses that are diagnostic for responses that can not be properly understood by looking at the levels of proteins or rnas only . finally , given that signaling and/or activation through ( auto)phosphorylation is fundamental to cellular function , and intracellular communication in particular , phosphoproteomics has been developed and applied to elucidate plant responses [ 38 , 78 , 79 ] . the aim here is to resolve temporal and stimulus - specific phosphorylation events with a view to resolve global and quantitative changes in the phosphorylation status of individual proteins in the proteome . we can expect to gain most valuable insights from phosphoproteomics , particularly into the crosstalk between different stimuli and hormones . here again , the use of the arabidopsis model system will prove highly valuable since we have access to many hormone deficient and/or insensitive mutants , mutants that constitutively express defense programs or lack key components of the defense program . plant - bacteria interactions are highly complex since multiple bacterial factors and plant - signaling events take place , which ultimately define the susceptibility or resistance of the plant exposed to the pathogen . several recent and current investigations are directed towards gaining a better understanding of the molecular mechanisms implicated in basal and specific plant defense responses against plant bacterial pathogens . this review summarizes the use of proteomic approaches and insights from them that eventually will significantly impact our understanding of the molecular and cellular processes that govern host responses such as pti , ets , and eti . additionally , the detailed global comparison of response pathways using proteomics has allowed the identification of novel proteins whose biological role warrants in - depth biochemical and cellular elucidation . finally , a system - level understanding of biotic stress responses may identify promising novel targets for the development of cultivars with improved disease resistance .

malnutrition in hospital patients is a global concern : up to 50% of inpatients are malnourished or at risk for malnutrition.16 this is also true for the people s republic of china , where figures of undernutrition in hospital patients are close to 10%.7 in fact , the overall percentage of hospitalized patients at nutritional risk , about 40%50% , is very similar to that observed in western countries , as shown in a comparative survey of nutritional status conducted in 20062007 at a large hospital in the people s republic of china and one in the usa.8 in the people s republic of china and in other countries , malnourished patients fare worse than well - nourished individuals , recovering more slowly , with an increased risk of infection and mortality , and longer average length of hospital stay ( los).914 infections and longer los clearly result in excess resource consumption . appropriate interventions aimed at preventing and treating malnutrition can potentially reduce the infection rate , complications , and hospital los and improve survival , thus conferring clinical and economic benefits.15,16 in critical illness , enteral nutrition is often not feasible , sufficient , or indicated , and thus parenteral nutrition ( pn ) is required . parenteral lipid emulsions are an integral part of pn . traditionally , they are prepared with vegetable oils rich in omega-6 fatty acids , such as soybean oil , which tend to favor a proinflammatory state . more recently , the beneficial effects of pn enriched with omega-3 polyunsaturated fatty acids ( pufa ) , most commonly fish oils , have been demonstrated , especially in those conditions associated with inflammation , such as sepsis and pancreatitis.17 the potential of omega-3 pufa to favorably modulate inflammation and hasten recovery and hospital discharge is acknowledged in the latest nutrition guidelines , which recommend their use in pn for both intensive care and surgical patients.18,19 the aim of this study was to compare clinical and economic outcomes for omega-3 pufa - enriched versus standard lipid emulsions in the chinese icu setting , from the perspective of the patient and their family , reflecting the organization of the chinese health care system . we used a discrete event simulation ( des ) model based on efficacy data from an international meta - analysis and the people s republic of china - specific clinical and economic input parameters derived from an observational study conducted in a large hospital based in shanghai.17,20 the logical construct of the evaluation is based on estimating the effectiveness of the intervention by applying relative efficacy data from randomized controlled trials to patient outcomes as observed in real - world practice . the validity of this rationale will be tested by formal comparison of predicted data with data not used in the modeling exercise . the model was based on the des technique and developed in excel.21 two treatment arms were simulated and compared at patient - level : pn using standard lipid emulsions ( ie , those not enriched with omega-3 pufa ; standard arm ) versus pn supplemented by an omega-3 pufa - enriched lipid emulsion ( omegaven 10% fish oil [ fresenius kabi , bad homburg , germany ] ; omegaven arm ) . each simulated icu patient was concurrently sent to the omegaven and standard arms , ie , the simulation of the two alternatives ran on the same cohort . no discounting was applied to outcomes and costs due to the short time frame of the simulation , which covered only the duration of the hospital stay . the following events were considered : transfers between icu and ward , new nosocomial infection , discharge from the hospital , and death . in icu , three alternative options were possible : the patient could be transferred to a general ward , discharged directly to home , or die in the icu . for those in the ward there were two possibilities : either they could be discharged , or die ( figure 1 ) . the clinical input parameters for the control patient population were obtained by analyzing data collected at the department of general surgery , zhongshan hospital , fudan university , shanghai , people s republic of china , from january 2008 to december 2011 , as part of a clinical economic trial that has been previously described and published.19 the full dataset comprised retrospective records from 1,101 patients from the general surgery service receiving pn supplemented with omega-3 pufa - enriched lipid emulsions ( omegaven ) or standard pn ( with standard lipid emulsions ) and matched 2:1 based on sex , age , main disease , icu admission , and surgical procedure . the calorie requirements for icu patients in our institution are routinely calculated according to the guidelines of the chinese society for parenteral and enteral nutrition , ie , 2025 kcal / kg / d in acute stress period and 2530 kcal / kg / d thereafter . nutritional emulsion doses were calculated after taking into account the caloric contribution of infused propofol and dextrose and , in the intervention group , of the supplemental n-3 emulsion , in order to assure correct and comparable energy delivery in both groups . the subset of patients who were admitted to the icu ( n=443 patients ; 136 receiving omegaven and 307 not ) were included for the current analysis . according to the clinical protocol , as reported in the publication , the primary statistical analyses were conducted on the population that received at least one pn infusion and the secondary analyses on the population of only patients who received at least 5 days of pn , yielding comparable results.20 clinical outcomes ( mortality , infection rate , lengths of stay in ward and in icu ) of patients who were admitted to icu and received standard pn were used for modeling the standard arm , whereas for the omegaven arm , values were recalculated using the relative risks / los distributions derived from an earlier meta - analysis of data from 23 randomized controlled european trials in icu or elective surgery patients receiving pn ( n=1,502 ) . in this meta - analysis , omega-3 pufa - enriched lipid emulsions ( various formulations and combinations containing fish oils and/or omega-3 triglycerides ) were compared with standard nonenriched lipid emulsions ( soybean oil with or without olive oil or medium chain triglycerides ) . the vast majority of subjects included in this meta - analysis are surgical patients ( 1,395 of 1,502 patients).17 results revealed that omega-3 pufa - enriched lipid emulsions give a clear advantage in terms of infective complications and recovery times , as indicated by significant reductions in los in the icu and overall hospitalization duration . other beneficial effects of omega-3 pufa - enriched lipid emulsions included improved markers of inflammation , lung gas exchange , liver function , and antioxidant status . the clinical benefits of omegaven included in the model were the reductions in ward los , icu los , and infection rate in the icu subgroup ( n=762 ) . clinical inputs for the simulation model , alongside the distribution type from which the individual values for the patient - level simulation were sampled , are summarized in table 1 . unit cost inputs ( in renminbi , rmb , 2010 value ) for the model were obtained from regression analyses of cost data from the same chinese hospital dataset . costs considered were the total hospital cost billed to the patients / relatives , aggregated into the following categories : pn costs , antibiotics costs , drug costs ( also including antibiotics ) , and costs accrued in the icu ( including drugs and pn ) . our aim was to obtain the distributions of the cost of 1 day in ward , 1 day in icu , 1 day of standard pn , and 1 day of pn with omegaven as adjunctive lipid component and of 1 episode of nosocomial infection , in order to reflect the cost structure of the simulation model.22 to this aim , the full icu patient dataset ( ie , both arms , differently than in the clinical outcomes analyses ) was analyzed and total reported hospital costs were split into three categories : pn costs , antibiotics costs , and stay costs ( including all other cost items , detailed by icu and ward stay ) . the cost per day of pn was obtained by calculating individual ratios between pn cost and pn duration . to separate the antibiotic costs for prophylaxis from those for treatment of an infection , we formulated a linear regression model that specified total antibiotics cost as depending on the los in ward , the los in icu , and the occurrence of a nosocomial infection . in the simulation model , the cost of infection is limited to the extra antibiotics used for its treatment , disregarding any effect on los , which is already captured by the relative los estimate in the meta - analysis . the resulting mean costs for antibiotics used as prophylaxis in icu and ward , are added to the corresponding stay cost to obtain the full cost of 1 day in icu and ward , pn excluded . determination of the cost of stay was carried out by specifying total hospital cost ( antibiotics and pn excluded ) as depending on the los in ward and icu . probabilistic sensitivity analysis ( psa ) , to assess the effects of uncertainty surrounding the parameter values on the final results , was performed by drawing all parameter values from their probability distributions . the results predicted by the model were compared with actual data obtained from the patients in the hospital database ( ie , those used to feed the baseline clinical parameters and cost inputs of the model ) . of particular interest are the clinical results from the omegaven - treated patients , as these were not used in the modeling , thus permitting an external validation of the model s predictive accuracy . the model was based on the des technique and developed in excel.21 two treatment arms were simulated and compared at patient - level : pn using standard lipid emulsions ( ie , those not enriched with omega-3 pufa ; standard arm ) versus pn supplemented by an omega-3 pufa - enriched lipid emulsion ( omegaven 10% fish oil [ fresenius kabi , bad homburg , germany ] ; omegaven arm ) . each simulated icu patient was concurrently sent to the omegaven and standard arms , ie , the simulation of the two alternatives ran on the same cohort . no discounting was applied to outcomes and costs due to the short time frame of the simulation , which covered only the duration of the hospital stay . the following events were considered : transfers between icu and ward , new nosocomial infection , discharge from the hospital , and death . three alternative options were possible : the patient could be transferred to a general ward , discharged directly to home , or die in the icu . for those in the ward there were two possibilities : either they could be discharged , or die ( figure 1 ) . the clinical input parameters for the control patient population were obtained by analyzing data collected at the department of general surgery , zhongshan hospital , fudan university , shanghai , people s republic of china , from january 2008 to december 2011 , as part of a clinical economic trial that has been previously described and published.19 the full dataset comprised retrospective records from 1,101 patients from the general surgery service receiving pn supplemented with omega-3 pufa - enriched lipid emulsions ( omegaven ) or standard pn ( with standard lipid emulsions ) and matched 2:1 based on sex , age , main disease , icu admission , and surgical procedure . the calorie requirements for icu patients in our institution are routinely calculated according to the guidelines of the chinese society for parenteral and enteral nutrition , ie , 2025 kcal / kg / d in acute stress period and 2530 kcal / kg / d thereafter . nutritional emulsion doses were calculated after taking into account the caloric contribution of infused propofol and dextrose and , in the intervention group , of the supplemental n-3 emulsion , in order to assure correct and comparable energy delivery in both groups . the subset of patients who were admitted to the icu ( n=443 patients ; 136 receiving omegaven and 307 not ) were included for the current analysis . according to the clinical protocol , as reported in the publication , the primary statistical analyses were conducted on the population that received at least one pn infusion and the secondary analyses on the population of only patients who received at least 5 days of pn , yielding comparable results.20 clinical outcomes ( mortality , infection rate , lengths of stay in ward and in icu ) of patients who were admitted to icu and received standard pn were used for modeling the standard arm , whereas for the omegaven arm , values were recalculated using the relative risks / los distributions derived from an earlier meta - analysis of data from 23 randomized controlled european trials in icu or elective surgery patients receiving pn ( n=1,502 ) . in this meta - analysis , omega-3 pufa - enriched lipid emulsions ( various formulations and combinations containing fish oils and/or omega-3 triglycerides ) were compared with standard nonenriched lipid emulsions ( soybean oil with or without olive oil or medium chain triglycerides ) . the vast majority of subjects included in this meta - analysis are surgical patients ( 1,395 of 1,502 patients).17 results revealed that omega-3 pufa - enriched lipid emulsions give a clear advantage in terms of infective complications and recovery times , as indicated by significant reductions in los in the icu and overall hospitalization duration . other beneficial effects of omega-3 pufa - enriched lipid emulsions included improved markers of inflammation , lung gas exchange , liver function , and antioxidant status . the clinical benefits of omegaven included in the model were the reductions in ward los , icu los , and infection rate in the icu subgroup ( n=762 ) . clinical inputs for the simulation model , alongside the distribution type from which the individual values for the patient - level simulation were sampled , are summarized in table 1 . unit cost inputs ( in renminbi , rmb , 2010 value ) for the model were obtained from regression analyses of cost data from the same chinese hospital dataset . costs considered were the total hospital cost billed to the patients / relatives , aggregated into the following categories : pn costs , antibiotics costs , drug costs ( also including antibiotics ) , and costs accrued in the icu ( including drugs and pn ) . our aim was to obtain the distributions of the cost of 1 day in ward , 1 day in icu , 1 day of standard pn , and 1 day of pn with omegaven as adjunctive lipid component and of 1 episode of nosocomial infection , in order to reflect the cost structure of the simulation model.22 to this aim , the full icu patient dataset ( ie , both arms , differently than in the clinical outcomes analyses ) was analyzed and total reported hospital costs were split into three categories : pn costs , antibiotics costs , and stay costs ( including all other cost items , detailed by icu and ward stay ) . the cost per day of pn was obtained by calculating individual ratios between pn cost and pn duration . to separate the antibiotic costs for prophylaxis from those for treatment of an infection , we formulated a linear regression model that specified total antibiotics cost as depending on the los in ward , the los in icu , and the occurrence of a nosocomial infection . in the simulation model , the cost of infection is limited to the extra antibiotics used for its treatment , disregarding any effect on los , which is already captured by the relative los estimate in the meta - analysis . the resulting mean costs for antibiotics used as prophylaxis in icu and ward , are added to the corresponding stay cost to obtain the full cost of 1 day in icu and ward , pn excluded . determination of the cost of stay was carried out by specifying total hospital cost ( antibiotics and pn excluded ) as depending on the los in ward and icu . probabilistic sensitivity analysis ( psa ) , to assess the effects of uncertainty surrounding the parameter values on the final results , was performed by drawing all parameter values from their probability distributions . the results predicted by the model were compared with actual data obtained from the patients in the hospital database ( ie , those used to feed the baseline clinical parameters and cost inputs of the model ) . of particular interest are the clinical results from the omegaven - treated patients , as these were not used in the modeling , thus permitting an external validation of the model s predictive accuracy . unit costs obtained from the regression analyses ( table 2 ) and used for the simulation are summarized in table 3 . omega-3 pufa - enriched lipid emulsions reduce the infection rate ( 1,348 versus 1,962 infections per 10,000 patients ) and the time spent in the icu and in the hospital overall ( 24 versus 30 days ) . due to shorter los ( approximately 6 days shorter ) and lower infection rates in the omegaven arm , the costs related to hospitalization are reduced sufficiently to completely offset the extra treatment costs of 1,793 rmb . indeed , omegaven use results in overall mean cost savings of more than 10,000 rmb . omegaven is expected to dominate standard pn in this patient population , as it is associated with a mean increase in effectiveness with a concurrent decrease in mean costs . results of the 1,000 psa iterations are represented graphically on a cost - effectiveness plane in figure 2 . most observations ( 88% ) are in the south - west quadrant , indicating negative incremental costs and negative incremental infections , ie , showing dominance of the omegaven arm . all observations are reasonably close to the mean of model predictions and fall well within the 95% confidence interval ( ci ) of the values predicted by the psa . it appears that the estimated los differences are a bit conservative , at least when compared to this particular population of patients in the zhongshan hospital , whereas the observed cost difference is slightly lower than the predicted mean . in any case , the main findings of the simulation and of the observation coincide , indicating improved patient outcomes at reduced mean costs . there were no deaths in the studied patient population , which may be surprising in the icu , where mortality rates are generally high . however , these patients were elective surgery patients mainly admitted to the icu for monitoring and weaning . in this setting , mortality is generally less than 5% , according to both the elective surgery patient group examined by a large meta - analysis,17 and the official statistics in progetto margherita in italy , one of the largest icu outcomes monitoring systems that we are aware of.23 on the other , no effect on mortality of the intervention is factored in the model , so low mortality does not introduce bias in the incremental values , although it may affect absolute results . a further potential limitation of our analysis is that the relative effectiveness estimates applied to our patient population were derived from international studies conducted on a mixed icu patient population . applicability to chinese standards of care may not be immediately evident . also , we used omegaven , which contains 10% fish oil , in our model , whereas in the meta - analysis , patients received various omega-3 pufa - enriched lipid emulsions.17 nevertheless , we were able to compare the results predicted by the theoretical model with observed data from the chinese setting that were not used in the model . this external validation process greatly increases the credibility of these results , which in fact appears partially conservative , as they slightly underestimate the stay reduction observed in our patient population admitted to the icu . there is considerable clinical evidence to support the potential of omega-3 pufa - enriched lipid emulsions to favorably modulate the inflammatory response and , consequently , the outcomes of icu patients who can not be fed by the enteral route.17 their acquisition cost is higher than that of standard lipid emulsions , and this could potentially represent a barrier to their widespread adoption . this may be particularly true in the chinese setting , where the patient ( or their family ) is asked to pay out of pocket for hospital expenditures . an extra expense for a nutritional product , which may not be perceived as a crucial intervention , may be difficult to accept . however , the results of the present simulation indicate that this initial additional investment for omega-3 pufa - enriched lipid emulsions should not be of great concern for chinese icu patients , since besides hastening recovery , they have the potential to more than offset their extra costs , ultimately resulting in a net saving on the overall expenses for the hospital stay . in conclusion , the present results suggest that the appropriate use of omega-3 pufa - enriched lipid emulsions in pn regimens given to chinese surgical icu patients may induce a pattern of faster recovery and subsequent hospitalization cost reduction , as already expected in european settings.22 apart from peculiarities in terms of case mix and clinical practice , it is the underlying positive effect of their use on discharge times that drives the potential to reduce hospitalization costs . this effect can be seen as an overall indicator of the efficacy and safety of the intervention , as reported in the international literature and shown valid when applied to a chinese hospital setting.20 we therefore conclude that the extra costs of omega-3 pufa - enriched lipid emulsions in the icu population should not present a barrier to their use and that they should be offered to patients whenever clinically indicated , as their economic convenience goes alongside their clinical utility .

the technique is used for evacuation of fluid contents or administration of medicines ( fig . example injection administering medicine to a ganglion on the dorsal side of the wrist an advantage of ultrasound - guided ( us - guided ) procedures is the control of the needle insertion path and , if needed , the possibility to modify the needle depth or angle without the risk of damaging adjacent structures . when performing us - guided procedures , one needs to observe specific principles , which ensures effective and safe performance . first of all , when performing injection without assistance , an appropriate set of tools should be prepared . it should contain needles of various sizes , syringes , sterile gloves , ultrasound probe covers , skin antiseptics , dressing materials as well as medicines to be used and physiological saline ( fig . 2 ) . set of tools containing needles of various sizes , syringes , sterile gloves , ultrasound probe covers , skin antiseptics , dressing materials , medicines and physiological saline particular attention should be paid to aseptic principles regarding the patient , physician and used equipment . in standard ultrasound apparatuses , transducers are not resistant to the effects of disinfectants . a transducer prepared is such a way should be disinfected with spirit which in this situation , also serves as ultrasound conductor instead of conventional gel ( fig . 3 ) . us transducer protected by a cover the usage of sterile surgical drapes is optional , e.g. they are used when there are skin lesions ( psoriasis or atopic dermatitis ) in the direct vicinity of the puncture site . the presence of such lesions in the planned puncture site constitutes a direct contraindication to the procedure . drapes should also be used when longer intervention is anticipated , e.g. growth factor injections . prior to inserting a needle , it is necessary to thoroughly evaluate a given region by means of ultrasound in order to rule out the presence of any pathological changes ( tumors , foreign bodies and vascular or nerve pathologies ) ( fig . which , following a us examination , occurred to be a benign tumor ( lipoma ) . b. malignant tumor ( chondrosarcoma ) in the same region . both lesions formed similar , painless bulges on the outline of the proximal aspect of the crus subsequently , the us image should be optimized , which ensures convenience and accuracy of the procedure ( fig . in particular , one should remember about setting the depth parameter , level and number of foci as well as adjusting the grey scale to own preferences . in certain cases , when a needle is to be introduced in a direct vicinity of an artery , it is recommended to use the doppler option . it is important to plan the needle path so as to reduce the risk of damaging the vessels , nerves and tendons ( needle tip acts as a scalpel ) . one should also remember that there is no need for inserting the needle straight to the target site but it can be introduced diagonally a longer but safer course . example ultrasound image of the anterior and distal aspect of the forearm : a. image is not optimized ; b. image is optimized the assessment of a lesion , including its size , location and echogenicity ( indirectly indicating its density ) , is of great significance for the selection of an optimal needle ( fig . the length of the needle should be chosen based on the depth of the target structure ( fig . d ) and its thickness depends on the type of contents that are to be evacuated or introduced . thicker needles are better for evacuation procedures ( contents of joints , ganglia or bursae are frequently dense and gelatinous ; hematomas may be partially organized with a large amount of fibrin ) . when thick needles are to be used , the skin may be additionally anaesthetized with a thin needle . a needle for administering medicines should be as thin as possible but its diameter depends on the type of the injected medication . for instance , hyaluronic acid requires the application of a thicker needle but diprophos or celestone may be injected with a needle of lower diameter . set of needles of various lengths and diameters on the right hand side of the us monitor , there is a depth indication expressed in centimeters : a. hematoma after injury to the biceps femoris . b. forefoot with the intermetatarsal space ; c. knee joint space at the level of the body of the medial meniscus ; d. tibial nerve in the tarsal tunnel we distinguish two ways of inserting the needle depending on its position in relation to the transducer : transverse ( needle inserted at the middle of the probe ) and longitudinal ( needle inserted at the shorter edge of the probe ) . in the first case , the needle is visible as a shadowing dot and , as it passes through , shifting of tissues is observed . this method allows for needle manipulation ( changing the angle just after insertion ) without the need to alter the position of the transducer . the longitudinal insertion is undoubtedly much easier , especially for novices , since the monitor shows the shadow of the entire needle . however , losing its image each time the insertion angle is changed constitutes a disadvantage of this method . what is more , a continuous movement of the transducer is necessary when the position of the needle is modified ( fig . c ) . a. us image of a needle placed transversely to the longer transducer edge . c. needle parallel to the longer transducer edge and its us image in the background when administering medicines , one should bear in mind that they are released only through the middle part of the needle bevel . therefore , when medicines are introduced to a narrow space , the needle tip should be placed in a structure located behind the distal wall of this space ( in the case of the subacromial bursa , the needle tip should be placed in the region of superficial fibers of the supraspinatus tendon ) . the first drops should be administered slowly so as to make certain that the needle is placed in the right localization . if expansion of tissues adjacent to the intended space is noticed , the depth of the needle should be modified ( fig . measurement of the bevel of an injection needle ( 2.5 mm ) when the equipment has been prepared , access planned and needle chosen , the transducer may be put aside and the puncture site should be prepared in accordance with the principles of aseptics . a marker may be used to highlight the planned puncture site so as to avoid the necessity to search for it again ( fig . the position of a patient should be comfortable , stable and safe in case of fainting . the author in her own practice uses a lying position even if interventions are carried out in the arm . the physician should assume a position that guarantees stable support for the arm , elbow or wrist ( this particularly refers to persons with trembling hands ) . the space for the transducer cable should also be taken into account steroid - based medicines which are the most frequently administered by orthopedists are celestone , diprophos and depo - medrol ( fig . the presence of sepsis and local or intra - articular infections are direct contraindications to such steroids . indirect contraindications include : periarticular osteoporosis , coagulopathy , anticoagulants ( frequently , the only option of anti - inflammatory treatment is to administer steroids due to contraindications to oral nsaids ) and joint instability ( intra - articular administration of steroids may induce osteochondrosis and intensify instability by degeneration and weakening of the ligaments and joint capsule ) . medicines used for us - guided injections steroid - based medicines are a typical example of a two - edged sword . they are effective anti - inflammatory agents but cause a range of adverse reactions , such as : local reactions : infections and in some cases , arthritis;post - injection flare ( severe pain which begins within several hours from injection , lasts 23 days and subsides spontaneously);articular cartilage damage;skin atrophy related to adipose tissue necrosis ( persists for approximately 2 years ) and discolorations ( persist for approximately 1 year).systemic reactions : facial flushing in approximately 15% of patients ( lasts 23 days);feeling of general malaise , headache;increased steroids should not be administered prior to planned physical effort or surgical procedures;glucose metabolism disorder ( in patients receiving oral hypoglycemic agents , a change of the therapy to insulin may be necessary ) . local reactions : infections and in some cases , arthritis;post - injection flare ( severe pain which begins within several hours from injection , lasts 23 days and subsides spontaneously);articular cartilage damage;skin atrophy related to adipose tissue necrosis ( persists for approximately 2 years ) and discolorations ( persist for approximately 1 year ) . infections and in some cases , arthritis ; post - injection flare ( severe pain which begins within several hours from injection , lasts 23 days and subsides spontaneously ) ; articular cartilage damage ; skin atrophy related to adipose tissue necrosis ( persists for approximately 2 years ) and discolorations ( persist for approximately 1 year ) . systemic reactions : facial flushing in approximately 15% of patients ( lasts 23 days);feeling of general malaise , headache;increased catabolism;increased risk of injury ( due to intensified degenerative process ) and infection steroids should not be administered prior to planned physical effort or surgical procedures;glucose metabolism disorder ( in patients receiving oral hypoglycemic agents , a change of the therapy to insulin may be necessary ) . facial flushing in approximately 15% of patients ( lasts 23 days ) ; feeling of general malaise , headache ; increased catabolism ; increased risk of injury ( due to intensified degenerative process ) and infection steroids should not be administered prior to planned physical effort or surgical procedures ; glucose metabolism disorder ( in patients receiving oral hypoglycemic agents , a change of the therapy to insulin may be necessary ) . fluctuating blood sugar levels may persist for 34 weeks following the injection . other medications that are frequently used in orthopedic indications include local anesthetics . similarly to steroids , they are characterized by a range of contraindications , such as : anaphylaxis;treatment with mao inhibitors or tricyclic antidepressants ( simultaneous administration of local anesthetics may induce severe and prolonged arterial hypertension ) . treatment with mao inhibitors or tricyclic antidepressants ( simultaneous administration of local anesthetics may induce severe and prolonged arterial hypertension ) . maximum doses of local anesthetics equal 10 ml of 2% lignocaine or 20 ml of 1% lignocaine . the dose may be increased 2.5 times when epinephrine is also administered . one should remember , however , that local anesthetics exert toxic effects on chondrocytes and their toxicity increases when combined with epinephrine . it is also mandatory to avoid their intravenous or intra - arterial administration , even in the slightest amounts . by doing so , one may induce neurological side effects ( trembling , tremors , hyperventilation , apnea or convulsions ) or cardiac reactions ( arrhythmia or circulatory collapse ) . ultrasound guidance while inserting the needle allows for a safe medicine administration and evacuation of fluid contents . it improves the efficacy of such procedures by ensuring accurate needle insertion in the target site and subsequent medicine injection or evacuation of fluid contents . thus , it reduces the duration of treatment and minimizes pain ( procedures are usually performed with a single puncture ) . there is no need for blind lesion seeking and administering medicines into adjacent tissues is avoided . author does not report any financial or personal links with other persons or organizations , which might affect negatively the content of this publication and/or claim authorship rights to this publication .

iron deficiency anemia ( ida ) is prevalent and a major public health care issue [ 1 , 2 ] . ida has been associated with motor and cognitive developmental deficits in children and may be irreversible [ 37 ] . ida may have an even greater impact on select populations who are already at risk for intellectual and developmental compromise . down syndrome ( ds ) is the most common human aneuploidy with an approximate incidence of one in 800 live births . clinical manifestations of ds include cognitive impairment , craniofacial dysmorphism , gastrointestinal tract abnormalities , congenital heart defects , endocrine abnormalities , immunologic defects , and neurologic deficits associated with early onset dementia . regarding the hematopoietic system , children with ds frequently show macrocytosis , abnormalities in platelet counts , and an increased prevalence of leukemia [ 913 ] . similar to the general population , individuals with ds may be at risk for ida and its consequent complications . those studies which have been published often focused on a select population of children with ds and may not be representative of the general ds population . for example , awasthi et al . investigated the hematological profile of patients with ds who presented with initial manifestations of a hematological disorder to a genetics clinic . of the 239 children with ds who were examined over a 10-year period , 6.2% were found to have a hematological disorder . of those 6.2% only 4 of the 239 children in the study ( 1.7% ) were found to have anemia . these tests revealed the prevalence of anemia to be no different from the general neonatal population . the authors suggested that anemia in this age group may be more of a reflection of either maternal iron stores or delivery - related newborn blood losses . performed blood counts and iron studies on 114 children with ds and found ida in 3% and i d in 10% , comparable with their prevalence in the general pediatric population . the paucity of data on the prevalence of anemia in ds patients of different age groups and the deleterious consequences associated with ida lead us to investigate the prevalence of anemia in this population and the specific risk factors associated with ida in children with ds . during 20042007 , 149 children and young adults with ds were seen at the center for down syndrome at the hadassah mount scopus university medical center , and these individuals were included in the study . the center for down syndrome serves the entire population of israel , and patients from the predominantly arab neighborhoods of east jerusalem are actively recruited as part of a cooperative ( israeli / palestinian physicians ) community - based program to enhance the care of children with ds from all ethnic backgrounds . as such , the center 's patient population is representative of the general population of the region . the study protocol was approved by the hadassah - hebrew university institutional review board ( helsinki committee ) . the study was prolective , with the patient population and data parameters defined before data acquisition . the patient population included children and young adults with ds aged 020 years at their first visit to the center ( before any intervention ) . patients were eligible for the study if they had a complete blood count ( cbc ) performed as part of their evaluation or had undergone blood testing within 3 months of their visit ( as part of the center 's protocol , we request that parents or patients bring recent laboratory results ) . it should be noted that all laboratory studies for outpatients in israel ( there is universal health coverage for israeli citizens ) must be approved by the patient 's health maintenance organization ( hmo ) , and hmos have different policies regarding approval of laboratory testing . a subgroup of 38 children also had iron studies ( iron , ferritin , and transferrin levels ) either performed at our center or at the child 's hmo . information collected for the study included birth history , initial nutrition , motor development , congenital malformations , and ds - related complications ( e.g. , feeding disorders , oropharyngeal hypotonia , etc . ) . height and weight measurements were analyzed in the context of growth charts developed for individuals with ds . the nutritional status of the patients was assessed , and every patient was evaluated for the presence of a feeding or nutritional disorder by the center 's dietitian and speech therapist . all hematinic study data was analyzed in terms of established age appropriate norms based on the nhanes iii . data was entered into a spreadsheet and imported to the spss statistical program ( spss 15 , chicago ) . both nonparametric and parametric associations between categorical variables were explored using the test or fisher 's exact test . categorical variables found to be associated with anemia in univariate analysis were further analyzed in a logistic regression model . during the years 20042007 , 303 children and young adults were evaluated as first - time patients at the center for down syndrome . of these , 149 ( 49.0% ) there was a greater proportion of males which is to be expected , as there is male predominance among patients with ds . the division between jewish and arab patients was close to the population distribution in the region . more than half the patients had heart defects , feeding disorders , and motor delay . with regard to feeding disorders and delayed walking , not all parents could recall this information or children had not reached an age at which this could be determined . the overall prevalence of anemia in our study group was 8.1% ( table 2 ) . the proportion of children with anemia increased with age , with 13.7% of children over the age of 10 years having anemia . likewise , the number of children having blood hemoglobin that was lower than the published nhanes iii averages for different age groups increased with age . iron stores as measured by serum ferritin indicated that nearly all children ( 26/27 ) tested had below normal levels for age . in contrast , 26 children had their serum transferrin measured , and their levels were normal for their age . in univariate analysis , it was found that age , ethnicity , weight , and motor development were related to an increased risk for anemia . height , history of feeding disorder , or congenital heart defects did not increase the risk for anemia . to determine the adjusted odds ratio for anemia , weight also had an impact on anemia , with the rate of anemia decreasing by 0.03 with every increase by one percentile in weight . interestingly , an association between motor development and below average hemoglobin concentration for age was found . when looking at the age of independent walking in 53 children , a lower than average hemoglobin for age was more prevalent among those who started walking after the age of 2 years ( 53.1% versus 24.0% , p < 0.05 ) . ida is relatively common in the general population , and in many countries and states , there are screening programs to identify children with anemia . the reason for the heightened concern regarding anemia is that ida has been associated with motor and cognitive developmental deficits in children [ 37 ] . in children with ds , whose intellectual capacity is compromised to begin with , utmost attention should be given to preventing anemia and its potentially deleterious developmental consequences . in the present study , we show that the prevalence of anemia in a general population of children with ds is 8.1% , with the rate increasing with age . there is a question of whether the relatively high rate of anemia in our population is unique to ds or more a reflection of the general population . review of studies done in the general israeli population shows that ida is an endemic problem ( similar to other countries in the middle east ) [ 1724 ] , and it appears that the rates of anemia for patients with ds in our clinic population were lower than those of the general population . for example , meyerovitch et al . found anemia to be as high as 15.5% in 918-months old infants . fraser et al . found a similar prevalence of 15% among jewish children and approximately 25% among bedouin children . it should be noted that the great variability between studies may represent regional differences and different criteria for defining anemia . the higher prevalence of anemia among arab children with ds reflects a more wide - ranging trend among the general population . found a higher prevalence in arab children : among jewish children , the rate of anemia was 44.3% from birth to 6 months and increased to 60% from the age of 6 months to one year . for similar age groups in the arab population , similar differences between groups have been noted in other studies [ 18 , 23 ] . it is possible that ethnic and religious differences related to anemia are secondary to socioeconomic factors which have an impact on adherence to health ministry recommendations regarding iron supplementation . the association that we found between low weight and anemia supports the hypothesis that inadequate nutrition may contribute to ida and even explain some of the differences found between different ethnic populations . cause and effect are difficult to determine , as severe iron deficiency alone may cause anorexia and poor weight gain . other factors , such as various chronic diseases which are more prevalent in ds may also contribute to anemia . as part of our initial evaluation of the participants , we ruled out celiac disease , thus excluding this condition as a contributing factor to ida . however , it is possible that feeding disorders , which are common among children with ds , may have caused nutritional deficits leading to anemia . the prevalence of anemia is declining among the general pediatric population in israel [ 21 , 22 ] . public health initiatives have played a role in lowering the rate of anemia , and children with ds have most likely benefited from these interventions which include iron supplementation for all children aged 4 months to one year , with continuation of supplementation if the cbc at one year of age indicates anemia . the results of iron studies were available for only 38 of the 149 children we evaluated for anemia in this study . thus , we can not truly characterize the anemia we found as ida , or identify risk factors associated with iron deficiency . we are further limited in this by the presence of relatively high mcv in this population , as discussed further below . however , as iron deficiency is the most common cause of anemia in all age groups worldwide , and in the absence of other proven causes of anemia in our study population , iron deficiency remains the most likely cause of the anemia found in this study . the study population consisted of children who are in the care of the center for children with down syndrome . it is possible that they do not adequately represent the general population of children with ds in israel . our population may overrepresent families with high compliance for medical followup and treatment , and for this reason , they may have a lower prevalence of anemia than other children with down syndrome . on the other hand , children with relatively mild manifestations of ds may be underrepresented in our clinic so that our study population is biased towards children with more severe manifestations of ds which may impact the rates of anemia . an interesting finding in our study was the tendency to macrocytosis in all age groups . macrocytosis is a common finding in children with ds and has been widely reported [ 16 , 2729 ] . macrocytosis is not related to vitamin b12 or folic acid deficiencies , and most likely , there is a metabolic or genetic reason for the macrocytosis . as a result , there may be difficulty in completely characterizing ida due to macrocytosis . the clinical significance of this point is that the iron status of children with ds should be monitored by both serial cbcs and iron studies . the prevalence of ida in children with ds does not greatly differ from the general population . nevertheless , children with ds and ida might be more susceptible to the effects of anemia based on the fact that they already have ds - related deficits in motor and neurocognitive development . since ida is an easily preventable and treatable problem when diagnosed in a timely manner , it is important to monitor children with ds by periodically performing a cbc and measuring iron stores .

coronary artery bypass grafting ( cabg ) is one of the most common treatments used to relieve the pain of coronary artery patients , prolong their life , and improve their quality of life ( qol ) . previous studies reported that cabg , due to relieving pain and disease signs , improving patients function , and leading to an increase in their participation in physical exercises , led to higher qol of these patients after surgery . meanwhile , other studies showed that some patients did not experience improved qol after surgery . about half of the patients have been reported to suffer from depression and some other psychological problems after cabg , which is attributed to impaired function , an increase in the level and duration of pain , more re - hospitalizations , and increased morbidity and mortality , which consequently lead to a reduction in their qol . it seems that psychosocial interventions due to their effects on pain , severe anxiety , anger and , depression could improve the patients qol ; however , there is no strong evidence supporting that psychosocial interventions could improve the cabg patients qol , because they often suffer from functional impairments . existential approaches as one of the psychosocial interventions have been adopted to improve function in patients . logotherapy is one of these approaches through which the patients are helped to find a new meaning for their miserable life events to have more adaptation with the disease . shoaa - kazemi and saadati reported that education based on logotherapy reduced hopelessness in women with breast cancer . in another study , group logotherapy led to increase in life expectancy and general health in adolescent girls suffering from thalassemia . positive effects of this approach have been reported on depression and hopelessness in the disabled with a spinal cord injury . moreover , some other researchers tried to investigate the effect of interventions with the approach of logotherapy , specifically on increase in qol . for instance , kang et al . and kang et al . reported that logotherapy improved qol in adolescents with cancer , and mosalanejad and koolee also supported the benefits of this approach in distressed infertile women . in spite of various studies supporting the beneficial effects of logotherapy - based interventions on improvement of patients functions and finally their qol , there was not any convincing evidence on the effects of this intervention on the qol of cardiac patients after cabg . as such an approach could be applied and potentially accepted by the nurses to improve the patients qol , this study was conducted to evaluate the effect of education , based on the main concepts of logotherapy approach , on the cabg patients qol . this is a quasi - experimental study with a two - group and pre - test post - test intervention conducted on patients undergoing cabg in the surgery ward of chemran university hospital in isfahan in 2013 . inclusion criteria were age over 35 years , ability to attend the project , passing recovery period 12 months after cabg , no previous education of logotherapy , and subjects personal interest to attend the study . based on the medical evidences and files , it was ensured that the patients had no diagnosed mental diseases , mental ret ardation , blindness , deafness , and alzheimer at the time of their participation in the study . the subjects who lost interest to participate in the study or were absent for two sequential sessions of educational intervention due to any reason were excluded . sample size was primarily calculated as 54 subjects based on consultation with statisticians and with regard to previous studies . considering subjects dropping out of the study , sample size was finally calculated as 75 subjects , who were conveniently recruited from oct to jan 2013 from among the patients who had undergone cabg surgery and were referred to the surgery ward of chamran university hospital in isfahan . the content of the program comprised an educational booklet based on frankl 's logotherapy theory , collected and designed by the research team from the relevant literature [ table 1 ] . content validity of the booklet was approved by 10 expert people ( 6 psychologists and 4 psychiatric nurses ) . the training sessions were mainly conducted by the principal researcher ( m. m. ) who was an experienced nurse . however , he was continuously supervised by his advisors and sometimes by some other experienced psychologists who were not members of the research team . content of logotherapy approach education program ( duration of each session was 90 min ) both groups received routine cabg post surgery education . in the intervention group , the educational sessions were held in the form of six 90-min sessions twice a week based on the studies of kang et al . and shoaa - kazemi and saadati . the educational program was carried out with quite similar conditions such as the educator , environment , temperature , light , etc . lecture , question and answer , and group discussion were adopted to present the educational materials . at the end of the educational sessions , a brief educational booklet , related to each session , was given to the subjects . after completing the research period , they received the educational booklet and related electronic file . the first section contained subjects demographic and clinical characteristics that were collected by questioning the patients and their accompanying persons as well as referring to their medical records . in the second section it has eight dimensions of general health ( 6 items ) , physical functioning ( 10 items ) , role physical ( 4 items ) , role emotional ( 3 items ) , bodily pain ( 2 items ) , social functioning ( 2 items ) , vitality ( 3 items ) , and mental health ( 6 items ) . the scores range from 0 to 100 in each domain , so that score 0 shows the worst and score 100 shows the best condition in each domain . failde and ramos accredited this questionnaire in coronary artery disease patients and reported its high internal consistency ( cronbach 's alpha = 0.720.94 ) . reliability of persian version of this questionnaire , measured in the study of dehdari et al . through precede - proceed method with a 2-week interval , was reported to be 0.76 ( r = 0.76 ) . the questionnaire was filled in both groups at the beginning and 50 days after intervention in similar conditions . participants signed an informed consent and were given written information and were ensured that their participation would be voluntary . participants signed an informed consent and were given written information and were ensured that their participation would be voluntary . in the present study , out of 121 qualified patients who met the inclusion criteria , 75 signed a written consent form to attend the study . after random allocation , there were two groups of intervention ( n = 40 ) and control ( n = 35 ) . during the study , meanwhile , one subject in the intervention group and three in the control group did not refer for the post - test . results showed no significant difference in age , sex , marital status , occupational status , level of education , and level of income between the two groups before intervention . most of the subjects were married , and were mostly working or retired . also , we compared clinical indexes such as history of hypertension , length of hypertension , history of diabetes and its length , history of smoking and its length , history of hyperlipidemia and its length , history of hospitalization , and history of angioplasty in the two groups . chi - square and t - tests were used to compare the two groups and did not show any significant difference in clinical indexes between them ( p > 0.05 ) . demographic characteristics of the patients in the intervention and control groups for more confidence of analysis , skewness and kurtosis indexes were calculated , which showed a normal distribution in the entered variables . in addition , in order for homogeneity of the groups , they were compared concerning the scores of qol dimensions and its overall score . independent t - test showed no significant difference in mean [ standard error ( se ) ] scores of physical functioning , role physical , role emotional , vitality , mental health , social functioning , bodily pain , and general health , as well as overall qol between intervention and control groups before intervention ( p > 0.05 ) . table 3 represents the mean score changes se of qol dimensions and overall qol ( before and after intervention ) in the two groups . there was a significant difference in mean score changes between the two groups in terms of six dimensions of qol including role emotional , vitality , mental health , social functioning , bodily pain , and general health before and after intervention ( p < 0.05 ) [ table 3 ] . meanwhile , no significant difference was observed in the two dimensions of physical functioning and role physical ( p > 0.05 ) . the findings showed a significant increase in mean score change of overall qol after intervention in the intervention group compared to control ( p < 0.001 , df = 39.1 , t = 5.04 ) . comparison of changes in mean ( se ) scores of qol dimensions and its overall score in the two groups 1 month after intervention the goal of the present study was to investigate the effect of education , based on the main concepts of logotherapy approach , on the cabg patients qol . the results showed that mean score changes of six qol dimensions and overall qol significantly increased in the intervention group . meanwhile , no significant difference was observed in the two dimensions of physical function and role play limitation due to physical reasons between the intervention and control groups ( although mean scores changes were more in the intervention group ) . although the present study shares some specific results in this topic , some parts of the results are in line with other similar studies , all of which are discussed . in support of the usefulness of logotherapy - based interventions in vitality and general health , gholami et al . investigated the effect of logotherapy among the thalassemic girls and reported that it was effective on subjects life expectancy and general health . although their study was not carried out on cabg patients , their results have strengthened the proposition of logotherapy - based interventions to be as useful to improve some parts of qol . in another study that was conducted by ho et al . ( 2010 ) in hong kong , the results supported the positive association between adolescents meaning in life and their optimism and well - being . this result may support the usefulness of improving peoples meaning in life , which is the main theme of logotherapy , in increasing the sense of well - being , which is known as an indicator of mental health . reported that group logotherapy interventions could effectively influence mental and psychological dimensions in patients with life - threatening diseases , such as cancer patients . nevertheless , future researches are necessary to investigate the effect of logotherapy - based intervention on the cabg patients mental health . another finding of the present study , the usefulness of the logotherapy - based intervention on the patients physical functioning , is not supported by reports in literature . likewise , de leon et al . investigated the effect of a psychosocial intervention based on cognitive therapy , compared to common care on the qol of 2481 patients after myocardial infarction ( mi ) . six months after intervention , it was found that those interventions had a positive effect on the mental health dimension of qol while they had little effect on the physical dimensions of qol , and overall qol had improved a little . moreover , fakhar et al . also reported that group counseling with a logo - therapeutic approach led to an increase in mental health and social action of older adult women , but had no notable effect on their physical complaints . likewise , la pier reported that the physical components of qol showed no notable improvement 6 months after cabg , compared to the mental components . it seems that psychosocial interventions tend to improve psychosocial functioning and psychosocial dimensions of qol , rather than its physical dimension . a potential justification is that physical functioning dimension of qol is associated with the level of the patients physical activities and surgery - related complications , and therefore , the process of recovery is longer in this dimension . la pier reported that an improvement in physical dimension of the qol is a gradual process and takes about 1 year time . nevertheless , further studies are needed investigating the usefulness of psychosocial interventions in the cabg patients physical functioning . the present study also supported the improvement of social functioning following psychosocial logotherapy - based intervention . it seems to be a desirable finding , although there are some contradicting evidences . for example , in ghanbari and goudarzi 's study , the social dimension of general health did not improve in the distressed women by group counseling with a logotherapy approach . such disparities of evidences may be attributed to different study samples , study contexts , and particular effects of cabg on the patients qol . therefore , there is a need of particular and tailored interventions to meet these patients health needs . this study is faced with some limitations , such as small sample size , which could limit the generalization of the findings . future studies with large sample sizes and in a variety of contexts are need to ensure the optimal effects of logotherapy - based education intervention on all dimensions of the cabg patients qol . the present study showed that educational interventions , based on the main concepts of logotherapy , led to an improvement in patients qol after cabg . it is recommended to combine such education with routine education of the patients undergoing cabg . future researches are also suggested to ensure the usefulness of psychosocial interventions like logotherapy - based education on the physical dimension of the cabg patients qol . this article was derived from a master thesis of mostafa mahdizadeh , with project number 392400 , isfahan university of medical sciences , isfahan , iran . the authors would like to thanks all participants of the study and also the isfahan university of medical sciences for its financial as well as scientific support .

laserassisted tattoo removal has wellknown limitations . often a lengthy regimen of many treatment sessions is required . although a scale has been described that estimates the number of required sessions 2 , it is often difficult for the clinician to predict the number of treatment sessions required for satisfactory tattoo fading or clearance 3 . it is not uncommon that 10 or more sessions at 4 to 6week intervals are required for a proper aesthetic result . this poses significant challenges for subjects and clinicians alike , and is often an inhibiting factor for subjects desiring tattoo removal from actually obtaining it . the r20 multipass technique initially showed promise by allowing several laser passes in a single session by permitting the laserinduced opaque whitening caused by the generation of microcavitation bubbles to naturally subside in approximately 20 minutes 4 . this technique has not been widely adopted largely due to workflow limitations ; one patient could require an 80minute treatment session which is impractical in a busy clinical setting . recently , it was demonstrated that perfluorodecalin ( pfd ) could rapidly dissipate the opaque , white microbubble layer formed after exposure of tattoos to qswitched lasers , allowing clinically efficient multipass treatment 1 . to this end , the present qualitative pilot study was undertaken to determine if rapid multiple laser passes at highest tolerated fluence enabled by a transparent pfdinfused silicone patch might have a similar beneficial effect for laser tattoo removal . perfluorodecalin is a stable , metabolically inert fluorocarbon liquid that has excellent optical transparency from the uv to the farir 5 . it has the unusual properties of simultaneously being both lipophobic and hydrophobic , yet it is freely flowing with an extremely low surface energy that allows it to rapidly wick into porous materials . its intraocular use assists in the repair of detached retinas . it enhances cosmetic preparations as a skin conditioner and hair detangler , but its high cost has limited more general use . a wellknown property of pfd and similar perfluorocarbons is their ability to dissolve gasses 6 . pfd can absorb half its liquid volume of gaseous oxygen as well as other gases such as nitrogen and steam . this led to its use in firstgeneration artificial blood substitutes as well as ongoing work in liquid ventilation and related medical applications 6 , 7 . since the partial pressure of gas in laserinduced microcavitation bubbles is well above the partial pressure of atmospherically equilibrated pfd , the diffusion of gas from microbubbles into liquid pfd requires no special handling or degassing requirements . although it is a heavy molecule with approximately twice the density of water , pfd readily evaporates when exposed to room air , an effect exacerbated by warm skin . covering it with a transparent impermeable membrane there are also optical indexmatching benefits to both the pfd and to the silicone material described below . a solution to this problem was simply to perforate medicalgrade silicone gel with a multiplicity of fine holes , and allowing the pfd to mechanically reside in them . pfd rapidly wicks into the perforations , and then readily wicks back out onto the surface of the skin . the index of refraction of human epidermal tissue was measured by ding et al . to vary from 1.44 at 600 nm to 1.42 at 1064 nm 8 . the indices of refraction of perfluorodecalin and the transparent silicone material are 1.31 and 1.40 , respectively . this provides good optical index matching that allows efficient coupling of laser light into the skin despite the presence of the liquid pfd and the silicone patch itself . littlejohn et al . have recently exploited this effect in a striking series of confocal microscopy studies of plant leaves 9 . when an opaque plant leaf plant leaf is briefly immersed in pfd , it becomes sufficiently transparent to read text through it . the optical clearing effect of the pfd patch may have significance in laser tattoo removal for several reasons . the reduction in optical scattering allows more photons to penetrate into the skin to interact with deeply residing ink particles , and reduces the local fluence near the skin surface compared to more highly scattering conventional treatment . this effect would also reduce potentially damaging epidermal thermal effects by reducing heat generated superficially by the laser , as well as thermally coupling heat that is generated into the bulk material of the silicone . perfluorodecalin is a stable , metabolically inert fluorocarbon liquid that has excellent optical transparency from the uv to the farir 5 . it has the unusual properties of simultaneously being both lipophobic and hydrophobic , yet it is freely flowing with an extremely low surface energy that allows it to rapidly wick into porous materials . its intraocular use assists in the repair of detached retinas . it enhances cosmetic preparations as a skin conditioner and hair detangler , but its high cost has limited more general use . a wellknown property of pfd and similar perfluorocarbons is their ability to dissolve gasses 6 . pfd can absorb half its liquid volume of gaseous oxygen as well as other gases such as nitrogen and steam . this led to its use in firstgeneration artificial blood substitutes as well as ongoing work in liquid ventilation and related medical applications 6 , 7 . since the partial pressure of gas in laserinduced microcavitation bubbles is well above the partial pressure of atmospherically equilibrated pfd , the diffusion of gas from microbubbles into liquid pfd requires no special handling or degassing requirements . although it is a heavy molecule with approximately twice the density of water , pfd readily evaporates when exposed to room air , an effect exacerbated by warm skin . covering it with a transparent impermeable membrane there are also optical indexmatching benefits to both the pfd and to the silicone material described below . a solution to this problem was simply to perforate medicalgrade silicone gel with a multiplicity of fine holes , and allowing the pfd to mechanically reside in them . pfd rapidly wicks into the perforations , and then readily wicks back out onto the surface of the skin . the index of refraction of human epidermal tissue was measured by ding et al . to vary from 1.44 at 600 nm to 1.42 at 1064 nm 8 . the indices of refraction of perfluorodecalin and the transparent silicone material are 1.31 and 1.40 , respectively . this provides good optical index matching that allows efficient coupling of laser light into the skin despite the presence of the liquid pfd and the silicone patch itself . littlejohn et al . have recently exploited this effect in a striking series of confocal microscopy studies of plant leaves 9 . when an opaque plant leaf plant leaf is briefly immersed in pfd , it becomes sufficiently transparent to read text through it . the optical clearing effect of the pfd patch may have significance in laser tattoo removal for several reasons . the reduction in optical scattering allows more photons to penetrate into the skin to interact with deeply residing ink particles , and reduces the local fluence near the skin surface compared to more highly scattering conventional treatment . this effect would also reduce potentially damaging epidermal thermal effects by reducing heat generated superficially by the laser , as well as thermally coupling heat that is generated into the bulk material of the silicone . a conventional nanosecond pulse duration qswitched alexandrite 755nm laser ( candela alex trivantage , wayland , ma ) was selected for use in this study . while several laser wavelengths may be used to treat black and dark blue ink , 755 nm is well recognized as being clinically effective in achieving clearance of such tattoos 3 , 10 . the selection of wavelength chosen for this particular study design was based simply on general availability and wellestablished clinical efficacy . the pfd patch was designed to have no clinical effect on wavelength or spot size selection ; its optical clearing effect was however clinically observed to allow substantially higher maximum tolerated fluence . this was an allendale irbapproved , singlesite , splitside , prospective pilot study to evaluate the efficacy and safety of a transparent pfd patch as an accessory to laser tattoo removal for accelerated clearing of blue or black tattoos . twenty adult subjects , fitzpatrick skin types i iii , were enrolled in the study , with 15 remaining ( two subjects had two tattoos ) for five or more treatment sessions at approximately 4week intervals . inclusion criteria included subjects 18 years of age with previously untreated tattoos less than 100 cm in size consisting of dark blue or black ink , fitzpatrick skin type i iii , no tan in the treatment area and no contraindications for participation in a clinical trial or treatment with a qswitched laser . subjects with a history of oral gold therapy , hypertrophic or keloidal scarring , use of oral retinoids within the previous 12 months , or who were pregnant , or breastfeeding characteristics including age , gender , fitzpatrick skin type , tattoo site , and color(s ) present in the tattoo were documented during the enrollment session . one half of the tattoo was randomly assigned laser treatment using the pfd patch ; the other half received conventional laser treatment through air without the patch and served as the control . lidocaine hcl 1% with or without epinephrine 1:100,000 was injected at the treatment site on all subjects throughout the study . pfd was applied to the skin and the patch was applied approximately 5 minutes prior to laser treatment . standard unpolarized flash photographs were taken for all subjects at each visit before treatment , showing patch placement , and immediately posttreatment . the pfd patch side received rapid multiple laser passes as clinically indicated , typically 3 or 4 , with an average of 3.6 . the control half received a single laser pass due to the immediate development of persistently opaque epidermal whitening following exposure to laser energy rendering additional treatments impossible . both sides of the tattoo were treated at the maximumtolerated fluence as determined by epidermal whitening without frank , clinically apparent blister formation . treatment through the patch allowed higher treatment fluence in all subjects relative to control . the patch was lifted between passes and additional pfd was reapplied with a foamtipped swab ( mg chemicals , burlington , canada ) to replenish any liquid that may have been absorbed into the skin . in cases where some epidermal whitening developed despite treatment through the patch , with reapplication of liquid pfd this whitening typically resolved rapidly . the patch was repositioned immediately after reapplication of liquid pfd to minimize evaporation and additional laser treatment was administered without further delay . upon completion of each treatment , subjects were given complete wound care instructions including clinic contact information . aquaphor ( beiersdorf , wilton , ct ) was applied , and tegaderm framestyle film dressings were applied over the treated area ( 3 m , st . the presence of side effects and adverse events was assessed and recorded for both patch and control sites immediately after treatment and at each visit . repeat treatments were performed at 4 to 6week intervals until the tattoo was either fully resolved on the patch side or until no further clinical benefit was deemed likely . at that time , subjects continued to receive laser treatments to the control side until the tattoo reached the maximal perceived clinical benefit . it is worth noting that although subjects were given the choice of continuing treatment with or without the patch on the control side after the patch side had cleared , all chose to continue with the patch . a conventional nanosecond pulse duration qswitched alexandrite 755nm laser ( candela alex trivantage , wayland , ma ) was selected for use in this study . while several laser wavelengths may be used to treat black and dark blue ink , 755 nm is well recognized as being clinically effective in achieving clearance of such tattoos 3 , 10 . the selection of wavelength chosen for this particular study design was based simply on general availability and wellestablished clinical efficacy . the pfd patch was designed to have no clinical effect on wavelength or spot size selection ; its optical clearing effect was however clinically observed to allow substantially higher maximum tolerated fluence . this was an allendale irbapproved , singlesite , splitside , prospective pilot study to evaluate the efficacy and safety of a transparent pfd patch as an accessory to laser tattoo removal for accelerated clearing of blue or black tattoos . twenty adult subjects , fitzpatrick skin types i iii , were enrolled in the study , with 15 remaining ( two subjects had two tattoos ) for five or more treatment sessions at approximately 4week intervals . inclusion criteria included subjects 18 years of age with previously untreated tattoos less than 100 cm in size consisting of dark blue or black ink , fitzpatrick skin type i iii , no tan in the treatment area and no contraindications for participation in a clinical trial or treatment with a qswitched laser . subjects with a history of oral gold therapy , hypertrophic or keloidal scarring , use of oral retinoids within the previous 12 months , or who were pregnant , or breastfeeding were excluded . informed consent was obtained as per standard protocol . characteristics including age , gender , fitzpatrick skin type , tattoo site , and one half of the tattoo was randomly assigned laser treatment using the pfd patch ; the other half received conventional laser treatment through air without the patch and served as the control . lidocaine hcl 1% with or without epinephrine 1:100,000 was injected at the treatment site on all subjects throughout the study . pfd was applied to the skin and the patch was applied approximately 5 minutes prior to laser treatment . standard unpolarized flash photographs were taken for all subjects at each visit before treatment , showing patch placement , and immediately posttreatment . the pfd patch side received rapid multiple laser passes as clinically indicated , typically 3 or 4 , with an average of 3.6 . the control half received a single laser pass due to the immediate development of persistently opaque epidermal whitening following exposure to laser energy rendering additional treatments impossible . both sides of the tattoo were treated at the maximumtolerated fluence as determined by epidermal whitening without frank , clinically apparent blister formation . the patch was lifted between passes and additional pfd was reapplied with a foamtipped swab ( mg chemicals , burlington , canada ) to replenish any liquid that may have been absorbed into the skin . in cases where some epidermal whitening developed despite treatment through the patch , with reapplication of liquid pfd this whitening typically resolved rapidly . the patch was repositioned immediately after reapplication of liquid pfd to minimize evaporation and additional laser treatment was administered without further delay . upon completion of each treatment , subjects were given complete wound care instructions including clinic contact information . aquaphor ( beiersdorf , wilton , ct ) was applied , and tegaderm framestyle film dressings were applied over the treated area ( 3 m , st . the presence of side effects and adverse events was assessed and recorded for both patch and control sites immediately after treatment and at each visit . repeat treatments were performed at 4 to 6week intervals until the tattoo was either fully resolved on the patch side or until no further clinical benefit was deemed likely . at that time , subjects continued to receive laser treatments to the control side until the tattoo reached the maximal perceived clinical benefit . it is worth noting that although subjects were given the choice of continuing treatment with or without the patch on the control side after the patch side had cleared , all chose to continue with the patch . in 11 out of 17 tattoos , those treated through the pfd patch showed more rapid clearance with higher subject satisfaction than standard throughair treatment ( table 1 ) . the patch allowed three or four rapid multiple passes in all subjects as opposed to only a single pass on the control side . the patch also allowed an increased fluence to be delivered relative to control by a factor of 1.5 to 1.8 , despite multiple laser passes , without an increase in adverse events . these anticipated adverse events were mild to moderate in severity and included erythema , edema , pain , and crusting . the incidence of anticipated adverse events was the same for both the patch and control sides of the tattoos . blister formation was reported by 2 of the subjects , and transient hypopigmentation by 3 of the subjects , all of which resolved completely and without sequelae . as one example , figure 1 shows subject 15 at : baseline , immediately after treatment 1 , and 4 weeks after treatment 5 . summary of subject demographics and observations ( a ) tattoo from subject 15 at baseline . ( b ) the pfd patch on the left side of the tattoo reduces whitening allowing four laser passes in a few minutes . there was a wide array of responses ranging from dramatic superiority after only two treatment sessions with over 90% clearance on the patch side compared to less than 20% on the control side , to marked superiority which became apparent after a few treatments , to cases in which superiority of the patch was not demonstrated . typical positive results are shown in figure 2 . even in cases where superiority of clearance relative to control was not demonstrated , this proofofconcept pilot study was designed to qualitatively compare the effect of rapid , multiple qswitched laser passes performed at highest tolerated fluence in conjunction with an optical clearing and index matching pfd patch relative to standard qswitched laser treatment on the clearing of tattoos . quantifying the improvement in rate of clearance , and partitioning the benefit of multiple passes and/or higher fluence on outcomes were beyond the scope of the study design . however , this study demonstrated that the pfd patch , when used in conjunction with a qswitched laser , produces a beneficial effect with respect to clearance of blue and black tattoo ink relative to standard treatment protocols . some of the factors implicated in this phenomenon include the age of the tattoo , the composition and depth of the ink , location on the body , smoking status , and professional versus amateur application . future studies that explore these parameters as they relate to pfd patch efficacy are clearly warranted , as are studies that evaluate the pfd patch in conjunction with qswitched lasers of other wavelengths and pulse durations in both the nanosecond and picosecond range . just as there are many factors affecting the speed and efficacy of laser tattoo removal in general , there appear to be several mechanisms at play with the use of the pfd patch . the first involves the unusual ability of pfd itself to absorb gas 6 , 7 . when a tattoo is exposed to the high optical energy of a laser pulse , stress waves , and cavitation bubbles are formed 11 . the apparent white layer is composed of microscopic bubbles formed nearly instantaneously as energy absorbed by the ink particles is transferred to surrounding tissue . further laser passes are ineffective because light can no longer penetrate sufficiently to interact with the pigment . the first mechanism that the pfd patch facilitates is the direct absorption of the gas within the bubbles . also , pfd contained in the most distal part of the perforations is at a lower partial pressure than that at the surface in direct contact with the cavitation bubbles , which drives the dissolution of gasses into the pfd . pfd is a very mobile fluid that readily fills voids and wicks into porous materials 9 , 13 . as the opaque bubble layer dissipates , optical clearing may become the dominant mechanism allowing photons to penetrate more deeply into the tissue 14 . the laser may have improved efficacy if its light reaches deep ink particles due to a reduction in optical scattering ; this may lead to better treatment of recalcitrant tattoos . but optical clearing also has a counterintuitive effect ; it reduces the local fluence in the upper layers of the skin precisely because it reduces scattering . this allows more photons to penetrate more deeply where recalcitrant ink tends to reside , but also appears to require a higher incident fluence to compensate for the reduction in local fluence in the uppermost layers of the skin . this is consistent with our clinical observation that the patch allows higher tolerated fluence when compared to throughair treatment of the same tattoo . we note that even as the patch significantly increases the maximum tolerated fluence , this increase did not result in increased side effects . the index of refraction of human epidermal tissue was measured by ding et al . to vary from 1.44 at 600 nm to 1.42 at 1064 nm 8 . the index of refraction of perfluorodecalin and the transparent silicone material are 1.31 and 1.40 , respectively . this provides optical index matching that allows efficient optical coupling of laser light into the skin despite the presence of the patch . a fourth mechanism is thermal protection of the epidermis by the bulk transparent silicone material of the pfd patch itself as well as the high heat capacity of pfd relative to air . as the patch is placed on the skin , air is excluded from the patchskin interface providing good thermal coupling from the epidermis through the pfd into the silicone . this is extremely important from a perspective of both patients and staff as laserplume has been well documented to contain noxious materials 15 , 16 . it is also important to note that , despite greater total energy application on the pfdtreated side on account of both multiple passes and increased fluence , there were no increases in adverse events or delay in recovery time associated with use of the pfd patch . rapid multipass treatment of tattoos with highest tolerated fluence facilitated by a transparent pfdinfused patch clears tattoos more rapidly than conventional methods . we observed that even with multiple laser passes , the highest tolerated fluence could be safely increased by a typical factor of 1.5 to as high as 1.8 with the pfd patch as compared to conventional treatment through an airskin interface on the control side of the same tattoo using a 755nm qswitched alexandrite laser . no unanticipated adverse events were observed . although this study was limited by its modest sample size and by the use of only one laser wavelength and pulse duration , the potential benefit of the pfd patch with other wavelengths and pulse durations ( including picosecond lasers ) warrants further investigation . costner had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis .

development of adhesion after any surgical process is influenced by various factors , such as , complexity of operation , extent of peritoneal trauma , previous illness , and poor nutritional status . the definite pathogenesis of adhesion formation is not yet clear ; however , there are some theories about the role of the immune system , which reveals that severe immune system reaction in response to peritoneal damage is the pathophysiology of adhesion formation . another theory in this field deduces that adhesion formation is a pathological part of healing . during abdominal surgery , for prevention of adhesion formation , damage to the peritoneum and use of foreign body should be decreased and careful hemostasis and repeated irrigation should be performed . there are some agents that are used before and after surgery to the purpose of adhesion formation . attempted drug treatments are antibiotics and immune system inhibitors , such as , corticosteroids , histamine receptor antagonists , vitamins , and hormones . although several researches have been performed in this field , an ideal strategy for its prevention is still unknown . among the drugs that are mentioned above , recent researches have mainly focused on the inhibition of the inflammatory system . although they have mentioned their role in adhesion reduction , the balance between systemic side effects and reduction of adhesion formation is still a major concern . on the other hand agents that change the healing process may influence adhesion formation ; vitamin a is an agent known to be required for epithelial tissue development , and it also facilitates normal wound repair . vitamin c is an essential cofactor of collagen synthesis and other components of connective tissues and plays an important role in the wound healing process . there is only one study on the role of vitamin a in adhesion formation and there is no data available about the role of vitamin c. our purpose , in this study , is to evaluate the effect of the optimal healing process ( by using vitamin c and vitamin a ) on post surgery abdominal adhesions and wound integrity . a total of 60 male wistar rats weighing between 250 to 350 g were used in this study . the rats were housed at a temperature of 26 1c and relative humidity of 40% . all the rats were fed a standard diet and had free access to food and water . the rats were acclimatized to this diet one week before the experiment . ethical approval for this study the anesthesia procedure was performed using 0.02 mg / kg intramuscular acepromazine ( woerden - the netherlands ) and 50 mg / kg ketamine ( woerden - the netherlands ) . the abdomens were shaved and prepared with betadine solution and to remove the powder particles , the gloves were washed with normal saline ( razi - iran ) . the adhesion formation procedure was performed using the method described by whang et al .. the rats underwent laparotomy via a 4 cm midline incision . a 2 2 cm part of the peritoneum , with the underlying muscle layer , was resected . the cecum was identified and exposed , and an area of serosa measuring 2 2 cm was abraded using a gauze until bleeding was observed . then the cecum was returned to its anatomical position and the abdominal cavity was closed in two layers with simple continuous sutures of nylon 3 - 0 ( supa - iran ) . the rats were randomly assigned to four groups ( 15 in each group ) . in group 1 ( vitamin a ) , the rats received 2000 units / kg intramuscular injection of vitamin a ( osveh - iran ) daily , for two weeks , after surgery ; in group 2 ( vitamin c ) , they received 100 mg / kg oral vitamin c ( osveh - iran ) daily , for two weeks , after laparotomy ; in the third group ( vitamin a and c ) , the rats received 2000 units / kg intramuscular injection of vitamin a and 100 mg / kg oral vitamin c daily , for two weeks , after laparotomy . in group 4 the doses of drugs that had been used in this study were determined according to those used previously in this field . after two weeks , the rats were sacrificed and a u - shaped incision was made under the anesthesia that was described above . photographs were taken and used for the grading of adhesion by a second surgeon , who was blinded about the drugs that had been used in each rat . the scoring systems that were used in this research project [ table 1 ] were used in several studies with the same purpose and have been validated within the literature . in this scoring system [ table 1 ] : score 0 : no adhesion , score 1 : thin filmy adhesion ; score 2 : more than one thin adhesion ; score 3 : thick adhesion with focal point ; score 4 : thick adhesion with planar attachment score 5 : very thick vascularized adhesions or more than one planar adhesion . adhesion , fibrosis , and inflammation scoring systems histopathological examinations were performed using light microscopy . the resected tissues , including the adhesion site , adhesion band , and cecal wall were fixed in 10% formalin and embedded in paraffin . the paraffin - embedded tissues were cut into 5 m slices and sustained with hematoxylin and eosin and masson 's trichrome dyes and reviewed by a single expert pathologist , who was blinded about the study groups . fibrosis and inflammation were graded using a semi - quantitative system . with regard to the scoring of the inflammation scoring system [ table 1 ] , score 0 : no inflammation ; score 1 : mild inflammation ( only a few scattered inflammatory cells were found ) ; score 2 : moderate inflammation ( small groups of inflammatory cells in many high power fields ) . ) ; score 3 : severe inflammation ( many inflammatory cells in diffuse pattern or in large groups ) . fibrosis was evaluated using the masson 's trichrome sustained sections of the fibrosis scoring system [ table 1 ] . score 0 : small scattered area of green staining ; score 1 : thin band of green staining ; score 2 : thicker connected band of green staining ; score 3 : thick and dense area of green staining . we also evaluated the wound disruption strength ( f - max ) by the method that was first described by greenhalgh et al . and has been used in similar studies . skin strips for testing were cut at right angles to the long axis of the wound with cutters . the cutters are dumbbell shaped , with the narrower portion containing the incision , measuring 4 mm across . the wider portions of the skin strips were placed in the jaws of a tensiometer ( zwick-1406 ) and were stretched at a constant rate ( 3 cm / minute ) until disruption occurred . wound breaking strength was determined by a digital readout as f - max in cn [ figure 1 ] . vit a = vitamin a ; vit c = vitamin c ; vit a and c = vitamin a and vitamin c ; sham = sham group . * : p < 0.05 considered significant for the comparison of adhesion , fibrosis , inflammation , and f - max among the study groups , after consultation with the study statistician , the sample size was determined to be 11 in each group , and after considering the post surgery mortality , 15 rats were selected to enroll in each group . statistical analyses were performed using the statistical software ( spss version 16.0 ; spss , inc . , chicago , il ) , by anova , and tukey hsd tests , and p < 0.05 was considered to be significant . the anesthesia procedure was performed using 0.02 mg / kg intramuscular acepromazine ( woerden - the netherlands ) and 50 mg / kg ketamine ( woerden - the netherlands ) . the abdomens were shaved and prepared with betadine solution and to remove the powder particles , the gloves were washed with normal saline ( razi - iran ) . the adhesion formation procedure was performed using the method described by whang et al .. the rats underwent laparotomy via a 4 cm midline incision . a 2 2 cm part of the peritoneum , with the underlying muscle layer , was resected . the cecum was identified and exposed , and an area of serosa measuring 2 2 cm was abraded using a gauze until bleeding was observed . then the cecum was returned to its anatomical position and the abdominal cavity was closed in two layers with simple continuous sutures of nylon 3 - 0 ( supa - iran ) . the rats were randomly assigned to four groups ( 15 in each group ) . in group 1 ( vitamin a ) , the rats received 2000 units / kg intramuscular injection of vitamin a ( osveh - iran ) daily , for two weeks , after surgery ; in group 2 ( vitamin c ) , they received 100 mg / kg oral vitamin c ( osveh - iran ) daily , for two weeks , after laparotomy ; in the third group ( vitamin a and c ) , the rats received 2000 units / kg intramuscular injection of vitamin a and 100 mg / kg oral vitamin c daily , for two weeks , after laparotomy . in group 4 ( sham ) , the rats did not receive any drugs . the doses of drugs that had been used in this study were determined according to those used previously in this field . after two weeks , the rats were sacrificed and a u - shaped incision was made under the anesthesia that was described above . photographs were taken and used for the grading of adhesion by a second surgeon , who was blinded about the drugs that had been used in each rat . the scoring systems that were used in this research project [ table 1 ] were used in several studies with the same purpose and have been validated within the literature . in this scoring system [ table 1 ] : score 0 : no adhesion , score 1 : thin filmy adhesion ; score 2 : more than one thin adhesion ; score 3 : thick adhesion with focal point ; score 4 : thick adhesion with planar attachment score 5 : very thick vascularized adhesions or more than one planar adhesion . the resected tissues , including the adhesion site , adhesion band , and cecal wall were fixed in 10% formalin and embedded in paraffin . the paraffin - embedded tissues were cut into 5 m slices and sustained with hematoxylin and eosin and masson 's trichrome dyes and reviewed by a single expert pathologist , who was blinded about the study groups . fibrosis and inflammation were graded using a semi - quantitative system . with regard to the scoring of the inflammation scoring system [ table 1 ] , score 0 : no inflammation ; score 1 : mild inflammation ( only a few scattered inflammatory cells were found ) ; score 2 : moderate inflammation ( small groups of inflammatory cells in many high power fields ) . ) ; score 3 : severe inflammation ( many inflammatory cells in diffuse pattern or in large groups ) . fibrosis was evaluated using the masson 's trichrome sustained sections of the fibrosis scoring system [ table 1 ] . score 0 : small scattered area of green staining ; score 1 : thin band of green staining ; score 2 : thicker connected band of green staining ; score 3 : thick and dense area of green staining . we also evaluated the wound disruption strength ( f - max ) by the method that was first described by greenhalgh et al . and has been used in similar studies . skin strips for testing were cut at right angles to the long axis of the wound with cutters . the cutters are dumbbell shaped , with the narrower portion containing the incision , measuring 4 mm across . the wider portions of the skin strips were placed in the jaws of a tensiometer ( zwick-1406 ) and were stretched at a constant rate ( 3 cm / minute ) until disruption occurred . wound breaking strength was determined by a digital readout as f - max in cn [ figure 1 ] . vit a = vitamin a ; vit c = vitamin c ; vit a and c = vitamin a and vitamin c ; sham = sham group . for the comparison of adhesion , fibrosis , inflammation , and f - max among the study groups , after consultation with the study statistician , the sample size was determined to be 11 in each group , and after considering the post surgery mortality , 15 rats were selected to enroll in each group . statistical analyses were performed using the statistical software ( spss version 16.0 ; spss , inc . , chicago , il ) , by anova , and tukey hsd tests , and p < 0.05 was considered to be significant . of the total of 60 rats in the four groups that were included in the study , nine died in the two - week interim after the first surgery . three of them belonged to the vit a group , one rat died from the vit c group , three from the vit a and c , and two from the sham group . means of variable in different groups after evaluation by the anova test , the analysis of variance showed that there was a statistically significant difference in the adhesion formation score ( p < 0.0001 ) and fibrosis score among the study groups ( p < 0.0001 ) . vit c group had the lowest mean adhesion formation score and fibrosis among the study groups . the tukey test confirmed that this difference was present in comparison with each of the other three groups . vit a = vitamin a ; vit c = vitamin c ; vit a and c = vitamin a and vitamin c ; sham = sham group . * : p < 0.05 considered significant with regard to the inflammation score , we found that the mean inflammation score was lower in vit c group than in the others , however , this difference was not statistically significant ( p = 0.558 ) [ figure 3 ] . vit a = vitamin a ; vit c = vitamin c ; vit a and c = vitamin a and vitamin c ; sham = sham group . * : p < 0.05 considered significant data analyses showed that the wound disruption strength differed significantly among the study groups ( p = 0.027 ) and the tukey test showed that this difference was significant between the vit c and the sham groups . vit a = vitamin a ; vit c = vitamin c ; vit a and c = vitamin a and vitamin c ; sham = sham group . nowadays , it is recognized that adhesion formation is a part of healing imbalance . in this study we aimed to determine the possible role of vitamin a and c on the postsurgical adhesion formation . we found that administration of oral vitamin c reduced adhesion formation and fibrosis among the study rats , and also , in the vitamin c group , the wound healing that had been evaluated by tensiometry was better than in the other study groups . by considering that cytokines and inflammation play an important role in the adhesion formation process , previous studies mainly focused on the inhibition of the inflammatory system to reduce adhesion formation . in this study we focused on the improvement of wound healing by vitamin a and c and their effect on adhesion formation . one study that was performed by demetriou et al . reveals that administration of vitamin a , of more than 150 mg orally , daily , increases adhesion formation and lower doses do not influence adhesion formation . in line with this study we have found that by the administration of vitamin a , adhesion formation does not decrease and even increases , however , this change is not statistically significant . it is well - known that vitamin c is an important cofactor for the synthesis of collagen , although the previous studies only mention its role in wound healing and none of them have evaluated its effect on adhesion formation . 's study revealed that vitamin c has an anti - inflammatory and healing effect and improves skin wound healing . in another study , performed by petrinau et al . , they have found that oral vitamin c increases the intestinal anastomotic resistance in rats . in our study we have found that vitamin c reduces adhesion formation and also increases the wound integrity , which has been assessed by tensiometry . this finding is against the theory which mentioned that adhesion formation is the pathological aspect of healing . in our study , administration of vitamin a and vitamin c has decreased adhesion formation , but it is not significant . in conclusion , we deduce that administration of oral vitamin c reduces adhesion formation and improves wound healing , and administration of vitamin a does not reduce adhesion formation . on the other hand the use of a combination of vitamin a and vitamin c does not reduce adhesion formation nor does it increase wound integrity .

approximately one million children are born worldwide through assisted reproductive techniques ( art ) . in many developed countries , the most important problems of art are the result of prematurity and low birth weight ( lbw)[3 , 4 ] . in three studies , prematurity and in five other case - control studies on art children , the rate of prematurity and lbw was almost two times more than that seen among single , normal conceived children[812 ] . prematurity and lbw increase the probability of neonatal death , neonatal complications , congenital malformations and diseases[13 , 14 ] . the most important factors which cause prematurity and lbw in these infants are multiple pregnancies and transferring of more than one embryo . decreasing numbers of transferred embryos from three to two , reduce 70% ivf induced preterm births by reducing multiple pregnancies . for unknown reason , in singleton transferred embryo , both lbw and prematurity still occur with a greater frequency among art conceived children in comparison to single normal conceived children[14 , 15 ] . a few studies have been done on the growth process of these children , however the problem with follow - up and parental belief about a lack of growth difference between their children and other normal conceived children are causes of limitation of sampling in these studies . in one study that compared 299 in vitro fertilized ( ivf ) children with 588 normal conceived ones , the ivf children had a lower weight and height at birth than the control group . at one year of age the growth rate increased , however they ultimately had a lower weight at three years of age than the control group , with no reported difference in height . in six studies , there were no significant difference in height , weight and head circumference between infants who were conceived by art and the control group[1 , 1721 ] . regarding the importance of this subject and the lack of a comprehensive study on the physical growth process of art infants in iran , this study was designed to compare the growth process of children conceived with different methods of art ( ivf and icsi ) by standard growth charts from birth until nine months of age . this was a descriptive , analytic , cross sectional study approved by the research ethics committee of the academic center of education , culture and research ( acecr ) and royan institute . during a 22 month period , a pediatrician performed two examinations ( first time between birth to 6 months and second time between 69 months ) on 333 art children that were conceived by ivf and icsi methods in royan institute with the parents written consent . the sampling method was non random , sequential with the inclusion criteria of infants conceived through one kind of art methods ( ivf , icsi ) and birth date from september 2007 to july 2009 and residence in tehran . if infants did not come for the second examination , they were excluded from study . information on the infants weight , height , and head circumference at birth were obtained from birth chart and interviews with their mothers . a pediatrician checked the infants height ( with measure mat in supine position ) , weight ( with seca digital scale ) and head circumference ( with tape ) at each visit . the patterns of weight gain and increasing of height ( greater or less than 2sd ) and pattern of increasing of head circumference ( greater or less than 3sd ) were obtained . there were 333 infants evaluated two times in this study , 173 ( 52% ) were male and 160 ( 48% ) female . there was a total of 108 ( 32% ) lbw neonates in this study , of which 24 ( 7% ) were single deliveries and 84 ( 25% ) multiple deliveries . of all lbw neonates , 13 ( 3.9% ) were ivf lbw neonates , of which 4 ( 1.2% ) were the result of single pregnancies and 9 ( 2.7% ) of multiple pregnancies . from 95 ( 28.5% ) icsi lbw neonates , 17 ( 5.1% ) resulted from single pregnancies and 78 ( 23.4% ) from multiple pregnancies ( table 1 ) . distribution of growth factors at birth in children born by art ivf : in vitro fertilization ; icsi : intracytoplasmic sperm injection table 2 shows the distribution of weight , height , and head circumference in the two times of assessment ( birth to 6 months and 69 months of age ) in children born by art . distribution of growth factors in children born by art ivf : in vitro fertilization ; icsi : intracytoplasmic sperm injection appropriate=50% weight of infants in that age according to nchs / who standard chart . 2sd ) or ( > 2sd)=2sd less or more than 50% weight of children in that age according to nchs / who standard chart . the most important problem in evaluating art children is lack of comparability with normally conceived children , which is due to several factors : background disorders of parental infertility , different drugs used in assisted reproductive technique process and for fetal survival , increased emotional stress in these parents and more exposure to environmental factors . clearly the best study group are those children who have been spontaneously born to infertile parents without treatment or with use of non - invasive methods other than ivf or icsi ( like ovulation induction ) , which is not practical . on the other hand , there are published articles that compare art children with normal conceived children or children conceived with the use of different methods of assisted reproductive techniques . in this study 32% of the children were lbw which is approximately six times greater than lbw infants in general population ( 5.33% ) who have been born in tehran . of these , icsi infants have the highest ( 34% ) frequency . in three studies which have reported the rate of lbw in art children , the results have shown a 45 times higher rate than in the normal population[57 ] . in six studies , however , this rate was two times higher than normal conceived children[812 , 15 ] . 7% of lbw newborns were single deliveries which are higher than lbw newborns of normal conception in tehran . the rate of lbw infants in the icsi and ivf groups were similar and there was no significant difference between the two groups ( p=0.152 ) . the lbw risk ratio ( rr ) in icsi infants , when compared with the ivf group , was 1.4 , which was different from that ( 1.03 ) in other studies . in some studies there was no significant difference in birth weight between the icsi and ivf groups [ 2426 ] . two of the most common reasons for lbw in these children are multiplicity and infertility background disorder . in one study which compared neonatal birth weight of ivf and icsi infants with infants of previously infertile women achieving pregnancy after sexual intercourse , neonatal birth weight is significantly lower in infants born after ivf and icsi methods than those in the other group and they concluded that art has specific effect on lowering of neonatal birth weight . in this study , both height and head circumference of art children were respectively 19.2% and 27.6% at birth less than general population infants according to standard growth curves . a reason could be that multiplicity was higher in the art group when compared with general population ( 25% vs 0.3% respectively ) . in one study which compared ivf children with normally conceived children in this study , the pattern of weight gain from birth to 6 months and 69 months , according to standard growth curves , showed that 4.2% and 3.9% of these children had more than 2sd decrease in weight gain respectively . weight gain disorder was lower in ivf infants and there was no significant difference in weight gain of ivf and icsi group . the rate of infants with a weight gain of greater than 2sd from birth to 6 months and 69 months were respectively 20% and 12.1% , which reached the level of general population of infants with increasing of age . in one study art infants had a faster growth and evidence of catch up in both height and head circumference from 6 months to 18 months old compared with infants born with natural conception . of these infants , 8.7% had a height increase disorder of more than 2sd until 6 months . a gradual improvement was noted until 9 months , while only 2.4 % of infants showed a height increase disorder of greater than 2sd . of the two groups , the icsi infants showed more delay in height increase until the age of 6 months . increase of head circumference was appropriate for age in 95.2% of these children until 6 months of age and in 94.6% until 9 months of age . this process is the same in both groups and there is no significant difference between the two groups . in one study , ivf infants at birth were compared with the normal population for weight , height and head circumference . the ivf newborns had lower birth weights and heights and head circumference , at 1 year of age they had an increase in growth however , at 3 years of age they had a lower weight when compared with the control group but the height and head circumference were similar . however , six studies have shown no significant differences in height , weight , head circumference and physical growth between art children and normal conceived children [ 1 , 1721 ] . in a recent study in uk which follows these children in various time points , no significant differences were observed regarding head circumference , height and weight between icsi and ivf groups . limited sample size , difficult access to this group of infants and their families and unwillingness of parents for re - examination of infants cause the results less reliable . in the future , selecting a greater number of newborns and implementing them in prospective studies with longer duration should be considered for better and more reliable results . the most important confounding factor which affects the growth status of art infants is multiplicity which can lead to low birth weight , height and head circumference at birth . although the higher number of art infants showed diminished growth patterns of weight , height and head circumference from birth until 6 months according to standard charts , but growth indexes improved until 9 months and there was no significant difference in the growth process between ivf and icsi infants .