Datasets:

iNeil77

/

pseudo-mini-pile

like 4

Cytohistomorphology of prostatic lesions--by FNAC & scrape methods. A pilot study of transrectal fine needle aspiration biopsy was conducted in 44 patients, above the age of 50 years, who presented with features of obstructive uropathy during a one year period between August 1990 and April 1991. Histopathological study was carried out in 23 out of 44 patients, who underwent total prostatectomy or transurethral resection following the aspiration biopsy procedure. In 21 patients FNAB by the transrectal route could not be obtained because of technical difficulties; therefore intraoperative scrape cytology was studied prior to histopathology, of the fresh prostatic specimen. A good cytohistopathological correlation was obtained by both methods; an accuracy of 95.6% and 95.2% with FNAC and scrape respectively. A wide range of benign and malignant lesions were studied.

Pillars Article: Evidence for Amino Acid Sequence Differences among Proteins Resembling the L-chain Subunits of Immunoglobulins. J. Mol. Biol. 1965. 12: 81-87. In this study immunoglobulin structural variation was examined through analysis of L-chain type proteins produced by a variety of distinct plasma cell tumors of the mouse. These proteins were examined by serological techniques, quantitative amino acid analysis and peptide mapping. It appeared from these studies that these proteins all contained a common amino acid sequence throughout a large portion of the molecule. Nevertheless, ea.ch of the proteins contained a unique region of amino acid sequence which allowed it to be distinguished from any other on the basis of certain variable peptides. This immediately suggested the possibility of a second chain, loosely linked by non-covalent bonding or joined through disulfide bonding. To examine this possibility, performic acid oxidation and disulfide reduction procedures were carried out. Following these react ions, several methods of separation failed to demonstrate any alteration in either the peptide map patterns or the amino acid composition of these proteins. It seems, therefore, that if a second chain is present it is covalently linked through some bond other than a disulfide bond. It is apparent from 'the peptide map data that variation must occur in some type of "specialized area". Although the role of the various chains of immune globulins is not yet clear, we believe that this remarkable type of amino acid sequence variation reflects in part the mechanism by which specificity is conferred.

Payments bank is the new buzzword in the banking industry. Since they serve as a convenient alternative in the wake of demonetisation, here are the ins and outs of how they work, and how you can make the most of the services they offer.A payments bank is a differentiated bank with the specific objective of catering to the unbanked and underbanked. Although the Pradhan Mantri Jan Dhan Yojana has brought down the number of unbanked individuals in the country, there are still millions who do not have bank accounts. According to a World Bank report, India is home to 21% of the world’s unbanked adults. Payments banks aim to service these customers, especially migrant workers and those from lowerincome households, as well as bring them into the formal financial system.While opening a bank account requires documentations and takes time, with payments banks, the process is fairly simple, paperless and instant, since the latter are primarily operated using mobile phones. For instance, all you need to start using Airtel Payments Bank, the country’s first payments bank, is your Aadhaar number, which is used for e-KYC, and your mobile number, which doubles as your account number.As the name suggests, the key focus of payments banks is on the payments space. They facilitate domestic and international remittances, bill payments, wage payments, recharges, insurance premium payments, etc. While they also provide deposit and withdrawal facilities, they cannot lend like traditional banks. Given that India still has a rural population of 67%, which does not have easy access to basic banking facilities, payments banks can offer an effective alternative.Traditional banks can do everything payments banks can, but due to their structures and business priorities they may be unable to cater to certain segments and geographies. For instance, while it’s impossible for a bank to open bran ches in every village across the country, payments banks can fill this gap through the use of mobile phones. There are two main ways in which payments banks are different from traditional banks: they can accept deposits of only up to Rs 1 lakh, and they cannot lend.Since payment banks aren’t allowed to lend, they make their profits by selling third party products. While payments banks themselves cannot offer certain services to customers, they can always partner with traditional banks for providing loans and selling investment products. “Nearly all of the payments bank aspirants in the country have tied up with banks,” says Rishi Gupta, MD & CEO, FINO PayTech, one of the companies that already holds a payments bank license. “Customers are willing to pay for the services they don’t have access to otherwise. Pay ments banks have a chance to reach out to them with these products at reasonable prices, by tying up with the right partners,” he adds.Payments banks largely deal with low value, high volume transactions. Hence, players who have a large presence, are accessible across platforms, and are able keep their costs low while providing a varied bouquet of services to customers, will be successful. Payments banks, therefore, complement traditional banks, rather than compete with them.Digital or e-wallets, on the other hand, are just a medium for making cashless payments. You can’t make deposits, earn interest or withdraw money through them. “Going forward, wallets will just become one more avenue through which customers can access their bank accounts and carry out digital transactions,” says Gupta.Payments banks offer a great deal of convenience to customers. Even if you have an existing account with a traditional bank, a payments bank can allow you to access banking services and perform transactions, well after the normal banking hours have ended. This eliminates the need for you to make time specifically for travelling to your branch to carry out transactions.Another important benefit is cash digitisation. Nearly 90% of transactions in India are typically cash based, but demonetisation has given a huge push to payments banks with its emphasis on digital transactions. “We are already witnessing new set of customers, including vendors, grocers and small business owners, opting for cashless payments. The adoption level will only increase going forward, and payments banks will facilitate this digital transformation,” says Gupta.Payments banks are therefore expected to create some disruption in the banking system and bring banking to the masses on a wider scale. While Airtel has launched its services, other players like FINO PayTech and Aditya Birla Idea Payments Bank are looking to launch theirs by early next year.While the Rs 1 lakh deposit limit of payments banks may seem small, around 70% of the bank accounts in India have less than Rs 1 lakh deposits.They differ from both traditional banks and e-wallets in terms of services.

Quantification and molecular characterization of regulatory T cells in connective tissue diseases The aim of our study was to investigate and characterize regulatory T cells (Treg) in peripheral blood of patients with connective tissue diseases (Systemic lupus erythematosus, systemic sclerosis, Sjgren's syndrome, poly- and dermatomyositis) as compared with blood from healthy controls. Treg cells were quantified and phenotypically characterized by flow cytometry while the expression level of Foxp3 mRNA was evaluated by real time PCR. A reduced percentage of peripheral blood Treg cells was found in patients than in controls, irrespective of the type of connective tissue disease. Treg cells, especially those expressing one of the phenotypical markers, seemed to differ not only between patients and healthy controls but also among types of diseases. Additionally, the presence of autoantibodies as well as disease activity appeared to be correlated with particular Treg cell populations, especially those expressing one of the examined phenotypical markers. Correlations with therapy suggested that glucocorticoids plus antimalarial or other immunosuppressor drugs diminished the percentage of Treg cells, especially of those with memory phenotype. These findings indicated dysregulations at the level of Treg cells and suggested an involvement of these cells in the pathology of connective tissue diseases. Moreover, our data are in agreement with the suggestion that Treg cells could be therapeutic targets for some autoimmune diseases.

Layer arrangement and assignment of H.264 scalable video on content delivery networks Scalable video coding (SVC) is a new coding paradigm in contrast to the conventional single-layer video coding. SVC enables an encoded video to be utilized in more flexible ways. In this paper, we combine the H.264 SVC with the content delivery network (CDN) to offer better video services. In particular, a new algorithm for layer arrangement and assignment of H.264 SVC is proposed. Experimental results show that the proposed method greatly reduces the latency for end users to receive the desired video service.

This application relates to the art of telecommunications power distribution and, more particularly, to a direct current power distribution backplane. Although the invention is particularly applicable for use in telecommunications and will be described with specific reference thereto, it will be appreciated that the invention has broader aspects and can be used for other power distribution requirements. In accordance with the present application, a telecommunications direct current power distribution backplane acts as both the connection point for all battery and ground sources, and also as the interconnection point between two or more power and/or distribution bays. A power distribution backplane in accordance with the present application includes a pair of copper panels laminated to opposite sides of an insulating panel. The two copper panels are painted two different colors to distinguish between positive and negative polarities. The copper panels are provided with connectors such as threaded nuts or studs for attaching busbars to distribute the two polarities to required devices. Connector areas adjacent the periphery of the two copper panels are provided for attaching interconnect busbars or splice plates for carrying current between two or more bays. Busbars extend outwardly from the bottom ends of the two copper panels for delivering power to the backplane from power conversion units and then to other required devices. It is a principal object of the invention to provide an improved telecommunications direct current power distribution backplane. It is also an object of the invention to provide such a backplane having a plurality of connectors. It is a further object of the invention to provide such a backplane having connectors that are accessible from both sides of each panel past the intermediate insulating panel.

Afghan Mujahedeen fighters pose with a captured Soviet soldier in 1986. Photo by Patrick David/AFP/Getty Images The New York Times reports today on a still-classified CIA report, commissioned by the Obama administration during the debate in 2012 and 2013 over whether to increase U.S. support for the anti-Assad rebels in Syria. Senior officials tell the Times that the report “concluded that many past attempts by the agency to arm foreign forces covertly had a minimal impact on the long-term outcome of a conflict. They were even less effective, the report found, when the militias fought without any direct American support on the ground.” Obama referred to this report in an interview with the New Yorker’s David Remnick last year, saying, “Very early in this process, I actually asked the CIA to analyze examples of America financing and supplying arms to an insurgency in a country that actually worked out well. And they couldn’t come up with much.” The best example they found was the support for the anti-Soviet mujahideen in Afghanistan in the 1980s, which eventually forced a Soviet withdrawal from the country. But Afghanistan’s subsequent experience doesn’t exactly make that an encouraging case study. The fact that the president and his advisers are talking about the unreleased document may be part of a plan to counter a line of criticism voiced by, among others, former Secretary of State Hillary Clinton and former Secretary of Defense Leon Panetta. That criticism—that the situation in Syria wouldn’t have spiraled out of control if the U.S. had provided more aid to the “moderate” rebels sooner—is contradicted by the CIA’s report. The CIA’s assessment jibes with the academic literature on the topic, as George Washington University political scientist Marc Lynch recently wrote on the Washington Post’s Monkey Cage blog: In general, external support for rebels almost always make wars longer, bloodier, and harder to resolve. … Worse, as the University of Maryland’s David Cunningham has shown, Syria had most of the characteristics of the type of civil war in which external support for rebels is least effective. The University of Colorado’s Aysegul Aydin and Binghamton University’s Patrick Regan have suggested that external support for a rebel group could help when all the external powers backing a rebel group are on the same page and effectively cooperate in directing resources to a common end. Unfortunately, Syria was never that type of civil war. The U.S. occasionally aided anti-communist rebel groups throughout the Cold War—the Bay of Pigs invasion was a notable example—but it really ramped up its support with the “Reagan doctrine” of the 1980s, which involved countering Soviet support for leftist governments in the developing world by funding anti-Communist rebel groups. In addition to Afghanistan, the CIA funneled arms and money to anti-Communist rebels in Nicaragua and Afghanistan. In the context of the Cold War, there’s an argument to be made that this strategy worked—the Soviet Union collapsed, after all—but in the actual conflicts, the outcomes were ambiguous and the wars longer and bloodier than they might have been otherwise. (Angola’s civil war lasted 27 years.) The study of history might have led to the White House’s reluctance to have the CIA provide direct aid to the rebels. The agency, though, was involved in facilitating aid from others, Arab governments and Turkey in particular, who may have been less discriminating about the recipients of that support than the U.S. might have been. When future historians ponder the lessons of this engagement, they may conclude that historical examples led the U.S. away from one set of mistakes and toward a whole different set of errors.

A life-course approach to health: synergy with sustainable development goals Abstract A life-course approach to health encompasses strategies across individuals lives that optimize their functional ability (taking into account the interdependence of individual, social, environmental, temporal and intergenerational factors), thereby enabling well-being and the realization of rights. The approach is a perfect fit with efforts to achieve universal health coverage and meet the sustainable development goals (SDGs). Properly applied, a life-course approach can increase the effectiveness of the former and help realize the vision of the latter, especially in ensuring health and well-being for all at all ages. Its implementation requires a shared understanding by individuals and societies of how health is shaped by multiple factors throughout life and across generations. Most studies have focused on noncommunicable disease and ageing populations in high-income countries and on epidemiological, theoretical and clinical issues. The aim of this article is to show how the life-course approach to health can be extended to all age groups, health topics and countries by building on a synthesis of existing scientific evidence, experience in different countries and advances in health strategies and programmes. A conceptual framework for the approach is presented along with implications for implementation in the areas of: (i) policy and investment; (ii) health services and systems; (iii) local, multisectoral and multistakeholder action; and (iv) measurement, monitoring and research. The SDGs provide a unique context for applying a holistic, multisectoral approach to achieving transformative outcomes for people, prosperity and the environment. A life-course approach can reinforce these efforts, particularly given its emphasis on rights and equity. Introduction The right to the highest attainable standard of health for all people, is enshrined in the World Health Organization's (WHO) constitution and in the United Nations' (UN's) human rights framework. 1,2 Subsequent international declarations emphasize that health is interlinked with peace, development and the environment. 1,3-6 The UN's Sustainable Development Goal 3 (SDG 3) for 2030 is to "ensure healthy lives and promote well-being for all at all ages". 7 Adoption of the SDGs provides a unique opportunity to apply a holistic, people-centred, multisectoral approach to health and development, which is well aligned with a life-course approach to health. Properly applied, a life-course approach can help realize the vision of SDG 3, ensure universal health coverage (UHC) and achieve health and well-being for all at all ages. To take advantage of this unique opportunity, we commissioned two reports on the evidence supporting a life course approach to health to inform policy and practice in the SDG era. The first focused on conceptual and operational implications and the second on epidemiology and the risk of chronic disease. 13,14 These evidence syntheses showed that there remain barriers to implementing a life-course approach. There needs to be a better, shared understanding of how individuals' health and well-being are shaped by multiple factors and how the risk of ill health can accumulate across life stages and generations. One obstacle is the current focus on single diseases or specific age groups, rather than holistically addressing health throughout life. Operational constraints include frequent shifts in political priorities, short-term policy and funding cycles, poor coordination between the actions of health care and other sectors of society in addressing social and environmental change (which may threaten both health and sustainable development) and limited measurement of health and well-being across individuals' lives and generations. 17 In addition, the evidence syntheses found that most studies of the life-course approach focused on noncommunicable diseases and healthy ageing in high-income countries -few considered other health topics, younger age groups or low-and middle-income countries. 13 Further, the predominant themes were theoretical, epidemiological, research-based and clinical, with limited application to policy, planning and programme implementation. 13,14 The aim of this article is to show how a life-course approach can be extended to all health topics, age groups and countries by building on a synthesis of existing scientific evidence, experience in different countries and advances in health strategies and programmes. Aligned with the SDGs and UHC, a life-course approach can facilitate the integration of individual, social, economic and environmental considerations. 7 As recommended by the Lancet Commission on Planetary Health, operationalizing a life-course approach will involve "integrating the aim of sustained improvements in human health and well-being with the preservation of key natural systems, supported by good governance and appropriate policies". 17 First, we provide a conceptual framework for a life-course approach by presenting definitions of the key concepts required to build shared understanding -a prerequisite for collective action. 9,10,13 This conceptual framework was developed by analysing and thematically categorizing the findings of the two evidence synthesis reports, which reviewed more than 200 publications, using a qualitative, narrative synthesis method. 13,14,18 The conceptual framework was based on WHO's World Report on Ageing and Health. 15 Its approach to healthy ageing was extended to other age groups and health topics through consultations across WHO departments that took into account scientific and conceptual advances and updates in global strategies and programmes. 16,19 Our synthesis method followed a multigrounded theory approach and included deductive and inductive analyses and triangulation of the different methods. 20 Particular attention was paid to the implications of implementing a life-course approach to help achieve UHC and realize the SDGs. Conceptual framework As we defined it, life course approach to health optimizes the functional ability of individuals throughout life, enables well-being and realization of rights, and recognizes the critical interdependence of individual, intergenerational, social, environmental and temporal factors. Fig. 1 depicts the conceptual framework we developed. It is important to provide clear definitions of key concepts, such as: (i) functional ability; (ii) intrinsic capacity; (iii) well-being; (iv) the realization of rights; (v) life stage; (vi) resilience; (vii) risk; and (viii) the social and environmental determinants of health. The main outcome of the life-course approach to health is functional ability, which is the sum of the individual and environmental attributes that enable a person to be or do what they have reason to value. 10 Functional ability enables well-being at all ages and is interdependent with the realization of rights. For a neonate or infant, functional ability could be manifested by feeding well and playing; for older adults, by the ability to function independently without dependence on care. Functional ability is determined by the individual's intrinsic capacity and physical and social environments and by the interaction between the individual and these environments. 10 Intrinsic capacity is the sum of all physical and mental (including psychological) capacities. 10 The con-cept of functional ability is consistent with the International Classification of Functioning, which defines functioning as a composite term for body functions and structures and the individual's activities and participation. 21 Additionally, functional ability takes into account the interaction between, and the interdependence of, individual, social and environmental determinants of health and the individual agency and collective actions required to ensure health and well-being throughout life. In Fig. 1, functional ability and intrinsic capacity are depicted as idealized arcs across the life course. Intrinsic capacity follows a biologically determined trajectory of physical and mental capacities. In contrast, functional ability can be optimized throughout life by a supportive environment. The vertical bars in Fig. 1 indicate that functional ability and intrinsic capacity can vary across a range at all life stages. This variability depends on the individual's circumstances and on the critical events that influence health trajectories. Well-being is a subjective state that can be evaluated across three domains: (i) perceived life satisfaction; (ii) emotions experienced; and (iii) self-realization and a sense of purpose or meaning. 22 A meta-analysis of longitudinal studies indicated that subjective well-being is associated with lower mortality. 22 Good health depends on, and enables, the realization of rights. 2,23 Desired health outcomes should be achieved by applying human rightsbased, gender-responsive and equitydriven approaches to policy-making and programme implementation. In addition to fulfilling legal obligations, this will help ensure better and more equitable health outcomes. 24,25 On life stages, there are differing perspectives and a need for clarity. For example, questions exist about whether life begins at birth or earlier, about the most appropriate age ranges for different stages and about the specific events that influence health trajectories throughout life. Life stage definitions are influenced not only by chronological age, but also by sociocultural norms and the individual's functional status. 13,14 For practical reasons and for programming purposes, here the life course is regarded as starting at birth. Our timeline in Fig. 1 covers four broad stages: (i) birth, the neonatal period and infancy; (ii) early and later childhood and adolescence; (iii) youth and adulthood; and (iv) older adulthood. These four stages are based on programming approaches used in global health strategies. 16,19 The preconception period and pregnancy, which occur during the reproductive years, are also important times during the life course. They can affect the next generation, as reflected in intrinsic capacity at birth. Resilience to ill health and the risk of ill health accumulate throughout life and across generations. 13,14 For example, 70% of preventable deaths from noncommunicable diseases in adults have been linked to risks encountered, and behaviours that started, during adolescence. 26 In particular, 50% of mental health problems are established by the age of 14 years and 75%, by the age of 24 years. 27 In addition to the critical events that shape an individual's health trajectory, the number and sequence of exposures to risk and periods of increased susceptibility -some of which occur before birth or are genetically inherited -are also crucial. 16 Social and environmental determinants of health include health systems, essential public health functions, multisectoral factors and cross-sectoral actions. There is evidence linking people's health and well-being to poverty reduction, education, access to clean air and water, the realization of human rights and sustainable livelihoods and environments, all of which are underpinned by good governance. 7,17,25, The individual good and social good are mutually dependent and both are underpinned by the physical environment. Taking this interdependence into account requires a paradigm shift in health and development policies and programmes. 9,10,17,30,31 Implications for implementation The implementation of a life-course approach to health involves four areas: (i) policy and investment; (ii) health services and systems; (iii) local, multisectoral and multistakeholder action; and (iv) measurement, monitoring and research. Policy and investment A life-course approach requires holistic, long-term, policy and investment strategies that promote better health outcomes for individuals and greater health equity in the population -the two are interlinked. 30 For example, since 1995 the Australian Longitudinal Study on Women's Health has provided evidence of how gender and health inequities accumulate throughout life: women who struggled to manage financially before the age of 20 years had an increased risk of reduced physical capacity in later life and their physical decline started earlier. 15 To counter this, the government updated its policy to ensure age-appropriate health care and address inequities across the life course. 13,15 Long-term investment in a lifecourse approach can provide high returns for health and sustainable development, both by limiting ill health and the accumulation of risk throughout life and by contributing to social and economic development. For example, in 2013 it was reported that 11% of recent economic growth in low-and middleincome countries resulted from a reduction in preventable deaths. 32 Investment in early childhood, child and adolescent health and development can yield a benefit-to-cost ratio of 10-to-1 in health, social and economic benefits and rates of mental health disorders and noncommunicable diseases in later life can be reduced. 26,27,33,34 In 2014, an analysis indicated that a comprehensive package of family planning, quality-of-care improvements in pregnancy and childcare and the prevention and management of childhood illnesses would yield 9 United States dollars in economic and social benefits in low-and middle-income countries for every dollar spent. 35 For older people, integrated health, social and environmental investment can help reduce health-care costs and care dependency and promote well-being. 36 Investment in evidence-based interventions can also improve resilience and mitigate risks throughout life and across generations. 9,10,13,14,19 Despite the evidence supporting disease prevention, in 2015 the Organisation for Economic Co-operation and Development (OECD) estimated that spending on prevention had decreased since 2009 in around half of OECD countries, whereas spending on longterm, outpatient and inpatient care continued to grow. 37 Much more focus is required on preventing health risks and reducing their cumulative effect throughout life and across generations, and to avoid prohibitive health-care costs. Further, domestic health expenditure and development assistance for health have tended to prioritize specific diseases or life stages over others. 38 A more holistic, long-term approach to policy and investment is required to operationalize a life-course approach to health, thereby helping to ensure UHC and realize the SDGs. Health services and systems Properly implemented, a life-course approach can improve the effectiveness and reach of UHC. Planning for a life-course approach to health should coincide with national planning to achieve UHC, preferably in a people-centred manner. For example, integrating services holistically to address people's health and well-being, rather than focusing on specific diseases or issues, can yield better health outcomes and improve efficiency. 39 A two-year study of health sector reform in China highlighted the value of people-centred integrated care for ensuring better health for the population at all ages: quality of care was enhanced, individuals and families experienced better care and the cost was affordable for both individuals and government -all factors critical for UHC. 40 Countries should themselves ascertain how best to implement UHC to ensure highquality and accessible services and provide financial protection that matches the unique health-care needs of their populations. 19 These needs are detailed in Fig. 2, which shows the core UHC framework, comprising health-care needs and health services and systems, and includes consideration of life stages and the enabling environment. Health systems strategies such as integrated people-centred health services can contribute to operationalizing the life-course approach and to implementing UHC. 41 A strong health-care system is essential and WHO proposes an approach to improving system performance that will help it evolve and respond to emerging challenges. This approach has three elements: (i) strengthening the foundations of the health system; (ii) setting a coherent institutional framework; and (iii) supporting transformation. 42 In addition, essential public health functions, which constitute a country's minimum public health requirements in areas such as governance, disease control, health promotion and health research, 43 are important for linking actions in health and other sectors. All these elements require investment in, and the development of, a dedicated health workforce. Local action Global strategies and national policies have to be translated into local actions to achieve the desired outcomes. Actions across different sectors of society can have a synergistic effect in improving health, reducing poverty, improving education and gender equality and promoting socioeconomic and sustainable development. 7,25 Cross-sectoral programmes involving health and other sectors are key. For example, the Madsen's Institute for Tribal and Rural Advancement programme in India used a life-course approach with cross-sectoral programmes to transform the health of, and prospect of sustainable development for, people in 48 villages in Orissa. 44 The programme, which was led by local communities along with local health services and government, started with malaria control and expanded, according to the communities' needs, to include other health, educational, environmental and poverty-reduction goals, because these were recognized as interdependent. The result was a range of health, social and developmental advances and the infant mortality rate halved over 15 years, though it remained extremely high in neighbouring villages not covered by the programme. 44 Policy and implementation efforts across different sectors can be coordinated by applying, for example, the Health in all Policies approach 25 and multistakeholder policy dialogue. 45 These techniques can help promote accountable and participatory governance and the institutionalization of crosssectoral programmes and multistakeholder partnerships, in alignment with the SDGs. Political leadership is critical for assuring an integrative, multisectoral approach. 7,25 Many countries have made progress towards achieving UHC and improving health and sustainable development using strategies aligned with these implementation techniques: Brazil, Chile, China, Cuba, Rwanda, Thailand and subnational regions such as Kerala in India have strengthened health systems, broadened access to health services and provided progressive financing to expand UHC. 28,46 These countries and others made progress by also addressing inequities in, and the social and environmental determinants of, health. 7,25,28,46 Measurement, monitoring and research Better understanding of the life-course approach to health, which can be obtained from both objective measures and people's subjective experience, can guide individual and collective efforts to improve functional ability at all ages. In particular, more information is needed on how greater life expectancy in some populations affects individuals' health and well-being in later life. Several key issues influencing measurement, monitoring and research should be considered. Outcomes New international standards incorporating a core set of indicators applicable to all life stages are needed to improve the measurement of life-course variables. 12,13 Age Chronological age may not accurately represent biological, social, psychological or functional age or an individual's experience of ageing. 12,13 Clearer information on age ranges for specific life stages and on how to identify critical phases and pathways would enable key services to be targeted more effectively. Determinants of health The focus should be on determinants that are modifiable or amenable to change. Determinants that shape a particular life stage or influence health throughout life should be identified and monitored. 36 Change in functioning and interventions Identify and measure both factors that can cause a decline in functioning or well-being and those that can reverse that decline (e.g. reducing air pollution) and determine how this knowledge was obtained. Identify interventions likely to produce the greatest gains at different life stages. Critical pathways and complex systems A unified measurement approach is needed to take account of the wide variety of life course variables. 10,13,14 This should include metrics for analysing the life course, measures of people-centred services and patient-reported outcomes. Equity Increased understanding is needed of how and why some people and groups experience unequal access to services, resources and power and have restricted rights and freedoms. Data should be collected from, for example, statistical surveys, administrative records and human rights reports. Engagement with Research studies Substantial investment in birth cohort, longitudinal and intervention studies is needed, particularly in low-and middleincome settings. 13,14,47 Past examples include WHO's Study on global AGEing and adult health (SAGE) in six low-and middle-income countries 48 and the Longitudinal Ageing Study in India (LASI). 49 Assuring long-term investment in cohort studies across the life course can be challenging, as in the 30-year Pelotas birth cohort study in Brazil. 50 Country information systems High-quality data on health, health equity and social and environmental determinants of health across the life course are needed, along with the capacity to analyse, communicate and use the data for policies and programmes. Implementation research and knowledge exchange Research policy and new research should be aligned to support and understand the implementations of the life-course approach. The exchange of knowledge between countries should be promoted. Table 1 provides examples of how SDGs, which have already been integrated into monitoring frameworks in many countries, can be aligned with the life-course approach. Indeed, the life-course approach is relevant to many SDGs. However, more work is required to improve the tracking of individuals' functional ability and health trajectories, including the accumulation of resilience and risk throughout life and across generations. It will also be important to determine how countries use this information to take appropriate actions and to achieve better outcomes. Qualitative studies Such studies are needed to gain an insight into the context-specific, individual, sociopolitical, cultural, economic and environmental factors that influence health and well-being throughout life, some of which may otherwise be overlooked or poorly understood. 13 Conclusion A life-course approach to health can help shape UHC and wider ambitions for health and the SDGs in several ways. First, and by definition, a lifecourse approach is central to ensuring the health and well-being of all people at all ages (SDG 3). Second, this approach recognizes the interdependence of people, prosperity and the environment and can be employed to implement multisectoral actions for achieving shared goals. Third, it can inform country-specific planning for UHC and bring together elements of many existing national, regional and global health and development strategies. Fourth, it emphasizes rights, gender equality and equity, thereby ensuring no one is left behind -a central tenet of the 2030 agenda for sustainable development. The usefulness of the life-course approach for helping countries address critical, interdependent factors affecting health and sustainable development in a holistic manner means that it fits perfectly with efforts to achieve UHC and to realize the SDGs. However, translating this approach into actions will involve overcoming numerous constraints and will require more work by stakeholders across many sectors of society.

Clemensstraße Course The Clemensstraße starts at Leopoldstraße, crosses Belgradstraße and Schleißheimer Straße and turns into Saarstraße at Winzererstraße. While in the area between Münchner Freiheit and Wilhelmstraße, relatively small shops line the street initially, Clemensstraße becomes predominantly a residential street. Until 2002, Clemensstraße 33 housed the Staatliche Fachakademie für Fotodesign München, which was founded on 15 October 1900, as the Lehr- und Versuchsanstalt für Photographie (test institution for photograph). In the area of Belgradstraße, on both sides of the street are numerous restaurants to be found, especially in the summer months their free play areas shape the overal impression of the road. With a several decades old traditions, such as the "X-Bar" as well as the, for example, from 1972 to 1976 by Heppel & Ettlich conducted "Jennerwein". Also located there, in Clemensstraße 61, was the "Clemensburg" as Munich's only BVB pub, which existed from 1907 to 2015. In the further course to the east, the Clemensstraße is again primarily a residential street. In the Clemensstraße 113/IV is the Säkularinstitut Ancillae Sanctae Ecclesiae. At the corner of Clemensstraße and Winzererstraße is the Landesarbeitsgericht München (Munich Labor Court). Historical buildings In the area between Münchner Freiheit and Fallmerayerstraße, the Clemensstraße, with a length of around 1,100 m, belongs to the historically protected construction ensemble Nordschwabing. Its design is mainly due to the expansion of the city after the incorporation of Schwabing in 1890 to Munich and the city expansion competition of 1892 under Theodor Fischer. Overall, the Clemensstraße has 36 historically protected monuments by the Bavarian State Office for the Preservation of monuments, of which 26 are in Schwabing-West and 10 in Schwabing. Famous residents 1884/85, the former Schwabing Hospital was built in Clemensstraße 33. In the spring of 1900, the stove and oven manufacturer Friedrich Wamsler, whose sons were among the founding members, gave FC Bayern Munich a fenced plot of land on Clemensstraße as a venue, until 1907 when he moved to Leopoldstraße and Parzivalplatz Here the first Munich City Derby also took place on 21 September 1902. From 1906 to 1910, Alexander Roda Roda lived in Clemensstraße 2. From 1917 to 1919 Ret Marut lived in Clemensstraße 84 /III and led the editorship of Der Ziegelbrenner ( brickmaker) there. From autumn 1967, Edgar Hilsenrath lived in the Clemensstraße 28. Rainer Werner Fassbinder and Juliane Lorenz lived in Clemensstraße 76, as well as Alexander Koester who lived on Clemensstraße (while his studio was on Leopoldstraße). Jochen Winter lived on Clemensstraße.

Labour has moved to box in the Tories with a pledge not to increase taxes after the election any more than it has already. That rising star, Chief Secretary to the Treasury Liam Byrne, channeling George Bush in 1988 (read my lips, no new taxes) dropped it in to the pre-election maelstrom of promises yesterday. In one sense this is clever politics from Labour, leaving the Tories as the only party so far unprepared to make specific commitments on tax. The Lib Dems seem, sort of, to be opposed to more tax rises to cut the deficit, but it’s difficult to be entirely sure. But there is a more skeptical conclusion one might draw. Namely, that Mr. Byrne’s promise on avoiding further tax increases is about as much use as a chocolate fireguard.

. BACKGROUND Supernumerary nipples are not rare but the developement of a complete supernumerary breast is exceptional. CASE REPORT A 59-year-old man presented a progressively increasing ancient right- groin-masse. The histopathologic examination of the lesion confirmed the diagnostic of polymastia. DISCUSSION The interest of this observation results from the very unusual occurence of polymastia (less than 1 p. 100 of supernumerary nipples), especially for a caucasian man. The prevalence appears to be higher in women and oriental people. Diagnostic of supernumerary nipple is difficult because of its atypical appearance and ectopic location. However, this diagnostic is important because ectopic breast tissue is subject to the same pathologic changes that occur in normally positioned breasts and it can be a marker for associated diseases such as urologic malformations or urogenital malignancies.

In a conventional direct memory access (DMA) apparatus, only a limited number of channels are available. In order to provide multiple m-channels, the DMA apparatus must be equipped with complicated circuitry. Moreover, even multiple channel DMA devices can only implement transfers from a single I/O device or memory to multiple I/O devices/memories, or, from multiple I/O devices/memories to a single I/O device or memory such as in a Motorola MC68450. Conventional DMA structures cannot perform transfers from multiple sources to multiple destinations; this is an undesirable limitation. It is therefore an object of the present invention to provide an apparatus for a multiple channel direct memory access that does not have the shortcomings of the prior art devices. It is another object of the present invention to provide an apparatus for multiple channel direct memory access by utilizing a virtual array technique. It is a further object of the present invention to provide an apparatus for a multiple channel direct memory access by utilizing a virtual array technique of simple circuitry to achieve the functions of a channel DMA.

China wants the South China Sea to be its own sea. And set its own navigation rules in one of the busiest trade regions of the world—most coming from China itself. Just a few days before the ruling of the International Court of Hague (ICH) on the South China Sea disputes, China is using harsh language, asserting its sovereignty over the South China and adjacent areas. Here’s a quote from a lengthy editorial in Global Times. While it is still unclear which way ICH will rule, one thing is clear: China’s aggressive standing in the South China Sea disputes has spooked its neighbors, including India, which has been forging closer ties with the US. That’s why New Delhi has been developing close ties with the US. That’s certainly an assurance for India, but it is bad news for the ongoing integration of the Southeast Asian region, as it puts China and American allies on a collision course that will damage global trade.

COLUMBIA, S.C. (AP) - Authorities say an inmate who escaped from a South Carolina jail was shot and killed by a woman after he kicked open the backdoor of her home. Pickens County Sheriff Rick Clark says the inmate was one of two prisoners who beat up two guards early Tuesday morning in a planned escape from the county jail. Clark says the woman who killed the inmate has a concealed weapons permit and was home alone. The sheriff says she shot him once in the head near her bedroom around 3 a.m. about 20 minutes after the escape. He thinks the killing was justified. Coroner Kandy Kelley identified the inmate as 30-year-old Bruce McLaughlin Jr. Sheriff Clark says the second inmate, Timothy Dill, was captured nearby. Clark says the guards' injuries weren't life-threatening.

Tennessee Lady Vols basketball is best suited for a fast pace and that's placing great demands on its starters in terms of minutes and production. Judging by its mixed results, Tennessee isn't up to speed yet in SEC play. The Lady Vols bolted from the starting blocks at Auburn but then stumbled against Missouri. Judging by the results of its first two league games, No. 13 Tennessee (12-2, 1-1) is better suited for a faster, more frenetic game tempo. Either way, the Lady Vols could use more pacesetters. Conference game No. 3 is against No. 16 Kentucky (14-2, 1-1) Thursday at Thompson-Boling Arena. (TV: SEC Network, 7 p.m.). A game against the Wildcats figures to be more like last Thursday's fast-paced game at Auburn than the halfcourt tussle with Missouri. Kentucky gathered 15 steals against Mississippi State on Sunday and had a hand in 24 Bulldogs turnovers. Afterward, Mississippi State coach Vic Schaefer perused the stat sheet and rattled off the names of several players and their playing minutes. Four Mississippi State starters logged at least 36 minutes. "We played a lot of minutes at that pace; 86 points is a lot of points," he said. The Lady Vols can relate. Through two SEC games, starters Rennia Davis and Meme Jackson are averaging 38 and 35 minutes per game, respectively. UT's bigger issue, though, is production, or lack thereof. In two conference games, freshmen guard Jazmine Massengill is the only reserve who has scored any points (nine). Kasi Kushkituah and freshmen Mimi Collins and Rae Burrell all are still scoreless. Collins and Burrell haven't grabbed any rebounds either. This trend began before conference play. UT had just one scorer off the bench in each of its last three pre-SEC games against schools from Power 5 conferences (Oklahoma State, Texas and Stanford). In those games, the reserves scored 16 total points. Lately there's been a correlation between playing minutes and lack of production. Kushkituah, Collins and Burrell have played a combined 33 minutes in the two conference games. Kushkituah has logged 18 of those minutes. "I want Kasi to step up more and demand the ball," UT coach Holly Warlick said. "I want Mimi Collins to be able to stay in the game. She's gotten in foul trouble it seems like the last three or four games. We need her physicalness and her ability to rebound the ball." As for Burrell, Warlick said: "The more practice we do, the better she gets. At times, she plays a little out of control for her. ... She has to get her defense a little better as well." UT getting just three points from its reserves against Auburn wasn't an issue. The Tigers' reserves didn't score. Bench scoring was a big factor against Missouri, however. The Tigers' reserves outscored Tennessee's 25-6. Missouri backup guard Haley Troup's 16 points were crucial to the outcome. UT's best upgrade came from a starter. Center Cheridene Green matched her season high with 13 points and set a career high by gathering 14 rebounds. "I need to be able to do that more for this team to help them," she said. Kentucky starting forward KeKe McKinney is a former Fulton High standout while starting guard Rhyne Howard is from Cleveland, Tenn. Howard has been named SEC freshman of the week five times already this season. She leads the team in scoring (17.4 points per game) and is second in 3-pointers with 38. According to her bio on the Kentucky athletics website, the 6-foot-2 Howard picked Kentucky over South Carolina and Purdue. "We recruited her," Warlick said. "She chose to go elsewhere." More: UT Lady Vols: Is Missouri guard Sophie Cunningham a dirty player? April 25, 2019, 11:24 p.m. April 26, 2019, 10:42 a.m.

Exploring Autonomy and Relatedness in Church as Predictors of Childrens Religiosity and Relationship with God Concerns about the shifting religious landscape for young people in the United States provides the impetus to expand research investigating childrens experiences in Christian education. A significant number of children regularly attend Christian education in church and yet there is limited research investigating how those programs support childrens faith. Guided by self-determination theory, this research investigates whether instructional practices can support childrens religiosity and relationship with God. The present study specifically assessed whether childrens perceived relatedness with adults and peers in church, and childrens perceived autonomy in Sunday school, predicted childrens religiosity and relationship with God. Two hierarchical multiple regressions were conducted to identify if the church variables were significant predictors of an identified relationship to God. Neither perceived relatedness in church nor perceived autonomy in Sunday school were significant predictors of identified religiosity. However, perceived relatedness in church did significantly predict relationship with God.

Ethical issues around access to over-the-counter medicines in South Africa South Africa is engaged in a heated debate around how to achieve universal healthcare (UHC) that will be accessible to all, affordable for the country and of high quality. Essentially, this discourse frames UHC as a right, yet there is strong evidence that certainly in the privately funded sector, healthcare functions as a commodity within a failing market system. Research has shown these failures to affect the highest cost elements of hospital, specialist and chronic disease care. In this review, we show that commoditisation also affects the primary healthcare market, specifically in the area of over-the-counter (OTC) medicines. The segment represents a multibillion-rand contribution to the economy, with stakeholders ranging from government, pharmaceutical manufacturers and pharmacists to medical schemes and their members driving the costs of OTC medicines up rather than down.

Dueling Banjos in the Evolutionary Study of Human Social Behavior I began writing this review during a remarkable journey to visit colleagues at a community-based hospital in northwestern Bangladesh. The train from Dhaka departed on time. In a cabin packed with strangers, I witnessed no violent aggression over window seats or bathroom access. After 8 hours, the train arrived at its final destination a few minutes early. This admittedly limp story illustrates some remarkable human capacities. Humans can work together to design and build an apparatus as complex and novel as a train, and we can make that train run on time. Crammed for 8 hours in a small cabin, we can sit peacefully with a mass of strangers, a rare feat among our primate relatives. And thanks to the generosity of donors from around the world, a communitybased hospital and development program serve the extremely poor in a place most donors have never visited. These are the kinds of truly remarkable feats of cooperation and generosity that Moral Origins, by Christopher Boehm, and Meeting at Grand Central, by Lee Cronk and Beth Leech, aim to understand and explain. Both books are enjoyable reads. The authors ground their discussions in compelling ethnographic accounts from a wide range of societies and reach beyond anthropology to include current research in psychology, economics, and biology. Ultimately, they aim for evolutionary accounts of our uniquely human capacities to cooperate and to be generous. Beyond these broad similarities, however, the two books have very different goals and viewpoints. Meeting aims to understand how humans succeed (and often fail) at working together, while Moral Origins tries to explain, among other things, the origins of human generosity toward non-kin. Meeting hopes to build a common ground of concepts and vocabulary for a wide range of questions about the origins of cooperation. Meanwhile, Moral Origins proposes a specific

Improve the Practice of Software Development in India by Having a Software Development Career Track in Indian CS&IT Academia Many, but not all, Indian CS&IT academics tend to have a focus on theory and research. They do not give much importance to the practice of software development. This paper proposes an additional software development career track for Indian CS&IT academics different from the existing research oriented career track. A measure of software contribution record is suggested. It opines that adoption of such changes to academic regulations will result in significant improvement of software development skill set in Indian CS&IT academia which, in turn, will result in better software development skill set in Indian CS&IT graduates. Introduction The author is a Physics Graduate (and Physics Masters drop-out) from India who was industry-trained and later self-taught in software development. He worked in the international software industry (US, Europe, Japan, South Korea, India etc.) developing systems as well as applications software (CS & IT) for over 18 years after which he retired from commercial work. He later, mainly as an "honorary faculty/visiting faculty", offered free service of teaching programming courses (lab. courses) and being a "technical consultant" for student projects in a Maths & Computer Science department of a deemed university in India for 9 years. This paper is mainly based on this experience of the author. The rather odd reality of the vast number of CS & IT departments of universities & colleges in India is that the majority of the teachers in these departments focus on theory and research publications but do not give much importance to practical areas like Software Design and Programming or Coding. Therefore the practice of software development is quite poor in most Indian CS & IT departments. The sections below give references to support these statements. Peer Reviewed Academic Literature Sources on Poor Software Development Skill Set in Indian CS & IT Academia, state that in India, "Software engineering does not yet have an independent curriculum with enough durable, codified content to justify a separate undergraduate curriculum.". They further state that in India, "Limited exposure to industry problems, inability to adapt course curricula to dynamic industry requirements, limited exposure to latest tools & techniques, inability to enter into emerging areas, rigid and outdated course curricula, (repetition omitted), poor industry linkages, little real-life case studies, little scope for creative learning are some of the drawbacks in the software education system in the universities.", conducted a survey of major software services companies in India and reported that the training programs of these companies include retraining on programming and Software Engineering (SE) as Indian academia is not able to impart these skills to the level that they expect. They further state that they studied the publicly available syllabi related to SE for a large number of Indian universities and found that the focus is on theoretical aspects and "Practical aspects, best practices, recent developments are not included and students rarely get a chance for application of the knowledge and skills they learned." General Public Views on Poor Software Development Skill Set in Indian CS & IT Academia The author believes that Indian CS & IT academics should also listen to views of students and others like the news media and teacher blogs on this matter. While these views may be contested as not having been validated by means of an academic/scientific peer review process the author is of the opinion that the almost unanimous voice of the general Indian public must be given some importance. The Indian public naturally expects that Indian CS & IT academics will prepare Indian CS & IT students to contribute mainly as competent software developers to the explosively growing software systems that pervade many aspects of modern life in India and the world. Most of the students graduating out of Indian CS & IT academia end up having somewhat strong theoretical and, at times, research-oriented skills but being poor in Software Design and Programming. The problem lies not with the CS & IT academics but with the Indian CS & IT academic system which provides career growth mainly for research output and largely ignores software contribution output. A study of over 50,000 engineers who graduated in 2011 in India, very alarmingly states, "The percentage of ready-to-deploy engineers for IT jobs is dismally low at 2.68%". It further, alarmingly again, states, "An economy with a large percent of unemployable qualified candidates is not only inefficient, but socially dangerous." A Bangalore, India industry organization is planning to set up a task force to have an interface between IT industry and academia to restructure academic courses to ensure that IT graduates have skills desired by industry. For this rather odd situation, where most Indian CS & IT academics/teachers do not have a strong software development skill set, to improve, Indian academic regulations should provide career advancement incentive for CS & IT academics who have a software contribution record. Further, students should be informed of the software contribution record of faculty of CS & IT departments by making it mandatory for CS & IT departments to put up such information on its web site. Teaching excellence in Indian CS & IT academia does not seem to be given much importance. It may be due to an obsession with research as there seems to be no significant rewards or recognition for teaching excellence whereas research excellence gives recognition, even fame at times, and career advancement. How can we improve software development teaching standards in Indian CS & IT academia? The sections below examine Indian academic regulations with this objective. A Short Introduction to The Indian CS & IT Academic System The University Grants Commission (UGC) is the apex academic body of India. "The UGC has the unique distinction of being the only grant-giving agency in the country which has been vested with two responsibilities: that of providing funds and that of coordination, determination and maintenance of standards in institutions of higher education." . The All India Council of Technical Education (AICTE) is a professional council which operates under UGC umbrella. The UGC website states about AICTE, "The council is authorized to take all steps that are considered appropriate for ensuring coordinated and integrated development of technical education and for maintenance of standards." . "The UGC serves as a vital link between the Union and State Governments and the institutions of higher learning." . The UGC regulations/norms for appointment of academics has a significant influence on the career of Indian academics of all academic streams including CS & IT who are employed in any higher education institution regulated by UGC or its professional councils like AICTE. But the extent of influence may vary depending on whether the educational institution receives government aid (funds) or not. The entry level position for a regular teacher post (as against a Teaching Assistant post) is the Assistant Professor position. The other teacher positions are Associate Professor and Professor. In India the degrees awarded for software education by UGC/AICTE regulated academia are mainly termed as Computer Science (CS) or Information Technology (IT) degrees with an additional variant of Computer Applications degrees. The Software Engineering (SE) degree/program is not well known in Indian academia. Most universities offer Software Engineering as a course along with other courses in their CS (and IT) curriculum. OR For the Assistant Professor post, the candidate should have studied under noted traditional masters, be a high grade artist of AIR/TV (Radio/Television) and have adequate theoretical knowledge; years of performance, participation in national/international seminars/workshops etc. come into play for higher posts of Associate Professor and Professor. Specifically, practical expertise of the performer is recognized and formal academic degree qualification in Music or Dance as well as research publications are not necessary. Suggestion of Two Tracks for CS & IT Academics: Research Oriented and Software Development Oriented The software development discipline is a very practice oriented discipline. Design & programming (coding) are vital skills. Of course, theoretical background is important but theory not backed by competent design & programming skill will make a software development practitioner/professional as incompetent as a musician or dancer who knows theory well but is not competent in performing music or dance. Research is also vital for the software field. It is research that creates fundamental advances in the Computer Science & Information Technology (CS & IT) fields. Without research, the great and revolutionary force of the Internet would not have been created. This single example, itself, of the benefit of research shows how critical it is for progress in the software field. There are many, many other areas of CS & IT research that are of great importance to the software field. In the author's opinion, we need both types of CS & IT teachers -practice oriented software development teachers & research oriented teachers. A very few teachers may excel at both, software development as well as research. But that will, in all probability, be a numerically insignificant minority among the huge number of CS & IT academics in the country. As of now, UGC appointment & promotion regulations do not differentiate between CS & IT disciplines and disciplines like Physics & Mathematics. The author could not find an equivalent regulations document for AICTE on its website but the general impression is that AICTE follows regulations similar to UGC in this regard. There is no incentive for practiceoriented software development teachers resulting in the majority of CS & IT academics being theory and research-oriented with not-so-strong software development skill set/knowledge. When the software development teacher himself is not so knowledgeable about software development the probability of students being taught software development skills well is very low. The author suggests that UGC & AICTE regulations for appointment and promotion of CS & IT academics be modeled on the lines of that of Music & Dance discipline. The author would not like to get into the debate of CS as science vs. CS as art. His emphasis is on the software development part of CS & IT being a very practice oriented discipline like Music and the performing arts. Further, in a tightly regulated system like Indian academia, precedent for any suggested change makes it easier to consider the change. Since the regulations for Music and the performing arts already have a mechanism to cater to both the research oriented teachers and the practice oriented teachers, the author considers it appropriate to refer to the precedent and suggest a similar mechanism for Indian CS & IT teachers. There should be two tracks for CS & IT academics -the current one for research oriented academics and another for practice oriented software development academics. Like the measure for competence in research for the (research oriented) CS / IT academic is the research publication record, the measure for competence of the software development CS / IT academic should be the quality and quantity of her open source software contribution record. Suggested Changes to Teacher Eligibility Tests (NET/SLET/SET) for CS & IT Disciplines According to UGC regulations the minimum requirements for an Assistant Professor appointment in engineering and technology discipline (which includes CS & IT) are a first class Master's degree in the appropriate branch of engineering and technology and qualifying in the teacher eligibility tests (NET/SLET/SET). AICTE seems to have watered down the requirement of Master's degree to a Bachelor's degree in engineering/technology discipline probably due to paucity of adequately qualified candidates applying for the Assistant Professor position. The teacher eligibility test is waived for candidates who have been awarded a Ph.D. degree. The present teacher eligibility test (NET/SLET/SET) for CS / IT academics is a paper only test (though the syllabus includes C/C++ & SQL ) due to which an aspirant can become eligible to be appointed as Assistant Professor without having good practical software development skills! That may be acceptable for a research track CS / IT teacher. But it is unacceptable for a software development track CS / IT teacher. Aspirants who do not have good practical software development skills should NOT be appointed as software development track CS / IT Assistant Professors (or other grade Professors). A new teacher eligibility test for software development track CS / IT academics should be introduced which will have a 50% weight-age practical test (on computer) involving programming and some amount of design, and 50% weight-age on theory. This will ensure that software development track teacher-aspirants will have to be reasonably good in both theory and practice aspects of CS / IT. Allow Movement from Research Track to Software Development Track & Vice-Versa A CS / IT academic should be able to switch track from research oriented to software development oriented if her software contribution record is appropriate. Similarly a software development oriented CS / IT academic should be able to switch track to research oriented if his research publication record is appropriate. Some CS / IT academics may have a respectable research publication record as well as a respectable software contribution record which would be a wonderfully balanced contribution record. How Do We Measure a Software Contribution? This will have to be evolved over time. Software industry bodies in India like NASSCOM & CSI (other countries would have other such bodies) can arrive at norms for evaluating an academic software contribution which can be updated at appropriate intervals to reflect the rapidly changing software practice. The author suggests the following for measuring (and sharing) the academic software contribution: 1. It should be open source allowing any person to download the software and use it, examine it or modify it. 2. Industry professionals should "peer review" the candidate academic software contribution using norms provided by industry bodies like NASSCOM or CSI and decide whether it is of requisite quality & quantity to be considered as a "peer reviewed" academic software contribution. Note that the contribution can be a single author contribution or a multiple author contribution like academic publications can be single author or multiple author. 3. Over time, an impact factor similar to one used by scientific journals can be evolved for a "peer reviewed" software contribution. Extent of usage of software can be considered for this impact factor like citations are considered in arriving at a scientific journal's impact factor. 4. To make it difficult for contributor-aspirants to fake, plagiarize or wrongly influence peer review of software contributions, any "peer reviewed" software contribution should be open to challenge by suitable industry professionals or academics. As the software will be downloadable including its source, a challenger will be in a position to study the contribution in depth and challenge its acceptance as a "peer reviewed" contribution. The challenge can be decided by an industry body like NASSCOM or CSI appointed referee. 5. All these "peer reviewed" open source academic software contributions should be properly listed and organized in a web based repository which is openly accessible. Involving the software industry in this "peer review" of academic software contributions may go a long way in reducing the huge academia-industry disconnect in the software field today. Concern of Research Rigour Being Watered Down One concern may be that the The author has direct exposure to only Indian software education academia and so has focused on it for most of this article. However, it was felt that mention of software education practices in some other countries would give a larger, international perspective. So he did a small literature survey to study efforts made to ensure good software development practice in software education in USA and some other countries, and extended it to cover certification and professional licensure. The study focuses more on Software Engineering (SE) degree programs than Computer Science (CS) degree programs. Judging what aspects of this small study report could be useful in Indian environment may ideally need somebody who has direct exposure to software education field in both India and other countries like USA. This author leaves those aspects for others to consider, if they find it worthy of consideration. SE is an established program in USA academia distinct from a CS program. The SE2004 volume gives guidelines for a SE curriculum and its website indicates that it was an exhaustive effort at improving SE education quality in the USA, UK, Australia, Canada, etc.. Accreditations of SE (and other engineering & technology) programs are conducted by organizations specializing in accrediting technical education., give details of SE programs and their accreditation in USA, Canada and UK. At a USA institute, "software engineering is a five year program, with students graduating with the equivalent of almost a full year of work experience." and there is collaboration between various companies and the institute on projects as part of the SE education program. Its website states that its senior projects involve a team of 4 to 5 students working on challenging, real-world software issues for companies & organizations and results in a functional software tool ready to be used by the organization. Stroustrup and others have adopted a "software curriculum" in a CS program with an aim to produce 'software professionals (for some definition of "professional")' and reported largely positive results from it. The IEEE Computer Society offers certification of graduates as well as self-taught software development professionals by conducting certification exams. It's "Certified Software Development Associate (CSDA)" certification/credential "is intended for graduating software engineers and entry-level software professionals and serves to bridge the gap between your educational experience and real-world work requirements" . Its more advanced "Certified Software Development Professional (CSDP)" certification/credential "is intended for mid-career software development professionals that want to confirm their proficiency of standard software development practices and advance in their careers" . IEEE Computer Society claims that its certification programs are "industry standard measurements of fundamental software engineering practices" and so are different from vendor-specific & product-specific certifications ., argue that current circumstances are favorable for formal certification in software engineering to be considered and state that there is growing support for IEEE CSDA and CSDP in both industry and academia. They further state that these certifications are based on the IEEE Computer Society's Guide to the Software Engineering Body of Knowledge (SWEBOK) which is followed by the CS and SE programs of some colleges and universities. Laplante, 2012, mentions that 10 states of USA may soon be requiring licensure for software engineers working on systems related to "public health, safety, and welfare" . He further mentions that the professional licensure requirements for software engineers will be similar to those of other engineering professions in the states of the USA and that most components of such Critical Views on Software Education in USA and Some Other Countries The author felt it appropriate to share some critical views on software education in USA and some other countries from academic and general public sources. Stroustrup, 2010, has argued that "fundamental changes to computer science education are required to better address the needs of industry", and shows the disconnect between CS academia and industry. Parnas, a veteran SE academic, in an ACM Fellow profile interview in 1999, states, "Most students who are studying computer science really want to study software engineering but they don't have that choice. There are very few programs that are designed as engineering programs but specialize in software.". He also states that the term software engineering is often confused with project management techniques. Mark Tarver, who taught in UK CS academia prior to 2000, is harshly critical of programming skills of UK final year project CS graduate students who confessed to not being able to do any programming. He is also harshly critical of UK CS education in general. A student, 2010, captured the feelings of the student community when he wrote, "I'm graduating with a Computer Science degree but I don't feel like I know how to program" and tried to seek advice from a professional programmer forum. A USA employer/interviewer, 2011, who has hired dozens of C/C++ programmers, stated, "A surprisingly large fraction of applicants, even those with masters' degrees and PhDs in computer science, fail during interviews when asked to carry out basic programming tasks". Conclusion If the practice oriented software development career track, as suggested in this paper, is introduced in UGC & AICTE regulations for appointment and promotion of Indian CS & IT academics then, over time, we will have a healthy mix of both research oriented as well as software development oriented Indian CS & IT academics. We may even have significant number of software development experts from the software industry moving to Indian CS & IT academia. What a boon that will be for boosting the software development skill set of Indian CS & IT academia! It will also dramatically reduce the huge academia-industry gap that plagues the Indian software field today. These changes, in turn, will, at least for the teaching-intensive Indian CS & IT departments, result in graduates & post-graduates of CS / IT having a good balance of theory and practice of software development with some appreciation for the research angle of CS / IT as well. Some of these graduates/post-graduates may choose to pursue research by doing a PhD in CS / IT. Some may become CS / IT academics who will be more knowledgeable about practical software development than is the case now. The majority of them will typically take up industry software development jobs for which they will be far better equipped with the required software development practice skill set than they are now. 9. Impact Factor of Scientific journals: A measure which is considered by Indian academic regulatory bodies to be reflective of relative importance of a journal within its field, http://en.wikipedia.org/wiki/Impact_factor. Reviewer1: This paper makes an interesting and controversial case for creating career tracks in the Indian CS&IT academia for faculty who, instead of pursuing theoretical research, would opt for establishing academic credentials based on their output of open source software. Much of this seems to reflect from the author's personal journey from being a non-CS graduate, with extensive experience in the CS&IT Software Development industry, and then trying to "fit in" into the academic make-up of an Indian University which seems to be heavily regulated centrally. Author: I disagree with a part of the last statement. I consider myself to be an accomplished industry-trained and self-taught software industry technical consultant, who, mainly as an Honorary Faculty/Visiting Faculty, provided free teaching and guidance service to students in software development/engineering and thereby contributed to strengthening the practice of software development/engineering in a CS department in India. I was not and am not interested to "fit in" the academic make-up of any Indian university at all -my intention was to help students learn the practice of software development well, and I believe I succeeded in no small measure in that regard. From my experience of Indian CS academia I had some suggestions to improve the practice of software design & development/engineering in it which I put forward in this article/paper. Reviewer1: Many issues here: the first and foremost, whether the specific situation in Indian academia is worth publishing in ---publication-name-description-blinded---with a much broader international audience. On the other hand, given that such situations exist in several countries, this is a good discussion starter to bring a broader awareness to the issues faced and the possible (in my mind, skewed) solution being proposed. From what I gather, the main problem seems to be in the area of software engineering education. Reviewer1: While, on one hand, most CS&IT faculty in India seem to be primarily devoted to theoretical research, there seems to be a practice among academia of relaxing the qualifications for hiring CS&IT faculty due to the "paucity" of qualified faculty. It is easy to see that the poor quality of Indian CS&IT graduates being prepared for software development jobs in India upon graduation is an artifact of poor quality software engineering education (or a complete lack of it). Author: I tend to agree with these views in the Indian context. Reviewer1: The solution being proposed, to create UGC regulated mandates for separate faculty career tracks, is rather controversial, and perhaps misplaced when one sees it in the larger context of the role of academia. Much of the problem should, and can, be addressed by creating a well qualified pool of faculty in the CS&IT disciplines, software engineering included. Additionally, along with the faculty, to create educational tracks in CS&IT Departments at universities to teach software engineering curricula. Without a presence of these two things, it seems like a proposal to create accommodations for industry professionals to enter non-research tracks in academia, is misplaced and a poor solution. Author: It certainly is *not* a proposal focused on creating accommodations for industry professionals to enter non-research tracks in academia. It is a proposal to provide career growth incentive for Indian CS & IT academics to excel in the practice of software development instead of focusing on research publication output and ignoring excellence in practice of software development. Industry professionals being accommodated in a non-research software development career track is a secondary and optional part of what this paper proposes, which in my opinion, has significant value for improving the practice of software development in Indian CS & IT academia. Reviewer1: This can be detrimental to the intrinsic health and make-up of an entire higher educational system. The case is made, based on faculty in the Performing Arts which tends to be one of the few outliers in this regard. Even in Performing Arts, there is much resistance. Ordinary, day-to-day practitioners of the art seldom attain faculty status even in the Performing Arts. Author: In India, it is common to see faculty of the performing arts deliver a performance to the public which leaves students, parents and the public in general in no doubt as to the practical skill of the performing arts faculty. In marked contrast, there is huge amount of doubt in the mind of students, parents and the public in general about the practical software development/engineering skill of most Indian CS & IT academics. Reviewer1: Besides, there are existing models that accommodate "both" classes of faculty in a single framework that are present outside India that need to be examined. For example, giving academic credit for software artifacts during the promotion and tenure process is widely promoted by the Guidelines published by the Computing Research Association (in the USA). The author should take a look at that. Author: It is interesting and it will be good if Indian academic regulations take note of it and provide significant academic credit for software artifacts. I agree very much with the view expressed therein that, "Assessing artifacts requires evaluation from knowledgeable peers." In the Indian context, in my opinion, at least in the short term, it is the software industry which has the capacity to provide enough numbers of knowledgeable peers to evaluate software artifacts produced by Indian CS & IT academia. Reviewer1: Much of the surveys presented in the paper are about the state (or lack there of) of software engineering education in India. To suggest that a government regulated body create a "practitioner track directed to serving a dimension of a transient and evolving industry" and further put into place specific software-based evaluation metrics for the hiring, promotion, and career advancement of such faculty is a bizarre idea that makes for an excellent blog post, or an opinion piece. Reviewer2: It is good to see a paper addressing issues relating to the relevance and quality of computing education at a national level in India, and the challenges in preparing competent practitioners for the local IT industry. Such a discussion has potential to be of interest to --publication-name-blinded---readers. However the solutions proposed fail to take into account several critical issues. The move beyond computing as CS, EE or IS to a broader set of cognate computing disciplines in a wider family as noted in the ACM 2005 overview report. Therefore institutions need the flexibility to adapt curricula to meet both local conditions and international standards. A highly rigid national framework militates against such adaptability, and thus we see private organisations filling the gaps by providing vocationally focussed certifications. If the core degree learning provides a sound underpinning education, then maybe this is ok? Shackelford, R., Cassel, L., Cross, J., Davies, G., Impagliazzo, J., Kamali Author: Noted. Reviewer2: "These distinctions can be traced back to the origins of the discipline, and early schisms "between the logicians and the technicians", depending upon whether one came from a more theoretically oriented mathematical background, or a more practically oriented engineering background". The role of the SE discipline has always been problematic, and the tensions between the body of knowledge, the evolving nature of practice in the field, what skills should be taught and the nature of the academy and its value systems has always been an issue. But University systems are by their nature international, and local solutions which focus primarily on the vocational teaching mission without doing equal justice to the research mission, are likely to result in reputational damage to the institution. Cf. the discussion below: Clear, T. Software Engineering and The Academy: Uncomfortable Bedfellows? SIGCSE Bulletin, 36, 2 (June 2004), 14-15. Author: I read some other messages in the above article: "Reflecting upon how this experience had enriched his teaching upon his return to the academy, he also noted that few engineering educators possessed any experience of engineering practice."... "If we consider medicine as an analogous profession, have not the medical educators themselves completed clinical practice requirements? Would doctors who had never practiced be regarded as credible professors of clinical medicine? Why do we privilege the doctoral qualification over the practice credentials in the case of our software engineering professors?"... "Being prepared to recruit ex-practitioners without PhD qualifications, and recognise their value in non-traditional ways may be strategies vital to success in teaching a quality software engineering programme." In my opinion the above views match the views expressed in my paper. Reviewer2: But I doubt that measuring an academic's software capability and contribution by open source software production is practicable. (Although for the 'R' statistical software package, newly contributed and specialised statistical modules are formally peer reviewed before acceptance). For instance Open Source is but one mode of software development. What of the skills of developing proprietary software in teams? Author: The problem with proprietary software would be availability of source code for reviewers. I guess this would be similar to proprietary research work which is not published in academic research publications and therefore may not contribute to an academic's career growth directly. Reviewer2: What of domains of application? What of experience of software engineering gained through research involvement with software development firms? Such partnership models are often applied as academics move away from regular software development, and perhaps through supervision of development by students, to a more theoretical, SE process, SE practice or managerial SE research focus. Author: The software contribution record that I suggested looked only at software contributions. It can be discussed whether it should be expanded to include some of the above suggestions and the manner in which it should be included. Reviewer2: The reality of the research teaching divide is also endemic in the academy, as developed in the paper below, and as recently observed by the Business School Accreditation Body AACSB's Blue Ribbon Committee in the report below: Author: Noted. Reviewer2: In other systems when hiring academics, their skill sets are carefully considered against the needs of the department. It is unlikely that an academic with no knowledge of software engineering practice would be hired to teach a software engineering course, although they may teach a math course or a course in theoretical CS. Author: Unfortunately what Clear,T. wrote (mentioned earlier), "few engineering educators possessed any experience of engineering practice" applies very well to Indian CS & IT academia. Career growth incentive to them to improve in software engineering practice may lead them to make efforts to do so. Otherwise it is natural that they will be attracted only towards producing research publications as that provides career growth. Reviewer2: As presented, while there is active debate in many of these areas, the paper does not fully address the issues that are obstacles to implementing such a nationwide programme of change in the Indian Higher Education System. It poses a challenging set of questions in the context of the author and his perspective on computing education in his country, and how practice and theory gap might be reduced. To that extent the issues are important to all computing educators, so a debate could certainly be had. As it stands unfortunately the paper lacks the dimensions to productively lead that debate. With a more considered set of proposals and a wider understanding of the academic setting and how to effect change in a complex context with local and global dimensions, there could be a stronger candidate for publication.

Scene structure analysis for sprint sports This work proposes a robust model to analyse the structure of horse races based on 2D velocity vector information. This model is capable of detecting scene breaks, classifying the view of the contenders and extracting the trajectory of the contenders throughout the race. The performance of the system is tested over six video clips from two different broadcast sources. The performance analysis shows the model achieves a high accuracy of view classification with the lowest value of 83%, all in real time.

What makes mental health and substance use services youth friendly? A scoping review of literature Background There are increasing calls to make mental health and substance use services youth friendly, with hopes of improving service uptake, engagement and satisfaction. However, youth-friendliness in this area has not been clearly defined and there is a lack of information about the characteristics that make such services youth friendly. The purpose of this scoping review was to examine the literature available on youth-friendly mental health and substance use services in order to identify the characteristics, outline the expected impacts, and establish a definition. Methods A scoping review of seven databases and grey literature sources was conducted. Twenty-eight documents were retained as relevant to the research questions. Relevant data from these documents was extracted, analyzed and presented to stakeholders, including youth, caregivers and service providers to validate and refine the results. Results Youth-friendly mental health and substance use services include integrated, inclusive, confidential and safe organization and policy characteristics; bright, comfortable, environment with informational materials; welcoming and genuine service providers with appropriate communication and counselling skills; an accessible location; minimal wait times; and individualized and innovative approaches. All areas in which youth friendliness should be implemented in a mental health and substance use service organization had a core value of youth voice. Conclusion Improving the youth friendliness of mental health and substance use services includes incorporating youth voice in organization, policy, environment, service providers, and treatment services, and has implications for treatment uptake, engagement and satisfaction. Further research is required to determine the impact of youth friendliness in such services. Electronic supplementary material The online version of this article (10.1186/s12913-019-4066-5) contains supplementary material, which is available to authorized users. Background The United Nations has defined 'youth' as a period of development between the ages of 15 to 24 years. This is a crucial period for the emergence of mental health challenges, with some 70% of mental health disorders arising before adulthood. An epidemiological study suggests that mental health and substance use (MHSU) disorders occur in some 12.6% of people under 18 years of age in Canada. In addition, Statistics Canada data shows that suicide is the second most common cause of death among youth, making youth-specific MHSU services a critical area for development. Despite treatments being available, many mental health disorders in youth remain untreated. Barriers to treatment in this age group include inadequate awareness of mental illness and the treatments available, youth preference for self-management, stigma, lack of screening and identification, treatment access issues, system fragmentation, and a lack of youth-specific evidence-based treatments. In order to improve service utilization, there is increased attention to factors affecting youth engagement in services, including the establishment of youth-friendly mental health services. The World Health Organization (WHO) developed a framework for youth-friendly health services in general; their recommendations include access to acceptable health services, and the right services for each individual, provided in an appropriate way. WHO proposes that making health services youth friendly may improve service utilization, with increased youth engagement and satisfaction. However, this framework was developed with an overall health perspective, including the full range of physical health services, i.e., it is not specific to MHSU services. These recommendations may or may not be relevant to MHSU services. Although some literature has addressed youth-friendly MHSU services, there is a lack of clarity about the definition and characteristics of youth friendliness in MHSU service contexts. Without an understanding of how the youth friendliness of MHSU services is defined and how it is characterized, it is difficult to establish the extent to which services are youth friendly and identify areas for improvement. The objective of this scoping review is to examine the literature available on youth-friendly MHSU services from the perspectives of youth, caregivers, and service providers. The main focus is to identify the characteristics of youth friendliness in MHSU service settings, formulate a definition, and outline the expected impacts. Methods For this scoping review, we have accepted the United Nations definition of youth (i.e. age 15-24 years), but allowed for flexibility in the defined age range based on definitions used in the literature. The methodology is described in detail in Hawke et al.. Our methodological approach was based on established guidelines and included six steps: Defining the research question This scoping review seeks to answer the following research questions: a) What are the characteristics of youth-friendly mental health and substance use services? b) What is the expected impact of youth-friendly mental health and substance use services on service uptake, engagement and satisfaction? c) How are youth-friendly mental health and substance use services defined? Identifying relevant studies A search of seven electronic databases (Table 1) was conducted to identify literature produced over the last fifteen years, with an extensive grey literature search based on the Grey Matters research tool. The database search was developed in Medline using text word and subject heading terms for the particular concepts of 'youth friendliness' and adolescent or youth, mental health or substance use (see Additional file 1). This search was then adapted to other databases. Since 'youth friendliness' is not a specific subject heading, and we wanted to explicitly address this concept (e.g., we were not interested in the broad concept of 'youth appropriateness'), we searched for citations that included either the word 'friendly' or 'welcoming.' Google Advanced Search was used to conduct a wider search for grey literature. We also identified additional literature from the reference lists of relevant documents. Study selection A total of 292 documents were identified through the database and grey literature search process, and 22 documents were added from reference lists of relevant documents. Ninety-four duplicate studies were removed and 220 studies were screened on the basis of inclusion and exclusion criteria (Table 2) at the title and abstract level. The Cochrane-recommended software program, Covidence, was used for title and abstract screening. Two raters independently screened and rated documents for relevance; any discrepancies were resolved by a third independent rater. One hundred and twenty-three studies were excluded at this stage; the remaining 97 studies were screened at the full text level, of which 28 were selected for final inclusion in the review (Fig. 1). Data extraction Data from the final 28 documents were extracted using a data extraction form by two research assistants and verified independently by a third researcher. For further details about the data extraction form, see the published study protocol. Collecting, summarizing and reporting of data The collected data were summarized descriptively; the characteristics of youth-friendliness were found to fall into four overarching spheres: organization and policy characteristics, environment characteristics, service provider Stakeholder consultations In order to validate the results, focus groups were conducted with 32 stakeholders, including youth, caregivers and service providers. We consulted standing advisory groups of service providers, caregivers and youth; since attendance at these groups is variable, our consultations included 19 service providers, 8 caregivers and 5 youth. Service providers were 13 female, 3 male, and 2 trans/ non-binary participants, with an average age of 37.8 (SD = 11.4); a majority (66.6%) were Caucasian. Caregivers were 7 female and 1 male participants, with an average age of 50.9 (SD = 8.8); a majority (75.0%) were Caucasian. The mean age of youth was 20 years (range 18-23 years), with 4 female and one male participant, and two Documents relevant to any mental health and substance use service setting (i.e., community centers, hospitals, primary care) Documents not discussing services for mental or behavioral health or substance use (e.g., focus on physical health services) Documents focusing on adolescents, youth, young adults, or emerging adults Documents mentioning youth friendliness only in passing/not explaining youth friendliness in ways that answer the research question Documents irrespective of gender/sex, and ethnicity Documents specific to a particular treatment modality rather than the service setting as a whole (e.g., youth adaptations of cognitive-behavioral therapy) Only documents addressing mental/ behavioral health or addiction service settings Only documents specifically discussing the definition, characteristics, or expected impact of youth friendliness in these settings Conference presentation more than 3 years ago Participants were asked to provide feedback about the preliminary results of the review and to identify any missing components. They were asked "What part of this information makes sense?", "What part of this information does not make sense?" and "What information would you add to these findings?" Their feedback was used to refine the results. Results Out of the 28 papers included in the review, 18 were peer-reviewed journal articles and 10 were grey literature documents; the 28 documents originated from 6 countries, representing 19 research teams. They presented the perspectives of service-seeking youth, caregivers and service providers. Results are summarized in Table 3. Data from the retained documents were found to fall into four main aspects of services: organizational/policy characteristics, environment characteristics, staff characteristics, and treatment/service characteristics; additional data suggested the impacts that youth-friendly MHSU services might have and proposed some aspects of a definition. Stakeholders provided feedback in focus groups, which was incorporated into the results. Organization and policy characteristics In order to truly make MHSU services youth friendly, findings suggest that substantial system level changes may be needed. This may require incorporating the following characteristics into the organization and policies of an MHSU service and more broadly into the MHSU service system as a whole: * = Supported/expanded upon by youth consulted. # = Supported/expanded upon by caregivers consulted. = Supported/expanded upon by service providers consulted. Youth voice: youth engagement at the organization/policy level Youth are considered to be best positioned to judge the youth friendliness of MHSU services. A number of authors therefore suggested that youth should be engaged in organization and policy development, implementation and evaluation of services, through youth advisory or consultation groups. Tokenistic youth engagement needs to be avoided, and youth engagement should be ongoing; an example includes involving youth on the board of directors #. This may support the appraisal and accountability of the service. Diverse youth from a wide variety of locally-relevant cultures and identities should be engaged #. Youth expect organizations to work 'with youth' (i.e., alongside youth) rather than 'for' or about youth, which they feel helps youth retain their agency and power*. Youth engagement helps youth develop skills that they can use in turn to provide input into services and to help the organizations become more youth friendly. Several papers provided recommendations on engaging youth effectively in service development/planning. An important aspect includes providing youth with incentives that are practically appealing, to help them engage at the organizational level,#, *. This may help youth take the first step to enter a service organization, which may then lead in turn to valuable youth engagement at both the organizational and service levels*. One-stop shop/integrated services In order to be youth friendly, the literature posits that youth-serving agencies should, at the organizational/policy level, offer comprehensive co-located services for mental and physical health, substance use, and social and vocational support. This may also include housing services. Integrated services are believed to make youth feel safe, since they can meet various practitioners to address a wide range of needs in an environment to which they are accustomed. Co-locating services prevents youth from spending time or money to access diverse services in different locations*; in addition, they can receive services without it being obvious to their peers what type of services they are seeking. The 'one-stop-shop' approach can also prevent youth from having to repeat their stories multiple times ; in an integrated service environment, organizations may share their databases about the youth's history # or give the youth access to their file to share, further preventing the repeated telling of their stories #. An integrated service experience can be supported by providing a wraparound worker who can help youth access multiple services #. Goodwin recommended embedding youth friendliness across partnering organizations, i.e., the youth friendliness of the main youth-serving agency is insufficient if the collaborating partners do not also uphold youth-friendly approaches. Confidentiality and privacy Confidentiality and privacy are critical to youth-friendly MHSU services. Thus, organizations should have clear policies about confidentiality, rights and responsibilities, and consent to involve others in treatment. Although integrated services can prevent youth from having to retell their stories, youth also appreciate confidentiality*, i.e., they only want their information shared with their consent, even among colleagues who are directly serving the youth*. Youth should therefore be informed about what is confidential and what is not, including confidentiality vs. sharing with parents and the limits to confidentiality. Youth's explicit permission should be obtained before releasing information to parents. Appropriate promotional approaches Often, youth may not be aware of the existing MHSU services available to them, which is an access barrier at the organizational level. Thus, a youth-friendly service is one that invests appropriate resources to promote services, using youth-informed methods to reach the target youth. Diverse youth should be engaged in developing youth-friendly promotional materials and strategies. Youth engagement in the promotion process is key as youth can explain services in youth-friendly terms and dispel myths. It may be important to include information about youth engagement in promotional materials, including the incentives being provided to youth,#. Knowing that engagement and incentives are available may motivate youth to take the first step in engaging with the organization*,,#. Youth also suggest displaying posters about services in spaces that youth frequently visit*. Peer mentors may be engaged to promote services in schools and educate youth about mental health issues #. To promote MHSU services specifically to male youth who may be more difficult to reach, it may be helpful to involve male counsellors or youth in targeted promotional activities to increase visibility of male-role models. Technological platforms Since today's youth are avid users of technology, MHSU service organizations should make the commitment at the organizational level to leverage technological platforms to reach youth for promotional, informational, and psychoeducational activities. For example, social media platforms/websites can be leveraged. The type of social media used to promote services may affect the level of youth engagement and service seeking. However, it should be kept in mind that youth may not follow certain social media pages if they are concerned about being stigmatized by their peers*; technological platforms used to promotes services should have generic names or icons that enable youth to use them discreetly and should be private and confidential. Websites should provide clear information that help youth identify issues, without providing diagnoses; they should also offer practical advice on how to stay mentally healthy and provide links to multiple resources/available services. Youth-serving agencies should commit at the policy level to making their service setting a safe space in which youth feel respected and valued, without being judged on any grounds. Youth appreciate interpersonal interactions that make them feel safe and welcome in a MHSU service. In order to provide a safe space, the key values of the MHSU service need to be identified and embedded in organizational policy. Safe-space values include no discrimination (e.g., discrimination against immigrant youth, racialized youth etc.)*, using a trauma-informed lens*, having a conflict resolution policy, placing safety first, and having back up clinical support, as well as understanding intersectionality*, and establishing an anti-oppression policy. The youth consulted noted that it may be impossible to ensure that a space feels safe to all service users, as the types of discussions and interactions taking place in the space cannot be completely controlled and some of the topics that youth wish to discuss may not feel safe to them (e.g., discussing traumatic experiences)*. Thus, youth suggest that it would be more youth friendly to establish the service setting as a 'brave space' rather than a 'safe space', since youth are being brave by discussing sensitive issues*. Transitional age focus To be youth friendly, organizations need to recognize that 'youth' is a transitional age that is distinct from childhood and adulthood, with developmental implications. Youth may not feel comfortable in services that are targeted towards adults or children. However, the 12-25 age range is also not a homogenous age group; services should cater to varying ages and developmental stages, which is a balancing task that can be difficult to achieve, but should be prioritized in the context of youth-friendly MHSU services. The youth consulted were particularly interested in ensuring smooth transitions between services; for example they appreciate having guidance in the transition from children's services to youth services or from youth services to adult services*. Inclusive and culturally diverse services A MHSU service may be perceived as more youth friendly when it is accessible for youth with a diversity of needs and abilities and respects their cultural background. In order to build trust with youth, organizations need to develop policies regarding knowledge of youth cultures, including sex, gender, race, discrimination, etc., and train staff to discuss such sensitive issues. For example, youth belonging to the LGBTQ community should be able to talk about their issues openly, without stigma. Similarly, Indigenous youth may appreciate groups focusing on Indigenous issues, without excluding other youth. For example, Goodwin established a bicultural service, taking into consideration the Western-European and Maori cultures reflecting the local cultural context. Although cultural competency (i.e., knowledge about common experiences of different cultural populations) may be an essential component of youth-friendly services, youth stressed that training staff in cultural competency is not equivalent to having staff with direct lived experience of the culture in question*. Thus, organizations striving to be youth-friendly should employ service providers from diverse groups, with a variety of cultural backgrounds. Terminology Bardash reported that youth find the current terms used in MHSU services to be pathologizing or disease-based, and suggested that more youth-friendly terms should be used, for example changing the term therapist to counsellor. There may be a need to develop terms or labels that youth and caregivers are comfortable using. Similarly, caregivers noted that labelling youth with a diagnosis may create stigma and be harmful for some youth, but that, for other youth, having a diagnosis may help them understand their issues and access appropriate services #. Thus, using terminology that is not stigmatizing, yet helps youth access the services they need, may make services more youth friendly. Environment characteristics One aspect that draws youth with MHSU challenges to the service setting may be its environment. Many characteristics of the environment that contribute to making a MHSU service setting youth friendly were highlighted in both the literature and stakeholder consultations. Youth voice: youth engagement in environment development Youth should be provided with opportunities to make the service environment their own. For example, youth engagement teams can be engaged in the design of the space, such as choosing the color of the walls or making murals. Service-seeking youth may also appreciate influencing their service environment, e.g., deciding to have music in the background during a session. Physical layout and dcor Youth prefer a comfortable, relaxed, appealing, and welcoming physical environment. They appreciate a non-clinical atmosphere, i.e., avoiding the white walls one might expect in a hospital setting. There should be windows in the space #, and it should be brightly illuminated*. Youth have reported preferring bright colors and comfortable furniture like couches, which makes the space more informal and comfortable. Colorful artwork and posters of modern music and media personalities also create a vibrant atmosphere. The artwork and posters should reflect diversity (e.g., displaying gay/ transsexual couples or people from diverse ethnical or cultural backgrounds) and be in tune with the culture of the youth served #. Youth might be invited to display their own artwork in the center. Although the literature suggested including magazines in the space to make the environment youth friendly, this may now be an outdated recommendation, as stakeholders mentioned that youth currently prefer using social media*,#,. Some youth may appreciate adult coloring books* or "Zines" (i.e., youth-published work). Similarly, music in the waiting room is considered to make the environment youth friendly, since it relaxes youth and puts them at ease*, but the choice of music may be different for different youth*,#,. While designing a space, it is important to find a balance between a professional versus youth-oriented decor, since some youth may not appreciate services aimed excessively towards youth,#. There should be a quiet area in the setting for youth to de-stress ; youth added that there should be a space to do school work while waiting for appointments*. Caregivers further suggested a smoking area for youth, as some youth may use smoking to manage their emotions #. The waiting area can be enhanced by providing easy access to condoms, dental dams #, and harm reduction supplies. Youth may want access to electronic entertainment, e.g., computers and iPads with internet access in the common waiting area. All three consultation groups expanded on this notion, noting that Internet access (Wi-Fi) has become an essential part of youth-friendly MHSU services*,#, ; youth mentioned feeling less anxious when Wi-Fi is available to occupy themselves while waiting for an appointment, search for MHSU concepts, communicate with friends or family, or search for public transit*. Session rooms should also be designed with youth friendliness in mind. For example, they might have refreshments available, which are particularly appreciated by youth*,,#. In addition, youth appreciate having small tactile objects available to keep their hands busy ("fidget toys"), as well as other features such as musical instruments or sports collectibles to stimulate conversation. This may help youth relax and communicate more easily*. Informational materials Several papers suggested that youth appreciate having informational brochures available in the waiting area. Youth-friendly brochures may provide information about a range of topics, in plain language and in multiple languages, including content in line with best practice guidelines; information should be up-to-date and strengths based, inspiring hope and normalizing help seeking. It may be appreciated if such information is displayed in plain sight along with a range of other information, where youth feel they can access the information discreetly. Since youth may not always read brochures, this information should also be available through other channels (e.g., websites, social media). Staff and service provider characteristics It has been suggested that youth find the youth friendliness of a service provider potentially more critical than their qualifications. The characteristics of a youth-friendly service provider are described below. Paradigms of working with youth The literature highlights that staff paradigms (i.e., ways of viewing the world and its various problems) about working with youth are crucial for the development of services relevant to youth. Staff are encouraged to challenge their pre-existing, longstanding ways of working in the mental health system. Similarly, service providers may abandon the professional constraints of conventional counselling settings and alter the service settings for youth depending on what they prefer, e.g., doing a project or walking in the park together, etc.. Challenges for service providers may include conquering their own biases (e.g., gender-related biases) and clinical training and beliefs (e.g., maintaining professional distance to preserve objectivity). Youth voice: youth as service providers The youth voice can be an integral part of the interprofessional team in the form of peer counselors to enhance youth friendliness. Since many youth like to talk to and listen to other youth, youth may be engaged in helping each other during times of stress. Youth may also express an interest in learning counselling skills and becoming peer counsellors themselves. The 'Right Here' project found that when peer counsellors are engaged, this provides them with an opportunity to share their lived experience, reduces stigma and decreases isolation. All three stakeholder groups suggested benefits of having young peer workers at the front door, for example a peer greeter*,,# who can welcome them and guide them through the site's offerings to help to make them feel comfortable. Young staff members While youth engagement mechanisms such as youth advisory groups and peer counselors are critical, employing young staff members, such as young clinicians, may also add to youth friendliness. Some youth may relate better to younger staff members who identify more with the realities of young people today than older staff with retrospective views. Following this principle, Goodwin reports that more than 50% of staff in their MHSU service, which they intend to be youth friendly, are under 23 years of age. Welcoming staff The youth friendliness of a MHSU service environment incorporates not only service providers, but also support staff such as receptionists and other collaborating professionals. By being welcoming, offering a smile when appropriate #, * and a casual "hello, how are you," the full range of staff members can help make a service youth friendly. Notably, youth may interact with support staff such as receptionists every time they access services, unlike clinicians whom they only see during particular appointments. The characteristics of these support staff may be a guiding factor in bringing youth back into services and should therefore have youth-friendly demeanors #. Service provider values & attitudes A number of personal characteristics, or virtues, were considered important in making a service provider youth friendly. Notably, Hyman et al. found that to be youth friendly, service provider should be "active listeners," have "positive personality traits" (i.e., friendly, nice, patient), and be "understanding." While many virtues were listed across the full range of documents reviewed, several emerged as the most dominant: being nonjudgmental, respectful, genuine, honest/direct, and "cool" or similar to youth. In stakeholder consultations, service providers notably agreed that genuineness was important since youth can identify when staff are not genuine. They highlighted the importance of using creativity when working with youth and being curious about the youth experience. However, they also emphasized that it would be difficult for one service provider to embody all of the values and aspects of youth friendliness, citing concerns around personal limitations, work-life balance, and burnout. Inter-professional support, possibly including peer support workers for staff, may help staff be more youth friendly. Communication and counselling skills Youth appreciate when staff have an easy and informal communication style, and are dressed casually. Youth recommend that staff communicate in a manner appropriate for a youth's age, introduce themselves and explain their role. Staff should have knowledge about slang used by youth, which may change rapidly, and clarify when the meaning is unclear. Using humor helps to reduce a youth's anxiety and achieve an open and relaxed rapport, but should be used situationally. Service providers should build trust, with mutual understanding, so youth do not feel pressured to divulge information. They are also encouraged to use a trauma-informed lens. A youth-friendly service provider genuinely* listens to youth and validates their feelings and thoughts. Youth prefer an open session atmosphere where they can talk about anything, including current worries and issues other than the main issue, without interruption. When staff remember the reasons a youth came to the service, it makes the service more youth friendly. Repeating their stories can be discouraging and may reduce the impact of treatment. Staff also recognize that youth may not know about mental health services; guiding youth in navigating services is therefore helpful. Staff should discuss youth's expectation regarding therapy and clarify any misconceptions. Likewise, staff may have to address their own misconceptions, to ensure they understand what a youth is communicating.* Youth also appreciate receiving practical advice and clear guidelines about how to solve problems. In addition, they appreciate appropriate information about how treatment is expected to help. Self-disclosure can help staff communicate with youth who find it difficult to talk about personal matters directly, e.g., when staff provide information about themselves, it may encourage youth to tell their own stories. Counsellors need to use sound clinical judgment and base their communication on what is most beneficial for youth ; this is particularly important for youth who may find it difficult to maintain boundaries. Treatment/service characteristics The final overarching category that has been suggested to make MHSU services youth friendly is the treatment or service itself. A number of characteristics were found to make a treatment/service more youth friendly. Location and access Youth are concerned about the location of services and how to access them, i.e., using public transport or having their parents drive them. MHSU services need to be located somewhere that youth can easily find and access, such as close to public transit or in places such as shopping centers or youth centers. Location can be associated with stigma, which may prevent youth from accessing services. For example some youth appreciate a discreetly located service to avoid being seen, whereas others prefer a location closer to other services, such as physical health care, since they can be perceived as accessing the other, less stigmatized service. Although some youth may consider school-based MHSU services stigmatizing if their peers are aware of their service use, school-based services may also be useful for some youth #. Appointment and wait times A number of documents suggest establishing flexible appointment times that are convenient for youth needs and schedules, e.g., outside school hours, work, or other daytime activities. Sessions should be long enough for youth to avoid feeling rushed, or flexible, depending on each youth's needs (e.g., youth may just want to drop in to have a chat). Drop-in visits and telephone consultations may also be helpful. For example, Goodwin's program provided a free phone number for consultations. Using text messages to provide appointment reminders may prevent youth from missing appointments. Youth may respond to text messages much sooner than other communication approaches. If privacy and confidentiality is ensured, text messaging can be used to communicate with youth more effectively. Minimal wait times are essential, since a youth's life situation may change rapidly. With long wait times, youth may age out of services, or their MHSU situations may deteriorate, potentially opening the door to catastrophic outcomes such as suicide attempts*,#. Immediate crisis management services are essential #. Some have suggested the benefits of providing an 'access worker' to support youth during wait times when waits are unavoidable. Such a support worker could check in with the youth during the wait*, provide support during critical times and increase the youth friendliness of the service. Cost Youth who cannot afford services will not likely access them*. Thus, youth-friendly MHSU services are affordable, free or inexpensive. Youth-practitioner fit A service should have service providers available representing locally prevalent diversity factors, e.g., gender/ sexual diversity, cultural diversity. # For example, a female youth with history of abuse may prefer talking to a female counsellor. Youth should therefore be asked whether they prefer a particular service provider or certain provider characteristics #. Youth may prefer a consistent service provider, since it is frustrating to lose access to a worker with whom they have established rapport. It may therefore be important to tell youth when a given service provider is available, and having that worker occasionally check in with the youth (e.g., a phone call or a text message), even if they cannot offer optimal appointment flexibility. If rapport is not established, or rapport breaks down, urgent recognition and transition to another appropriate service provider in a timely manner may be necessary. First contact and assessment A prolonged assessment process during the first contact may discourage youth and affect retention, especially after a protracted wait time #. An informal first contact, without a long paperwork process, is considered more youth friendly. Consistent with an organizational commitment to using technology, using electronic means of assessment (e.g. iPads) may be more youth friendly #. Goodwin suggests a simple assessment process using the CHEADS framework (Culture, Home, Education, Activities, Drugs, Alcohol, Sex, Suicide), which utilizes a holistic, developmental and strengths-based framework. Alternatively, an initial session may be offered to establish rapport with youth and provide initial counselling, followed by a detailed assessment during follow up sessions #. Youth voice: youth involvement in treatment decisions Youth need to be well informed about their care, so that they are able to ask questions and make decisions about it. They may be presented with all of the available treatment options, and may be asked if they know about a treatment option that staff could potentially provide. It is encouraged to solicit youth feedback after every session, to ask what they appreciated and what might not have worked for them. For youth who may be apprehensive about sharing their feedback, an online, anonymous feedback form may be made available #. Informed decisions and feedback that is then reflected in the care plan may help build rapport and give youth control over their care. Individualized response It is essential to provide an individualized response, since every youth is unique #,, *. This may require flexibility by service providers, i.e., regarding the time it takes to establish rapport, the topic and pace of conversation, and duration of interaction with the youth. For example, some youth may prefer a strengths-based framework that helps youth build resiliency and resourcefulness. Individualizing services requires building an understanding the youth's personality and matching services to the youth #. Ensuring genuine follow up with every youth after services can help determine satisfaction or identify any need for ongoing services #. Recreational approaches Physical or recreational activities may complement youth services. "Right here" follows the evidence-based approach of using exercise to promote mental health. Since youth are attracted to activities associated with their interests and hobbies, "Right here" offers physical activities rooted within mental health promotion. Staff may be encouraged to engage with youth in activities like playing in the school yard or gym, hiking, fishing, or working on a project together. Youth may be offered variation within the session, such as a 10 min break for a fun activity. Recreational activities help establish rapport and facilitate exploration of sensitive issues. Activities should be developmentally appropriate. Group therapy and group activities Group therapy or support activities may be helpful for some youth, since this format gives them the opportunity to meet other youth with similar experiences. When conducting group therapy, it is important to develop group agreements that encourage all attendees to respect each other's boundaries and diverse cultures/identities. Group activities may involve structured groups, drop-in groups, or groups with recreational activities embedded in them. Artistic and innovative approaches Some youth appreciate innovative approaches or using non-verbal ways of communicating, e.g. drawing or writing about their emotions. Art therapy, drama therapy or music therapy may be consistent with youth-friendly services. An example of an innovative way of interacting with male youth is using superhero metaphors in treatment, which may provide youth with a language and context to talk about trauma-related experiences. However, some youth may not appreciate using a superhero metaphor, since not everybody has to be a "superhero"*. Caregiver involvement Youth may attend services on the insistence of their caregivers rather than in a self-motivated manner. While this may promote service access, youth have reported that an adult voice may subdue their own voice during the service process. However, caregivers want to be involved in decisions and informed of the youth's condition #. Given the support that caregivers can provide, the caregivers we consulted suggested that youth who do not have a caregiver may benefit from having a supportive worker assigned to them. # In addition, service providers suggested that isolated youth may be encouraged to develop a network of informal supporters for situations in which staff are unavailable, e.g., outside working hours. Expected impact of youth-friendly mental health and substance use services A number of papers described the expected impacts of making MHSU services more youth-friendly in terms of treatment outcomes, although empirical evidence backing these impacts is lacking. Nevertheless, it is hypothesized that service uptake and retention would be improved by implementing many of the youth-friendliness recommendations, including youth engagement in multiple aspects of the organization, service promotion, youth-friendly environment characteristics, youth-friendly staff and service providers, and hearing the youth voice at the service/treatment level. As a cornerstone to youth friendliness, integrating the youth voice in planning and delivering MHSU services is expected to increase service uptake and improve outcomes by making the services more acceptable to youth. Youth engagement is expected to lead to reduced stigma, stress, and suicidality, combined with increased coping, empowerment, organizational transparency, and connections among youth, while supporting youth in becoming future professionals in the field. In a bidirectional manner, if an organization establishes youth-friendly characteristics such as flexible times, listening to youth opinions, and applying their ideas, this may increase youth engagement in the organization, which is expected to translate into the improved youth friendliness of the organization. Authentic youth-friendly MHSU services may lead to a social/system level change, and improve health equity. In the long term, by improving youth's social situations and outcomes, more youth-friendly services may reduce the overall cost of services*,#. Definition One of our aims of this scoping review was to develop a comprehensive definition of youth-friendly MHSU services to guide future work in this area. Several papers referred to the definition of youth-friendly services provided by the WHO, and one mentioned the WHO 'You're Welcome' criteria of youth-friendly services as a definition. A number of other documents alluded to their own definitions of youth-friendly services (Table 3). However, there was no single, comprehensive definition specific to MHSU services. Based on the diversity of the literature and stakeholder feedback, we propose the following definition of youth-friendly MHSU services: "A youth-friendly mental health and substance use service is one that is accessible, appealing, flexible, confidential and integrated, where youth feel respected, valued, and welcome to express themselves authentically, without discrimination of any kind; it is a developmentally and culturally appropriate service that mandates youth participation in service design and delivery, to empower youth and help them gain control over their lives." Discussion This scoping review examined the literature and obtained feedback from various stakeholders regarding the concept of 'youth friendliness' in MHSU services. The characteristics of youth-friendly MHSU services were found to fall into four main categories: organization and policy characteristics, environment characteristics, service provider characteristics, and treatment/service characteristics. The youth voice was found to be a core value across all the four categories. Youth should be engaged in the services from the planning and developing stage through to the implementation and delivery of services. In addition, they should be engaged in designing the environment, and be engaged as staff members. It is critical to prevent tokenistic youth engagement and ensure their meaningful involvement, where their feedback is incorporated in the services. In addition to youth engagement, the youth voice should be heard at the service level; i.e., youth should have a say in the services provided to them and service providers should be relatable to youth. MHSU service organizations should be integrated with a variety of other services, including physical health services, social and vocational services ; confidentiality should be incorporated in their policies ; services should be promoted using technological platforms ; organizations should provide a 'brave space' for youth while ensuring smooth transition across services for different developmental stages ; they should provide inclusive services that use non-stigmatizing terminology. The environment should have a colorful and appealing dcor, with comfortable furniture and informational material. Youth-friendly service providers should challenge pre-existing paradigms, welcome youth, communicate easily and informally, and use a variety of ways to establish rapport with youth. The service is youth friendly when it is accessible, affordable, flexible in timing and duration, individualized, and uses innovative treatment and service options that attract youth and keep them using services. Such youth-friendly services are expected not only to improve service seeking by youth, but also to increase their engagement in and satisfaction with the service. Finally, we have proposed a comprehensive definition of youth-friendly MHSU services, based on the results of this scoping review and feedback obtained from the stakeholders. While this review considered the characteristics that make a service friendly to youth, many of the characteristics are not specific to youth. For example, involving service users in the design and delivery of services and providing affordable treatment that is acceptable and appropriate may apply to adult populations as well. On the other hand, many characteristics were identified that are specific to youth; for example using youth-appropriate dcor, employing technology for assessments, and having knowledge of rapidly changing youth culture and youth language are aspects that may apply differentially to a youth population. Nevertheless, all of the suggestions, whether specific to youth or encompassing a broader age range including youth, should be considered when developing a service in the most youth-friendly manner. As a transitional age group bridging the gap between childhood and adulthood, youth's service setting preferences are not mutually exclusive from the needs of other age groups, but overarching and comprehensive, with youth-specific components. Engaging youth in all aspects of the organization is key to ensuring that the services are developed in a way appropriate to youth, helping to incorporate not only aspects that might be considered universally "friendly" across the age ranges, but aspects that are specific to a young population and sensitive to rapid cultural shifts as new generations of youth enter services. It is important to consider the importance of integrated services that span the transition from child services to adult services, which is often abrupt and without youth-specific transitional-age services tailored to this developmental stage. Thus, having services that span the age range of 12-25 years and are tailored to a diversity of youth needs can help to make the transition process smoother. This aligns with the international movement toward integrated youth MHSU and wellness centers. Of course, youth are not a homogenous group, and different youth may have different preferences. It may be necessary to elicit youth feedback about services to orient the services to the local youth population. Likewise, it is important to consider balance between the professional nature and the youth-friendliness of a MHSU service; i.e., if the focus is excessively on youth-oriented aspects, the professional goal and purpose of the service could be forgotten and some youth may find it too "youthy". This review revealed an important contradiction with regards to confidentiality. On the one hand, youth do not wish to be required to retell their stories, and caregivers wish to be informed of their youth's situations #. On the other hand, youth want confidentiality, which may conflict with the open communication required to prevent them from having to retell their stories and to meet the needs of concerned caregivers. It is important for MHSU service agencies to take this dichotomy into account and to address consent and confidentiality issues in a way that maximizes the seamlessness of inter-professional collaboration, involves caregivers at the appropriate level, and respects youth's wishes and rights with regard to confidentiality. They may consider discussing the complexity of confidentiality directly with the youth, including the impacts of sharing their story with their caregivers and other service providers, to help the youth come to an informed decision to guide information sharing. Caregivers may be provided support in the form of caregiver-specific services (e.g., ), which may help meet their needs while maintaining the confidentiality of youth. Some aspects of youth-friendliness in MHSU services overlap with the WHO guidelines for youth-friendly health services as a whole. For example, WHO also mentions that services should be promoted in the community, be inclusive to all youth, be free or affordable, with convenient appointment times and location, confidential, appealing, and have non-judgmental and relatable service providers. However, other aspects of the findings distinguish MHSU service settings from the overarching principles identified by WHO. These include the importance of non-stigmatizing terminology specifically regarding MHSU services; establishing a 'brave space'; having peer support workers; hiring young staff to whom youth can relate; conducting youth-friendly MHSU assessments using electronic devices (e.g. iPads); individualizing services depending upon the needs and preferences of youth; and providing diverse, innovative service options from which youth can choose. These differences highlight the importance of considering youth friendliness specific to MHSU services. These findings open the door to a range of future research opportunities. Notably, there is considerable heterogeneity among youth populations, and a single set of youth-friendliness guidelines are not expected to satisfy all youth; future research should consider culture and subgroup differences in youth preferences and ways in which these can be accounted for feasibly in MHSU services. In addition, no papers were found that explicitly studied the association between youth-friendly MHSU services and treatment outcomes. Researchers are encouraged to use creative qualitative and quantitative methodologies to determine the impacts of enhancing the youth friendliness of MHSU agencies. For example, future research should examine the mechanisms and impacts of youth friendlinessif, how, and why it impacts youth service utilization and outcomes. To make this possible, a psychometric tool to assess the degree of youth friendliness of a given agency should be developed to transform the concept of youth friendliness into a measurable construct. Limitations This scoping review has several limitations. The number of stakeholders consulted in our study was sufficient to contextualize the findings of the scoping review, but a larger sample size in a stand-alone qualitative study would support greater generalizability, particularly regarding youth consultations. In addition, only documents available in the English language were selected for this review; however, it has been found that the English-language focus does not create systematic biases in review papers. The search terms were narrow and specific to 'youth friendliness' or 'youth welcoming'. This may be a limitation, but alternately may be considered a strength since it enabled us to define youth-friendly MHSU service, which, to the best of our knowledge, has not been comprehensively defined before. Although a number of articles reported on youth perspectives, it is important to note that this data was analyzed by adult researchers and was therefore filtered by an adult lens; the actual findings may therefore contain an adult bias. However, by abiding by the key finding that youth should be directly engaged in all aspects of an agency, youth-serving organizations can ensure that they take their guidance directly from their own representative group of youth, employing the current findings as a guideline to stimulate discussion with their youth representatives. It should be noted that the grey literature was representative rather than exhaustive. In addition, following the principles of the scoping review methodology, an assessment of the quality of studies was not conducted in our review. However, by describing the type of document in Table 3, we have allowed some comparison of studies; in addition, we have strengthened by soliciting stakeholder feedback, which adds methodological rigor. Conclusion This scoping review provides a comprehensive overview of the components of youth friendliness that MHSU organizations can use to enhance the youth friendliness of their services. A variety of steps can be taken to make MHSU services more youth friendly, potentially increasing service seeking, service uptake, and satisfaction. Integrating the youth voice into MHSU services-in the form of youth engagement at all levels of an organization-was found to be a core component of youth-friendly services. Further research is required to measure the impact of youth-friendly services on service outcomes. Additional file Additional file 1: Youth Friendliness Scoping Review Search Strategy -MEDLINE Search. The comprehensive MEDLINE search strategy is detailed in this file (DOCX 19 kb) Abbreviations LGBTQ: Lesbian, Gay, Bisexual, Transgender, Queer; MHSU: Mental Health and Substance Use; WHO: World Health Organization

Outcome of early laparoscopic cholecystectomy versus delayed laparoscopic cholecystectomy for patients with acute cholecystitis Acute cholecystitis is inflammation of gall bladder, usually associated with cholelithiasis, with a high incidence in our environment. Laparoscopic cholecystectomy (LC) has been the procedure of choice for symptomatic gall bladder disease. Laparoscopic cholecystectomy can be done as early laparoscopic cholecystectomy (ELC) or delayed laparoscopic cholecystectomy (DLC) after conservative treatment. However, the definition of early varies amongst the guidelines,the British Society of Gastroenterology recommend cholecystectomy within the same hospital admission or up to 2 weeks after discharge. The American Gastroenterological Association guidelines suggest that cholecystectomy should be performed as soon as possible and in no case beyond 2-4 weeks after discharge, whereas the American College of ABSTRACT INTRODUCTION Acute cholecystitis is inflammation of gall bladder, usually associated with cholelithiasis, with a high incidence in our environment. Laparoscopic cholecystectomy (LC) has been the procedure of choice for symptomatic gall bladder disease. 1 Laparoscopic cholecystectomy can be done as early laparoscopic cholecystectomy (ELC) or delayed laparoscopic Gastroenterology recommends cholecystectomy within index admission. 3,4 The first studies that assessed ELC as a treatment for acute cholecystitis date back to the 1950s. In western world early laparoscopic cholecystectomy for acute cholecystitis started gaining popularity in 1980s but after carefully examining the results studies all over world the Japanese Society of Hepato-Biliary-Pancreatic Surgery in "The updated Tokyo Guidelines announced in 2013" cautiously suggested that early laparoscopic cholecystectomy is the first-line treatment in patients with mild acute cholecystitis, whereas in patients with moderate acute cholecystitis, delayed/elective laparoscopic cholecystectomy after initial medical treatment with antimicrobial agents is the first-line treatment. 8 Despite these guidelines and literatures, cholecystectomy during the same admission is not commonly practiced. The majority of specialists perform an interval cholecystectomy due to uncertainty regarding the efficacy and safety of an early cholecystectomy. However, only minority of surgeons is performing early laparoscopic cholecystectomy. As this procedure demands a huge experience in laparoscopic cholecystectomy, till now, the exact timing and potential benefits of early laparoscopic removal of gall bladder have not been clearly established and continue to be controversial. 11 Although literature favors early laparoscopic cholecystectomy, most evidence comes from prospective studies specifically designed to prove this particular aspect, which probably does not reflect the worldwide clinical practice. 12,13 The objective of the present study was to to to assess the outcomes of early versus delayed cholecystectomy for patient's acute cholecystitis. METHODS This study was conducted from March 2014 to February 2017 and included 70 patients. Ethical clearance was granted by our college ethical committee. The study participants need to be scheduled for an early or delayed cholecystectomy. Random assignment was performed by drawing a sealed, unlabeled, unordered envelope from a container by an independent party immediately after informed consent was obtained. All patients who are 18 years or above, who presented to our outpatient department or in emergency department with features of acute cholecystitis and given consent to participate in the this study were included. The diagnosis of acute cholecystitis was made according to the Tokyo 2013 criteria, with local (Murphy's sign or right upper quadrant pain) and systemic (fever or elevated C-reactive protein/white blood cell) signs of inflammation and confirmed by ultrasound. 14 The abdominal ultrasound was performed by trained radiologists. Characteristics findings of acute cholecystitis were thickening of the gallbladder wall and pericholecystic fluid or radiological murphy's sign, associated with biliary stone. Patients that were excluded from the study are Gall stone induced pancreatitis, choledocholithasis, suspected concomitant acute cholangitis, severe preexisting medical comorbidity, contraindicated to laparoscopic cholecystectomy, pregnancy; previous upper abdominal surgery, patients who refuse to participate in the study. The paricipatients were divided in to two groups, Group A (early laparoscopic cholecystectomy) and Group B (delayed laparoscopic cholecystectomy). Thirty five patients with acute cholecystitis were admitted and treated conservatively with fasting, intravenous fluids, antibiotics and analgesics till the symptoms subsided. Hospital stay and treatment cost during this period was noticed and patients were discharged and were advised to follow up. These patients constituted group B and were subjected to elective laparoscopic cholecystectomy after 6-8 weeks interval. Other 35 patients with acute cholecystitis underwent laparoscopic cholecystectomy within 72 hours of onset of symptoms and they constituted group A. All patients are operated by single experienced laparoscopic surgeon. All patients are subjected to standard four port laparoscopic cholecystectomy, oral intake tarted as soon as patients tolerated and discharged accordingly and are advised to follow up in OPD at 1 week, 6 weeks and 6 months. The demographic profile, clinical presentation, Intra-operative complications, postoperative complication, operative time, total hospital stay, and cost were noted and subjected to statistical analysis. Hospital costs included all costs during primary hospitalizations, readmissions in the DLC group. Cost data were obtained from the hospital accounting database and available for each patient. Mean hospital stay and cost was calculated using the total number of patients in each group as denominator. Statistical analysis All data was analyzed by software SPSS version 19 "P" value <0.05 was considered, statistically significant. was present in all patients in both the groups (p=1). Pericholecystic fluid was present in 12 patients in early group and 13 in delayed group (p=1). In group A single stone was present in 15 patients and multiple stones in 20 patients while in Group B single stone was present in 12 patients and multiple in 23 patients. There was no statistical difference between two groups (p>0.05). 15 As the experience and confidence of surgeons in laparoscopic cholecystectomy rose up, several clinical trials, though samples were small in size, proved that early laparoscopic cholecystectomy in acute cholecystitis is feasible, safe, cheaper and requires shorter hospitalization. However, laparoscopic cholecystectomy for acute cholecystitis has not become routine, because the timing and approach to the surgical management in patients with acute cholecystitis is still a matter of controversy. 20 High conversion rates have been reported by different studies, ranging from 6% to 35% for early laparoscopic cholecystectomy for acute cholecystitis. The higher conversion rate obviates the advantages of an early laparoscopic cholecystectomy. In our study, the demographic data between two groups was comparable and was statistically insignificant ( Table 1). This prospective study was conducted from The mean operative time in early laparoscopic cholecystectomy was 81 minutes which was slightly higher than delayed laparoscopic cholecystectomy 78 minutes, because obscure anatomy, distended, edematous and friable gall bladder which perforate during surgery due to which our operative time increase. But this slight increase in operative time in early laparoscopic cholecystectomy benefits patients in terms cost and hospital stay. In our study 3 patients converted to open cholecystectomy in early group and 2 patients in delayed group, the difference was statistically insignificant, the reasons for conversion in early group were obscured calots triangle anatomy, oedematous, friable gall bladder and in one patient CBD stone and in delayed group the reason for conversion were dense fibrous adhesions, distorted calots triangle anatomy and also CBD Stone in one patient, which are noticed during surgery. In our study conversion rate was low as compared with 13% to 15 % conversion rate reported by literature. 24 Because of flexible attiude towards conversion, no CBD, gastrointestinal tract, liver injury were noted in both the groups. It was recommended that during early laparoscopic cholecystectomy, several technical points should be kept in mind for good exposure of clots triangle, decompression of gall bladder for holding and retraction of gall bladder, dissection at clots triangle should be done by blunt instruments or by irrigation cannula (hydrodissection) to avoid injuries. In our study decompression of gall bladder was done in both groups. A sub-hepatic drain was placed in 22 patients in early laparoscopic cholecystectomy and 20 patients in delayed laparoscopic cholecystectomy, because spillage of bile and stones during sugergy. Perforated gallbladder and spilled out stones were taken out using retrieval bag. The average blood loss was more in the early group than in the delayed group; however, no patient required blood transfusion. The difference could be attributed to more vascularity around gallbladder and Calot's triangle in acute phase. Average hospital stay in early group was 1.5 days and delayed group 1.3 days which was statistically insignificant. The total duration of hospital stay in early laparoscopic cholecystectomy was 1.5 days while in delayed laparoscopic cholecystectomy was 7.95 days which was statistically significant. This include admission at the time of acute cholcystits and readmissions. In our study, In delayed group there occur recurrent admissions( 4 times) in 5 patients because of pain and 20 patients admitted twice in hospital before electively cholecystectomy and one patient develop biliary pancreatitis and were treated by Intravenous fluids and antibiotics. No patient requires ICU admission. In delayed group, during waiting interval of 6-8 weeks patients also develops mental stress. Different studies conducted till date offer significantly lower hospital in early laparoscopic cholecystectomy. The study conducted by Banz et al shows a difference in hospital stay of 2 days between two groups while study conducted by Linden VD showed difference of 10 days between two groups. 25,26 The peri-operative and post-operative complications such as bleeding, bile leak, bile duct injuries, intra-abdominal abscess, fever and port site infection were comparable in both groups and there was no significant difference between two groups (Table 2). 27,28 The average cost in early laparoscopic cholecystectomy was 9240 INR and in delayed laparoscopic cholecystectomy was 12251 INR. The difference in the cost was statistically significant. The cost includes multiple admissions and antibiotics. There is also loss of work during the hospital admission in delayed group, which is more as compared to early laparoscopic cholecystectomy. Moreover, the total duration of antibiotic therapy and length of stay, as well as costs were significantly reduced by an ELC. 24 In today's world, people are very much shorter of two things i.e. time and money, both these are more in delayed cholecystectomy. CONCLUSION Early laparoscopic cholecystectomy in acute cholecystitis is, safe, costs less due to fewer stays in ICU, fewer readmissions and requires shorter hospital stay. It is comparable to delayed laparoscopic cholecystectomy in terms of mortality, morbidity, and conversion rate. It also causes reduction in days away from the work, reduces recurrent biliary events and prevents readmission as cholecystectomy is performed within the index admission. So early cholecystectomy has both medical and social-economic advantages and should be the preferred approach for patients. It should be performed by a surgeon who is expert in laparoscopy.The delayed cholecystectomy should be performed in patients in which acute pancreatitis, choledocholithiasis, or cholangits can't be ruled out and those with unacceptable anesthetic risk at the time of diagnosis.

Graphene oxide coated long period grating based fibre optic humidity sensor In this paper, the response of a graphene oxide (GO) coated long period grating (LPG) to the change in temperature and in humidity is reported. To create the probe, an improved Hummer's method was used to synthesis the GO solution used as its basis, allowing coating of functionalized LPG by using a multi-layer dip coating technique. A consistent and stable response of the resonance peak intensity of the GO coated LPG was observed to the change in humidity, achieving a sensitivity of 0.15 dB / %RH with a linear correlation coefficient of 0.9804 over the relative humidity range from 60%RH to 95%RH at room temperature (25°C). A blue shift of the resonance peak wavelength was recorded when the proposed sensor was exposed to varying temperature conditions from 25°C to 70°C and the response was found to be linear with a correlation coefficient of 0.9973. The GO coated LPG humidity sensor probe performed with a good stability and repeatability over a number of test cycles in this initial performance evaluation.

Interventions for Women Veterans with Mental Health Care Needs: Findings from a Scoping Review Abstract Experts have prioritized research on women veterans mental health and the delivery of gender-sensitive care. The purpose of this study was to conduct a scoping review of the literature to summarize interventions for women veterans with mental health care needs designed in the Department of Veterans Affairs (VA). We identified 1,073 articles; eight were eligible for full review and represented seven unique interventions. Four studies focused on individual-level interventions; three studies focused on interpersonal-level interventions. Some attributes of gender-sensitive care included modifying the treatment environment and offering same gender clinicians. In designing interventions, clinicians and researchers can: (a) create interprofessional teams which include nurses, (b) use participatory methods to improve study designs, (c) assess participants barriers to care prior to designing interventions, (d) incorporate and evaluate attributes of gender-sensitive care, and (e) utilize and clearly delineate how theory guides research. With improved intervention research, clinicians and researchers can support women veterans with mental health care needs.

A practical method for fission yeast transformation by electroporation. High-voltage shock within a very short duration under the proper conditions causes cells to incorporate exogenous macromolecules. This technique, electroporation, has been widely used in recent years to transform many organisms. We determined optimum conditions for fission yeast transformation using this method. Of nineteen combinations of electric field strength and pulse time examined, 1.75 kV/0.2 cm, 4 msec pulse was found to provide approximately 4.0 x 10 transformants per micrograms of DNA. Other factors responsible for the transformation efficiency in fission yeast are also discussed.

Using constrained snakes for feature spotting in off-line cursive script Studies in the psychology of reading indicate that reading probably involves recognizing features which are present in letters, such as loops, turns and straight strokes. If this is the case it is likely that recognizing these features will be a useful technique for the machine recognition of cursive script. A new method of detecting the presence of these features in a cursive handwritten word is described. The method uses constrained snakes which adapt to fit the maxima in the distance transform of a word image while retaining their basic shape. When the shape has settled into a potential minimum its goodness-of-fit is used to determine whether a match has been found. The features located by this method are passed on to a neural network recognizer. Examples of the features recognized are shown, and results for word recognition for this method on a single-author database of scanned data with 825 word vocabulary are presented.<<ETX>>

Q: pros and cons of a bootable BackTrack instance vs installed I've been wanting to mess around some with BackTrack to get a better understanding of some of the tools out there for penetration testing. I have a Linux box that isn't doing much right now that I was planning to install BackTrack 5.0 on. Recently though I was reading about booting BackTrack from DVD or USB key. My question is, besides not having to dedicate an existing HD to the BackTrack installation, are there any pros or cons to running from a bootable DVD or USB key? Is one easier to update? Is one faster? Do certain features work better or worse? A: Generally depends what you are doing. If you are planning on learning first, on a legal enviorment, I would recommend to install backtrack (dual boot, usb or virtually). installing it: Runs Faster No need to do a large update over & over. Allows you to add your own tools, and save files. Allows you to save preferences. At this point it seems that installed backtrack is the best option, but live backtrack gives you something that the installed backtrack dosn't. It will always be in a clean state. Just the fact that it is in a clean state, might be more important than all of the other points for a pen-tester, esepcially for a black hat. That is why another option is customizing the the live version. It all boils down to what exactly are you looking for (as well what you prefer)? Learning -> Installed, Work -> Installed/Modified Live, Black-Hat Pen-Test -> Live/Modified Live. Backtrack is built on ubuntu, updates are done the same way. sudo apt-get update & upgrade If you install it or use live cd you will have to update it, but take in account that with the live cd you will need to do a large update that may take from 15-25min, instead of small updates from the installed OS. Running backtrack from harddrive/ssd is faster, than accessing the OS from a externall usb/cd. In my case performance difference has been minimum. If you build your own tools, or have found some tools that are not included with Backtrack 5 can be added to the installed OS, if you use the live version you will have to reinstall them. When you boot into backtrack, your user is root and the password is toor. You also have to start network by running $ /etc/init.d/networking start Some want their own password, wallpaper, have no need for stealthy boot, and so on. So they modify it on their installed OS. A: Another option is to install it as a VM, this would give you the best of both worlds, it would be updatable, and you could take recoverable snapshots/backups of your VM instance if you're planning on doing anything that might break your installation. Personally I have it installed as a VM along with other VMs like metasploitable so that I can experiment and learn how the tools work, and I have it installed on an old laptop (about 6-7 years old) and it works fine.

Q: What was with the two different colored prison uniforms in Daredevil season 2? In Daredevil S02, we see two kinds of prison uniforms, full orange and full white. We see in the flashback that Wilson Fisk gets a white prison uniform but his current one was orange. The Punisher was also given a white prison uniform but most of the prisoners had orange uniforms. What was with the two different colored uniforms? Does it have some significance or is it just random? Does it happen similar in real life US prisons too? A: tl;dr: Most likely, the white uniform is meant to reflect a prisoner that has just gone through intake, while the orange jumpsuits represent high-security prisoners. This is a not-uncommon practice in US prison systems. In real US prisons, uniform policy is entirely up to the local or state prison system, but the system presented in Daredevil does have real-world equivalents. It's very similar to the California prison system, with the colors reversed: an orange jumpsuit is given at intake, until the prisoner is classified into a "security" level and given a new color. (Orange is the New Black shows this same system slightly more accurately) So, for example, general population prisoners in California get white or blue clothing, while high-security prisoners may get something more obvious. Additionally, in many prison systems, different uniform colors may be used for certain categories of prisoner that have different prison access. For example, again in California, prisoners that are allowed to work on or outside the perimeter have green uniforms. I'm not sure what New York City (where Daredevil is set) prisoners are wearing these days, but I don't think they actually wear orange jumpsuits. Ironically, the success of Orange is the New Black has made the orange jumpsuit "cool", and is causing problems for a lot of prison systems. Many of them are converting back to the old striped uniforms of the late 1800s.

Microsoft offers new Windows security features with free 90-day taster New features in Defender Advanced Threat Protection are available to preview in Windows 10. It's packed with a wide assortment of new and refined features, including some new security options designed to block zero-day exploits and ransomware. Microsoft is continuing to try to fine-tune the privacy settings with Windows 10 with a few new additional options that will be part of the Fall Creators Update. The additional tweaks, which Microsoft announced on Sept.13, are follow-ons to the substantial number of new privacy settings that Microsoft made part of the Windows 10 Creators Update that began rolling out this past spring. The company has been trying to stem the stream of complaints by various protection watchdogs and some customers about its privacy settings and the amount of telemetry data it collects since Windows 10 first launched. With the Fall Update, Microsoft will be making two new privacy-related changes to the setup process. Users will get direct access to the company's Windows 10 privacy statement during the setup process. In addition, users setting up a new device will be able to jump directly to relevant settings for location, speech recognition, diagnostics, tailored experiences, and ads via the Learn More page. With the Windows 10 Fall Creators Update, Microsoft also is adding the ability to set application controls beyond just location. Apps installed through the Microsoft Store will prompt users for permission for use of their cameras, microphones, contracts, calendar, etc. These new application permission prompts will only apply to apps installed after installing the Fall Creators Update; users can adjust app permissions on other already-installed apps by going to Settings and then Privacy. Enterprise users also will get a new setting that limits the diagnostic data "to the minimum required" for Windows Analytics. Windows Analytics is a service aimed at IT pros to give them more information on deploying, servicing and supporting Windows 10. Microsoft is continuing to roll out test builds of Windows 10 Fall Creators Update to its Insider testers. Just last night, Microsoft rolled out another Windows 10 Fall Creators Update PC test build, No. 16288, with a number of fixes, but no brand new features. Microsoft also delivered another test build of Windows 10 Mobile Feature Release 2, No. 15250, which adds support for two-factor authentication, alongside providing a number of fixes and updates. Microsoft is set to begin rolling out Windows 10 Fall Creators Update to mainstream users as of Oct. 17.

Development of a core set of domains for data collection in cohorts of patients with ankylosing spondylitis receiving anti-tumor necrosis factor-alpha therapy. OBJECTIVE To create a core set of measurement concepts for use in the creation and maintenance of anti-tumor necrosis factor-alpha patient registries in ankylosing spondylitis (AS). METHODS A Delphi-based approach was used to identify elements that best identify a patient's clinical state, disease progression, and potential drug-related toxicities. Decision-making was based on systematic literature reviews and clinical experience and expertise. RESULTS A core set of measurement domains was defined including disease activity and physical function outcomes. Comparison with domains used in existing AS registries showed excellent agreement with current practice. CONCLUSION This core set is a basis for data collection across AS populations.

The relationship between worldview, self-efficacy, psychological distress, and a health-promoting lifestyle among a South African undergraduate university sample This study examined the relationship between worldview, self-efficacy, psychological distress, and health-promoting lifestyle among an undergraduate South African student sample. We recruited a sample of 211 participants who responded to an online questionnaire consisting of the Health-Promoting Lifestyle Inventory, the Organicism-Mechanism Lifestyle Profile, the Hopkins Symptom Checklist, and checklists on nutrition, exercise, and alcohol use self-efficacy, gender, and place of residence. The data were analysed using SPSS 18.0. Hierarchical regression analysis indicated that the linear combination of demographic variables, worldview, self-efficacy, and psychological distress significantly explained a health-promoting lifestyle. We also found that psychological distress and nutrition and exercise self-efficacy were significantly associated with a health-promoting lifestyle.

The politics of social welfare: MPs attitudes and activities in the 13th Israeli Knesset This paper reports the findings of a study exploring the attitudes and activities of members of the 13th Israeli Knesset, and seeks possible connections between the two. The study involved extensive interviews with members of the 13th Israeli Knesset (199296), as well as drawing on archival and quantitative data of their activities. The paper presents a short overview of the Israeli political system, the 13th Israeli Knesset and its composition. The MKs perceptions of social welfare policy, their attitudes towards government involvement in the provision of social welfare services and their activities, both formal and informal, on social welfare issues are described. Finally, possible connections between the MKs attitudes and their activities are explored.

Metal Ion Chelates as Surrogates of Nucleobases for the Recognition of Nucleic Acid Sequences: The Pd2+ Complex of 2,6-Bis(3,5-dimethylpyrazol-1-yl)purine Riboside A 2,6-bis(3,5-dimethylpyrazol-1-yl)purine ribonucleoside has been prepared and incorporated as a conventionally protected phosphoramidite into a 9-mer 2-O-methyl oligoribonucleotide. According to 1H NMR spectroscopic studies, this nucleoside forms with Pd2+ and uridine a ternary complex that is stable at a micromolar concentration range. CD spectroscopic studies on oligonucleotide hybridization, in turn, suggest that the Pd2+ chelate of this artificial nucleoside, when incorporated in a 2-O-methyl-RNA oligomer, is able to recognize thymine within an otherwise complementary DNA strand. The duplex containing thymidine opposite to the artificial nucleoside turned out to be somewhat more resistant to heating than its counterpart containing 2-deoxycytidine in place of thymidine, but only in the presence of Pd2+. According to UV-melting measurements, replacement of 2-O-methyladenosine with the artificial nucleoside markedly enhances hybridization with a DNA target, irrespective of the identity of the opposite base and the presence of Pd2+. With the thymidine containing DNA target, the T m value is 24°C higher than with targets containing any other nucleoside opposite to the artificial nucleoside, but the dependence on Pd2+ is much less clear than in the case of the CD studies. Introduction In nature, recognition of nucleic acid sequences is based on Watson-Crick base pairing, while vertical stacking of base pairs accounts for most of the duplex stability. At room temperature, 10 base pairs are typically required for a stable duplex, meaning that targeting sequences shorter than this by the conventional strategy, that is, using complementary oligonucleotides, is problematic. Sequences within a double-stranded region are also difficult to target because thermodynamics favor formation of the longer duplex. The first problem has partly been addressed by using small molecules exhibiting high affinity towards certain specific short sequences. No clear-cut relationship exists between the target sequence and the structure of the small molecule, however, making the design and preparation of such molecules a demanding task. PNA oligonucleotides offer a solution to the second problem, as PNA/DNA heteroduplexes are more stable than native double-stranded DNA, but even in the best cases a substantial excess of the PNA is still needed for efficient invasion. Oligonucleotides composed of unnatural monomers with an enhanced affinity towards their complement nucleobases could potentially form stable duplexes even with short target sequences as well as invade double-stranded DNA even when present in only stoichiometric amounts. One way to achieve the desired high affinity is to exploit the coordination of a ring nitrogen (N1 of purines or N3 of pyrimidines) of the natural nucleobase to a soft metal ion, such as Pd 2+, carried by an artificial nucleobase. Discrimination between the four natural nucleobases, in turn, could be achieved through a combination of additional destabilizing (steric) and stabilizing (hydrogen bonding) interactions. A number of studies on metal-ion-mediated base pairs have been published, but the focus has generally been on expanding the genetic code by introducing a completely new artificial base pair or impregnating DNA with metal ions for nanotechnological applications, rather than developing high-affinity complements for the natural nucleobases. In the former, both of the ligands of the metalion-mediated base pair may be freely designed for maximum performance (in many cases, the same ligand is used in both strands), whereas in the latter the sole artificial nucleobase must be able to not only coordinate the metal ion but also accommodate the steric and hydrogen bonding requirements of the natural nucleobase, presenting a unique challenge. In the present study, the Pd 2+ complex of 2,6-bis-(3,5dimethylpyrazol-1-yl)purine ribonucleoside is used as an artificial nucleoside. Nucleoside 1, with no potential for stabilizing hydrogen bond interactions, may be considered as a reference structure for future studies. On a monomeric level, the binding affinity and selectivity of this artificial nucleoside were studied by NMR titrations. For a more realistic model, nucleoside 1 was additionally converted to a phosphoramidite building block and incorporated into a 2 -O-methyl-RNA oligonucleotide. The effect of Pd 2+ on the secondary structure and thermal stability of duplexes between this modified oligonucleotide and complementary 2 -O-methyl-RNA and DNA oligonucleotides was investigated by melting temperature and CD spectrometric studies. For comparison, the same experiments were also performed on a 2 -O-methyl-RNA oligonucleotide having adenosine in the place of the artificial nucleoside. NMR Spectrometric Titrations. The formation and stability of the complexes between the artificial nucleoside 1 and uridine in the presence and absence of Pd 2+ were studied by 1 H NMR spectrometric titration. The NMR spectra were recorded in a 120 mM deuterated phosphate buffer at pH 7.3. The initial concentration of the nucleoside components of the putative ternary complex, namely, 1 and uridine, was 3.6 mmol L −1, while a deficit of Pd 2+ (0.7 eq., 2.5 mmol L −1 as K 2 PdCl 4 ) was employed to ensure exclusive formation of the desired ternary complex. The titration was carried out by diluting the sample with buffer until the uridine concentration was 0.061 mmol L −1. Over the entire concentration range studied, two distinct sets of signals were observed for uridine: one referring to the free nucleoside and the other one (presumably) to the ternary complex (Figures 1(a)-1(d)). The two sets of signals were particularly well resolved in the case of H5 and H1 resonance of uridine and the integrals of these signals were used to determine the mole fraction of the complex at each concentration ( Figure 2). To exclude the possibility that the observed changes in the chemical shifts of the H5 and H1 of uridine were caused by Pd 2+ alone, a corresponding experiment with uridine and Pd 2+ but without the artificial nucleoside 1 was carried out (Figures 1(f)-1(i)). In this case, an upfield change in the chemical shifts of the H5 and H1 of uridine was observed, in striking contrast with the downfield shift associated with formation of the putative ternary complex. In other words, the H5 and H1 signals assigned to uridine in its ternary complex with Pd 2+ and the artificial nucleoside 1 were not observed in the absence of the latter. No effort was made to characterize the complexes between uridine and Pd 2+ but the NMR spectra suggest that a number of different relatively weak complexes prevail, again in sharp contrast with the single strong complex formed in the presence of the artificial nucleoside 1. Upon introduction of Pd 2+, the signals for the hydrogens on the pyrazole rings of 1 shift downfield by approximately 0.4 ppm. The signals of two of the methyl substituents of the pyrazole rings exhibit an even greater downfield shift (approximately 0.6 and 0.8 ppm, resp.), whereas the other two are shifted slightly upfield. Adding uridine to the system hardly affects the chemical shifts of these protons (data not shown). As expected, dilution of the sample was accompanied by decrease of the proportion of signals arising from the ternary complex (Figures 1(a)-1(d)). However, even at the lowest concentration employed, that is, 61 mol L −1, the mole fraction of the complex was still more than 80% of the saturation level observed at high concentrations. In the absence of Pd 2+, no complex was formed even though a high concentration (13.84 mmol L −1 ) of the nucleosides was used ( Figure 1(e)). In all likelihood, Pd 2+ forms a tridentate chelate with the artificial nucleoside 1 by binding to N1 of the purine ring and N2 of the pyrazolyl moieties, the fourth coordination site being filled by the N3 of uridine ( Figure 3). The ability of thymine to form base pairs mediated by N3-coordinated soft metal ions has previously been demonstrated and uracil most likely exhibits similar behavior. While no spectra could be obtained at sufficiently low concentrations to allow for reliable determination of the stability of the complex, the data at hand suggest a dissociation constant in the low micromolar range. CD Spectropolarimetric Measurements. To obtain information about the impact of the modified nucleoside and 7X, the situation is quite different: the curves for the "mismatched" duplex 7X:10C in the presence and absence of Pd 2+ overlap with each other and also with the curve for the "full-match" duplex 7X:10T in the absence of Pd 2+ ( Figure 5(b)). In the presence of Pd 2+, however, duplex 7X:10T is remarkably resistant to heating, losing significantly less of its ellipticity than the other combinations. In other words, the artificial 2,6-bis(3,5-dimethyl-1H-pyrazol-1-yl)purine nucleobase seems to be able to recognize thymine, but only in the presence of Pd 2+. With the 2 -O-methyl-RNA homoduplexes between unmodified oligonucleotides, the ellipticity of the matched duplex 7A:8U exhibits a strongly sigmoid curve with an inflection point at approximately 75 C and the mismatched duplex 7A:8C shows a similar curve with an inflection point at approximately 60 C (Figure 6(a)). The inflection points are essentially independent on the presence of Pd 2+, but in the case of the mismatched duplex 7A:8C, the loss of ellipticity at high temperatures is somewhat lower in the presence of Pd 2+. In contrast, no discrimination between uridine and cytidine is observed with the modified oligonucleotide 7X: both duplexes 7X:8U and 7X:8C exhibit largely similar sigmoid curves with inflection points at approximately 60 C (Figure 6(b)). In both cases, the maximum loss of ellipticity is somewhat lower in the presence of Pd 2+. The plots of the duplexes containing multiple mismatches are essentially linear and independent on both the sequence and the presence of Pd 2+ (Figure 7). Table 2. As expected, the unmodified oligonucleotide 7A forms the most stable 2 -O-methyl-RNA/DNA heteroduplex with the fully complementary DNA oligonucleotide 10T, but the discrimination is not very strict. For example, the fullmatch duplex 7A:10T exhibits a T m value of only 5 C higher than the mismatched duplex 7A:10A (50.0 and 45.0 C, resp.). Adding 1 eq. of Pd 2+ to the oligonucleotide mixtures has little effect on the stability of any of the duplexes studied. Unexpectedly, all of the respective heteroduplexes formed by the modified oligonucleotide 7X turned out to be significantly more stable than the ones formed by 7A, with T m values ranging from 58.6 to 62.6 C. The most stable duplex was the one between 7X and 10T, although the selectivity was even lower than in the case of 7A. Furthermore, the selectivity is only marginally improved in the presence of Pd 2+. In Discussion The Pd 2+ chelate of the 2,6-bis-(3,5-dimethylpyrazol-1-yl) purine nucleobase presented in this study has no potential for hydrogen bonding interactions with the canonical nucleobases-in other words, its base pairing relies solely on metal ion coordination. On the other hand, the modified nuclobase presents a much greater surface for - stacking interactions and the observed Pd 2+ heteroduplexes is probably a result of this enhanced basestacking. The Pd 2+ -dependent selective recognition of a thymine base within a complementary DNA oligonucleotide, in turn, is probably attributable to two factors, namely, the relatively small size of the thymine base, as well as its potential to act as an anionic nitrogen ligand. Of the four native nucleobases, only the pyrimidines may form a base pair of Watson-Crick geometry with the artificial metallo-nucleobase (and even these base pairs would be approximately 1.3 longer than the natural ones). Of the two pyrimidine nucleobases, only thymine (or uracil) is readily deprotonated to yield a negatively charged nitrogen ligand with a significantly greater affinity for metal ions. Indeed, Hg II has been shown to selectively bind to a T-T mispair within a double-stranded oligonucleotide by coordinating to the N3 of both thymine residues. The fact that no selectivity for uracil is observed with the 2 -O-methyl-RNA homoduplexes may be reasoned if the bulky dimethylpyrazole moieties cause a large enough steric hindrance to prevent the metallo-base pair from assuming planar geometry. Presumably, a nonplanar base pair should be more easily accommodated within the more flexible 2 -O-methyl-RNA/DNA heteroduplex than the relatively rigid 2 -O-methyl-RNA homoduplex. Conclusions A 2 -O-methyl-RNA oligonucleotide incorporating an artificial nucleobase that serves as a tridentate chelate for soft metal ions has been synthesized. When hybridized with a complementary DNA oligonucleotide, this modified oligonucleotide selectively recognizes a thymine residue opposite to the artificial nucleobase. The discrimination is somewhat more pronounced in the presence of 1 eq. of Pd 2+, but the difference is too small to be taken as compelling evidence for the formation of a metal-ion-mediated base pair between thymidine and 1. Within fully matched 2 -O-methyl-RNA homoduplexes, the modification is destabilizing regardless of the presence of Pd 2+, probably because the proposed metallo-base pair cannot assume a planar geometry needed to fit within the relatively tight base stack of these oligonucleotides. Within mismatched duplexes, as well as 2 -O-methyl-RNA/DNA heteroduplexes, the modification is stabilizing but the effect is rather sequence and Pd 2+ independent, suggesting that the origin of this stabilization is the large - stacking surface of the artificial nucleobase. The metal-ion-carrying nucleobase presented in this study represents a reference structure with no potential of specific interactions with the natural nucleobases and the preference for thymine is probably based on its small size and ability to serve as an anionic nitrogen ligand. The fact that the strong base pairing observed at the monomeric level is only modestly reflected in the thermal stability of the respective double-stranded oligonucleotide is most likely due to difficulties in accommodating this (presumably) nonplanar base pair within an oligonucleotide environment. It should be noted that the CD and T m studies do not provide first-hand information on the interactions (if any) between thymine (or uracil) and the Pd 2+ complex of the artificial nucleoside 1. In other words, the possibility that within a double-stranded oligonucleotide, a complex of a different geometry prevails cannot be completely ruled out. More elaborate structures featuring additional hydrogen bonding interactions as well as carefully placed steric constraints will, in all likelihood, exhibit greatly enhanced affinity and selectivity. For example, replacing the dimethylpyrazole moieties with monosubstituted hydrazines would result in a structure not only sterically less hindered than 1 but also capable of donating two hydrogen bonds to the oxo substituents of thymine or uracil. On the other hand, using a pyrimidine, rather than a purine, nucleoside as the parent compound would alleviate some of the steric crowding caused by the relatively bulky Pd 2+ ion. Finally, other soft metal ions could be screened to find the optimal combination of affinity and selectivity. Experimental 5.1. General. 2,3,5 -Tri-O-acetyl-6-chloro-2-iodopurine riboside was a commercial product that was used as received. For the triethylammonium acetate buffer used in HPLC chromatography, triethylamine was distilled before using. The NMR spectra were recorded with a Bruker Avance 500 NMR spectrometer and the chemical shifts are given in ppm. The mass spectra were recorded with a Bruker micrOTOF-Q ESI-MS spectrometer and the CD spectra with an Applied Photophysics Chirascan spectropolarimeter. The 9-(-d-Ribofuranosyl)-2,6-dihydrazinopurine. To neat hydrazine hydrate (6.5 mL, 134 mmol) was added 2, 3, 5 -tri-O-acetyl-6-chloro-2-iodopurine riboside (1.03 g, 1.91 mmol) and the resulting mixture was stirred for 14 d at room temperature. Over the course of the first day, the appearance of the reaction mixture changed from yellowish and cloudy to clear and colorless to light red, followed by formation of a white precipitate. The reaction mixture was diluted with 2-propanol (15 mL) and stirred for 15 min, after which the precipitate was collected by filtration and washed with cold 2-propanol (2 100 mL). Finally, the precipitate was dried under vacuum to yield 0.534 g (89%) of 2 as a white powder. 1 (3,5-dimethylpyrazol-1-yl) purine. To dry compound 3 (0.337 g, 1.08 mmol) was added 6.4 eq. of dry 2,4-pentanedione (0.70 mL, 6.912 mmol) and 0.1 eq. of trifluoroacetic acid (8.27 L, 0.108 mmol). The reaction mixture was stirred at room temperature for 16 h, during which time the product crystallized. The volatiles were removed under reduced pressure to yield crude 1 that was used in the next step without further purification. For the NMR titrations, a small sample was purified by silica gel chromatography eluting with a mixture of MeOH, CH 2 Cl 2 and Et 3 N (9 : 90 : 1, v/v). 1 Oligonucleotide Synthesis. The oligonucleotides were assembled on a CPG-supported succinyl linker at a loading of 27 mmol g −1. Standard phosphoramidite strategies for RNA (600 s coupling time) or DNA (20 s coupling time) were used throughout the sequences, except for the modified phosphoramidite building block 2, which was coupled manually using an increased coupling time (60 min). Based on trityl response, coupling yield for building block 2 was 36% and the other couplings proceeded with normal efficiency. The products were released from support and deprotected by conventional treatment with 33% aq. NH 3 (5 hours at 55 C). The crude oligonucleotides were purified by RP-HPLC on a Hypersil ODS column C18 (250 4.6 mm, 5 m) eluting with a mixture of 0.10 mol L −1 aq. triethylammonium acetate and MeCN, the flow rate being 1.0 mL min −1. The amount of MeCN was increased linearly from 10 to 40% during 25 min for the 2 -O-methyl-RNA oligonucleotides and from 10 to 30% during 25 min for the DNA oligonucleotides. The purified products were characterized by ESI-MS analysis.

Crying at this MSNBC meltdown reaction to Kanye West in the Oval Office. "That was an assault on our White House!" Hosts spiral into hysteria over how MAGA is male dominated and means white supremacy? Assault on our White House? Did you miss the Clinton years? What, the part where Kanye talked about the need for jobs in the inner city, for better relationships between the police and community members, or proper mental health treatment? Don’t want to analyze that? Is it possibly because you know liberal policies have failed these people and you have no answers? The female host wanted to give her favorite quote first (and I can’t be bothered to look up her name). #Triggered! Since the Kavanaugh nomination debacle and the embrace of toxic masculinity by Lindsey Graham, Mitch McConnell, and more (but definitely not by Jeff Flake), I’ve been thinking about the war on boys and men feminists have been waging for a few generations now, and how that is about to fail in a huge way. Kanye’s comments about MAGA versus “I’m with her” bear that out. Liberals don’t like Kanye West leading the black community away from their destructive policies, and they sure as hell aren’t going to like it if he starts advocating for men to throw off the soy-boy shackles feministas have them in. Instead of having any thoughtful dialogue, they use his bipolar diagnosis against him and call him crazy.

Mark Eves Personal life and education Mark Eves was born in northern California to Arthur Eves, a former military chaplain during World War II, and his mother, a school teacher. The Eves family moved to Oregon when he was 3 months old. He is the youngest of 7 children in his family. When he was 5, the Eves family moved again, this time to Italy so that his father could study to become a Montessori teacher. His family later moved to Arizona and later to Louisville, Kentucky, where Eves settled at age 11. He later attended the University of Louisville and Louisville Presbyterian Theological Seminary. He met his wife, Laura, while both were seeking master's degrees in marriage and family therapy at Louisville Presbyterian. The pair settled in North Berwick, Maine, around 2002 and have three children. Maine Legislature In 2008, he was elected to the Maine House of Representatives from District 146, North Berwick. He was re-elected in 2010 and 2012 before being chosen as the Speaker of the Maine House of Representatives for the 126th Maine Legislature (2012–2014). From 2010 to 2012, Eves was the ranking minority member of the Health and Human Services committee. In the November 2014 general election, the Democrats lost control of the Maine Senate but retained a narrow majority in the Maine House of Representatives. The legislature subsequently re-elected Eves as Speaker. During his time in the legislature, Eves focused on efforts to help seniors maintain independence and lower living costs. According to the Bangor Daily News, "He led efforts to provide direct-care workers with raises and in 2014 sponsored a successful property tax relief bill that included an extra benefit for homeowners older than 65. In 2015, Eves proposed a $15 million senior citizen housing bond, which was approved by more than 69 percent of voters at referendum." On June 30, 2014, the Talking Points Memo website claimed that some Maine adherents to the sovereign citizen movement had called for Eves and fellow Democratic Senate President Justin Alfond to be tried, convicted, and executed for treason during meetings with Governor Paul LePage in 2013. LePage denied that such discussions took place, even after learning that audio recordings exist of two men claiming such a discussion took place. Campaign for governor On July 13, 2017, Eves announced he was running for the Democratic nomination for Governor of Maine. As part of his announcement, his campaign touted "under Eves' leadership the Legislature passed a bipartisan middle-class tax cut, boosted property tax relief for all Maine families, and strengthened investments in Maine's children, seniors and workers." On February 24, 2018, former Bangor Mayor Sean Faircloth suspended his campaign for governor and endorsed Eves. Charter school creation In September 2012, Good Will-Hinckley, a private, not-for-profit organization located in Fairfield, Maine, opened a charter school called the Maine Academy of Natural Sciences ("MeANS"). As part of the 2013–2015 Maine State budget, MeANS received approximately $1,060,000 in discretionary funding from the State. The president of Good Will-Hinckley at the time was Glenn Cummings, the former Democratic Speaker of the Maine House of Representatives who had opposed charter schools while serving in the legislature. Subsequent hiring process In September 2014, Good Will-Hinckley initiated a nationwide search for a new president after Cummings resigned. Bill Brown, who worked for Eves in the State Legislature, later testified that, at the request of former Speaker Cummings, he informed Eves of the job opening and suggested that Eves apply. Brown, who was also the chairman of MeANS's board at the time, helped Eves organize his resume but did not provide assistance to any of the other applicants. Of the nineteen applications received, six candidates were selected to be interviewed, including Eves. Brown, in addition to being present for the hiring committee's interviews of Eves, also sat in on the interviews for all of the other candidates and commented on aspects of Eves' candidacy to other interview committee members. The committee eventually unanimously voted to offer Speaker Eves the position previously held by former Speaker Cummings. On June 5, 2015, Eves signed an employment agreement with Good Will-Hinckley. LePage funding threats and subsequent firing When Governor LePage learned of Eves' selection, he contacted Good Will-Hinckley criticizing Eves as a "hack" and urging them to reconsider their decision. Governor LePage indicated that he would be withdrawing all support from Good Will-Hinckley as long as Eves remained as President of the organization and described Eves as "a longtime opponent of public charter schools". LePage thereafter stated that he would not send any more discretionary funding to Good Will-Hinckley, although he took no steps to reduce or eliminate funding allocated for Good Will-Hinckley in the proposed budget. LePage went on to say "He [Eves] worked his entire political career to oppose and threaten charter schools in Maine. He is the mouthpiece for the Maine Education Association. Giving taxpayers' money to a person who has fought so hard against charter schools would be unconscionable." "Former legislator Paul Violette, the past head of the Maine Turnpike Authority, went to jail for enriching himself and misappropriating public money. . . . These former legislators used their political positions to land cushy, high-paying jobs in which they were trusted to use taxpayer money to improve the lives of Mainers. They abused that trust and had to face the consequences of their actions. The same is true of Mark Eves." On June 24, 2015, Good Will-Hinckley fired Eves. Civil lawsuit against LePage Eves, as well as Republican State Sen. Roger Katz, criticized LePage for attacking Eves' personal livelihood and family. Eves filed a civil lawsuit against LePage on July 30, 2015, asserting illegal retaliation and blackmail. Eves said he and his office would not be involved in any legislative actions against LePage. On May 3, 2016, U.S. District Judge George Singal dismissed Eves' lawsuit, finding that Governor LePage was entitled to immunity from suit for his actions as the discretion afforded LePage "clearly encompasses advocating for his preferred charter school policy" and the "dispurs[ment of] funds" for MeANS. On January 26, 2018, the full United States Court of Appeals for the First Circuit in Boston agreed to hear Eves' case, after it had been rejected by a three-judge panel of the court.

Standard mosaic geometries in modern imaging systems, such as a thermal imager, give rise to the fundamental limitation of creating undersampled images, which are degraded by aliasing. This problem is considered to be the most important effect which limits recognition and identification ranges for these systems in various surveillance scenarios. Aliasing is a distortion affecting spatial frequency components of the image that are higher than half of the sampling frequency. A point target image can either cover one detector element and generate a strong single signal or cover up to four detector elements which will produce much weaker signals from all four elements. Variable registration of the image's continuous signal with the sampling lattice leads to small output signal fluctuations resulting in all edges of a spread target being degraded by the spurious registration. Two known techniques have been used to, at least partly, solve the aliasing problem. A first solution is called information prefiltering and simply consists in eliminating all frequencies that are higher than half of the sampling frequency. This is realized in imaging systems by matching the blur circle of the optics to an array of at least 2.times.2 detectors, i.e. each point of the image on the mosaic covers at least 2.times.2 detectors. This prefiltering of the information provides a good solution to undersampling problems but is, however, extremely expensive to implement since an array of at least 1024.times.1024 detector elements will be required to obtain a 512.times.512 image resolution which is about typical for T.V. An array of 1024.times.1024 detector elements is practically impossible to achieve at present with infrared focal plane arrays of high sensitivity and any array with that number of detectors elements will be extremely expensive to manufacture. A second solution to reduce the effects of aliasing is to introduce a dithering or microscan into the system. Introducing a scan mirror in the optical path allows multiple images to be formed on the mosaic of detector elements with a small displacement between each of the images. A single plane mirror actuated by piezo-ceramic transducers may be used as a microscan mechanism such as that described in an article by R. J. Dann et al on pages 123 to 128 of SPIE, Vol. 685, Infrared Technology XII (1986). This mirror causes an image scene to be displaced by some fraction of a pixel with respect to the detector array so that interpixel sampling can occur in both horizontal and vertical directions. For instance if a 2.times.2 microscan is applied, the first field records the image at a first reference position on array. The image is then displaced by half a pixel to the right to record a second image and then a half a pixel vertically to record a third image. The image is then displaced a half a pixel to the left for recording a fourth image and then vertically to return the image to its original position. These microscan images are electronically merged together as interlaced fields to form a regular full frame image containing the 4 fields for a 2.times.2 micro scan as previously described. In a similar manner, the image could be displaced by one third of a pixel for each step to implement a 3.times.3 microscan. A number of problems are associated with the use of microscan image such as significant sensitivity reduction caused by the use of many fields to build up an image. This severely limits the duration over which the incident radiation power may be integrated resulting in less sensitivity. The imagery produced by microscan systems is also interlaced which is less suitable for automatic recognition systems and other auto-processors used in modern surveillance systems. Furthermore, a prime objective of developing staring systems is the elimination of scanning mechanism in an IR camera to allow smaller, lighter, cheaper and more reliable imaging systems. The introduction of the microscan mirror can generally be considered as a retrograde step that moves in the opposite direction desired by system designers in that more electronics, more power, more volume and sophisticated mechanics are required to control that type of system. A hexagonal, rather than square image elements, mesh imaging system has been extensively studied for reasons other than aliasing control. However, the hexagonal mesh cannot easily be addressed by either Cartesian coordinated or polar coordinates. It is, therefore, laborious to use hexagonal meshes with all memory buffers and most image processing algorithms since they rely on Cartesian coordinate systems. Furthermore, the size of detector elements in a hexagonal mesh is less than that for square detector element resulting in a loss of sensitivity.

. We studied the effect of eosinophil peroxidase (EPO) on beta-adrenergic receptor (BAR)-adenylate cyclase system based on the hypothesis that eosinophils may participate in the pathogenesis of beta-blockade in acute asthma. The effect of EPO on BAR density on guinea pig lung membrane was studied first. The BAR density was decreased significantly by 10(-4) M H2O2 alone. EPO combined with 10(-4) M H2O2 and iodide caused additional decrease in BAR density, and the decrease was EPO concentration-dependent (1-10 U/ml). The effect of EPO on cyclic AMP (CAMP) accumulation in S49 cells was studied next. The CAMP accumulation with 10(-4) M isoproterenol was significantly inhibited with combination of EPO and H2O2, and the decrease was again EPO concentration-dependent (0.1-1 U/ml) without any changes in BAR density on the cells. Thus, EPO was demonstrated to have an influence on the BAR-adenylate cyclase system.

Enrollment is now open for the 9th Annual Camp Ryan Woods Autism Foundation, and is open to teens and young adults on the autism spectrum and those individuals with other special needs. Enrollment runs from April 1-30. Activities include field trips; dance/music therapy; golfing; bowling; science museums and plenty of fun.To sign up, email the foundation at rwaf@comcast.net or call 860-834-3018. Enrollment is now open for the 9th Annual Camp Ryan Woods Autism Foundation, and is open to teens and young adults on the autism spectrum and those individuals with other special needs.Enrollment runs from April 1-30. Activtities include field trips; dance/music therapy; golfing; bowling; science museums and plenty of fun.To sign up, email the foundation at rwaf@comcast.net or call 860-834-3018.

“Swingers” was the best episode of Up All Night that season two has offered so far, punny title aside. It features some of the heart that makes Chris and Reagan a believable couple, Maya Rudolph getting to do a little more understated acting, and Rachel Dratch. Thank God for Rachel Dratch, even if she only got a few minutes of airtime as a saucer-eyed fangirl. Things are looking up for Up All Night. The dilemma that Reagan and Chris face this episode isn’t unique: After their years together, the habit they’ve gotten into is to settle on the couch, mindlessly salt their food, and gossip about various Real Housewives franchises. When the television goes out, they awkwardly stumble into a real, sit-down, TV-less dinner date. No surprises in how it goes, but the writing—plus some great performances from Will Arnett and Christina Applegate—freshens what could be a stale plot. The joy of coupledom is partially conspiracy. Sure, you should be eating broccoli or reading the news, but getting to watch bad television and make out in the backyard is a whole lot more fun. Doing the wrong thing together is more fun than the right thing. The best scene of the episode is actually when Reagan, nervous about the lack of dinner conversation, makes herself cue cards for the dinner. When Chris finds out, he chastises her—and it turns into an actual conversation. No TV sounds good, Chris argues, but it’s actually terrible. “Like communism,” he affirms. Or like Ron, the ice cream man who lived across the street from Chris growing up. Proximity takes the joy out of something. The ice cream man as a hollow divorcee just isn’t as good as the fantasy. The conversation leads to Reagan’s revelation that she’d always wanted to join the circus, and a botched make-out session in the garden. To make up for his shyness around the neighbors, Chris buys Reagan tickets to a trapeze lesson with him. Here is the cold, hard truth: Trapezes are scary. They are hard. And as a date, a trapeze lesson is mostly a chance to make an idiot of yourself in an expensive way. After Will Arnett performs some impressive contortions, the two conclude that they’re happy being boring together. But not before they get to savor the best part—kissing in the safety net afterwards. Ava, meanwhile, is still coping with the cancellation of her talk show. She invites the Brinkleys to a doof-less champagne brunch, where they discover her secret hoarding room. When Reagan suggests that Ava gets rid of things—a rainstick, a keyboard, an extra yoga ball—Ava vehemently resists, clutching a jumble of weird objects. “Seriously, you look like the Cat in the Hat right now,” Reagan says. Reagan’s brother Scott—remember him?—rises to the occasion, the occasion being the time to sell a bunch of crap on Craigslist. At a yard sale of Ava’s possessions, she happens upon Ava super-fan Linda (Rachel Dratch). Ava gets so inspired by Linda’s affection that she gives away a bunch of her beloved show memorabilia, including a “champagne mug” that meant a lot to her. Ava then, of course, has to try to get it back. In the end she ends up getting a mug with a picture of her, Scott, and the old mug on it. It’s a sweet, if small, narrative, and a relief from Ava’s dramatic breakdowns of the last few weeks. Let’s hope Up All Night keeps on this track—the writers might just pull it off.

COMPREHENSIVE EDUCATION X TEACHER TRAINING This article aims to analyze and understand how Integral Education and Teacher Training takes place, given that it is of paramount importance for the teaching and learning process. Therefore, integral education is multifaceted and understands that it must guarantee the full development of the human being in all its spheres. In this intellectual, physical, emotional, social and cultural context, aiming to contribute to the change and improvement of the educational system, seeking to improve the professional competence of teachers, encouraging them to actively participate in educational innovation, thus improving the quality of education.

Reticulocytopenia in trichinellosis. This study characterizes the peripheral blood, erythrocytic profile of mice experimentally infected per os with three different doses of Trichinella spiralis larvae. Such results have not been previously detailed despite reports of hemorrhagic episodes associated with the disease (Gould, S. E., 1970. In Trichinosis in man and animals, S. E. Gould (ed.). Charles C Thomas, Springfield, Illinois, pp. 269-328; Beck, J. W., and J. E. Davies, 1981. Medical parasitology. C. V. Mosby Company, St. Louis, Missouri, pp. 140-145). Sixty mice (10 to 12-wk-old, outbred CD1 females) were divided into three groups of 20. Group I was infected with 100 T. spiralis larvae, Group II with 500, and Group III with 1,000

Materials and Orthopedic Applications for Bioresorbable Inductively Coupled Resonance Sensors Bioresorbable passive resonance sensors based on inductorcapacitor (LC) circuits provide an auspicious sensing technology for temporary battery-free implant applications due to their simplicity, wireless readout, and the ability to be eventually metabolized by the body. In this study, the fabrication and performance of various LC circuit-based sensors are investigated to provide a comprehensive view on different material options and fabrication methods. The study is divided into sections that address different sensor constituents, including bioresorbable polymer and bioactive glass substrates, dissolvable metallic conductors, and atomic layer deposited (ALD) water barrier films on polymeric substrates. The manufactured devices included a polymer-based pressure sensor that remained pressure responsive for 10 days in aqueous conditions, the first wirelessly readable bioactive glass-based resonance sensor for monitoring the complex permittivity of its surroundings, and a solenoidal coil-based compression sensor built onto a polymeric bone fixation screw. The findings together with the envisioned orthopedic applications provide a reference point for future studies related to bioresorbable passive resonance sensors. INTRODUCTION Implantable sensors have been used for research purposes as part of orthopedic fixation devices for decades, but their clinical usage has remained scarce. The early smart implant systems utilized percutaneous wires for power and data transfer, but the wires are known to increase infection risks and may constrain the device usage to hospital surroundings. 1−3 One approach for wireless sensor systems involves inductively coupled passive resonance sensors, which essentially consist of a parallel circuit of an inductor (L) coil and a capacitor (C). Such sensors operate without batteries, which reduces their size and complexity, thus making them easier to integrate into orthopedic implants. 4 As a recent approach, sensors made from bioresorbable materials are designed to operate for a defined time under physiological conditions, after which they degrade into nontoxic substances that can be eliminated from the body. 5,6 The operational principle of the sensors is based on inductive coupling between the LC circuit and a reader coil, whereupon a resonance curve is created at a given frequency range. The resonance curve may form a peak or a dip, depending on whether the real part of the impedance or the phase of the impedance is measured, respectively. Typically, the capacitance or inductance of the sensor changes in response to a measured variable, which shifts the resonance curve. This can be detected by estimating the frequency of the maximum or minimum value of the curve (depending on whether the resonance curve is a peak or a dip, respectively). A review by Huang et al. discusses the operational principle and state-of-the-art of these sensors in more detail. 7 A typical resonance sensor consists of a planar or solenoidal inductor coil connected to an interdigital or parallel-plate capacitor, which is often used as the sensing element. In addition, the sensors comprise a certain resistance (R) and may contain separate resistive components, which is why the term RLC circuit is sometimes used. Passive resonance sensors enable a variety of measurement applications, including but not limited to pressure, strain, pH, temperature, and biochemical sensing. 7 Bioresorbable sensors are, by definition, only suitable for short-term applications. For example, after an open reduction and internal fixation (ORIF) of broken bones, the sensors could be added into the fixation devices to temporarily monitor parameters like temperature for early signs of infection, intratissue pressure for cues of acute compartment syndrome, or strain to measure the stiffness of the fracture callus or to personalize tendon rehabilitation processes. 4,8−10 Furthermore, intraoperative load sensors have provided improved results in total knee replacements by guiding the surgeon toward correct knee loading. 11 Similar sensor-guided operations could be performed with smart implants where a bioresorbable sensor would be integrated into the orthopedic implant. These kinds of applications could reduce unnecessary patient discomfort and facilitate massive savings by detecting adverse events early or by reducing revision surgeries and expensive imaging procedures. 4,12 One of the main challenges in bioresorbable sensors is their fabrication. In many cases, the bioresorbable substrates are incompatible with conventional microfabrication processes like electrodeposition, photolithography, and etching. 13, 14 The process steps may involve spin-coating materials with organic solvents, baking at high temperatures, or immersing the substrates into electrodeposition solutions or lift-off chemicals. The associated conditions may damage the substrates or already prepared functional layers, which complicates the assembly of bioresorbable sensors. The aim of this study is to provide an overall materials perspective on bioresorbable passive resonance sensors by discussing different material options, fabrication methods, and sensor architectures. The experimental novelty of the work lies in two original sensors, new material combinations and discussion of in vitro testing methods. Furthermore, an improved version of a previously published pressure sensor is utilized to discuss the effect of polymer substrates on the sensor performance as well as to compare physical vapor deposited (PVD) magnesium (Mg) and zinc (Zn) conductors. The novel sensor architectures include the first bioactive glassbased wireless resonance sensor and a molybdenum (Mo) wire-based compression sensor with a solenoidal design. The performance of the devices is demonstrated with wireless sensor measurements, on top of which the material properties of the components are evaluated in simulated physiological conditions. Finally, the water barrier materials are addressed by evaluating atomic layer deposited (ALD) encapsulation films, which are deposited on bioresorbable polymer substrates. In addition to the experimental results, several potential orthopedic applications are suggested for wireless bioresorbable sensors. RESULTS AND DISCUSSION 2.1. Bioresorbable Polymer-Based Pressure Sensors. Bioresorbable wireless pressure sensors reported so far are mostly based on polymeric substrates. 3,15−18 This is rational because bioresorbable polymeric bone fixation plates have been used for decades especially in pediatric patients, where permanent fixation might hinder bone growth. 19 Thus, fabricating the sensors directly onto the orthopedic plates offers one simple possibility for integrating the sensors onto the implants. In this study, the material attributes of a recently reported polymer-based bioresorbable pressure sensor 18 were adjusted regarding the adhesive layers and Mg conductor patterns. This section involves testing these Mg pressure sensors and characterizing the water uptake and flexural properties of the substrate material in simulated physiological conditions. The Mg pressure sensors were fabricated by attaching two poly(desaminotyrosyl−tyrosine ethyl ester carbonate) (PDTEC) substrates (430 m) with e-beam evaporated Mg conductor patterns (7.5 m) onto a holed spacer by using molten polycaprolactone (PCL) films (∼15 m) as an adhesive (Figure 1a). The working principle of the sensor is based on variable capacitors formed by the Mg electrodes on the substrates; as pressure is increased, the electrodes bend toward each other in the two cavities that are confined by the substrates and the holes in the spacer. This increases the capacitance of the LC circuit, which is detected as a shifting resonance peak (or decreased resonance frequency) as illustrated earlier. 18 In this study, the adhesive PCL layer that attaches the substrates into the spacer was about twice as thick than in the previous version. This was assumed to increase the functional lifetime of the pressure sensor because in the anterior publication the substrates were noticed to detach from the spacer during immersion. In addition, the evaporation masks were now fabricated from laser-cut metal sheets instead of 3D-printed polymers that were used in the earlier study. 18 The masks were redesigned to remove excessive Mg from around the coils to reduce possible stray capacitances. In this study, the sensor remained readable and responded to pressure changes under immersion in the Sorensen buffer solution for 10 days, after which the resonance peak (∼101 MHz) was largely attenuated and the test was terminated. The Sorensen buffer was chosen to reliably compare the sensor behavior with our previously reported pressure sensor, which had failed during the first 24 h of immersion. 18 In addition, a similar sensor was now immersed in Minimum Essential Medium (MEM) to more accurately simulate the contents of physiological solutions. 20 The sensor was readable in MEM for up to 12 days. Thereafter, the detection of the resonance frequency (∼88 MHz) was not reliable anymore due to resonance peak attenuation, which increased the uncertainty in estimating the resonance frequency. The attenuation was caused by the corroding Mg conductors, which increased the electrical resistance in the circuit. Furthermore, the increasing resistance may decrease the resonance frequency. 21 The effects of the resistance on the resonance frequency are often neglected in conventional applications where the resistances are diminutive, but should be taken into account in biodegradable devices where the resistances and their changes can be more significant. Bacterial growth was noticed as a film on top of the MEM solution upon test termination after 14 days, which may potentially have accelerated Mg corrosion via acidification. 22 As discussed later in section 2.3, the differences in the simulated physiological conditions have a significant impact on the metal corrosion. On the other hand, the contamination risks and increased complexity of the test setups advocate for using simpler buffer solutions than cell culture media in sensor measurements, where the conductors are encapsulated. This is because the encapsulation layers diminish the effect of proteins and other nonpermeable substances on the metal corrosion. The initial resonance frequencies of the immersed sensors in Sorensen and MEM were 101.89 MHz (106.57 MHz in air) and 92.76 MHz (98.67 MHz in air), respectively. The resonance frequencies decreased during the first 12 h ( Figure 1d), caused by the capacitance increase due to water diffusion into the PDTEC substrates. Thereafter, the resonance frequency of the sensor started to rise, which is earlier shown to result from the outward bending of the substrates. 18 This could have been caused by relaxation or swelling of the substrates or possibly by hydrogen gas generation arising from the corrosion of Mg. 20 Furthermore, the corrosion increased the resistance of the conductors, which can be considered as one of the factors that contribute to the drifting. The small amount of water that diffused into the polymer matrix could have slowly initiated the dissolution of Mg, possibly explaining why no clear corrosion was noticed after 24 h of immersion. 18 The materials testing revealed that the water uptake of PDTEC was 2.5 wt % after 12 h, in contrast to the final equilibrium state of 3.0 wt % after a few days (Figure 1e). The water uptake remained at the same level during the rest of the 100 days test period, which is consistent with the reported slow degradation rate of PDTEC. 23 The pressure response measurements ( Figure 1b) showed that the initial sensitivity of the nonimmersed sensor was around −7 kHz/mmHg, which is in the same range compared to the previously reported set of sensors. 18 The pressure sensitivity of the sensor was noticed to drift as a function of immersion time (Figure 1c). In comparison, the bioresorbable LC circuit-based pressure sensor of Luo et al. showed also slight sensitivity drifts under immersion, but the changes were much smaller. 15 The three-point bending test showed only a modest increasing trend in the flexural Young's modulus of PDTEC during the first week, as tested under aqueous conditions at 37°C (Figure 1f,g). Thus, the changes in the mechanical properties of PDTEC do not explain the nonlinear sensitivity drifting. Instead, the drifting was likely attributed to structural changes between the substrates and the adhesive PCL layers, possibly due to hydrogen generation inside the sensor. It can be concluded that the diffused water caused changes in the dielectric properties of the capacitors, dimensional changes in the substrate, and corrosion of the conductors, all of which are undesirable regarding sensor stability. The drifting of the sensor would require frequent calibration in practical implant applications. Thereby, we suggest that in this kind of sensor architecture the water ACS Applied Materials & Interfaces www.acsami.org Research Article diffusion into the polymer matrix should be ideally fully prevented during the functional lifetime of the sensor, regardless of the degradation rate of the conductor material. This could be achieved for example with an appropriate bioresorbable encapsulation layer. The PDTEC samples tested in dry conditions exhibited increased flexural strength compared to the wet samples ( Figure 1h). While dry samples maintained the same stress values beyond the yield point, the immersed samples showed strain softening. The stress needed to flex the PDTEC samples to a constant displacement of 2 mm under aqueous conditions decreased significantly within 3 h of testing ( Figure 1i). The stress relaxation behavior could be of significance in applications where the pressure is static. In addition to the mechanical properties, the response of human fibroblasts to compression-molded PDTEC discs was evaluated ( Figure S1, Supporting Information), indicating that their biocompatibility was at least comparable to, if not better than, that of poly-L/Dlactide 96L/4D (PLDLA 96/4) discs or untreated polystyrene well plates. Possible applications for bioresorbable pressure sensors include detecting adverse conditions during or after the surgery. For example, craniosynostosis is a malformation of an infant's skull caused by premature ossification of cranial sutures, which is often treated with a cranial vault remodeling by using bioresorbable plates and screws. Elevated intracranial pressure (ICP) levels after surgery may potentially require further treatment, which is why wireless postoperative ICP monitoring would be desirable. 24 Detecting acute compartment syndrome (ACS), which is caused by elevated pressure inside muscle compartments, is another attractive application for temporary pressure sensors. The diagnosis usually relies in clinical symptoms such as disproportionately severe pain and paresthesia, but delays between initial assessment and diagnosis are still frequent, leading to irreversible ischemic damage in 6−8 h if the condition is not properly treated. 25 Implantable pressure sensors could be used to detect cues of ACS in unresponsive or sedated patients or to complement clinical assessment in other risk groups. Finally, sensors could be used to guide surgeons during the operation. For example, pressure sensors could be used to avoid periosteal necrosis and subsequent osteopenia, which may arise from applying too much compression on a bone fixation plate. 26 Embedding such sensors onto fixation plates could aid in the adoption of the technology, as there would be fewer modifications to the surgical techniques compared to external sensors that are removed in the end of the operation. 2.2. Bioactive Glass-Based Wireless Resonance Sensors. Bioresorbable glasses and ceramics offer underrepresented yet fascinating substrate materials for wireless resonance sensors. Invented by Larry Hench, bioactive glasses can create a strong bonding interface with bone or even with soft tissues by releasing soluble ions upon immersion in water. 27 These ions stimulate osteogenic cells and contribute to the formation of a bonelike apatite layer onto the glass surface, due to which such glasses are clinically used for example as synthetic bone grafts. The dissolution kinetics of bioactive glasses can be adjusted by their composition, and certain glass compositions are fully bioresorbable. Even though fast dissolving borate glasses have been proposed as sensor substrates, the interest toward bioactive glasses in biodegradable electronics has been scarce. 28,29 Herein, we present the first wirelessly measured bioactive glass-based resonance sensor with S53P4 (Bonalive) glass disc substrates, dissolvable Mg conductors, and spin-coated bioresorbable polymer dielectric layer. A simplified electrical design and the schematic structure of the bioactive glass-based resonance sensor are presented in Figure 2a,b. The sensor architecture consisted of spin-coated PDTEC dielectric layers (∼1 m) and Mg conductors (7.5 m) that were e-beam evaporated through 3D-printed stencil masks. Figure 2c presents the measured graphs of the impedance spectrum with increasing reading distances. Because no batteries are needed in the sensors, the most critical limiting factor for their miniaturization is the size of the coil, which has a strong effect on the reading distance of the device. 2,7 The bioactive glass-based sensor showed a detectable but attenuated resonance peak (∼44 MHz) at a distance of 8 mm, which is in line with the previously reported 14 mm reading distance for the Mg pressure sensors with larger coils. 18 For comparison, the reading distance for nondegradable intraocular resonance pressure sensors with a diameter of 6 mm have been reported at 30 mm already in 1967 by Collins. 30 A more recent example with 4 4 mm 2 pressure sensors reached a 15 mm reading distance by using Cu conductors. 31 The uncertainty in detecting the resonance frequency from the attenuated peaks increased along with the increasing reading distance (Figure 2d). In addition, the determined resonance frequency changed with the increasing reading distance due to parasitic capacitances between the sensor and the reader coil. 32 This feature might require compensation in practical applications. One potential application for passive resonance sensors is monitoring complex permittivity changes in their close proximity. 33,34 This feature is attributed to the electrical field in the capacitor, which partly reaches the environment of the sensor. Changes in the permittivity of the immediate sensor environment affect its capacitance and thus shift the resonance frequency of the device. For example, nondegradable sensors with interdigital capacitors (finger electrodes) as sensing elements have been earlier tested for monitoring the degradation behavior of bioresorbable polymers as well as for distinguishing different tissues. 35,36 The finger electrodes offer the possibility to confine most of the interactions between the electrical field and the sensor surroundings near these electrodes. 34 The fabricated bioactive glass-based resonance sensors were used to demonstrate the complex permittivity sensing capability by distinguishing different media in which the sensor was embedded (Figure 2f). The sensors were first coated with nondegradable parylene (13 m) to eliminate the effect of Mg corrosion during the tests. The standard deviations of the estimated resonance frequencies (n = 200) in air, ethanol, and di-H 2 O were 9.7, 9.5, and 9.4 kHz, respectively. Correspondingly, those of Sorensen buffer and Dulbecco's Modified Eagle Medium (DMEM) with high glucose were 10.8 and 10.7 kHz. The ∼15% higher standard deviations in Sorensen or DMEM solutions compared to di-H 2 O can be explained by their ionic content. In another test, a nonlinear resonance frequency decrease was observed as saline was gradually added into di-H 2 O where the sensor was immersed (Figure 2g). The result was caused by the capacitance increase originating from the addition of sodium and chloride ions. A highly desirable potential application (Figure 2e) for resonance sensors made from bioactive glass would be monitoring the formation of the apatite layer and the subsequent bonding of bone onto the glass. The sensors could be integrated onto bioactive glass plates that have been clinically used for repairing orbital floor fractures and nasal septal perforations. 37 A similar sensing method could be of benefit also in nondegradable implants like total hip prostheses. This kind of quick osseointegration measurement could complement or even replace conventional imaging procedures and aid in personalizing rehabilitation. To conclude, glass substrates contain several advantages over polymeric alternatives, such as better compatibility with conventional microfabrication processes. 29 For example, bioactive glasses tolerate solvents like acetone and elevated temperatures that may be required for lithography processes utilizing photoresist masks. A recent study demonstrated dry fabrication methods for Mg microcoils and heaters on float glass substrates, requiring only four steps: Mg deposition, photolithography for pattern definition, ion beam etching of Mg, and resist stripping with oxygen plasma and acetone. 38 This is one example of methods that could be useful with bioactive glass substrates for fabricating devices with detailed conductor patterns. 2.3. Fabrication and Properties of Bioresorbable Conductor Metals. The prevalent bioresorbable conductor materials are metals such as Mg, Zn, Mo, iron (Fe), and tungsten (W), out of which all but W are dietary minerals. Yin et al. have reported the electrical and corrosion properties of various dissolvable metal thin films (40−300 nm) because their properties might be very different compared to bulk materials. 39 Nevertheless, more studies are needed to cover the relevant behavior of bioresorbable metal films, especially in radio-frequency (RF) applications where the films are typically measured in micrometers rather than nanometers and their electrical properties may be affected by the skin effect. In this section, the fabrication, structure, electrical properties, and corrosion behavior of a few micrometers thick Mg and Zn thin films are discussed, including the drastic effect of different corrosion test conditions. In addition, alternative fabrication methods for bioresorbable conductors are briefly summarized. In LC circuits, lower electrical resistance of the inductor coil generally enables higher quality resonators with longer reading distances. 2 However, at high frequencies, the skin effect may restrict the current flow on the surface of the conductors. 40 Physical vapor deposition (PVD) methods are attractive for fabricating conductors because they can be utilized without transfer printing, and the techniques can be readily applied onto many types of substrates. In this study, e-beam evaporation was used for Mg deposition, as it is known to be a capable method for producing Mg films at the micrometer scale. 43−45 On the contrary, the Zn films were magnetron sputtered because the high vapor pressure of Zn results easily in undesirable wall deposits in evaporation systems. 46 Evaporated Mg (7.5 m) and sputtered Zn (∼4 m) films were first deposited on bioresorbable PDTEC substrates to study the morphology of the conductors. A prolonged Zn sputtering process was noticed to heat the PDTEC substrates over their glass transition temperature (T g = 99°C), which impaired obtaining thicker Zn films. In addition, both metals (1.7 m) were deposited on glass substrates to compare their electrical characteristics and corrosion rates with minimal influence of the substrate. The Mg film surface morphology (Figure 3a) consisted of similar facets as described recently with sputtered Mg. 47 The Zn film surfaces comprised individual grains together with larger clusters. The cross-sectional focused ion-beam SEM (FIB-SEM) images revealed that the Mg films had a coarse columnar structure compared to the denser structure of Zn. The structure could explain why the Zn films (1.7 m) showed comparable or even slightly lower electrical resistances compared to Mg films of same thickness (Figure 3c). Comparing the approximated mean bulk resistivity of the 1.7 m thick sputtered Zn films (180 nm) with that of the evaporated Mg films (200 nm) of similar thickness demonstrates that the fabrication method dominated the electrical properties of the films over intrinsic material properties. This can be concluded by comparing literature bulk resistivity values, which suggest that Zn (59 nm) should be less conductive than Mg (44 nm). The results illustrate the differences between thin films and bulk materials, which should be taken into account when choosing the conductor materials and their fabrication method. The sharper profile of the Mg conductors (Figure 3b) originated from the directional nature of evaporation, where the material was deposited in a line of sight manner in contrast to more nondirectional sputtering, which resulted in an arched Zn film contour. 48 The sputtering masks should thus be in a close contact with the substrate, as a short circuit might otherwise form between the coil turns. The disadvantages of fabricating the conductor patterns by using PVD together with shadow masks are related to limited resolution and the required vacuum conditions. 14 Higher precision can be achieved by using lithographic masks, but transfer printing from a provisional substrate is often needed because most bioresorbable polymers do not tolerate the associated chemicals and temperatures. 49 Alternative fabrication techniques include approaches, where patterned metal films are formed by micromachining or wet etching of metal foils. 3,50−53 The advantage of these top-down methods is the easiness in obtaining thicker films compared to PVD or most other bottom-up processes. On the other hand, several tens of micrometers thick Mg and Zn microstructures have been obtained by electroplating the conductor patterns onto a temporary substrate and subsequently transfer printing them onto bioresorbable substrates. 15,54 Further approaches include conductive ink printing methods that do not require vacuum technology and would thus be beneficial for scaling the manufacturing processes. 14,55 These methods are currently under development, but the nonconductive surface oxide layers on biodegradable metal particles make their development challenging. Yin et al. concluded that thin films of Mg, Mg alloy AZ31B, and Zn degrade significantly faster compared to Fe, Mo, or W. 39 Figure 3d elucidates the degradation rate differences of Mg and Zn films (1.7 m) in cell culture medium (MEM supplemented with 10% fetal bovine serum and 1% antibiotics) at +37°C with 5% CO 2 supply, which is the recommended practice for in vitro corrosion testing of magnesium, as stated by Gonzalez et al. in their position paper. 20 Mg started to visibly degrade immediately upon immersion with corrosion pits present after 3 h, and most of the film dissolved within the first 24 h. Testing of thicker Mg films (7.5 m) revealed the dramatic difference in the degradation behavior between different conditions ( Figure S2), which should be recognized when studying unprotected bioresorbable metal films. For example, the Mg samples in di-H 2 O and Sorensen buffer did not show similar pitting corrosion as those immersed in cell medium. Furthermore, mere addition of 5% CO 2 accelerated the corrosion of the films in di-H 2 O. The Sorensen buffer resulted in a significantly faster degradation compared to cell culture medium, possibly due to lack of proteins and differences in the buffering system. The Zn film surface appeared black, which may be caused by the observed Zn nanoclusters on top of the films. 56 The dissolution of the Zn films was much slower compared to Mg, but Zn flakes detached from the film already during the first 24 h. The slower degradation rate could be a benefit in applications where a longer sensor lifetime is desired. The corrosion of bulk Zn and Mg in simulated body fluid (SBF, pH 7) has been estimated to occur at a pace of 50 and 220 m year −1, respectively. 57 Correspondingly, the dissolution rate for sputtered Zn thin films (300 nm) has been estimated at 120− 170 nm day −1 (44−62 m year −1 ) in di-H 2 O, with an observation that the films lose their electrical conductivity 10 times faster than it takes for the thickness to decrease to zero. 39 Thus, nonpassivated Mg and Zn thin films are not considered practical in bioresorbable electronics. Instead, slower dissolving Mo was suggested for applications where the electrodes are in direct contact with biological tissues. 2.4. Bioresorbable Conductor Metals in Passive Resonance Sensors. Most bioresorbable inductively coupled devices reported so far utilize Mg as the conductor material. 3,18,38,51,58 On the contrary, the first fully biodegradable resonance pressure sensor presented by Luo et al. was based on 50 m thick electroplated Zn films on top of a 5−10 m Fe layer. In this section, the performances of Mg-and Znbased pressure sensors are compared. The schematic structure of the sensors is presented in Figure 1a with Mg conductors. Furthermore, the properties of wirelessly readable compression sensors with thick Mo wire (200 m) conductors around polymeric screws are presented. The results indicate that magnetron sputtered Zn (∼4 m) was sufficient for producing wireless pressure sensors with similar, virtually linear pressure responses compared to sensors made from 7.5 m thick Mg (Table 1). However, a practical reading distance for the Zn pressure sensors was only about 6 mm (Figure 4d), whereas the Mg pressure sensors were relatively effortlessly readable at a distance of 10 mm. The poorer performance of the Zn pressure sensors was likely caused by their lower conductor thickness, which resulted in a higher electrical resistance. Another potential reason is the arched cross-sectional profile of the Zn films, which may have decreased the quality of the resonance sensor due to increased parasitic capacitances or resistances. The resonance peak of the Zn-based sensors attenuated so considerably in Sorensen buffer solution that their resonance frequency was difficult to detect under immersion. Along with different corrosion behavior, this is another important reason why in vitro testing of bioresorbable LC circuits should not be performed in di-H 2 O. Photographs illustrating the differences in sensor degradation are presented in Figure S3. Although planar inductor coils are often used for flat resonance sensor architectures, orthopedic screws facilitate the implementation of solenoidal coil-based resonators. A similar idea has been demonstrated with nondegradable materials by embedding an LC circuit-based temperature sensor inside an interference screw for early detection of infections. 8 In our study, a resonance compression sensor constructed by using parylene-insulated Mo wire (diameter 200 m) is presented in Figure 4e. A reference sensor was fabricated by using commercial insulated Cu wire (diameter 180 m). The capacitor in the compression sensor composed of two turns of a double-stranded wire that was coiled along the screw threads, whereas the inductor coil was formed from a single Mo wire strand. Compressing the screw brings the turns between the wirings closer in both the inductor coil and the capacitor wirings, which leads to increased capacitances in the structure, which is noticed as a decreasing resonance frequency shift. For example, an axial compressive strain of 0.7% decreased the resonance frequency from 80.9 to 80.1 MHz with a further drop to 79.6 MHz at a strain of 1.4% ( Figure 4g). This sensing capability could be applied for monitoring the dimensional changes in self-reinforced bioresorbable polymer screws, which are expected to swell and shorten 1− 2% after implantation, thereby allowing improved compression at the bone fracture line. 59 Figure 4. (a) Pressure responses of the bioresorbable Mg pressure sensors, as measured through a glass bottle from a reading distance of 6 mm. A photograph of the sensor is shown in the inset. (b) Graphs of the impedance spectrum measured by increasing the reading distance of the Mg sensor, including rescaled graphs of the largest reading distances (on the right). The testing was performed by stacking 1 mm thick microscopy slides one by one between the sensor and the reader coil to stepwise increase the reading distance. (c, d) Corresponding Zn pressure sensor data. (e) Structure of the Mo wire compression sensor with a solenoidal coil. (f) Impedance spectrum graphs of the Mo compression resonance sensor with an increasing reading distance, including a reference measurement using a similar sensor made from Cu wire. In our measurement setup, the tip of the polymer screw adds another 5 mm to the indicated distance between the sensor coil and the reading coil. (g) Impedance phase graphs at various axial compressive strains, showing a decrease in the resonance frequency as estimated from the minimum value of the phase. The resonance peak of the Mo-based device was noticed to be comparable to the Cu reference sensor (Figure 4f). The Mo-based LC resonator was effortlessly readable with 10 mm of glass between the reader coil and the resonator. In this measurement setup, the tip of the screw (Figure 4e) increased the actual reading distance by 5 mm. The inductance and capacitance of the resonator can be increased by adding more windings to the coil or the capacitor, respectively. Based on a preliminary immersion test using Sorensen buffer solution (37°C ), uncoated Mo wires retained their electrical conductivity for ∼4 weeks, after which the resistance started to increase ( Figure S4). The first wire broke after 14 weeks of immersion. A previous immersion testing of Mo wire (10 m) in bovine serum has shown only a minor resistance increase during the 16 day test period. 51 These findings demonstrate the potential of Mo in applications where a slow conductor degradation is preferred. ACS Applied Materials & Interfaces 2.5. Encapsulation Layers. Achieving clinically relevant stable operation times of multiple days or weeks remains a challenge with implantable bioresorbable sensors. The dissolution or fracture of the conductors are among the main reasons for an untimely device failure along with disintegration of the device structure. 14,49,60 Water penetration into the device is a common denominator for all of these breakdown mechanisms, for why separate water barrier layers have been studied to improve the stability of bioresorbable sensors. 61,62 There is a great demand for encapsulation layers that could be applied onto bioresorbable polymer substrates because the deposition of inorganic coatings often requires elevated temperatures. In this section, the pros and cons of lowtemperature atomic layer deposited (ALD) TiO 2 films on polymeric substrates are discussed. In addition, other options for increasing the functional lifetime of bioresorbable sensors are recapitulated. Typical water barrier layers involve inorganic ceramic coatings like SiO 2, MgO, and Si 3 N 4 that are used in conventional electronics as well. Such coatings can be deposited for example by evaporation, sputtering, thermal oxidation, plasma-enhanced chemical vapor deposition (PECVD), or atomic layer deposition (ALD) methods. 61,62 Kang et al. have studied different encapsulation layers and their combinations on silicon wafers, suggesting that some pinholes and other defects may be expected with PECVD deposited films despite their conformal nature, whereas ALD provides a means for reducing the amount of defects. 61 Conventional PECVD processes are usually operated at temperatures around 250−350°C, even though room temperature processes have been also developed. 61,63,64 Many ALD processes can be performed at lower temperatures, facilitating the use of polymeric substrates that typically require temperatures below 100°C. 65,66 However, there are only few studies where ALD coatings have been performed on biodegradable polymer substrates. 67,68 In this study, the protective effect of ALD TiO 2 on a Mg layer (7.5 m) evaporated onto bioresorbable PLDLA 96/4 substrates was studied. TiO 2 was chosen as the coating material due to its excellent water corrosion resistance properties. 69 The samples with different amounts (0, 150, 250, and 500) of ALD process cycles and thus different TiO 2 thicknesses (0, 15, 25, and 50 nm, respectively) were immersed in Sorensen buffer. The coatings were peeled off from the ends of the substrate ( Figure S5) by using tape to enable water diffusion into the polymer, while keeping the coating on top of the Mg patterns intact. This simulated a realistic scenario, where the surgical insertion of an ALD coated implant would be difficult to perform without damaging the coating. The noncoated Mg pattern disintegrated within the first minutes and was almost fully dissolved after 6 h of immersion ( Figure 5). The ALD-coated Mg samples showed reduced dissolution rates with increasing TiO 2 thicknesses, where the thickest coating (∼50 nm) resulted in an intact Mg pattern after 2 days of immersion. However, a black Mg surface layer possibly consisting of Mg(OH) 2 was noticed earlier as a sign of corrosion, as described in Mg corrosion studies performed in atmospheric conditions. 20 The corrosion could have been caused by the equilibrium water uptake into the PLDLA 96/4 substrates. Based on previous studies, using composite coatings formed from two or more different coating materials might provide improved water barrier properties. 61,69 Nonetheless, more studies are needed using bioresorbable substrates, as they significantly contribute to the functionality of the protective layer. For example, any dimensional changes in the substrates may potentially crack the coatings, as shown with an LC resonator formed using ALD-coated polymer substrates ( Figure S6). Hence, in this kind of fully immersed and highly delicate sensor applications, ALD coatings might be more compatible with rigid substrates such as bioactive glasses. Inorganic coatings on rigid nondegradable wafers have been previously discussed in the literature. 61,62,70 To avoid the challenges related to mechanical fragility of inorganic coatings, natural waxes have been described as a potential biodegradable encapsulation material option. 51,71 The most promising reported candidate was candelilla wax that showed hardly any water uptake during the first 2 weeks of immersion. A 300 m thick wax layer helped Mg patterns retain their conductivity for more than 7 days in phosphate buffer solution (PBS). 71 Further advances have been recently reported by blending different waxes. The combination of transfer printed monocrystalline silicon layers together with edge-sealing wax barriers enabled accurate ICP measurements in rats for up to 3 weeks using a wired bioresorbable sensor. 72 Furthermore, recent advances in gas-phase polymerization of hydrolytically degradable polymers could in the future provide bioresorbable conformal coatings similar to nondegradable parylene, which has already been utilized in passivation coatings of implanted devices. 73 A common scheme for protecting bioresorbable circuitry is to use sensor substrates as encapsulation layers. Most of the reported bioresorbable polymers are bulk-degrading, which means that water diffuses into the polymer matrix at a faster speed than the polymer erodes. 74 For example, the equilibrium water uptake of immersed polyesters is around 1 wt %. 36 Even such a small amount of water leads to corrosion of the metal conductors over time and may affect the dimensional properties of the polymer. One interesting possibility to circumvent this problem is to use surface-eroding polymers like poly(ortho esters) or polyanhydrides, where water diffusion into the polymer matrix is slower than the erosion rate of the material. 74 As an example, polyanhydride coating (120 m) has been shown to enable a stable operation of 3 days for a silicon semiconductor-based pressure sensor. 10 Nevertheless, the effects of surface-eroding substrates on wireless LC circuitbased sensors remains to be tested. EXPERIMENTAL SECTION 3.1. Device Fabrication. The Mg and Zn pressure sensors whose structure was illustrated in Figure 1a were fabricated by extruding PDTEC powder (Integra LifeSciences, Princeton, NJ) and compression-molding pieces of the extruded rod into plates (430 m). PDTEC spacers (50−70 m) were compression-molded and laser-cut as described earlier. 18 Compression-molded PCL layers (15−20 m) were melted onto both sides of the spacer, and excessive PCL was removed from the laser-cut holes. E-beam-evaporated Mg (7.5 m) or magnetron-sputtered Zn (4 m) conductors were deposited onto the PDTEC substrates through laser-cut steel masks, after which the substrates were attached onto the spacer by heating the structure to 80°C and using the molten PCL layers as an adhesive. The sides of the sensors were finally heat sealed (Hawo HPL ISZ, Obrigheim, Germany) and trimmed with scissors to yield sensors sized approximately 1 mm by 25 mm by 35 mm. A simplified electrical model of a resonator based on a similar pattern has been reported earlier. 75 The wireless compression sensors (Figure 4e) based on parylenecoated Mo wire (200 m) conductors were fabricated by extruding PLDLA 96/4 into a rod ( = 10 mm), threading the rod, and cutting it into billets. The Mo wire was coated with nondegradable parylene C (10 m; Galentis S.r.l., Italy) to prevent short circuit. Two holes were drilled through each billet to provide electrical vias for the construct and to aid in fixing the wire to the threaded billet. A solenoidal coil was formed by winding Mo wire around the billet (5.5 turns). The capacitor was formed by coiling double-stranded wire along the threads (2 turns). The loose double-stranded wire ending was attached to the billet by using molten PCL as an adhesive. Reference resonators were fabricated in a similar manner using commercial enamel insulated Cu wire (180 m). The bioactive glass resonance sensors ( Figure 2b) were made from silicate S53P4 glass that was prepared by a conventional glass melting method in platinum crucible. The nominal oxide composition of S53P4 is 53 wt % SiO 2, 23 wt % Na 2 O, 20 wt % CaO, and 4 wt % P 2 O 5. 76 In this study, proportional amounts of SiO 2, CaCO 3, Na 2 CO 3, and CaHPO 4 2H 2 O raw materials were used. The mixture was melted at 1450°C, cast and quenched in a prewarmed (350°C) graphite mold, and annealed at 520°C for 5 h. The resulting S53P4 bioactive glass rods ( = 14 mm) were sliced into discs (h = 2 mm) which were polished. E-beam-evaporated Mg (7.5 m) formed the first conductor layer, after which PDTEC solution (12%) in cyclohexanone (VWR Chemicals, Fontenay-sous-Bois, France) was spin-coated onto the discs. 3D-printed masks were used to define the Mg patterns. Another Mg layer (7.5 m) was evaporated onto the dielectric PDTEC layer to complete the resonator. The resonators were finally parylene coated (13 m) to enable studying the resonator behavior in aqueous conditions without constraints related to Mg corrosion. 3.2. Physical Vapor Deposition. E-beam evaporation of Mg granules (99.99%; G-materials, Germany) was performed at less than 7 10 −6 Torr with substrate rotation. The source-to-substrate distance was 31 cm. The Zn films were deposited from a Zn target (99.99% Zn; Kurt J. Lesker Company, Hastings, UK) by using direct current (DC) magnetron sputtering. The vacuum level was 5 10 −6 Torr with a working Ar gas pressure of 10 mTorr. The sputtering current and voltage were 1 A and 560 V, respectively. The sputtering target-to-substrate distance was 10.5 cm. No substrate rotation was used. 3.3. Thin Film Characterization. The cross-sectional structure of the Mg (7.5 m) and Zn (4 m) films on bioresorbable PDTEC substrates was analyzed with a scanning electron microscope (SEM) combined with focused ion beam milling (FIB-SEM; Zeiss Cross-Beam 540) from a working distance of 5.2 mm with an electron high tension (EHT) of 3.0 kV. A platinum cover was applied onto the target films before gallium ion milling. The surface of the metal films was imaged with a high-resolution field emission SEM (FESEM; Zeiss UltraPlus) from a working distance of 5.0 ± 0.2 mm and with an EHT of 1.5 kV. The surface topography of the metal films was further characterized by using a noncontact atomic force microscope (AFM; XE-100, Park Systems Inc., USA) equipped with silicon probes (ACTa, Applied NanoStructures Inc., USA). The imaged area with the AFM was 5 5 m 2. The height and the cross-sectional profile of the Mg and Zn films (1.7 m) on glass slides (Figure 3b) was measured by using a mechanical profiler (Dektak XT Stylus, Bruker Corporation). The electrical resistance (/cm) of these films was calculated by dividing the measured resistance of the deposited 4-wire patterns (n = 6) by the distance between the inner lines of the pattern (Figure 3c). Mean bulk resistivity of the 1.7 m thick films was approximated by multiplying the mean electrical resistance values with the estimated conductor cross-sectional area. Based on the profilometer data, the width of the Mg conductor films was estimated at 1 mm, and the cross-sectional area of the Zn films was considered similar to that of the Mg films. Finally, the samples were immersed in 25 mL of cell culture medium (MEM; Sigma-Aldrich supplemented with 10% fetal bovine serum and 1% antibiotics) at +37°C with a 5% CO 2 supply and photographed at predetermined time points for corrosion behavior comparison (Figure 3d). In addition, thicker Mg samples (7.5 m) were immersed in similar cell culture conditions as well as in 25 mL of di-H 2 O and Sorensen buffer (+37°C) to compare different corrosive environments ( Figure S2). 3.4. Wireless Measurements. The reading distance of all LC circuit-based sensors was investigated by using the same measurement setup, which included a double-turn square reader coil (diameter about 20 mm) on a printed circuit board (PCB). 45 The reading distance was stepwise increased by adding 1 mm glass slides between the reader coil and the sensor. After each 1 mm increment, the real part of the impedance of the reader coil was measured with an impedance analyzer (Agilent 4396B). Furthermore, the miniaturized bioactive glass-based sensor was measured 100 times at each discrete distance to obtain the mean and standard deviation of the resonance frequency, similarly to our previous Mg pressure sensor. 18 The other wireless measurements were performed by using setups that were constructed on occasion depending on the type of measurement. The reader coils were chosen to increase the coupling coefficients between the sensors and the reader coils. The Mg and Zn pressure sensors were measured using a similar setup as described earlier, where a single-turn copper reader coil ( = 33 mm) was located inside an oven and connected to the impedance analyzer with a cable. 18 The sensors were taped onto the bottom of a glass bottle, which was pressurized from 0 to 200 mmHg applied pressure in increments of 20 mmHg by using a manual pressure regulator connected to a pressure calibrator. The reading distance through the glass bottle was ∼6 mm. The immersion tests were performed by pouring 100 mL of buffer solution into the bottle and measuring the resonance frequency every 15 min. In addition, the pressure response of the sensor was measured during immersion at predetermined time points. The wireless compression sensor built onto a PLDLA 96/4 screw was axially compressed in a vise by using an electrically insulating Teflon block between the reader coil and the metallic vise jaw. As opposed to other measurements that were performed with an impedance analyzer, the resonance frequency of the compression sensor was determined by using an in-house built portable reader device. 77 The reader coil was a single turn aluminum coil with a diameter of 30 mm on a poly(ethylene terephthalate) (PET) sheet. The measurements were performed by using the phase-dip method, where the resonance frequency was the estimated minimum value in the phase of impedance. 77 The compression was measured by using a digital caliper. The parylene-coated bioactive glass resonance sensors were measured through a 1 mm thick Petri dish by using the double-turn rectangular reader coil. The resonators were first immersed in di-H 2 O and measured, after which 9% NaCl solution was stepwise added until the solution reached a NaCl concentration of 4.5%. After each addition of the NaCl solution, the mixture was gently suspended using a pipet to ensure that the solution was homogeneous. The response of the sensor was recorded after each NaCl addition step. To test the effect of the immersion media onto the sensor, 200 measurement samples were recorded in air and under immersion in di-H 2 O, Sorensen phosphate buffer, DMEM with high glucose (Sigma-Aldrich, United Kingdom), and 96% ethanol (VWR Chemicals). The sensor was rinsed with di-H 2 O and tapped dry with tissue paper between each solution. 3.5. Water Uptake Testing of Polymers. The water uptake properties of PDTEC were evaluated by using samples (n = 5) with a size of 50 10 0.4 mm 3. The samples were dried in a vacuum, weighed, and then immersed in Sorensen buffer solution at 37°C. At predetermined time points, the samples were gently wiped with tissue paper and weighed. The wet weights were compared to the initial dry weight. After 100 days of immersion, the hydrolysis was terminated by rinsing the samples with di-H 2 O, drying them thoroughly in a vacuum, and weighing to ensure that no mass loss had occurred. 3.6. Mechanical Testing. Flexural characteristics of PDTEC were determined by testing the stress−strain and the stress relaxation behavior of the material with an Instron Electropuls E1000 testing machine (High Wycombe, UK) equipped with a 50 N load cell. The span length of the three-point bending setup was 30 mm, and the sample size was 50 10 0.9 mm 3. The stress−strain behavior of samples (n = 3) was obtained by bending the samples with a 5 mm/ min crosshead speed until 5% flexure strain was reached. The tests were performed in ambient laboratory conditions as well as in aqueous conditions (Figure 1f) after different immersion times. Young's moduli were calculated from the linear portion of the acquired stress−strain curves. The stress relaxation behavior of the PDTEC samples (n = 3) was tested under immersion (Sorensen buffer, +37°C) by bending the sample rapidly to 2 mm displacement and holding it for 3 h. The stress needed to hold the displacement was recorded with respect to time. 3.7. ALD Coating. The 7.5 m thick Mg patterns were e-beam evaporated onto compression-molded PLDLA 96/4 substrates (0.4 mm 30 mm 40 mm). Thereafter, ALD TiO 2 coatings were deposited onto the metallized substrates at 60°C by using a Beneq TFS 200 ALD reactor. ALD TiO 2 films were grown from titanium tetrachloride (TiCl 4 ) (Sigma-Aldrich) and water, both vaporized from the source at 20°C. One deposition cycle for TiO 2 consisted of a 0.5 s TiCl 4 pulse, a 20 s N 2 purge, a 0.5 s water pulse, and a 20 s N 2 purge. The ALD TiO 2 film thickness was varied by alternating the number of ALD cycles. The amount of cycles was 150, 250, and 500. Each ALD cycle corresponded to about 1. The film thicknesses were measured from silicon witness pieces by using spectroscopic ellipsometry (J.A. Woollam Co., Inc., model M-2000FI). CONCLUSIONS AND FUTURE CONSIDERATIONS This study summarizes the prospects and caveats in the assembly, testing, and performance of wireless inductor− capacitor (LC) resonance sensors fabricated by using bioresorbable materials, as well as outlines several potential orthopedic applications for such devices. The reported Mgbased pressure sensors were wirelessly readable and pressure responsive for 10 days in aqueous conditions, but water diffusion into the bulk-degrading polymer substrates resulted in sensitivity and baseline resonance frequency drifting. Using surface-eroding materials or separate encapsulation layers to hinder water diffusion into the substrates should thereby be considered to enable stable operation during the functional lifetime of the sensor. In our opinion, bioactive glasses possess tremendous undiscovered potential in bioresorbable sensors, including possible improvements in their stability. Moreover, these glasses tolerate conventional microfabrication techniques better than most biodegradable polymers, which provides prospective opportunities for device fabrication and assembly. The reported resonance sensors operate at distances that are sufficient for applications close beneath the skin. Longer reading distances could be achieved for instance by using thicker conductors or developing bioresorbable materials with improved electrical conductivities. However, depending on the material, thick films may be difficult to produce by physical vapor deposition (PVD), and the obtained thin film conductivities are often lower than those of the bulk materials. Thus, PVD might not be the ideal conductor fabrication method for maximizing the reading distances. Although Mg is the most studied biodegradable metal with the highest conductivity in this material group, Zn and Mo provide slower corroding options whose potential should be more thoroughly investigated. ■ ASSOCIATED CONTENT * s Supporting Information The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsami.0c07278. Cell culture results, discussion and experimental methods; skin depths of common bioresorbable materials; corrosion testing of magnesium films (7.5 m); in vitro degradation of wireless Mg and Zn pressure sensors; molybdenum wire (200 m) immersion test; illustration of the peeled-off area of the ALD coatings; ALD-coated substrates in an LC resonator (PDF)

James Murdoch Testifies At Media Ethics Inquiry News Corp. chairman Rupert Murdoch and his son James are to appear this week before a panel investigating the practices, culture and ethics of British press. The Murdochs are expected to be asked about the extent of their knowledge of phone hacking by their newspapers. News Corp. chairman Rupert Murdoch and his son James are to appear this week before a panel investigating the practices, culture and ethics of British press. The Murdochs are expected to be asked about the extent of their knowledge of phone hacking by their newspapers. The scandal that's engulfed Rupert Murdoch's News Corp is taking center stage in London, at the Royal Courts of Justice, once again. Here, his son James Murdoch. JAMES MURDOCH: I swear by the mighty God that the evidence I shall give shall be the truth, the whole truth and nothing but the truth. MONTAGNE: The younger Murdoch is answering questions about the phone hacking scandal that involves a tabloid newspaper owned by News Corp, the company that his father controls. James Murdoch recently gave up his leadership post overseeing News Corp's British newspapers and his position as chairman of the British satellite broadcasting giant BSkyB. One question is whether News Corp used its relations with British politicians to advance a big corporate acquisition involving BSkyB. NPR's Phil Reeves joins us from London. Good morning. MONTAGNE: So, bring us up to date with the inquiries and what has been, you know, doing up to now? REEVES: Well, the hearing was hardly a few minutes old before James Murdoch was fielding some very meticulous, very persistent questions about phone hacking at the News of the World. He said that when he took over - when he took control of the company that runs his father's British newspapers, he'd been assured that the hacking was confined to one rogue reporter and a private investigator called Glenn Mulcaire. At issue, though, is whether Murdoch - James Murdoch - in fact, knew much more than that, whether he new that hacking was endemic at the paper and covered this up. He was repeatedly asked about an email, dating back to 2008, that showed that hacking was going on on a far wider scale. He repeatedly denied seeing that email until much later. And then Robert Jay, counsel to the inquiry, finely summarized the core issue. ROBERT JAY: Do you accept, at least, this: There are two possibilities here. (Unintelligible) to decide in due course, either you were told about the evidence which linked others at News Of The World to Mulcaire, and this was, in effect, a cover up; or you - you weren't told or you didn't read your emails properly and there was a failure of governance within the company. Do you accept that those are the only two possibilities? MONTAGNE: So break that down a little bit, for us, Phil. The core issue - this is a key issue - what has that relate to the core issues in this inquiry? REEVES: Well, the core issues are now becoming James Murdoch's relationship with British politicians, and one politician in particular: Jeremy Hunt, the British Culture Secretary. Hunt was basically the minister who was responsible, awhile back, for deciding whether Murdoch's News Corp would be allowed total control of the very lucrative British satellite broadcasting company, BSkyB, in which it currently has a minority controlling stake. This is a big deal for the Murdochs. Jay - the man we just heard from, the counsel to the inquiry - has been reading, in the last hour or two, a lot of emails that pass between Jeremy Hunt's office to James Murdoch's public affairs advisor, a guy called Fred Michel. One of these includes a statement in which Michel tells Murdoch that J.H. - presumably, Jeremy Hunt - believes we're in a good place tonight. And in another one, there's an email in which he confides that he's passing confidential information, illegally, although James Murdoch said that was a joke. This is a big issue here and the betting shops are already taking bets. In fact, they've stopped taking bets, and so, many of them, as to whether Jeremy Hunt will soon be leaving government. MONTAGNE: And just briefly, what did James Murdoch look like today, in court? Well, he, you know, he's got increasingly confident. He was rather tense when he began, and at times, somewhat ill tempered. But he's become more confident and he's been arguing very strongly. Phil, thanks very much. NPR's Phil Reeves, speaking from London. This is NPR News.

Nicholville residents and sisters-in-law Karen and Renee Stauffer recently returned from a 10-day trip to Ethiopia last month to meet the children they sponsor and see the program Partners With Ethiopia (PWE). 'I am so grateful to have the opportunity to travel to Ethiopia and meet the people we care about,' said Karen Stauffer. 'It was incredible to see that 100 percent of the funds raised in the US go directly to the indigenous NGO and are being used wisely in addressing the local needs.' From left, Renee Stauffer, Karen Stauffer and Aletamo, who is sponsored by local Potsdam residents Chad and Anna Greer.

Resveratrol Alleviates Dextran Sulfate Sodium-Induced Acute Ulcerative Colitis in Mice by Mediating PI3K/Akt/VEGFA Pathway Ulcerative colitis (UC) is a chronic inflammatory disease that affects the colon, and its incidence is on the rise worldwide. Resveratrol (RSV), a polyphenolic compound, was recently indicated to exert anti-inflammatory effects on UC. Consequently, the current study was conducted to investigate the mechanism of RSV on alleviating UC in mice by mediating intestinal microflora homeostasis. First, potential targets that RSV may regulate UC were screened using the TCMSP database. Next, mice were treated differently, specifically subjected to sham-operation and dextran sulfate sodium (DSS) induction, and then treated or untreated with RSV. Disease Activity Index (DAI) and Hematoxylin-Eosin (HE) staining were employed to analyze the pathological changes of mice colon. In addition, the expression patterns of inflammatory factors in spleen tissues were detected using ELISA, while the protein expression patterns of phosphoinositide 3-kinase (PI3K), protein kinase B (Akt), and vascular endothelial growth factor A (VEGFA) in colon tissues were determined by means of immunohistochemistry (IHC) and Western blot analysis. Moreover, changes in intestinal flora and metabolite diversity in UC were analyzed by metabonomics. It was found that RSV played inhibitory roles in the PI3K/Akt pathway in mice. Meanwhile, the administration of RSV induced downregulated the expressions of TNF-, IFN-, IL-1, IL-6, and IL-4. The six floras of Haemophilus and Veillonella were significantly enriched in UC, while Clostridium, Roseburia, Akkermansia, and Parabacteroides were found to be enriched in control samples. Lastly, it was noted that Akkermansia could regulate the intestinal flora structure of UC mice through triacylglycerol biosynthesis, glycerol phosphate shuttle, cardiolipin biosynthesis, and other metabolic pathways to improve UC in mice. Altogether, our findings indicate that RSV suppressed the activation of the PI3K/Akt pathway and reduced the VEGFA gene expression to alleviate UC in mice. INTRODUCTION Ulcerative colitis (UC) is one of the most common forms of inflammatory bowel disease, characterized by damage to colonic epithelial cells (). The pathogenesis of UC is attributed to various factors, ranging from hereditary susceptibility to epithelial barrier defects, dysimmune response, and environmental factors (). Clinically, UC is mostly diagnosed in late adolescence or early adulthood, but the disease can manifest at any age, with typical symptoms including bloody diarrhea (da ). Currently, total proctocolectomy and ileal pouch-anal anastomosis are regarded as the gold standard for surgical treatment of refractory UC (). Although there are numerous drug treatment options available for UC, its nonresponsive behavior to systemic steroid therapy remains a huge challenge in the field of inflammatory bowel disease (). Rhizoma smilacis glabrae (RSG), a widely used traditional Chinese medicine, is known for its ability to deoxidize, dehumidify, and relieve joint movement, while its chemical composition is known to include resveratrol (RSV) (). RSV is a polyphenolic compound found in grapes, red wine, chocolate, and some berries and roots, which possesses antioxidant, anti-inflammatory, and anticancer properties (). Moreover, RSV has been shown to be efficacious against UC; for example, supplementation with RSV improves disease activity and quality of life in patients with UC, at least in part, by reducing oxidative stress (). Besides, RSV can directly regulate the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, such that RSV reduced intestinal inflammation after irradiation by regulating the PI3K/Akt pathway (Radwan and Karam, 2020). Meanwhile, the PI3K/Akt pathway is an intracellular pathway, which plays an indispensable role in the control of the cell cycle (). Furthermore, the PI3K/Akt pathway is implicated in the regulation and release of proinflammatory cytokines, which in turn participates in the development of UC, while PI3K/Akt expressions are augmented in mice with UC (). On the other hand, vascular endothelial growth factor A (VEGFA) has previously been identified as a central target gene of RSV and has been known to exhibit better affinity with RSV (Wang W. et al., 2020). In addition, VEGFA can influence physiology and tumor-induced angiogenesis, whereas elevated VEGFA gene expressions are associated with tumor progression, recurrence, and survival (). More strikingly, UC patients are known to exhibit higher levels of VEGFA than normal controls (). Consequently, the current study aimed to verify how RSV regulates the PI3K/Akt/VEGFA pathway to relieve UC. Ethics Statement All experimental procedures are proceeded in accordance with the instructions of the Experimental Animal Care and Use Ethics Committee of The First People's Hospital of Yongkang Affiliated to Hangzhou Medical College and Wenzhou Medical University. Extensive measures were undertaken to minimize the suffering of the experimental animals. Network Pharmacological Analysis Firstly, the compound components of RSG were retrieved through the TCMSP database (http://tcmspw.com/tcmsp.php), and condition screening was performed and set as oral bioavailability (OB) > 10% and drug-likeness (DL) > 0.1, which reared a total of 34 compound components. Next, the multitargets corresponding to the compounds in RSG were searched using the TCMSP database. Meanwhile, genes related to UC were identified through the GeneCards database (https:// www.genecards.org/), and Jvenn (http://jvenn.toulouse.inra.fr/ app/example.html) was utilized to search for the overlap of compound targets and UC targets. To further conduct enrichment analysis on the overlap between drug targets and disease targets, WEB-based GEne SeT AnaLysis Toolkit (http:// www.webgestalt.org/) was adopted to find targets (the species condition was restricted to "Mus musculus" and the database was selected to be "KEGG"). In addition, to find the core targets involved in the pathway, the STRING website (https://string-db. org/) was employed to analyze the gene association interaction (minimum required interaction score 0.4), and the Cytoscape 3. 5.1 software was used to visualize the association interaction network relations. Finally, the Cytoscape 3.5.1 software was employed to construct the drug-compound-target direct relationship network. The flowchart of the current study is shown in Supplementary Figure 1. Study Subjects Resveratrol (RSV, Cat. NEL-1291) was procured from NeoCell (Irvine, California, United States). Meanwhile, a total of 80 male BALB/c mice (aged 6-8 weeks; calculated mean weight of 18.49-23.72 g) were purchased from the Animal Experimental Center of Guangzhou University of Chinese Medicine, Guangzhou, China. The experiment was commenced after one week of adaptive feeding. The mice were randomly divided into the following four groups (n 20): the normal control group (NG group), the model control group (MG group), the RSG group (RG group), and the positive control group (PG group). Mice in the MG group were treated with free drinking of 5% dextran sulfate sodium (DSS, MW: 5,000) for 7 days, and then this changed to free access to distilled water for 7 days. Meanwhile, the mice in the NG and MG groups received the same amounts of distilled water. On the other hand, mice in the RSG group were treated with RSV at a dosage of 100 mg/kg.d. Sulfasalazine (SASP; Jiuzhou Pharma, Zhejiang, China; CAS No: 599-79-1), as a positive control drug, was administered to mice in the PG group at a dosage of 200 mg/kg.d. RSV and SASP treatments were performed every day from day 1 to day 7. At the beginning of modeling, mice were given gavage every day at the same time and continued to intervene until the end of the experiment. During the experiment, the body weight, fecal consistency, and blood in the stool of the mice were all monitored every day, and "DAI (Disease Activity Index, Table 1) score" was used to describe and indicate the "severity of UC." After the experiment, the animals were euthanatized and Frontiers in Pharmacology | www.frontiersin.org August 2021 | Volume 12 | Article 693982 samples were collected for subsequent analyses. Fresh fecal samples were also collected using metabolic cages and immediately stored at −80°C for later use. The colon contents were stored at −80°C for intestinal microflora analyses. Hematoxylin-Eosin Staining The distal section of the colon was excised, and the rest was fixed in 4% paraformaldehyde and embedded in paraffin. Next, 5 m thick sections were stained with Hematoxylin-Eosin (HE) and observed under a BH22 optical microscope (Olympus, Tokyo, Japan) at 100x magnification. The tissue sections were observed under an optical microscope and scored according to the 5-score grading system reported by Xiong et al. as follows : a score of 0 indicated no inflammation; a score of 1 indicated low leukocyte infiltration and no structural changes; a score of 2 indicated moderate leukocyte infiltration, dilation, and malformation, with no ulcers in the mucosal gland duct; a score of 3 indicated severe leukocyte infiltration, accompanied by increased blood vessel density and thickening of the intestinal wall; a score of 4 indicated a large amount of white blood cell infiltration, high blood vessel density, enlarged and deformed glands, obvious loss of goblet cells, thickened intestinal wall, and complicated ulcers. Enzyme-Linked Immunosorbent Assay Colonic tissues were homogenized in phosphate-buffered saline (PBS) buffer (pH 7.4) and centrifuged at 14,000 g at 4°C for 15 min. The supernatant was then collected and subjected to BCA quantification. Based on the quantitative results, the same amount of protein was selected from each experimental group selected and the levels of cytokines (TNF-, IFN-, IL-1, IL-4, IL-6, and IL-10; pg/ml/mg) were quantified using ELISA kits (Pierce Biotechnology, Rockford, IL) according to the manufacturer's protocol. Immunohistochemistry After the experiment, the colon tissues of mice were collected, and the paraffin-embedded mouse colon tissues (thickness of 4 m) were fixed with formalin. Following deparaffinization and hydration, the sections were treated with 3% hydrogen peroxide to block endogenous peroxidase activity, and antigenic repair was achieved by boiling the sections in citrate buffer for 30 min. Next, the sections were sealed with 5% bovine serum albumin (BSA) and incubated overnight at 4°C with primary antibodies PCNA (AB29, dilution ratio of 1: 10,000, Abcam, Cambridge, United Kingdom), VEGFA (AB133352, In Vitro Culture The frozen-thawed colon tissues were broken into fragments measuring around 4 2 1 mm 3. Next, one to three segments from each biopsy were selected as day 0 (D0) controls and fixed for histological evaluation. The remaining fragments were treated with DSS, DMSO, 740Y-P (activator of PI3K/Akt), or RSV. The fragments were then individually placed into four-well cell culture plates (Thermo Fisher, Waltham, MA) containing 300 L medium (McCoy's 5a medium) with bicarbonate added with 25 mM HEPEs (Gibco Life Technologies Corp., Grand Island, NY), 0.1% HSA, 3 mM glutamine, 30 g/ml penicillin, 50 g/ml streptomycin, 2.5 g/ml transferrin (Thermo Fisher), 4 ng/ml selenium (Sigma-Aldrich, St Louis, MO, United States), and 50 g/ml ascorbic acid (Sigma-Aldrich). Later, 150 g/ml 740Y-P (Bio-Techne, Cambridge, United Kingdom) and 1% of DMSO (Sigma-Aldrich) were added for the first 48 and 24 h, respectively, at 37°C, in humidified air with 5% CO 2. On day 1, the medium was renewed with fresh medium supplemented with 10 ng/ml insulin (Sigma-Aldrich) and 1 ng/ml HFSH (Gonal F, Merck Serono, United Kingdom), and the tissues were cultured for 5 days, with half of the medium being renewed every other day. After 0, 1, 3, and 6 days of culture, a total of 56 cortical strips were fixed in 4% paraformaldehyde for 24 h for histological and immunohistological analysis. Overall, 21 fragments cultured for 0, 1, or 6 days were used for Western blot analysis, and colon tissues isolated from 35 fragments were used for gene expression analysis with real-time quantitative polymerase chain reaction (RT-qPCR). RT-qPCR Colon tissues from different groups were collected and lyzed using TRIzol kits (Thermo Fisher, 10296010) to extract the total RNA content from the tissue samples. The complementary (cDNA) Synthesis kits (HiScript First Strand cDNA Synthesis Kit, Vazyme Biotech, China, R111-01) were then used to synthesize cDNA with a 20 l system. The reaction conditions were as follows: 37°C, 15 min; 85°C, 5 s. -Actin was used as the internal reference to analyze mRNA expression. The 2 −CT method was applied to the measurement of the target gene relative expression levels (Supplementary Table 1). Western Blot Analysis Colon and spleen tissues of mice were collected, and the protein content was extracted using radioimmunoprecipitation assay (RIPA) lysate. The concentration of the obtained protein was determined with bicinchoninic acid kits (BCA). A total of 50 g of protein samples was then isolated with sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE). The isolated proteins were transferred onto a polyvinylidene fluoride membrane and sealed with 5% skimmed milk at room temperature for 2 h. Next, the tissues were incubated with the primary antibody overnight at 4°C. The main incubation antibodies included anti-VEGFA (ab52917, dilution ratio of 1 : 10,000, Abcam), anti-Akt (ab38449, dilution ratio of 1 : 1,000, Abcam), anti-PI3K (ab140307, dilution ratio of 1 : 2000, Abcam), and anti--actin (ab179467, dilution ratio of 1 : 5,000, Abcam). Afterward, the cultivated tissues were further incubated with goat anti-rabbit immunoglobulin G (IgG) for 1 h at room temperature. The membrane was then incubated with ECL working solution (EMD Millipore, Bedford, Massachusetts, United States) for 1 min at room temperature. The excess ECL reagent was removed, the membrane was sealed, and an X-ray film was placed in the carton for 5-10 min of exposure, followed by development and fixing. The grayscale of each band in Western blot images was quantified using the ImageJ analysis software. -Actin was used as the internal reference. The experiment was repeated three times to obtain the mean value. Metabolomics Analysis The intestinal flora database GMrepo (https://gmrepo.humangut. info/), gutMEGA (http://gutmega.omicsbio.info/, condition: ulcerative colitis/normal, p value < 0.05), and gutMDisorder (http://bio-annotation.cn/gutMDisorder) were retrieved to uncover the gut bacteria related to UC, with Jvenn being used to obtain the intersection. The relevant samples of UC were searched through the Metabolomics Workbench database (https://www. metabolomicsworkbench.org/), downloading the data matrix (Alterations in Lipid, Amino Acid, and Energy Metabolism Distinguish Crohn Disease from Ulcerative Colitis and Control Subjects by Serum Metabolomic Profiling Reversed phase POSITIVE ION MODE). The sample was comprised of 20 control and 20 UC samples. The R language "limma" package (http://www.bioconductor.org/packages/release/bioc/html/ limma.html) was used to perform differential analysis of the metabolite expression profiles, with |logFC|>0.6 and p < 0.05 as the screening criteria for differential metabolites. The R language "pheatmap" package (https://cran.r-project.org/web/packages/ pheatmap/index.html) was applied to plot a heat map of the differential metabolite expression. The MetaboAnalyst tool (https://www.metaboanalyst.ca/) was adopted for enrichment analysis of differential metabolites. Using the VMH database (https://www.vmh.life/?tdsourcetag s_pctim_aiomsg), the microbes with differential metabolites were predicted, and Jvenn was adopted to intersect the differential microbes of UC to predict the key to UC microorganisms. The distribution and box plot of the relative abundance of key microorganisms in both healthy and UC samples were further searched using the GMrepo database. Statistical Analysis Statistical analyses were performed using the SPSS 21.0 version (IBM, Armonk, New York). Measurement data were expressed by mean ± SD. Paired t-test was adopted for comparisons of the paired data between two groups with normal distribution and homogeneity of variance, while unpaired t-test was performed for comparisons of unpaired data. One-way analysis of variance (ANOVA) or repeated measures ANOVA was conducted for multiple group comparison, followed by Tukey's post hoc test. The Kaplan-Meier method was used to calculate the survival rate, and log-rank test was used for univariate analysis. Pearson's correlation was used to analyze the correlation of the observed indexes. A value of p < 0.05 was considered statistically significant. RSV Contributes to UC Development RSG is widely used in traditional Chinese medicine to deoxidize, dehumidify, and relieve joint movement. Moreover, the chemical composition of RSG has been systematically confirmed, wherein some compounds are known to exert effects on antioxidation, anti-inflammatory, immune regulation, urinary lowering, and liver protection (). Initially, we searched the compound components in RSG using the TCMSP database, retrieved a total of 34 compound components, and then searched for the corresponding targets of compounds in Poria cocos through the TCMSP database. In addition, genes related to UC were retrieved through the GeneCards database, and Jvenn was performed to find the intersection of the 92 overlapping genes of compound targets and UC targets in RSG ( Figure 1A). KEGG enrichment analysis was further performed on the overlapping genes of drug targets and disease targets, and the pathways in which the genes were primarily involved were obtained ( Figure 1B), including various cancer pathways, apoptosis pathways, and PI3K/Akt pathways. Among them, various studies have highlighted that inhibiting the PI3K/Akt pathway can improve UC (). Furthermore, the results of enrichment analysis showed that 22 genes participated in the PI3K/Akt pathway ( Figure 1C). Aiming to elucidate the core targets participating in the PI3K/ Akt pathway, we obtained the correlation and interaction analysis network of 22 genes using the STRING website ( Figure 1D). It was found that VEGFA was at the core of the interaction network (degree 19). Moreover, the relationship network diagram of disease-compound-target was obtained through the Cytoscape software ( Figure 1E), and further analysis of VEGFA-related node revealed that three compounds (quercetin, RSV, and diosgenin) acted on the target gene VEGFA ( Figure 1F). The genes involved in PI3K/Akt pathway were further analyzed with the Cytoscape software and the genes in the PI3K/Akt pathway primarily acted on eight compounds ( Figure 1G), among which RSV regulated the most target genes, reaching 16 target genes ( Figure 1H). Altogether, these findings indicated that RSV may regulate VEGFA through the PI3K/Akt pathway, thus affecting UC. RSV Attenuates DSS-Induced UC in Mice To further investigate the specific effects of RSV on UC, we used DSS to establish mouse models of UC. The schematic diagram of the experimental process is shown in Figure 2A. In comparison with NG mice, the colon length of mice in the MG group was observed to be markedly shorter (p < 0.01). Meanwhile, the Frontiers in Pharmacology | www.frontiersin.org August 2021 | Volume 12 | Article 693982 administration of RSV and SASP induced an evident increase in colon length (p < 0.05) ( Figure 2B). The change in body weight curve illustrated that the body weight of mice in the NG group increased with age, while the body weight of mice in the MG, RG, and PG groups all exhibited a decrease at the same ages. Following treatment with RSV and SASP, the body weight of mice in the RG and PG groups was increased slowly and then stabilized compared with the MG group ( Figure 2C). In addition, the DAI score index showed that mice in the MG group showed early blood in the stool, and blood was apparent from the "DAI" curve, while the blood in the stool of mice of the same age was notably reduced compared with that of the RG group ( Figure 2D). Furthermore, HE staining demonstrated that the colon of mice in the MG group was severely damaged compared to those in the NG group, while no significant structural disorders were observed in the RG and PG groups ( Figure 2E). PCNA was further applied to assess the proliferation level of intestinal epithelial cells (), and PCNA of the MG group was found to be lower than that of the NG group, while the PCNA in the colon of the RG group and the PG group was higher ( Figure 2F). The effect of RSV on the expressions of inflammatory factors in the colon tissue of mice with UC was further analyzed with the help of ELISA. It was found that the levels of proinflammatory cytokines IL-6, IL-8, IL-1, and TNF- in colon of mice in the MG group were all significantly elevated (p < 0.01), while the expression levels of anti-inflammatory cytokine 1 L-10 were markedly declined in comparison with those in the NG group (p < 0.05). On the other hand, compared with the MG group, the expression levels of IL-6, IL-8, IL-1, and TNF- in the colon of the RG and PG groups were all significantly reduced (p < 0.01), whereas the expression of 1 L-10 was notably increased (p < 0.01) ( Figures 2G-K). Taken together, these findings suggested that RSV intervention can reduce the expression of inflammatory factors in mice with UC, thus attenuating the symptoms of UC. RSV Blocks PI3K/Akt Pathway to Reduce VEGFA Expression The results of network pharmacology analysis suggested that RSV may reduce the expression of VEGFA through the PI3K/Akt The expression of IL-6, IL-8, IL-1, TNF-, and IL-10 in the colon tissues of mice in different treatment groups was monitored using ELISA. n 20. Measurement data were expressed by mean ± SD. One-way ANOVA or repeated measures ANOVA was conducted for multiple group comparison, followed by Tukey's post hoc test. *p < 0.05, ** p < 0.01, and *** p < 0.001. NG, normal control group; MG, model control group; RG, resveratrol group; PG, positive control group. Frontiers in Pharmacology | www.frontiersin.org August 2021 | Volume 12 | Article 693982 pathway to exert functions on UC. To verify the aforementioned, we analyzed the expression patterns of PI3K/Akt pathway-related genes with the help of RT-qPCR. It was found that, compared with that in the NG, the VEGFA, PI3K, and Akt gene expression levels in the colon tissues of the MG were all significantly enhanced (p < 0.01). Meanwhile, compared with the MG group, the VEGFA and PI3K gene expression levels in the colon tissues of the RG were all significantly reduced (p < 0.05) ( Figure 3A). In addition, the results of Western blot analysis and IHC illustrated that mice in the MG group presented with markedly elevated VEGFA, PI3K, p-Akt, and Akt protein expressions when compared to those in the NG (p < 0.01). Opposingly, when compared to that in MG, the protein expressions of VEGFA, PI3K, and Akt in RG were decreased (p < 0.05) ( Figures 3B,C). To further define the role of RSV in the PI3K/Akt pathway by regulating VEGFA expression, we introduced a PI3K/Akt activator (740Y-P) in mice and adopted RT-qPCR, Western blot analysis, and IHC, which revealed that the protein expression levels of VEGFA, PI3K p-Akt, and Akt were all significantly reduced in the colon tissues in the RG group while being increased in the colon tissues in the MG + PI3K/Akt activator group compared with the RG group ( Figures 3D-F). The above results indicate that PI3K/Akt activator can reverse the reduction of RSV on VEGFA, PI3K, and Akt expression. Altogether, these findings indicated that RSV may be used to treat UC by inhibiting PI3K/Akt pathway to play anti-inflammatory and other active roles. Inhibition of PI3K/Akt Pathway Reduces DSS-Induced UC in Mice The results of ELISA illustrated that administration of 740Y-P induced elevated IL-6, IL-8, IL-1, and TNF- expression levels (p < 0.01) but reduced those of IL-10 (p < 0.05). These findings suggested that the activation of the PI3K/Akt pathway can promote intestinal inflammation in mice. However, the administration of RSV and DMSO induced downregulated the expression levels of IL-6, IL-8, IL-1, and TNF- (p < 0.05) but augmented those of IL-10 (p < 0.05). These findings highlighted that RSV can reduce UC inflammation in mice. Furthermore, cotreatment of RSV and 740Y-P brought about reduced expressions of IL-6, IL-8, IL-1, and TNF- (p < 0.01) and increased IL-10 expression levels (p < 0.01) (Figures 4A-E). Activating the PI3K/Akt pathway can offset the therapeutic effect of RSV on intestinal inflammation in mice. Additionally, RT-qPCR demonstrated that the treatment of 740Y-P brought about a significant elevation in PI3K expressions in mice with UC (p < 0.01), which could be reversed by the administration of RSV (p < 0.05). In the mice with UC equally treated with RSV, the administration with 740Y-P was found to induce elevated PI3K expression levels (p < 0.05) ( Figure 4F). Meanwhile, Western blot analysis and IHC illustrated that administration of 740Y-P in mice with UC induced raised protein expression levels of PI3K and p-Akt/Akt ratio compared to those treated with DMSO (p < 0.01). Likewise, the administration with 740Y-P induced elevated PI3K expressions and p-Akt/Akt ratio in the mice with UC equally treated with RSV compared to those treated with DMSO ( Figures 4G,H). All in all, these findings indicated that the activation of the PI3K/Akt pathway can promote DSS-induced UC in mice. RSV Improves the Intestinal Flora Structure of Patients With UC by Inhibiting the PI3K/ Akt Pathway To further clarify whether RSV could regulate intestinal symbiotic flora to restore colonic flora homeostasis, we FIGURE 4 | Inhibition of PI3K/Akt pathway alleviates DSS-induced UC in mice. (A-E) The expression of IL-6, IL-8, IL-1, TNF-, and IL-10 in the colon tissues of mice in different treatment groups was determined using ELISA. (F) The expression of PI3K in colon tissues was examined using RT-qPCR. (G) The expression of PI3K, p-Akt, and Akt protein in colon tissues was examined using Western blot. (H) The expression of VEGFA and Akt protein in colon tissues was detected using IHC. *p < 0.05, ** p < 0.01, and *** p < 0.001. n 20. Measurement data were expressed by mean ± SD. One-way ANOVA was conducted for multiple group comparison, followed by Tukey's post hoc test. MG, model control group; RG, resveratrol group; 740Y-P, PI3K/Akt activator. Frontiers in Pharmacology | www.frontiersin.org August 2021 | Volume 12 | Article 693982 screened a total of 1,241, 81, and 45 intestinal bacteria associated with UC using the GMrepo, gutMEGA, and gutMDisorder databases, respectively, and obtained six significantly different bacteria including Clostridium, Roseburia, Akkermansia, Haemophilus, Parabacteroides, and Veillonella by intersection ( Figure 5A). In addition, the log2Ratio of the six significantly different intestinal flora in the UC sample and the normal sample was obtained through the gutMEGA database ( Figure 5B). Related samples of UC were further retrieved through the Metabolomics Workbench database, and differences in metabolite expression profiles were analyzed. The following six differential metabolites were obtained: glycerol 3-phosphate, ergothioneine, N-acetylasparagine, pyroglutamine, hypotaurine, and leucylalanine, and consequently, a heat map of differential metabolite expression was plotted ( Figure 5C). The enrichment analysis results of different metabolites and the correlation network diagram of metabolites were obtained through the MetaboAnalyst tool ( Figures 5D-F), which displayed that metabolites were primarily involved in triacylglycerol biosynthesis, glycerol phosphate shuttle, and cardiolipin biosynthesis. Additionally, analyses of the VMH database indicated that microbes with different metabolites were further predicted to intersect with the different microorganisms of UC to obtain Akkermansia ( Figure 5G). We predicted that Akkermansia was the key microbe influencing UC through its metabolism. The distribution and box diagram of relative abundance of the key microorganism Akkermansia in healthy samples and UC samples were subsequently searched through the GMrepo database ( Figures 5H,I), which clarified that Akkermansia may improve UC in mice by metabolizing the intestinal microflora structure of mice with UC. Further searching the KEGG database revealed that differential metabolites were involved in the biosynthesis of secondary metabolites (map01110). Meanwhile, RSV was also found to be implicated in this metabolic pathway, and there was an intersection of metabolites. Thus, we speculated that RSV might regulate the structure of intestinal flora by regulating related metabolites. Interestingly, a prior study has shown that Akkermansia has more abundant taxa in the control samples in comparison with UC samples (), whereas RSV is also known to restore the intestinal flora such as Akkermansia, which is reduced due to enteritis, to a steady-state level (). Altogether, these findings indicated that RSV had a tendency to restore intestinal homeostasis by regulating the structure of intestinal flora. Combined with the conclusion that RSV can improve UC by inhibiting the PI3K/Akt pathway, we concur that RSV may improve the intestinal microflora structure of UC patients by inhibiting the PI3K/Akt pathway. DISCUSSION UC is an inflammatory disease of the bowel, whose severity changes over time (). Evaluating the risk of UC progression and determining the best treatment plan remain a clinical challenge because the majority of patients show an incomplete response to treatment (). The current study was conducted to investigate the mechanism of RSV on alleviating UC in mice by mediating intestinal microflora homeostasis through the PI3K/Akt/VEGFA pathway, and the obtained findings revealed that RSV suppressed the activation of the PI3K/Akt pathway and reduced the VEGFA gene expression to alleviate UC in mice ( Figure 6). Initial findings in our study revealed that RSV alleviated DSSinduced UC in mice. In addition, we observed that administration of RSV brought about a marked reduction in IL-6, IL-8, IL-1, and TNF- expressions and increased that of IL-10. Similarly, a prior study revealed that RSV treatment at a certain dose could partially improve disease activity and quality of life in patients with UC (). Meanwhile, RSV was also previously shown to exert protective effects on DSS-induced colitis in mice with UC (). Further in line with our findings, another study illustrated that resveratrol treatment led to decreased expressions of inflammatory factors and increased expressions of tight junction proteins, thus alleviating UC intestinal mucosal barrier dysfunction (). Furthermore, significantly elevated protein expressions of IL-1 were recently observed in inflammatory colon tissues of patients with UC, wherein the administration of RSV resulted in decreased mRNA and protein levels of IL-1 (). Moreover, the study performed by Yao et al. showed that RSV treatment significantly inhibited the severity of UC and dramatically reduced the expressions of TNF-, IL-8, IFN-, p22, and gp91 relative to the UC control group, highlighting the antioxidant effects of RSV on preventing oxidative damage induced by DSS (). IL-10 serves as an anti-inflammatory cytokine, which is increased after RSV administration in inflammatory bowel disease (Wang J. et al., 2020). Subsequent experimentation in our study revealed PI3K/Akt/ VEGFA as a molecular target for RSV in the treatment of UC. Interestingly, a recent report illustrated that RSV can affect the progression of intestinal injury via regulation of the PI3K/Akt pathway (Radwan and Karam, 2020). Expanding on their results, the current study demonstrated that the RSV could relieve the pathological condition of mice with UC by inhibiting the PI3K/ Akt pathway to reduce the VEGFA gene expression via intestinal flora. The PI3K/Akt pathway is known to participate in the regulation and release of proinflammatory cytokines, which in turn influences the development of UC (). In addition, correlation and interaction analysis of 22 genes on the STRING website revealed that VEGFA was the core target of the API3K/Akt pathway ( Figure 1D). VEGFA was previously identified as a central target gene through the PPI network and was further known to exhibit better affinity with RSV in computer simulation studies (Wang W. et al., 2020). However, our study focuses on UC as well as the mechanism research and analysis of RSV in the intestinal flora, rather than the occurrence and development of obesity. Above all, the aforementioned findings and data indicate that RSV plays a role in UC by mediating VEGFA via the PI3K/Akt pathway. Additionally, the current study illustrated that RSV inhibited the activation of the PI3K/Akt pathway to reduce VEGFA expression. The relationship between RSV and PI3K/Akt has been investigated previously; for instance, RSV was found to downregulate the protein expression of PI3K/Akt, thus attenuating the progression of intestine (Radwan and Karam, 2020). Moreover, upregulated levels of VEGFA have been documented in UC patients compared to normal controls (). Similarly, RSV possesses the ability to inhibit the expression of CXCR4 by reducing the phosphorylation level of NF-B, which brings about a reduction in VEGF secretion (). Furthermore, our findings revealed that inhibition of the PI3K/ Akt pathway alleviated DSS-induced UC in mice. On the other hand, activation of the PI3K/Akt contributed to highly increased expressions of IL-6, IL-8, IL-1, and TNF- but reduced those of IL-10. In line with our findings, another study suggested that application of a PI3K/Akt inhibitor can improve various symptoms of UC in mice, such as reduced growth, loose stools, and stool bleeding, and further represses the activation of the PI3K/ Akt pathway (). Besides, RSV is also known to reduce TNF--induced IL-1 and MMP-3 production by suppressing PI3K-Akt signaling in fibroblastoid synoviocytes of rheumatoid arthritis (). Overall, our findings indicated that RSV improved the intestinal flora structure of UC mice through inhibiting the PI3K/ Akt pathway. Simultaneously, we also uncovered that Akkermansia may improve UC in mice by metabolizing the intestinal flora structure of UC mice. Existing literature shows that Akkermansia is more abundant in untreated patients with UC (). Moreover, RSV can restore intestinal flora such as Akkermansia to homeostatic levels due to reduced enteritis (). Altogether, the current study revealed that RSV suppressed the activation of the PI3K/Akt pathway and reduced the VEGFA gene expression to alleviate UC in mice. Our findings may offer a theoretical basis to translate the anti-inflammatory role of RSV to clinic terms in the treatment of UC. With the help of metabolomics methods, we further discovered the alleviating effect of RSV, which may work by changing the microbiota in the intestinal tract of experimental animals. In our future endeavors, we will further evaluate the results of bioinformatics analysis and experimentally analyze the role of the intestinal microbiota from experimental animals and its relationship with RSV. In addition, experimental analysis of gut microbiota should be conducted with the help of experimental animals. Prospective studies are also expected to deal with any possible, yet unpredictable factors when using this mechanism in the clinical treatment of UC. DATA AVAILABILITY STATEMENT The original contributions presented in the study are included in the article/Supplementary Material; further inquiries can be directed to the corresponding author. ETHICS STATEMENT The animal study was reviewed and approved by the First People's Hospital of Yongkang Affiliated to Hangzhou Medical College and Wenzhou Medical University.

Adipose tissue immunity and cancer Inflammation and altered immune response are important components of obesity and contribute greatly to the promotion of obesity-related metabolic complications, especially cancer development. Adipose tissue expansion is associated with increased infiltration of various types of immune cells from both the innate and adaptive immune systems. Thus, adipocytes and infiltrating immune cells secrete pro-inflammatory adipokines and cytokines providing a microenvironment favorable for tumor growth. Accumulation of B and T cells in adipose tissue precedes macrophage infiltration causing a chronic low-grade inflammation. Phenotypic switching toward M1 macrophages and Th1 T cells constitutes an important mechanism described in the obese state correlating with increased tumor growth risk. Other possible synergic mechanisms causing a dysfunctional adipose tissue include fatty acid-induced inflammation, oxidative stress, endoplasmic reticulum stress, and hypoxia. Recent investigations have started to unravel the intricacy of the cross-talk between tumor cell/immune cell/adipocyte. In this sense, future therapies should take into account the combination of anti-inflammatory approaches that target the tumor microenvironment with more sophisticated and selective anti-tumoral drugs. INTRODUCTION The incidence of obesity and its associated disorders is increasing at an accelerating and alarming rate worldwide (;). Relative to normal weight, obesity is associated with significantly higher all-cause mortality (Frhbeck, 2010;). Body mass index (BMI) represents the most used diagnostic tool in the current classification system of obesity, frequently used as an indicator of body fat percentage (BF). The controversy in studies arises in part because a wide variety of BMI cutoffs for normal weight has been applied to correlate with mortality which can yield quite diverse findings. Furthermore, in spite of its wide use, BMI is only a surrogate measure of body fat and does not provide an accurate measure of body composition (Frhbeck, 2012;). Noteworthy, obesity is defined as a surplus of body fat accumulation, with the excess of adipose tissue really being a well-established metabolic risk factor for the development of obesity-related comorbidities such as insulin resistance, type 2 diabetes (T2D), cardiovascular diseases and some common cancers (Bray, 2004;a;Van ;;). Results from epidemiological studies indicate that overweight and obesity contribute to the increased incidence and/or death from quite diverse types of cancers, including colon, breast (in postmenopausal women), endometrium, kidney (renal cell), esophagus (adenocarcinoma), stomach, pancreas, gallbladder and liver, among others (Calle and Kaaks, 2004). The mechanisms linking excess of adiposity and cancer are unclear but the obesityassociated low-grade chronic inflammation is widely accepted as an important factor in cancer pathogenesis (d;Hursting and Dunlap, 2013). Chronic hyperinsulinaemia as well as the alterations in the production of peptide and steroid hormones associated to obesity are other postulated mechanisms involved in cancer development (Calle and Thun, 2004). Particular attention is placed on the pro-inflammatory microenvironment associated with the obese state (d;;Hursting and Dunlap, 2013), specifically highlighting the involvement of obesity-associated hormones/growth factors in the cross-talk between macrophages, adipocytes, and epithelial cells in many cancers. Among the various pathophysiological mechanisms postulated to explain the link between obesity and cancer, the dysfunctional adipose tissue may be a unifying and underlying factor (van ). Understanding the contribution of obesity to growth factor signaling and chronic inflammation provides mechanistic targets for disrupting the obesity-cancer link (). In this regard, obesity prevention is a major part of several evidence-based cancer prevention guidelines (). Recent studies exploring the effect of weight loss, suggest that severe caloric restriction in humans may confer protection against invasive breast cancer (Michels and Ekbom, 2004). This protective effect includes reductions in the initiation and progression of spontaneous tumors in several tissues (Longo and Fontana, 2010). Moreover, the association between obesity and cancer is consistent with data from animal models showing that caloric restriction decreases spontaneous and carcinogen-induced tumor incidence (;). Both bariatric surgery and short-term intentional weight loss have been shown to improve insulin sensitivity and inflammatory state, which have been postulated to contribute to the relationship between obesity and cancer (;). THE IMPORTANCE OF OBESITY-INDUCED CHRONIC INFLAMMATION Adipocytes, the principal cellular component of adipose tissue, are surrounded by connective tissue comprising macrophages, fibroblasts, preadipocytes, and various cell types included in the stromovascular fraction (;;Cinti, 2012). Although adipocytes have been considered primarily as fat-storage depots, in recent years, it has become clear that together with other metabolically active organs, adipose tissue is a dynamic endocrine system key in the regulation of whole body energy homeostasis (a;Ahima, 2006;). Indeed, mature adipocytes are involved in endocrine, paracrine, and autocrine regulatory processes (Ahima and Flier, 2000) through the secretion of large number of cytokines, hormones and other inflammatory markers, collectively termed adipokines ((Lago et al.,, 2009). In addition to playing key roles in the regulation of the lipid and glucose homeostasis, adipokines modify physiological processes, such as hematopoiesis, reproduction, and feeding behavior, being also involved in the genesis of the multiple pathologies associated with an increased fat mass including cancer development (Rajala and Scherer, 2003). However, adipose tissue not only secretes adipokines but also functions as a target of these pro-inflammatory mediators, expressing a wide variety of receptors for cytokines, chemokines, complement factors, and growth factors (Frhbeck, 2006a,b;Schffler and Schlmerich, 2010). The connection between inflammation and diabetes was suggested more than a century ago, but the evidence that inflammation is an important mediator in the development of insulin resistance came recently. It was described that the administration of tumor necrosis factor- (TNF-) led to increased serum glucose concentrations (). The first study that established the concept of obesity-induced adipose tissue inflammation was conducted by Hotamisligil et al., demonstrating that the pro-inflammatory cytokine TNF mediate insulin resistance in many experimental models of obesity. Importantly, the development of adipose tissue has been associated with increased plasma levels of well-known inflammatory and acute phase proteins such as C-reactive protein, interleukin (IL)-6, IL-8, serum amyloid A (SAA) and monocyte chemotactic protein (MCP)-1 in patients and different animal models of obesity (;Wellen and Hotamisligil, 2003;Frhbeck, 2005;;b;;Cataln et al.,, 2008, whereas production of the anti-inflammatory and insulinsensitizing adipokine adiponectin is reduced with increasing body weight (). In obesity, the activation of the c-Jun N-terminal kinase (JNK) and nuclear factor B (NF-B) transduction signals is key in the inflammation process of adipose tissue and these pathways could interact with insulin signaling via serine/threonine inhibitory phosphorylation of IRS (;). Genetic or pharmacological manipulations of these different effectors of the inflammatory response modulate insulin sensitivity in different animal models. Recent data suggest that stromovascular cells also contribute to the secretion of inflammatory adipokines. In this sense, the infiltration of adipose tissue by immune cells is a feature of obesity, with adipose tissue macrophage (ATM) accumulation being directly proportional to measures of adiposity in both mice and humans (). This evidences a role of adipose tissue as part of the innate immune system. ADIPOSE TISSUE INFLAMMATION, A MICROENVIRONMENT FOR TUMORIGENESIS Analogously to adipose tissue, the tumor microenvironment is composed by multiple cell types including epithelial cells, fibroblasts, mast cells, and cells of the innate and adaptive immune system that favor a pro-inflammatory and pro-tumorigenic environment (). These inflammatory cells secrete cytokines, growth factors, metalloproteinases, and reactive oxygen species, which can induce DNA damage and chromosomal instability, thereby favoring carcinogenesis (). The abundance of leukocytes in neoplasic tissue was crucial to establish the link between chronic inflammation and cancer development. Now, inflammation is a well-known hallmark of cancer, and growing evidence continues to indicate that chronic inflammation is associated with increased cancer risk (Aggarwal and Gehlot, 2009). The expanded adipose tissue constitutes an important initiator of the microenvironment favorable for tumor development (d) due to its ability to produce and secrete inflammatory cytokines by adipocytes or infiltrating macrophages (). Noteworthy, novel adipokines related to inflammation and insulin resistance with emerging roles in tumor development have been recently described to be increased in adipose tissue from patients with colon cancer (d). In this line, periprostatic adipose tissue of obese subjects shows a dysregulated expression of genes encoding molecules involved in inflammatory processes including antigen presentation, B cell development, and T helper cell differentiation. Moreover, subjects with prostate cancer display an altered profile of genes with great impact on immunity and inflammation in their periprostatic adipose tissue (). The up-regulation of complement factor H and its receptor in periprostatic adipose tissue from patients with prostate cancer has been also described, suggesting an inhibitory modulation of the complement activity in prostate tumor cells and evasion to attack. Other altered molecules include the B lymphocyte antigen CD20 encoded by the MS4A1 gene with a functional role in B-cell activation and FFAR2 that encodes a protein reported to modulate the differentiation and/or activation of leukocytes (). This observation highlights the bi-directional interactions between periprostatic adipose tissue and tumor cells, which influence adipose tissue function and may influence prostate cancer progression inducing an environment favorable to cancer progression. Clusters of enlarged adipocytes become distant from the vasculature in expanding adipose tissue leading to local areas of hypoxia and eventually necrosis. The reduction in oxygen pressure associated with adipose tissue hypoxia is considered to underlie the inflammatory response (;Ye, 2009;Trayhurn, 2013). The master regulator of oxygen homeostasis is the hypoxia-inducible factor (HIF)-1. HIF-1 is increased in the adipose tissue of obese patients and its expression is reduced after surgery-induced weight loss (). It is well-documented that HIF-1 also influences both the innate and the adaptive immunity regulating functions of myeloid cells, neutrophils, macrophages, mast cells, dendritic cells, natural killer cells and lymphocytes (Eltzschig and Carmeliet, 2011). Similarly to what takes place in tumor tissue, adipose tissue hypoxia is related to the presence of macrophages, which migrate to the hypoxic regions and alter their expression profile increasing inflammatory events (). Hypoxia activation is a critical microenvironmental factor during tumor progression with oxygen concentrations in solid tumors being frequently reduced compared with normal tissues (Semenza, 2003;). HIF-1 and HIF-2 are overexpressed in certain solid tumors (;), with these elevated levels being associated with cancer-related death in specific tumoral types of the brain (oligodendroglioma), breast, cervix, oropharynx, ovary, and uterus (endometrial). HIF-2 is also strongly expressed by subsets of tumor-associated macrophages, sometimes in the absence of expression in any tumor cell (). Overall, hypoxia has effects on the function of adipocytes and appears to be an important factor in adipose tissue dysfunction in obesity increasing the risk of cancer development. The blocking of tumor angiogenesis as an anticancer strategy has shown desirable results across multiple tumor types (Folkman, 1971;). The standard chemotherapy usually results in partial or total resistance after different cycles of treatment. Based on the hypothesis that endothelial cells have a normal complement of chromosomes and a relative genetic stability, the use of inhibitors of angiogenesis may avoid acquired drug resistance. Current pharmacotherapeutic options for treating obesity and related metabolic disorders remain limited and ineffective. Emerging evidence shows that modulation of angiogenesis is a possible therapeutic intervention to impair the development of obesity by regulating the growth and remodeling of the adipose tissue vasculature (;Cao, 2010). Adipose tissue growth is angiogenesis-dependent () and the modulation of angiogenesis appears to have the potential to impair the development of obesity. Studies in mice have shown that the administration of anti-angiogenic agents prevents diet-induced or genetic obesity (a). Genetically obese mice treated with different angiogenesis inhibitors such as TNP-470, angiostatin, endostatin, Bay-129566, a matrix metalloproteinase inhibitor, or thalidomide showed reduced body and adipose tissue weights as well as increased apoptosis in the adipose tissue compared with control mice (). In this regard, targeting a proapoptotic peptide to prohibitin in the adipose vasculature caused ablation of white fat in both, diet-induced and age-related obesity (). Recently, the antiangiogenic treatment blocking VEGFR2 by antibodies but not of VEGFR1 has been described to limit adipose tissue expansion (). To evaluate the effects of the different antiangiogenic agents characterized in the cancer field in obesity models in vivo may be an attractive target to limit adipose tissue expansion. However, a too strong inhibition of adipose tissue expansion by impairing angiogenesis may lead to ectopic lipid storage, increased inflammation, and further deterioration of systemic insulin sensitivity (;). Moreover, adipose tissue development is a multifactorial process and it is unlikely that a single angiogenesis inhibitor will allow reduction of obesity without associated side effects. Thus, blocking the capacity for angiogenesis may have different outcomes, depending on the stage of obesity. IMMUNE CELL TYPES PRESENT IN EXPANDED ADIPOSE TISSUE In cases of severe obesity, adipose tissue can constitute up to 50-60% of the total body mass being the expanded adipose tissue a largely uncharacterized immunological organ with distinct subpopulations of cells of the immune system (Kanneganti and Dixit, 2012). Furthermore, excess of body fat is accompanied by altered immune cell function and different expression profile of genes related to immunity in obese human subjects compared with healthy-weight individuals (). Discrepancies in leukocyte number, subset, and activity of monocytes between lean and obese individuals have been reported (). Adipose tissue has been shown to exhibit a dynamic infiltration by innate and adaptive cells during the onset of insulin resistance and diet-induced obesity (). The observation of infiltrated macrophages in the adipose tissue of obese patients prompted an increased interest in the interplay between immune cells and metabolism. Recent studies have revealed a growing list of immune cell types (including macrophages, lymphocytes, mast cells, eosinophils neutrophils and foam cells) that infiltrate adipose tissue and have potential roles in insulin resistance (Olefsky and Glass, 2010;;;) (Figure 1). The role of adaptive immune cells in obesity-induced adipose tissue inflammation has been less characterized than that of innate immune cells. Based on studies in mouse models, lymphocyte infiltration in adipose tissue might occur in a chronological sequence. B and T lymphocytes are recruited during early FIGURE 1 | Obesity is associated with a great infiltration of cells from both the innate and adaptive immune systems. The aberrant population expansion of these cells is related to the onset of obesity-related comorbidities, primarily cancer development. obesity-induced inflammation by preadipocytes or chemotactic adipokines like CCL5, CXCL5, CXCL12, or CCL20. Furthermore, the cytokines derived from Th lymphocytes reportedly modulate macrophage phenotype switching, which is directly linked to insulin resistance (). To explain the chronological order of how immune cells infiltrate adipose tissue in obesity, it has been proposed that T cells may stimulate preadipocytes to induce the recruitment of macrophages via chemotactic factors such as MCP-1, shedding new light on the importance of chemotaxis in this scenario (). INNATE IMMUNE SYSTEM IN ADIPOSE TISSUE Macrophages and monocytes are representative of the innate immune system and represent a large proportion of the stromovascular cell fraction in adipose tissue. Several cell types of the innate immune system are involved in the development of adipose tissue inflammation and the most studied cell type among these is the ATM (). Neutrophils and mast cells, also members of the innate immune system have been also implicated in promoting inflammation and insulin resistance during obesity, whereas eosinophils and myeloid-derived suppressor cells have been suggested to play a protective role (Wu and Van Kaer, 2013). MONOCYTES AND MACROPHAGES IN ADIPOSE TISSUE The majority of macrophages found in the adipose tissue of diet-induced obese mice are originated from blood monocytes (;). Monocytes are a heterogeneous cell population that differ in their migration and cell fate properties (Saha and Geissmann, 2011). The phenotype of macrophages depends on the subset of monocytes upon arrival at target tissues being probably determined by the local microenvironment (). The number of resident macrophages present in adipose tissue was found to correlate positively with obesity in various mouse models and in human adipose tissue (;). Thus, it is possible to speculate that macrophages might be involved in the growth of the fat mass in a similar manner to that described in tumors (). Based on their cytokine profile secretion and cell surface markers, ATMs are classified into two main types: the "classical" macrophages named M1 in contrast to the "alternatively activated" M2. M1 macrophages are the first line of defense against intracellular pathogens with high microbicidal activity and are classically stimulated by interferon (IFN)- or by lipopolysaccharide (LPS). M1 induce the secretion of inflammatory cytokines (IL-1, IL-6, TNF-, MCP1) and reactive oxygen species, and nitric oxide (NO) through the stimulation of inducible NO synthase (iNOS) (). Alternative activation, resulting from induction by the Th2 cytokines interleukin IL-4 and IL-13 is associated with tissue repair and humoral immunity producing immunosuppressive factors, such as IL-10, IL-1Ra, and arginase (Gordon and Taylor, 2005). Obesity induces a phenotypic switch from an anti-inflammatory M2polarized state to a pro-inflammatory M1 state (). The importance of the M1/M2 ratio has been reported in macrophage-specific Pparg-deficient mice that show impaired alternative macrophage activation, increased development of obesity and adipose tissue inflammation as well as glucose intolerance (). The identification of the signaling pathways that control macrophage polarization in expanding adipose tissue remains a challenging issue. In this sense, it has been described that the local hypoxia in expanding adipose tissue Frontiers in Physiology | Systems Biology October 2013 | Volume 4 | Article 275 | 4 may promote the M2 to M1 switching (Ye and McGuinness, 2013). Moreover, a recent study in Trib1-deficient mice has shown a severe reduction of M2-like macrophages in adipose tissue highlighting the contribution of Trib1 for adipose tissue homeostasis by controlling the differentiation of tissue-resident M2-like macrophages (). INVOLVEMENT OF NEUTROPHILS, EOSINOPHILS, AND MAST CELLS IN OBESITY The notion that a transient "acute inflammatory infiltrate" precedes the "chronic inflammatory infiltrate" in obesity and that neutrophils play a key role (Wagner and Roth, 2000) producing chemokines and cytokines, thereby facilitating macrophage infiltration has been proposed (). In this line, adipose tissue neutrophils could have a role in initiating the inflammatory cascade in response to obesity based on the fact that mice fed with a high-fat diet show an increase in neutrophil recruitment to adipose tissue peaking at 3-7 days and subsiding thereafter (). The treatment of hepatocytes with neutrophil elastase causes cellular insulin resistance while deletion of neutrophil elastase in obese mice leads to reduced inflammation (). Although eosinophils are associated with allergic diseases and helmintic infections (Rothenberg and Hogan, 2006), the biologic role of these cells in adipose tissue remains incompletely defined (Maizels and Allen, 2011). It has been shown that eosinophils are the main source of IL-4 and IL-13 in white adipose tissues of mice, and, in their absence, M2 macrophages are greatly attenuated (). Moreover, in the absence of eosinophils, mice which were fed a high-fat diet develop increased body fat and insulin resistance (). The promotion of eosinophil responses can protect against metabolic syndrome (). Mast cells, like macrophages, are inflammatory cells, but the exact mechanisms of mast cells in the pathogenesis of obesity are not fully understood. In this regard, increased mast cells in adipose tissue from obese subjects compared with those of lean subjects have been reported. Obese subjects also had significantly higher tryptase concentrations in their serum than lean individuals. Mast cells may contribute to inflammation through the secretion of IL-6 and IFN- (). Moreover, mast cell number is related to fibrosis, macrophage inflammation and endothelial activation of adipose tissue in human obesity (). These observations suggest a possible association between mast cells and obesity-associated inflammation (;Zhang and Shi, 2012). ADAPTIVE IMMUNE SYSTEM IN ADIPOSE TISSUE Recent advances in the field of adipose tissue biology reveal a prominent role of different types of lymphocytes (T-lymphocytes, B-lymphocytes, and natural-killer cells) in adipose tissue inflammation depending on the obese state in parallel to macrophages (Sell and Eckel, 2010). T-LYMPHOCYTES IN ADIPOSE TISSUE CD4 + T cells along with CD8 + T cells constitute the majority of T-lymphocytes. Experimental data suggest that T-lymphocytes might play a role in the development of insulin resistance during obesity. In this sense, T-lymphocytes are described in visceral and subcutaneous adipose tissue of obese mice and humans () but the role of different subtypes of lymphocytes, CD4 +, and CD8 + cells, in adipose tissue inflammation remains largely unexplored. The increase in the number of T cells in adipose tissue from diet-induced obesity mice is genderdependent, with higher numbers of T cells in obese males than in females or lean males (). Based on studies in mouse models, lymphocyte infiltration in adipose tissue might occur in a chronological sequence with T lymphocytes being recruited during early obesity-induced inflammation by chemokines like RANTES, a T-cell specific chemokine also known as CCL5 (). In this regard, the expression of RANTES and its respective receptor CCR5 in visceral adipose tissue of morbidly obese patients have been described (). CD4 + T cells are crucial in achieving a regulated effective immune response to pathogens. In adipose tissue, CD4 + T cells are mainly classified into the classical T-helper 1 (Th1) and T-helper 2 (Th2) although new subsets have been identified including T-helper 17 (Th17), induced T-regulatory cells (iTreg), and the regulatory type 1 cells (Tr1), among others (). The roles for CD4 + T lymphocytes in adipose tissue are related to the regulation of body weight, adipocyte hypertrophy, insulin-resistance, and glucose tolerance. Thus, CD4 + cells are key in the control of disease progression in diet-induced obesity (). Th1 cells show a pro-inflammatory profile, secreting IFN-, which elicits the production of macrophage mediators, induces leukocyte adhesion molecules and chemokines, as well as increases antigenpresenting capacity by macrophages and endothelial cells (Geng and Hansson, 1992;). Interestingly, T cells extracted from fat tissue of obese mice and stimulated in vitro produced higher amounts of IFN- than those extracted from lean animals. This finding suggests that obesity primes T cells from adipose tissue toward a Th1 switch (). Winer et al. () reported that the increase of CD4 + T cells with obesity in mice is largely due to the accumulation of IFN produced by Th1 cells. The elevated levels of IFN also contribute to the classical activation of adipose tissue macrophages, resulting in increased inflammation in adipose tissue. On the other hand, Th2 are anti-inflammatory cells and are a source of IL-4 and IL-13. In this regard, T cells may orchestrate an inflammatory cascade, depending on the set of cytokines they predominantly produce (Hansson and Libby, 2006). A dramatic increase in the number of Th1 cells has been described in dietinduced obesity states, whereas the number of Th2 cells remained unchanged (Sell and Eckel, 2010). T regulatory (Treg) cells are a small subset of T lymphocytes constituting normally 5-20% of the CD4 + compartment. Tregs are critical in the defense against inappropriate immune responses such as inflammation and tumorigenesis () because they control the behavior of other T cell populations and influence the activities of the innate immune system cells (). Treg cells regulate the activities of macrophages and adipocytes probably secreting IL-10, given their association with improved insulin sensitivity in both rodents and www.frontiersin.org October 2013 | Volume 4 | Article 275 | 5 humans (). It has been recently described that the accumulation of Tregs in visceral adipose tissue is mediated by the nuclear receptor peroxisome proliferator-activated receptor (PPAR)- (). PPAR- tended to impose the transcriptional characteristics of visceral adipose tissue Tregs on nave CD4 + T cells (). Tregs may be regulated by local hypoxia, increased adipocyte death and adipocyte stress (). The diminished Treg cells in obesity could promote the infiltration of macrophages in adipose tissue and, thereby, increase the production of inflammatory cytokines. CD8 + T cells are involved in the initiation and propagation of inflammatory cascades in obese adipose tissue (). CD8 + cells are required for adipose tissue inflammation and have major roles in macrophage differentiation, activation and migration (). A study in mice reported mainly CD8 + lymphocyte infiltration in hypoxic areas of epididymal adipose tissue in mice fed a high-fat diet, whereas the numbers of CD4 + and regulatory T cells were reduced (). The infiltration by CD8 + T cells precedes the recruitment of macrophages. Indeed, immunological and genetic depletion of CD8 + T cells lowered macrophage infiltration and adipose tissue inflammation as well as ameliorated systemic insulin resistance (). Another study also demonstrates an early T lymphocyte infiltration during the development of insulin resistance in a mouse model of high fat diet-induced obesity as well as a correlation of T cells with waist circumference in diabetic patients (), highlighting the association of insulin resistance with adipose tissue lymphocyte infiltration. Oppositely, most of these cells were CD4 + with only a few CD8 + cells. Recent studies have focused on another regulatory T cell subset, natural killer T (NKT) cells, in the development of obesity-associated inflammation and comorbidities (Lukens and Kanneganti, 2012;). NKT cells are abundant in metabolically active organs such as liver and adipose tissue (Emoto and Kaufmann, 2003;) and show the capacity to produce a variety of both pro-and anti-inflammatory cytokines (Wu and Van Kaer, 2013). NKT cells exert their effects in the development of inflammation and metabolic diseases in response to nutritional lipid excess (Wu and Van Kaer, 2013). B-LYMPHOCYTE ACCUMULATION IN DYSFUNCTIONAL ADIPOSE TISSUE A fundamental pathogenic role for B cells in the development of metabolic abnormalities has been described (;). In mice, B-lymphocytes accumulate in adipose tissue before T cells, shortly after the initiation of a high-fat diet (). The early recruitment of B cells promotes T cell activation and pro-inflammatory cytokine production, which potentiates M1 macrophage polarization and insulin resistance (). Moreover, an impaired function of toll-like receptors in B cells from patients with T2D that increases inflammation by the elevation of pro-inflammatory IL-8 and lack of antiinflammatory/protective IL-10 production has been described (). ADIPOKINE DYSREGULATION AND CANCER A growing body of evidence suggests that the inflammatory milieu of the obese state is linked to the development of cancer through different mechanisms (). Infiltrating immune cells in adipose tissue regulates the local immune response, inducing increased levels of pro-inflammatory cytokines and adipokines and providing a major link to the obesity-associated tumor development (van ). Critical molecules involved in the promotion of tumor cell proliferation include inflammatory transcription factors , adipokines (leptin and adiponectin) as well as inflammatory cytokines and enzymes (TNF-, IL-6, MCP-1, SAA) and matrix metalloproteases (;Aggarwal, 2009). Among all these molecules, perhaps the transcription factor NF-B is the central mediator of inflammation. Leptin, the product of the ob gene, is an adipocyte-derived hormone that is a central mediator in regulating body weight by signaling the size of the adipose tissue mass (). Leptin levels are closely correlated with adiposity in obese rodents and humans (;Frhbeck et al.,, 2001). Subsequent studies have suggested that this hormone may be linked to the increased incidence of cancer in obesity (). Leptin has attracted attention due to its potential function as an antiapoptotic, mitogenic, proangiogenic, and prometastatic agent, as observed in numerous in vitro studies (Frhbeck, 2006a,b;). Circulating levels of leptin have been investigated to determine the correlation with cancer and progressive disease. A strong association between leptin levels and colorectal and endometrial cancer has been reported (;a). However, the findings of clinical studies of the relationship between leptin and breast cancer are inconsistent (van ). Interestingly, many colorectal, breast, and endometrial cancers overexpress the leptin receptor OB-R (a,b). Leptin produced by adjacent adipose tissue might promote the growth of colorectal cancer enhancing the proliferation of colon cancer cells although other factors released by adipocytes are also likely to be involved in the process. It suggests that the presence of tumor-associated adipose tissue represents an important microenvironmental influence (;Vansaun, 2013). It has now been extensively documented that adiponectin expression is inversely correlated with obesity (;). Adiponectin may influence cancer risk through its well-recognized effects on insulin resistance, but it is also plausible that adiponectin acts on tumor cells directly (;). Interestingly, several cancer cell types express the adiponectin receptors AdipoR1 and AdipoR2 that may mediate the inhibitory effects of adiponectin on cellular proliferation (). Epidemiologic studies show that low levels of adiponectin have an inverse association with the risk for the development of multiple cancers as well as advanced progression of disease (;;). In a prospective analysis, adiponectin levels were inversely associated with endometrial (Dal ) and breast cancer risk FIGURE 2 | Adipose tissue constitutes an active endocrine organ. In the lean state, adipose tissue exhibits resident macrophages polarized toward an M2 status and Treg cells involved in support a metabolic homeostasis. Moreover, the inflammation is controlled through the eosinophil-derived interleukin (IL)-4 and IL-13 as well as the IL-10 secreted by Treg cells and M2 macrophages. With a progression of obesity, adipocytes undergo hypertrophy and release adipokines that promotes the acquisition of an M1 macrophage phenotype with increased production of pro-inflammatory factors such as tumor necrosis factor-, (TNF-), monocyte chemotactic protein (MCP)-1, and IL-6. This is accompanied by the infiltration of mast cells and T lymphocytes contributing to the dysregulation of adipose tissue and favoring and perpetuating an inflammatory state. TNF-, a cytokine originally identified as mediating endotoxin-induced tumor necrosis (), has been shown to be involved in the development of a number of cancers through the promotion of vessel growth and tumor destruction by direct cytotoxicity angiogenesis () as well as the metastatic potential of circulating tumor cells (). However, although TNF- is the most potent activator of NF-B, elevated levels of TNF- in tissue or serum are not very common in cancer patients (Aggarwal and Gehlot, 2009). The increased circulating levels of TNF- of both obese rodents and obese humans, suggest a possible link between obesity and tumorigenesis (). In this regard, obesity-promoted hepatocellular carcinoma development was dependent on increased production of the cytokines TNF- and IL-6, which cause hepatic inflammation and activation of the oncogenic transcription factor STAT3 (). Diet-induced obesity produces an elevation in colonic TNF- giving rise to a number of alterations including the dysregulation of the Wnt signaling pathway, with an important involvement in colorectal cancer (). Another pro-inflammatory molecule produced in adipose tissue is IL-6. The circulating levels of IL-6 are higher in subjects with obesity-related insulin resistance (). IL-6 is a pleiotropic cytokine with a significant role in growth and differentiation (Ghosh and Ashcraft, 2013) that signals to the nucleus through STAT3, an oncoprotein that is activated in many human cancers and transformed cell lines (). Interestingly, STAT3 is activated by leptin () and probably may have a role in the pro-tumorigenic effects of this adipokine. Moreover, different studies indicate that serum IL-6 levels are a negative indicator of the development of breast cancer in overweight or obese patients with prominent insulin resistance (;Knupfer and Preiss, 2007). MCP-1 is a member of the CC chemokine superfamily that plays a crucial role in recruitment and activation of monocytes during acute inflammation and angiogenesis (Charo and Taubman, 2004). Circulating levels of MCP-1 are generally increased in obese patients compared to lean controls. Gene expression levels in adipose tissue follow the same trend, being higher in the visceral and subcutaneous adipose tissue of obese patients compared to lean volunteers (). There is emerging evidence that MCP-1 induces tumor cell proliferation via activation of the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) pathway in various cancer types (). Moreover, MCP-1 promotes cancer tumorigenesis indirectly via its effects on macrophage infiltration (). It has been described that MCP-1 is highly expressed by breast tumor cells and has causative roles in breast malignancy and metastasis (Soria and Ben-Baruch, 2008). The pleiotropic roles of CCL2 in the development of cancer are mediated through its receptor, CCR2 (). Novel adipokines involved in obesity-associated inflammation have emerged as important players of tumor growth (d). OPN is a secreted glycoprotein expressed by different cellular types (). Recently, several studies have highlighted the expression of OPN in adipose tissue of both humans and mice and its involvement in obesity and obesityassociated T2D promoting inflammation and the accumulation of macrophages in adipose tissue ). High OPN expression in the primary tumor is associated with early metastasis and poor outcome in human breast and other cancers (). LCN-2 also known as neutrophil gelatinase associated lipocalin is a component of the innate immune system with a key role in the acute-phase response to infection (). Increased levels of LCN-2 in visceral adipose tissue in human obesity and a relationship with pro-inflammatory markers has also been described (Cataln et al.,, 2013. In addition to inhibiting invasion and metastasis, LCN-2 also appears to be a negative regulator of angiogenesis in cancer cells (). Tenascin-C (TNC) is an extracellular matrix glycoprotein specifically induced during acute inflammation and persistently expressed in chronic inflammation (Chiquet-Ehrismann and Chiquet, 2003;). Increased expression of TNC has been described in most solid cancers, playing important roles in enhancing proliferation, invasion and angiogenesis during tumorigenesis and metastasis (Midwood and Orend, 2009;). In this line, elevated expression levels of TNC have been found in visceral adipose tissue in obesity with a tight association of genes being involved in maintaining the chronic inflammatory response associated to obesity (c). YKL-40 is another adipokine involved in inflammation and cancer cell proliferation. YKL-40 is a growth factor with elevated gene and protein expression levels in visceral adipose tissue in human obesity-associated T2D (b). Moreover, circulating levels of this cytokine are described as an obesity-independent marker of T2D (). On the other hand, elevated levels of YKL-40 were found in patients with different types of solid tumors, including several types of adenocarcinomas, small cell lung carcinoma, glioblastoma, and melanoma (). Calprotectin is a member of the S100 protein family released by activated phagocytes and recognized by TLR4 on monocytes (). Calprotectin is not only involved in differentiation and cell migration but has also been identified as an important regulator of inflammation in cancer development and tumor spreading (;). The increased levels of calprotectin in obesity and obesity-associated T2D have been shown decrease after weight loss achieved by RYGB (a). CONCLUSIONS The prevalence of obesity has risen steadily for the past several decades. Excess of adiposity is associated with increased death rates for all cancers combined and for cancers at multiple specific sites with the strongest evidence for endometrial cancer, postmenopausal breast cancer, colon cancer, renal cell carcinoma of the kidney, liver, gallbladder, esophageal, and pancreatic cancer. The mechanisms linking obesity and cancer are unclear but lowgrade chronic inflammation, dysregulation of growth signaling pathways, chronic hyperinsulinemia, and hypoxia associated to obesity are widely accepted as important factors in cancer pathogenesis. Particular attention is placed on the pro-inflammatory environment associated with the obese state, specifically highlighting the involvement of infiltrated immune cells into adipose tissue. In this sense, the understanding of the regulatory mechanisms that lead to polarization of macrophages or lympocytes in adipose tissue toward a pro-inflammatory phenotype will provide new ways to control adipose tissue inflammation (Figure 2). A better understanding of the mechanistic links between obesity and cancer will help to identify intervention targets and strategies to avoid the pro-tumorigenic effects of obesity.

Combined Bacterial Meningitis and Infective Endocarditis: When Should We Search for the Other When Either One is Diagnosed? Introduction We aimed to describe patients with coexisting infective endocarditis (IE) and bacterial meningitis (BM). Methods We merged two large prospective cohorts, an IE cohort and a BM cohort, with only cases of definite IE and community-acquired meningitis. We compared patients who had IE and BM concurrently to patients with IE only and BM only. Results Among the 1030 included patients, we identified 42 patients with IEBM (4.1%). Baseline characteristics of patients with IEBM were mostly similar to those of patients with IE, but meningitis was the predominant presentation at admission (39/42, 92.3%). Causative pathogens were predominantly Streptococcus pneumoniae (18/42, 42.9%) and Staphylococcus aureus (14/42, 33.3%). All pneumococcal IE were associated with BM (18/18). BM due to oral and group D streptococci, Streptococcus agalactiae, and S. aureus were frequently associated with IE (14/30, 46.7%). Three-month mortality was 28.6% in patients with IEBM, 20.5% in patients with IE, and 16.6% in patients with BM. Conclusions Patients with pneumococcal IE or altered mental status during IE must be investigated for BM. Patients with S. aureus, oral and group D streptococcal or enterococcal BM, or unfavorable outcome in pneumococcal meningitis would benefit from an echocardiography. Patients with the dual infection have the worst prognosis. Their identification is mandatory to initiate appropriate treatment. INTRODUCTION Infective endocarditis (IE) and bacterial meningitis (BM) share low incidence, therapeutic challenges resulting from poor antibiotic diffusion to infection sites, and a mortality rate approximating 20%. Furthermore, the clinical presentation of each entity may mimic that of the other. The situation is even more complex when these two diseases develop in a single patient, given the necessity of urgent and specific therapeutic management of each condition. This combination of IE and BM in a single patient has been described mainly through case reports. A recent Dutch nationwide cohort study on meningitis showed that 24 out of 1025 patients (2%) with BM also had IE. Although the study provided original information on this rare combination, only cases initially identified with meningitis were described, without any control group reported. To describe the natural history and clinical characteristics of this rare combination, we analyzed the cases of endocarditis-meningitis combination in a cohort of patients with IE and a cohort of patients with BM. This enabled us to compare patients with both IE and BM with patients presenting each disease alone. Study Design We merged the data from the AEPEI IE cohort and the COMBAT meningitis cohort. The AEPEI IE cohort is a prospective observational study that was conducted in 2008 in seven French regions by the Association pour l'Etude et la Prevention de l'Endocardite Infectieuse (AEPEI) that included all definite cases of IE. The methods used for this study-hereafter referred to as the AEPEI IE cohort-have been described elsewhere. Briefly, all physicians in public and private practice who were likely to manage patients with IE were contacted and invited with frequent reminders to report every suspected case of IE. A case report form was filled out by a trained clinical research assistant and validated by an expert committee. The COM-BAT meningitis cohort is a prospective observational study in which all cases of definite community-acquired bacterial meningitis identified in 69 French hospitals in 2013-2014 were reported, as described elsewhere. Both cohorts received a 1-year follow-up. Case Definition and Report Form IE cases were classified by an expert committee using the modified Duke classification and only definite IE cases were considered. Bacterial meningitis was defined by positive CSF (cerebrospinal fluid) culture and/or positive soluble antigen in CSF with or without cell reaction and/or positive polymerase chain reaction (PCR) in CSF and/or purpura fulminans (with or without positive CSF culture) with a PCR in blood and/or positive blood culture and CSF cell reaction. Patients with both IE and BM were compared to patients with IE only and to patients with BM only, first for all patients and then according to the causative microorganism (Streptococcaceae, Staphylococcus aureus). A specific case report form was used for each cohort. Medical history, risk factors for IE, clinical presentation, laboratory and echocardiographic findings, medical and surgical treatment, and outcome were collected. Two variables were specific to the AEPEI IE cohort, namely medical or surgical procedures or situations entailing risk of bacteremia (within 3 months before hospitalization). Otherwise, most definitions from the BM cohort were similar to those of the IE cohort. Moreover, the design of the case report form, as well as the data analysis implied some common authors from the two studies. Furthermore, medical charts of patients with IE-BM were reviewed for the time sequence of events, the diagnosis (IE or BM) established at hospital admission, and which of the two infections pre-existed according to the medical history of patients with IE-BM in the weeks preceding hospital admission. Statistical Methods Continuous variables were described with median and interquartile range , and categorical variables as number of cases and percentage. Variables were compared with nonparametric tests, the Fisher's exact test for categorical variables and the Mann-Whitney-Wilcoxon test for continuous variables. All statistical analyses were performed with SAS v9.2 (SAS Institute). Ethical and Regulatory Issues The AEPEI IE and COMBAT cohorts (Clini-calTrials.gov: NCT03272724 and NCT02916732, respectively) were approved by an institutional review board (CHU Besanon 12/2007 and CPP Ile de France CPP4 (IRB00003835) (2012-16NI), respectively) and the French data protection board (CNIL) (DR-2017-003 and EGY/FLR/AR128794, respectively). In both cohorts, patients were informed of the study orally and, in accordance with French law, did not have to provide written consent. We also performed the analysis for meningitis only after withdrawal of meningitis due to Neisseria meningitis The causative microorganisms in the patients with IE-BM from the AEPEI IE cohort were Streptococcaceae (8, Among patients with IE-BM, the mitral valve was the most frequently involved valve (more than 50%), followed by the aortic valve (ca. 30%), while contrary to patients with IE, other or dual localizations were exceptional. IE-BM and BM were mostly community-acquired, contrary to patients with IE, notably staphylococcus IE. Out Regarding diagnosis of patients with IE-BM at hospital admission, the time interval between symptom onset and hospitalization was short, similar to meningitis or S. aureus IE, but differing from Streptococcaceae IE (involving a significantly longer time interval before hospitalization). Almost two-thirds of the patients with IE-BM (25/42) initially presented fever associated with altered mental status, and fever was almost constant in patients with IE-BM, patients with IE, and patients with S. aureus BM, but only in 73.3% of the patients with Streptococcaceae BM. Focal neurological signs appeared in the initial presentation in 8 patients out of 42, among whom four presented seizures. Glasgow coma scale was altered for patients with IE-BM and biological markers were highly elevated, similar to patients with BM, but not to patients with IE, and septic shock was significantly more frequent. Patients with IE-BM presented more cerebrovascular events than patients with IE or BM, with no difference in cardiac surgery rate with Table 2 Comparison of the characteristics of the three groups of patients with streptococci or staphylococci infections according to the localization of the infections: infective endocarditis and meningitis, infective endocarditis only, and community acquired meningitis only DISCUSSION By merging two prospective cohorts, we were able to gather and describe the largest group of patients with IE-BM, to compare these patients with those with IE only and BM only, to determine their characteristics, and to propose specific care. Association of IE and BM is a rare (3% of IE; 5% of BM) but severe condition, with a mortality rate of 28.6%, similar to the 2% rate (24/ 1025 BM) and 29% (7/24) mortality reported in the literature. The background characteristics of the patients with IE-BM appeared closer to those of patients with IE, but most patients with IE-BM at admission seemed more comparable to patients with BM with acute presentation, and altered mental status leading to a shorter time interval between symptom onset and hospitalization and antibiotic initiation. Fever was almost systematic for patients with IE and patients with IE-BM but not for patients with BM, in accordance with the literature. Cloxacillin concentrations likely to be insufficient in cerebrospinal fluid Precession (and potential responsibility) of one of the two diseases over the other is difficult to ascertain. Since the characteristics of the patients with IE-BM and patients with IE are similar, it seems plausible that in most cases, endocarditis preceded meningitis onset. The marked symptomatology of meningitis, as opposed to the more silent symptomatology of endocarditis, may explain why meningitis is in the foreground even though it is a complication of endocarditis. We observed that meningitis always resulted from a bacteremia and never from contiguous infectious foci, such as otitis. This is also valid for the classic Austrian syndrome, favored by alcoholism and immunosuppression. Besides, patients with community-acquired S. aureus meningitis almost always present with a primary infection focus such as pneumonia or endocarditis and with a short time to endocarditis diagnosis (3 days in ). Indeed, there were only four cases of S. aureus BM without IE in the BM cohort, and 77.8% of BM were associated with IE. It is noticeable that patients with IE-BM were more likely to present with cerebrovascular events, with Streptococcaceae as well as S. aureus, in line with Servy et al.. The increased risk of neurological complications usually associated with S. aureus may result from a comparison limited to pneumococcal meningitis, or a limited sample size. Given the urgency of initiating appropriate treatment for each of these two infections (Table 3), it is necessary to identify both infections beforehand. Considering the often silent nature of cardiac damage, the main challenge is to diagnose cardiac localization during meningitis rather than the opposite. However, the negativity of 12 out of the 27 (44.4%) lumbar punctures performed in the 497 patients of the endocarditis cohort (Fig. 1), because of neurological signs, underscores the non-specificity of the neurological symptoms in patients with IE, possibly resulting from sepsis or low cardiac flow. For typically IE-responsible microorganisms (S. aureus, group D and oral streptococci, enterococci), IE usually appeared preceding meningitis, although the flagrant meningitis symptomatology placed it in the foreground; in such meningitis cases, we suggest performing an echocardiography, regardless of the presence or not of a previously identified IE predisposing cardiac condition. In contrast, since pneumococcus IE is rare, a lack of improvement over the course of meningitis and/or a previously known IE predisposing cardiac condition and/or another focus of infection (particularly pneumonia) should prompt an echocardiography. Indeed, early diagnosis of IE concomitant with pneumococcal meningitis is difficult and even unlikely, as IE symptoms are often non-specific, and most patients with meningitis have only one set of blood cultures performed before antibiotic initiation, because of the urgency of the situation, which limits assessment of persistent bacteremia, the most common IE diagnostic criterion. For the few patients with IE diagnosed first, the challenge is to know when to perform lumbar puncture. All our cases of pneumococcal endocarditis were associated with meningitis as were 40% of the 111 cases reported by de Egea et al., suggesting the need for systematic or at least a low threshold to perform lumbar puncture in patients with pneumococcal IE. Coagulase-negative staphylococci were responsible for 10.5% of the IE cohort, but they were never isolated from a combined meningeal localization, either in the Dutch study or in ours. Patients with IE-BM tended towards higher mortality, possibly in relation to the increased mortality associated with S. aureus IE, and a higher risk of cerebrovascular complications (ca. 50%), consistently with the Dutch study. The higher mortality was not due to a different rate of cardiac surgery, as compared to patients with IE, which suggests that associated BM may not be a contraindication for cardiac surgery in patients with IE. In accordance with the literature, anticoagulants did not favor cerebrovascular complications [1,. Our study has some limitations. Some definitions varied between the two cohorts, notably with regard to cerebrovascular complications. However, even though our new definition took into account all potentially described cerebrovascular events for homogeneity, we cannot formally rule out a reporting bias between the two cohorts. Meningitis may have been underreported in the endocarditis cohort, and endocarditis in the meningitis cohort. Nonetheless, the population-based design of our study limits the risk of referral bias, its prospective design limits reporting bias, and the consistency between our cohorts and the literature suggests minimal biases. Another limitation could be a change in the epidemiology between the IE cohort which was formed in 2008, and the BM cohort, formed in 2013-2015. Notwithstanding this noticeable delay, it is unlikely that there is a significant change as IE guidelines were updated in 2015 without any changes recommended between 2008 and 2015, and the BM guidelines published in 2008 focused on treatment rather than on diagnosis. In the meantime, changes in vaccine recommendation concerned pathogens unrelated to IE or BM (such as pertussis, HPV, or MMR in 2014) and the extension of pneumococcal vaccine to adults at risk was published at the end of 2013, with a practical implementation posterior to the constitution of our BM cohort. Consequently, significant changes in the epidemiology of IE and BM between 2008 and 2015 or in physicians' practices are unlikely. Finally, the lack of precise information on the timing and doses of antibiotics precluded any analyses on the impact of appropriate medical treatment. CONCLUSION The combination of IE and BM is a rare event, with a dismal prognosis. Patients with pneumococcal IE or altered mental status during IE must be investigated for bacterial meningitis. Likewise, patients with S. aureus, oral and group D streptococcal or enterococcal MB, or unfavorable outcome in pneumococcal meningitis would benefit from blood cultures and echocardiography. Early diagnosis may allow better outcomes through timely surgery when needed, and optimal antibacterial regimen.

A vibration energy harvester for freight train track self-powered application Summary The safe and stable operation of the widely distributed freight trains urgently needs to solve the power supply problem of the freight train track monitoring network. In this article, an innovative and efficient energy harvesting mechanism is designed based on a mechanical vibration rectifier (MVR), with four modules of motion conversion, motion rectification, generator, and storage. The motion conversion module converts the linear vibration of the rail into rotational motion through the ball screw. The motion rectification module integrates mechanical rectification and transmission speed-up and converts the bidirectional rotation of the transmission shaft into a faster unidirectional rotation of the generator. Experiments show that the power and mechanical efficiency of the proposed vibration energy harvester can reach 28.0416W and 75.92%, respectively. This high-performance MVR can meet the power demand of wireless sensor networks by harvesting vibration energy to ensure the normal operation of freight trains. INTRODUCTION Freight trains are widely distributed, but rail safety issues during transportation are not guaranteed. Lowpower wireless sensing devices are increasingly being used to monitor track safety, but the energy supply for these sensors is a thorny issue (Ca ;;;;). The cost of transmitting electricity over long distances is prohibitive in areas with power shortages. It is difficult to ensure a normal power supply even because of harsh natural environment factors such as rugged terrain and changeable weather. If batteries are used to power these electronic devices, they can only meet the electricity demand for a short period and require regular manual maintenance. Not only is it a waste of human resources but these discarded batteries may also pollute the environment ). Environmental energy recovery technology can realize the selfpowered of wireless monitoring nodes green and cleanly. Solar energy, wave energy, wind energy, noise energy, and vibration energy are all part of environmental energy. Among them, solar energy is greatly affected by weather and seasons and cannot provide a continuous and stable energy supply (). Wind and wave energy are too dependent on terrain and region to ensure the universality of energy harvesting installations (;). The noise power generation is too low to fully meet the needs of wireless sensor devices (). Vibration energy is a widespread energy beam, such as rails, wheels, bridges, etc (;Park, 2017). Especially for the track vibration, the running speed of the train, the load, the unevenness of the track, the mismatch between the track and the wheels, etc., will cause and excite the track to different degrees of strong vibration. And the track vibration has strong adaptability to environmental conditions such as weather and temperature. Therefore, it is necessary to develop a high-performance rail vibration energy harvester to meet the electricity demand of low-power sensor devices, to ensure the safe and stable operation of freight trains. Because of the higher power generation and the need for no external power supply, some scholars have studied electromagnetic vibration energy harvesters. Pourghodrat proposed to improve the original harvester's shortcomings of being unable to harvest upward vibration ((Pourghodrat et al.,,2011). The improved model consists of gears, racks, and a pair of clutches. The test connected a resistor with a total resistance of 131U in series with the generator and obtained the output voltage on the 10U resistor. Experiments were carried out on the rotation speed of the generator under the conditions of no-load (120 rpm) and loaded (560 rpm) trains, respectively. Under no-load and load conditions, the average output power increased to 0.19 and 4.24W. Gao () et al. designed a copper-bead spaced track-type electromagnetic energy harvester, which is suitable for freight trains to capture energy caused by vibrations between the wheel pair and the track system. Using copper beads as radial spacing ensures reliable unidirectional motion of the magnets inside a multilayer-multirow coil. The magnetic levitation harvester can capture vibrations in the low-frequency range of 3-7 Hz with an amplitude of 0.6-1.2 mm. For the resonance harvest, the output power is 119 mW for a displacement of 1.2 mm load resistance of 44.6 U. A fast anchorfree installation of an energy harvester for freight trains was presented by Lin () et al. For the protection of the track structure, the energy harvester is held in place using a combination of spring preload and a reset device. Although the freight train was in operation, tests on the harvester showed a mean output of 7W at a vibration amplitude of 5.7 mm and a travel speed of 64 km/h. Pan proposed a rack-pinion pinion-based suspension energy harvester with a simplified structure (b). They also designed an enclosed lubricated gearbox and a unique two-guide-rail mechanism specifically for the harvester. The onboard test with the gearbox ratio of 43:1 was tested, and the average power was 1.3 W when the total weight of the load was about 23 tons, and the speed was 30 km/h. Zhang designed a heavy-duty freight railway harvester based on a scissor link and slider mechanism. The bench test for mechanical testing and sensing machine testing was performed with a maximum output power of 7.44W at an amplitude of 8 mm, a frequency of 4Hz, and an external resistance of 2U. However, there are still many problems in the research of electromagnetic track vibration energy harvesters. The installation of the device will cause structural changes to the track facilities, which may cause hidden dangers to the safe operation of freight trains; the energy harvester has low power generation and does not fully take advantage of the large input force of track vibration, and cannot fully cover the energy consumption of the wireless sensor system (); the reasonableness of the design, the processing accuracy of the device and the production cost, and the service life are subject to improvement (). This article proposes a novel electromagnetic track vibration energy harvester based on mechanical vibration rectifier (MVR). The device is installed on the underside of the track between the two sleepers and does not cause damage to the track structure. The proposed system includes a motion conversion module, a motion rectification module, a generator module, and an energy storage module. The ball screw is used as the motion input mechanism of the device, and the motion rectification module performs mechanical rectification and increases speed. The reciprocating vibration becomes unidirectional rotational motion after rectification and acceleration, and the mechanical energy is converted into electrical energy by the generator, which is finally stored in the supercapacitor. The acceleration ratio of the device reaches 1:48, which fully uses the large force of the track vibration caused by the freight train to increase the power generation of the energy harvester, thereby meeting the power supply demand of the wireless sensor. The energy harvester proposed in this article can not only solve the high cost of laying the power grid but also reduce the pollution of the battery to the environment. In some remote, severe cold, plateau, and other harsh environments, it provides a continuous energy supply for the wireless sensor platform to ensure the safe operation of freight trains. System design During the running of freight trains, their body weight is heavier than that of ordinary trains because of their cargo capacity. Therefore, the track can also generate more severe vibration during the running process, which leads to the dissipation of a large part of the mechanical energy. Besides, the lack of energy supply for the auxiliary monitoring facilities of most freight trains during running. Therefore, a track vibration energy harvesting device integrating motion conversion and motion rectification modules is proposed. Selfpower supply for the electrical equipment connected to the freight train tracks includes traffic lights, track quality and safety monitoring sensors, and other auxiliary facilities. As shown in Figure 1, the track vibration energy harvesting device includes four modules: A motion conversion module, a motion rectification module, a generator module, and an energy storage module. The motion conversion module transmits track vibration and converts linear reciprocating motion into bidirectional rotational motion. The motion rectification module has speed boosting and mechanical rectification functions. A brushless generator is used as the electrical output device. In practical applications, the generated electrical energy is rectified and stabilized and finally stored in the supercapacitor. Figure 2 illustrates the structure of the motion conversion module used to harvest the vertical vibration response of the track. The energy conversion module includes two single-degree-of-freedom motion input boards, two fixed boards, four fixed shafts, a set of right-handed ball screw, and a large bevel gear. The iScience Article upper input board harvests the track vibration through the shaft holders, the linear sliding circular flange bearing, and the two support shafts. When the track is in contact with the upper input board, the input boards move the nut downwards and the lead screw drives the large bevel gear to rotate counterclockwise. When the speed is 0 mm/s, the upper input board moves upward in the opposite direction. At this time, the nut moves upwards and the lead screw drives the large bevel gear to rotate clockwise. The up and down movement of the nut causes the lead screw to make a reciprocating rotational movement, thus achieving the same reciprocating rotational movement of the large bevel gear. The motion of the entire process is transformed from the linear vibration input of the track to rotational motion. Finally, the motion is transmitted to the motion rectification module by meshing large and small bevel gears. Motion rectification module As shown in Figure 3, the motion rectification module is the key part of the energy harvester, increasing the transmission speed and mechanical rectification. The core of the motion rectification section is the one-way bearing in gear ① and gear ③. The two one-way bearings are placed in the inner holes of gear ① and gear ③ with opposite meshing directions. They are connected with gears ① and ③ by welding. This is significant because the transmission shaft meshes with gear ① and gear ③ in opposite directions, respectively. When gear ② is turned clockwise, the internal one-way bearing of gear ① transmits the torque and is responsible for the motion transmission. At this time, the internal one-way bearing of gear ③ is in the overrun state and does not transmit torque. After two-stage gear acceleration, the rotation is transmitted to the generator shaft, causing the generator shaft to rotate clockwise. When gear ② rotates counterclockwise, the internal one-way bearing of gear ③ transmits torque and is responsible for motion transmission. At this time, the internal one-way bearing of gear ① is in the overrun state and does not transmit torque. Then after twostage gear acceleration, the rotation is transmitted to the generator shaft, which still rotates in a clockwise direction. Gear ⑤ is an idler gear, which in addition to changing the direction, also plays a role in satisfying iScience Article the arrangement of the entire transmission system by extending the wheelbase. It also has a certain energy storage effect, which contributes to the stability of the system. The bidirectional rotation of the input is converted into unidirectional rotation of the output using a motion rectification module. This significantly increases the degree of energy harvesting compared to bidirectional rotation and improves the harvesting efficiency and reliability of the system. Finally, the conversion of the bidirectional reciprocating motion of the track to the unidirectional rotational motion of the shaft of the generator is realized. Generator module The unidirectional rotation generated by the motion rectification module can be converted into electrical energy by the generator module. To improve the power generation efficiency and facilitate installation, the generator should have the characteristics of small rotational inertia, small copper loss and small size ). Therefore, the generator (57BL55S06-230TF9) is selected in this article, as shown in Figure 4. The detailed parameters of the generator are shown in Table 1. Energy storage module Because the brushless generator used in this article produces a three-phase alternating current, it cannot directly store or supply power to the load. Therefore, as shown in Figure 4, a three-phase bridge rectifier iScience Article circuit converts three-phase alternating current into direct-current pulse current. Then, the generator excitation current is controlled by the voltage regulator, and the output voltage is adjusted to a constant value. So that it can stably and continuously supply power to the load. Compared with batteries, supercapacitors have excellent cycle stability, large energy storage capacity, high power density, extremely fast charging and discharging speed, high energy conversion efficiency, long service life, strong temperature performance, and high safety factor. Considering the particularity of the freight train track environment, the energy storage elements are required to have a longer working life, stronger temperature adaptability, and larger energy storage space. Therefore, supercapacitors are chosen as energy storage elements. Dynamic analysis and simulation This section carries out the dynamic analysis of the MVR to establish the mathematical model of the device and analyze the dynamic characteristics of the device. Modeling the device can provide a theoretical basis for subsequent simulations and experiments, as shown in Figure 5. This articles proposes a freight train track vibration energy harvester with a ball screw as the core conversion component. Different from the traditional linear energy harvesting device of the track, the MVR takes full advantage of the large input force by adding a set of speedincreasing bevel gears. Continue to increase the speed in the spur gear transmission and convert the reciprocating linear vibration of the track into the unidirectional rotation of the generator through the one-way bearing, which further improves the power generation performance of the MVR. When the small cylindrical spur gear and the transmission shaft are relatively stationary, the one-way bearing engages with the transmission shaft to transmit the torque and drives the generator to rotate unidirectionally. On the contrary, when the rotation speed of the small cylindrical spur gear is lower than that of the transmission shaft, the one-way bearing is idling and does not transmit motion torque. At this time, the one-way bearing on iScience Article the other side is in the meshing state, so the two sides mesh alternately. In this way, the continuity of the movement is ensured, and mechanical rectification and acceleration are realized at the same time. Analysis of rotation damping coefficient of generator As shown in Figure 6, the three windings of the brushless generator are connected in a star shape. The resulting AC will have a phase difference of 120. The three-phase voltage of the generator can be expressed as: where, V 1, V 2, and V 3 are the phase voltages of the generator; E m and u S represent the amplitude and angular frequency of the induced voltage. The power P C that can be recovered in the circuit and the power P l caused by the internal resistance consumption constitutes the electromagnetic power P E of the generation, P E can be expressed as: where, the internal resistance of the generator is denoted by R i ; and P C can be represented as: The electromagnetic efficiency h e of the device can be expressed as: Combining Equation with Equation, the electromagnetic power can be expressed as: At the same time, the amplitude E m of the induced voltage can be obtained from the angular velocity u g of the generator shaft and the back EMF constant k e, which is expressed as follows: Substituting Equation into Equation, the electromagnetic power P E can be simplified as: Because of the conservation of energy, the electromagnetic power P E is also expressed as: where, the electromagnetic torque of the generator shaft is denoted by T E. The electromagnetic torque of the generator shaft is linearly related to the angular velocity of the shaft, which can be expressed as follows: where, the generator rotation damping coefficient is denoted by C R. Combining Equation with Equation, the electromagnetic power can be expressed as: The expression of the generator rotation damping coefficient C R can be derived from Equations and : ) iScience Article This equation shows that the generator rotation damping coefficient is proportional to the back EMF constant k e and inversely proportional to the total circuit resistance (R e, R i ). Linear damping coefficient analysis From the law of conservation of energy, it is clear that the input system power P input is equal to the sum of the power lost by the system P f and the electromagnetic power P E of the generator. The power lost by the system is mainly divided into four parts: ball screw, bevel gear, spur gear, and generator loss power. ) where, the transmission efficiency of the ball screw is denoted by h bs ; the transmission efficiency of the bevel gears is denoted by h b ; the transmission efficiency of the spur gear system is denoted by h sg ; the mechanical efficiency of the generator is denoted by h g ; the total transmission efficiency is denoted by h. Because in the following friction analysis, the friction generated by the interaction of various mechanical components such as ball screws, bevel gear assembly, spur gear meshing, bearings, etc., has been considered in the MVR system. These are the same as the total loss efficiency h. Here we set the total transmission efficiency h = 1 because we will introduce the friction F f into the overall system dynamics analysis later. The input power of the MVR can be expressed as: where, C L is the linear damping of the MVR; _ x is the velocity of the input board. Substitute Equations and in turn into Equation, we can get: Linear motion can be converted into rotary motion using a ball screw, and the conversion equation is: where, the rotational angular velocity of the ball screw is denoted by u; the lead of the ball screw is denoted by l. the shaft angular velocity of the generator is denoted by u g ; the transmission ratio of the bevel gears is denoted by i 1 ; the transmission ratio of the spur gear system is denoted by i 2 、i 3 ; the total transmission ratio is denoted by. Combining Equations and with Equation gives an expression for the linear damping coefficient The above equation shows that the linear damping coefficient C L of the MVR is proportional to the total transmission ratio and the back EMF constant of the generator; it is inversely proportional to the total loss efficiency, the lead of the ball screw, and the total circuit resistance. Friction analysis In the MVR structure, the friction generated by the interaction of various mechanical components such as ball screws, bevel gear assembly, spur gear meshing, and bearings is the main cause of power loss. The literature proposes that oversimplification of the MVR model can lead to an incorrect assessment of total power absorption during modeling and analysis. The frictions from the different components of the MVR are combined into one term and expressed using the following Equation (Armstrong-H ;;): and F e are the total friction, the Coulomb friction, the Stribeck friction, viscous friction coefficient, and maximum static friction, and v and V s are the velocity of the MVR and the relative velocity threshold for the Stribeck friction. When the MVR is still, the static friction can be any value less than F e, depending on the value of the actuating force. The unknown term in the expression for total friction F f can be obtained by measuring the force required by the MVR system in the open circuit state without any external resistance and using the mathematical least squares method. Kinetic analysis The MVR generates a displacement x under the action of the excitation force F 1, and the mathematical description of the vibration system can be obtained by the Lagrangian equation as follows: where, the kinetic energy of the MVR is denoted by T; the dissipation function of the MVR is denoted by D. When the one-way bearings transmit torque, the equation of motion is as follows: where, the angle of rotation of the ball screw is denoted by q in ; the angle of rotation when the one-way bearing is engaged is denoted by q. The angular velocity u of the ball screw in the motion conversion module can be expressed as follows: The kinetic energy T of the input transmission system can be expressed as the sum of the kinetic energy of the reciprocating part and the kinetic energy of the rotating part. inertia of small bevel gear is J sb ; inertia of large cylindrical spur gear ② is J lg ; inertia of small cylindrical spur gears ① and ③ is J sg1 ; inertia of medium cylindrical spur gears ④ and ⑥ is J mg ; inertia of small cylindrical spur gears ⑤ and ⑦ is J sg2 ; rotational inertia of generator is J g. Substituting Equation into Equation, the kinetic energy T of the MVR can be obtained: The MVR dissipation function can be expressed using the Rayleigh dissipation function: The expression of the excitation force F 1 can be obtained by combining the three Equations,, and : When going down: ) When going up: ) where, g is the gravitational acceleration; We introduce the overall friction F f of the MVR system into the system dynamics. Because the total transmission efficiency is 100%, we can get the final system dynamics equation as follows: When going down: Device parameters are shown in Table 2. System simulation Because of the limitation of the experimental equipment, the sinusoidal vibration input was selected for the experiment. Therefore, the system simulation is for sinusoidal input. That is to analyze the changes and differences in the power characteristics and damping force of the MVR harvester under different amplitudes, frequencies, and external load resistances. When the external load resistance value is set to be 5U, the variation of the system damping force under different vibration frequencies and amplitudes is shown in Figure 7. At the same frequency, the damping force of the MVR increases with the amplitude; at the same amplitude, the damping force of the MVR increases with the frequency. Therefore, the damping force is proportional to the vibration frequency and amplitude. Experiment details The bench experiments of the MVR were carried out using the MTS Landmark 370.02 servo-hydraulic test system, as shown in Figure 8A. The main parameters of this MTS test system are shown in Table 3 below. The MTS test system controls the vertical position of the lifting beam by the lifting switch to adjust the proposed model in the proper space. When the displacement of the telescopic beam changes, the configured force sensor can record the real-time input force. The upper and lower hydraulic wedge clamps use locking switches to fix the model to keep the model stable during the experiment. The MTS test system also has an emergency stop button to ensure the safety of the whole process of the experiment. Because the vibration frequency of the track is from 1 to 4Hz, the vibration amplitude is between 1 and 12mm (). While verifying the practical feasibility of the MVR proposed in this article, the limitations of the Parameter Value Ball screw lead l 40mm First-stage bevel gear transmission ratio i 1 4 Second-stage spur transmission ratio i 2 4 Third-stage spur transmission ratio i 3 3 The total transmission ratio i 48 The total mass of objects in reciprocating iScience Article experimental equipment should also be considered. Therefore, the experiment was carried out under the condition of a sinusoidal input waveform with a vibration frequency of 1-2.5Hz and an amplitude of 2-4mm. The on-site layout of the experimental equipment is shown in Figure 8A. The full-scale prototype of the proposed MVR is fixed on the MTS test system, as shown in Figure 8B. Set different parameters and control the start and stop of the experimental bench through the console, as shown in Figure 8C. The displacement and force signals were then measured and recorded with a computer, as shown in Figure 8D. The threephase generator is connected to three load resistances of equal value, and the resistance values are set to 1, 3, and 5U, respectively, as shown in Figure 8E. Finally, the voltage signal of the external load resistor is displayed by an oscilloscope (model RIGOL DS1102Z-E) and stored in the USB flash disk, as shown in Figure 8F. The field installation details of the MVR under the real track and equipment are shown in Figure 9, including the prototype, oscilloscope, resistors, supercapacitors, a computer, etc. Use an uninterruptible power supply (UPS) to solve the power problem. It shows the layout of MVR in practical application scenarios. Friction recognition The experimental determination of the unknown term in Equation is divided into two steps. The first step determines the values of F f and v under different conditions. The MTS test system is set to excitation with triangular wave displacement (square wave velocity). The generator is always an open circuit, so the force measured at different frequencies and amplitudes is the value of F f of the MVR. Because the MTS machine is a triangular wave displacement input, the relationship between the square wave velocity and triangular wave displacement is v = 4 fa, where f is the frequency and a is the amplitude, thus determining the value of the velocity v. The second step determines the unknowns by fitting the equations. The values of F f and v of different groups are combined with the least squares method to calculate the value of the unknown iScience Article parameter in Equation. Table 4 lists the average friction and velocity values measured at a frequency of 1.5 Hz at different amplitudes. Figure 10 shows the input force of the testing machine toward the prototype under the excitation of triangular wave displacement (square wave velocity) at 1.5 Hz. It can be seen that there is still some force fluctuation when the velocity is constant. There are three reasons for this. First, the MVR uses multiple complex transmission components. Because of the precision of processing and assembly, the parts may bounce or misalign, and some iScience Article shocks may occur, resulting in a sudden increase in the force value. Second, the rotational inertia of the transmission system adopted by the MVR is relatively large, which may lead to a certain degree of flywheel effect. Third, because the MTS equipment uses a PID controller, some overshoot and fluctuation will also affect the input force of the MVR, especially when the triangular wave displacement input is used; the sudden change of the driving direction will make this phenomenon more obvious. Input and output characteristics of the system The proposed prototype was tested on the MTS test system with a sinusoidal input. In the experiment, the vibration amplitudes are 2, 3, and 4mm, the vibration frequencies are 1, 1.5, 2, and 2.5Hz, and the external loads are 1, 3, and 5U. Figure 11 shows the force-displacement loops when the vibration frequency and amplitude are taken as constant values, respectively. The experimental results show that the input force increases when the amplitude or frequency increases. The reason is that when the amplitude or frequency becomes larger, the rotational and linear speed increases, and more kinetic energy needs to be generated to meet the demands of the rotating parts. This means that a larger force needs to be input per unit displacement. In addition, the results also show that the effect of amplitude on the input force is more obvious. In Figure 12, we analyze the differences between the simulation and experimental results in detail. It can be seen from the comparison that there are five main reasons for the difference between the simulation forcedisplacement loop and the experimental force-displacement loop. First of all, as shown in mark ①, the experimental value is lower than the simulation value at this time. This is because of the manufacturing and assembly accuracy problems of the MVR, which caused stuck during the experiment, resulting in a low and fluctuating input force. At the position of ②, the force-displacement loop is misaligned, which is caused by the disengagement and engagement under the action of inertia. After the velocity of the input components decreases until it stops, the output rotating components continue to rotate because of inertia and stop later than the input components. When the displacement reaches its maximum value and changes direction, the input components temporarily disengage from the output rotating components. The input force after disengagement drops to a very low value, which results in a large change in amplitude but a small change in force. As shown in mark ③, the area of the experimental force-displacement loop is smaller than that of the simulation force-displacement loop. The reason for this phenomenon is the same as that of ②. Since the disengagement and engagement processes are not considered in the simulation process, the change of the input force is delayed. At the position of ④ in the Figure 12, the value of the experimental force suddenly increases and exceeds the simulation value. This is the result of the combined action of inertia and shock. ④ only appears in the experimental results with higher frequency because the inertia iScience Article effect of the rotating system is more obvious in the high-frequency state, and the faster speed will increase the possibility of shock. In addition, it can be seen that the phenomenon of force fluctuation generally exists in the experimental results, as shown in ⑤. The reason is that the electromagnetic distribution in the generator is not uniform, and the input frequency is low, which causes the damping force to change when the coil cuts off the magnetic induction line (). Although the differences mentioned above exist between the simulation and experimental results, the area range of the force-displacement loop and the magnitude of the force are generally the same. The optimization of the friction model achieves a good match between the simulation and the experiment, and the simulation and experiment force-displacement loops have a high degree of fit. Therefore, it is shown that dynamic models can perform well in predicting MVR performance. As shown in Figure 13, when the external load resistance is constant at 5U, the instantaneous voltage changes with time under different vibrational frequencies and amplitudes. We can see that as the vibration amplitude and vibration frequency increase, the voltage value also increases. In the experimental data, like the influence on the input, the influence of the vibration amplitude on the output voltage is also greater than that of the vibration frequency. The device has a certain flywheel effect, which increases the energy density of the device. The mechanical efficiency of the MVR is calculated from the experimental data, and the mechanical efficiency of the system is: Where W input is calculated from the area surrounded by the experimental force-displacement loop, and W output is calculated from the experimental instantaneous voltage U(t): R e dt (Equation 31) Calculating the output electrical power results of different amplitudes and frequencies and the statistics are shown in Table 5. The output electrical power ranges from a minimum of 6.8988W to a maximum of 28.0416W, and the average mechanical efficiency of the system is 42.73%. It is found that when the external load equals the generator's internal resistance, the load's power reaches the maximum value. It is known that the internal resistance of the generator R i = 1.15U, so when the load resistance gradually approaches the internal resistance R i = 1.15U from 5 to 3U, it finally becomes 1U. The output electrical power increases continuously as the load resistance decreases. Luigi Costanzo et al. introduced an electronic interface for maximizing power extraction from a train suspension energy harvester. A novel maximum power point tracking (MPPT) technique is realized by a DC-DC converter equipped with speed driven adaptive (SDA). Although train vibration characteristics may vary over time, this technique quickly stabilizes the voltage at the rectifier output to an optimum value by measuring the generator velocity in real-time. The SDA technique implements a dynamic adaptive control to handle the tolerances and time variability of the controlled system parameters. Compared with the widely used perturb and observe (P&O), the SDA technique performs better ((Costanzo et al.,,2020. In the follow-up article, the influence of the voltage drops of the diode bridge rectifier is considered, further optimization is carried out, and a more accurate model is proposed. It is verified experimentally with constant and time-varying generator speeds. In addition, it iScience Article extends to active AC-DC converters, which have better power extraction performance than passive rectifiers because they can manage both active and reactive power. But more complex control techniques also result in higher control losses relative to passive rectifiers. For both types of converters, the optimal operating conditions for maximum power can be predicted by measuring the generator speed (). The proposed system can obtain better output performance if the above optimizations are taken for the energy harvesting circuit in the practical application of MVR. lot the efficiency values as a three-dimensional curve, as shown in Figure 14 below. The mechanical efficiency is inversely proportional to the vibration amplitude and frequency when the load resistance is constant at 1U. And the amplitude change has a more significant effect on the efficiency, as shown in Figure 14A. When the vibration frequency is constant at 2 Hz, the mechanical efficiency generally decreases with the amplitude and load resistance increase. The closer the load resistance is to the internal resistance of the generator, the greater the mechanical efficiency, as shown in Figure 14B. When the vibration amplitude is constant at 2mm, the vibration frequency and load resistance negatively correlate with the iScience Article mechanical efficiency. And the change in load resistance has a greater impact on efficiency currently, as shown in Figure 14C. In general, the mechanical efficiency of MVR increases with the decrease of vibration amplitude, vibration frequency, and load resistance in the experimental data. Charging experiment and application analysis The MTS bench test using MVR to charge supercapacitors is shown in Figure 15. The test adopts the vibration condition of the lowest frequency and the smallest amplitude: the vibration frequency is 1.5Hz, and the vibration amplitude is 2mm. Using the smallest data can better prove the feasibility of the MVR to charge the supercapacitor and power the tracking sensor network. The capacitances are 1, 1.65 and 2.5F, respectively. With the same output voltage, in theory, the final voltage of the supercapacitor can be the same. But the test results show that the charging voltage of the supercapacitor can first rise rapidly to a certain value and then slowly rise to the final value. It can also be seen from Figure 15 that different capacitances have a different time to reach the same charging voltage. As the capacitance increases, so does time. In general, the fast-charging characteristics and large-capacity characteristics of supercapacitors provide the necessary guarantee for the self-power of sensor networks. To ensure the safety and feasibility of the device, a comparative analysis is made on whether the proposed energy harvester is installed on the track. The experimental data uses the experimental displacement responses recorded by the MTS test system. Among them, the data adopts the largest data in this experiment; the vibration frequency is 2.5Hz, the amplitude is 4mm, and the external load is 5U for testing. iScience Article Therefore, the safety of the device can be better proved. From Figure 16, it can be concluded that the presence or absence of MVR has very little effect on the track. In addition, comparing the vibration data after installing the MVR with the original vibration data, the mean relative error (MRE) was 0.0125%. The iScience Article installation of MVR will not affect the dynamic response of the train, nor will it bring any safety problems to the train operation. Figure 17 shows the practical application of the proposed MVR in a heavy-duty freight train railway. When a freight train passes, the contact between the wheels and the track will cause irregular reciprocating vibrations. The MVR harvests the track vibration energy that would otherwise be wasted through rectification and voltage regulation processing to achieve the purpose of power generation. The electrical energy stored in the supercapacitor powers low-power wireless sensors such as tilt sensors, acceleration sensors, gyroscope sensors, and displacement sensors. The sensor transmits the track safety information monitored in real-time to the remote monitoring terminal through the wireless sensor network, signal processing, satellite transmission, and other processes and keep information interaction with freight trains at all times. If there is a safety problem on the track, the train driver can be notified via satellite to avoid safety accidents. In addition, there are two energy supplies for the sensor: battery and grid. In some remote areas, the battery needs to be replaced manually and regularly, and it will cause a certain degree of pollution to the environment. Laying the power grid consumes a lot of manpower and material resources, and long-distance power transmission will also cause power loss. Through harvesting track vibration energy, the self-power of low-power wireless sensors is realized. The MVR feeds back the energy from the track to the safety monitoring of the track to ensure the stable and safe operation of the freight train. Therefore, the MVR proposed in this article, applied to wireless sensor self-powered and freight train track safety monitoring, has huge economic benefits and application value. iScience Article From Ref (a), it can be known that the vibration range of the track is 1-12mm and 1-4Hz, and the specific situation is related to the train type and load. This article studies heavy-duty tracks for freight trains. Because of equipment limitations, etc., the 2-4mm and 1.5-2.5Hz used in the experiment are the smaller values in the track vibrations. In heavy-duty track conditions, the MVR will generate more power. Therefore, it is of great reference value to use the average power under the condition of 2.5Hz as the estimation of power generation. Track wireless sensor systems often include tilt, acceleration, displacement, and pressure sensors. The combined power of these sensors is 0.48W. Table 6 lists the parameters of several other common track monitoring wireless sensors. The average power is 24.7029W when the load is 1U, and the vibration frequency is 2.5Hz. Assuming that the speed of the freight train is 60 km/h, the fixed wheelbase of the bogie is 1800mm, the diameter of the upper roof is 120mm, the action time of one carriage on the MVR is 0.1152s, the number of carriages is 100, and the number of trains passing through each day is 24. To fully harvest the track vibration energy, 20 proposed MVRs are arranged on opposite sides of the track. When all trains in a day pass by the MVRs, the total power generation is 136.60kJ. The combination of four common track-side wireless sensors: tilt sensor, acceleration sensor, displacement sensor, and pressure sensor, can be continuously powered for 70.05h >24 h. It can realize the all-day power supply to the sensor combination. This is the case where the vibration amplitude and frequency are smaller than the actual vibration of the track, and only 10 MVRs are arranged on one side of the track. If the proposed MVRs are installed on a large scale, a higher power generation will be achieved, which can fully realize the selfpowered wireless sensor networks. Table 7 summarizes the electromagnetic vibration energy harvester systems proposed in the railway field. The mechanism, installation location, electrical performance, and efficiency are compared. All prototypes and data are from the corresponding literature. From the installation position, the output power of the devices on the track-side is significantly higher than that of the onboard devices, but the efficiency is lower. However, MVR has improved in efficiency compared to track-side or onboard devices. At the same time, its output power is also higher in the track-side devices. In contrast, it can be seen that the proposed MVR in this article has better electrical performance and energy conversion efficiency. Conclusions This article proposes a track vibration energy harvesting system with a MVR mechanism as the core. The motion conversion module and the motion rectification module of the device are arranged vertically to avoid excessive length, which is beneficial to the installation of the device. The mechanism of the MVR adopts a design that combines the bevel gear speed increase and the spur gear multi-stage speed increase. This can fully use the large input force of the track vibration and harvest the track vibration energy to a greater extent. The system includes four modules: motion conversion, rectification, generator, and storage. The motion conversion module converts the linear vibration of the track into the bidirectional rotation of the bevel gear through the ball screw. The motion rectification module converts the bidirectional rotation of the bevel gear into a faster unidirectional rotation of the generator shaft by integrating mechanical rectification and speed increase. Then, the three-phase brushless generator generates electrical energy. After the rectification and voltage regulation, the electrical energy will be stored in the iScience Article supercapacitor and supplied to the track-side wireless sensor systems. The performance and dynamic response of the proposed device are verified by simulation and experimental analysis. The proposed MVR adopts sinusoidal input in the MTS bench experiment. When the amplitude is 4mm, the frequency is 2.5Hz, and the external load is 1U, the power can reach 28.0416W. The highest mechanical efficiency is 75.92%, and its average value is 42.73%. Because of the heavy load conditions of freight train tracks, the proposed MVR has great potential for power generation. The realization of low-power wireless sensor self-energy can ensure the safe operation of freight trains and contribute to green energy development, carbon neutrality, emission reduction, and environmental protection. Limitations of the study The proposed vibration energy harvesting system still needs further optimization analysis and field experiments. The limitations of this study are summarized as follows: Because of experimental conditions and equipment limitations, the simulation and experiment use a regular sine wave input. To more accurately evaluate the performance of the proposed system, future studies will be tested on real-running tracks. Start the finite element analysis and fatigue testing of the proposed system and further improve the machining and fitting accuracy of the device to predict and improve the life of the device. Clean energy such as solar, wind, and noise are also included along the freight train track. Therefore, there is great potential to explore the form of hybrid energy harvesting as a supplementary energy source for MVR. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d KEY RESOURCES TABLE

An Analysis of Sites of Disease in Revision Endoscopic Sinus Surgery Revision endoscopic sinus surgery is performed when symptoms associated with sinusitis persist after sinus surgery and despite continued medical therapy. The causes of treatment failure are varied and may include systemic, mucosal, and anatomic factors associated with persistent inflammatory disease. The purpose of this retrospective review was to define the sites of recurrent or persistent sinonasal disease in patients undergoing revision endoscopic sinus surgery. This data was based on our preoperative CT scan and nasal endoscopy, as well as intraoperative findings. This study includes an evaluation of the most recent sinus surgery in a group of 153 patients and 265 operated sides. The frequency and distribution of regional anatomic sites of disease is presented and discussed.

PAMELA data and leptonically decaying dark matter Recently PAMELA released their first results on the positron and antiproton ratios. Stimulated by the new data, we studied the cosmic ray propagation models and calculated the secondary positron and antiproton spectra. The low energy positron ratio can be consistent with data in the convection propagation model. Above $\sim 10$ GeV PAMELA data shows a clear excess on the positron ratio. However, the secondary antiproton is roughly consistent with data. The positron excess may be a direct evidence of dark matter annihilation or decay. We compare the positron and anti-proton spectra with data by assuming dark matter annihilates or decays into different final states. The PAMELA data actually excludes quark pairs being the main final states, disfavors gauge boson final states. Only in the case of leptonic final states the positron and anti-proton spectra can be explained simultaneously. We also compare the decaying and annihilating dark matter scenarios to account for the PAMELA results and prefer to the decaying dark matter. Finally we consider a decaying neutralino dark matter model in the frame of supersymmetry with R-parity violation. The PAMELA data is well fitted with neutralino mass $600\sim 2000$ GeV and life time $\sim 10^{26}$ seconds. We also demonstrate that neutralino with mass around 2TeV can fit PAMELA and ATIC data simultaneously. I. INTRODUCTION The existence of dark matter (DM) has been confirmed by many astronomical observations, but the nature of DM is still an open question. Many kinds of particles in theories beyond the standard model (SM) are proposed as DM candidates. The DM particles are usually stable due to the protection of some discrete symmetry. For example, the lightest supersymmetric particle (LSP) in the usual supersymmetric (SUSY) model is stale due to the conservation of R-parity, and is a well motivated candidate for DM. Generally there are three kinds of strategies to detect the DM particles: the "collider search" at large colliders such as large hadron collider (LHC) or international linear collider (ILC); the "direct detection" to find the signal of nuclei recoil when DM particles scatter off the detector; the "indirect detection" to search for the products from DM annihilation or decay, such as neutrinos, photons and anti-matter particles. It is usually a big challenge for indirect detection due to the difficulty in discriminating the signal from the astrophysical background. Therefore precise measurements with wide energy range and improved resolution are necessary for DM indirect detection. PAMELA is a satellite borne experiment designed to measure the cosmic rays (CRs) in a wide energy range with unprecedented accuracy. Recently, the PAMELA collaboration released the first data about antiprotons and positrons. Usually it is thought that antiprotons and positrons are produced when CRs propagate in the Milky Way and collide with the interstellar medium (ISM). The abundance of these secondaries can be calculated with relatively high precision. However, the PAMELA results show an obvious excess in the faction of e + /(e + + e − ) at energies above ∼ 10 GeV. Interestingly the excess keeps to rise up to energy ∼ 100 GeV. On the other hand, the spectrum of antiprotons fits the prediction quite well. These results confirm the previous results by HEAT and AMS within the error bars. The PAMELA results may provide a direct evidence of DM in the way of "indirect detection". However, before resorting to the exotic physics of DM, it is necessary to go through the possible astrophysical sources to account for this results. The model-independent spectral shape analysis shows that there might be most likely a primary source with e + e − pairs required to explain the rise of the positron fraction. The non-excess of the antiproton data also favors a leptonic origin of the positrons. Pulsar is thought to be a good candidate to produce only leptons, and was used to explain the previous HEAT data. The recent analysis show that the PAMELA data can also be fitted considering the contributions from nearby pulsars such as Geminga and B0656+14. It should be noted that another interesting conclusion in Ref. shows that the uncertainties of the propagation of CRs, the production cross section of secondary particles and the errors of electron measurements might lead to the underestimation of the positron fraction, and the "excess" is actually not an excess. As one possibility, the contribution from DM annihilation or decay is also widely discussed. The scenarios about DM annihilation include (i) annihilation to SM particle pairs, like gauge boson, quark and lepton pairs ; (ii) virtual internal bremsstrahlung process to e + e − ; (iii) annihilation to new mediating particle pair which would decay to e + e −, etc. However, in the DM annihilation scenario, an unnatural large "boost factor" is necessary to reproduce the PAMELA positron data. Another problem is that the non-excess of thep/p data will set constraint on the properties of annihilating DM, which makes the model building difficult. Considering the difficulties to explain the large positron excess by annihilating DM, we propose to solve the problem using decaying DM in the present work. If there exists some tiny symmetry violation, the DM particles can decay very slowly to SM particles. The decaying DM models are studied extensively in literatures to explain the observational data or set constraints on the decay properties of DM. For the self-consistence of this work, we first studied the process of cosmic ray propagation carefully, and give realistic propagation models to produce the background contributions to positrons and antiprotons from CR interaction with ISM. The DM induced positrons and antiprotons are calculated in the same propagation models. We find that the PAMELA data can be well fitted for a leptonically decaying DM (LDDM) model. The results for different decay final states are discussed in detail. And a possible model in the SUSY frame with R-parity violation is proposed. The paper is organized as follows. In section II, we discuss the propagation of CRs and give the updated positron and antiproton background estimations. In section III, we present a model-independent approach to recover the PAMELA data and discuss why we need the decaying DM whose decay products are mainly leptons. In section IV, we give an example of this LDDM model and discuss another possibility. Finally we give the summary and discussion in section V. II. PROPAGATION OF GALACTIC COSMIC RAYS In this section we will study the cosmic ray propagation model carefully so that we can predict the positron and antiproton spectra to compare with the PAMELA data. The charged particles propagate diffusively in the Galaxy due to the scattering with random magnetic field. The interactions with ISM and interstellar radiation field (ISRF) will lead to energy losses of CRs. For heavy nuclei and unstable nuclei there are fragmentation processes by collisions with ISM and radiactive decays respectively. In addition, the overall convection driven by the Galactic wind and reacceleration due to the interstellar shock will also affect the distribution function of CRs. The propagation equation can be written as where is the density of cosmic ray particles per unit momentum interval, Q(x, p) is the source term, D xx is the spatial diffusion coefficient, V c is the convection velocity, D pp is the diffusion coefficient in momentum space used to describe the reacceleration process, p ≡ dp/dt is the momentum loss rate, f and r are time scales for fragmentation and radioactive decay respectively. We describe a bit more about the relevant terms in Eq. in the follow. For primary particles such as the protons and some heavy nuclei, the source function is the product of two parts: the spatial distribution f (x) and energy spectrum q(p). f (x) can follow the distribution of possible sources of CRs, such as the supernova remnants (SNR). The injection spectrum q(p) ∝ p − is usually assumed to be a power law or broken power law function with respect to momentum p. For secondary particles the source function is given according to the distributions of primary CRs and ISM where p (x, p) is the density of primary CRs, c is the velocity of injection CRs, H and He are the cross sections for the secondary particles from the progenitors of H and He targets, n H and n He are the interstellar Hydrogen and Helium number densities, respectively. The spatial diffusion is regarded as isotropic and described using a rigidity dependent The reacceleration is described by the diffusion in momentum space. The momentum diffusion coefficient D pp relates with the spatial diffusion coefficient D xx as where v A is the Alfven speed, w is the ratio of magnetohydrodynamic wave energy density to the magnetic field energy density, which characterizes the level of turbulence. w can be taken as 1 and the reacceleration is determined by the Alfven speed v A. The convection velocity, which corresponds to the Galactic wind, is assumed to be cylindrically symmetric and increase linearly with the height z from the Galactic plane. It means a constant adiabatic energy loss of CRs. V c (z = 0) = 0 is adopted to avoid the discontinuity across the Galactic plane. Finally the energy losses and fragmentations can be calculated according to the interactions between CRs and ISM or ISRF. For some simplified cases the propagation equation can be solved analytically using the Green's function method. However, generally it is not easy to find the analytical solution. A numerical method to solve this equation has been developed by Strong and Moskalenko, known as the GALPROP model. In GALPROP, the realistic astrophysical inputs such as the ISM and ISRF are adopted to calculate the fragmentations and energy losses of CRs. The parameters are tuned to reproduce the observational CR spectra at Earth. It is shown that the GALPROP model can give relative good descriptions of all kinds of CRs, including the secondaries such as e +,p and diffuse -rays. In this work we employ GALPROP models to calculate the propagation of CRs. Two GALPROP models are adopted. One is the diffusion + convection (DC) scenario and the other is the diffusion + reacceleration (DR) model. It has been shown that the DR model is easier to reproduce the energy dependence of the observed B/C data. However, the reacceleration will produce more low energy CRs and overestimate the low energy spectra of electrons, positrons, protons and Helium. In addition the DR model seems to underproduce the antiprotons. In DC model, the results of e −, e +, p andp are in better agreement with the data, but the "peak" around 1 GeV of the B/C data is not well generated in the model. Here we quote these two models in the sense that the differences between these models are regarded as the uncertainties of the propagation model of CRs. The propagation parameters are listed in Table I. Other parameters which are not included in the table are: the height of the propagation halo z h = 4 kpc, the spatial distribution of kpc and z s = 0.2 kpc. III. MOTIVATION FOR A LEPTONICALLY DECAYING DM MODEL In the section we will adopt a model independent approach to constrain the DM annihilation or decay products from the PAMELA data. We find the PAMELA data actually excludes the annihilation or decay products being quark pairs, strongly disfavors the gauge bosons and favors dominant leptonic final states. In principle, there should be no difference in treating annihilation or decay. However, there is a subtle difference for the two scenarios. We know that the annihilation or decay depends on the DM density in different ways. Further since what we observed on Earth is the integrated positron or antiproton flux from the nearby region, we may get slightly different spectra after propagation for the annihilation or decay scenarios even the source spectra are the same. In the section we only study the case of decay to show the result. However, the main conclusion will be unchanged for annihilation. In the last of the section we also show why decaying DM is superior to annihilating DM. The source term in Eq. 1 is given by where (r) is the DM density distribution in the Galaxy, DM is the life time of DM, dN/dE is the original positrons spectrum from each DM decay. The DM mass m DM is supposed to be a free parameter while its life DM will be fixed by the positron fraction. In the work we take the NFW profile for DM distribution with the local DM density ⊙ = 0.3GeV /cm 3. We assume two-body final state with energy of 100 and 300 GeV for either quark, lepton In Fig.3, we show the positron and antiproton fraction when the decay products are gauge boson pairs. We find that the positron spectrum from gauge boson decay is usually softer than PAMELA given even taking the gauge boson energy at 1000 GeV. Especially, we find the gauge boson channel is problematic for the antiproton spectrum. They give several times larger anti-proton fraction than the data in the two transportation models. Therefore DM decaying to gauge bosons are strongly disfavored by the anti-proton data. This conclusion is similar with Ref. the authors suggest to use extremely high energy gauge bosons of about 10TeV to interpret both positron and antiproton spectra. In that case, only the soft tail of positron and antiproton spectra from high energy gauge boson are adopted. Since the endpoint of the anti-proton soft tail has energy larger than 100 GeV it has no conflict with the present PAMELA data that cut off at ∼ 100 GeV. It predicts very high antiproton flux above ∼ 100 GeV. The model requires very heavy DM (∼ 10 TeV). It should be mentioned that the PPB-BETS and ATIC experiments seem to see electron spectrum has a significant excess above several hundred GeV with a cutoff around 800GeV. The heavy DM with mass of 10TeV seems not to account for this positron excess. In Fig.4, we show the positron and antiproton fraction when DM decay to quark pairs. Positrons are produced after hadronization of quarks via the decay of charged pions. However we find these positrons are too soft and can not account for the excess of positrons above ∼ 10 GeV. Furthermore, quark hadronization produces unwanted anti-protons as expected which are several times larger than the experimental data. In Fig.5, we show the case of leptonic final states. The positron spectrum is easily to fit the PAMELA data in this case for e and final states. However, for final states we may need the energy larger than ∼ 300 GeV to account for the hard positron spectrum. Certainly there is negligible influence on the antiproton spectrum in the pure leptonic decay. In Table.II we give a summary on these three channels to fit the PAMELA data. The gauge bosons final states with energy around hundreds of GeV to ∼TeV have problems Finally we will try to compare the two scenarios of annihilating and decaying DM. We find, if the positron excess at PAMELA is indeed of DM origin, the decaying DM is superior to annihilating DM. First, annihilating DM has to resort to large "boost factor" at the order The labels are the same as that in Fig. 3. Gauge boson Quarks Leptons of ∼ 10 2 to ∼ 10 4 to account for the large positron flux. However, detailed analysis of boost factor from the clumpiness of DM structures based on N-body simulation gives that the most probable boost factor should be less than 10 − 20. The same conclusion is also found through the direct computation of the antimatter fluxes from N-body simulation. A nearby subhalo or the DM spike around the intermediate mass black hole might be able to provide large boost factors, however, these scenarios are found to be of little probability or suffer large uncertainties. Some authors use Sommerfeld-enhancement to increase the annihilation cross-section and some people adopt non-thermal DM such as wino. 2 This method is usually constrained by the data of gamma rays In the next section, we will consider a scenario of LDDM. Our example is given in the minimal supersymmetric standard model with trilinear R-parity violation term LL. The neutralino being the lightest SUSY particle forms dark matter and is produced thermally at early universe in the same way as stable neutralino. To account for the PAMELA positron excess we find it has the life time of about ∼ 10 26 seconds, which is much larger than the life of the universe. IV. NEUTRALINO WITH R-PARITY VIOLATION AS AN EXAMPLE OF LDDM In this section we turn to discuss the specific decaying DM model in supersymmetry scenario. In SUSY model, the discrete symmetry of R-parity can be invoked to avoid dangerous baryon-number violation terms which drive unexpected proton decay. Defined as R = (−1) 2S+3B+L, the R-parity of a SM particle is even while its superpartner is odd. Then the LSP particle is stable. Since the neutralino LSP can have correct relic density via thermal production which makes it a suitable DM candidate. Although R-parity symmetry is well motivated for SUSY phenomenology, there is no reason for this symmetry to be exact. One can introduce some R-parity violation terms in the Lagrangian which make the LSP decay into SM particles. The general gauge invariant superpotential of the minimal supersymmetric standard model can be written as where i, j, k are generation indices (we neglect these indices bellows). The LH term in this superpotential mixes the lepton and Higgs field. Because Higgs and Lepton have the same gauge quantum numbers, one can rotate away the bilinear term by redefining these fields. The LL, LQD terms violate lepton number, and the UDD terms violate baryon number. Then totally 45 couplings including 9 ijk, 27 ijk and 9 ijk are invoked in theory. There might also exist many soft SUSY breaking terms which induce R-parity symmetry breaking. These terms added more additional free parameters, and we do not discuss them here. The R-parity violation terms must be tiny to satisfy stringent experiment constraints, especially the constraints from proton decay. The tiny R-parity violation may be due to some fundamental theories at high energy scale. For example, in SU grand unified theories (GUT) the gauge invariant terms as f ijk5 i5j 10 k, where5, 10 denote matter field representations contain leptons and quarks, could induce R-parity violation explicitly. f ijk is suppressed and gives tiny R-parity violation couplings. To construct a realizable theory taking account for all the experimental constraints, more symmetries and high order operators are always required. In general, we should consider all R-parity violation terms in Eq. 6. However, they might not appear in theory at the same time. In some theories only baryon-number violation terms UDD is included, while some other theories can only predict lepton-number violation LQD term. In a class of discrete gauge symmetric models the baryon-number violation term should be absent since they may induce rapid proton decay. In this work, we only consider lepton-number violation term LL in order to account for the PAMELA positron excess. We assume all the components of ijk are equal and neglect the annihilation of neutralinos in the following discussion for simplicity. In Fig. 6, we show the positron fraction including contribution from neutralino decay for different benchmark points. From Fig. 6, we can see the positrons are most probably distributed lower than 1 3 m0. This is due to the three-body decay and the roughly equal decay fraction of i l − j l + k. The positron spectrum given here with three-body decay is generally softer than two body final states with monochromatic lepton. We notice that neutralino heavier than 300GeV to about 2 TeV can fit the PAMELA data well. If one takes account the results from PPB-BETS and ATIC experiments, it seems to suggest a heavy neutralinos up to ∼TeV if they are due to DM decay. Another feature of this scenario is neutrino flux from neutralino decay, but we find this neutrino flux is too small to be detected by neutrino telescope such as Super-kamiokande, IceCube, etc while which is well within the atmospheric neutrino bound from Super-kamiokande(similar analysis for neutrino flux from decaying DM can be found in Ref. ). Finally we will give some comments on other scenarios of decaying dark matter. In some SUSY scenarios, the LSP may be the neutral particles as gravitino or sneutrino. They can also be the candidates of DM. However, in the bilinear R-parity violation scenario, the gravitino would mainly decay into gauge boson plus lepton which is not favored by antiproton data from PAMELA. If the R-parity violation term is LL as we discussed comparing with ATIC data Ref.. The labels are the same as that in Fig. 6. above, the spectrum of decay products is similar. But the decay of gravitino is suppressed by the Planck scale and the R-parity violation parameter can be as large as ijk > 10 −14, which may lead to unstable NLSP decay quickly to avoid destroying the success of big-bang nucleosynthesis and be observable at colliders. Another possible candidate of DM in SUSY is sneutrino. The left-handed sneutrino has been ruled out by DM direct detection, therefore the right-handed sneutrino receives more concerns. If we neglect all the soft breaking terms, the interactions for right-handed neutrino superfeild N are induced only from Yukawa term y ij L i H u N j. After introducing only bilinear R-parity violation terms i L i H u, the right-handed sneutrino will decay into lepton pairs with a large fraction, due to mixing between Higgs and left-handed lepton superfields. However, it should be mentioned that mixing between right-handed sneutrino and Higgs boson can not be avoided in general. These mixing terms have to be suppressed in order not to conflict with PAMELA antiproton data. The kinematical conditions can be used to suppress the right-handed sneutrino decay to two Higgs or one Higgs plus one lepton. To suppress the LSP direct decay to quarks which is induced by the mixing of right-handed sneutrino and Higgs, an extra relation i y ij i ∼ 0 is needed for the j-th generation right-handed sneutrino which is the LSP. In the Ref. authors proposed similar idea, they assume the LSP is the third generation right-handed sneutrino and only 1 = 0, then the small yukawa coupling y 13 make this right-handed sneutrino as a good candidate of LDDM. The difference between leptonically decaying neutralino and right-handed sneutrino might be represented in the original positron spectrum. The former one is softer than the latter, because the former one is three-body decay while the latter one is two-body decay. It means that the PAMELA implication on DM mass is different for these two scenarios. With the synergy of PAMELA and collider experiments, it is possible to distinguish whether the DM is neutralino, gravitino or right-handed sneutrino. V. SUMMARY AND DISCUSSION The recent released PAMELA data shows interesting features, that the positron shows an obvious excess above ∼ 10 GeV while the antiproton flux is well consistent with the expectation from the conventional cosmic ray model. The result implies there should exist some kinds of primary positron sources in addition to the secondaries from CRs interactions with the ISM. Before the discussion of possible exotic sources of positrons it is extremely important to explore the background carefully. In this work we first recalculate the background contributions of positron and antiprotons from CRs using GALPROP. Considering the CR data of unstable secondaries, such as 10 Be/ 9 Be, it is possible to reduce the uncertainties in predicting the positron and antiproton flux from the propagation parameters. Two typical propagation models, the diffusion+convection and diffusion+reacceleration ones, are adopted as benchmarks of the CR propagation models. In both of the two models, propagation parameters are adjusted so that most of the CR spectra, such as B/C, 10 Be/ 9 Be and so on, are well consistent with the observation. The DC model is found to be consistent with thep/p and the low energy e + /(e + + e − ) data of PAMELA without introducing a charge-dependent solar modulation model. While the DR model shows a bit of underestimation of thep/p data and produce more low energy positrons. In both models the positron fraction at high energies shows obvious excess. We then consider DM origin of the primary positrons. We compared the positron and antiproton spectra with PAMELA data by assuming the annihilation or decay products are mainly gauge bosons, quarks and leptons respectively. We find the PAMELA data exclude quarks being dominant final states, disfavor gauge bosons and favor the leptonic final states. Comparing annihilating DM and decaying DM scenarios, we prefer decaying DM because annihilating DM usually requires very large boost factors. Moreover, annihilating DM usually produce more gauge bosons and quarks than leptons. A concrete example of such LDDM model is considered in MSSM with tiny LL Rparity violation term. We choose neutralino as the LSP and the DM particle. We show that neutralino with mass 600 ∼ 2000 GeV and life time of ∼ 10 26 seconds can fit the PAMELA data very well. We also demonstrate that neutralino with mass around 2TeV can fit PAMELA and ATIC data simultaneously. Another LDDM model is right-handed sneutrino being DM with bilinear R-parity violation term. With the interplay of PAMELA and LHC it is possible to distinguish the DM between neutralino and right-handed sneutrino. Finally we will discuss the implications of the LDDM models. LDDM can have many interesting phenomena in experiments other than PAMELA, such as gamma ray observation. In general, it can have two-body decay and three-body decay channels as DM → l + l − and DM → l + l − X where the leptons in the final-states are required from PAMELA data. Particle X can be photons, neutrino in general. If the LDDM has the decay channel DM → l + l −, the spectrum of gamma ray can reveal the property of LDDM and the mechanics behind. For example, if there is an intermediating resonance particle Y which decays to lepton pairs, the decay of LDDM is now DM → Y → l + l −. Thus the photon is monochromatic and can be explored by the Fermi Gamma Ray Space Telescope(FGRST). Detecting the gamma ray spectrum will be an important way to test the LDDM model, where FGRST will play an important role. For our neutralino LDDM model the neutrino observation will provide a way to test the model since the decay produces hard neutrino spectrum. Another possible way to test the model is to look for the synchrotron emission of the hard electrons and positrons by DM decay. Further studies on this issue are on going.

Cameron Wesley Janssen (born April 15, 1984) is an American professional ice hockey player who retired from playing for the Nottingham Panthers of the Elite Ice Hockey League (EIHL) on August 12, 2016. The New Jersey Devils drafted him 117th overall in the fourth round of the 2002 NHL Entry Draft. Janssen was regarded as an enforcer. Early life [ edit ] Janssen grew up in the St. Louis suburb of Eureka, Missouri, where he attended Eureka High School for three years. During his sophomore and junior years of high school, Janssen played for the St. Louis Sting of the Junior A North American Hockey League.[1] Playing career [ edit ] In 2001, Janssen was selected in the third round of the Ontario Hockey League draft by the Windsor Spitfires. Instead of completing his senior year at Eureka High School, Janssen moved to Windsor, Ontario to begin his first season with the Spitfires. After one season in Ontario, Janssen was drafted by the New Jersey Devils as the 117th overall pick during the fourth round 2002 NHL Entry Draft. During the 2003–04 OHL season, Janssen joined the Guelph Storm, where he participated in the Memorial Cup tournament.[2] In his rookie NHL season, Janssen led the Devils with eleven fighting majors. On February 24, 2007, he scored his first career NHL goal against the Washington Capitals at 10:33 in the second period in his 82nd NHL game. Janssen in 2011 with the Blues In the second period of a regular season game against the Toronto Maple Leafs on March 2, 2007, Janssen knocked-out Toronto defenseman Tomáš Kaberle unconscious with a late hit to the head. Kaberle was carried off the ice on a stretcher.[3] The NHL announced Janssen would be suspended for three games without pay for the incident, forfeiting $7,220.16.[4] In an interview, Kaberle mentioned Janssen had not contacted him for reconciliation, and went on to say, "I don't care [to hear from him]. He doesn't respect me and I don't respect him."[5] On March 30, 2007, Janssen injured his shoulder in a fight with Riley Cote of the Philadelphia Flyers and missed 4 games. He returned for the playoffs against the Tampa Bay Lightning. Janssen was injured in the 2007 NHL preseason as well, suffering an injury in a fight with Jesse Boulerice.[6] On February 26, 2008, Janssen was traded by the Devils to his hometown team, the St. Louis Blues, for defenseman Bryce Salvador.[7] He made his Blues' debut two days later, wearing #55 against the Phoenix Coyotes. A free agent after his contract with the St. Louis Blues expired in 2011, Janssen signed a one-year, two-way contract with the Devils on July 14, 2011[8] becoming the 22nd player to be re-acquired and play for the team.[9] Janssen signed as a free agent on a one-year contract with the Nottingham Panthers of the EIHL on August 15, 2015.[10] Controversy [ edit ] In July 2012, Janssen appeared on an internet-based radio show called "The Thom and Jeff Show" and subsequently delivered a profanity-laced interview in which he made several controversial comments, including one about gay players. Janssen later issued an apology for the incident, noting that he had "used poor judgment during the course of the show" and saying "moving forward, I hope to eliminate that type of language from my vocabulary. I would also like to take this chance to express my support for the work the You Can Play project is doing, and for the gay community in general."[11][12] Career statistics [ edit ]

(GOLDEN, COLO.) - Barack Obama charged John McCain today with proposing disingenuous polices to relieve the financial crisis. During a speech on economy at the Colorado School of Mines, Obama said McCain's support for more regulation of the financial industry is misleading. "His newfound support for regulation bears no resemblance to his scornful attitude towards oversight and enforcement," Obama said. "John McCain cannot be trusted to reestablish proper oversight of our financial markets for one simple reason: he has shown time and again that he does not believe in it." Obama's call for more regulation and oversight over the financial sector was in line with his remarks given in New York City in March. "In the wake of the Bear Stearns bailout, I called for a new, 21st century regulatory framework to restore accountability, transparency, and trust in our financial markets," Obama said then, adding that McCain did not support regulation then. Obama also said that McCain's support of Bush's economic policies and his failure to respond to the crisis as it was looming, contributed to the current economic climate. "Senator McCain did nothing," he said. The most scathing charge against McCain came as Obama said the current economy is proof that the ideas that he subscribes to have fallen short. "What we've seen the last few days is nothing less than the final verdict on an economic philosophy that has completely failed." Republican National Committee spokesman Alex Conant responded saying, "Obama's attack is another example of his 'I-know-best' attitude that rejects the sort of consensus-building, open-minded leadership Washington needs."

James E Simpson Jr Personal life James Simpson was born on July 24, 1928 in Somerset, Kentucky. Following his education in the public schools, Simpson joined the United States Army in 1947. He took advantage of GI Bill funds to finance his education at the Cincinnati College of Mortuary Science. He graduated with a degree in 1951. In 1952, he began working at the African American C.E. Jones Funeral Home in Covington, which was located at 633 Scott Street. In May, 1961, Anna Jones, the owner of the funeral home retired. At this time, James Simpson took over the operation of the C.E. Jones Funeral Home, the name of which was changed to Jones & Simpson Funeral Home. In 1972, the City of Covington acquired the original funeral home site for additional parking. A new location was found at 1129 Garrard Street. In 1971, James Simpson ran successfully for Covington City Commission. Simpson had three sons James Simpson – III, (late) Ronald Lee Simpson, Rep. Arnold Ray Simpson (D), and a daughter Adrienne Simpson. His wife Zona Simpson died in 2003. He was known for his jolly laugh and sense of humor. Simpson loved woodworking where he learned cabinet making from Chester Rice at the Lincoln Grant School, a blacks only school during segregation in Covington. He talked to people about business, about politics, and about how to progress while maintaining one's dignity. Death James Simpson Jr. died on February 18, 1999 in his home from complications he suffered from emphysema. He was survived by his widow, Zona Simpson, and four children: James Simpson III, Ronald Simpson, Adrienne Simpson, and Rep Arnold Simpson (D)KY, a former City Manager of Covington and State Representative. Funeral services were held at the First Baptist Church on 9th Street in Covington with burial at Highland Cemetery in Fort Mitchell, Kentucky. Honored by street in Covington In 2008 the City of Covington voted to name the street leading to the main entrance of the new St. Elizabeth hospital (finished in 2009) as "James Simpson Jr Way" in honor of James Simpson Jr.

In vitro assembly of coiled bodies in Xenopus egg extract. When demembranated sperm nuclei are placed in a Xenopus egg extract, they become surrounded by a nuclear envelope and then swell to form morphologically typical pronuclei. Granules ranging from < 1.0 to approximately 3.0 microns in diameter appear within such nuclei. Bell et al. identified four nucleolar proteins in these "prenucleolar bodies" by immunofluorescent staining (fibrillarin, nucleolin, B23/NO38, 180-kDa nucleolar protein). By in situ hybridization we show that these bodies also contain U3 and U8 small nuclear RNAs (snRNAs), known to be involved in pre-rRNA processing. Moreover, they contain all the snRNAs involved in pre-mRNA splicing (U1, U2, U4, U5, and U6), as well as U7, which is required for histone pre-mRNA 3' end formation. In addition to the nucleolar antigens previously identified, we demonstrated staining with antibodies against the Sm epitope, trimethylguanosine, and coilin. Because the composition of these prenucleolar bodies is closer to that of coiled bodies than to nucleoli, we propose that they be referred to as coiled bodies. The existence of large coiled bodies in transcriptionally inactive pronuclei suggests that they may play a role in the import, assembly, and storage of RNA processing components but are not themselves sites of processing. In transcriptionally active nuclei coiled bodies could serve as sites for initial preassembly and distribution of snRNP complexes for the three major RNA processing pathways: pre-mRNA splicing, pre-rRNA processing, and histone pre-mRNA 3' end formation.

At JustBats, we love our alumni about as much as we love our customers. So, when former Wichita State pitcher and JustBats employee, Tommy Hottovy, made it to The Show, we were ecstatic. Now, Tommy Hottovy has the perfect 21st-century baseball occupation: Director of Run Prevention for the Chicago Cubs. For Hottovy's part, the Chicago Cubs have allowed the least amount of run in all of MLB this year. Recently, we caught up with former MLB pitcher, JustBats alum, and Cubs' Director of Run Prevention for a Q&A. What exactly does Director of Run Prevention for the Chicago Cubs entail? Officially, my title is Coordinator of Advance Scouting, and my main focus is on run prevention, which encompasses anything that helps prevent the other team from scoring runs. My daily responsibilities are pretty extensive, as I do a lot for the game that day, as well as prep work for the upcoming teams we will see. But, my main responsibilities are breaking down the opposing hitters and working with our coaching staff to determine our plan of attack, coordinating all of our defensive positionings, and communicating with the coaching staff that will be positioning the players during the game to make sure we are all on the same page. Also, I'm in charge of making notes on the opposing offense in general and things they like to do specifically during the game (i.e. when they run, situational hitting, bunting, etc.), and communicating with any Pro Scouts we have in the field to make sure our plan is on the right track with what they may be seeing in a short look before our series. What is the best part of your job? By far the best part of my job is getting to work directly with the players and staff and have an immediate impact on the game that night. If I am breaking down a hitter, and we decide we want to pitch a guy a certain way (i.e. we want to start him with a curveball in his second at-bat) and he gets a hit or if we decide to play a shift on a hitter, and he hits against the shift in a big part of the game, I have to be able to answer for the decisions we make. Luckily, we have a great group of guys, and we have created an environment where communication flows constantly. Very rarely is there a time where the pitcher or player is not informed with what we want to do, pitching or positioning wise, and in the end, the players see how much time and effort goes into every game, and every series and you earn their trust as the season goes on. What is the toughest part of the job? Without question, the toughest part of my job are the deadlines. We are constantly working on a three-day deadline. Most of the time I am working on two teams at the same time, the daily communication and strategy for the team we are playing, as well as all the prep work, reports, and positioning for the team we are about to play. The minute one team finishes the next team begins, so there is very little down time during the season. Why do you think sabermetrics is important to the future of baseball? To me, it's the same reason data analysis is to any company. It is an integral part of the future success of an organization. Technically, everyone has access to the same data, which is an insane amount. Ultimately, the collection, interpretation, and distribution/communication of the data are what separates one team from the next. You can have all the data in the world, but if you can't sift through it, find what is pertinent not only to the team as a whole but also to the individual player, and then be able to translate that information into a language that the recipient understands (which in some cases is actually a different language), then you won't be successful and in some cases, the data could actually be a hinderance. >>> There's always something new. New baseball bats releases are here! <<< My ultimate goal, and what I feel the most important role sabermetrics will play in the future of baseball, is to find the right balance between all of these aspects. So, in the end, when the game is on the line, the player feels 100% comfortable with any situation they could potentially see on the field. Are there any aspects of your job that youth and high school teams could or should adopt? Without question. What I tell most high school or youth teams that I talk to is that it is hard to gather much pertinent information on opposing players because you just don't see them enough, and the sample sizes are pretty low. What you can do, though, is gather information and tendencies of your players to help come up with game plans. For example, each pitcher should have their spray chart of where hitters hit the ball off them, not just where that hitter himself hits the ball, which can help tailor a defense to what a specific pitcher likes to do. There are pretty standard defenses you can run that data has proven over the course of baseball history that can be baseline defenses for a team to run and then make adjustments off of depending on any pitcher/hitter tendencies that you may see. What did you enjoy the most about working for JustBats.com and Pro Athlete, Inc.? Obviously, I was very fortunate to get to work with some amazing people, and I cherish the interactions and conversations I had with all of them on a daily basis. But, the thing I enjoyed the most working for Pro Athlete was the freedom, encouragement, and opportunities they give every employee to grow professionally, not only in their daily activities but for their future endeavors, as well. JustBats thanks Tommy Hottovy for taking the time to answer some questions and, of course, wishes him continued success in his career with the Chicago Cubs. If you have any questions on baseball bats or softball bats, give the Pros at JustBats a call at (866) 321-2287. Who knows, you might be talking to a future MLB player. What do you think of Hottovy's job? Do you use sabermetrics?

Update The Juvenile Justice Systems - Now! This article may cause discomfort or perhaps even anger among some people in the Juvenile Justice Community. Let me start by saying, I believe that the current American Juvenile Justice System is outdated. In my opinion, many of the Juvenile Justice Systems are still employing social work principles and treatment methodologies of the 1960’s, 1970’s, and the 1980’s. - in short, the Father Flanagan (Founder of Boy’s Town) philosophy: “There’s no such thing as a bad boy” , when in reality there are some really bad boys and girls. The incorrigible juveniles, runaways, habitual truants, etc., that composed the juvenile delinquent population of the past are not the offenders filling juvenile institutions today. Many of today’s juvenile offenders have committed violent crimes and require a different type of incarceration that includes intensive (personalized) treatment and educational programs. As a society, we cannot continue to turn a blind eye on these out of control juveniles. I grew up in the 1950’s and 1960’s and I knew some boys who were sent to reform school for excessive truancy, car theft, and petty theft. Today, these crimes would not even get a second look by most criminal justice agencies. As a police sergeant in the 1970’s, I worked extensively with juveniles. Then in the mid-1990’s, I once again had the opportunity to work with juveniles who had been adjudicated as adults and sentenced to adult prisons. It was working with the sad and difficult youthful offenders’ population that I came to the realization that the current Juvenile Justice System was missing its mark. I spent hours interviewing and just talking with these youthful offenders, listening to their stories of how they could manipulate the juvenile system, the school system, and their parents (if the parents even played any role in their lives). What I believe is needed for the Juvenile Justice System is a comprehensive overhaul where those juveniles who are convicted of minor offenses and are under a certain age can receive the care that they need in a juvenile facility. Additionally, I believe that there needs to be another stage, a hybrid youthful offender/adult correctional system that would concentrate on the needs of youthful offenders. Youth offenders are persons between the ages of thirteen and nineteen who have committed serious crimes. This hybrid correctional system, using data (good and bad) that has been collected from youthful offender programs in adult facilities, and high security juvenile facilities, would be created as an entirely new correctional environment, to include programming where these violent youthful offenders could be incarcerated. In cases that involve this juvenile population, the criminal justice system has one and perhaps two chances to help these juveniles get their lives straightened out. If the Criminal Justice System fails, many of these juveniles will follow a path of crime doing life (in jails and prisons) on the installment plan (2 years here, 5 years there, etc.). The title for offenders twelve years of age or under would be juveniles. The title for offenders thirteen to nineteen would be youthful offenders. There should be Extensive “Baseline Testing” upon entry into the CJ formal system. What I mean by “Baseline Testing” is the development of a comprehensive understanding of the offender. The “Baseline Testing” package should include; cognitive, psychosocial, extensive physical, dental, and emotional. It is my deep seeded belief that with this comprehensive testing the CJ system would have a complete picture of the offender and his/her needs. If this testing is not conducted, I believe, we are just throwing good money away. Too often the criminal justice system uses the shotgun approach to treatment; they put everyone through the same programs, rather than tailoring the programs to the needs of the offenders. Yes, it is expensive, but so is having the same people come back to prison over and over. There are those who will disagree with this approach to re-tooling the Juvenile Justice System to meet the needs of today’s youth. I believe that my approach is worth a serious try. There should be an evaluation tool built into the program that measures the success of each element of the program. Develop “highly structured” programs where initially the offender(s) day is highly structured. As the offenders progress through the program, the structure begins to be taken away. Integrate educational programs (academic, technical, and vocational) into the youthful offender program; this is crucial. Rules of the school must be strictly enforced and offenders can receive official write-ups for both academic and behavior issues. When appropriate, youthful offenders should be permitted to live on their own. There are some people who think I have lost my mind by suggesting that youthful offenders be permitted to live apart from their parents, etc. Well, I am a realist and in various cases the offender’s parents are part of their problem (the parents are addicts, violent and abusive, and/or involved in criminal activities). The offenders’ parole officers could conduct unannounced checks on them to insure that they are following the rules. The time to make the changes in the Juvenile Justice System is now. Most of the current state systems are struggling to keep their heads above water. They (the states) continue to fall further and further behind in treating, rehabilitating, or punishing violent juvenile offenders. I have given up looking at statistics because I no longer believe them. News, web sites, and common sense tell us that street gangs are growing larger and spreading into suburban and rural communities. As an example: according to the WIKI research web site, “16-24 for males however it is only an average as they are at their peak strength at this age.” People who work with street gangs report that the street gangs are recruiting younger or junior members to their gangs. They do this to take advantage of the Juvenile Justice System and the way it treats juvenile offenders. Society has the right to be safe from violent youth. The Juvenile Justice System should not be a swinging door where offenders released are no better, perhaps worse, than when they were incarcerated. States have to stop trying to conduct youthful offenders rehabilitation on the “cheap”. This new Youthful Offender Program that I am proposing will not be cheap to initiate and operate. What must be considered is what is being spent on incarcerating adults and juveniles today; furthermore, there must be evaluation methodologies in place prior to initiating this new Youthful Offender Program. It has been over 100 years since the Juvenile Justice System has had an intensive comprehensive up-dating. Recently there was a news article that reported that girls are reaching puberty at an earlier age. “New research adds further evidence that girls are entering puberty at younger and younger ages, with implications for their physical and mental health. By 8-years-old, more than 1-in-10 girls have already begun developing breasts, which marks the technical start of puberty for girls, according to a new study published Monday in the Journal of Pediatrics. The street gangs are recruiting younger or “junior” members to gangs. They do this to take advantage of the Juvenile Justice System because it is more lenient in the way it treats juvenile offenders. I truly believe that an updating of the Juvenile Justice System is necessary. Furthermore, I believe that Juvenile Justice Systems need to incorporate a Youthful Offender Program in their incarceration and treatment model. The kids of today are sophisticated when it comes to “street smarts”. The Juvenile Justice Systems must adapt to the changes in society.

writer: Kurt Zindulka "echinawire.com" A teacher, surnamed Hou, went completely off the rails at the Taiping High School in Lingshan county, Guangxi province. At noon on the 28th of March, the teacher stripped naked and began to grope and grab a female student. Images captured from a security camera show the bad teacher forcing himself on the girl. Eventually other teachers and faculty members wrestled Hou away from the girl, and called the police and the man’s family. The thirty year old man reportedly suffered from psychotic episodes in 2011, and had received treatment for mental illness. After two years of treatment it was believed that he had recovered. The school decided to not have him teach classes, only allowing Hou to work in the school lab. They claim that since he was reinstated, he has been a perfectly fine staff member, with no incidents until now. Hou has since been placed in a hospital to receive care, and the student has been in counseling. According to the official statement the girl did not suffer any physical injuries. The story has captured the interest of Chinese social media, with many wondering if people who suffer from mental illness should be allowed to work with children.

SOME 20 of the 23 presidential candidates contesting next month’s general elections, yesterday signed a peace pledge, binding themselves to a code of conduct compelling them to campaign peacefully. The peace pledge document was prepared by the National Peace and Reconciliation Commission (NPRC) as part of efforts to promote a peaceful campaign environment ahead of elections set for July 30. Zanu PF presidential candidate Emmerson Mnangagwa, his MDC-T and MDC Alliance counterpart Nelson Chamisa and leader of the leader of the smaller MDC-T party faction Thokozani Khupe did not attend the event, but had their officials sign the document on their behalf. MDC-T national chairperson Morgen Komichi, who signed on behalf of Chamisa, said Zimbabweans had suffered State-sponsored violence for the past 38 years, adding that going forward the government must take responsibility for peace. “We as the opposition have no responsibility to make or break peace, unless government authorises it. The other stakeholder to peace is the army, and they must not be used to deny the people’s will when a man who has never gone to war wins the elections. At independence, he was two years old and he could have gone to war if he were older. So, let us not deny him (Chamisa) if he wins the elections,” Komichi said. He challenged State security agents and traditional leaders to remain impartial and stop acting as Zanu PF political commissars. MDC leader Welshman Ncube said peace could only be achieved if those charged with running the elections act in a palpable and fair manner, which ensures access to the voters’ roll to all actors, transparent printing of ballot papers, and thwarting of all forms of voter intimidation like demanding voter registration slips. “Intelligence officers and soldiers operate to advance political agendas in our communities. As we commit to this peace pledge we hope to see all soldiers withdrawn from the people so that they freely exercise their sovereign right to select a government of their choice,” Ncube said. Khupe’s deputy, Obert Gutu, said the electorate must be set free from physical, emotional and psychological violence. Mnangagwa’s representative and Zanu PF secretary for administration, Obert Mpofu declined to comment on accusations that the ruling was behind most of the violence cases in the country. “In my capacity as Minister of Home Affairs, I pledge government’s commitment to do all to ensure elections are peaceful and devoid of victimisation, harassment and intimidation and allow our citizens to vote for a political party of their choice. You are free to do whatever political activity you want to do without fear of victimisation,” Mpofu said. Alliance for People’s Agenda president Nkosana Moyo said elections cannot be democratic if people were subjected to intimidation as had been the case in the past 38 years. The signing ceremony also had its comical side with presidential aspirant Brian Mteki singing before signing the document while other candidates made solidarity speeches which sounded more like campaign speeches. Francis Danha, leader of the opposition #1980 Freedom Movement briefly disrupted proceedings after he heckled Zimbabwe Electoral Commission chairperson Justice Priscilla Chigumba, accusing her of being biased in favour of Zanu PF and refusing to implement reforms demanded by the opposition. Danha last week also caused a scene when he disrupted a political parties’ meeting organised by Zec. Chigumba, who remained composed during the drama, later called on political parties to also adhere to the Zec code of conduct. Representatives of the European Union, United Nations, the Kofi Annan Foundation, Zimbabwe’s chapter 12 commissions, civic society groups and church organisations attended the event. For peace to prevail in Zimbabwe we want to see Soldiers in their Baracks without taking sides. CIO security agents must not intimidate people in rural areas especially Uzumba Maramba Pungwe. They come at night to tell people that if you don’t vote for Zanu pf you will disappear like what they did in 2008 run up. People are living in fear because of Soldiers and CIO. This is a good move. Lets all thrive for peace during and after elections as most modern countries. For MDC-T to play use the “Zimbabweans had suffered ‘State-sponsored violence’ for the past 38 years,” card in an election being keenly contested by Pres. Mnangagwa is really juvenile, especially when we know it’s all thanks to Prez. Mnangagwa that Mugabe’s rule is over. If anyone should be thanked for bringing peace and ending violence in this country, then it should be Prez. Mnangagwa. He is my choice and he deserves my vote. It’s my fervent request to all Zimbabweans. Let us all live in peace during and after the elections. We have one common home, Zimbabwe. So let’s do all we can to make it a safe country after all this is over. If the leaders of the various parties are willing to come together for peace, I hope their supporters too are willing to do the same. Peace is key to the future of Zimbabwe. President Mnangagwa has been an advocate for peace ever since he took over from Mugabe. I am happy to see all the other political leaders fall in line and support his peaceful election campaign. Finally ED’s voice has been heard and hopefully peace will prevail even after the elections.

. Isolated dislocation of the carpal scaphoid is an extremely rare injury, which is usually accompanied by significant ligamento-capsular lesions. A review of the literature found only 21 reported cases. The aim of this report is to present a single case of isolated radio-palmar dislocation of the scaphoid treated conservatively, which provided a good functional result at 10 years follow up.

Scapular Fractures: What Radiologists Need to Know. OBJECTIVE The purpose of this article are to review scapular anatomy and function, describe imaging features of traumatic scapular injury, and discuss the role of diagnostic imaging in clinical decision making after shoulder trauma. CONCLUSION Knowledge of scapular anatomy, function, injury patterns, imaging appearance, and clinical management is important for the radiologist to the care of patients who present with acute shoulder trauma.

RRM2 enhances MYCN-driven neuroblastoma formation and acts as a synergistic target with CHK1 inhibition High-risk neuroblastoma, a pediatric tumor originating from the sympathetic nervous system, has a low mutation load but highly recurrent somatic DNA copy number variants. Previously, segmental gains and/or amplifications allowed identification of drivers for neuroblastoma development. Using this approach, combined with gene dosage impact on expression and survival, we identified ribonucleotide reductase subunit M2 (RRM2) as a candidate dependency factor further supported by growth inhibition upon in vitro knockdown and accelerated tumor formation in a neuroblastoma zebrafish model coexpressing human RRM2 with MYCN. Forced RRM2 induction alleviates excessive replicative stress induced by CHK1 inhibition, while high RRM2 expression in human neuroblastomas correlates with high CHK1 activity. MYCN-driven zebrafish tumors with RRM2 co-overexpression exhibit differentially expressed DNA repair genes in keeping with enhanced ATR-CHK1 signaling activity. In vitro, RRM2 inhibition enhances intrinsic replication stress checkpoint addiction. Last, combinatorial RRM2-CHK1 inhibition acts synergistic in high-risk neuroblastoma cell lines and patient-derived xenograft models, illustrating the therapeutic potential. INTRODUCTION Neuroblastoma is a pediatric tumor arising from immature sympathetic neuroblasts, with current survival rates for high-risk cases still being disappointingly low despite intensive multimodal therapy. Given that the number of mutations in newly diagnosed cases is typically very low, the search space for mutated druggable targets is limited except for ALK mutations. In contrast to the low mutational burden, DNA copy number changes are highly recurrent with 2p and 17q gains occurring in both MYCN-amplified and nonamplified high-risk cases, while 1p and 11q deletions are predominantly found in MYCN-amplified and MYCN-nonamplified high-risk cases, respectively. We and others previously showed that focal gains and amplifications can highlight candidate genes implicated in neuroblastoma initiation and/or maintenance, potentially expanding the current number of available druggable targets. Recent whole-genome sequencing efforts have uncovered recurrent complex rearrangements, including chromothripsis affecting the chromosome 2 short arm. These rearrangements are often accompanied by amplicon formation encompassing the MYCN locus and regulatory sequences driving MYCN expression, as well as additional genes that have been proposed to have a tumor-promoting role distinct from MYCN activity itself, such as ODC1, the gene encoding for the rate-limiting enzyme in polyamine biosynthesis; the ALK gene implicated in neuronal development and codriver of MYCNdriven neuroblastoma formation ; and SOX11, encoding a presumed lineage dependency transcription factor with functions distinct from the core regulatory transcription factor circuitry. Here, we report on the further dissection of focal chromosome 2p imbalances and identified the "ribonucleotide reductase subunit M2" (RRM2) gene, located on 2p25.1, which encodes the small regulatory subunit of the ribonucleotide reductase (RNR) complex. RRM2 is the catalytic component of the RNR enzyme and is essential for the maintenance of deoxynucleotide triphosphate (dNTP) pool homeostasis required for DNA replication and repair. Synthesis of RRM2 protein is regulated in a cell cycle-dependent fashion, increasing to maximal levels during S phase of the cell cycle. Depletion causes G 1 -S phase arrest and rapidly leads to increased levels of replicative stress due to DNA replication fork stalling and decreased cell proliferation. Replicative stress activates the ATR (Ataxia Telangiectasia and Rad3-Related Protein)-CHK1 (Checkpoint Kinase 1) DNA damage response to control cell cycle checkpoints, origin firing, and replication fork stability to ensure genomic stability. This response includes RRM2 up-regulation through CHK1-E2F Transcription Factor 1 (E2F1) transcriptional regulation and ATR-controlled cyclin F inactivation to block RRM2 protein degradation. MYC and MYCN (V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma) proteins cause replicative stress, among others, through increased replication origin use and elevated global transcriptional activity. This can explain the up-regulation of many DNA damage response genes including RRM2 to cope with toxic replicative stress levels and increased DNA damage. Evidence for a more direct role of RRM2 in cancer formation or maintenance comes from mouse models in which increased RRM2 expression promotes lung, breast, and prostate cancer. Furthermore, RRM2 dependency was demonstrated in BRAF V600Edriven melanoma and Ewing sarcoma. Of further interest, RRM2 was shown to be the target of synthetic lethal interaction with G2 Checkpoint Kinase (WEE1) inhibition in H3K36me3deficient cancers. Together, these studies underline the potential importance of RRM2 levels in oncogenesis and cancer cell survival, thus marking RRM2 as a potential drug target. Here, we provide evidence for enhanced RRM2 levels resulting from increased RRM2 copy numbers through large segmental or focal chromosome 2p gains or high-level amplification. Elevated RRM2 expression levels correlated with decreased overall and event-free survival in patients with neuroblastoma, and RRM2 expression levels were up-regulated during MYCN-driven neuroblastoma formation in mice. In vitro experiments support a role for RRM2 as a dependency factor in both neuroblastoma cell lines and three-dimensional (3D) neuroblastoma spheroid cultures. Further evidence for a direct cooperative role of RRM2 in neuroblastoma formation was provided through combined overexpression with MYCN in the sympathetic neuronal lineage in zebrafish, which led to increased tumor penetrance from 16% up to more than 80%, while overexpression of RRM2 alone did not cause tumor formation. High-risk neuroblastoma cells are addicted to the replicative stress-response ATR-CHK1 signaling pathway, with RRM2 as a key downstream factor of this signaling pathway. In vitro forced overexpression of RRM2 in neuroblastoma alleviates replicative stress, as monitored by pRPA32 (phosphorylated Replication Protein A 32 KDa Subunit) levels. This is further supported in vivo by our double transgenic MYCN-RRM2 zebrafish neuroblastoma model, with tumor cells exhibiting reduced S345 pCHK1 and H2AX (gamma H2A Histone Family Member X) protein levels. Last, RRM2 inhibition synergistically enhances sensitivity of neuroblastoma cells to pharmacological targeting of ATR-CHK1 pathway addiction, thus suggesting the therapeutic potential for this drug combination in high-risk CHK1addicted, primary neuroblastomas. RRM2 is a target for focal gains and amplifications affecting gene dosage and neuroblastoma patient survival DNA copy number profiles of 556 primary high-risk neuroblastoma cases were analyzed for recurrent small segmental gains or amplifications affecting chromosome 2p loci. In addition to known amplicons implicating MYCN, ODC1, ALK, and SOX11, we identified a previously unknown smallest region of overlap encompassing RRM2, encoded on 2p25.1 ( Fig. 1A and fig. S1A). Subsequent additional analysis of high-resolution whole-genome data (63 cases; EGAS00001001308), whole-exome data (156 cases; EGAS00001003244), and low-resolution DNA copy number data (200 cases; GSE45480) revealed an additional 60 of 419 cases with 2p gains or amplifications (fig. S1B), with amplification defined as >4-fold increase of RRM2 signal in relation to the number of chromosomes 2 and gains with a 1.5-to 4-fold copy number in accordance with the European Neuroblastoma Quality Assessment group. In some cases, the RRM2 locus was involved in more complex amplicons, as illustrated by case "WGS-4" resulting from chromothripsis involving chromosome 2p encompassing the RRM2 locus, case "WGS-12" with the RRM2 locus being part of a complex amplification involving multiple loci across the entire chromosome 2, and case "WES-17" with the RRM2 gene involved in complex amplicon on 2p also involving MYCN and case "WES-19" displaying a similar pattern as observed for WES-17, but displaying an additional copy number jump within RRM2. Given the crucial role of RRM2 in nucleotide metabolism and replicative stress control and its recent established role as (co)driver in various cancer subtypes, we performed further data mining to find support for a functional role for RRM2 in neuroblastoma. First, we evaluated the effects of RRM2 gene copy number increase on expression levels and observed a positive correlation (R = 0.39, P = 1.28 10 −11 ) (Fig. 1B). We also observed a positive correlation between MYCN copy number status and RRM2 expression levels (Fig. 1C), in keeping with a direct regulatory role for MYCN, based on publicly available chromatin immunoprecipitation sequencing (ChIP-seq) data indicating direct binding to the RRM2 promotor (fig. S1C). MYC/MYCN also regulates the transcription of the E2F1, E2F2, and E2F3 genes, which directly regulate RRM2 expression.. In addition, Zeid et al. characterized the kinetic effects of dynamic modulation of MYCN (at 0, 2, and 24 hours after inactivation) to profile changes in states with high, medium, and low levels of MYCN in Tet-OFF SHEP-21N neuroblastoma cells ( fig. S1F). Collectively, these experiments consistently show strong downregulation of RRM2 upon MYCN inactivation/depletion. Second, Kaplan-Meier analysis showed that high RRM2 expression levels predict both adverse overall and event-free survival probability of patients in three large primary tumor cohorts. These results are in keeping with our previously reported four-gene prognostic signature in neuroblastoma, which included RRM2 ( Fig. 1D and fig. S1G). Third, we looked into the gene expression dataset of early (hyperplastic) lesions at weeks 1 and 2 after birth and established tumors at week 6 from a murine model of MYCN-driven neuroblastoma (TH-MYCN) and expression data from normal matching sympathetic mouse ganglia. This allowed monitoring of the dynamic regulation of gene expression during the tumor formation process, and we observed strong up-regulation of Rrm2 expression levels in comparison to wild-type mice sympathetic ganglia (Fig. 1E). We also investigated whether RRM2 expression levels could be enhanced through DNA copy number gains, affecting RRM2 upstream regulators (Fig. 1F). Besides MYCN, a second bona fide oncogene and target of amplification, LIN28B, also regulates RRM2 through down-regulation of let-7. In addition, CHD5, a known tumor suppressor and commonly deleted gene in the critical 1p36 chromosome region in neuroblastoma, is a transcriptional repressor of WEE1, which itself controls cyclin-dependent kinase 2 (CDK2), ensuring RRM2 degradation during S-G 2 -M transition. Last, BRCA1 (Breast Cancer gene 1) (encoded on the recurrently gained 17q region in neuroblastoma) was shown to be recruited by MYCN to promoter-proximal regions to prevent MYCN-dependent accumulation of stalled RNA polymerase II (RNAPII) and has also been reported to up-regulate RRM2 expression. Together, these data suggest that, in neuroblastoma, an integrated gene regulatory network controls RRM2 expression levels, which is further enhanced by recurrent increased DNA copy numbers affecting these loci ( fig. S1H). Functional in vitro and in vivo validation of RRM2 as a novel dependency factor in neuroblastoma To assess the functional impact of RRM2 down-regulation, we performed a transient RRM2 knockdown using two independent small interfering RNAs (siRNAs) ( Fig. 2A, left) in two high-risk neuroblastoma-derived cell lines, the MYCN-amplified IMR-32 cells and nonamplified CLB-GA cells. Transient RRM2 down-regulation induced the expected elevated levels of pRPA32 and 345 pCHK1, reflecting increased replicative stress. In addition, RRM2 knockdown also led to increased DNA damage, evidenced by yH2AX induction known to result from replication fork collapse ( Fig. 2B and fig. S2A) and reduced proliferation (Fig. 2C). In keeping with these findings, we also found evidence for p53 pathway activation illustrated by up-regulation of CDKN1A (encoding the p21 response gene) and RRM2B encoding the p53-controlled RNR (p53R2) ( Fig. 2A, right). Previous studies revealed strong effects on the cellular transcriptome under conditions of nucleotide stress. We explored this in IMR-32 and CLB-GA neuroblastoma cells by whole-transcriptome profiling followed by "gene set enrichment analysis" (GSEA) before and after RRM2 knockdown. This revealed a significant down-regulation of MYC and E2F targets (Fig. 2D, top) and up-regulation of p53 targets (Fig. 2D, bottom) compared to control cells, among others. To investigate the role of RRM2 on MYCN-driven neuroblastoma formation in vivo, we evaluated the impact of increased RRM2 expression on a MYCN-driven neuroblastoma zebrafish model. Therefore, a stable Tg(dh:hRRM2; dh:mCherry) zebrafish line (further designated as RRM2 line) was generated and crossed with Tg(dh:eGFP-MYCN)-overexpressing zebrafish, designated as MYCN. RRM2 overexpression in MYCN;RRM2 double transgenic zebrafish markedly increased tumor penetrance from 16 to 84% and accelerated in vivo neuroblastoma formation, which started already as early as 5 weeks of age (P < 0.0001) (Fig. 3A, left). To confirm these results and exclude an off-target effect of the integration site, we generated a mosaic model using the Tol2 transposase system (which induces random integration of overexpression constructs) to express cmlc2:eGFP/dh:RRM2 in the MYCN zebrafish, whereby the integration of the transgene is tracked by a green fluorescent signal in the heart of the zebrafish driven by the cmlc2 promotor. The mosaic model supports the data from the stable lines with significant (P = 0.0424) acceleration of tumor formation in MYCN zebrafish expressing RRM2 (Fig. 3A, right). Tumor penetrance is less marked as compared with the stable line experiments, which is expected given that constructs are not integrated into all the sympathetic lineage precursors in all evaluated embryos for the mosaic approach. We used fluorescence microscopy to follow up tumor formation in both MYCN-only and MYCN-RRM2 double transgenic zebrafish over time, with human MYCN and RRM2 being coexpressed with green fluorescent protein (GFP) and mCherry, respectively. By reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis, we could show specific human RRM2 overexpression in the established stable MYCN-RRM2 double transgenic zebrafish compared to MYCN-only zebrafish (Fig. 3C). Next, we performed hematoxylin and eosin (H&E) staining and immunohistochemistry analysis for the markers GFP, TH, and MYCN, both on sections (10 magnification) of MYCN and MYCN;RRM2 zebrafish ( Fig. 3D), confirming that the tumors are indeed neuroblastomas in both model systems. Increased RRM2 levels coincide with a CHK1-driven gene response indicative of enhanced replicative stress resistance Previous studies showed that MYC(N) executes both transcriptional and nontranscriptional mechanisms to facilitate progression through the cell cycle. In cancer cells with weakened G 1 -S control, enhanced MYC/MYCN levels increase the number of origins of replication to accelerate DNA replication, which subsequently causes increased need for nucleotide supply, leading to nucleotide stress sensed by the ATR-CHK1 replication stress checkpoint. During early S phase, RRM2 levels are still low, and dividing cells are particularly vulnerable to fork stalling. MYC(N) also indirectly anticipates to increase dNTP supply among others through activating E2Fs, which directly regulate RRM2 transcription (fig. S1H). To gain further insight into the functional impact of RRM2 overexpression on the neuroblastoma phenotype, we first performed immunoblotting for S345 pCHK1 and yH2AX from protein extracts of both MYCNonly and MYCN-RRM2 double transgenic zebrafish. We could observe a down-regulation of S345 pCHK1 and yH2AX in the MYCN-RRM2 double transgenic zebrafish (Fig. 3E), hinting toward enhanced replication stress resistance upon RRM2 overexpression in vivo. Next, we conducted an in vitro time series experiment in CLB-GA neuroblastoma cells exposed to pharmacological CHK1 inhibition using prexasertib as a stressor over a 6-to 48-hour time frame and monitored replicative stress marker induction (Fig. 3F). We observed increased down-regulation of CHK1 autophosphorylation ( S296 pCHK1) together with reduction in total CHK1 and RRM2 protein levels as well as up-regulated yH2AX (double-strand DNA breaks) and pRPA32 levels (binds single-stranded DNA and is a marker for enhanced form stalling). Next, we evaluated the presumed rescue effect of doxycyclin-inducible overexpression of RRM2 in CLB-GA neuroblastoma cells under conditions of prexasertib exposure (Fig. 3G). Combining prexasertib exposure with RRM2 overexpression strongly attenuated pRPA32 levels in keeping with our proposed hypothesis that enhanced RRM2 expression can suppress replicative stress. In addition to the direct and E2F-driven up-regulation of RRM2 through MYCN and other copy number-driven genes (see above), RRM2 levels are also tightly regulated through the ATR-CHK1 pathway (see fig. S1H). Moreover, ATR also dampens origin use to keep excessive effects of supraphysiological MYCN levels under control. In light of these observations, we further evaluated whether elevated RRM2 levels facilitate replication stress resistance in neuroblastoma cells. end, we used the unique dataset of Blosser et al. to score gene signatures related to sensitivity or resistance to pharmacological CHK1 inhibition by prexasertib in a large cohort of primary neuroblastomas (GSE62564). We observed that high RRM2 expression indeed confers stronger sensitivity to prexasertib treatment, indicative of high ATR-CHK1 activity (Fig. 3H). The top-ranking gene sets in this transcriptional sensitivity signature include E2F transcriptional targets, G 2 -M cell cycle, and spindle-associated checkpoint genes. To investigate the relation of RRM2 levels to replicative stress and ATR-CHK1 signaling activity, we also performed bulk RNA sequencing (RNA-seq) on emerging tumor from 6-week-old single and double transgenic fish. The volcano plot (Fig. 3I) shows top-scoring down-and up-regulated genes between the two groups . GSEA (Fig. 3J) for the differentially expressed genes between the double MYCN; RRM2 and MYCN-only transgenic fish shows up-regulated enrichment in the double transgenic group for DNA repair genes. Ten (DDX11, TRIP13, POLQ, FOXM1, RAD41L, MMS22L, ERCC8, FANCB, PARPBP, and RAD51AP1) of 31 highest-ranked genes from both DNA repair gene sets overlapped with the top-ranked CHK1correlated genes in the Kocak neuroblastoma patient cohort (n = 649; GSE45545), suggesting that MYCN-RRM2-driven neuroblastomas in the double transgenic zebrafish model are also marked by enhanced ATR-CHK1 signaling activity. This includes FOXM1, a critical regulator of S-G 2 transition and DNA repair; POLQ implicated in replication stress response ; and the DNA helicase DDX11, which interacts with the fork protection complex to preserve replication fork integrity in stressful conditions. Of further interest, the differentially expressed RAD51D plays a noncanonical role in sensing dNTP pool changes. We also find positive enrichment of genes related to cilium organization and movement, with 53 of previously reported cilia genes among the top 200 up-regulated genes from our analysis. In addition, the FOXJ1 (Forkhead Box J1) master regulator transcription factor controlling the expression of cilia genes was also among the top 50 regulated genes (log 2 FC of 4.5, P adj of 2.15 10 −8 ). It is highly intriguing that human ciliopathies have been brought into context of replicative stress, thus further pointing toward a functional role of increased RRM2 levels in MYCN-driven neuroblastoma in relation to replicative stress in our zebrafish model. In addition, recent studies point toward an association between primary cilia and cancer, as they play a role in the interactions between cancer cells and the tumor microenvironment. In addition, a direct link between ciliary signaling and regulation of tumor growth and response to treatment has been described, with an impact on core cancer signaling pathways, including DNA damage response. FOXJ1 and concomitant reduction of the ciliogenesis program have been previously linked to aggressive ependymoma tumor development. Further studies are warranted to clarify the possible role of FOXJ1 and cilia genes in connection to RRM2-enhanced MYCN-driven neuroblastoma formation. Pharmacological RRM2 inhibition suppresses growth of high-risk neuroblastoma-derived cell lines Several compounds targeting RRM2 or RNR activity have been reported, including the iron chelator triapine (further referred to as 3AP) for which positive safety and tolerability data are available from several clinical trials. First, to assess 3AP sensitivity, we determined average inhibitory concentration (IC 50 ) values in a panel of eight neuroblastoma cell lines and compared the effects with the deoxycytosine analog and the RRM1 inhibitor gemcitabine, a commonly used chemotherapeutic in cancer treatment, as well as the effects of hydroxyurea (further denoted as HU), a well-established RRM2 inhibitor in the same cell line panel. Cell viability was most effectively reduced with 3AP compared to gemcitabine or HU (Fig. 4A). MYCN-amplified cell lines and the nonamplified CLB-GA cell line responded well in the nanomolar range, while the other MYCN-nonamplified cell lines were poor responders to 3AP treatment. Correlation analysis of RRM2 expression levels with the area under the curve (AUC) values as obtained for 3AP (Fig. 4A) indicated that cell lines with high RRM2 expression display reduced sensitivity to 3AP (Fig. 4B). We next selected MYCN-amplified IMR-32 and MYCN-nonamplified CLB-GA neuroblastoma cells to study further the phenotypic and molecular effects of 3AP treatment. A significant reduction in cell confluence (Fig. 4C) and increased apoptosis could be observed for both cell lines (Fig. 4D) when exposed to respective IC 50 and IC 30 of 3AP. Notably, in nonmalignant murine NIH3T3 fibroblasts, no apoptotic effects were observed under IC 50 drug conditions in the presence of the expected reduction in proliferation (Fig. 4E). Flow cytometry analyses revealed an almost complete G 1 -S phase arrest and increase of cells in G 1 upon treatment with 3AP at IC 30 (Fig. 4F). Both IC 30 and IC 50 could impose a reduction in the available dNTP pools (Fig. 4G), underscoring the on-target effect of 3AP treatment. In addition, a significant up-regulation of the p53 target genes CDKN1A and RRM2B was induced, as measured by RT-qPCR (Fig. 4H). RRM2 inhibition at IC 50 and IC 30 3AP concentrations caused enhanced RPA32 phosphorylation (marker for increased single-stranded DNA) and elevated yH2AX levels. In keeping with these observations, using DNA combing, we also found significant increased levels of stalled forks upon 3AP treatment versus controls (Fig. 4I), likely due to increased double-stranded DNA breaks (presumably reflecting increased fork collapse). As expected, elevated fork stalling and accompanying increased pRPA32 and yH2AX levels led to S345 pCHK1 activation (measured through pCHK1 levels) ( Fig. 4J and fig. S2B). Given that p53 mutations can confer a more aggressive (drug-resistant) neuroblastoma phenotype, we also evaluated the phenotypic response to pharmacological RRM2 inhibition of the p53-mutant neuroblastoma cell line SK-N-BE-C. We observed reduced cell confluence following 3AP treatment, with both IC 30 S3B). Immunoblotting following 3AP treatment of SK-N-BE-C cells treated with 3AP showed upregulated S345 pCHK1 and pRPA32 levels. In addition, as observed in IMR-32 and CLB-GA cells, total CHK1 levels were down-regulated following 3AP exposure at IC 50 Last, we evaluated the transcriptional responses of IMR-32 and CLB-GA cells after 48 hours of exposure to their respective IC 30 and IC 50 3AP concentrations. All four cell lines tested showed a p53 gene signature response induction (Fig. 5A). Furthermore, using GSEA, a strong overlap between 3AP and RRM2-targeting siRNAs induced gene signatures and was notable in both IMR-32 and CLB-GA cells, supporting the on-target effect of RRM2 pharmacological inhibition using 3AP (Fig. 5B). In further support of the on-target activity of 3AP as demonstrated by dNTP measurements (Fig. 4G), we also compared the transcriptome profiles after 3AP exposure of IMR-32 and CLB-GA neuroblastoma cells to published transcriptome profiling data of prostate cancer cells (cell line C4-2) following exposure to COH29, a small-molecule RRM2 inhibitor. From this PLIN5 FLRT3 USP18 INHBE TESC CA12 LHX9 TOX3 LRFN1 CERKL MYCL AFF3 INSIG1 CCDC167 FIGN IGFBP5 LINC00682 PLAUR TFAP4 PHLDB2 DACT3 LIMCH1 LIPE-AS1 RNF112 RNU1-2 BBC3 CAMK1 H19 PHLDA3 CELF5 GPR155 MGP STRA6 CORO6 PGPEP1 KIFC2 analysis, we could show that 3AP-induced transcriptome changes in both IMR-32 and CLB-GA robustly overlap with those imposed upon COH29 exposure (Fig. 5, C and D). Pharmacological RRM2 inhibition imposes dormant origin activation following replication fork stalling at early firing origins In addition, to monitor the impact of 3AP on individual replication forks by DNA combing, we applied the novel sequencing method "transferase-activated end ligation" sequencing (TrAEL-seq) to establish the detailed genome-wide landscape of DNA replication changes imposed on neuroblastoma cells by 3AP exposure (IC 50 ). Using this method on IMR-32 cells, we could measure replication fork stalling events as well as the impact on replication fork directionality and origin usage. In the "read density plot" for 3AP-treated cells, which shows the distribution of replication forks across the genome (Fig. 5E, panel 3), large and defined peaks appear in comparison to the relatively uniform profile of dimethyl sulfoxide (DMSO)-treated cells, indicative of increased replication fork stalling at these sites. Notably, these peaks line up with replication initiation zones (IZs) containing replication origins active in untreated cells, defined on the basis of the DMSO "read polarity plot" that displays the average direction of replication fork movement (Fig. 5E, panel 2; regions transitioning from negative to positive polarity), indicating that most forks initiated at normal S-phase IZs rapidly stall upon 3AP exposure. In addition, multiple dormant origins become active upon 3AP treatment (Fig. 5E, panel 4; regions transitioning from negative to positive polarity). The read polarity plot also shows that the replication profile of 3AP-treated cells becomes more disordered, as the reduced bias in read polarity results from the direction of replication fork movement at any given genomic location becoming less well defined (Fig. 5E). These substantial changes and reproducibility of the data could be shown by means of a principal components analysis (PCA) (Fig. 5F). Genome-wide, replication forks are uniformly distributed between IZs and random locations in DMSO-treated cells but accumulate at IZs and are depleted from random locations in 3AP-treated IMR-32 cells (Fig. 5G), with a particularly strong enrichment at early IZs ( Fig. 5H). Last, we observed an enrichment of 3AP-induced fork stalling at all early replicating regions and a depletion at late replicating regions relative to DMSO controls (Fig. 5I). Together, this shows that 3AP treatment induces significant stalling of replication forks initiated at commonly used and particularly early IZs, in keeping with the above-described cell cycle and gene expression data. Consequently, it appears that numerous typically dormant replication origins become activated, attempting to complete replication, resulting in the disordered replication profiles seen in 3AP-treated cells. Combined pharmacological RRM2-CHK1 inhibition as a novel therapeutic strategy in high-risk neuroblastoma The ATR-CHK1 signaling axis plays a critical role on the control of replication fork stability and origin firing. CHK1 has been reported as a synthetic lethal target in MYCN-amplified neuroblastoma, and neuroblastoma was ranked as the most sensitive pediatric cancer for CHK1 inhibitor prexasertib. ATR inhibition has been shown to cause replication catastrophe under conditions of high replicative stress. Gemcitabine or HU has been used to enhance replicative stress and sensitize cells for CHK1 inhibition. However, gemcitabine acts both directly on RRM1 (not RRM2) and through disruption of DNA synthesis through incorporation of dNTP analogs, while HU acts on RRM2 but only in the higher micromolar range. In view of this and the above data showing potent effects of 3AP, we selected this drug to further test its effect in combination with either ATR or CHK1 inhibitors. We first evaluated pharmacological ATR (BAY1895344) compared to CHK1 (prexasertib) inhibition in combination with 3AP at low-dose concentrations (IC 15 ). Cell confluency was measured by means of IncuCyte live cell imaging for human IMR-32 and CLB-GA neuroblastoma cells under conditions of low single-dose RRM2 or ATR pharmacological inhibition in comparison to combined treatment. Drug synergism was observed at 72 hours after treatment with respective Bliss indices of 0.47 (IMR-32) and 0.36 (CLB-GA), concomitant with reduced cell confluence (Fig. 6A) and significant induction of apoptosis (Fig. 6B), the latter supported by induction of CDKN1A and PUMA gene expression in CLB-GA cells (Fig. 6C). Treatment of nonmalignant NIH3T3 fibroblast cells did not affect cell growth or survival, showing that neither cell confluence nor cell death was significantly changed in the combined treatment compared to single-agent or control treatment, indicating that the combination treatment can be tolerated by normal cells (Fig. 6, A and B). Increased apoptosis was also accompanied by up-regulated yH2AX levels ( Fig. 6D and fig. S2C). Notably, the DNA-dependent protein kinase (DNA-PK) salvage pathway, as measured by pDNA-PK, was activated upon combined RRM2 and ATR inhibition (reducing p-ATR levels), in line with previous observations. In a second step, using a similar approach, we dissected the phenotypic and molecular consequences of combined 3AP and prexasertib treatment. In comparison to combined RRM2 and ATR inhibition, higher BLISS indices were observed for this drug combination of 0.69 (IMR-32) and 0.58 (CLB-GA), respectively, and significant reduction of cell confluence (Fig. 7A). The drug combination also increased the caspase 3/7 signal (Fig. 7B) compared to single-drug and control-treated (DMSO) cells. In contrast, NIH3T3 fibroblast cells did not exhibit any measurable effects of a similar combined pharmacological RRM2-CHK1 inhibition (Fig. 7, A and B), thus suggesting low or no toxicity in normal cells. Reduced cell confluence was concomitant with a clear induction of an S phase arrest in the combination treatment versus controls (Fig. 7C). The induction of apoptosis was further confirmed by RT-qPCR analysis, indicating both p53 pathway activation (up-regulated CDKN1A and RRM2B expression) and increased expression of proapoptotic markers BAX, NOXA, and PUMA (Fig. 7D). Furthermore, 3APprexasertib synergism increased pRPA32 and yH2AX levels, and marked reduction in RRM2 protein levels was noted (Fig. 7E), suggesting that RRM2 could represent the target for synthetic lethal interaction. In contrast to combined RRM2-ATR pharmacological inhibition, we could no longer observe increased pDNA-PK levels upon combined RRM2-CHK1 inhibition, indicating that this drug combination can circumvent this rescue pathway while efficiently imposing DNA damage, as evidenced by up-regulated yH2AX levels ( Fig. 7E and fig. S2D). Similar as for the 3AP single treatment, we also evaluated the phenotypic consequences of combined 3APprexasertib treatment in p53-mutant SK-N-BE-C cells. Exposure of SK-N-BE-C cells to 3AP-prexasertib combination treatment shows a synergistic effect on attenuated cell confluence, as measured by IncuCyte live cell imaging ( fig. S3D), as well as cell death compared to control or (low-dose) single treatments ( fig. S3E). Immunoblotting following combined 3AP-prexasertib treatment showed up-regulation of S345 pCHK1 and yH2AX levels, together with reduced RRM2 and total CHK1 protein levels ( fig. S3F), in line with the observations in IMR-32 and CLB-GA neuroblastoma cells. The effects of nucleotide inhibition by RNR inhibitors or RRM2 knockdown on CHK1 levels have been reported by several teams. Particularly instructive is the recent work of Ohmura et al. in Ewing sarcoma, who demonstrated that, upon exposure to the gemcitabine RNR inhibitor, total CHK1 is down-regulated together with down-regulation of global protein levels. These authors also showed that, upon RRM2 knockdown, similar results are observed. Moreover, we could show that, upon combined 3APprexasertib treatment, S296 pCHK1 autophosphorylation is effectively reduced, concomitant with an increase in S345 pCHK1 signal ( fig. S4A). It has been demonstrated that functional inhibition or knockdown of RRM2 directly affects protein translation through inhibition of the translational inhibitor 4E-BP1. We therefore also investigated whether the loss of the inhibitory phosphorylation of 4E-BP1 also occurred in neuroblastoma cells upon combined pharmacological RRM2-CHK1 inhibition. Our data indeed show a decrease in p4E-BP1 levels, which indicates activation of this translational inhibitor, in keeping with the observed reduction of both CHK1 and RRM2 protein levels ( fig. S4B). Combined 3AP-prexasertib drugging induces expression of the nucleotide stress-induced transcriptional regulator and tumor suppressor HEXIM1 (Hexamethylene Bis-Acetamide-Inducible Protein 1) To gain further mechanistic insight into the observed drug synergism, we performed gene signature analysis following transcriptome profiling by RNA-seq. GSEA revealed a significant down-regulation of G 2 -M cell cycle genes and E2F targets (Fig. 8A). The set of up-regulated genes was also strongly enriched for p53 target genes and revealed that combined 3AP-prexasertib treatment significantly reduced the expression of various oncogenes with an established role in neuroblastoma, including TWIST1 (a direct MYCN target and interaction partner) and PBK (a converging target gene of LIN28B/ let-7 and MYCN) together with a strong induction of expression of tumor suppressor HEXIM1, a negative regulator of the transcriptional regulator pTEFb (Fig. 8B). Transcriptional up-regulation of HEXIM1 was confirmed by RT-qPCR (Fig. 8C). To gain further insight into the upstream regulators of RRM2 expression, we performed an unbiased landscaping of RRM2 upstream regulators using CasID as a proximity-based labeling approach for RRM2 promotor interactome mapping. A total of four different single guide RNAs (sgRNAs) were designed that cover the RRM2 promotor in a tiling approach versus a control sgRNA against lacZ. Following biotin-streptavidin affinity purification in SK-N-B(E)2-C cells over four biological replicates, high-confidence RRM2 promotor interactors were identified ( Fig. 8D and table S1), including HMGB2 and HEXIM1, as well as the NurD, PAF, and COMPASS chromatin modifier complexes. HEXIM1 is a negative regulator of the positive transcription elongation factor P-TEFb complex (consisting of CDK9 and cyclin T1). Recent data suggest that HEXIM1 could act as a tumor suppressor to block transcription under conditions of nucleotide stress by sequestration of P-TEFb. In addition, the P-TEFb component CDK9 itself was significantly enriched in the performed CasID experiment (FDR < 0.05). We also scrutinized this hit list using the "Ingenuity Pathway Analysis" (IPA) tool, indicating a clear enrichment of DNA damage and checkpoint proteins (Fig. 8D). Although we could not detect MYCN itself in our assay, IPA analysis indicated, among others, MYCN, E2F4, and CDKN2A/p16 as putative key upstream regulators of the enriched RRM2 regulator pool, and publicly available MYCN ChIP-seq data in neuroblastoma cell lines showed direct MYCN binding on the RRM2 promotor region (Fig. 1E). Next, we also evaluated the activity scores of various publicly available gene signatures in the transcriptome profiles obtained in IMR-32 and CLB-GA cells upon exposure to single and combined 3AP/prexasertib: (i) Scoring of prexasertib response gene sets established by Blosser et al. showed a significant down-regulation of genes that are negatively correlated to prexasertib sensitivity and a significant up-regulation of genes that are correlated to prexasertib resistance (Fig. 8E); (ii) the adrenergic neuroblastoma gene set established by Van Groningen et al. was significantly down-regulated upon combined 3AP-prexasertib treatment both in IMR-32 and CLB-GA cells, while the mesenchymal signature was not significantly altered (Fig. 8, F and G); and (iii) we determined the activity score of AKL (Anaplastic Lymphoma Receptor Tyrosine Kinase) signaling and observed that the set of genes activated downstream of the ALK receptor was significantly up-regulated upon exposure of IMR-32 and CLB-GA cells to combined 3APprexasertib treatment compared to single-agent and control (DMSO) treatment (Fig. 8, H and I). In vivo validation of synergistic RRM2-CHK1 inhibition Next, we aimed to validate the observed in vitro synergism between 3AP and prexasertib using an in vivo murine xenograft model in immunodeficient mice. Here, subcutaneous xenografted tumors from IMR-32 neuroblastoma cells were treated with vehicle, 3AP only (10, 7.5, 5, or 2.5 mg/kg), prexasertib only (10 mg/kg), or a combination. Mice treated with 3AP or prexasertib monotherapy displayed no obvious signs of toxicity based on their body weight and animal behavior (Fig. 9, A and B). However, in the combination therapy, mice treated with higher 3AP doses (5, 7.5, or 10 mg/kg) and prexasertib (10 mg/kg) suffered from severe drug toxicities (Fig. 9A) and were euthanized before the end of the treatment regime as they reached the preset humane end points of this in vivo study. Mice treated with the lowest 3AP dose (2.5 mg/kg) in combination with prexasertib (10 mg/kg) also presented mild (seven of eight) to severe (one of eight) signs of toxicity, including a significant drop in body weight at the end of the treatment regime (P = 0.004) (Fig. 9C). Upon treatment discontinuation, these mice regained body weight and fully recovered. Next, we evaluated the effects of the treatment on the tumor progression. Mice treated with a dose range of 3AP monotherapy displayed little or no effect on the in vivo tumor progression rate compared to the vehicle-treated group (Fig. 9D). Single treatment with prexasertib (10 mg/kg) could slow down tumor growth (P = 0.04; Fig. 9E). Our results show that combined 3AP (2.5 mg/kg) and prexasertib (10 mg/kg) were strongly synergistic and could completely halt neuroblastoma tumor development in vivo (Fig. 9E). Again, a strong significant difference could be observed at day 24 (4 days after the treatment was stopped) between vehicle and combined 3AP (2.5 mg/kg) with prexasertib (10 mg/kg)-treated mice (P = 0.004). These observations were further confirmed in terms of progression-free survival of the different treatment groups included in this study (Fig. 9, F and G). No statistical difference (log-rank Mantel-Cox test) in tumor size could be observed between vehicleand 3AP-treated mice for all tested 3AP concentrations including 10 mg/kg (P = 0.90), 7.5 mg/kg (P = 0.07), 5 mg/kg (P = 0.59), and 2.5 mg/kg (P = 0.18), while only slight significance was noted for the prexasertib-treated group (P = 0.05) (Fig. 9, F and G). In contrast, a clear significant difference (log-rank Mantel-Cox test) in tumor sizebased survival could be shown between vehicle-treated mice and those that received the combination treatment of 3AP (2.5 mg/kg) and prexasertib (10 mg/kg) (P = 0.0007). Time after injection (days) Treatment period (d16-d20) combinations of 3AP and prexasertib were evaluated in nontumor nonobese diabetic (NOD) severe combined immunodeficient (SCID) gamma (NSG) mice to evaluate toxicity effects. No mortality was observed for any of the dose levels tested. However, significant weight loss was observed in treated animals at the highest dose level , and treatment was only tolerated for 1 week because of severe weight loss and poor clinical appearance. In contrast, animals treated with lower doses had few to no dosing holidays and were tolerated for nearly two treatment cycles ( fig. S5A). In addition, serial blood cell count measurements were performed, which show treatmentassociated anemia and thrombocytopenia, but with consequent recovery ( fig. S5B) For both PDX models, we could achieve significant differences when comparing the combination response to the other arms, both in terms of average (Fig. 9, H and I) and relative mean tumor volumes (Fig. 9, J and K). However, given that only three mice per treatment group were included, further experiments are warranted to learn whether the combination treatment is truly synergistic in these models compared to the single-treatment arms. DISCUSSION High-risk neuroblastoma genomes are predominantly marked by a landscape of highly recurrent large segmental and focal DNA copy imbalances, while mutations are sparse. Multiple loci located on the short arm of chromosome 2 frequently undergo segmental gains or chromothripsis events, causing focal high-level amplifications of which MYCN amplification is the most frequently altered target. Here, we identified RRM2 as a previously unidentified copy number-driven dependency gene, which is strongly associated with poor prognosis, up-regulated during MYCN-driven mouse neuroblastoma formation and causing increased penetrance and accelerated neuroblastoma formation under forced combined overexpression with MYCN in the developing zebrafish sympathetic neuronal lineage. In vitro knock down experiments and pharmacological inhibition of RRM2 showed strong dependency in adrenergic neuroblastoma cell lines and neuroblastoma patient tumor-derived spheroid cultures. How do we explain the RRM2 dependency in neuroblastoma cells? First, high MYCN/MYC activity causes weakened G 1 -S control and activates dormant origins of replication, causing enhanced proliferation but at the cost of increased demand for nucleotides (among others), which causes enhanced replicative stress levels and ATR-CHK1 activation. Second, RRM2 is cell cycle-regulated, and while induced during G 1 -S transition, RRM2 levels are still low during early S phase. In view of this, ATR-CHK1 activation is critical in suppressing origin firing and enhancing RRM2 levels through control of CDK2-mediated E2F degradation during early S phase. In this context, the previously reported synthetic lethality for CHK1 in MYCN-amplified neuroblastomas is not unexpected and further supported by the highest CHK1 inhibitor sensitivity for neuroblastoma across a wide range of tumor entities. Further evidence that elevated RRM2 levels facilitate replication stress resistance in neuroblastoma cells comes from the data from Blosser et al., showing that high RRM2 expression is associated with enhanced sensitivity to the prexasertib CHK1 inhibitor, thus indicative of high ATR-CHK1 activity. Forced RRM2 overexpression in MYCN-nonamplified CLB-GA neuroblastoma cells suppresses excessive prexasertib-induced replicative stress and further supports the role of elevated RRM2 expression for suppression of excessive replicative stress. Moreover, GSEA for the differentially expressed genes for double MYCN-RRM2 versus MYCN-only transgenic zebrafish neuroblastomas also reveals enhanced ATR-CHK1 signaling activity in keeping with increased pCHK1 and yH2AX in MYCNversus MYCN/RRM2-overexpressing zebrafish neuroblastomas. This dataset also revealed possible involvement of cilia genes and their master regulator FOXJ1. However, the exact significance of this intriguing finding remains to be unraveled by further studies. Elevated MYC/MYCN activity is also considered to induce transcriptional amplification of actively transcribed loci, which may cause so-called transcription-dependent replicative stress because of the formation of paused transcriptional complexes and R loops, which pose a physical and topological challenge to the DNA replication machinery and subsequent slowing down and stalling of DNA replication forks. Evidence has emerged that several factors are regulated by MYC/MYCN that alleviate replicative stress. Among others, the work of Herold et al. revealed a pronounced role for AURKA (Aurora Kinase A) in suppressing R loop formation and a novel role for BRCA1 (located on 17q and also often affected by gains) in limiting MYCN-driven accumulation of stalled RNAP. Further studies are warranted to investigate the role of ATR-CHK1 control of RRM2 levels in relation to transcription-replication conflicts and R loop suppression. While monotherapies for RRM2 inhibition have not led to durable responses on tumor growth inhibition, previous effects of gemcitabine, which inhibits DNA replication through RRM1 inhibition and incorporation of toxic nucleotide analogs, showed the potential for CHK1 sensitization. Given the previously established strong dependency of neuroblastoma for CHK1-mediated checkpoint control and, thus far, poorly explored potential for synergistic drugging, we therefore decided to evaluate the use of RRM2 inhibition to enhance CHK1 sensitivity. We observed a strong synergism between the combined inhibition of RRM2 and CHK1, using 3AP and prexasertib, respectively. Both in a cell line xenograft and several initially treated PDXs, sensitivity was noted at the initially used high concentrations. In the cell line xenograft, a short period of 4 days of treatment already resulted in a complete regression of the engrafted tumor, both for prexasertib monotherapy and the 3AP-prexasertib combination. Upon drug withdrawal, tumors treated with "prexasertib only" rapidly recurred, while mice remained tumor free for almost 40 days in the combination treatment group, indicating the potential value of 3AP-prexasertib combination to treat patients with highrisk neuroblastoma. Next, we also evaluated the response to the 3APprexasertib combination in PDXs (MYCN nonamplified or MYCN amplified with ALK mutation) and observed similar strong growth reduction. Using a combined transcriptome and proteome approach, we also sought for mechanistic insights into the underlying molecular mechanism driving the synthetic lethal drug interaction. In response to combined RRM2 and CHK1 inhibition, we consistently observed strong transcriptional HEXIM1 induction. HEXIM1 was reported to respond to nucleotide stress and acts as a negative regulator of transcription elongation regulator at oncogenic loci and stabilizes mRNAs of tumor suppressor genes in melanoma. Of further importance, we used programmable DNA binding of dCas9 with the promiscuous biotin ligase BirA* (CasID) for proximity biotinylation of proteins (table S1), and we identified HEXIM1 as one of the RRM2 promotor-bound proteins that, together with ATRinduced E2F1 degradation, may further attenuate RRM2 transcription. In addition, several epigenetic regulatory protein complexes were identified at the RRM2 promotor, including NurD, PAF, and COMPASS chromatin factors. Furthermore, CHD5 is encoded on the commonly deleted 1p36 chromosomal region in neuroblastoma and known to replace CHD4 in NurD complexes during neuronal differentiation, suggesting that tight RRM2 regulation may also be an important factor in normal differentiation of sympathoblasts. In addition, HMGB2 was one of the top enriched factors in this assay, recently described as a master regulator of the chromatin landscape during senescence, with loss of its nuclear expression being instructive to CTCF (CCCTC-binding factor) clustering, the latter also strongly enriched in our CasID assay. RRM2 expression and function is tightly regulated by various factors. Several of these regulators are also affected by copy number changes, further suggesting that these highly recurrent chromosomal and focal genomic imbalances exert effects that support tumor initiation and/or maintenance. To the best of our knowledge, RRM2 is the first copy number-driven dependency gene for which direct impact of transcriptional up-regulation has been successfully modeled in the zebrafish MYCN-driven neuroblastoma model. We are currently also generating mouse and zebrafish models overexpressing RRM2-dTAG to allow to monitor in vivo the effect of RRM2 protein degradation on tumor maintenance as a prelude for previously unknown protein-degrading drugging approaches. At present, it is difficult to irrefutably prove the impact of a copy number gain for a given gene on neuroblastoma formation and behavior and, even more so, to establish the biological (and possible epistatic) effects of multiple genes implicated in large chromosomal gains or losses. One approach that has been tested is CRISPR-based chromosomal deletions in mouse neural crest cells before MYCN overexpression-mediated transformation to neuroblasts and injection in mice. In conclusion, our results converge toward a key RRM2 dependency in neuroblastoma cells by RRM2-controlled modulation of checkpoint integrity and replication fork stability in response to MYCN-induced replicative stress. Co-overexpression of RRM2 induced enhanced neuroblastoma formation and increased tumor penetrance in the MYCN-driven zebrafish model. We provide evidence that elevated RRM2 levels facilitate neuroblastoma cells to cope with replicative stress along with evidence for enhanced activation of ATR-CHK1 response. We present preclinical evidence that selective and/or combinatorial targeting of the RRM2 axis opens perspectives for potent and tolerable previously unidentified targeted drug combinations for the clinic. The emerging role of RRM2 and CHK1 dependency in other tumor entities including Ewing sarcoma and glioblastoma may warrant to broaden clinical trial efforts to evaluate the potential of the proposed combination therapy. Given the critical role of RRM2 in high-risk neuroblastoma, we also hope that our work will trigger further investigation toward novel pharmacological compounds, such as protein degraders to target RRM2 in combination with previously unknown replication stress checkpoint signaling drugs. Inducible RRM2 overexpression cell line The RRM2 fragment was amplified by PCR (forward and reverse primer sequences are provided on table S6), and OriGene clone GC-Z9335-GS was used as a template. The obtained fragment was gel-purified and ligated into the opened Mlu I/Nde I sites of response vector pLVX-TRE3G-Zsgreen1 producing pLVX-TRE3G-Zsgreen1-IRES-RRM2. The sequence of the constructed plasmid was verified by Sanger DNA sequencing (GATC). Lenti-X 293T cells were transfected with the regulator vector pLVX-pEF1a-Tet3G and Lenti-X Packaging Single Shots (VSV-G) according to the manufacturer's instructions. The supernatant containing the lentivirus was collected, filtered through a 0.45-m filter, and concentrated using PEG-it. CLB-GA cells were infected with the concentrated virus. After 48 hours of incubation, the transduced clones were obtained by limiting dilution. After clonal expansion, the TAT protein expression in each clone was checked by immunoblotting using TetR monoclonal antibody (clone 9G9). In addition, induction of each expressing clone was tested after transduction with the pLVX-TRE3G-Luc control vector. Selected clones were transduced with the lentivirus produced, as described above, from vector pLVX-TRE3G-Zsgreen1-IRES-hsRRM2 and subsequently selected with only 4 g/mL of puromycin. Compounds and chemicals 3AP, gemcitabine, and HU were obtained from Sigma-Aldrich; prexasertib and BAY1895344 were obtained from Bio-Connect. Cell viability measurements for a single compound treatment The adherent cell lines were plated in 96-well plates at a density of 2 10 3 to 1.5 10 4 cells per well, depending on the cell line. Cells were allowed to adhere overnight, after which different compounds-3AP, HU, and gemcitabine-were added in a range of concentrations. Cytotoxicity assays were performed at 48 and 72 hours after treatment with CellTiter-Glo reagent. In addition, the apoptosis levels were measured, at 72 hours after treatment, using the Caspase-Glo 3/7 Assay System. Both protocols were adapted, adding 50 l of reagent for each assay. The results were normalized to vehicle (0.1% DMSO), and the different inhibitory concentration values and AUC were computed using GraphPad Prism Software (version 9.2). The doseresponse curve analysis was performed through ECanything equation assuming a standard slope of −1.0. For the caspase analysis, each caspase signal was normalized to the area of occupancy, given by the IncuCyte Software. The error bars in figures represent the SD from three biological replicates. Combination and synergism measurements To find synergism, cells were seeded in 384-well plates at a density of 1.5 10 3 to 2 10 3 cells per well, depending on the cell line. Cells were allowed to adhere overnight, after which these were exposed in a range of concentration of different compounds, alone or in a combination matrix or in fixed combination (3AP, prexasertib, and BAY1895344). The treatment was performed using a D300 TECAN instrument. Cell proliferation was monitored for 72 hours, in which pictures were taken through IncuCyte Live Cell Imaging System. Each image was analyzed through the IncuCyte Software. Cell proliferation was monitored by analyzing the occupied area (percentage of confluence) of cell images over time. The synergism was computed according to the Bliss independent (BI) method using the HTSplotter tool. Once the combinations with the highest BI score were selected, the adherent cell lines were plated in 96-well plates at a density of 2 10 3 to 1.5 10 4 cells per well, depending on the cell line. These ones were allowed to adhere overnight, following their exposure to a determined concentration of each different compound as mentioned above. The proliferation was monitored for 72 hours by the same system, as well as the analyses of each image. From the same plate, once the latest time point was scanned by the IncuCyte software, the apoptosis levels were measured using the Caspase-Glo 3/7 Assay; however, this protocol was adapted by adding 50 l of reagent for each assay. The caspase analysis was performed as mentioned above. Proliferation plots were generated using our recently published HTSplotter tool, in which the SD from three or more biological replicates is represented as error bars. As for the caspase assay, the data was meancentered and autoscaled. Organoid cell viability screening Patient-derived neuroblastoma tumor organoids were harvested using Accutase solution (Sigma-Aldrich), made single cell, filtered using a 70-m nylon cell strainer (Falcon), and resuspended in an appropriate growth medium. Subsequently, cells were plated at densities ranging from 1000 to 6000 cells per well using the Multi-drop Combi Reagent Dispenser on repellent black 384-well plates (Corning). Following 24 hours of recovery time, cells were treated with 0 to 10 nM prexasertib and/or 0 to 10 M 3AP or DMSO (negative control) using the Tecan D300e Digital Dispense (HP). Two technical replicates were included in each experiment, and two biological replicates were completed for each patient-derived neuroblastoma tumor organoid. After 5 days of treatment, adenosine triphosphate levels were measured using CellTiter-Glo 3D (Promega) according to the manufacturer's instructions. The results were normalized to vehicle (0.1% DMSO), and data were analyzed with GraphPad Prism v7.04. siRNA-mediated knockdown of RRM2 NB cells were transfected using the appropriate Neo kit (catalog no. MPK10096) with siRNA toward RRM2 (Ambion, Life Technologies) and or scrambled siRNA (Ambion, #AM4635). After transfection, the cells of each condition were split and seeded in a 96-well plate, at a density of 1.5 10 4 to 3 10 4 cells per well, and in a T-25, at a density of 2.2 10 6 cells per flask. The cells seeded in a 96-well plate were monitored for proliferation during 72 hours in which pictures were taken through IncuCyte. Proliferation was analyzed as mentioned above. From the same plate, once the latest time point was scanned in IncuCyte, the apoptosis levels were measured using the Caspase-Glo 3/7 Assay System. The protocol was adapted, adding 50 l of reagent for each assay. The caspase analysis was performed as mentioned above, and the HTSplotter tool was used to generate the proliferation plots. The error bars from the proliferation assay represents the SD from three or more biological replicates, while the ones showed on the caspase assay were mean-centered and autoscaled. The cells seeded in a T-25 flask were collected for RNA and protein isolation, 72 hours after transfection. The knockdown was evaluated by RT-qPCR and immunoblotting. DNA combing Exponentially expanding neuroblastoma cells were pulse-labeled for 20 min with 25 M thymidine analog 5-iodo-2-deoxyuridine. Cells were washed with warm medium and pulse-labeled a second time for 20 min with 5-chloro-2-deoxyuridine, and, depending on the condition, 500 M HU and 500 or 250 nM 3AP were combined. Cells were refreshed three times with warm medium and harvested by trypsinization. The cell pellet was washed with ice-cold phosphatebuffered saline (PBS); cells were resuspended at a cell density of 1 10 6 cells/ml and placed on ice. In total, 2 l of the cell suspension was spotted at one end of a glass slide. When the drop became opaque, 7 l of the lysis buffer was added. After 7 min of incubation, tilting the slide allowed the spreading of the DNA fibers. The air-dried slides were immersed in methanol/acetic acid (3:1), dried, and stored at −20°C until immunofluorescence staining. DNA fibers were acid-treated with 2.5 M HCl for 80 min, blocked in 5% bovine serum albumin (BSA) in PBS with Tween 20 and immunolabeled overnight at 4°C with mouse anti-5-bromo-2-deoxyuridine (BrdU) B44 (1:100; BD347580) and rat anti-BrdU Bu1/75 (1:150; Ab6326). The secondary antibodies were goat anti-mouse AF647 (1:100; Life Technologies, A21241) and goat anti-rat AF488 (1:100; Life Technologies, A11006). Incubation time was 1 hour at room temperature. The slides were rinsed with PBS followed by an alcohol series (70 to 95% ethanol), dried, and mounted with 1% propyl gallate as an antifading reagent. Imaging was done on a Zeiss Axio Observer.Z1 epifluorescence microscope equipped with a Plan-Apochromat 63/1.40 Oil DIC M27 lens and connected with an Axiocam 506 mono camera. The length of the fiber tracks was converted from pixels to micrometers and measured with Fiji (ImageJ) software. The measured fibers were further randomly selected the usingrandom.choice function from Python (version 3.9). Cell culture for fluorescence-activated cell sorting, RNA, and protein collection The neuroblastoma cell lines were seeded in a T-75 flask at a density of 2 10 6 to 2.25 10 6 cells per flask, depending on the cell line. As for the inducible CLB-GA RRM2 overexpressing cell line, doxycyclin was added at 1 g/ml immediately upon seeding. Cells were allowed to adhere for 48 hours, after which the medium was replaced by fresh medium and the treatment was added. Upon the selected treatment time points, the cells were scraped and centrifuged for 5 min at 1200 rpm, and the pellet was washed twice with ice-cold PBS. During each wash, the cells were pelleted during 5 min at 1200 rpm. The samples were divided for RNA and protein isolation and/or for flow cytometric analysis for cell cycle measurements. dNTP pool assay Neuroblastoma cells were seeded in a six-well plate at a density of 3.0 10 5 cells per well, depending on the cell line. Cells were allowed to adhere overnight, after which the medium was replaced by fresh medium and treatment was added. After 48 hours of treatment, the medium of all conditions were collected for further analyses. The plates were put on ice, in which each well was washed with 1 ml of ice-cold washing solution (0.9% NaCl). Next, 300 l of icecold extraction buffer was added and incubated for 2 to 3 min on ice. Then, the cells were scraped and collected. Next, 20 l of each sample was loaded into the Dionex UltiMate 3000 LC System (Thermo Fisher Scientific, Bremen, Germany) equipped with a C-18 column (Acquity UPLC-HSS T3, 1.8 m; 2.1 mm by 150 mm; Waters) coupled to a Q Exactive Orbitrap mass spectrometer (Thermo Fisher Scientific) operating in negative ion mode. A step gradient was carried out using solvent A and solvent B (100% methanol). The gradient started with 5% of solvent B and 95% of solvent A and remained at 5% B until 2 min after injection. A linear gradient to 37% B was carried out until 7 min and increased to 41% until 14 min. Between 14 and 26 min, the gradient increased to 95% B and remained at 95% B for 4 min. At 30 min, the gradient returned to 5% B. The chromatography was stopped at 40 min. The flow was kept constant at 0.25 ml/min at the column that was placed at 40°C throughout the analysis. The mass spectrometry operated in full scan mode (mass/charge ratio range: ) using a pray voltage of 4.80 kV, capillary temperature of 300°C, sheath gas at 40.0, and auxiliary gas at 10.0. The AGC (Automatic Gain Control) target was set at 1.0E+006 using a resolution of 35,000, with a maximum IT (injection time) fill time of 200 ms. Data collection was performed using the Xcalibur software (Thermo Fisher Scientific). The data analyses were performed by integrating the peak areas (El-Maven Polly-Elucidata). This experiment was performed once with three technical replicates. Cell culture for fluorescence-activated cell sorting, RNA, and protein collection The neuroblastoma cell lines were seeded in a T-75 flask at a density of 2 10 6 to 2.25 10 6 cells per flask, depending on the cell line. Cells were allowed to adhere for 48 hours, after which the medium was replaced by fresh medium and the treatment was added. After 48 hours of treatment, the cells were scraped and centrifuged for 5 min at 1200 rpm, and the pellet was washed twice with ice-cold PBS. During each wash, the cells were pelleted during 5 min at 1200 rpm. The samples were divided for RNA and protein isolation and for flow cytometric analysis of cell cycle. Cell cycle analysis Cell pellet was fixed in cold 70% ethanol for at least 1 hour. After fixation, cells were centrifuged for 5 min at 1200 rpm. The pellet was washed twice in 1 ml of PBS. During each wash, the cells were pelleted during 5 min at 1200 rpm. Then, the pellet was resuspended, and ribonuclease A (RNase A) was added to a final concentration of 0.2 mg/ml in PBS. The samples were incubated for 1 hour at 37°C. Last, 59.8 M propidium iodide (PI) was added to the solution. Samples were analyzed in PI/RNase A solution by Bio-Rad S3 fluorescence-activated cell sorting (FACS) cell sorter flow cytometer. All data were further analyzed by FlowJo software, following the cell cycle instructions. Western blot analysis Cells were lysed in cold radioimmunoprecipitation assay (RIPA) buffer supplemented with protease and phosphatase inhibitors. Samples were rotated for 1 hour at 4°C to obtain more complete lysis. The cleared lysates were collected and centrifuged at 10,000 rpm in a microcentrifuge for 10 min at 4°C. Protein concentrations were determined using the Pierce BCA Protein Assay Kit. The lysates were denaturized before loading on a gel, through five times Laemli denaturation buffer supplemented with -mercaptoethanol. Thirty micrograms of protein extracts was loaded on 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) gels with 10 tris/glycine/SDS buffer and run for 1 hour at 130 V. Samples were blotted on nitrocellulose or polyvinylidene difluoride (PVDF) membranes in 10% of 10 tris/glycine buffer and 20% of methanol. The membranes were blocked during 1 hour in 5% milk or 5% BSA in Tris-buffered saline with 0.1% Tween® 20 detergent (TBST). Primary antibody incubations were done in blocking buffer overnight at 4°C. Blots were washed three times with TBST before the incubation for 1 hour of secondary antibodies. The immunoblots were visualized by using the enhanced chemiluminescent Femto (Bio-Rad). The protein quantification analysis of the generated blots was performed through ImageJ software, where the area from each protein was normalized to the loading protein in respect to each blot. Antibodies used were the following: RRM2, pCHK1(Ser 345 ), pCHK1(Ser 296 ), CHK1, pRPA32, RPA32, yH2AX, vinculin, tubulin, ATR, p-ATR, 4E-BP1 (53H11), and p-4E-BP1(Thr 37/46 ). The material origin used for Western blot and the antibodies are provided on tables S4 and S5, respectively. RNA isolation complementary DNA synthesis and real-time qPCR RNA extraction was performed, practicing the manufacturer's instructions of miRNeasy kit (QIAGEN) including on-column deoxyribonuclease treatment, and NanoDrop (Thermo Fisher Scientific) was used to determine the concentration. Complementary DNA (cDNA) synthesis was achieved, practicing the iScript Advanced cDNA synthesis kit instructions from Bio-Rad. The PCR mix contained 5 ng of cDNA, 2.5 l of SsoAdvanced SYBR qPCR super mix (Bio-Rad), and 0.25 l of forward and reverse primers (to a final concentration of 250 nM; Integrated DNA Technologies). The RT-qPCR cycling analysis was performed using a LC-480 device (Roche). qBasePlus software 3.2 (www.biogazelle.com) was used for the analysis of the gene expression levels. For the neuroblastoma cell lines, the following reference genes were used: B2M, HPRT1, TBP, and YHWAZ. The error bars in figures represent SD after error propagation, with mean centering and scaling to control. The primer designs are provided on table S6. CasID To identify the putative upstream regulators of RRM2 binding at its promotor region, we exploited the CasID technology. Briefly, SK-N-BE 1:250 (w/w)] and digested in an incubator, for 4 hours at 37°C. Then, 1 g of trypsin (Promega) was added to the beads/proteins and digested in an incubator overnight at 37°C, and beads were removed by centrifugation at 500g for 2 min. Add trifluoroacetic acid to the digest for a final pH of 2 to 3. After acidification, precipitate was allowed to form by letting it stand for 15 min on ice. The acidified peptide solution was centrifuged for 15 min at full speed (room temperature) to remove the precipitate and was analyzed on a Q-HF standard gradient. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE repository with the dataset identifier PXD029630. RNA-seq processing and GSEA RNA-seq was carried out for siRNA-mediated knockdown of RRM2 in IMR-32 and CLB-GA cells, 3AP treatment (48 hours) with two different concentrations (IC 30 and IC 50 ; table S7) for IMR-32 and CLB-GA cells and combined 3AP-prexasertib treatment (48 hours) for IMR-32 and CLB-GA cells. Libraries for mRNA-seq were prepared using the QuantSeq 3 mRNA library prep kit (Lexogen, Vienna, Austria) with umi barcoding according to the manufacturer's protocol. The libraries were equimolarly pooled and sequenced on an Illumina NextSeq 500 high-throughput flow cell, generating singleend 75-bp reads. Sequencing quality was confirmed using FastQC (version 0.11.7). Trimmed reads were aligned to the human reference genome using the STAR alignment software. The resulting mapped files were inspected for quality using Qualimap BamQC. Feature counts were used to infer gene-level expressions from the mapped data, and expression levels per sample were aggregated using custom Python scripts. All subsequent analyses were conducted in R statistical language. BioMartR was used for obtaining gene annotation and references from BioMart. DESeq2 was used for differential gene expression analysis; data were additionally normalized using a regularized log transformation (rlog2) followed by log FC shrinkage to account for variability at extreme ranges (lfcShrink). As apparent batch effects between cell lines were observed in the data, Limma's "batchEffectCorrection" method was used to account for batch effect to deeper investigate the distinct conditions. GSEA was done using either the c2 gene set collection from MSigDB (gsea-msigdb. org) or gene lists compiled from this study. All RNA-seq data are available through the Gene Expression Omnibus (GEO) repository (GSE161902). TrAEL-seq library preparation and data processing IMR-32 cells were seeded in a T-25 (2.2 10 6 cells per flask) and allowed to adhere for 48 hours, after which the medium was replaced by a fresh one with either 0.1% of DMSO (vehicle) or 3AP treatment (689.5 nM). After 24 hours of treatment, the supernatant of each flask was collected and added to the trypsinized cells and centrifuged (5 min at 1200 rpm), and the pellet was washed with ice-cold PBS. Cells were collected, 1 10 6 per condition, and washed with L buffer and lastly resuspended in 60 l of the buffer. The cell suspension was warmed for at least 2 min at 50°C before adding to 40 l of melted and warm CleanCut agarose. The mixture was vortexed for 5 s and directly pipetted into a plug mold. Agarose-embedded DNA from IMR-32 cells was generated and processed into libraries as previously described, and libraries were sequenced on an Illumina NextSeq 500 as high-output 75-bp single end by the Babraham Institute Next-Generation Sequencing facility. Scripts used for unique molecular identifier (UMI) handling and more detailed information on data processing are available at https:// github.com/FelixKrueger/TrAEL-seq and described in detail in. TrAEL-seq read structure is NNNNNNNN(T)nSEQUENCESPECIFIC, where NNNNNNNN represents the UMI and (T)n represents poly(T). Before TrAEL-seq preprocessing, sequences were deduplicated on the basis of the first 23 bp on their 5 end (using the script TrAELseq_sequence_based_deduplication.py). This region contains both the UMI sequence and the first 15 bp of genomic sequence and identifies (and removes) PCR-amplified multicopy sequences that would, under normal conditions, survive the UMI-aware deduplication procedure by aligning to several different genomic regions at random. The script TrAELseq_preprocessing.py was then used to remove and store the first 8 bp (UMI). Up to 3 T (inclusive) at the start of the sequence were removed, and reads were subjected to adapter and quality trimming using Trim Galore (v0.6.5; default parameters; https://github.com/FelixKrueger/TrimGalore). UMIpreprocessed and adapter-/quality-trimmed files were then aligned to GRCh38 with Bowtie2 (v2.4.1; option: --local; http://bowtie-bio. sourceforge.net/bowtie2/index.shtml) using local alignments. Last, alignment results files were deduplicated using UmiBam (v0.2.0; https://github.com/FelixKrueger/Umi-Grinder). This procedure deduplicates alignments on the basis of the mapping position, read orientation, and the UMI sequence. Deduplicated mapped reads were imported into SeqMonk v1.47 (www.bioinformatics.babraham.ac.uk/ projects/seqmonk/) and immediately truncated to one nucleotide at the 5 end, representing the last nucleotide 5 of the DNA end. Reads were then summed in 200-kb running windows spaced every 10 kb. Read counts were normalized to reads per million mapped, exported from SeqMonk, and plotted in GraphPad Prism 8. Read polarity values were calculated and plotted for each quantification window using the formula read polarity = (R − F)/(R + F), where F and R relate to the total forward and reverse read counts, respectively. The R code to generate these plots can also be found here: https://github.com/FelixKrueger/TrAEL-seq. To determine regions where replication initiates, the ForkCall program was used using the read polarity data (the code for ForkCall can be found here: https://github.com/s-andrews/forkcall). The read polarity signal from 200-kb running windows tiled every 10 kb along the genome was smoothed using LOWESS regression to remove local noise. Filters were applied to remove poorly covered or particularly short areas, and remaining regions where the directionality index consistently increases were called as replication IZs and imported into SeqMonk v1.47. Early and late replicating regions were defined on the basis of Repli-Seq data from HCT116 cells (GSE137764). Gaussian smoothed and normalized data from BrdU-labeled reads from the first three time points (S1 to S3; early replicating) and last three time points (S14 to S16; late replicating) in S phase were totaled. The 10% of regions with the highest values were imported into SeqMonk v1.47 and used to define replication timing. All sequencing data are available through the GEO repository (GSE186122, SuperSeries GSE161902). Cell line xenograft All animal experiments were performed according to the Guide for the Care and Use of Laboratory Animals (Eight Edition) following approval of the Committee on the Ethics of Animal Experiments of Ghent University (permit number: ECD 20/55). Persons who carried out the described experiment received appropriate training in animal care and handling. The mice were allowed to acclimatize for 1 week before the experimental procedure started and were randomly assigned to the different treatment groups. IMR-32 cells were cultured as described above to investigate the synergistic effect of the combinatorial 3AP and prexasertib treatment in vivo. A total of 2 10 6 cells were mixed with Matrigel (354230, Corning) and subsequently injected subcutaneously in the right flank of 5-week-old female Crl:NU-Foxn1nu nude mice (strain code 088, Charles River Laboratories). Compound treatment was started when tumors reached 300 mm 3. For 3AP, a dose range of 10, 7.5, 5, and 2.5 mg/kg was tested, while the dose of prexasertib was fixed to 10 mg/kg. Treatment was continued for five consecutive days for 3AP (intraperitoneally; 10% DMSO in sterile H 2 O, twice a day with a minimum of 8 hours in between treatments) and three consecutive days for prexasertib (subcutaneously; 20% Captisol in sterile PBS, twice a day). The control group received both vehicles. Following treatment discontinuation, animals were observed for another 6 to 7 weeks to determine complete or partial response (PR) to the compound treatment (i.e., regrowth of tumors). TV was assessed using a caliper and calculated according to the spheroid formula: V = 0.5 a b 2, with a as the largest and b as the smallest superficial perpendicular diameter. To control for systemic toxicity during the treatment period, the body weight and physical status of the animals were monitored by animal caretakers until they were judged to be in discomfort. When systemic toxicity (weight gain/loss of 20% or more) or maximum TV (2000 mm 3 ) was reached, the animal was euthanized by cervical dislocation. Patient-derived xenograft Patient tumor tissue used to generate a PDX was obtained under the Memorial Sloan Kettering Cancer Center (MSKCC) Institutional Review Board-approved protocols #17-387 and #06-107. Tumors were implanted in the subcutaneous flank of NSG mice (NOD. Cg-Prkdc scid Il2rg tm1Wjl /SzJ; Jackson Laboratory). Mice were monitored at least weekly until signs of tumor engraftment were observed. Tumor measurements were performed using manual calipers, and treatment was initiated when TV was ~100 mm 3 (TV = 1/2 length width 2 ). Animals were assigned to four treatment arms through block randomization and included vehicle (30% polyethylene glycol, molecular weight 400/5% Tween 80/10% n-methyl-2-pyrrolidone in 5% dextrose water), prexasertib , 3AP (2.5 mg/kg, IP; BID (twice a day) 5 days on/2 days off), and combination at equivalent singleagent doses for prexasertib and 3AP. Animals were treated for 4 weeks, with tumors measured twice weekly. Treatment cohorts were compared using Mann-Whitney-Wilcoxon test. Time to progression was estimated using a Kaplan-Meier estimator and compared using a log-rank test. Progressive disease was defined as doubling of TV relative to baseline, stable disease is <100% TV relative to baseline and <50% TV regression, PR is >50% TV regression, and complete response (CR) is >95% TV regression or no measurable tumor. Disease control rate is defined as the sum of stable disease + PR + CR. All animal studies were conducted under barrier conditions, and experiments were performed using protocol and conditions approved by the MSKCC Institutional Animal Care and Use Committee under protocol 16-08-011. Zebrafish modeling Zebrafish maintenance and generation of a stable line Zebrafish were housed in a Zebtec semiclosed recirculation housing system (Techniplast, Italy) and maintained following standard procedures. All zebrafish studies and maintenance of the animals were in accordance with protocol #17/100, approved by the Ethics Committee for the use of animals in research of the Faculty of Medicine and Health Sciences at Ghent University. The dh:hRRM2 DNA construct for the Tg(dh:hRRM2; dh:mCherry) transgenic line was generated using multisite Gateway cloning by combining three entry clones: dbh-pDONRP4-P1R (gift from the Look laboratory), RRM2-pDONR221 (GeneCopoeia, #GC-Z9335-GS) (see also table S8), and p3E-polyA (gift from the Look laboratory) into a modified destination vector containing I-SceI cleavage sites (gift from the Look laboratory). Generation of stable Tg(dh:hRRM2; dh:mCherry) transgenic fish One-cell-stage wild-type zebrafish embryos were injected with mix containing dh:RRM2 (12 ng/l), dh:mCherry (20 ng/l) (gift from the Look laboratory), I-SceI enzyme (0.5 U/l), and CutSmart buffer (0.5 U/l). The injected fish were raised to adulthood and crossed to screen for founder fish. The offspring of the founder fish were raised, and DNA and RNA samples were collected to confirm the presence of the dh-hRMM2 construct in the genome and expression of hRRM2 mRNA, respectively. For analysis, the following primer pairs were used: CCAACAGAAGTGGACCAACA (forward) and GGCAGCTGCTTTAGTTTTCG (reverse). A 472-bp fragment of the dh:RRM2 transgene fragment was amplified and further confirmed by Fragment Analyzer (Applied Biosystems). RT-qCPR primers were the same as used for the in vitro experiments. The Tg(dh:eGFP-MYCN) line was a gift from the Look laboratory. Generation of mosaic dh:MYCN;RRM2 fish The dh:RRM2 DNA construct for the mosaic injections was generated using the same multisite Gateway cloning strategy, but using a destination vector containing Tol2 transposase sites as well as a cmlc2-GFP sequence (gift from the Langenau laboratory). Each time, 20 ng/l was injected together with transposon mRNA (35 ng/l). Tumor watch was executed in the same way as done for the stable transgenic lines. Screening and sample collection From 5 weeks on, fish were screened every 2 weeks for neuroblastoma development by the use of a fluorescent microscope (Nikon, SMZ18) using the NIS Elements software. Statistical analysis was performed using GraphPad Prism software version 5.0 (La Jolla, CA). The method of Kaplan and Meier was used to estimate the rate of tumor development. Fish that died without evidence of EGFP + or mCherry + masses were censored. The log-rank test was used to assess differences in the cumulative frequency of neuroblastoma between MYCNonly transgenic fish and MYCN;RRM2 transgenic fish. Western blot analysis Cells were lysed using a tissue lyser and cold RIPA buffer supplemented with protease and phosphatase inhibitors. Samples were rotated for 1 hour at 4°C to obtain more complete lysis. The cleared lysates were collected and centrifuged at 10,000 rpm in a microcentrifuge for 10 min at 4°C. Protein concentrations were determined using the Pierce BCA Protein Assay Kit. The lysates were denaturized before loading on a gel, through five times Laemli denaturation buffer supplemented with -mercaptoethanol. Thirty micrograms of protein extracts was loaded on 10% SDS-PAGE gels with 10 tris/glycine/SDS buffer and run for 1 hour at 130 V. Samples were blotted on nitrocellulose or PVDF membranes in 10% of 10 tris/glycine buffer and 20% of methanol. The membranes were blocked during 1 hour in 5% milk or 5% BSA in TBST. Primary antibody incubations were done in blocking buffer overnight at 4°C. Blots were washed three times with TBST before the incubation for 1 hour of secondary antibodies. The immunoblots were visualized by using the enhanced chemiluminescent Femto (Bio-Rad). The protein quantification analysis of the generated blots was performed through ImageJ software, where the area from each protein was normalized to the loading protein in respect to each blot. Antibodies used were the following: pCHK1(Ser 345 ), yH2AX, and vinculin. The material origin used for Western blot and the antibodies are provided on tables S4 and S5, respectively. Bulk RNA-seq after FACS of the zebrafish lines A pool of three to five 6-week-old fish per sample (for a total of three samples of MYCN;RRM2 and five samples of MYCN fish) was euthanized using an overdose of MS-222. After mechanical dissociation in resuspension solution (0.9 PBS and 10% FCS) using a scalpel, the cell suspension was passed through a 40m mesh filter before cell sorting. The cell suspension was analyzed by imaging flow cytometry in collaboration with the Flow Cytometry Core Facility (VIB, Ghent University, Belgium). Forward and side scatters were used to gate for live, single cells, while sorting itself was based on enhanced GFP (eGFP)-positive cells and could also be evaluated through imaging on the sorter. Images were captured using a BD Biosciences FACS imaging-enabled prototype cell sorter that is equipped with an optical module, allowing multicolor fluorescence imaging of fast flowing cells in a stream enabled by BD CellView Image Technology based on fluorescence imaging using radiofrequency-tagged emission. No other markers were used. The sorted cells were collected in lysis buffer (RTL) of the RNeasy plus micro kit (QIAGEN, 74,034), supplemented with 2-mercaptoethanol (10 l/1 ml of RTL, as recommended). The cells were kept on ice/cooled in the sorter during the whole procedure. Further RNA isolation was done using the RNeasy plus micro kit (QIAGEN, 74,034). Integrity and concentration of the RNA was evaluated using the Fragment Analyzer (Advanced Analytical Technologies) with the High Sensitivity RNA analysis kit (DNF-472-0500). The ProSize software version 3.0.1.5 was used to determine the RQN (RNA quality number) RNA integrity score considering the entire electropherogram. Full-length cDNA synthesis and amplification were done using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Biosystems, 634,890). An input of 1 ng of SMART-Seq v4 amplified cDNA was used for Nextera XT DNA library prep (Illumina, FC-131-1024), and the libraries were sequenced using a NextSeq 500 (Illumina). Quality control on fastq files was performed with FastQC (www.bioinformatics. babraham.ac.uk/projects/ fastqc/). Reads were aligned to Danio rerio reference genome GRCz10 with STAR v2.4.2a using a two-pass strategy. Genes were quantified using the Danio_rerio.GRCz10.91.gtf transcriptome. The DESeq2 R package was used for count normalization and differential gene expression analysis. The normalized read counts were used to generate PCA plots, heatmaps, and the correlation matrix. Pearson's correlation coefficient was calculated on log-transformed normalized read counts. Preranked GSEA was preformed using GenePattern 2.0 (www.genepattern.org). Immunohistochemistry analysis For immunohistochemistry analysis, fish were euthanized with an overdose of MS-222, and their belly was cut open with a scalpel to increase impregnation. They were fixed overnight using modified Davidson fixation buffer (for 100 ml: 22 ml of 37% formaldehyde, 12 ml of glacial acetic acid, 33 ml of 95% EtOH, and 33 ml of distilled water). The fish were subsequently emerged overnight in 10% neutral buffered formalin. After fixation, the fish were decalcified with citric acid for several hours. Thereafter, the fish were dehydrated and brought to paraffin (70% EtOH overnight, 2 hours of 90% EtOH, 3 1 hour of 100% EtOH, 3 1 hour of xylene, and 2 2 hours of paraffin at 65°C). Sagittal sections were made, and standard H&E staining was performed next to immunohistochemistry staining with the primary antibodies MYCN (Santa Cruz Biotechnology, sc-53993), TH (Pel-Freez Biologicals, P40101), and GFP (Cell Signaling Technology, #2956). Quantification and statistical analyses Expression datasets available in R2 (https://r2.amc.nl) were downloaded, and Pearson correlation from SciPy (version 1.6.2) from Python (version 3.9) was applied to evaluate the correlation between the selected genes. In vitro quantitative data were presented as means and SD from at least more than three biological replicates. Paired two-tailed Student's t test was applied to the qPCR data using Microsoft Excel. As for the caspase 3/7 activity, the statistical analysis was applied to mean-centered and autoscaled data. As to determine the overall P value, Kruskal-Wallis test was applied, followed by a post hoc comparison by Dunn's test. The analysis was done on Python (version 3.9) using SciPy (version 1.6.2) and scikit-posthocs library (version 0.6.7). One-way analysis of variance (ANOVA) and Holm-dk method for multiple comparison testing were applied to DNA combing fibers using GraphPad Prism 9.2.0 software. For the in vivo xenograft, the Mantel-Cox method was applied for the survival analysis using GraphPad Prism 9.2.0 software. For all the analyses, the P value lower than 0.05 was considered as statistically significant. For the significance, P values lower than 0.05 were represented as "*," P values lower than 0.01 as "**," P values lower than 0.001 as "***," and, lastly, P values lower than 0.0001 as "****."

Thermodynamic and Mechanical Properties of DMPC/Cholesterol Mixed Monolayers at Physiological Conditions One of the main known effects of cholesterol is to rigidify the cell membrane throughout the so-called condensing effect. Although many studies have been done in mixtures of cholesterol with different membrane lipids, there are not many studies in a wide concentration range of cholesterol or at physiological conditions. In this work, we studied mixtures of DMPC/Cholesterol monolayers to determine the effect of cholesterol, from very low to physiological concentrations and two pHs. We use a Langmuir balance and Brewster angle microscopy to study their thermodynamic behavior at 37.0 ± 0.1°C at the air/solution interface. From the analysis of the (−A) isotherms, we determined the excess area and the compressibility elastic modulus to determine the monolayers mechanical properties. Surprisingly, we found three main effects of cholesterol: The first one is a fluidization effect of the monolayer at all cholesterol concentrations. The second effect is the so-called condensing effect that appears due to the non-ideality of the mixture. The third effect is a stiffness of the monolayer as the cholesterol concentration increases. These effects are stronger in pure water, pH ≈ 6.6, than on buffer at physiological pH = 7.4. We also found that all mixtures are thermodynamically stable at all concentrations at a surface pressure of 30.1 ± 1.6 and 27.4 ± 3.2 mN/m in pure water and buffer, respectively. Furthermore, we compared this stability with a fatty acid monolayer that shows a much lower surface pressure equilibrium value that DMPC or its mixtures with cholesterol, indicating a possibly reason why double chain lipids are better than single chain lipids to made up the cell membrane. INTRODUCTION Cholesterol is a very important component in all membranes of mammalian cells and it is critical to human health: It is known that cholesterol is responsible for the modulation of physical properties of cell membranes, because the bulky molecular structure of cholesterol interferes with the movement of the phospholipid tails. It constitutes up to 40% of the plasma membrane in some type of cells and the cholesterol concentration seems to be involved in the regulation of microphase separation (lipid rafts), rigidity, membrane thickness and permeability. One effect of adding cholesterol is to reduce the L /L phase transition temperature, and it removes completely the transition at 50% of cholesterol concentration, by inducing the formation of an intermediate phase known as the liquid crystalline ordered or liquid ordered phase. The transition temperatures are correlated with the chain melting temperature (0°C for some glycerophospholipids and 37°C for sphingolipids). Other effects of adding cholesterol include changes in the lipid molecule cross sectional area, the thickness of the bilayer, the orientational order of the lipids and the motion of the hydrocarbon chains. Cholesterol mixed with phospholipids can form oligomeric chemical complexes with a fundamental stoichiometry 3:2 and 6:1 phospholipids per cholesterol molecule. The formation of these phospholipid/cholesterol complexes produce the socalled cholesterol condensing effect where the area occupied by the molecules is decreased. As stated by the umbrella model, the lipid acyl chains and the nonpolar cholesterol part become densely packed as they share the limited space below the phospholipid head groups. At a particular concentration, the head groups cannot protect additional cholesterol molecules from contact with water and they form a separated and immiscible monohydrated cholesterol phase. The solubility limit for cholesterol in phosphatidilcholines (PC) bilayers is known to be around 66%. Recent monolayer studies of the interaction of phospholipids and cholesterol have shown that the molecular area of the mixture is typically smaller than the weighted molecular areas of the pure components. It was found that cholesterol interacts preferentially with phospholipids containing fully saturated chains and this interaction decreases significantly with unsaturated chains. Cholesterol interacts more strongly with sphingolipids than with phosphatidylcholines of similar chain length. Monolayers mixtures of phosphatidilcholines and cholesterol have a higher collapse pressure ( c ) than monolayers of single components, indicating that a mixed monolayer is more stable. Model systems with only a few components have been extensively used to study the properties of biological membranes. Giant unilamellar vesicles have been used to study mechanical properties and interactions between lipids and DNA, peptide and proteins in a simple model system composed of a single phospholipid bilayer. Langmuir monolayers have also been used as 2D model systems to study interactions present in biomembranes, since the physicochemical and mechanical characterization of the monolayers can be obtained from surface pressure-area (−A) measurements. Furthermore, phase transitions, morphologies and textures can be obtained by combining additional characterization techniques such as neutron and X-ray scattering, polarized fluorescence, Brewster angle microscopy (BAM) or atomic force microscopy (AFM). Phosphatidylcholines play an important role in cell membranes since they represent more than 50% of the lipids of the plasma membrane in most eukaryotic cells. The interaction of DMPC and other phosphatidylcholines of different acyl chain length and saturation degree with cholesterol has been studied at pH 6.6 and 24°C, and found that cholesterol cannot condense in the same way unsaturated lipids as it does saturated lipids, due to the kinks of the double bonds on the acyl chains. In a similar study, at different temperatures from 10-30°C, it was found that acyl chain asymmetry modifies the interfacial elasticity of the lipid monolayers. The condensation effect in DMPC and DPPC induced by different sterols at 23°C has been determined by mean of the analysis of the excess free energy; it was found that the mixture of phosphatidylcholines with cholesterol produced the most stable monolayers in comparison when cholesterol is replaced by ergosterol or lanosterol. The effect of the subphase pH on the condensation effect in mixed monolayers of DPPC/cholesterol in a wide range of cholesterol fraction (10-90%) has been studied by Gong et al, at 25°C. They found that the monolayer is more stable at neutral pH and at 60% of cholesterol fraction. Kim et al. observed that at 23°C a very low fraction of cholesterol (≈0.2%) modifies dramatically the morphology and the dynamic properties of a DPPC monolayer by reducing the surface viscosity due to the formation of 6:1 phospholipid/cholesterol complexes. This complexes decorates the boundaries of the DPPC lipid domains. In this work, we study the interaction between DMPC and cholesterol from very low to physiological cholesterol mole fractions (0.01-0.40) and at physiological conditions of temperature, 37 ± 0.1°C and pH, ≈ 6.6 and 7.4. We use the Langmuir balance technique to study the model membrane monolayers, and we obtain the mechanical properties of the membranes from the isotherms. We show that cholesterol have three effects i) It fluidizes the monolayer at low surface pressures and at all concentrations studied, ii) When the pure condensed phase appears, it shows the so-called condensing effect, and iii) Upon increasing the concentration of cholesterol the monolayers stiffens. Langmuir-Blodgett Trough A Langmuir-Blodgett trough (model 611, NIMA Technology LTD., Coventry, England) was used to measure the pressurearea isotherms, using a filter paper as the Wilhelmy plate for the surface pressure determination (with a precision of ±0.1 mN/m). The trough was filled with deionized water (bioresearch grade water, >18.0 M-cm of resistivity, Barnstead/Thermolyne, Dubuque, Iowa, United States) and deionized water was used to prepare the pH 7.4 phosphate buffer solution. The temperature was kept at 37.0 ± 0.1°C, during the experiments in order to have human physiological temperature conditions, using a water recirculator bath (Neslab, United States). Before starting each experiment, the subphase and trough cleanliness were tested by closing the barriers and checking that the pressure sensor readings were less than 0.1 mN/m when the barriers of the Langmuir through were fully closed (and by the presence of a dark background only, observed by Brewster angle microscopy, see below). Using a 50 l Hamilton glass microsyringe, the lipid/ Cholesterol mixtures were gently deposited on the air/water interface and waited at least 30 min to allow for the evaporation of the solvent before starting each experiment. The monolayer was then compressed at 20 cm 2 /min. The average area per molecule was calculated by the NIMA software based upon the average molecular weight, concentration and volume of the deposited sample. Brewster Angle Microscope During the compression, images of the monolayer were acquired using a Brewster Angle Microscope BAM (Nanofilm EP4, Accurion GmbH, Germany) in order to see morphologies of the monolayer and phase transitions, along the obtained isotherms in the whole surface pressure range. Mixed Monolayer Stability Study We studied the stability of the DMPC/cholesterol mixed monolayers by slowly compressing them up to 35 mN/m and maintaining the area per molecule constant by using the area control function of the NIMA trough software. The surface pressure was recorded for approximately 300 min, in order to determine changes in surface pressure as consequence of the monolayer relaxation until its equilibrium value. The experiments were done both in ultrapure water (pH ≈ 6.6) and in a buffer subphase at pH 7.4. Isotherms The addition of even a very small amount of cholesterol produces a considerable shift in the take-off pressure area. Considering an ideal mixture behavior between DMPC and cholesterol, each isotherm should give a take-off pressure area equal to A X DMPC A DMPC + X Chol A Chol, where A i and X i are the molecular take-off area and the mole fraction of the "i" component, respectively. Taking a 0.01 cholesterol fraction gives A 0.99 +0.01 141.0 2 /molecule, which is much larger than the experimental value of 115.3 ± 0.1 2 /molecule obtained. In fact, this is reflected at all cholesterol concentrations studied here, as it is shown in Figure 1. This difference implies that cholesterol interacts strongly with the liquid expanded (LE) DMPC phase, disrupting its formation and making the gas phase to disappear at much lower areas per molecule. Here, we are taking the take-off pressure as a reference for the "disappearing" of the gas phase, although in a mixture this is not completely correct, especially when the concentration of cholesterol becomes high. However, at the higher concentration of cholesterol in the mixture, we notice that the gas phase disappeared at about 5-8 mN/m and at lower cholesterol concentrations the gas phase disappear at even lower surface pressure; therefore we are taking the take-off pressure area as a reference for this case. So, taking the take-off pressure as a reference of the condensed phase of pure DMPC, the molecules are arranged with a particular tilt azimuthal order parameter. However, the bulky cholesterol molecule disrupts this order, shifting the appearance of the pure condense phase to lower areas per molecule, as denoted by a smaller take-off area of the surface pressure, as shown in Figure 2. A cholesterol molecule changes the tilt angle of the DMPC molecules around it, making them more vertical with respect to the surface, so that they occupy a smaller effective area. The LE − G coexistence region is thus extended, decreasing the take-off pressure area by more than just the difference in areas of the individual components. Cholesterol have therefore the effect of fluidizing the monolayer, preventing the appearance of the pure condensed phase. Figure 3 shows representative BAM images along various isotherms. The images show the coexistence of the gaseous (G) phase (darker regions) and the more condensed (LE) phase (brighter regions) at relatively low surface pressures ( Figures 3A-D). In the pure DMPC isotherm, the G phase disappears at the take-off surface pressure, as it is noticeable absent at a pressure of 5 mN/m ( Figure 3E), something typical for a pure component system. As we increase the amount of cholesterol there is a residual amount of gaseous phase at the same pressure of 5 mN/m, see Figures 3F-H. But at the surface pressure of 15 mN/m, the gaseous phase disappears at all mixture concentrations but in fact it disappears even a lower surface pressures, rendering a homogenous monolayer in the condensed phase ( Figures 3I-L). At an even higher pressure value of 32.5 mN/m, we notice the presence of small 3D crystals which become more noticeable at higher pressures particularly close to the collapse pressure (Uc). The amount and size of the 3D crystals increase with the cholesterol concentration. It has been proposed that the properties of a lipid monolayer can be correlated to those of a bilayer around a surface pressure of 32-35 mN/m. Excess Area Analysis A way to estimate the miscibility and the interactions between molecules present in a two-component monolayer mixture is by the determination of the excess area : where A 12 is the average area per molecule of the mixture and A i and X i as defined above. A negative excess area indicates attractive forces between the two kind of molecules of the mixture. Figure 4 shows the excess area determined at different surface pressures in the cholesterol range studied. The excess area is negative in all cases, indicating attractive interactions in the condensed phase between DMPC and cholesterol. At a given pressure the excess area is fairly constant at all cholesterol fractions; showing a clear effect that is noticeable even at the smaller amount of cholesterol studied. The effect is more evident at lower surface pressures, possible due to there is more space between the phospholipid molecules where cholesterol can be intercalated. As the surface pressure increases, this space is reduce making the presence of cholesterol between the lipids more difficult, until it is expelled at even higher surface pressures. The strongest attractive interaction (most negative excess area) occurs in the range of 0.30-0.40 M fraction of cholesterol. It is worth noting that this range of cholesterol concentration coincides with the physiological value in most cell membranes. Thermodynamic Properties Thermodynamic stability of mixed monolayers can be obtained by comparing the pure monolayer using the excess Gibbs free energy, It can be noticed from Figure 5 that the excess Gibbs-free energy for all the mixtures is negative, therefore it can be concluded that the DMPC and cholesterol molecules form a stable mixed monolayer at all conditions. The lowest energy happens again at a concentration between 30-40% of cholesterol concentration and at surface pressures of 30-40 mN/m that correspond to the values present in mammalian cell membranes. Mechanical Properties and Equilibrium Spreading Pressure Monolayer mechanical properties can be analyzed by calculating the isothermal compressibility or rather its inverse, the area compressibility elastic modulus given by, Figure 6 shows a plot of C −1 s as a function of the area per molecule for different cholesterol fractions. Note that C −1 s start at a very low value when the monolayer is at the coexistence region of the condensed and gaseous phases (see Figure 3A). In this situation, the high compressibility of the gas phase gives a low value for C −1 s. The value of C −1 s rises sharply at the take-off pressure area, mainly due to the compression force required to overcome the repulsive interactions of the condensed domains during domain coalescence. The sharp rise stops once we reach a uniform monolayer and here we see two different slopes for pure DMPC (Area/molecule between 90 and 130 2 ), indicating a phase transition between two different condensed phases with different compressibility values. That transition is not as evident with a small fraction of cholesterol, probably due to the fact that cholesterol introduces some disorder in the monolayer. As it was discussed before, the cholesterol changes the tilt angle of the DMPC molecules around it, moving the system away from a well-defined phase. At higher molar fractions (>0.10), the C −1 s curve start showing again two slopes; this is the monolayer becomes stiffer at higher surface pressures due to a rise in Frontiers in Physics | www.frontiersin.org March 2021 | Volume 9 | Article 636149 5 molecule packing driven by the well-known cholesterol condensation effect, where the phospholipid acyl chains interact strongly with cholesterol as reported in the literature. This condensing effect does not mean that the monolayer becomes more ordered, in fact there are reports that the molecular correlation is short range. Even more, at around physiological concentration of cholesterol (0.3-0.4), the C −1 s curve still show two slopes. However, the lower slope region has shrunk while the upper one has increased. The pure cholesterol C −1 s curve only show one high slope indicating a low compressibility of the condensed phase, in good agreement with its corresponding isotherm. All C −1 s the curves reached a maximum value until collapse occurs; after the maximum, the value of C −1 s decreases rapidly to zero because the film becomes highly compressible due to collapse. On the other hand, the behavior of both type isotherms, and therefore C −1 s, is quite different at pH 7.4 than in ultrapure water (pH ≈ 6.6). First of all, the take-off surface pressure occurs at higher molecular areas at pH 7.4. This means that the condensed phase appears at larger areas per molecule, due to the interactions between the head groups and the phosphate ions of the buffer solution expands the condensed phase. This difference in the take-off surface pressure might change the phase order compared to those present at lower pH, it could result in a more tilted phase; this result in a more expanded phase but also somewhat more compressible, as can be observed by both type of isotherms and C −1 s, since the latter is significantly larger for the pure DMPC and the higher cholesterol concentration at the higher pH. In addition, the change in pH has an effect in the behavior of C −1 s, for example, for the pure DMPC monolayer it shows three different slopes before collapse at pH 7.4 while at pH ≈ 6.6 it shows only two slopes, indicating that the monolayer might have three and two different phase regions, respectively. In addition, the maximum of the C −1 s value at the intermediate concentrations of cholesterol is similar at 0.01 M fraction of cholesterol, but at 0.1 M cholesterol concentration is significantly higher at the lower pH. However, an addition of a small amount of cholesterol has a more noticeable effect at the higher pH than at lower pH. As mentioned above, the C −1 s values change strongly with the addition of only 0.01 cholesterol fractions even more at 0.1 cholesterol fraction the C −1 s curve becomes more shallow, with not very well defined regions. But at around physiological concentration of cholesterol, e.g., 0.35-0.40, the C −1 s curve behavior changes strongly; the slope is very high, especially at physiological pH, and closer to the behavior of the It is worth noticing that the maximum of the C −1 s curves at high concentration of cholesterol and also for pure cholesterol, is much higher at higher pH, indicating that the monolayer is stiffer. This behavior is easily observed in Figure 7, where for different concentrations of cholesterol, the C −1 s values are slightly lower at low surface pressures for the higher pH. But as the surface pressure is increased, the monolayer behavior is reversed since at higher pH shows higher values of C −1 s than a lower pH, which again indicates that the monolayer becomes stiffer. Figure 8 shows a monolayer stability analysis as a function of time at pH ≈ 6.6 ( Figure 8A) and physiological pH ( Figure 8B). In this study, we prepare again Langmuir monolayers with different concentrations of cholesterol and compared their relaxation with that of pure DMPC. We also include for comparison, the relaxation behavior of pure arachidic acid and pure cholesterol. It has been proposed that the behavior of a monolayer in a surface pressure range of 32-35 mN/m is equivalent to the behavior of a bilayer in a cell membrane at 20°C. To test this hypothesis, the monolayers were slowly compressed (20 cm 2 /min) up to 35 mN/m and allowed to relax to its equilibrium surface pressure. Our relaxation studies indicate that all monolayers have a pressure drop as a function of time. However, both DMPC and DMPC + cholesterol relax to an equilibrium surface pressure of about 30.2 ± 1.4 and 27.4 ± 3.2 mN/m in pure water (pH ≈ 6.6) and buffer at pH 7.4, respectively. It is surprising that at pH ≈ 6.6 the equilibrium surface pressure in quite similar for all the cholesterol concentration range, the surface pressure drop was between 3.8 and 6.2 mN/m, while at pH 7.4 the surface pressure drop is somewhat larger, between 4.4 and 11.5 mN/m. Therefore, the equilibrium surface pressure values at pH 6.6 are not very different for all DPPC-Cholesterol mixtures, but at pH 7.4 the equilibrium surface pressure values are not as homogeneous. The pressure drop indicates that the monolayer is slowly collapsing; that is, forming three-dimensional structures, but it is worth noting that the equilibrium surface pressure at pH 7.4 of pure DMPC and its mixture with a cholesterol mole fraction of 0.35 falls in the range of the equilibrium surface pressure at pH 6.6. In addition, we can state that at 37.0°C and physiological pH 7.4 that any of these monolayers could be equivalent to a bilayer below 27 mN/m, in terms of their equilibrium properties. Remarkably, pure cholesterol has a quick and very large surface pressure drop at physiological pH, to about 17 mN/m, as shown in Figure 8B). This indicates that the equilibrium surface pressure of the mixture is mostly due to the DMPC. Moreover, the surface pressure of arachidic acid shows two behaviors at pH 7.4; first, a rapid decay of about 11 mN/m in a short time, followed by a much slower decay of about 6 mN/m more toward the final equilibrium spreading pressure of about 18 mN/m. This is, the equilibrium spreading pressure value of arachidic acid is similar to that of pure cholesterol and almost half the initial surface pressure value. Even more, at pH 6.6, the equilibrium pressure of arachidic acid decays more slowly that at pH 7.4, but it decays even to a lower value of about 12.5 mN/m. This give us a good indication that monolayers formed by single chain lipids have a much lower equilibrium surface pressure than monolayers formed by double chain lipids, such as phospholipids. This also might indicate why nature chose double chain lipids, such as phospholipids, to be the main lipid components in cell membranes. Due to energetic considerations, single chain lipids tend to form micelles while double chain lipids tend to form vesicles that are associated with the formation of cell membranes. However, even if single chain lipids could form vesicles, they could not form thermodynamically stable unilamellar vesicles but rather multiwall vesicles; for the case of arachidic acid they will be 4 to 5 bilayers thick. Frontiers in Physics | www.frontiersin.org March 2021 | Volume 9 | Article 636149 8 structures can be noted over the homogeneous DMPC monolayer, this is due to the relaxation of the monolayer. In the second row, a homogeneous Cholesterol monolayer can be noted at 35 mN/m and then when the equilibrium surface pressure is reached (17 mN/ m), after 2.5 hours, some 3D structures can be noted floating on a homogeneous monolayer. In the third row the DMPC+0.3 cholesterol mixed monolayer is shown. At the start of the experiment at 35 mN/m, separated 3D structures can be noted due to the condensing effect induced by the cholesterol molecules. While at the equilibrium surface pressure (27 mN/m), 3D structure domains can be noted as well, forming a foam-like structure. Finally, the fourth row shows the images corresponding to the arachidic acid monolayer. At the beginning of the surface pressure relaxation experiment (35 mN/m) some 3D structures can be observed. But at the equilibrium surface pressure (17 mN/m), a large amount of arachidic acid crystals can be noticed due to the collapse of the monolayer by the relaxation process. It is important to notice that the arachidic acid monolayer achieves stability at a surface pressure value 37 % lower than the DMPC monolayer and its mixtures with cholesterol. Therefore, the phospholipid monolayer has a stable surface pressure much higher than the single-chain fatty acid. CONCLUSION The analysis of the thermodynamics and mechanical properties of Langmuir monolayers of DMPC/cholesterol as a function of the concentration of cholesterol and at two pH values at physiological temperature gave interesting results. For example, we found that the isotherms of DMPC/cholesterol monolayers mixtures show an increase in the monolayer fluidity at all cholesterol concentrations. Cholesterol is a bulky molecule that makes the take-off surface pressure of the monolayer appears at lower areas per molecule. This means that the presence of the gas phase remains at much lower area per molecule compared to that of the pure DMPC monolayer due to the effect of cholesterol, thus fluidizing the monolayer. However, this effect is much less pronounced as the concentration of cholesterol increases, and near physiological cholesterol concentration the monolayer is less compressible, as observed by an increased in slope of the compression modulus, C −1 s, more noticeable at physiological pH than at the lower pH of pure water. On the other hand, it is important to notice that the excess free energy is the lowest at physiological concentrations of cholesterol at both pH and surface pressure, this is, it becomes more negative not only as the concentration of cholesterol increases but also as the surface pressure increases as well, close to the equilibrium surface pressure determined at both pH. This indicates that DMPC and cholesterol mix better at higher cholesterol concentrations as well as at higher surface pressures. In general, in agreement to the excess area and Gibbs free energy analysis, this results showed the presence of attractive interactions that form thermodynamically stable monolayers in the whole cholesterol fraction range studied, and where more stable monolayers were observed when the mixture contained about the average physiological cholesterol fraction (≈0.35) that resulted to be energetically favored and gives more stable monolayers. Furthermore, we show that monolayers formed by either pure DMPC or a mixture of DMPC with cholesterol relax to about the same equilibrium surface pressure, although the final surface pressure relaxation value is different depending on the pH. Furthermore, we also show that a monolayer formed by a single chain lipid, such as arachidic acid, is much less stable than the pure DMPC or the DMPC/cholesterol mixture; this results clearly indicates a possible reason on why nature uses double chain lipids as its mayor component in cell membranes. DATA AVAILABILITY STATEMENT The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. AUTHOR CONTRIBUTIONS AB-F, VMC-M, ERA-P, and EAV-M performed the experiments and data analysis. AB-F, EG, and JR-G wrote and discussed the paper funding acquisition. All authors discussed the data, conclusions and proof read the manuscript. EG and JR-G were responsible for the funding acquisition JR-G directed the project and experiments. All authors contributed in the revision of the manuscript. FUNDING This work was supported by CONACYT through grants FC-341, FC-157, CB-254981, CB-237439 and CB-254460. Part of the work was also supported by the UASLP through the Fondos Concurrentes program.

Investigators announced on Tuesday that a body believed to be Mollie Tibbetts was found in rural Poweshiek County. Here are the facts. Mollie Tibbetts, 20, of Brooklyn was reported missing July 19 after she failed to show for work that day at a Grinnell day care. She was a psychology major at the University of Iowa. Friends and family said Tibbetts demonstrated a desire to help others, a natural ability to work with children and a gift for making anyone feel like the most important person in a room — because she genuinely believed they were. Cristhian Bahena Rivera, 24, who resides in rural Poweshiek County, was charged Tuesday with first-degree murder in the alleged abduction and death of Mollie Tibbetts, according to the Iowa Division of Criminal Investigation. He was employed and lived in the area four to seven years, investigators said, but they would not disclose his employment history during a press conference Tuesday. Yarrabee Farms, owned by the brother of a prominent Iowa Republican, released a statement Tuesday night saying Rivera was an “employee in good standing” and was “shocked to hear” that Rivera had been implicated. The owner, Dane Lang, is the son of Craig Lang, the former president of both the Iowa Farm Bureau Federation and the Iowa Board of Regents and a 2018 Republican candidate for state secretary of agriculture. Lang on Tuesday night said Rivera "was vetted through the government's E-Verify system." At a press conference on Wednesday, he walked back that comment, saying his team actually used a less intense verification check through the Social Security Administration, not the E-Verify system. Tibbetts was last seen on surveillance footage running along Boundary and Middle streets in her hometown. Cristhian Bahena Rivera allegedly followed her in a black Chevy Malibu. A criminal complaint said he then pursued her east of Brooklyn into the county along 385th Avenue. Rivera parked his car and started running alongside and behind Tibbetts. She pulled out a cellphone and said she would call the police. Rivera told police he panicked, got mad and then "blocked" his memory, becoming aware while in his car at an intersection that he had placed a woman in his trunk, according to a criminal complaint. Rivera dragged and carried the woman roughly 65 feet into an isolated area in the cornfield, he told police, then covered her body with corn leaves and drove away. After officials identified his vehicle in surveillance footage, he complied with law enforcement and led them to the body. Rivera guided law enforcement to the location of the body from memory. Tibbetts was first seen running along Boundary and Middle streets the evening of July 18, according to the criminal complaint. She ran east, outside of town, along 385th Avenue. Rivera allegedly abducted Tibbetts around the 1900 block of 385th Avenue, according to the criminal complaint. Rivera said he "blocked" his memory, coming to at an unknown intersection, according to the criminal complaint. Iowa DCI did not release the location of this intersection and would not say whether Tibbetts was alive at this point. After making a U-turn, Rivera told police he drove up a driveway and toward a cornfield where he hid Tibbetts' body along 460th Avenue, the complaint alleges.

UPDATE: He's been found. Police are asking for the public's help locating a 22-year-old man who escaped from custody at a rest area near Maupin on Friday. According to Oregon State Police, Rodrick Edminston escaped at the Cow Canyon rest stop, about 20 miles south of Maupin, near the Warm Springs Reservation. J&R Secure Transport was transporting Edminston from a psychiatric facility in Pendleton to Bend via Highway 97 when Edminston escaped, police said. It is not clear how he got away or whether he has a vehicle. Oregon State Police and Wasco County Sheriff's Office searched the area, but did not find Edminston. Edminston is about 5'8", weighs 123 pounds and has black hair and brown eyes. He was last seen wearing a red shirt, shorts, and red tennis shoes. He was not restrained while being transported and was not armed, police say. He did not have any known friends or family in the immediate area where he was last seen. Lifeways Inc., the mental health facility, had classified Edminston as "dangerous," and had been holding him on a mental health hold. According to police, he has been diagnosed with schizophrenia. Edminston does not face any criminal charges. Police are asking anyone who sees Edminston or has information about his location to contact local law enforcement or Lifeways at 541-276-6207. -- Anna Marum amarum@oregonian.com 503-294-5911 @annamarum

Green Tea Polyphenol Epigallocatechin-3-gallateAlleviated Coxsackievirus B3induced Myocarditis Through Inhibiting Viral Replication but Not Through Inhibiting Inflammatory Responses Abstract: Viral myocarditis, which is mainly caused by coxsackievirus B3 (CVB3), affects about 5%20% of the world population and still lacks efficient treatments. Green tea, a tonic and healthful beverage that was originated in ancient China, has been receiving considerable attention for its protective effect on cardiovascular diseases in recent years. In the present investigation, we aimed to explore the effect of green tea polyphenol epigallocatechin-3-gallate (EGCG) on CVB3-induced myocarditis and its underlying mechanism. Our study showed that EGCG could alleviate CVB3-induced myocarditis as evidenced by less cardiac injury and higher survival rate. Furthermore, we found that EGCG failed to downregulate the expression of inflammatory cytokines but could significantly inhibit the replication of CVB3. Furthermore, we found that EGCG treatment could downregulate the protein expression level of coxsackievirus and adenovirus receptor, the major receptor for CVB3 to infect cardiac myocytes. In conclusion, our data indicated that EGCG could ameliorate CVB3-induced myocarditis through inhibiting viral replication, which might provide a potential novel therapeutic strategy for viral myocarditis.

DNA sequences of a bovine gene and of two related pseudogenes for the proteolipid subunit of mitochondrial ATP synthase. The dicyclohexylcarbodi-imide-reactive proteolipid is a membrane subunit of mitochondrial ATP synthase. In cows it is encoded by two different nuclear genes known as P1 and P2. These genes are expressed in a tissue-specific fashion which reflects the embryonic origin of the tissues. The proteins that they encode are synthesized in the cytosol, and are precursors of the proteolipid that have different mitochondrial import sequences of 61 and 68 amino acids respectively. By use of gene-specific probes derived from the bovine P2 cDNA, regions containing corresponding parts of the bovine P2 gene have been isolated from a bovine genomic library, and their DNA sequences and those of flanking and intervening regions have been determined. The sequence contains four exons, which represent the cDNA sequence, spread over 3.8 kb of the bovine genome. Two of the introns are in the DNA sequence coding for the mitochondrial import sequence, and a third intron is in a sequence encoding an extramembranous structure between the two putative transmembrane alpha-helical domains of the mature proteolipid. An Alu-type repetitive element was detected at the extreme 5' end of the sequence. The bovine P1 and P2 genes for the dicyclohexylcarbodimide-reactive proteolipid of ATP synthase are members of a multiple gene family that also contains many pseudogenes. The bovine P1 gene has not been isolated, but two distinct P1 pseudogenes have been cloned and their DNA sequences have been determined. Both of them contain 'in-phase' stop codons and frame-shift mutations, and one of them bears the hallmarks of retroposition; it has no introns, it contains a poly(A) tract at its 3' end and it is flanked by direct DNA sequence repeats. The second P1 pseudogene is very unusual. It appears to be derived from a partially processed transcript and contains an intervening DNA sequence of 861 bp that corresponds in position with an intron in the human P1 gene. This pseudogene also could have been introduced by retroposition since its sequence is flanked by short direct repeats. However, it does not contain a poly(A) tract at its 3' end. An alternative, but less likely, explanation is that rather than being a retroposon, this sequence arose by duplication of an expressed gene at a time when it had only one intron.

Self-similarity, renormalization, and phase space nonuniformity of Hamiltonian chaotic dynamics. A detailed description of fractional kinetics is given in connection to islands' topology in the phase space of a system. The method of renormalization group is applied to the fractional kinetic equation in order to obtain characteristic exponents of the fractional space and time derivatives, and an analytic expression for the transport exponents. Numerous simulations for the web-map and standard map demonstrate different results of the theory. Special attention is applied to study the singular zone, a domain near the island boundary with a self-similar hierarchy of subislands. The birth and collapse of islands of different types are considered. (c) 1997 American Institute of Physics.

The Growth of a Rhetoric of Liberty The key to unlocking the back-story lies in recovering the expansive rhetoric surrounding the freeman in the first half of the seventeenth century. The first involves the elaboration of certain rights and liberties as being constitutive of Englishness. The second strand of thinking owes more to ideas drawn from both Roman law and the Roman histories. The purpose of building up the profile of the free Englishman or, for that matter, the free-born Englishman is always and invariably polemical. Finally, in the Civil War period, the floodgates of thought are truly opened wide and there is an efflorescence of reflection on what it meant to possess true liberty. The civic virtues, such as courage, military readiness, honesty and reason, cluster around political and legal definitions of what it meant to be an Englishman. So also do values such as economic industriousness and cultivation of property.Keywords: Civil War period; Englishman; liberty; rhetoric

Psychometric Evaluation of the Turkish Version of the Zarit Burden Interview in Family Caregivers of Inpatients in Medical and Surgical Clinics The aim of this study was to adapt the Zarit Burden Interview (ZBI) to family caregivers of inpatients in medical and surgical clinics to assess the validity and reliability of the Turkish version. The study design was descriptive and methodological. A total of 223 family caregivers providing care to patients for at least 1 week in clinics were selected through convenience sampling. Data were collected using the Turkish translation of the ZBI. The psychometric testing of the adapted instrument was carried out to establish internal consistency, interitem correlation, and construct validity. The content validity procedure resulted in a final scale comprising 18 items. Cronbachs alpha was.82. Factor analysis yielded one factor. The Turkish version of the ZBI adapted to the clinics can be used as a one-factor tool.

Ex-Novell CTO, Jeff Jaffe, is now CEO of W3C, the World Wide Web Consortium, and will be working with Tim Berners-Lee. Jaffe will take on the role of operations management at the 65 person organisation as CEO, a position which has been open since June 2009, when the previous CEO, Steve Bratt, left to become CEO of the World Wide Web Foundation. The move will allow Berners-Lee to focus on the technical issues that surround developing and managing web standard such as HTML5. Jaffe told US media that "Something I intend to put a lot of energy into is having an extremely open and active dialogue with all the stakeholders of W3C. W3C will have better engagement with the development community". One element of the consortium Jaffe will probably want to work on is the W3C web site, which at the time of writing, was still prominently advertising the post of CEO on its front page. Jaffe has previously spent twenty years at IBM, eventually becoming corporate vice president of technology, five years at Lucent as Bell Labs president of research and advanced technology and, most recently, four years as CTO of Novell, a post he left in January. The W3C is jointly run by the MIT Computer Science and AI Laboratory, the European Research Consortium for Informatics and Mathematics and Keio University in Japan and has over 350 member organisations around the world. Update - Jaffe, known for his blogging, has now posted his first entry on the W3C blog saying "I am honored to be here, I am honored to work with Tim Berners-Lee, and excited to play a role in this mission". Jaffe explained that his immediate priority is "to preserve and enhance the W3C culture of having an open consensus-based process". As part of that process, as CEO of the W3C, he plans to blog more frequently ; "I intend to post often and invite comments. This will be a good way for people to engage in public discussion with me on issues of importance to the organization".

Clinical Trials in Non-Small Cell Lung Cancer with Biomarker-Driven Treatment Allocation: Ready or Not, Here We Come. Lung cancer is the leading cause of cancer mortality. Great advances in non-small cell lung cancer therapy have been seen in the last decade, beginning with the success in treating lung cancer harboring EGFR mutations and ALK-gene rearrangements. The potential of these biomarker-driven therapies has propelled research in biomarker targeted approaches to the forefront of lung cancer research. The successful development of immunotherapeutic agents targeting PD-L1 and PD-1 with an associated non-genomic biomarker has opened a new front in the effort for targeted approaches. Although early-phase lung cancer studies have hinted at the potential to use biomarkers to select patients for allocation to treatment in the conduct of clinical trials, data from late-phase studies have tempered expectations. The data leave unclear the wisdom of routinely restricting enrollment on lung cancer clinical trials to biomarker restricted populations, particularly non-genomic biomarkers.

Growth and survivorship of American beech (Fagus grandifolia Ehrh.) seedlings in a northern hardwood forest following a mast event1 Abstract Despite the recognized importance of root sprout production in northern populations of American beech (Fagus grandifolia Ehrh.), further consideration of the relative role of regeneration from seed in this species appears warranted and timely. A careful examination of the literature revealed that seed- and sprouts-origin individuals co-occurred within all published study sites where the two were differentiated and that presence of a seedling bank may be the rule rather than the exception for American beech. We compared the effects of canopy gaps and root trenching on the growth and survival of a cohort of beech seedlings in Hubbard Brook Experimental Forest (HBEF) in northern New Hampshire, USA. Seedlings in gap plots became larger both above- and belowground. Foliar nitrogen concentrations were affected by both above- and belowground treatments and increased the most for seedlings in trenched gap plots. Seedling height and canopy treatment were important predictors of seedling survivorship with the highest survival in gap locations. The relationship between seedling height and survival was more complex. In the first two years, taller seedlings had a higher probability of dying, while after the second year taller seedlings were more likely to survive to be four-years old. The relatively high survivorship of seedlings at HBEF and their response to gap openings taken together with literature documentation of the long-term presence of seed-origin beech stems in the understory strongly suggest the presence of a beech seedling bank in this forest. This is one of a few manipulative studies on naturally regenerating American beech seedlings, and the first study to relate the likelihood of survival to seedling traits for this important species in the northern hardwood forest.

Altered serotonin transporter binding potential in patients with obsessive-compulsive disorder under escitalopram treatment: DASB PET study Background Obsessive-compulsive disorder (OCD) is a chronic, relapsing mental illness. Selective serotonin reuptake inhibitors block serotonin transporters (SERTs) and are the mainstay of treatment for OCD. SERT abnormalities are reported in drug-free patients with OCD, but it is not known what happens to SERT levels during treatment. This is important as alterations in SERT levels in patients under treatment could underlie poor response, or relapse during or after treatment. The aim of the present study was first to validate a novel approach to measuring SERT levels in people taking treatment and then to investigate SERT binding potential (BP) using DASB PET in patients with OCD currently treated with escitalopram in comparison with healthy controls. Method Twelve patients and age- and sex-matched healthy controls were enrolled. The patients and healthy controls underwent serial PET scans after administration of escitalopram and blood samples for drug concentrations were collected simultaneously with the scans. Drug-free BPs were obtained by using an inhibitory E max model we developed previously. Results The inhibitory E max model was able to accurately predict drug-free SERT BP in people taking drug treatment. The drug-free BP in patients with OCD currently treated with escitalopram was significantly different from those in healthy volunteers . Conclusions This result extends previous findings showing SERT abnormalities in drug-free patients with OCD by indicating that altered SERT availability is seen in OCD despite treatment. This could account for poor response and the high risk of relapse in OCD.

Four suicide bombers struck in Syria's Raqqa on Wednesday, a spokesman for the US-backed Syrian Democratic Forces (SDF) which controls the city said. A string of bombings have in recent months targeted the northeastern corner of Syria held by the SDF, even after its capture of the last ISIS enclave in the area. ISIS has claimed responsibility for several of those attacks, underscoring its continued threat after its territorial defeat last month at Baghouz on the Euphrates at the Iraqi border. In January, the group targeted a restaurant in Manbij, a flashpoint city held by a militia allied to the SDF near areas controlled by the Syrian government and Turkey-backed rebels, killing four Americans. "Four suicide bombers blew themselves up," said Mustafa Bali, head of the SDF's media office. The SDF drove ISIS from Raqqa in 2017 but the fierce military campaign there, including intensive air strikes from a US-led coalition, left much of the city in ruins. ISIS fighters are still holding out in a remote area of the Syrian desert and security officials say others have gone underground in Iraqi cities.

Offspring of mothers with bipolar disorder: a systematic review considering personality features Objective: To examine personality/temperament features and mental health vulnerability in offspring of mothers with bipolar disorders (BD), including dimensions which may impact psychological characteristics or therapeutic measures. Methods: A systematic review, following the Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) guidelines, was conducted to search for original articles that investigated personality/temperament features of offspring of women with BD and emotional factors involved in the mother-child relationship. The electronic search was performed in the PubMed, Web of Science, and PsycINFO databases from February 2010 to February 2017. Results: Ten quantitative studies were included in the analysis: seven from the United States, two from Brazil, and one from Canada. The narrative synthesis was categorized into three dimensions: 1) reliability of instruments for prediction of future psychopathology in offspring; 2) environmental risk factors for offspring; and 3) early interventions. The findings showed impairments in the offsprings lives, high rates of behavior and temperament problems, and psychiatric disorders. Conclusion: BD is a frequent psychiatric disorder, and the offspring of mothers with this condition are exposed to complex family relationships and psychosocial difficulties. If they are to ensure a good provision of mental health and psychosocial care to this unique population, early interventions must not neglect their contextual specificities. Systematic review registration: PROSPERO CRD-42017039010 Introduction Bipolar disorder (BD) is a psychiatric disorder of multifactorial etiology, being highly heritable with important contributions from the environment. Therefore, offspring of patients with BD may be at high risk for psychopathologies and social difficulties. 1,2 Parents diagnosed with BD have challenges in the management of their disorder and in their effective parenting ability. In this context, among the challenges faced by their offspring is the need to adapt to new family and social roles, living with less family cohesion and organization, and enduring a greater potential for conflicts. Accordingly, the children of parents with BD represent an ideal population to assess the natural history of the disease and its prodromal symptoms. 6 In one of the largest studies with offspring of BD patients, the Dutch Bipolar Offspring Study (DBOS), 7 carried out in the Netherlands with a 12-year follow-up (from adolescence to adulthood) of 108 children, the authors found that 72% of the cohort developed an axis I psychiatric disorder according to the DSM-IV throughout their lives and, by the age of 28, on average, more than half had developed a mood disorder. According to Birmaher et al., 8 the largest study with children was the Pittsburgh Bipolar Offspring Study (BIOS), with a sample consisting of 388 offspring of 233 parents with BD and 251 offspring of 143 parents in a demographically matched control group. Compared to offspring in the control group, the offspring of parents with BD showed a fourteenfold increase in rates of bipolar spectrum disorders, an approximately two-to threefold increase in any mood and anxiety disorders, and a four-to sixfold increase in the rates of any axis I disorders. Over 75% of the children that developed BD had their first mood episode before the age of 12, with most of these episodes meeting criteria for BD not otherwise specified and, to a lesser extent, major depression. 8 In this context, psychological support for family members and caregivers of patients with BD is indicated, 9,10 and, unless excluded by the patient, caregivers and family members should have the opportunity to be involved in treatment and follow-up decisions. 10 There is a gap in the scientific literature with regard to which of these psychological aspects most necessitate support. 6 The aim of the present study, therefore, was to conduct a systematic review of studies that identify the personality/temperament features of offspring of women with BD. The main aim was to contribute to the description of the emotional factors involved in this mother-child relationship to support health teams that work with this population, in addition to providing foundations for future studies. Methods This systematic review follows the Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) Statement. 11 The review protocol was registered in the International Prospective Register of Systematic Reviews (PROSPERO, registration number CRD42017039010). Search strategies and screening procedure A search was conducted in MEDLINE (via PubMed), PsycINFO, and Web of Science for articles published between February 8, 2007 andFebruary 8, 2017. The search strategy was first developed in MEDLINE (via PubMed) and then adapted to all database, using the following boolean operators: ''bipolar disorder'' AND ''offspring'' AND ''psy*.'' Data extraction Studies with offspring of any gender of mothers with BD, in the format of original articles reporting clinical trials, case reports, or cohort, cross-sectional, case-control, and qualitative studies. When applicable, offspring from mothers without mental disorders or with disorders other than BD were considered as comparator groups. Studies in which participants were offspring of puerperal women or women in puerperal depression, as well as studies focused on caregivers of women with BD in which findings about their children were not specified, were excluded. Articles reporting diseases and comorbidities related to mental disorders in general and reviews, expert opinions, and other article formats were also excluded. After removing duplicate records, four authors (LKC, MEB, DAS, and RAB) conducted further selection independently, screening titles and abstracts and then accessing the full text. They discussed all disagreements with a fifth senior reviewer (ERT). The studies included by the four authors (LSC, MEB, DAS, and RAB) were analyzed using a pre-piloted data extraction form. Data synthesis A narrative synthesis that adopted a textual approach to summarize and explain the data was conducted. The content analysis of the selected articles followed a categorization according to their main findings. The results were developed in flowing text for better fluency in reading and to connect the themes. The entire process was validated externally through discussions with other researchers in scientific meetings. Quality appraisal The quality appraisal considered at least 60% of the criteria set by the following checklists, according to the study design Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). The studies were organized in EndNote throughout the refinement process. Results A total of 10 articles were found that fulfilled the inclusion criteria and addressed characterization of the psychological aspects of offspring of mothers with BD. Figure 1 presents the PRISMA flow diagram of the entire selection process. The studies were conducted in three different countries: seven in the United States, two in Brazil, and one in Canada. All the articles included used quantitative approaches (Table 1). Narrative synthesis of the set of findings allowed their categorization into three dimensions: 1) Reliability of instruments for prediction of future psychopathology in offspring of BD mothers; 2) environmental risk factors for offspring of BD mothers; and 3) early interventions, once identified risks were considered. Reliability of instruments for prediction of future psychopathology in offspring of mothers with BD Bipolar affective disorder has substantial impact both on persons with the condition and on their relatives, including their offspring. The instability associated with BD influences perceptions and interpretations of subjective reality. When subjects are mothers with the condition who are requested to answer about the behavior of their offspring, the responses may influence a ''BD toxicity bias.'' In chronological order, the first of the included studies, conducted in Brazil by Petresco et al., 12 aimed to evaluate the prevalence of psychopathology in offspring of women with BD compared to two control groups: mothers with other psychiatric disorders and mothers without a psychiatric diagnosis. More psychiatric problems were found in the offspring of mothers with BD, coinciding with results from the international literature. The studied offspring 12 presented a higher prevalence of anxiety disorders and significant differences in relation to the control groups regarding axis I disorders throughout life. In the sample of 43 offspring of mothers with BD studied, 62.8% fulfilled the criteria for at least one psychiatric diagnosis throughout their lives. (Axis I, here, refers to the DSM-IV classification system, since the multiaxial formulation ceased to exist with publication of the DSM-5.) The instrument used by these authors 12 was the Child Behavior Checklist (CBCL), also used in 50% of the articles that constitute the sample of the present review. It should be emphasized that the CBCL is an inventory of symptoms that is particularly useful in screening and assessing the severity and response to treatment. It is not, however, a scale that makes diagnoses; therefore, it is impossible to say that 62.8% of the offspring of mothers with BD fulfilled the diagnostic criteria based on this scale alone. It can be said that they presented symptoms that indicated certain diagnoses. Petresco et al. 12 found a high rate of disruption to core internal regulatory processes, as did Klimes-Dougan et al., 14 who examined risk patterns in offspring of women with BD. Their findings 14 indicate that thought and internalization problems, such as anxiety and depression, withdrawal and depression, somatic complaints, externalization problems, and aggressiveness and rule violation, are more severe in the offspring of mothers with BD. After applying the CBCL in four different periods of offspring development, 14 the findings indicated the presence of deficits in self-regulation in these children. At first, these deficits were related to externalization problems; however, over time, they seemed to advance and compromise internalization processes, which favored the development of thought disturbances. The study suggests that the development of regulatory capacity depends on the support that parents are able to offer, and that an early accumulation of externalization problems was a statistically reliable predictor of thought disorders and internalization problems at the end of 20 years. Petresco et al. 12 also highlighted internalization and externalization problems. Higher rates were found through the use of the Youth Self-Report Social Problems (YSR), because children themselves would be better informants of these issues than their parents. The CBCL was also applied in the study by Simeonova et al., 20 which sought to investigate associations between temperament and behavior during childhood (mean age = 25.464.9 months) of children of women with BD. It was applied together with the Early Childhood Behavior Questionnaire (ECBQ). These authors observed that the broad temperament dimension negative affectivity and the individual sadness and shyness scales of the ECBQ were positively associated with the internalization problems dimension of the CBCL. According to the authors, this was the first report in the literature to highlight the importance of negative affect and attention deficits, and suggested that, at the beginning of development, children of mothers with BD already demonstrate the markers of subtle temperament traits which may be linked to 20 also highlighted that characteristics of difficult temperament at the beginning of development can serve as global risk indicators in a spectrum of internalization and externalization problems. The ECBQ frustration scale was significantly correlated with many CBCL subscales, and may be a marker of trait-related vulnerability in unaffected children of parents with BD. Another ECBQ scale that was significantly associated with several CBCL scales was shyness. This may suggest that children born to a mother with BD who present shyness, inhibition, and anxiety may be at increased risk of future development of behavioral problems. 20 These studies 12,20 support the idea that there is continuity, over time, of temperament traits as one of the predictors of future psychopathology in offspring of women with BD. It is also possible to observe the evolutionary trajectory of these offspring temperament traits. This trajectory is characterized by global deficiencies in flexibility, frustration tolerance, inhibitory control, soothability, ability to follow daily patterns of rhythm, and negative affectivity. Freed et al., 21 also applying the CBCL, argued that the problems of internalization and externalization are greater in offspring of mothers with BD in comparison to offspring of fathers with BD. These authors correlated the greatest family conflict and the lowest family cohesion with more intense symptoms of internalization and externalization in the offspring. Lower family cohesion was also associated with current mood disorders in the offspring. Moderation analyses indicated that the link between lower family cohesion and symptoms of internalization was stronger for younger offspring than older ones. Greater family conflict and current mood disorder were also associated in younger male offspring, but not in older men or women. 21 Environmental risk factors for the offspring of mothers with BD Another cluster of findings considers that the occurrence of maternal BD creates a stressful environment for the offspring, mainly during childhood. This stress refers to physical or psychological abuse, even if unintentional, suffered by the offspring. Examples include mothers with suicide attempts witnessed by their offspring, mixed feelings offspring may have regarding their mothers' manic episodes, and self-neglect. This familiar environment, at a more critical level, may contribute to the development of mood disorders among the offspring. In the study by Moreno et al., 13 the CBCL was used in conjunction with the Schedule for Affective Disorders and Schizophrenia for School-Age Children-Present and Lifetime version (K-SADS-PL), an instrument that allows diagnoses to be made in childhood psychiatry studies. It was observed that the maternal care provided by women with BD is dysfunctional, and that the presence of this psychopathology can lead to poor care. This should be considered as an important environmental risk factor for offspring. The study suggests that having a parent with BD promotes a stressful environment in childhood and Braz J Psychiatry. 2022;44 found that, by symptoms alone, 33.3% of the offspring suffered physical and/or psychological abuse. In comparison to controls, only offspring with maternal BD witnessed suicide attempts by their mothers. Doucette et al. 17 investigated the impact of the environment on the lives of offspring of mothers with BD, with application of the Kiddie Schedule for Affective Disorder (K-SADS). Their findings indicate that exposure to parental BD early in life can be predictive of future mood disorder. However, the authors emphasized that the impact of early parent-child relationships, when only one parent has the disorder, and how this affects predictors remains uncertain. It was found that the mother's perception of greater neglect and the emotionality of the offspring were significantly associated with risk of developing a mood disorder. The duration of exposure to parental BD significantly interacted with the offspring's emotionality to predict future mood disorders. Furthermore, the mother's perception of neglect was associated with high emotionality of the offspring. 17 These authors 17 observed that the mother's perception of childhood neglect was a significant predictor of mood and anxiety disorders in the children. Mother's neglect persisted as the worst risk factor for mood and anxiety disorders, even after adjusting for the duration of exposure to parental illness early in life, offspring temperament, and stress. Besides maternal neglect, an environment where interparental violence is perpetrated is significantly discussed in the studies included in the current review as a risk factor for aggressive behavior. The findings of these authors suggest that offspring can be particularly vulnerable to developing aggressiveness when growing up with a mother that commits this type of violence. The risk of aggression in the adolescents increased more than eighteenfold due to being offspring of mothers with BD and due to experiencing interparental violence during the previous year. Doucette et al. 17 and Freed et al. 21 pondered that mothers with a lower propensity to establish stable relationships or to live with the biological father of their offspring also contributed to more psychological and behavioral problems among the offspring. These aspects suggest the relative absence of other caregivers in the family environment and, therefore, that offspring are more exposed to the effects of the attachment to mothers with uncontrolled symptoms of their psychiatric disorder. Early interventions Early family interventions were discussed in many articles as ways to avoid further psychological problems among the offspring of mothers with BD. All the articles found indicate, as a clinical response to their results, that family interventions -including early intervention, 20,21 psychoeducation, and/or monitoring of offspring -should be performed. Petresco et al. 12 highlighted the importance of a comprehensive approach that includes investigating the patient's family environment. According to these authors, offspring should be followed prospectively until the most likely age of onset of psychiatric disorders, particularly mood disorders. This monitoring makes it possible to detect prodromal signs of these disorders and possibly minimize or prevent distress. Regarding early interventions, Johnson et al. 16 found a possible endophenotypic marker of psychopathological risk evident early in the development of the children of mothers with BD, prior to any clinical signs or symptoms. These authors studied respiratory sinus arrhythmia (RSA) in infants aged 6 months as a laboratory stressor paradigm to assess physiological reactivity to stress. They found increases in RSA in infants born to mothers with BD compared to infants of mothers with major depression and a control group born to mothers without psychiatric disorders. Infants of mothers with BD showed a maladaptive pattern of psychophysiological regulation in response to stress. This pattern was not explained by perinatal outcome, maternal depressive symptoms, or stressful life events, indicating a specificity. The studies included in this review emphasized dimensional analyses regarding the need for the development of early interventions, focused on the offspring of women with BD. 18,20,21 These analyses revealed that the offspring of mothers with BD presented elevated symptoms in all groups of personality disorders. They also presented an increased risk for these diagnoses to be made earlier, i.e., in mid-adolescence and early adulthood, when compared to offspring of mothers with unipolar depression or without psychiatric disorders. Discussion Despite the breadth of our inclusion criteria, the methodological designs of the studies did not vary widely. Half of the studies were cross-sectional, with a lower level of evidence; four are cohort studies; and only one is a casecontrol study. The small number of studies and their low evidence level the scarcity of scientific literature regarding personality/temperament features in offspring of mothers with BD. It also draws attention to the absence of qualitative studies, which are valued in the investigative field as providing insight into the experience of being a son or daughter of someone with BD. It is important to highlight that some of the studies aimed to evaluate DSM-IV psychiatric diagnoses among the offspring of bipolar mothers, while other studies assessed the degree of mental suffering or other psychosocial issues that are not exclusively psychiatric. This observation was possible from the analysis of the instruments used, highlighting the importance of discussing the screening and the assessment of the severity of symptoms, as well as their changes over time, and what is the situation of the offspring regarding these changes. Despite using different methodologies and evaluating different aspects, the included studies show that, at different stages of development, it is possible to identify vulnerability factors in the offspring of mothers with BD. According to the studies, these offspring seem to combine aspects that indicate the importance of early care for this at-risk population. The present study highlights neuropsychological and endophenotypic factors in the offspring of mothers with BD, as well as some emotional and psychological issues, which could be further investigated through the use of qualitative methods. There is a lack of qualitative research on this topic, which could provide significant contributions in listening to offspring and their needs. Regarding this scarcity of studies on the experience of living with a mother with mental disorders, Gladstone et al. 22 highlighted the invisibility of these children within the social processes that shape their lives. From the results of studies that used the CBCL, we observed that self-regulation deficits are common among the offspring of mothers with BD. Indeed, much of the development of self-regulation skills depends on the support that parents can offer. Mothers with BD may not satisfactorily respond to their offspring's self-regulation problems, thus contributing to deregulation of the motherchild relationship. In this context, the set of the reviewed studies showed that the negligence of mothers with BD is widely described as associated with a certain degree of uncontrolled emotionality of the offspring, besides their biological risk factors for developing mood disorders. Maternal violence was also found as a specific, important contributing factor for the development of aggressive behavior of the offspring, instead of other psychopathological symptoms and conjugal violence between the parents in a broader way. However, these results should be interpreted cautiously. Besides the negligence and aggressive behavior of mothers with BD posing as risk factors for their offspring's well-being, other factors probably also contributed to the increased risks of aggressive behavior or mood disorders among these offspring. Sociodemographic status (including low socioeconomic level and younger maternal age) and other aspects of early mother-child interactions were also cited in the studies, although none of them specifically evaluated these aspects. 13,17 Our systematic review found a high incidence of axis I disorders, corroborating what is widely discussed in the scientific literature about the offspring of mothers with BD. 9,10,15 Regarding neuropsychological aspects, Klimes-Dougan et al. 23 found deficits in executive functioning, spatial memory, and attention in offspring of mothers with BD compared to offspring of healthy mothers. Chang et al., 24 in a study with offspring of parents with BD, associated certain temperament characteristics of the children with future psychopathologies. Using the DSM-IV criteria, these authors found psychiatric disorders in 52% of the participants, the most frequent being attention deficit hyperactivity disorder (28.3%), followed by anxiety disorder (15.1%), BD (13.2%), and depression (11.3%). These percentages exceed 52%, because some of the children presented more than one disorder. Gutt 25 also found a higher prevalence of diagnoses of attentiondeficit/hyperactivity disorder and highlighted the higher prevalence of behavioral problems in the offspring of women with BD, in comparison to the offspring of mothers with schizophrenia, with conduct disorders, and with control children of healthy mothers. Still regarding the temperament of children born to parents with BD, Farchione et al. 26 identified greater hostility and irritability in comparison with a control group. Duffy et al. 27 observed a greater predisposition of these children to be easily distressed, afflicted, or worried. Chang et al. 28 found a decreased ability to adapt to new situations and to perform many activities, with difficulty in continuing with tasks, as well as a sad mood. Maoz et al. 29 suggested that aggressiveness is a marked characteristic in preschool children of parents with BD. The findings of the present study also highlight aggressiveness among the externalization problems observed: in the study by Narayan et al., 19 this understanding comes from the idea that the offspring of mothers with BD are vulnerable to becoming aggressive, having grown up witnessing interparental violence. These findings demonstrate the issue of family structure being affected by the presence of maternal BD, which creates a stressful childhood environment. Ellenbogen & Hodgins 30 found high neuroticism in parents with mood disorders, which, associated with inappropriate parenting practices and the creation of a stressful family environment, can cause psychosocial problems in their offspring. Chang et al. 28 observed that families in which one parent had BD presented less cohesion and organization and more conflicts than families without individuals with the disorder. Reinares & Vieta 31 observed a mutual influence between the individual with BD and the family, emphasizing that the course of the disorder can be affected by family attitudes and its manifestations also have a great impact on the functioning and distress of the family. Goldstein et al. 32 associated family conflicts, hostility, and recent sexual abuse with a high risk of suicidal ideation in offspring of parents with BD. These authors suggest that offspring receive treatment that includes the management of suicide risk and axis I conditions, with individual interventions that can target excessive hostility and family interventions, aiming to reduce family conflict. The present review presents data that reaffirm the need for family interventions, as highlighted in the study by Reinares et al., 33 in which the authors state that family involvement should be secured as soon as possible and be adjusted to the needs and characteristics of each patient and their family members. This study suggests that family interventions can contribute to reducing the patient's risk of recurrence and their psychosocial and functional impairments, improving the health and well-being of all family members and even reducing and optimizing socioeconomic resources for the treatment of BD. 33 Roso et al. 34 highlight the benefits of psychoeducational interventions associated with the treatment of patients with BD, and suggest that this can be carried out in large, open groups, including patients, family members, and those interested in the topic, as a way to adapt this need to the Brazilian socioeconomic reality. Accordingly, the inclusion of family members has become a necessary condition for the treatment of individuals with BD 35 and is recommended in the main guidelines for the management of this disorder. 9,10 The family approach is a fundamental part of treatment and can be carried out through family guidance, psychoeducation, or family psychotherapy. 35 Petresco et al. 12 highlighted the importance of a comprehensive approach, which includes the patient's family environment, and in which children should be followed prospectively up to the most likely age of onset of certain psychiatric disorders, particularly mood disorders, in order to check for prodromal signs and possibly minimize or prevent distress. The findings of this review have clinical implications for the care of patients with BD and their offspring. Given our verification of significant harm to children's lives, services that work with the BD population must be adapted to provide adequate care. Support, psychoeducational, and/ or psychotherapeutic groups can be important means of identifying individual needs for care, seeking to avoid late diagnosis of axis I psychiatric disorders as well as to prevent suicide attempts. The limitations of this study are related to the exclusion of theses and dissertations on the subject and to restricting the search to articles published the last 10 years. Older articles could yet provide relevant information, considering that personality/temperament features can be timeless. Future studies may consider these data and look at new aspects, such as genetic and/or environmental issues. In conclusion, the present study provides significant contributions to the scientific literature regarding the characteristics of the offspring of women with BD and the importance of this knowledge for multidisciplinary teams involved in the care of patients with BD. The complex family context to which the offspring of mothers with BD are exposed involves psychosocial difficulties and a lack of early interventions. It is therefore essential to develop original studies that broaden understanding of this phenomenon to create effective interventions directed toward these children. The factors identified in this review should be worked on with patients in order to provide specialized care to their offspring, considering the important implications of maternal disorders for the lives of these children, as identified in the present review.

Global stability analysis for a two species predator-prey model with dispersal for predators among patches and holling type II functional response In this paper, we investigate a two species predator-prey model with dispersal and Holling type II functional response for predators among n patches. Our main purpose is to extend the global stability criteria by Li and Shuai on a predator-prey model with dispersal for preys among n patches. Firstly, by using the basic reproduction number and uniform persistence theory, we obtain the threshold dynamics of the system, that is, the system is uniformly persistent and there exists at least one coexistence equilibrium if the basic reproduction number is larger than one unit. Secondly, by using the method of constructing Lyapunov functions based on graph-theoretical approach for coupled systems, we derive sufficient conditions that the positive coexistence equilibrium of the coupling model is unique and global asymptotically stable.

Blocking Effect of Natural Alkaloids on COVID-19 Pentameric Ion Channel: An in silico Perspective Numerous deaths worldwide have been caused by the coronavirus pandemic and are currently progressing with successive mutations and a lack of appropriate and definitive treatment. One of the drug targets to control the replication of the virus and treat this disease is to block the ion channel of the virus. This will lead to its death by disturbing the internal balance of the virus. Natural compounds such as alkaloids are usually known as effective compounds due to their medicinal characteristics and easy access to their sources. To this end, more than 3,200 natural alkaloid structures interacted with pentameric ion channels. Alkaloid compounds established significant and stable interactions with the channel. More clearly and in more detail, six alkaloid compounds with the best pharmacokinetics and binding affinity of less than -10.52 kcal/mol were selected as hit and suitable compounds for virus control. The compound of psammaplysin U (NA-1) with a binding affinity of -13.52 kcal/mol and binding free energy of -82.21 kcal/mol established hydrogen interactions with the amino acid of Val 25 in the B chain of the ion channel, which placed the compound at the top of the selected compounds. The molecular dynamics simulation of the ligand-protein complex in the 100 ps trajectory showed that the principal interactions were hydrogen and halogen bonding with the amino acids of Val 25 and Thr 30 in the B chain and A chain, respectively, which could be a suitable inhibitor to combat the COVID19. Introduction The emergence of a new coronavirus termed severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) at the end of 2019 led to an epidemic in several Chinese provinces, including Wuhan. The World Health Organization (WHO) declared a state of crisis and gave it the official name of COVID-19 after the death toll exceeded 1,000. The latest cases and death rates in the world as of September 2021 were more than 219 and 4.55 million, respectively. The most common symptoms of this disease are fever, myalgia, dry cough, chest pain, and fatigue. Still, in some cases, dizziness, nausea, diarrhea, sore throat, rash, and paleness of the fingers and toes are observed, and even in rare cases, patients lose their taste and smell sense. The various similarities of the virus with SARS and MERS caused epidemics in multiple nations worldwide in 2002 and 2012, respectively, placing it within the Coronaviridae family and Coronavirinae subfamily. Cryo-electron microscopic studies have revealed that the corona is a spherical virus with approximately 125 nm diameter. Coronaviruses contain envelope and single-stranded RNA. They are divided into four different groups: alpha, beta, gamma and, delta. The COVID-19 is considered the Betacoronavirus. The virus has four main structures: nucleocapsid, membrane, spike, envelope, and several non-structural proteins. In this way, each protein plays a vital role in the virus's life and reproduction. The E protein with an 8-12 kDa weight has an ion channel activity with two different terminals, including an N-terminal ectodomain and a C-terminal endodomain, as shown in Figure 1. Protein E is surrounded by protein M and consists of 75 to 109 amino acids and an -helical transmembrane. The role and function of the E protein (viroporin ion channel) have not been clarified completely, but it is expected to regulate ionic balance inside and outside the cell, which is very critical in the life and pathogenesis of the virus. However, others have recommended that E protein may promote viral release by modifying the host secretory pathway. It has been reported that the protein has a pathogenic function in the SARS and MERS viruses. Stated that mice infected with the coronavirus lacking the E protein reduced mortality. Viruses such as hepatitis C, HIV-1, and influenza A that cause human disease are RNA viruses that express viroporin. Nowadays, the expansion of complementary therapies, natural medication are finding their place. Fallah et al. stated that natural compounds in the essential oil and extract belonging to Panax ginseng and Sambucus nigra demonstrate a potential affinity against the SARS-CoV-2 spike RBD. Alkaloids with bioactive characteristics are notable compounds in pharmaceutical industries. Alkaloid compounds such as atropine, capsaicin, colchicine, and trigonelline had antiviral impacts on RNA and DNA of HSV-1 and PI-3 viruses, respectively. Alkaloids are known for representing a broad spectrum of biological characteristics, such as being Ca +2 channel blockers and enzyme inhibitors, being antimalarial, cytotoxic, anti-infective, and antimicrobial. Previous research reported that alkaloids such as isoboldine have a significant inhibitory effect on SARS-COV-2 protease and showed excellent oral absorption. Polycyclic guanidine alkaloids isolated from Monanchora n. sp. were examined for antiviral potentials against five COVID-19 proteins (nsp10, main protease, membrane glycoprotein, spike glycoproteins, and nucleocapsid phosphoprotein), compounds of Crambescidin 786 and Crambescidin 826 exhibited promising in silico ADMET, and the best binding modes and free energies results. Another study reported that quinoline and quinazoline Alkaloids such as norquinadoline A, deoxynortryptoquivaline, and deoxytryptoquivaline inhibited three protein targets of SARS-COV-2 and showed excellent pharmacokinetic and safety profiles. Particular medication or vaccine production process requires at least ten years from bench research to approve. At the moment, performing computational design and drug discovery can considerably reduce both the cost and the time required for medication development. In addition, the successive mutations of the COVID-19 and the lack of definitive treatment, this study aims to find a suitable and potent inhibitor using molecular docking and dynamics simulation to prevent replication of the virus. The interaction of the hit compounds with the E protein will be examined; it shows how the receptor is blocked and disturb the internal balance of the virus. On the other hand, it will show the ADMET properties of hit poses. Preparation of alkaloid structures. More than 3200 natural alkaloid compounds were obtained from Database for Rapid Dereplication of Known Natural Products (DEREP-NP) openly obtainable at (https://github.com/clzani/DEREP-NP) then prepared through LigPrep software of maestro Schrdinger 2015. To create the required 3D structures, the ionization state and compounds' chirality of the compounds remained intact, the present salts were removed, and only one structure holding the minimum energy was generated for each alkaloid compound. Preparation of receptor. The NMR structure of the pentameric ion channel of the coronavirus was obtained from the protein data bank (PDB ID: 5X29, https://www.rcsb.org). Optimization of the receptor was performed using the Protein preparation program of the maestro Schrdinger package 10.5. In the preparation process, hydrogen atoms were added to the amino acids, zero-order metal bonds and disulfide bonds were formed in the protein's chains. Missing loops and side chains were created by Prime software. Selenomethionine was converted to methionine, and water molecules were removed beyond 3 from the het groups. The PROPKA was employed to predict the pKa of ionizable groups of the receptor at pH 7.00. Ultimately, the OPLS3 force field optimized and minimized the pentameric ion channel of SARS-CoV-2. Active binding site identification. Active site prediction is required for molecular docking in a suitable position. According to Abreu et al., establishing the hydrogen bonds with amino acid residues of Phe 26 and Ala 22 blocks the channel. The Sitemapping application was used for the prediction and validation of the active site (Maestro 10.5). For this purpose, the site map with a site score of more than one was selected as an active pocket site among five predicted sites. According to the mentioned information, the grid box was made in midpoints (X: -0.35, Y: -0.01, Z: -0.22) and with suitable dimensions (X, Y, Z: 20 ) by Receptor Grid Generation Schrdinger package. Molecular docking study. The glide of maestro Schrdinger was used to dock alkaloid compounds and investigate their interaction with amino acid residues in the active binding site of the E protein (5X29). A partial charge of 0.15, as well as a scaling factor of 0.8, was used to soften the potential for nonpolar parts of the compounds. In the docking process, entire compounds were considered flexible and rotated freely (nitrogen inversions and ring conformations). First of all, a large number of the ligands were docked with high throughput virtual screening (HTVS) precision for fast virtual screening and identifying effective alkaloids, then 30% of the best poses with the highest docking scores were examined for XP (extra precision) docking. Finally, more than 200 hit compounds were selected for further analysis. Molecular docking results were expressed in kcal/mol. Free binding energy. Prime molecular mechanics generalized Born surface area (MM-GBSA) module was applied to calculate the sum of entire intermolecular interactions in the protein-ligand complex. The free energy calculation was performed for the complex according to the MM-GBSA method and the following equation. However, other methods are also used, including free energy perturbation as well as molecular mechanics Poisson-Boltzmann surface area (MM-PBSA). The solvation model and force field in this process were considered VSGB 2.0 and OPLS3e, respectively. The pharmacokinetic properties of the alkaloid compounds were investigated using QikPrep software. Drug-like characteristics such as molecular weight (MW), H-bond donor, H-bond acceptor, central nervous system (CNS), logPo/w, polar surface area (PSA), PCaco, brain/blood partition coefficient (logBB), percentage of oral absorption, and metabolism, which are one of the most significant steps in drug discovery, were evaluated for hit compounds. Molecular dynamics simulation. Molecular dynamics simulation for top-scoring alkaloid compound complexed with COVID-19 E protein studied through Macro Model software from Schrdinger maestro suite. The stochastic dynamics procedure was used because it includes random forces that simulate the buffering of a system by solvent molecules. Ligand energy in an aqueous solvent and extended cutoff was minimized using the OPLS3e force field. Polak-Ribier Conjugate Gradient (PRCG) method restarts every 3N iterations at a maximum iteration of 2500 and a convergence threshold of 0.05 for complex minimization. Eventually, simulation was provided using the stochastic dynamics procedure at a simulation temperature of 300 K, a time step of 1.5 fs, and an equilibration time of 1 ps. Finally, 100 ps was considered for simulation time. Results and Discussion The development of new antiviral drugs is a time-consuming process that requires complex clinical trials. Molecular docking is a new approach that requires less time and cost in screening millions of molecules. Also, it can be a powerful tool against disease. The interactions and inhibitory effects of natural alkaloids on the coronavirus ion channel were studied by molecular docking. The molecular docking of 3,200 alkaloids resulted in the selection of 25 compounds (Figure 2), which all had a docking score of less than -8.09 kcal/mol. The free binding energy calculation and pharmacokinetic characteristics were employed to achieve these 25 alkaloid compounds. Psammaplysin U (NA-1) with the lowest docking score (-13.26 kcal/mol) and the lowest glide emodel (-67.93 kcal/mol) was determined to have the best interaction with the protein. The lowest free binding energy (Gbind) of -93.11 kcal/mol was obtained for the purpurealidin D compound as the most stable hit pose. The docking score, free binding energy, and natural alkaloids interactions with E protein are described in Table 1. Interactions of top-scoring alkaloid compounds with pentameric ionic channel. The top six compounds with the highest docking score (-13.258 to -10.522 kcal/mol) are psammaplysin U, nocobactin NA, purpurealidin D, Pyrinodemin A, Psammaplysin S, and Araplysillin V, respectively. 2D and 3D interactions between the pentameric ion channel and the hit poses are shown in Figures 3-8. Compound NA-1, which has halogen and H-bond interactions with Thr 30, Val 29, Val 25, and Leu 28 amino acids, possesses the highest binding affinity of -13.258 kcal/mol with E protein pentameric ion channel (5X29). Furthermore, the free binding energy of -87.75 kcal/mol of psammaplysin U indicates the stability of the compound at the binding site. Carbonyl oxygen with Thr 30 amino acid in the chain A, the nitrogen atoms of the amide with Val 25, and hydroxyl with Val 29 in chain B form a hydrogen bond, while Leu 28 in B chain form a halogen bond with the bromine of benzene ring ( Figure 3). Biological activities such as antimalarial, anti-HIV, antifouling, and cytotoxic activity were demonstrated by psammaplysin derivatives extracted from nine different species of Verongida sponge. The NA-1 compound contains an isobranch monoenoeic fatty acid with the molecular formula of C38H53Br4N3O7, which can be extracted from the Balinese marine sponge (Aplysinella strongylata). Nocobactin NA (NA-2) interacts with the amino acid of Arg 61 in the E chain. The hydroxyl and the oxygen atom of the carbonyl group of NA-2 establish hydrogen bonds with the amino acid simultaneously. Also, a docking score of -11.32 kcal/mol and free binding energy of -85.72 kcal/mol was calculated for the compound (Figure 4). Nocobactin NA is produced by Nocardia asteroid and Nocardia farcinica, which usually grow before iron. NA-2 is a lipid-soluble compound whose tumor-specific cytotoxicity properties were shown by Sakagami et al.. The oxygen of the carboxyl and carbonyl group in the compound of Purpurealidin D leads to a binding affinity of -11.28 kcal/mol by forming hydrogen bonds with the amino acid of Thr 30 in chain A. The desired compound with a free energy of -93.01 kcal/mol in the pentameric ion channel was selected as the third effective compound in this study ( Figure 5). The purpurealidin D is a compound of Bromotyrosine alkaloids found in sponge Psammaplysilla purpurea. The free binding energy of Pyrinodemin A was calculated as -82.53 kcal/mol, and the docking score energy was estimated at -11.02 kcal/mol. In Figure 6, it can be seen that the pyridine ring in the NA-4 compound induces a - stacking with Phe 26 in the C chain, which blocks the ionic channel and disturbs the internal balance of the virus. Pyrinodemin A, with the molecular formula of C38H59N3O, is a cytotoxic pyridine alkaloid found in Kinawan marine sponge (Amphimedon sp.). Tesuda et al. reported that the NA-4 compound had cytotoxic properties against murine leukemia with IC50 = 0.058 g/ml. ADMET prediction. Drug-likeness properties for alkaloid compounds were calculated by the QikProp panel and filtered the compounds to the 25 final hit poses. Lipinski's rule of 5 (molecular weight, octanol-water partition coefficient, hydrogen acceptor and donor), toxicity-related descriptors (PCaco, logBB, percentage of oral absorption, and CNS activity), and several parameters, including metabolism and PSA (Veber rule), were predicted. According to the results in Table 2, these natural alkaloid compounds proved agreeable in silico pharmacokinetic properties. One of the most prominent features of the drug is absorption, which makes it easy to use. The factor of log P indicates the hydrophilicity of the drug, which the high value of the log P leads to a decrease in drug absorption. All hit alkaloids except compounds of NA-9, NA-12, NA-14, NA-17, and NA-20 had an oral absorption of more than 50%. Among the top 6 selected compounds, NA-1, NA-4, NA-5, and NA-6 showed 100% oral absorption, and NA-3 compounds noted more than 95% absorption. CNS activity of the entire 25 compounds except for NA-4, NA-23, NA-24, and NA-25 were reported -2. However, the compounds mentioned were in an acceptable range with no penetration into the central nervous system. Besides, hydrogen acceptors and donors displayed great results for all 25 alkaloids. Additional information on ADMET properties is presented in Table 2. Molecular dynamics analysis. Molecular dynamics simulation was used to understand the bonds in the ligand-ion channel complex accurately. Molecular dynamics simulations were evaluated for a 100 ps trajectory to achieve the top ligand's stability and mechanism of interaction with the pentameric ion channel in 150 frames. The system hit a stable equilibrium after about 60 picoseconds from the simulation process ( Figure 9). According to the standard, the convergence threshold was considered 0.05, and if a difference of 0.05 kJ/mol is observed between at least two calculated potential energies, the system will iteratively be optimized. The simulation's film shows that the first interaction of ligand-protein is the nitrogen atom of Psammaplysin U with the Val 25 in the B chain. Besides, in the equilibrium times, the most interactions were the halogen bond of the bromine with Thr 30 in chain A. Conclusions The present study was performed to identify and determine an appropriate inhibitor of natural alkaloid compounds to block the ion channel of the coronavirus in the current situation with no definite medication. The compounds of NA-1 to NA-6 with the highest docking score were identified as hit poses by molecular docking study. Post-screening analyses such as free binding energy and pharmacokinetic characteristics have not been ineffective in selecting these compounds. So that among these compounds, the most stable compound in the presence of protein is NA-3 with -93.01 kcal/mol, and the unstable compound with the energy of -60.20 kcal/mol was NA-6. Finally, the compound of Psammaplysin U with docking score of -13.26 kcal/mol, glide emodel of -93.67 kcal/mol, and hydrogen interactions with amino acids of Val 25, and Val 29 in the chain B, Thr 30 in chain A, also halogen interaction with Leu 28, was selected as the superior alkaloid compound. The first interaction in the molecular dynamics simulation was the hydrogen bond of the NA-1 compound with the amino acid of Val 25 in the B chain of the virus's ion channel. Psammaplysin U could be a suitable compound for equilibrium disruption of the virus and ultimately the disease therapy. Funding This research received no external funding. and phenolic acids.

KEVIN ROBINSON February 8, 2019 at 5:00 a.m. The funeral for Kevin Robinson, 44, of Waldo, will be held 11:00 am on Saturday, February 9 at Youngblood Auditorium, 811 Madison St. Magnolia, Arkansas, with Pastor Leroy Martin officiating. Burial will be in Smith Cemetery, Waldo under the direction of Henderson Funeral Service. Calling hours will be Friday, February 8 from 12:00 noon - 4:00 pm at the funeral home.

Constraint-Variance Tolerant Data Repairing Integrity constraints, guiding the cleaning of dirty data, are often found to be imprecise as well. Existing studies consider the inaccurate constraints that are oversimplified, and thus refine the constraints via inserting more predicates (attributes). We note that imprecise constraints may not only be oversimplified so that correct data are erroneously identified as violations, but also could be overrefined that the constraints overfit the data and fail to identify true violations. In the latter case, deleting excessive predicates applies. To address the oversimplified and overrefined constraint inaccuracies, in this paper, we propose to repair data by allowing a small variation (with both predicate insertion and deletion) on the constraints. A novel -tolerant repair model is introduced, which returns a (minimum) data repair that satisfies at least one variant of the constraints (with constraint variation no greater than compared to the given constraints). To efficiently repair data among various constraint variants, we propose a single round, sharing enabled approach. Results on real data sets demonstrate that our proposal can capture more accurate data repairs compared to the existing methods with/without constraint repairs.

Despite calls for changes in the existing custody agreement between Britney Spears and Kevin Federline, the judge in the case ruled today that things are (basically) to stay the same. Today’s emergency hearing dealt primarily with the pop star’s apparent inability to respond in a timely fashion to calls from the testing facility for her court-ordered random drug tests. According to K-Fed’s attorney, Mark Vincent Kaplan, who told the judge that the singer exists in a “parallel universe,” Brit has not responded properly to 8 out of 14 attempts (each “failed” attempt consists of three phone calls from the facility within a one-hour period). Britney’s excuse? Aside from her lawyer, Anne Kiley, calling the testing facility “corrupt” and the facility’s head a “liar,” it appears that Britney’s biggest problem is the time at which the facility calls. Also at issue is Britney’s apparent cell phone issues. Both Kaplan and the judge mentioned problems of changed phone numbers, lost phones, assistants answering and then hanging up, calls being forwarded to random numbers and so on. After a recess, during which the court was unable to secure a new testing facility, Kaplan asked that Britney no longer be allowed to drive the boys, and that if she’s in the car with them, another person must drive. The judge shot this idea down, stating that it would in effect be a change to the custody ruling, but not without a bit of scolding for the beleaguered songstress.

THE ECONOMY Household debt shrinks for 1st time Consumers appear to be curbing spending, but it's unclear whether they've volunteered to do so. What economists don't know is whether people are bringing down their debt voluntarily or whether it's being imposed on them through foreclosures or the denial of credit. Economists say consumers appear to be curbing their spending and displaying a healthy prudence about taking on new debt -- something financial planners have been admonishing Americans to do for decades. What's known is that the debt held by U.S. households shrank in the three months ended Sept. 30. That's the first time that has happened since the government began keeping records more than 50 years ago, the Federal Reserve said Thursday. WASHINGTON — The American consumer's long-running love affair with debt appears to be on the rocks. But like a lot of soured romances, the reasons are open to debate. "While it's good that households are beginning to save, it's much more likely that this is being imposed on them by the unavailability of credit than any desire to sustain their balance sheets over the long run," said Vincent Reinhart, a former senior Fed economist who is now a fellow at the American Enterprise Institute. Household debt declined 0.8% in the third quarter, mostly as a result of a 2.4% decline in mortgage debt, the Fed reported. Other consumer debt, which includes credit card debt, rose a modest 1.2%. The Fed also noted that household net worth continued to decline in the same quarter, largely because of shrinking home equity. Homeowners' equity as a percentage of the value of their homes has fallen to just 44.7%. Until this year, that percentage had not fallen below 50% since 1945. "You don't have the house to borrow from anymore," said Joel Naroff, president of Naroff Economic Associates in Holland, Pa. "The fact that net worth is going down means that people are feeling poorer and poorer and are cutting back by saving rather than borrowing," Naroff added. "The question is whether this is a long-term change in philosophy" or just short-term austerity. But it's also true that Americans are saving more. The savings rate, a meager 0.2% in the first three months of the year, rose to 1.1% for the third quarter. With the nation in recession and unemployment rising, many people are simply cutting back as a precaution. "I have to be careful with money because of what's going on in the economy," said Marsha Phillips, 48, a single mother who works as a janitor at the YMCA in Burbank. "I'm on a budget." Phillips said she had cut back on such luxuries as eating out and buying DVDs. Now she goes out no more than once a month. "My bills never got paid on time, and they racked up," Phillips said. "I'm on an even keel now." Adam Ziegler, a 26-year-old graphic designer from West Hollywood, said he was planning to spend $30 or $40 for each person on his holiday shopping list, down from $50 or so in years past. He's eating out less and spending less time in nightclubs. "I've been only going out a little bit and not drinking as much," Ziegler said. Ofelia Cruthirds, 43, of Fontana is also slashing her holiday gift budget. With eight sisters and five brothers, Cruthirds said she had usually spent $1,000 a year on Christmas gifts for her siblings and her dozens of nieces and nephews. She plans to spend less than $500 this year. "I'm not buying anything with a credit card -- we're trying to get the debt down," she said. "The economy won't get better soon. Too many people are losing their jobs."

Continuous surface-relief microoptical elements and their replication in polymer and other materials This paper describes the enabling technologies developed at INO to generate continuous surface-relief profile diffractive and refractive optical elements in photoresist. Grey-scale mask photolithography based on high-energy beam sensitive glass and laser direct writing have been used to fabricate aspherical refractive and diffractive microlenses respectively. Properties of refractive microlenses are compared to those fabricated by the standard reflow technique. The replication of such elements by injection molding and UV-embossing in acrylic and custom hybrid sol-gel glasses respectively is described. Fidelity of replication in the various processing steps is given. Optical performance of aspherical microlenses with f-numbers between 0.69 and 7 as well as thermo-mechanical properties of organic/inorganic materials are given.

The human mandible: lever or link? The mammalian mandible, and in particular the human mandible, is generally thought to function as a lever during biting. This notion, however, has not gone unchallenged. Various workers have suggested that the mandible does not function as a lever, and they base this proposition on essentially two assertions: the resultant of the forces produced by the masticatory muscles always passes through the bite point; the condylar neck and/or the temporomandibular joint is unsuited to withstand reaction forces during biting. A review of the electromyographic data and of the properties of the tissues of the temporomandibular joint do not support the non-lever hypothesis of mandibular function. In addition, an analysis of the strength of the condylar neck demonstrates that this structure is strong enough to withstand the expected reaction force during lever action. Ordinarily the human mandible and the forces that act upon it are analyzed solely in the lateral projection. Moments are then usually analyzed about the mandibular condyle; however, some workers have advocated taking moments about other points, e.g., the instantaneous center of rotation. Obviously it makes no difference as to what point is chosen since the moments about any point during equilibrium conditions are equal to zero. It is also useful to analyze the forces acting on the mandible in the frontal projection, particularly during unilateral biting. The electromyographic data suggest that during powerful unilateral molar biting the resultant adductor muscle force is passing between the bite point and the balancing (non-biting side) condyle. Therefore, in order for this system to be in equilibrium there must be a reaction force acting on the balancing condyle. This suggests that reaction forces are larger on the balancing side than on the working side, and possibly explains why individuals with a painful temporomandibular joint usually prefer to bite on the side of the diseased joint.

Human-Computer Interaction Technology for Upper Limb Rehabilitation Based on Gesture Recognition Control In this paper, according to the motion characteristics of human upper limbs, a two-limb universal upper limb rehabilitation robot with 7 degrees of freedom is designed to satisfy the use of left and right limbs, and in order to verify the rationality, the static analysis of key parts is carried out. Secondly, the non-contact human-computer interaction gesture recognition technology based on Kinect is studied. The hand tracking and positioning of the left and right hands are respectively realized by the Kinect skeleton acquisition technology, and real-time static gesture recognition based on SVM which can distinguish between left and right hands is implemented to judge the gesture recognition results and control the motion of the upper limb rehabilitation robot. Finally, a human-computer interaction experimental platform based on gesture recognition is built to test and realize a variety of rehabilitation modes for left and right limb training.

Peaches & Herb History Herb Fame (born Herbert Feemster, October 1, 1942, in Anacostia, Washington, D.C.), sang in church and neighborhood groups as a child. After graduation from high school, he worked in a local record store where he met record producer Van McCoy and was signed to Columbia subsidiary Date Records by McCoy and A&R executive Dave Kapralik. Francine "Peaches" Barker (April 28, 1947 – August 13, 2005), using the stage name Francine Day, started a singing trio initially dubbed The Darlettes and later renamed The Sweet Things after a change of record label to Date Records. Having produced two releases for the trio, McCoy decided to record Feemster/Fame and Hurd/Day together at Kapralik's suggestion. The resulting single, "We're in This Thing Together," was distributed to radio stations but went nowhere for months until December 1966, when a St. Louis disc jockey broadcast the single's B-side, a revival of the 1934 hit "Let's Fall in Love". The new duo, christened "Peaches & Herb", had a string of successful singles and albums over the next two years such as "Let's Fall in Love", "Close Your Eyes", "For Your Love", and "Love Is Strange". Despite burgeoning success and a media image as the "Sweethearts of Soul", Barker chose to semi-retire from the duo after two years because of the rigors of touring. Marlene Mack (aka Marlene Jenkins), who had sung on the Jaynetts' hit "Sally Go 'Round the Roses" and had recorded as Marlina Mars, replaced Barker on stage, but Barker remained on all of the duo's recordings for Date Records. During this period, the semi-retired "Peaches" also worked as a solo artist using her married name, Francine Barker. She released three singles in total on the Columbia Records label, including "Angels in the Sky" and "Mister DJ". Fame retired the act in 1970 when, for personal reasons, he enrolled in the police academy of Washington, D.C. and thereafter joined the city's police department. Peaches & Herb lay dormant until Fame decided to re-enter the music business in 1976. In his search for a new "Peaches", Herb again enlisted the assistance of Van McCoy, who suggested that Linda Greene would be suitable for the position. Fame met Greene and concurred, thereby leading to formation of the most successful of the "Peaches & Herb" incarnations to date. Linda's early musical training (while growing up in Washington, D.C.) was at The Sewell Music Conservatory. Fame and Greene recorded seven albums altogether, including one album released only in Argentina. Their first album, Peaches & Herb, was recorded for MCA Records and produced by Van McCoy, but it generated only one charted hit, "We're Still Together". Peaches & Herb signed with MVP/Polydor and under the management of Paul J. Cohn, released 2 Hot, which went gold. The album's first single, "Shake Your Groove Thing", went gold and peaked at #5 on the Billboard Hot 100 in March 1979. The follow-up single, viewed as the album's "secret weapon" by producer/songwriter Freddie Perren, was the triple platinum hit "Reunited". This song, evoking the 1960s Peaches & Herb hit "United" (originally recorded and made a hit by The Intruders), reached #1 on both the Hot 100, the Billboard R&B chart, and in Canada. "Reunited" was nominated for a Grammy Award for Song of the Year in 1980. Subsequent releases with Polydor produced several more hits, including the lasting wedding staple, "I Pledge My Love". After changing labels again to the Entertainment Company, Fame and Greene released their seventh album in 1983. Scoring only one minor hit, Greene and Fame decided to make no more albums and retired their partnership. Once again, Fame returned to law enforcement and joined the U.S. Marshals Service in 1986 as a deputized court security officer at the U.S. Court of Appeals for Veterans Claims. Greene returned to her family and, together with her husband Stephen Tavani, went on to release three gospel albums and start the charity WOW (Winning Our World). Formerly Greene, Linda now goes by Linda Peaches Tavani, and anticipates a solo album release in the coming years. While remaining employed at the court, Fame again revived the brand in 1990. For the fourth "Peaches" he chose Patrice Hawthorne, fresh from television exposure on the Natalie Cole-hosted talent show Big Break. The duo appeared infrequently in concerts, and did not release any recordings. Hawthorne remains a Philadelphia bandleader of her own orchestra, CTO Soho. Due to unpaid royalties, Fame's financial state was far from wealthy despite years of hits and selling nine million records with Greene. Thus, in 2001, Fame and Greene hired attorneys Oren Warshavsky and Steven Ames Brown through Artists Rights Enforcement Corporation. The attorneys brought a lawsuit against MVP Records, then headed by Christine Perren. Perren's testimony at trial revealed a series of contradictions in MVP's defense, with the result that Fame and Greene received royalties, income, and a reaffirmation of their artists' rights. Those rights have since been vigorously defended. Having financial security, Fame would then have been able to leave the court and focus solely on his music career. Instead, he banked significant funds and continued enjoying the work. A fifth "Peaches"—singer, songwriter, and advocate for breast cancer prevention, Miriamm—joined the duo in 2002. Miriamm began touring with Herb and was introduced to the world as the new "Peaches" when she joined Herb in the PBS televised "Rhythm, Love & Soul" Fundraising drive. They shared the stage with greats such as Aretha Franklin, Gloria Gaynor and Lou Rawls, among others. Their performance re-introduced Peaches and Herb and their on-stage chemistry was so well received, it sparked another invitation to the duo for the follow-up star-studded installment of the PBS show featuring R&B greats such as Irene Cara, Heatwave, and Anita Ward. Both performances currently air periodically throughout the year. Miriamm currently performs as a free-lance vocalist and has founded a breast cancer foundation, EPW Breast Cancer Foundation, Inc., in honor of her mother, Edith P. Wright, providing support to families facing breast cancer. Wanda Makle subsequently performed with Fame in weekend appearances, and in 2008 they were reported to be planning a recording together. Those plans dissolved, and instead Makle was ultimately dropped in favor of another "Peaches," Meritxell Negre from Barcelona, Spain. Negre, who was introduced to Fame by producer Bill Davis, is the first-ever non-black "Peaches" and third recording artist to co-record a Peaches and Herb album. Together, Fame and Negre recorded Colors of Love, the first album from Peaches & Herb since 1983. Combined with Fame's classic, zesty tenor flair, Negre's soulful, alto-soprano range seamlessly replaces Linda Greene 25 years after the Peaches & Herb album Remember. Colors of Love was released in May 2009 by Imagen Records, approximately three months after Negre's stage debut as "Peaches". Fame has since returned to touring with Wanda Tolson. On June 25, 2019, The New York Times Magazine listed Peaches & Herb among hundreds of artists whose material was reportedly destroyed in the 2008 Universal fire. Legacy The disco song "Shake Your Groove Thing" has featured prominently in many films such as An Extremely Goofy Movie, Monster, The Adventures of Priscilla, Queen of the Desert, Connie and Carla, Marock, Sausage Party and The Country Bears, as well as in an advertisement campaign by Intel in the late 1990s. In June 2009, rock band Faith No More opened their set at Brixton Academy with their own cover of "Reunited" the song alluding to the band's own eleven-year break up and subsequent reunion. They subsequently did the same for their headlining slot at Download Festival on June 12.

Washington (CNN) -- Another attempted terrorist attack on the United States in coming months is "certain," the heads of major U.S intelligence agencies told a Senate committee Tuesday. Al Qaeda remains the top security threat to the United States, but a growing cyber-security threat also must be addressed by the U.S. intelligence community, the heads of the CIA, the FBI and other agencies told the Senate Intelligence Committee. The hearing covered a range of security issues and became contentious, with Republicans on the committee arguing with Democratic counterparts and the intelligence chiefs on how the Obama administration has handled terrorism suspects such as the failed Christmas Day bomber of a U.S. airliner. Asked by committee chair Sen. Dianne Feinstein, D-California, of the likelihood of another attempted terror attack on the United States in the next three to six months, the officials agreed with Director of National Intelligence Dennis Blair's initial answer of "certain." While none of the intelligence chiefs, who included CIA Director Leon Panetta, FBI Director Robert Mueller and others, cited a specific pending threat, their testimony made clear that an evolving al Qaeda remains their top concern. "My greatest concern, and what keeps me awake at night, is that al Qaeda and its terrorist allies and affiliates could very well attack the United States," Panetta said. Al Qaeda is adapting methods to make their plots more difficult to detect, shifting from large attacks with multiple players to using individuals without any background in terrorism, Panetta said. He noted the Christmas Day attempt as an example, saying the suspect had a U.S. visa but little history of involvement with terrorist groups. "Obviously, they decided to make use of someone like that within a very short period of time" of the suspect coming into contact with al Qaeda, Panetta said. Blair also said that deciding whether to prosecute terrorist suspects in a criminal court or by a military commission should be decided on a case-by-case basis. The question involved the handling of Umar Farouk AbdulMutallab, the suspect in the failed Christmas Day bombing of a U.S. airliner. Republicans have criticized security officials for charging the suspect in criminal court instead of treating him as an enemy combatant to be prosecuted by a military commission. Sen. Kit Bond, R-Missouri, said it was a mistake for security officials to have read AbdulMutallab his Miranda rights on the night he was arrested, instead of first conducting further interrogation. Blair, however, said the handling of terror suspects requires flexibility to allow for the appropriate response in each case. FBI Director Robert Mueller agreed, saying that providing a suspect with Miranda rights can bring better information than traditional military or intelligence interrogation. Mueller noted that incentive agreements with suspects have many times resulted in gaining "actionable intelligence" that otherwise might never have come forward. Republican Sens. Olympia Snowe of Maine and James Risch of Idaho, asked why AbdulMutallab was read his Miranda rights so quickly. Mueller said the decision must be considered in the context of the full investigation. "You're looking at it through the rear-view mirror," Mueller said. "Do not discount what has happened or what does happen after that in terms of gaining intelligence." Later Tuesday, a law enforcement official told CNN AbdulMutallab had been talking to investigators since last week and providing useful, current and actionable intelligence -- leads that the FBI and intelligence officials have been actively following up. The official was not authorized to speak for attribution because the case remains under investigation. Mueller said none of the intelligence chiefs at Tuesday's hearing were consulted about the decision to read AbdulMutallab his Miranda rights. That decision was made by the chief security interrogator at the scene in consultation with the Department of Justice, Mueller said. The discussion included a harsh exchange among committee members, with Democratic Sens. Feinstein, Jay Rockefeller of West Virginia and Sheldon Whitehouse of Rhode Island accusing Republican Sens. Bond and Orrin Hatch of Utah of politicizing the issue. Feinstein noted the policy of charging terrorists in U.S. criminal courts dates back to the Reagan administration, while Whitehouse called Republican framing of the issue "fallacious." Hatch also asked Blair if any evidence showed that President Obama's plan to close the Guantanamo Bay, Cuba, detention facility for terrorism suspects would reduce the terrorist threat against the United States. Hatch and Bond said they opposed the plan because it would bring terrorism suspects to U.S. soil. Blair responded that Guantanamo has become a major recruiting tool for al Qaeda, setting off an exchange with Hatch that concluded with Blair saying: "Guantanamo has achieved a sort of mythic quality that helps al Qaeda." In his written testimony to the committee, Blair said it would take the capture or deaths of al Qaeda's top two leaders -- Osama bin Laden and Ayman al Zawahiri -- to possibly end the group's intent to attack the United States. On the cyber-security threat, Blair's written testimony described an inability to contend with attacks using computer networks and telecommunications systems. "Sensitive information is stolen daily from both government and private sector networks, undermining confidence in our information systems, and in the very information these systems were intended to convey," Blair wrote. "We often find persistent, unauthorized, and at times, unattributable presences on exploited networks, the hallmark of an unknown adversary intending to do far more than merely demonstrate skill or mock a vulnerability." Feinstein agreed with Blair's assessment that the nation was unprepared for the kinds of possible cyber attacks it could face. "The need to develop an overall cyber-security strategy is very clear," Feinstein said.

But this fiery debate has also potentially triggered physical backlash. Confirmed arson in Southern California: The most recent attack came on Wednesday evening in Thousand Oaks, California, where arsonists broke a Planned Parenthood window to douse the interior with gasoline — and then set it on fire. The small fire was put out by the facility’s sprinkler system, but the clinic is unsure how soon it can reopen. Suspicious fire in Washington State: In early September, a Planned Parenthood clinic in Pullman, WA, saw a more detrimental arson case that took hours to put out. Clinic staff said the fire could shutter the center for a month, at the least. Hate crime in Louisiana: A man was accused of pulling metal signage off a Metairie, LA abortion clinic on August 15. Under Louisiana law, it’s illegal to commit a crime against a person and property “because of actual or perceived membership or service in, or employment with, an organization.” Thus, this act was deemed a hate crime because it was specifically targeting employees who provide abortions. Vehicle arson in New Orleans: Another arsonist targeted a Planned Parenthood clinic in the process of being built in early August. The New Orleans construction site failed to ignite, but the nearby empty vehicle of security guard caught fire. This particular construction site has been plagued with vandalism and protests for months, delaying the opening of the clinic. These incidents haven’t occurred in a vacuum. Lawmakers and reproductive rights activists have been quick to link the recent attacks to the larger national debate swirling around Planned Parenthood’s abortion services. And local clinic staff also acknowledge the larger impact of these direct attacks. The people who work at clinics often become the subject of threats, harassment, and violence designed to drive them out of business. According to the National Abortion Federation — which tracks national statistics related to clinic violence — there have been more than 200 arsons and bombings of clinics since the mid-1970s. Over the past several years, the level of personal attacks against abortion providers has increased.

Synaptic Contributions to Receptive Field Structure and Response Properties in the Rodent Lateral Geniculate Nucleus of the Thalamus Comparative physiological and anatomical studies have greatly advanced our understanding of sensory systems. Many lines of evidence show that the murine lateral geniculate nucleus (LGN) has unique attributes, compared with other species such as cat and monkey. For example, in rodent, thalamic receptive field structure is markedly diverse, and many cells are sensitive to stimulus orientation and direction. To explore shared and different strategies of synaptic integration across species, we made whole-cell recordings in vivo from the murine LGN during the presentation of visual stimuli, analyzed the results with different computational approaches, and compared our findings with those from cat. As for carnivores, murine cells with classical center-surround receptive fields had a push-pull structure of excitation and inhibition within a given On or Off subregion. These cells compose the largest single population in the murine LGN (∼40%), indicating that push-pull is key in the form vision pathway across species. For two cell types with overlapping On and Off responses, which recalled either W3 or suppressed-by-contrast ganglion cells in murine retina, inhibition took a different form and was most pronounced for spatially extensive stimuli. Other On-Off cells were selective for stimulus orientation and direction. In these cases, retinal inputs were tuned and, for oriented cells, the second-order subunit of the receptive field predicted the preferred angle. By contrast, suppression was not tuned and appeared to sharpen stimulus selectivity. Together, our results provide new perspectives on the role of excitation and inhibition in retinothalamic processing. SIGNIFICANCE STATEMENT We explored the murine lateral geniculate nucleus from a comparative physiological perspective. In cat, most retinal cells have center-surround receptive fields and push-pull excitation and inhibition, including neurons with the smallest (highest acuity) receptive fields. The same is true for thalamic relay cells. In mouse retina, the most numerous cell type has the smallest receptive fields but lacks push-pull. The most common receptive field in rodent thalamus, however, is center-surround with push-pull. Thus, receptive field structure supersedes size per se for form vision. Further, for many orientation-selective cells, the second-order component of the receptive field aligned with stimulus preference, whereas suppression was untuned. Thus, inhibition may improve spatial resolution and sharpen other forms of selectivity in rodent lateral geniculate nucleus.

Study population The COSM and the SMC are prospective cohorts of men and women, respectively, in central Sweden. The COSM was initiated in the late autumn of 1997 when all men who were born between 1918 and 1952 and resided in Västmanland and Örebro counties received a mailed questionnaire about diet, beverage consumption, lifestyle, and other risk factors for chronic diseases. A total of 48,850 men (49 % of the source population) answered the questionnaire. Simultaneously, an identical questionnaire (except for some sex-specific questions) was completed by 39,227 women (70 % response rate) who were born between 1914 and 1948 and lived in Västmanland and Uppsala counties. Those women had been enrolled in the SMC in 1987–90, but the baseline data did not include cardiovascular risk factors. We therefore used the 1997 questionnaire as the baseline for the present analyses. We excluded men and women with an incorrect/missing personal identification number (n = 297 men and n = 243 women), those with a diagnosis of AF (n = 1,496 men and n = 634 women) or cancer other than non-melanoma skin cancer (n = 2,592 men and n = 1,811 women) before baseline, those who died between the administration of the 1997 questionnaire and start of follow-up (1 January 1998; n = 55 men and n = 26 women), and those with missing data on coffee consumption (n = 2,529 men and n = 1,919 women). This left 41,881 men, 45–79 years of age, and 34,594 women, 49–83 years of age for analysis. The Regional Ethical Review Board at Karolinska Institutet in Stockholm, Sweden, approved the study. The completion of the self-administered questionnaire was considered to imply informed consent. Assessment of coffee consumption and covariates The questionnaire completed by participants in the autumn of 1997 inquired about education, smoking, body weight, height, physical activity, history of hypertension and diabetes, family history of myocardial infarction before 60 years of age, diet, and consumption of coffee and other beverages. The questionnaire assessed average consumption of 96 foods and beverages during the previous year. With regard to coffee consumption, participants were asked to report how many cups of coffee they consumed per day or per week. In a validation study (conducted in a subsample of 111 participants of the SMC) of a similar questionnaire, the questionnaire assessment of coffee correlated well with the mean of four 7-day dietary record assessments (Spearman correlation coefficient, r = 0.61) [16]. Cardiac disease was defined as a diagnosis of ischemic heart disease or heart failure in the Swedish National Inpatient Register. We classified participants as having hypertension and diabetes if they reported in the questionnaire that they had any of these diseases or if they had a diagnosis of hypertension or diabetes in the Swedish Hospital Discharge Register or the Swedish National Diabetes Register. Participants were asked to indicate their time spent on walking and bicycling during the last year. They could choose from six predefined categories: almost never; <20 min/d; 20–40 min/d; 40–60 min/d; 1–1.5 h/d; or ≥1.5 h/d. We calculated body mass index as self-reported weight (in kg) divided by the square of self-reported height (in m). Alcohol (ethanol) consumption, in the last year, was calculated by multiplying the frequency of consumption of beer, wine and liquor by the amount consumed at each occasion. Ascertainment of cases Via linkage of study participants (using the personal identification number assigned to each Swedish citizen) with the Swedish Hospital Discharge Register, we obtained information on dates of diagnosis of AF. Diagnoses in the Hospital Discharge Register are coded according to the Swedish International Classification of Disease (ICD) system. AF was defined as atrial fibrillation or atrial flutter (ICD-10 code I48). A previous validation study of AF diagnoses in the Hospital Discharge Register showed that the AF diagnosis is correct in 97 % of the cases [17]. Statistical methods Participants were followed up from 1 January 1998 until the date of diagnosis of AF, date of death (information obtained from the Swedish Death Register) or end of follow-up (31 December 2009), whichever came first. We categorized participants into five groups (approximate quintiles) according to their coffee consumption: <2 cups/d (reference); 2 to <3 cups/d; 3 to <4 cups/d; 4 to <5 cups/d; and ≥5 cups/d. We used Cox proportional hazards regression models with age as the time scale to estimate relative risks (RR) with corresponding 95 % confidence intervals (CI). All multivariable models included education (less than high school; high school; university) and known risk factors for AF, including smoking (never; past and <20 pack-years; past and ≥20 pack-years; current and <20 pack-years; current and ≥20 pack-years), history of cardiac disease (yes or no), history of hypertension (yes or no), history of diabetes (yes or no), body mass index (in kg/m2, continuous), walking/bicycling (almost never; <20 min/d; 20–40 min/d; 40–60 min/d; >1 h/d), family history of myocardial infarction (yes or no), and consumption of alcohol (nondrinkers; and <1, 1–6, 7–14 and >14 drinks/wk) and tea (cups/d, continuous). Analyses of men and women combined also adjusted for sex. Tests for trend were conducted by modeling the median consumption of coffee in each category as a continuous variable. In addition, the continuous measure of coffee consumption (cups/d) was used to fit a restricted cubic spline model and to obtain a smooth representation of the RR as a function of coffee consumption. We used three knots to divide the continuous coffee consumption into four intervals. We performed sensitivity analyses by excluding those with a history of cardiac disease or hypertension because they might have changed their coffee consumption before baseline. Furthermore, we examined the effect of excluding coffee abstainers from the reference group or excluding AF cases diagnosed during the first two years of follow-up. We also conducted an analysis using coffee abstainers as the reference group. All statistical analyses were conducted using SAS (version 9.3; SAS Institute, Cary, NC, USA). Two-sided P values <0.05 were considered statistically significant.

Security, privacy, and personalization: Informing next-generation interaction concepts for interactive TV systems The success of the next-generation of interactive TV systems will depend on the type and form of user interaction these systems can support. New services like social TV, direct image, and data up- and download from the set-top box, connectivity of the iTV system to the PC and other mobile media devices, pose the question of how to support security, privacy, and personalization. To investigate the (sometimes nave) concepts of users of what changes an interactive TV system will bring for their living room behaviors in terms of security and privacy, and how to support these aspects regarding user interaction, we set up two ethnographic studies. Study one investigated users' assumptions and ideas on the concepts of security, privacy, and personalization in households that did currently not use interactive TV. This allowed us to understand possible problems in terms of security and privacy before the introduction of interactive TV. Study two investigated current practices and usages of media and devices, to understand what type of interaction concept would support the practices of the user best. The results show that new forms of user interaction must support personalized access to the content on the TV, that they must support security and privacy, and that they should enable new forms of connectivity for all devices used in the living room.

Lucius Octavius Lucius Octavius (c. 116 – 74 BC) was a Roman politician who was elected consul in 75 BC. Biography A member of the Plebeian gens Octavia, and the son of Gnaeus Octavius (consul 87 BC), Lucius Octavius was elected Praetor by 78 BC at the latest. He is suspected by the historian Thomas Robert Shannon Broughton to have been the author of the Formula Octaviana, a law which provided for the restoration of property and money which had been obtained by violent acts, or by threats of violence. In 75 BC, Lucius Octavius was elected consul alongside Gaius Aurelius Cotta. During the later stages of his consulate, both Lucius Octavius and his colleague were attacked by crowds along the Via Sacra while they were campaigning on behalf of Quintus Caecilius Metellus Creticus’ campaign for the praetorship. Both men had to take refuge in Lucius Octavius’ house. For his Proconsular governorship, Lucius Octavius was allotted the province of Cilicia. He arrived there in early 74 BC, but died very shortly afterwards, just as the Third Mithridatic War was beginning. His replacement as governor was the consul Lucius Licinius Lucullus.

Psychosocial impact of sickle cell disease on mothers of affected children seen at University of Ilorin Teaching Hospital, Ilorin, Nigeria. BACKGROUND Attention paid to psychological disorders of mothers or families of children suffering from sickle cell disease (SCD) in Nigeria has been inadequate. OBJECTIVE To assess the psychosocial impact of SCD on mothers of affected children and two control samples. DESIGN A cross-sectional controlled study. SETTING University of Ilorin Teaching Hospital, Ilorin, Nigeria. SUBJECTS One hundred mothers of SCD affected children (SCD children) were the study sample while the controls were made of 75 mothers of children with bronchial asthma (asthmatics) and 75 mothers of children with some acute medical illness (AMI). RESULTS The mothers of children with SCD (SCD mothers) were significantly likely to report burden in the areas of finance, time consumption and hindrance from enjoyment of live and were also more likely to over-protect their children. A total of 28% of SCD mothers were identified as probable cases with psychological problems on SRQ compared to 20% and 25% of mothers of asthmatics and AMI children respectively, this differences were, however, not statistically significant. CONCLUSION As a result of the prevalent psychosocial impact of this disease on mothers it is strongly suggested that special consideration in terms of routine psychosocial assessment and treatment be incorporated into the various levels of health care system. There is also the need to encourage the establishment of more social organisations like SCD clubs where affected families can interact and counsel one another.

Effect of sodium chloride on gentamicin accumulation by Escherichia coli: correlation with bacterial growth and viability. The kinetics of gentamicin accumulation by a sensitive strain of Escherichia coli were investigated at gentamicin concentrations from 0.02 to 200 microgram/ml. Accumulation with time shows two energy-dependent phases and is saturable. Sodium chloride delays the onset of the second more rapid energy-dependent phase and decreases the magnitude of gentamicin accumulation for incubations up to 60 minutes at all gentamicin concentrations tested. Simultaneous determinations of accumulation, cell viability, and growth inhibition indicate that antimicrobial activity is correlated with the magnitude of gentamicin accumulation. These observations suggest that altered bacterial accumulation of gentamicin explains the effect of sodium chloride on the antimicrobial activity of gentamicin.

The extent of release of encapsulated methionine in the intestine of cattle 1. Factors affecting the release of methionine from kaolin-saturated-fat capsules in the intestine of cattle were investigated. Bile and pancreatin were shown to be necessary for appreciable solution of the capsule. 2. The relationship between site of release and site of absorption was ascertained. One site was shown to be in the proximal duodenum the second longer site is in the distal duodenum and proximal jejunum. Encapsulated methionine was carried past the first absorption site. 3. The results of in vitro incubations confirmed by those of in vivo studies show that 6065% of the methionine becomes available for absorption in the intestine.

The sustainability of gender norms: women over 30 and their physical appearance on holiday Abstract The present study examines womens experiences of their physical appearance on holiday questioning whether gendered norms, focussed on the deal body, are sustainable if women are to experience fully the health and wellness benefits promised in a holiday. While the research focus on body image has most often been adolescents and young women, this study explores the experiences of midlife and older women. Employing the feminist research method, memory-work, women individually wrote memories of recent experiences of physical appearance while on holiday and discussed them in collectives. The findings suggest that while some of the older women appear to have resisted societal directives for the body by focussing on what the body could do, rather than what the body looked like, for most, the dominant image of the body was oppressive with memories of appearance related to body weight/shape and clothing. The findings suggest that women, as they age, are confronted by gender, age and health discourses which are difficult to resist. Whether or not women can challenge core societal beliefs about appearance has implications for whether they can experience the freedom and lack of constraints popularly associated with a holiday.

HONOLULU (HawaiiNewsNow) - After averaging 3.17 blocks per set last week in a 3-0 stretch for the Rainbow Warrior volleyball team, middle blocker Patrick Gasman was named the Big West Conference Defensive Player of the Week. Gasman is the second Warrior in a row to earn the weekly honor. The California native recorded a career-high eight blocks against Saint Francis in a three-set sweep last weekend, accumulating 19 blocks over nine sets of play during the road trip. 19 blocks, including a career-high 8 in a single match, to go with 3.17 digs/set and 15k on .517 hitting in a 3-0 weekend earns @HawaiiMensVB Defensive #BWCAOTW. Thanks to Gasman’s efforts on the defensive end, Hawaii is currently 8-0 on the season, marking the best start under head coach Charlie Wade and the best start to a season since 1996 when the ‘Bows began 13-0. The Warriors are back home to take on Lincoln Memorial in a two-match, non-conference series on Friday, February 15th and Sunday, February 17th at the Stan Sheriff Center.

. OBJECTIVE To investigate the effects of multi-walled carbon nanotubes (MWCNTs) with different length or chemical modification on endothelial cell activation and to explore the role of nucleotide-binding oligomerization domain-like receptor family pyrin domain containing 3 (NLRP3) inflammasome. METHODS MWCNTs were characterized by dynamic light scattering (DLS) after being suspended in culture medium. The immortalized mouse cerebral microvascular endothelial cell line b.End3 was treated with short MWCNTs (S-MWCNT, 0.5 to 2 m), long MWCNTs (L-MWCNT, 10 to 30 m) and the above long MWCNTs functionalized by carboxyl-(L-MWCNT-COOH), amino-(L-MWCNT-NH2) or hydroxyl-(L-MWCNT-OH) modification. Cytotoxicity of MWCNTs in b.End3 cells was determined by cell counting kit-8 (CCK-8) assay and lactate dehydrogenase (LDH) release assay, and non-toxic low dose was selected for subsequent experiments. Effects of all types of MWCNTs on the endothelial activation of b.End3 were determined by the measurement of vascular cell adhesion molecule-1 (VCAM-1) concentration in cell supernatant and adhesion assay of human monocytic cell line THP-1 to b.End3.To further elucidate the mechanism involved, the protein expressions of nucleotide-binding oligomerization domain-like receptor family pyrin domain containing 3(NLRP3) in cells treated with S-MWCNT, L-MWCNT and L-MWCNT-COOH were measured by Western blot. RESULTS At a higher concentration (125 g/cm2) and treated for 24 h, all types of MWCNTs significantly inhibited viability of b.End3 cells. At a sub-toxic concentration (6.25 g/cm2), all types of MWCNTs treated for 12 h significantly induced the activation of b.End3 cells, as evidenced by the elevated VCAM-1 release and THP-1 adhesion. Compared with S-MWCNT, L-MWCNT significantly promoted endothelial cell activation. L-MWCNT and L-MWCNT-COOH activated b.End3 cells to a similar extent. Furthermore, treatment with S-MWCNT, L-MWCNT and L-MWCNT-COOH increased NLRP3 expression in a time-dependent manner at 6.25 g/cm2. Compared with S-MWCNT, cells treated with L-MWCNT for 4 h and 12 h exhibited significantly increased protein expressions of NLRP3. However, no significant differences were detected in the level of NLRP3 protein in cells treated with L-MWCNT and L-MWCNT-COOH. CONCLUSION Compared with the surface chemical modification, length changes of MWCNTs exerted more influence on endothelial cell activation, which may be related to the activation of NLRP3 inflammasome. Our study contributes further understanding of the impact of MWCNTs on endothelial cells, which may have implications for the improvement of safety evaluation of MWCNTs.

The present invention relates to home network computer systems, and more particularly, but not by way of limitation, to a transmit/receive switch utilized in a 10Base-T Ethernet data communications system, that provides data communication between computers and peripherals over a two-wire medium. As more appliances and items in the home become computer controlled, and as more homes obtain multiple computer systems with associated peripherals, the importance of a home network for allowing data communications between computer systems, automated appliances, and peripherals within a home is increasing. While many high speed networking alternatives are available for businesses, which generally have a greater capability for investment in networking resources, choices for a home network are limited by practical and economic factors common to the typical household. Systems designed especially for home networking may require expensive custom hardware having marginal or negligible performance advantages giving rise to unattractive price vs. performance tradeoffs. On the other hand, the cost associated with rewiring a home to provide cable capable of carrying signals at network frequencies typical of existing network technology, such as Baseband Ethernet, using existing network hardware can be prohibitive for most households. Baseband Ethernet technology is commonly used in businesses for providing network connectivity, and has evolved into successively more robust forms over many years. One commonly used baseband Ethernet technology is know as the 10BASE-T network. The 10BASE-T network has an operating rate of 10 Mbps, is compliant with LAN 802.3 standards and specifications, and thereby provides moderate to high speed interconnectivity between many workstations and peripherals for most applications. In a conventional business LAN application, workstations and peripherals, such as printers and disk towers are wired together to allow shared access, data transfer, and communication between individual user workstations and network devices. A typical 10BASE-T network interface card (NIC) is located at each workstation and network device and accommodates two pairs of unshielded twisted-pair wire. Under the 10BASE-T standard, one twisted pair is used for data transmission and one twisted pair is used for data reception. Due to the specialized nature of the interface circuitry and the common mode noise rejecting capability of the xe2x80x9ctwistedxe2x80x9d configuration of the actual wire pair or, alternatively, the noise rejecting capability of shielded coaxial cable, relatively high data rates may be achieved. In the typical home however, existing coaxial cables for cable TV service cannot be used to transmit data because of the resulting signal interference, and twisted wires pairs are unavailable. Accordingly, high data rate networks are not possible without expensive rewiring. One solution to the home networking problem has been to use existing phone lines to transmit data. Conventional subscriber line wire pairs however, are traditionally contemplated for narrow band voice transmission in the range of 0 to 4 KHz. Physical limitations arise related to, for example, signal-to-noise ratio, which have traditionally limited the maximum frequency capable of being transmitted over normal phone lines, making it possible for only relatively low data rate signals to be transmitted. As a result of such limitations, the overall cost and complexity of bringing high data rate network communications to the home environment has typically been prohibitive, although some home network systems have been attempted. One example of a prior art home network is the TUT Systems, HR1300T. The HR1300T uses a xe2x80x9ctime modulation line codexe2x80x9d to provide an in-home network over existing phone lines with a modulation scheme providing a data rate of 1.3 Mbps. While 1.3 Mbps provides an improvement over the data rates achievable with, for example, standard modem technology, the HR1300T requires a proprietary protocol incompatible with 10Base-T Ethernet standards. Accordingly, CSMA/CD protocols cannot be implemented. Other proposed solutions to home networking include standard modem technology, digital subscriber line (XDSL) technology, and wireless technology. Standard modem technology has traditionally been limited to data speeds of 56 kbps and requires very complicated circuitry and high quality line characteristics not reliably available in a typical home. Although, xDSL technology can transmit data at a much higher rate than standard modem technology, up to 4 Mbps, the cost of implementation of xDSL is very high and requires very complicated modulation methods. High quality line characteristics, such as signal-to-noise ratio, may also be required with xDSL technology to meet theoretical objectives. Wireless solutions allow for connectivity between elements, typically using frequencies around 900 MHz, but have certain drawbacks. Since wireless portable phones and are often operated in neighboring bands there is a high likelihood of signal interference between a wireless LAN and portable phones or household devices such as, televisions, computers, garage door openers, alarm systems, and the like. Moreover, CSMA/CD protocols, essential to proper handshaking and collision avoidance between network elements, are far more difficult to implement and more unreliable in a wireless application. Without reliable compliance with CSMA/CD protocols a properly functioning, standards compliant 10Base-T network will not be possible. CSMA/CD is an acronym for xe2x80x9cCarrier Sense Multiple Access with Collision Detectionxe2x80x9d. In a CSMA/CD network, transmission channels are normally open for transmission on a continuous space available basis. Devices communicate when necessary, subject to whether the transmission media is clear, essentially xe2x80x9ccompetingxe2x80x9d for transmission time. Since Ethernet protocols are largely packet based, and packets are generally designed to be relatively small (1Kbyte), a given device is not expected to occupy a channel for an inordinate amount of time. It is still possible, due for example to propagation delay, for collisions to occur even though the protocol is designed to avoid collisions. A conventional four wire 10Base-T Ethernet network with CSMA/CD typically avoids collisions by sensing the presence of a signal on the receive pair at the network interface controller (NIC) and inhibiting transmissions initiated by the NIC over the transmit pair during such intervals. If a collision occurs, an Ethernet compliant network device immediately stops the transmission of a frame as soon as a collision has been detected. By stopping the transmission, greater efficiency is achieved. To recover from the collision, the network device waits an interval then retransmits. If a collision occurs on the second attempt, the device waits for a longer interval before retransmitting. The process of waiting for progressively longer intervals is called xe2x80x9cbackoff.xe2x80x9d Each time the device senses a collision on a subsequent transmit attempt, the time between making a transmission attempt will be increased by a small constant factor, leading to xe2x80x9cexponential backoff.xe2x80x9d After a limit is reached, data is simply lost. Because, a typical Ethernet NIC has four wires, a two wire transmit pair and a two wire receive pair which are wired at all times to the network, the CSMA/CD protocol is active at all times. A problem arises however in the home network environment where only a single pair of wires is available. In such an environment, CSMA/CD has not been possible since only one of the two pairs may be connected to the two wire phone line at one time. Therefore, as can be appreciated, there is a need to provide a CSMA/CD compliant home network that is easy-to-install-and-use, that is available at a low cost, and that can provide high data rates while taking advantage of existing two wire phone lines. The present invention overcomes the above identified problems as well as other shortcomings and deficiencies of existing technologies by providing CSMA/CD compliant 10Base-T Ethernet data communications over an ordinary two wire phone line. An apparatus and method for practicing thereupon include a transmit/receive switch coupled between a network interface controller (NIC), having a transmit and receive wire pair, and a two wire medium such as a residential phone line. The transmit/receive switch, in the default position, may be set to normally receive. The NIC senses receive energy originating from the two wire media through the connection provided by the transmit/receive switch, in the default position, between the switch common and the receive wire pair. When receive energy is no longer sensed at the NIC, a transmit signal may be generated by the NIC, placed on the transmit wire pair and sensed by a carrier sensor having a control logic unit. In response to detecting transmit signal energy, carrier sense/control logic unit changes the transmit/receive switch to transmit position and transmit data may be coupled through the switch to the two wire medium. Upon completion of data transmission, the carrier sensor/control logic unit returns the transmit/receive switch to the receive position in order to resume carrier sensing in accordance with CSMA/CD protocol specifications on the two wire medium.

What project or projects do you maintain and what was your motivation for creating those projects and releasing them as open source software? All of my personal work is open source, but the main one that I actively (try to) keep up and is used by some people are Git-it and its related repos. I have an older project, Sheetsee.js, that I’m planning on diving back into and revamping after a long hiatus. If you created any of those projects, were they meant to solve a specific problem you faced, or were they born out of a larger opportunity you saw? Some of my smaller tools, like for turning a spreadsheet into a markdown table or viewing GitHub issues offline, came to be because I faced that problem. But the bigger ones, I’ve created because I saw a need. Sheetsee.js started because I believed we could make better use of free resources in order to make having a website with data more accessible. I think an underlying goal of mine is to demystify and bring barriers down to using or understanding technology. I think great and interesting things (or movements!) could come about if more people could collect and present data. There is a huge middle-ground of projects that don’t need traditional databases but there’s still a huge hurdle for new or non-developers to get started. I started Git-it because I felt like there weren’t a lot of great tools for leaning Git and GitHub. Especially ones that included the greatest part of GitHub—collaborating. Git-it is a desktop app that walks you through using Git locally, then remotely with GitHub and with a collaborator—a robot, @reporobot, that writes to your project and reviews (and comments on) your pull request. It also teaches you terminal and doesn’t use an emulator, it’s real Git and GitHub. How has the project evolved since you first got involved or first released it? Sheetsee.js started out as a bit of JavaScript inside of Wordpress templates. This was a part of my Code for America fellowship project for visualizing city budgets. After that I received a Code Sprint grant from Knight-Mozilla OpenNews to build it out into its own library. I basically learned JavaScript by writing a library, which is a little bananas, and why I want to go back and re-do it all in the next month :) Git-it used to be an application that ran in terminal, like the rest of the NodeSchool lessons. But a challenge that kept coming up is, unlike those doing the other NodeSchool lessons, those doing Git-it didn’t have the primary objective of learning Node. So it was a hurdle to have to explain and have folks install Node in order to use Git-it (and to debug installations across different machines). I eventually switched Git-it over to be an Electron.js app, which is fantastic. Now it can be more visual and users don’t have to install Node, they just download an application, a process they’re likely to be more familiar with. How do you spend your time on those projects? (i.e. Developing, managing the community, triaging issues, etc.) Because these projects are mostly maintained by me alone my work on them can be sporadic. There was a long period where I tried to work on something everyday but along with also working and having other life goals I got really worn out, so I took a break. I also switched teams at work and was able to work on open source there, which was fantastic. I started the Electron.js team while I was at GitHub and that project involved much more issue triaging and community work on top of developing. It’s got a great and active community. How would you describe the community around projects you participate in? What are your favorite and least favorite aspects? I’ve had great experiences with the Node and JS communities. Though, my least favorite parts are the bickering and tear-downs and other negative things people tend to quarrel over. Early on, I definitely was very defensive of my chosen language but have since had a coming-of-age and realize how ridiculous this kind of tribalism is. What keeps you involved in those projects? Do you have long term plans for maintaining your involvement? I stay involved because I still believe they are helping at least a few people. I also get massive amounts of self-inflicted guilt about working on them. I don’t really have long term plans, it would be great if they were a part of my job somehow, but that seems like a pipe dream! What is the most important thing someone submitting an issue or patch should know? Please fill out a description! No matter how trivial! Please! It saves time for the person reviewing; they don’t have to read your code to read your mind and it’s helpful for those learning and reading old issues/pull requests. Please write a description! And if you’re feeling extra generous some before and after screenshots are wonderful! Gifs are great! What’s your development environment right now? I have a 12” MacBook for general internet things and writing code that I can travel with and take to coffee shops. I have a iMac desktop at home, however, so I can do things in Illustrator, look at pictures really large and crisply and have a screen full of code. Sometimes having two machines is cumbersome, but I’ve mostly got it down now. What was your first development environment? Do you miss anything from it? My first setup was similar except that I just did it all on one 13” Macbook Air. I don’t miss it, it was before retina :) Where do you see the open source software community headed? I have no clue — anything can happen. I’d love to see open source get more financial support. A lot of people put a lot of free time into work used by so many. Also, the lack of financial security in open source makes it an impossible choice for many marginalized groups. The larger and more mixed the group of people sharing knowledge in the open, the better.

Cooperative System and Scheduling Algorithm for Sustainable Energy-Efficient Communities The High connectivity among devices within the Internet-of-Things facilitates two-way flow of information throughout the infrastructure reaching homes and the consumers targeting broader energy goals. Our proposal encompasses consumers cooperating in response to utility supply conditions, i.e., electricity available from renewable sources. Such a smart and green community of consumers autonomously adapts its energy consumption by enabling a local aggregator to integrate their demand into a common view and, re-schedule the community demand given the renewable energy supply and the consumers demand time preferences. In this paper, we evaluate the developed scheduling algorithm using benchmark data to validate our proposal implementation over existent technology. Introduction Information and communication technologies (ICT) are essential tools for enabling energy efficiency as well as establishing new energy services and solutions. In particular, the Internet of Things (IoT) and the Smart Grid together can provide the foundational infrastructure and use of advanced information, control and communication technologies to save energy, reduce cost and increase reliability and transparency. Connected devices (e.g, household items, machines, or gadgets) can automatically influence each other so increasing the overall potential for energy savings and the range of management systems' involvement. ICT can also play an important role in shaping consumer behaviour. Furthermore, the real exploitation of renewable sources for energy supply presents multiple challenges not only for utilities, grid and system operators, but also for the consumers who do not see this type of information on their utility bills. Demand response (DR) programmes appear to bolster not only energy efficiency but also renewable energy resource management initiatives as to handle their sophisticated planning and operation scheduling requirements. In this short paper, we present a cooperative DR system model which is designed to promote behavioural changes in small or large communities of electricity consumers. The community will target common interests (i.e., to be green) that create the need for involved entities to reach binding agreements and coordinated behaviour. We implement and analyse the resource (i.e., the renewable supply) allocation process, initially conceived in a centralised way by means of a data collector called the Aggregator. This entity provides the community with the scheduling of the total demand taking into account both the renewable supply available from the local utility providers and the costumers' consumption time preferences. Experimentation with estimated values and benchmarks throws feasible performance cost that validates the viability of the system implementation over existent technology (i.e., Z-Wave or IEEE 802.11i standards). Figure 1 illustrates the main roles and processes within the adopted cooperative demand response framework. In our proposal, Consumers adapt their energy consumption cooperatively on a centralised way; that is, they share their demand schedule with a data collector called Aggregator. The Aggregator facilitates the integration of the energy consumption information and implements an optimised resource allocation algorithm in response to the Utility's supply conditions, in particular, targeting renewable sources. Fig. 1. A user (or household) equipped with an energy consumption scheduler or home energy manager on a portable device (i.e., an app on a smartphone or tablet) that is connected to a communication network. A community consists of a set of Consumers sharing electricity supplier or substation. Consumer System Design Let N denote an ordered set of Consumers that are willing to cooperate in the pursuit of global community targets (i.e., become greener), sending their data to the Aggregator. Each Consumer i ∈ N has a set of household appliances Ai = {washer, dryer, coffee makers, cooker, fridge, TV, alarm, light controller, water heating, AC system,...}. Each consumer then pre-allocates 1 a certain amount of fixed demand 2 as well as variable consumption resulting from their utilisation planned for the upcoming 24 h. The daily fixed demand for con- i,a ij as the aggregated load of non-shiftable local consumption of the appliances and frequent behaviours. Variable energy demand is considered flexible since consumer preference for an appliance to start within a particular time interval is also taken into account. For each appliance, there is a execution window (i.e., a closed interval) denoting a minimal starting time and a maximal ending time. In other words, Consumer i will keep/set the following data for his/her appliance a ij ∈ A i as in Table 1. Aggregator System Design A centralised system with aggregation tasks communicates with the Utility as well as with the Consumers as shown in Fig. 1. An algorithm is originally built to optimise the allocation of the expected electricity supply from renewables amongst the community's Consumers and according to the their expressed preferences. We denote by RW t the energy supply generated from a set of renewable sources at a time slot t ∈ {0,..., 23}. The Aggregator can easily compute the daily fixed demand for the whole community of consumers at a time t t=0 RW t. By contrast, aggregation of the variable consumption is an optimisation problem given the consumers' time preferences. 1 We consider a discrete time slot system, which granularity is one hour of the day. We have developed an energy consumption scheduling app (or home energy manager) that connects via a home area network (HAN) and/or lower power wireless such as ZigBee, with all the appliances at home and the Aggregator. The app provides the Consumer with an interface to control, monitor, visualise and program the functioning of appliances. 2 Formulae and benchmarks can be used to estimate appliance and home electronic energy use in kilowatt hours (kWh) as well as household local records. Algorithm 1. Demand Calculation Function (DCF) 1: for iappliance 1 to size of appliances configuration (Ai) do 2: The Aggregator will execute a scheduling of the community's requested variable demand per hour vD t i when the aforementioned worst case does not apply, and aiming at ∀t ∈ {0,..., We face here a global centralised optimisation problem to which there exists a unique Nash bargaining solution such that: where F () 3 is in charge of shifting the variable demand given Consumers' appliance preferred activation time. Algorithm 1 displays a round-robin strategy over the matrix of all appliances' operation preferences and the remnant of the RW supply vector after deducting the total fixed demand (Algorithm 1 -lines 1-3). Upon reaching the optimisation objective, the Aggregator will notify the community that an agreement has been reached and privately release the reallocated demand vector − → i, ∀i ∈ N. Algorithm Validation We evaluate the performance of Algorithm 1 with simulated 4 data of consumers' fixed and variable consumption demands at different case scenarios for appliances' fixed and variable consumption, i.e., Case 1 for high consumptions, Case 2 for high fixed expends, Case 3 when variable is high and, Case 4 for low consumption communities. Figure 2 illustrates the reallocation processing cost of communities with up to 60 consumers with up to 4 appliances, which is taking 3 min in the worst case. In fact, worst case occurs when appliances demand high variable consumption (Cases 1 and 3) and the algorithm performs a random strategy. On the other hand, we found that the factor incurring the highest performance cost on our algorithm is consumers holding a different number of appliances to schedule; 6 min in the worst case (triangle-up line in Fig. 2) and applying a sequence with the first player being the same every time. Figure 3 throws best outcomes over communities with low variable demand and the same number of appliances per consumer. Conclusions Smart communities, capable of identifying patterns in energy consumption, will be able to reduce or shift their use of the utility resource, making the overall consumption more sustainable and efficient. Unlike the majority of previous Demand Response strategies that focus on pricing and aim at reducing the energy cost and the peak-to-average ratio, our solution tends to promote a transformation of the whole energy value chain by making consumer communities cooperate targeting the available renewable energy supply. In this paper, we have shown the performance cost of a centralised scheduling algorithm (less than 1 min cost) for different size of communities and consumption patterns. Immediate future work relates to the algorithm testing with real traces from the Birmingham Living Lab and the real implementation of both algorithm and home controllers on a pilot testbed, paying special attention to the system and network security.