text1
stringlengths 11
17.4k
| text2
stringlengths 11
8.2k
| label
class label 2
classes |
|---|---|---|
Botulinum toxin B, or Myobloc, has been approved by the US Food and Drug Administration to treat cervical dystonia due to level A evidential support by the scientific community. Surgery known as GPi DBS (Globus Pallidus Pars Interna Deep Brain Stimulation) has come to be popular in treating phasic forms of dystonia, although cases involving posturing and tonic contractions have improved to a lesser extent with this surgery. A follow-up study has found that movement score improvements observed one year after the surgery was maintained after three years in 58% of the cases. It has also been proven effective in treating cervical and cranial-cervical dystonia. Tics
Treatment of tics present in conditions such as Tourettes syndrome begins with patient, relative, teacher and peer education about the presentation of the tics. Sometimes, pharmacological treatment is unnecessary and tics can be reduced by behavioral therapy such as habit-reversal therapy and/or counseling. Often this route of treatment is difficult because it depends most heavily on patient compliance. Once pharmacological treatment is deemed most appropriate, lowest effective doses should be given first with gradual increases. The most effective drugs belong to the neuroleptic variety such as monoamine-depleting drugs and dopamine receptor-blocking drugs. Of the monoamine-depleting drugs, tetrabenazine is most powerful against tics and results in fewest side effects. A non-neuroleptic drug found to be safe and effective in treating tics is topiramate. | A trichodiscoma is a cutaneous condition, a benign, usually skin-colored tumor most often affecting the face and upper trunk. : 674
See also
Birt–Hogg–Dubé syndrome
Fibrofolliculoma
List of cutaneous conditions
List of cutaneous neoplasms associated with systemic syndromes
References
== External links == | 0-1
|
Such as t(8;21), t(15;17), del(6q), del(12p), t(x;12) and t(14;19). In BAL patients, it is prone to bruising, spotting, which is due to megakaryocytes that could produce platelets decrease, resulting in a lack of platelets. Anemia: reduction metrocytes that could produce red blood cells, resulting in a lack of red blood cells. Patients are prone to asthma and dizziness in walking or exercise. Persistent fever, infection prolonged healing: Most of the white blood cells are leukemia cells, no normal function, leading to decreased immunity, susceptible to infection. Diagnosis
Following observation of the symptoms, the patients need to get complete blood counts and a bone marrow examination. If the patient has leukemia, the morphology and immunophenotype check is needed to make sure the type of leukemia. The morphology of the blast in BAL is not certain. The cells could display both myeloid lineage and lymphoid or undifferentiated morphology. Therefore, the diagnosis cannot based on the morphology result. The immunophenotype check is the most important basis of the diagnosis of BAL. Before 2008, the diagnosis of BAL was based on a score system proposed by the European Group for the Immunological Classification of Leukemias (EGIL) which could differentiate from other kinds of acute leukemia. The table shows this method. If the score of only one lineage is higher than 2, the acute leukemia could be acute myeloid leukemia (AML) or acute lymphoblastic leukemia (ALL). | Some of the rarer auto-antibodies (e.g., NMDAR) have no commercially available assay and can only be measured by a very small number of research laboratories worldwide, further delaying diagnosis by weeks or months. Most patients with limbic encephalitis are initially diagnosed with herpes simplex encephalitis, because the two syndromes cannot be distinguished clinically. HHV-6 (human herpes virus 6) encephalitis is also clinically indistinguishable from limbic encephalitis.There are two sets of diagnostic criteria used. The oldest are those proposed by Gultekin et al. in 2000. A revised set of criteria were proposed by Graus and Saiz in 2005. The main distinction between the two sets of criteria is whether or not the detection of a paraneoplastic antibody is needed for diagnosis. Antibodies against intracellular neuronal antigens
The main antibodies within this group are those against Hu, Ma2, CV2, amphiphysin and Ri. The syndrome of anti-Ma2 encephalitis may be clinically mistaken for Whipples disease. Antibodies against cell membrane antigens
The main antibodies within this group are those against N-methyl-D-aspartate receptors (NMDAR) and the voltage-gated potassium channel-complex (VGKC-complex). Anti-NMDAR encephalitis is strongly associated with benign tumours of the ovary (usually teratomata or dermoid cysts). Anti-VGKC-complex encephalitis is most often not associated with tumours.Patients with NMDAR encephalitis are frequently young women who present with fever, headache and fatigue. This is often misdiagnosed as influenza, but progresses to severe behavioural and personality disturbance, delusions, paranoia and hallucinations. Patients may therefore initially be admitted to a psychiatric ward for acute psychosis or schizophrenia. The disease then progresses to catatonia, seizures and loss of consciousness. | 0-1
|
Sturge–Weber syndrome, sometimes referred to as encephalotrigeminal angiomatosis, is a rare congenital neurological and skin disorder. It is one of the phakomatoses and is often associated with port-wine stains of the face, glaucoma, seizures, intellectual disability, and ipsilateral leptomeningeal angioma (cerebral malformations and tumors). Sturge–Weber syndrome can be classified into three different types. Type 1 includes facial and leptomeningeal angiomas as well as the possibility of glaucoma or choroidal lesions. Normally, only one side of the brain is affected. This type is the most common. Type 2 involvement includes a facial angioma (port wine stain) with a possibility of glaucoma developing. There is no evidence of brain involvement. Symptoms can show at any time beyond the initial diagnosis of the facial angioma. The symptoms can include glaucoma, cerebral blood flow abnormalities and headaches. More research is needed on this type of Sturge–Weber syndrome. Type 3 has leptomeningeal angioma involvement exclusively. The facial angioma is absent and glaucoma rarely occurs. This type is only diagnosed via brain scan.Sturge–Weber is an embryonal developmental anomaly resulting from errors in mesodermal and ectodermal development. Unlike other neurocutaneous disorders (phakomatoses), Sturge–Weber occurs sporadically (i.e., does not have a hereditary cause). It is caused by a mosaic, somatic activating mutation occurring in the GNAQ gene. Imaging findings may include tram track calcifications on CT, pial angiomatosis, and hemicerebral atrophy. Signs and symptoms
Sturge–Weber syndrome is usually manifested at birth by a port-wine stain on the forehead and upper eyelid of one side of the face, or the whole face. | The birthmark can vary in color from light pink to deep purple and is caused by an overabundance of capillaries around the ophthalmic branch of the trigeminal nerve, just under the surface of the face. There is also malformation of blood vessels in the pia mater overlying the brain on the same side of the head as the birthmark. This causes calcification of tissue and loss of nerve cells in the cerebral cortex.Neurological signs include seizures that begin in infancy and may worsen with age. Convulsions usually happen on the side of the body opposite the birthmark, and vary in severity. There may also be muscle weakness on the side of the body opposite the birthmark.Some children will have developmental delays and cognitive delays; about 50% will have glaucoma (optic neuropathy often associated with increased intraocular pressure), which can be present at birth or develop later. Glaucoma can be expressed as leukocoria, which should suggest further evaluation for retinoblastoma. Increased pressure within the eye can cause the eyeball to enlarge and bulge out of its socket (buphthalmos).Sturge–Weber syndrome rarely affects other body organs. Cause
The blood vessel formations associated with SWS start in the fetal stage. Around the sixth week of development, a network of nerves develops around the area that will become a babys head. Normally, this network goes away in the ninth week of development. In babies with SWS due to mutation of gene GNAQ, this network of nerves doesnt go away. | 11
|
Antibodies against CD3 have been shown to delay the development of type 1 diabetes in those at high risk; however, they have not been widely adopted due to concerns over the duration of their effect, and activation of Epstein-Barr virus infections in those undergoing treatment.Vitamin D supplementation may help with preventing type one diabetes. This is believed to be the case due to vitamin D receptors affecting the B-cells involved in promoting pancreatic homeostasis.Vaccines are being looked at to treat or prevent type 1 diabetes by inducing immune tolerance to insulin or pancreatic beta cells. While Phase II clinical trials of a vaccine containing alum and recombinant GAD65, an autoantigen involved in type 1 diabetes, were promising, as of 2014 Phase III had failed. As of 2014, other approaches, such as a DNA vaccine encoding proinsulin and a peptide fragment of insulin, were in early clinical development. Organ replacement
Pluripotent stem cells can be used to generate beta cells but previously these cells did not function as well as normal beta cells. In 2014 more mature beta cells were produced which released insulin in response to blood sugar when transplanted into mice. Before these techniques can be used in humans more evidence of safety and effectiveness is needed.There has also been substantial effort to develop a fully automated insulin delivery system or "artificial pancreas" that could sense glucose levels and inject appropriate insulin without conscious input from the user. | Bleeding disorder
Women with a bleeding disorder may be prone to more excessive bleeding. A hematologic work-up should discover the cause. Other
On occasion an ovarian cyst can rupture and give rise to internal hemorrhage. This may occur during ovulation or as a result of endometriosis. If the pregnancy test is positive, consider pregnancy related bleeding (see obstetrical hemorrhage), including miscarriage and ectopic pregnancy. Diagnosis
A history will establish if the condition is acute or chronic, and if external circumstances are involved. A gynecologic examination is usually complemented by a gynecologic ultrasonography. A blood count determines the degree of anemia and may point out bleeding problems. The pregnancy test is important, particularly as bleeding in early pregnancy presents as gynecological hemorrhage and ectopic pregnancy can be fatal. Diagnosis is broadly classified into supportive and definitive investigations:
Supportive
Complete blood count to assess degree of anemia. Ultrasonography to rule out uterine lesions, PID. Definitive
Pregnancy test for those who are not yet post menopausal mandatory. Speculum examination to take samples for pap smear. Dilation and curettage to get samples for histology and also control the bleeding if associated with abortion. Colposcopy. Definition
Menstruation occurs typically monthly, lasts 3–7 days, and involves up to 80 ml blood. Bleeding in excess of this norm in a nonpregnant woman constitutes gynecologic hemorrhage. In addition, early pregnancy bleeding has sometimes been included as gynecologic hemorrhage, namely bleeding from a miscarriage or an ectopic pregnancy, while it actually represents obstetrical bleeding. However, from a practical view, early pregnancy bleeding is usually handled like a gynecological hemorrhage. | 0-1
|
If the person wishes to conserve the ability to breastfeed and only single-duct discharge is present, then ductoscopy or galactography should be considered in view of performing a localised duct excision. Epidemiology
Nipple discharge is the third most common breast complaint by women, after breast pain and a breast lump. 10% of women can notice a nipple discharge when squeezing their breast and more than 50% of women can experience this using a breast pump.Most abnormal nipple discharge is not associated with breast cancer, but 1-5% of breast cancers present with nipple discharge. References
== External links == | Trismus, commonly called lockjaw as associated with tetanus, is a condition of limited jaw mobility. It may be caused by spasm of the muscles of mastication or a variety of other causes. Temporary trismus occurs much more frequently than permanent trismus. It is known to interfere with eating, speaking, and maintaining proper oral hygiene. This interference, specifically with an inability to swallow properly, results in an increased risk of aspiration. In some instances, trismus presents with altered facial appearance. The condition may be distressing and painful. Examination and treatments requiring access to the oral cavity can be limited, or in some cases impossible, due to the nature of the condition itself. Definition
Trismus is defined as painful restriction in opening the mouth due to a muscle spasm, however it can also refer to limited mouth opening of any cause. Another definition of trismus is simply a limitation of movement. Historically and commonly, the term lockjaw was sometimes used as a synonym for both trismus and tetanus.Normal mouth-opening ranges from 35 to 45 mm. Males usually have slightly greater mouth opening than females. (40–60 mm, average of 50 mm). The normal lateral movement is 8–12 mm, and normal protrusive movement is approximately 10 mm. Some have distinguished mild trismus as 20–30 mm interincisal opening, moderate as 10–20 mm and severe as less than 10 mm.Trismus is derived from the Greek word trigmos/trismos meaning "a scream; a grinding, rasping or gnashing". | 0-1
|
Prevention
Early childhood caries can be prevented through the combination of the following: adhering to a healthy nutritional diet, optimal plaque removal, use of fluoridation on the tooth surface once erupted, care taken by the mother during the pre-natal and peri-natal period and regular dental visits. The following are recommendations to help prevent ECC. Adequate diet
Dietary habits and the presence of cariogenic bacteria within the oral cavity are an important factor in the risk of ECC. ECC is commonly caused by bottle feeding, frequent snacking and a high sugar diet
In regards to preventing ECC through bottle feeding, it is fundamental not to allow the child to sleep using ‘sippy cups’ or bottles as this is a large factor contributing to baby bottle decay/caries. This is highly encouraged as it prevents continuous exposure to non-milk extrinsic sugars and therefore the potential progression of caries – this means the oral cavity can return to a neutral pH and therefore decreased acidity. These researches also suggest trying to introduce cups to children as they approach their first birthday and to reduce the use of a bottle. A low-sugar and high nutritional diet is recommended for both the mother and the child especially during breastfeeding, and it is also recommended to avoid frequent snackingA 2019 Cochrane review concluded that there is a 15% drop in risk of developing ECC, when mother with infants or pregnant women were given advice on a healthy child diet and feeding practices. Consequently, resulting in less decay for the child. | Despite the potential for filling failure, ART is still recommended for children when access to electricity, drills, dentists, or other dental resources are limited. References
16.Maternal Perception about Early Childhood Caries in Nigeria in Kalipeni, E.; Iwelunmor, J.; Grigsby-Toussaint, D.; and Moise, I. K. (eds.) (In Press, June 2018). Public Health, Disease and Development in Africa. London: Routledge Publishers. External links
American Academy of Pediatric Dentistry
American Dental Association ADA page on early childhood tooth decay
Columbia Center Comparison of Dental Surgery versus Caries Suppression with other treatments
Childrens Dental Health Project | 11
|
MRI
MRI is a newer technique used to diagnose spondylolysis and is favorable for a few reasons. The MRI is much more accurate than the x-ray and also does not use radiation. The MRI uses powerful magnets and radio frequencies to produce very detailed images of many different densities of tissue including bone and soft tissues. Treatment
Conservative management
Treatment for spondylolysis ranges from bracing, activity restriction, extension exercises, flexion exercises and deep abdominal strengthening, that is administered through physical therapy. The duration of physical therapy a patient receives varies upon the severity of spondylolysis, however typically ranges from three to six months. The goal of physical therapy is to minimize movement at the unstable defect of the pars interarticularis. Once a patient completes physical therapy, and displays no symptoms or inflammation in the lower back, they are cleared to continue with daily or athletic activities. However, a patient may need to maintain a variety of rehabilitation techniques after physical therapy to prevent the recurrence of spondylolysis. Deep abdominal co-contraction exercises
The aim of deep abdominal co-contraction exercises is to train muscles surrounding the lumbar spine which provide stability of the spine. Spondylolysis results in a spinal instability and disrupts patterns of co-recruitment between muscle synergies. Specifically, local muscles that attach directly to the spine are affected. The lumbar multifidus and transversus abdominis play a direct role in stabilizing the lumbar spine. Instead the local muscles in individuals with spondylolysis are vulnerable to dysfunction, which results in abnormal spinal stability causing chronic low back pain. | The tension is released, by contraction of the ciliary muscle, to allow the lens to become more round, for close vision. This implies the ciliary muscle, which is outside the zonula, must be circumferential, contracting like a sphincter, to slacken the tension of the zonula pulling outwards on the lens. This is consistent with the fact that our eyes seem to be in the relaxed state when focusing at infinity, and also explains why no amount of effort seems to enable a myopic person to see farther away. The ability to focus on near objects declines throughout life, from an accommodation of about 20 dioptres (ability to focus at 50 mm away) in a child, to 10 dioptres at age 25 (100 mm), and levels off at 0.5 to 1 dioptre at age 60 (ability to focus down to 1–2 meters only). The expected, maximum, and minimum amplitudes of accommodation in diopters (D) for a corrected patient of a given age can be estimated using Hofstetters formulas: expected amplitude (D) = 18.5 - 0.3 × (age in years), maximum amplitude (D) = 25 - 0.4 × (age in years), minimum amplitude (D) = 15 - 0.25 × (age in years). Diagnosis
Treatment
In the visual system, images captured by the eye are translated into electric signals that are transmitted to the brain where they are interpreted. As such, in order to overcome presbyopia, two main components of the visual system can be addressed: image capturing by the optical system of the eye and image processing in the brain. | 0-1
|
Withdrawal symptoms include headaches, anxiety, tension, depression, insomnia, restlessness, confusion, irritability, sweating, dysphoria, dizziness, derealization, depersonalization, numbness/tingling of extremities, hypersensitivity to light, sound, and smell, perceptual distortions, nausea, vomiting, diarrhea, appetite loss, hallucinations, delirium, seizures, tremor, stomach cramps, myalgia, agitation, palpitations, tachycardia, panic attacks, short-term memory loss, and hyperthermia. It takes about 18–36 hours for the benzodiazepine to be removed from the body. The ease of physical dependence to lorazepam, (Ativan brand was particularly cited), and its withdrawal were brought to the attention of the British public during the early 1980s in Esther Rantzens BBC TV series Thats Life!, in a feature on the drug over a number of episodes. Interactions
Lorazepam is not usually fatal in overdose, but may cause respiratory depression if taken in overdose with alcohol. The combination also causes greater enhancement of the disinhibitory and amnesic effects of both drugs, with potentially embarrassing or criminal consequences. Some experts advise that people should be warned against drinking alcohol while on lorazepam treatment, but such clear warnings are not universal.Greater adverse effects may also occur when lorazepam is used with other drugs, such as opioids or other hypnotics. Lorazepam may also interact with rifabutin. Valproate inhibits the metabolism of lorazepam, whereas carbamazepine, lamotrigine, phenobarbital, phenytoin, and rifampin increase its rate of metabolism. Some antidepressants, antiepileptic drugs such as phenobarbital, phenytoin and carbamazepine, sedative antihistamines, opiates, antipsychotics and alcohol, when taken with lorazepam may result in enhanced sedative effects. | Lorazepam, sold under the brand name Ativan among others, is a benzodiazepine medication. It is used to treat anxiety disorders, trouble sleeping, severe agitation, active seizures including status epilepticus, alcohol withdrawal, and chemotherapy-induced nausea and vomiting. It is also used during surgery to interfere with memory formation and to sedate those who are being mechanically ventilated. It is also used, along with other treatments, for acute coronary syndrome due to cocaine use. It can be given by mouth or as an injection into a muscle or vein. When given by injection onset of effects is between one and thirty minutes and effects last for up to a day.Common side effects include weakness, sleepiness, low blood pressure, and a decreased effort to breathe. When given intravenously the person should be closely monitored. Among those who are depressed there may be an increased risk of suicide. With long-term use, larger doses may be required for the same effect. Physical dependence and psychological dependence may also occur. If stopped suddenly after long-term use, benzodiazepine withdrawal syndrome may occur. Older people more often develop adverse effects. In this age group lorazepam is associated with falls and hip fractures. Due to these concerns, lorazepam use is generally only recommended for up to two to four weeks.Lorazepam was initially patented in 1963 and went on sale in the United States in 1977. It is on the World Health Organizations List of Essential Medicines. It is available as a generic medication. | 11
|
Effect on life expectancy
In 1999, Dr. Susan Barrow of the Columbia University Center for Homelessness Prevention Studies reported in a study that the "age-adjusted death rates of homeless men and women were four times those of the general U.S. population and two to three times those of the general population of New York City". A report commissioned by homeless charity Crisis in 2011 found that on average, homeless people in the UK have a life expectancy of 47 years, 30 years younger than the rest of the population. Health impacts of extreme weather events
People experiencing homelessness are at a significant increased risk to the effects of extreme weather events. Such weather events include extreme heat and cold, floods, storm surges, heavy rain, and droughts. While there are many contributing factors to these events, climate change is driving an increasing frequency and intensity of these events. The homeless population is considerably more vulnerable to these weather events, due to their higher rates of chronic disease, and lower socioeconomic status. Despite having a minimal carbon footprint, homeless people unfortunately experience a disproportionate burden of the effects of climate change.Homeless persons have increased vulnerability to extreme weather events for many reasons. They are disadvantaged in most social determinants of health, including lack of housing and access to adequate food and water, reduced access to health care, and difficulty in maintaining health care. They have significantly higher rates of chronic disease including respiratory disease and infections, gastrointestinal disease, musculoskeletal problems and mental health disease. | Oritavancin, sold under the brand name Orbactiv among others, is a semisynthetic glycopeptide antibiotic medication for the treatment of serious Gram-positive bacterial infections. Its chemical structure as a lipoglycopeptide is similar to vancomycin.The U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) have approved oritavancin for treatment of acute bacterial skin and skin structure infections. In vitro activity
Oritavancin shares certain properties with other members of the glycopeptide class of antibiotics, which includes vancomycin, the current standard of care for serious Gram-positive infections in the United States and Europe. It possesses potent and rapid bactericidal activity in vitro against a broad spectrum of both resistant and susceptible Gram-positive bacteria, including Staphylococcus aureus, MRSA, enterococci, and streptococci. Oritavancin was more active than either metronidazole or vancomycin against strains of Clostridium difficile tested.Oritavancin has potential use as a therapy for exposure to Bacillus anthracis, the Gram-positive bacterium that causes anthrax, having demonstrated efficacy in a mouse model both before and after exposure to the bacterium.oritavancin demonstrates in vitro activity against both the planktonic and biofilmstates of staphylococci associated with Prosthetic joint infection (PJI), albeit with increased minimum biofilm bactericidal concentration (MBBC) compared to Minimum inhibitory concentrations (MIC) values. Moreever oritavancin has demonstrated activity against in vitro to vancomycin-susceptible enterococci (VSE) and vancomycin-resistant enterococci (VRE) in both planktonic and biofilm states. Mechanism
The 4-chlorobiphenylmethyl group disrupts the cell membrane of Gram-positive bacteria. It also acts by inhibition of transglycosylation and inhibition of transpeptidation. Synergism
Several antibiotics have been tested as partner drugs of oritavancin. | 0-1
|
The use of a flexible IOL enables the lens to be rolled for insertion into the capsular bag through a very small incision, thus avoiding the need for stitches. This procedure usually takes less than 30 minutes in the hands of an experienced ophthalmologist, and the recovery period is about 2–3 weeks. After surgery, patients should avoid strenuous exercise or anything else that significantly increases blood pressure. They should visit their ophthalmologists regularly for 3 weeks to monitor the implants. IOL implantation carries several risks associated with eye surgeries, such as infection, loosening of the lens, lens rotation, inflammation and nighttime halos, but a systematic review of studies has determined that the procedure is safer than conventional laser eye treatment. Though IOLs enable many patients to have reduced dependence on glasses, most patients still rely on glasses for certain activities, such as reading. These reading glasses may be avoided if Multifocal IOLs, Trifocal IOLs or EDOF lenses are used. Medical uses
Intraocular lenses have been used since 1999 for correcting larger errors in near-sighted, far-sighted, and astigmatic eyes. This type of IOL is also called phakic intraocular lens (PIOL), as it is implanted without removing the patients natural crystalline lens.Phakic IOL appear to be less dangerous than excimer laser surgery (LASIK) in those with significant nearsightedness.More commonly IOLs are implanted via Clear Lens Extraction And Replacement (CLEAR) surgery. | Diagnosis
Ganglioneuromas can be diagnosed visually by a CT scan, MRI scan, or an ultrasound of the head, abdomen, or pelvis. Blood and urine tests may be done to determine if the tumor is secreting hormones or other circulating chemicals. A biopsy of the tumor may be required to confirm the diagnosis. Treatment
Because ganglioneuromas are benign, treatment may not be necessary, as it would expose patients to more risk than leaving it alone.If there are symptoms or major physical deformity, treatment usually consists of surgery to remove the tumor. Prognosis
Most ganglioneuromas are noncancerous, thus expected outcome is usually good. However, a ganglioneuroma may become cancerous and spread to other areas, or it may regrow after removal.If the tumor has been present for a long time and has pressed on the spinal cord or caused other symptoms, it may have caused irreversible damage that cannot be corrected with the surgical removal of the tumor. Compression of the spinal cord may result in paralysis, especially if the cause is not detected promptly. References
== External links == | 0-1
|
In excess, it both overstimulates metabolism and disrupts the normal functioning of sympathetic nervous system, causing "speeding up" of various body systems and symptoms resembling an overdose of epinephrine (adrenaline). These include fast heartbeat and symptoms of palpitations, nervous system tremor such as of the hands and anxiety symptoms, digestive system hypermotility, unintended weight loss, and, in lipid panel blood tests, a lower and sometimes unusually low serum cholesterol.Major clinical signs of hyperthyroidism include weight loss (often accompanied by an increased appetite), anxiety, heat intolerance, hair loss (especially of the outer third of the eyebrows), muscle aches, weakness, fatigue, hyperactivity, irritability, high blood sugar, excessive urination, excessive thirst, delirium, tremor, pretibial myxedema (in Graves disease), emotional lability, and sweating. Panic attacks, inability to concentrate, and memory problems may also occur. Psychosis and paranoia, common during thyroid storm, are rare with milder hyperthyroidism. Many persons will experience complete remission of symptoms 1 to 2 months after a euthyroid state is obtained, with a marked reduction in anxiety, sense of exhaustion, irritability, and depression. Some individuals may have an increased rate of anxiety or persistence of affective and cognitive symptoms for several months to up to 10 years after a euthyroid state is established. In addition, those with hyperthyroidism may present with a variety of physical symptoms such as palpitations and abnormal heart rhythms (the notable ones being atrial fibrillation), shortness of breath (dyspnea), loss of libido, amenorrhea, nausea, vomiting, diarrhea, gynecomastia and feminization. Long term untreated hyperthyroidism can lead to osteoporosis. | There is also a special low iodine diet available that will control the symptoms providing no other food is fed; Hills y/d formula, when given exclusively, decreases T4 production by limiting the amount of iodine needed for thyroid hormone production. It is the only available commercial diet that focuses on managing feline hyperthyroidism. Medical and dietary management using methimazole and Hills y/d cat food will give hyperthyroid cats an average of 2 years before dying due to secondary conditions such as heart and kidney failure. Drugs used to help manage the symptoms of hyperthyroidism are methimazole and carbimazole. Drug therapy is the least expensive option, even though the drug must be administered daily for the remainder of the cats life. Carbimazole is only available as a once daily tablet. Methimazole is available as an oral solution, a tablet, and compounded as a topical gel that is applied using a finger cot to the hairless skin inside a cats ear. Many cat owners find this gel a good option for cats that dont like being given pills. Radioiodine treatment, however, is not available in all areas, as this treatment requires nuclear radiological expertise and facilities that not only board the cat, but are specially equipped to manage the cats urine, sweat, saliva, and stool, which are radioactive for several days after the treatment, usually for a total of 3 weeks (the cat spends the first week in total isolation and the next two weeks in close confinement). | 11
|
Others liken the pain and sensation to a chemical burn that doesnt go away. It is a mistake to think that the reaction is like a sunburn, it is far deeper in the skin and often requires the use of ingestible steroids as well as topical steroids in order to alleviate the condition to a degree. The best protection is to be fully covered from sunlight, even when cloudy or hazy. The use of UV-rated clothing is suggested as well as a UV-rated umbrella for outdoors. See also
List of cutaneous conditions
Photosensitivity with HIV infection
Skin lesion
References
== External links == | A patient developed this chorea with no definite evidence of previous Sydenhams chorea or recent streptococcal infections, but had anti-basal ganglia antibodies, suggesting immunological basis for the pathophysiology of this chorea. Diagnosis
Differential diagnoses
Chorea can also be a manifestation of drug toxicity (for example, anticonvulsants, antiparkinson agents, neuroleptics, steroids, and estrogen), or a result of an infectious disease such as meningovascular syphilis, Lyme disease, viral encephalitis, and many others. Treatment
Drug treatment is indicated for patients with severe disabling chorea. It is treated with haloperidol, chlorpromazine alone or in combination with diazepam, and also pimozide, which is another neuroleptic drug which may have fewer adverse effects than haloperidol. Valproic acid, chloral hydrate, risperidone, or phenobarbital can also be used. See also
Chorea
References
Further reading
Palanivelu, L. M. (2007). "Chorea gravidarum". Journal of Obstetrics & Gynaecology. 27 (3): 310. doi:10.1080/01443610701241134. PMID 17464821. S2CID 119999. == External links == | 0-1
|
The canary in British pits was replaced in 1986 by the electronic gas detector. The first qualitative analytical method to detect carboxyhemoglobin emerged in 1858 with a colorimetric method developed by Felix Hoppe-Seyler, and the first quantitative analysis method emerged in 1880 with Josef von Fodor. Historical treatment
The use of oxygen emerged with anecdotal reports such as Humphry Davy having been treated with oxygen in 1799 upon inhaling three quarts of hydrocarbonate (water gas). Samuel Witter developed an oxygen inhalation protocol in response to carbon monoxide poisoning in 1814. Similarly, an oxygen inhalation protocol was recommend for malaria (literally translated to "bad air") in 1830 based on malaria symptoms aligning with carbon monoxide poisoning. Other oxygen protocols emerged in the late 1800s. The use of hyperbaric oxygen in rats following poisoning was studied by Haldane in 1895 while its use in humans began in the 1960s. Incidents
The worst accidental mass poisoning from carbon monoxide was the Balvano train disaster which occurred on 3 March 1944 in Italy, when a freight train with many illegal passengers stalled in a tunnel, leading to the death of over 500 people.Over 50 people are suspected to have died from smoke inhalation as a result of the Branch Davidian Massacre during the Siege of Waco in 1993. Weaponization
In ancient history, Hannibal executed Roman prisoners with coal fumes during the Second Punic War.The extermination of stray dogs by a carbon monoxide gas chamber was described in 1874. | In 1884, an article appeared in Scientific American describing the use of a carbon monoxide gas chamber for slaughterhouse operations as well as euthanizing a variety of animals.As part of the Holocaust during World War II, the Nazis used gas vans at Chelmno extermination camp and elsewhere to murder an estimated over 700,000 people by carbon monoxide poisoning. This method was also used in the gas chambers of several death camps such as Treblinka, Sobibor, and Belzec. Gassing with carbon monoxide started in Action T4. The gas was supplied by IG Farben in pressurized cylinders and fed by tubes into the gas chambers built at various mental hospitals, such as Hartheim Euthanasia Centre. Exhaust fumes from tank engines, for example, were used to supply the gas to the chambers.Recently, carbon monoxide gas chambers have been used to facilitate capital punishment exemplified by execution practices at the San Quentin State Prison. Physiology
Carbon monoxide is produced naturally by many physiologically relevant enzymatic and non-enzymatic reactions best exemplified by heme oxygenase catalyzing the biotransformation of heme (an iron protoporphyrin) into biliverdin and eventually bilirubin. Aside from physiological signaling, most carbon monoxide is stored as carboxyhemoglobin at non-toxic levels below 3% HbCO. Therapeutics
Small amounts of CO are beneficial and enzymes exist that produce it at times of oxidative stress. A variety of drugs are being developed to introduce small amounts of CO, these drugs are commonly called carbon monoxide-releasing molecules. | 11
|
Still, medical examination, including a nonstress test, is recommended in the event of any type of any change in the strength or frequency of fetal movement, especially a complete cease; most midwives and obstetricians recommend the use of a kick chart to assist in detecting any changes. Fetal distress or death can be confirmed or ruled out via fetoscopy/doptone, ultrasound, and/or electronic fetal monitoring. If the fetus is alive but inactive, extra attention will be given to the placenta and umbilical cord during ultrasound examination to ensure that there is no compromise of oxygen and nutrient delivery.Some researchers have tried to develop models to identify, early on, pregnant women who may be at high risk of having a stillbirth. Definition
There are a number of definitions for stillbirth. To allow comparison, the World Health Organization uses the ICD-10 definitions and recommends that any baby born without signs of life at greater than or equal to 28 completed weeks gestation be classified as a stillbirth. : Overview tab The WHO uses the ICD-10 definitions of "late fetal deaths" as their definition of stillbirth. Other organisations recommend that any combination of greater than 16, 20, 22, 24 or 28 weeks gestational age or 350 g, 400 g, 500 g or 1000 g birth weight may be considered a stillbirth.The term is often used in distinction to live birth (the baby was born alive, even if it died shortly thereafter) or miscarriage (early pregnancy loss). The word miscarriage is often used incorrectly to describe stillbirths. | In 119 women who underwent hysterectomy and oophorectomy by laparoscopy, ovarian remnants were known in 5 and were found during surgery in 21 patients (18%). [2] However, this was a small study and the participants were only symptomatic women. Therefore, it is not known whether the data can be extrapolated to include all women who have undergone oophorectomy. References
External links
Ovarian remnant syndrome | 0-1
|
In order to expedite the process of discovering a drug, the NCI researchers actively sought collaborations with pharmaceutical companies having access to libraries of compounds with potential antiviral activity. This assay could simultaneously test both the anti-HIV effect of the compounds and their toxicity against infected T cells. In June 1984, Burroughs-Wellcome virologist Marty St. Clair set up a program to discover drugs with the potential to inhibit HIV replication. Burroughs-Wellcome had expertise in nucleoside analogs and viral diseases, led by researchers including George Hitchings, Gertrude Elion, David Barry, Paul (Chip) McGuirt Jr., Philip Furman, Martha St. Clair, Janet Rideout, Sandra Lehrman and others. Their research efforts were focused in part on the viral enzyme reverse transcriptase. Reverse transcriptase is an enzyme that retroviruses, including HIV, utilize to replicate themselves. Secondary testing was performed in mouse cells infected with the retroviruses Friend virus or Harvey sarcoma virus, as the Wellcome group did not have a viable in-house HIV antiviral assay in place at that time, and these other retroviruses were believed to represent reasonable surrogates. AZT proved to be a remarkably potent inhibitor of both Friend virus and Harvey sarcoma virus, and a search of the companys records showed that it had demonstrated low toxicity when tested for its antibacterial activity in rats many years earlier. | However, if there are certain "red flag" symptoms present, plain radiographs (X-ray), CT scan or magnetic resonance imaging may be recommended. These red flags include:
History of cancer
Unexplained weight loss
Immunosuppression
Urinary infection
Intravenous drug use
Prolonged use of corticosteroids
Back pain not improved with conservative management
History of significant trauma
Minor fall or heavy lift in a potentially osteoporotic or elderly individual
Acute onset of urinary retention, overflow incontinence, loss of anal sphincter tone, or fecal incontinence
Saddle anesthesia
Global or progressive motor weakness in the lower limbs
Prevention
Moderate-quality evidence exists that suggests that the combination of education and exercise may reduce an individuals risk of developing an episode of low back pain. Lesser-quality evidence points to exercise alone as a possible deterrent to the risk of the condition. Management
Nonspecific pain
Patients with uncomplicated back pain should be encouraged to remain active and to return to normal activities. The management goals when treating back pain are to achieve maximal reduction in pain intensity as rapidly as possible, to restore the individuals ability to function in everyday activities, to help the patient cope with residual pain, to assess for side effects of therapy and to facilitate the patients passage through the legal and socioeconomic impediments to recovery. For many, the goal is to keep the pain at a manageable level to progress with rehabilitation, which then can lead to long-term pain relief. | 0-1
|
Chronic mucocutaneous candidiasis is an immune disorder of T cells. It is characterized by chronic infections with Candida that are limited to mucosal surfaces, skin, and nails. : 310 It can also be associated with other types of infections, such as human papilloma virus. An association with chromosome 2 has been identified. Signs and symptoms
The signs and symptoms of this condition are thickened skin, skin ulcer, dyspareunia, endocardium abnormality, vision problems, hepatitis, seizures, bloody urine, and meningitis. Associated Diseases or Conditions
There are a number of disorders associated with chronic mucocutaneous candidiasis including endocrine dysfunctions, vitiligo, malabsorption syndromes, neoplasms, and others. In most patients, chronic mucocutaneous candidiasis is correlated to abnormalities in cell-mediated immunity (T-lymphocyte mediated response). The T-lymphocytes fail to produce the necessary cytokines that are required for immunity against Candida. Current effective treatments include anti-fungal drugs and, for long-term remissions, restoration of cellular immunity.Patients with autosomal-dominant mucocutaneous candidiasis may be at risk for epidermoid esophageal cancer due to the nitrosamine compounds produced by chronic candida infections. Cause
Chronic mucocutaneous candidiasis can be inherited either autosomal dominant or autosomal recessive. There are 9 types of this condition with the first CANDF1 being located at 2p22.3-p21 (cytogenetically). Mechanism
The mechanism the human immune system has is normally to fight an infection (like Candida). Initially, Th17 cells are made by the immune system, which in turn produces interleukin-17 (IL-17). This induces inflammation and white blood cells confront infection.Chronic mucocutaneous candidiasis mutations affect IL-17 by inhibiting its pathway. | It is however later said that Solid Snakes body, created as a genetically engineered clone, had been designed to break down quickly.In season 3 episode 9, "The Ballad of Kevin and Tess", of the TV series The 4400, Kevin is said to have Werner syndrome to hide his real condition from the public.In The Invisible Man season 1 episode 6, "Impetus", the new character Gloria has an experimentally altered type of Werner syndrome that causes it to become contagious.The central character in Gail Tsukiyamas novel DREAMING WATER (2002) has Werners syndrome.In season 1 episode 8 "Cold Comfort" from TV series Dark Angel, a character has a "form of progeria, similar to Werner syndrome", due to genetic manipulation. With an appropriate treatment, her condition seems to be stabilized.In Resident Evil: The Final Chapter (2016), the deadly "T-Virus", which causes the viral pandemic in the Resident Evil film series, is revealed to be the cure for "adult progeria". James Marcus originally develops the virus to cure his young daughter Alicia Marcus.Ratsasan (2018), a Tamil movie (as well as its Telugu remake Rakshasudu), features a young man born with Werners and is a victim of childhood bullying due to his appearance and has bad experience proposing to a girl, who turns into serial killer and hunts down and kills school girls. See also
References
External links
This article incorporates public domain text from The U.S. National Library of Medicine
Werner Syndrome from GeneReviews, contains extensive information on the disorder | 0-1
|
By inhibiting PDE4, an enzyme which breaks down cyclic adenosine monophosphate, cAMP levels rise, resulting in the down-regulation of various pro-inflammatory factors including TNF-α, interleukin 17 and interleukin 23, as well as the up-regulation of anti-inflammatory factor interleukin 10. It is given in tablet form and taken by mouth. Side effects include headaches, back pain, nausea, diarrhea, fatigue, nasopharyngitis and upper respiratory tract infections, as well as depression and weight loss. It was patented in 2014 and manufactured by Celgene. There is no current generic equivalent available on the market. Other treatments
A review found tentative evidence of benefit of low level laser therapy and concluded that it could be considered for relief of pain and stiffness associated RA.Retinoid etretinate is effective for both arthritis and skin lesions. Photochemotherapy with methoxy psoralen and long-wave ultraviolet light (PUVA) are used for severe skin lesions. Doctors may use joint injections with corticosteroids in cases where one joint is severely affected. In psoriatic arthritis patients with severe joint damage orthopedic surgery may be implemented to correct joint destruction, usually with the use of a joint replacement. Surgery is effective for pain alleviation, correcting joint disfigurement, and reinforcing joint usefulness and strength. | Some glycation product are implicated in many age-related chronic diseases, including cardiovascular diseases (the endothelium, fibrinogen, and collagen are damaged) and Alzheimers disease (amyloid proteins are side-products of the reactions progressing to AGEs).Long-lived cells (such as nerves and different types of brain cell), long-lasting proteins (such as crystallins of the lens and cornea), and DNA can sustain substantial glycation over time. Damage by glycation results in stiffening of the collagen in the blood vessel walls, leading to high blood pressure, especially in diabetes. Glycations also cause weakening of the collagen in the blood vessel walls, which may lead to micro- or macro-aneurysm; this may cause strokes if in the brain. See also
Advanced glycation end-product
Alagebrium
Fructose
Galactose
Glucose
Glycosylation
Glycated hemoglobin
List of aging processes
Additional reading
Ahmed N, Furth AJ (July 1992). "Failure of common glycation assays to detect glycation by fructose". Clin. Chem. 38 (7): 1301–3. doi:10.1093/clinchem/38.7.1301. PMID 1623595. Vlassara H (June 2005). "Advanced glycation in health and disease: role of the modern environment". Annals of the New York Academy of Sciences. 1043 (1): 452–60. Bibcode:2005NYASA1043..452V. doi:10.1196/annals.1333.051. PMID 16037266. S2CID 20952378. == References == | 0-1
|
However, subsequent studies have found that, though DLD runs in families, it is not usually caused by a mutation in FOXP2 or another specific gene. Current evidence suggests that there are many different genes that can influence language learning, and DLD results when a child inherits a particularly detrimental combination of risk factors, each of which may have only a small effect. Nevertheless, study of the mode of action of the FOXP2 gene has helped identify other common genetic variants involved in the same neural pathways that may play a part in causing DLD.Language disorders are associated with aspects of home environment, and it is often assumed that this is a causal link, with poor language stimulation leading to weak language skills. Twin studies, however, show that two children in the same home environment can have very different language outcomes, suggesting we should consider other explanations for the link. Children with DLD often grow up into adults who have relatively low educational attainments, and their children may share a genetic risk for language disorder.One non-genetic factor that is known to have a specific impact on language development is being a younger sibling in a large family. Associated factors
It has long been noted that males are more affected by DLD than females, with a sex ratio of affected males-to-females around 3 or 4:1. However, the sex difference is much less striking in epidemiological samples, suggesting that similar problems may exist in females but are less likely to be detected. | A major divide is between theories that attribute the difficulties to a low-level problem with auditory temporal processing, and those that propose there is a deficit in a specialised language-learning system. Other accounts emphasise deficits in specific aspects of learning and memory. It can be difficult to choose between theories because they do not always make distinctive predictions, and there is considerable heterogeneity among children with DLD. It has also been suggested that DLD may only arise when more than one underlying deficit is present. Developmental learning disorder in adults
Relatively little research has been conducted to test the outcomes of DLD in adults. In a study comparing 17 men with DLD to siblings without DLD, researchers found that the DLD men had normal intelligence with higher performance IQ than verbal IQ. The participants still exhibited a severe and persisting language disorder, severe literacy impairments, and significant deficits in theory of mind and phonological processing. Within the DLD cohort, higher childhood intelligence and language were associated with superior cognitive and language ability at final adult outcome. In their mid-thirties, the DLD cohort had significantly worse social adaptation (with prolonged unemployment and a paucity of close friendships and love relationships) compared with both their siblings and National Child Development Study (NCDS) control cohorts, matched on childhood IQ and social class. Self-reports showed a higher rate of schizotypal features but not schizoaffective disorder. Four DLD adults had serious mental health problems (two had developed schizophrenia). | 11
|
Trimethoprim (TMP) is an antibiotic used mainly in the treatment of bladder infections. Other uses include for middle ear infections and travelers diarrhea. With sulfamethoxazole or dapsone it may be used for Pneumocystis pneumonia in people with HIV/AIDS. It is taken by mouth.Common side effects include nausea, changes in taste, and rash. Rarely it may result in blood problems such as not enough platelets or white blood cells. Trimethoprim may cause sun sensitivity. There is evidence of potential harm during pregnancy in some animals but not humans. It works by blocking folate metabolism via dihydrofolate reductase in some bacteria which results in their death.Trimethoprim was first used in 1962. It is on the World Health Organizations List of Essential Medicines. It is available as a generic medication. Medical uses
It is primarily used in the treatment of urinary tract infections, although it may be used against any susceptible aerobic bacterial species. It may also be used to treat and prevent Pneumocystis jirovecii pneumonia. It is generally not recommended for the treatment of anaerobic infections such as Clostridium difficile colitis (the leading cause of antibiotic-induced diarrhea). Trimethoprim has been used in trials to treat retinitis.Resistance to trimethoprim is increasing, but it is still a first line antibiotic in many countries. Spectrum of susceptibility
Cultures and susceptibility tests should be done to make sure bacteria are treated by trimethoprim. | Core decompression
Other treatments include core decompression, where internal bone pressure is relieved by drilling a hole into the bone, and a living bone chip and an electrical device to stimulate new vascular growth are implanted; and the free vascular fibular graft (FVFG), in which a portion of the fibula, along with its blood supply, is removed and transplanted into the femoral head. A 2016 Cochrane review found no clear improvement between people who have had hip core decompression and participate in physical therapy, versus physical therapy alone. There is additionally no strong research on the effectiveness of hip core decompression for people with sickle cell disease.Progression of the disease could possibly be halted by transplanting nucleated cells from bone marrow into avascular necrosis lesions after core decompression, although much further research is needed to establish this technique. Prognosis
The amount of disability that results from avascular necrosis depends on what part of the bone is affected, how large an area is involved, and how effectively the bone rebuilds itself. The process of bone rebuilding takes place after an injury as well as during normal growth. Normally, bone continuously breaks down and rebuilds—old bone is resorbed and replaced with new bone. The process keeps the skeleton strong and helps it to maintain a balance of minerals. In the course of avascular necrosis, however, the healing process is usually ineffective and the bone tissues break down faster than the body can repair them. | 0-1
|
Pieces of cord and fascia of approximately one centimeter are excised. The cords are placed under maximum tension while they are cut. A scalpel is used to separate the tissues. The surgeon keeps removing small parts until the finger can fully extend. The person is encouraged to start moving his or her hand the day after surgery. They wear an extension splint for two to three weeks, except during physical therapy.The same procedure is used in the segmental fasciectomy with cellulose implant. After the excision and a careful hemostasis, the cellulose implant is placed in a single layer in between the remaining parts of the cord.After surgery people wear a light pressure dressing for four days, followed by an extension splint. The splint is worn continuously during nighttime for eight weeks. During the first weeks after surgery the splint may be worn during daytime. Less invasive treatments
Studies have been conducted for percutaneous release, extensive percutaneous aponeurotomy with lipografting and collagenase. These treatments show promise. Percutaneous needle fasciotomy
Needle aponeurotomy is a minimally-invasive technique where the cords are weakened through the insertion and manipulation of a small needle. The cord is sectioned at as many levels as possible in the palm and fingers, depending on the location and extent of the disease, using a 25-gauge needle mounted on a 10 ml syringe. Once weakened, the offending cords can be snapped by putting tension on the finger(s) and pulling the finger(s) straight. | At 3–14 years of age:
2 major criteria or 1 major and 3 minor criteria. Major criteria are:
ALMS1 mutation in 1 allele and/or family history of Alström syndrome,
Vision pathology (nystagmus, photophobia, diminished acuity). If old enough for testing: cone dystrophy by ERG.Minor criteria:
Obesity and/or insulin resistance and/or Type 2 Diabetes
History of dilated cardiomyopathy with congestive heart failure
Hearing loss
Liver dysfunction
Kidney failure
Advanced bone ageVariable supportive evidence:
Recurrent pulmonary infections, normal digits, delayed developmental milestones, hyperlipidemia, scoliosis, flat wide feet
hypothyroidism, hypertension, recurrent urinary tract infection, growth hormone deficiency. Presentation 15 years – adulthood:
2 major and 2 minor criteria or 1 major and 4 minor criteria. Major criteria are:
ALMS1 mutation in 1 allele and/or family history of Alström syndrome. Vision pathology (history of nystagmus in infancy/childhood, legal blindness, cone and rod dystrophy by ERG).Minor criteria:
Obesity and/or insulin resistance and/or Type 2 Diabetes
History of dilated cardiomyopathy with congestive heart failure. Hearing loss
Hepatic dysfunction
Renal failure
Short stature
Males: hypogonadism, Females: irregular menses and/or hyperandrogenismOther supportive features:
Recurrent pulmonary infections, normal digits, history of developmental delay, hyperlipidemia, scoliosis, flat wide feet,
hypothyroidism, hypertension, recurrent urinary tract infections/urinary dysfunction, growth hormone deficiency, alopecia. Prevention
Prevention for Alström syndrome is considered to be harder compared to other diseases/syndromes because it is an inherited condition. However, there are other options that are available for parents with a family history of Alström syndrome. Genetic testing and counseling are available where individuals are able to meet with a genetic counselor to discuss risks of having the children with the disease. | 0-1
|
Tagraxofusp, sold under the brand name Elzonris, is an anti-cancer medication for the treatment of blastic plasmacytoid dendritic cell neoplasm (BPDCN). It was approved for use in the United States in 2018, and after a second review, in the EU in January 2021. The U.S. Food and Drug Administration (FDA) considers it to be a first-in-class medication.Tagraxofusp is a fusion protein consisting of interleukin 3 (IL-3) fused to diphtheria toxin. The fusion protein readily kills cultured pDC by binding to their IL-3 receptors to thereby gain entrance to the cells and then blocking these cells protein synthesis (due to its diphtheria toxin portion inhibiting eukaryotic elongation factor 2). Society and culture
Legal status
In July 2020, the European Medicines Agency (EMA) recommended the refusal of the marketing authorization for tagraxofusp. The Agency was concerned that due to the design of the study and the small number of participants, it was not possible to be sure how effective the medicine was in treating blastic plasmacytoid dendritic cell neoplasm. In addition, the medicine could cause capillary leak syndrome (an unpredictable, potentially life-threatening side effect due to increased permeability of small blood vessels), which had led to some fatal outcomes.On 12 November 2020, the Committee for Medicinal Products for Human Use (CHMP) of the EMA adopted a positive opinion following a re-examination procedure, recommending the granting of a marketing authorization for the medicinal product Elzonris, intended for the treatment of blastic plasmacytoid dendritic cell neoplasm (BPDCN). Tagraxofusp was approved for medical use in the European Union in January 2021. | The medical history of the patient (endurance sports) and physical examination (bradycardia, and maybe a third or fourth heart sound), can give important hints. ECG – typical findings in resting position are, for example, sinus bradycardia, atrioventricular block (primary and secondary) and incomplete (IRBBB) or complete right bundle branch block (RBBB) – all those findings normalize during exercise. Echocardiography – differentiation between physiological and pathological increases of the hearts size is possible, especially by estimating the mass of the wall (not over 130 g/m2) and its end diastolic diameter (not much less 60 mm) of the left ventricle. X-ray examination of the chest may show increased heart size (mimicking other possible causes of enlargement). Cardiac MRI - In athletes heart, there is balanced atrioventricular remodeling, reduced thickening of the heart after detraining, no late gadolinium enhancement, low to normal T1 signal, and normal extracellular volume. | 0-1
|
In any case, spironolactone has been found to reduce the bioavailability of oral estradiol, which could be due to induction of estradiol metabolism via CYP3A4. Spironolactone has also been found to inhibit UGT2B7. Spironolactone can also have numerous other interactions, most commonly with other cardiac and blood pressure medications, for instance digoxin.Licorice, which has indirect mineralocorticoid activity by inhibiting mineralocorticoid metabolism, has been found to inhibit the antimineralocorticoid effects of spironolactone. Moreover, the addition of licorice to spironolactone has been found to reduce the antimineralocorticoid side effects of spironolactone in women treated with it for hyperandrogenism, and licorice hence may be used to reduce these side effects in women treated with spironolactone as an antiandrogen who are bothered by them. On the opposite end of the spectrum, spironolactone is useful in reversing licorice-induced hypokalemia. Aspirin and other nonsteroidal anti-inflammatory drugs (NSAIDs) have been found to attenuate the diuresis and natriuresis induced by spironolactone, but, not to affect its antihypertensive effect.Some research has suggested that spironolactone might be able to interfere with the effectiveness of antidepressant treatment. As the medication acts as an antimineralocorticoid, it is thought that it might be able to reduce the effectiveness of certain antidepressants by interfering with normalization of the hypothalamic–pituitary–adrenal axis and by increasing levels of glucocorticoids such as cortisol. However, other research contradicts this hypothesis and has suggested that spironolactone might actually produce antidepressant effects, for instance studies showing antidepressant-like effects of spironolactone in animals. | Society and culture
Generic names
The English, French, and generic name of the medication is spironolactone and this is its INN, USAN, USP, BAN, DCF, and JAN. Its name is spironolactonum in Latin, spironolacton in German, espironolactona in Spanish and Portuguese, and spironolattone in Italian (which is also its DCIT).Spironolactone is also known by its developmental code names SC-9420 and NSC-150339. Brand names
Spironolactone is marketed under a large number of brand names throughout the world. The major brand name of spironolactone is Aldactone. Other important brand names include Aldactone-A, Berlactone, CaroSpir, Espironolactona, Espironolactona Genfar, Novo-Spiroton, Prilactone (veterinary), Spiractin, Spiridon, Spirix, Spiroctan, Spiroderm (discontinued), Spirogamma, Spirohexal, Spirolon, Spirolone, Spiron, Spironolactone Actavis, Spironolactone Orion, Spironolactone Teva, Spirotone, Tempora (veterinary), Uractone, Uractonum, Verospiron, and Vivitar.Spironolactone is also formulated in combination with a variety of other medications, including with hydrochlorothiazide as Aldactazide, with hydroflumethiazide as Aldactide, Lasilacton, Lasilactone, and Spiromide, with altizide as Aldactacine and Aldactazine, with furosemide as Fruselac, with benazepril as Cardalis (veterinary), with metolazone as Metolactone, with bendroflumethiazide as Sali-Aldopur, and with torasemide as Dytor Plus, Torlactone, and Zator Plus. Availability
Spironolactone is marketed widely throughout the world and is available in almost every country, including in the United States, Canada, the United Kingdom, other European countries, Australia, New Zealand, South Africa, Central and South America, and East and Southeast Asia. Usage
There was a total of 17.2 million prescriptions for spironolactone in the United States between the beginning of 2003 and the end of 2005. | 11
|
In 1956, two different sulfonylureas were brought to market in Germany under the trade names Nadisan and Rastinon. American pharmaceutical companies in the postwar period had been seeking to establish business relations with the remnants of German pharmaceutical giants weakened by the war and partition of Germany. Upjohn (based in Kalamazoo until its purchase by Pharmacia in the 1990s) made deals with Hoechst, maker of Rastinon. The result was a cross-licensing agreement which produced Orinase. Upjohn stood to open up a whole new arena of treatment for diabetes, one with a built-in and sustainable market, i.e. patient population. Just as two German companies brought sulfonylureas to market within the same year, Upjohn discovered Eli Lilly had begun clinical trials for carbutamide, another oral hypoglycemic. Upjohn pushed for large-scale clinical trials from 1955–1957, enrolling over 5,000 patients at multiple sites. Upjohns formulation was preferred when the Lilly formulation demonstrated evidence of toxicity in parallel trials at the Joslin Clinic. Lilly pulled carbutamide and halted development, leaving the field open for Upjohn to market its new treatment. In 1956, Upjohn filed for approval from the Food and Drug Administration. Jeremy A. Greene found the applications size – 10,580 pages in 23 volumes with 5,786 cases reports – was necessary to "render visible the relatively small improvements provided in less severe forms of diabetes." Indeed, Orinase was marketed by Upjohn not as a cure-all for all diabetics, but specifically as a treatment that was "not an oral insulin" and "did not work in all diabetics". | Sanofi said the acquisition would be completed by the first quarter of 2010. Current brands
Chattem manufactures many over-the-counter healthcare products. They are marketed in three categories: pain relief, skin & hair care, and health & wellness. Pain relief
Arthritis Hot
Aspercreme
Capzasin
Cortizone 10
Flexall
Icy Hot
Sportscreme
Skin & hair care
Gold Bond
Gold Bond Ultimate
Selsun Blue
Health & wellness
ACT Oral Care
Allegra
Kaopectate
Nasacort
Rolaids
Unisom
Unisom Natural Nights
Xyzal
References
== External links == | 0-1
|
Rarely severe symptoms such as the inability to walk, ongoing vomiting, or social isolation may occur while rare complications may include dehydration, electrolyte problems, or a lower esophageal tear from severe vomiting. Cause
Motion sickness can be divided into three categories:
Motion sickness caused by motion that is felt but not seen, as in terrestrial motion sickness;
Motion sickness caused by motion that is seen but not felt, as in space motion sickness;
Motion sickness caused when both systems detect motion but they do not correspond, as in either terrestrial or space motion sickness. Motion felt but not seen
In these cases, motion is sensed by the vestibular system and hence the motion is felt, but no motion or little motion is detected by the visual system, as in terrestrial motion sickness. Carsickness
A specific form of terrestrial motion sickness, being carsick is quite common and evidenced by disorientation while reading a map, a book, or a small screen during travel. Carsickness results from the sensory conflict arising in the brain from differing sensory inputs. Motion sickness is caused by a conflict between signals arriving in the brain from the inner ear, which forms the base of the vestibular system, the sensory apparatus that deals with movement and balance, and which detects motion mechanically. If someone is looking at a stationary object within a vehicle, such as a magazine, their eyes will inform their brain that what they are viewing is not moving. Their inner ears, however, will contradict this by sensing the motion of the vehicle.Varying theories exist as to cause. | Thus, with the exception of voluntary eye movements, the vestibular and oculomotor systems are thoroughly linked. Second is the operation of Sherringtons Law describing reciprocal inhibition between agonist-antagonist muscle pairs, and by implication the stretching of extraocular muscle that must occur whenever Sherringtons Law is made to fail, thereby causing an unrelaxed (contracted) muscle to be stretched. Finally, there is the critical presence of afferent output to the Vagus nerves as a direct result of eye muscle stretch or traction. Thus, tenth nerve stimulation resulting from eye muscle stretch is proposed as the cause of motion sickness. The theory explains why labyrinthine-defective individuals are immune to motion sickness; why symptoms emerge when undergoing various body-head accelerations; why combinations of voluntary and reflexive eye movements may challenge the proper operation of Sherringtons Law, and why many drugs that suppress eye movements also serve to suppress motion sickness symptoms.A recent theory argues that the main reason motion sickness occurs is due to an imbalance in vestibular outputs favoring the semicircular canals (nauseogenic) vs. otolith organs (anti-nauseogenic). This theory attempts to integrate previous theories of motion sickness. For example, there are many sensory conflicts that are associated with motion sickness and many that are not, but those in which canal stimulation occurs in the absence of normal otolith function (e.g., in free fall) are the most provocative. The vestibular imbalance theory is also tied to the different roles of the otoliths and canals in autonomic arousal (otolith output more sympathetic). Diagnosis
The diagnosis is based on symptoms. | 11
|
Myxobolus cerebralis is a myxosporean parasite of salmonids (salmon, trout, and their allies) that causes whirling disease in farmed salmon and trout and also in wild fish populations. It was first described in rainbow trout in Germany a century ago, but its range has spread and it has appeared in most of Europe (including Russia), the United States, South Africa, Canada and other countries. In the 1980s, M. cerebralis was found to require a tubificid oligochaete (a kind of segmented worm) to complete its life cycle. The parasite infects its hosts with its cells after piercing them with polar filaments ejected from nematocyst-like capsules. Whirling disease affects juvenile fish (fingerlings and fry) and causes skeletal deformation and neurological damage. Fish "whirl" forward in an awkward, corkscrew-like pattern instead of swimming normally, find feeding difficult, and are more vulnerable to predators. The mortality rate is high for fingerlings, up to 90% of infected populations, and those that do survive are deformed by the parasites residing in their cartilage and bone. They act as a reservoir for the parasite, which is released into water following the fishs death. M. cerebralis is one of the most economically important myxozoans in fish, as well as one of the most pathogenic. It was the first myxosporean whose pathology and symptoms were described scientifically. The parasite is not transmissible to humans. Taxonomy
The taxonomy and naming of both M. cerebralis, and of myxozoans in general, have complicated histories. | Dermatographic urticaria is a skin disorder and one of the most common types of urticaria, affecting 2–5% of the population. Signs and symptoms
The condition manifests as an allergic-like reaction, causing a warm red wheal to appear on the skin. As it is often the result of scratches, involving contact with other materials, it can be confused with an allergic reaction, when in fact it is the act of being scratched that causes a wheal to appear. These wheals are a subset of urticaria (hives), and appear within minutes, in some cases accompanied by itching. The first outbreak of urticaria can lead to other reactions on body parts not directly stimulated, scraped, or scratched. In a normal case, the swelling will decrease without treatment within 15–30 minutes, but, in extreme cases, itchy red welts may last anywhere from a few hours to days. Causes
Symptoms are thought to be the result of histamine being released by mast cells on the surface of the skin. Despite the lack of antigens, histamine causes the skin to swell in affected areas. If the membrane that surrounds the mast cells is too weak it will easily and rapidly break down under physical pressure, which then causes an allergic-like reaction.Symptoms can be caused or induced by:
The underlying cause of dermographism is not known, and it can last for many years without relief. The condition may subside and be effectively cured; however, it is often a lifelong ailment. | 0-1
|
Regadenoson, sold under the brand name Lexiscan among others, is an A2A adenosine receptor agonist that is a coronary vasodilator that is commonly used in pharmacologic stress testing. It produces hyperemia quickly and maintains it for a duration that is useful for radionuclide myocardial perfusion imaging. The selective nature of the drug makes it preferable to other stress agents such as adenosine, which are less selective and therefore cause more side-effects. Regadenoson was approved by the United States Food and Drug Administration on April 10, 2008, and is marketed by Astellas Pharma under the tradename Lexiscan. It is approved for use in the European Union and under the name of Rapiscan. It is marketed by GE Healthcare and is sold in both the United Kingdom and Germany. Regadenoson was approved for use in the European Union in September 2010.Regadenoson has a 2 to 3 minute biological half-life, as compared with adenosines 10-second half-life. As a result, regadenoson stress protocols use a single bolus, instead of a 4-6 minute continuous infusion, which was needed with adenosine. Another difference is that adenosine infusion is weight based (140mcg/kg/minute), while with regadenoson, a 0.4 mg/5mL preloaded syringe dose is standard for all weights. Regadenoson stress tests are not affected by the presence of beta blockers, as regadenoson vasodilates via the adenosine pathway without stimulating beta adrenergic receptors.One side effect of regadenoson is that it can temporarily disrupt the integrity of the blood-brain barrier by inhibiting P-glycoprotein function. References
External links
"Regadenoson". Drug Information Portal. U.S. National Library of Medicine. | A specific cause of the infarction should be looked for, such as diabetes, polyarteritis nodosa (inflammatory damage of vessels) or systemic lupus erythematosus. Neurosyphilis is also a known cause. Other causes include:
Treatment is supportive and aims to relieve symptoms. The prognosis is dependent upon individual circumstances and factors. Posterior spinal artery syndrome
Posterior spinal artery syndrome is much rarer than its anterior counterpart as the white matter structures that are present are much less vulnerable to ischemia since they have a better blood supply. When posterior spinal artery syndrome does occur, dorsal columns are damaged and ischemia may spread into the posterior horns. Clinically the syndrome presents as a loss of tendon reflexes and loss of joint position sense
Transient ischemic attack
Transient ischemic attacks (TIAs) rarely affect the spinal cord and usually affect the brain; however, cases have been documented in these areas. Spinal arteriovenous malformations are the main cause and are represented later in this article. However, TIAs can result from emboli in calcific aortic disease and aortic coarctation. Spinal arteriovenous malformations
Spinal arteriovenous malformations (AVMs, or angiomatous malformations) are congenital (from birth) abnormalities of blood vessels. Arteries that directly communicate with veins bypass the capillary network (which has not yet developed) and thus creates a shunt. AVMs appear as a mass of convoluted, dilated vessels. In regards to the spinal cord, they are usually located in the thoracolumbar region (between the thoracic and lumbar regions, 60% of the time), as opposed to the upper thoracic (20%) and cervical regions (approximately 15%). | 0-1
|
Ranking 140th within the top 200 prescribed drugs in the United States for 2007, Avelox generated sales of $697.3 million worldwide.Moxifloxacin is also manufactured by Alcon as Vigamox. Patent
A United States patent application was made on 30 June 1989, for Avelox, Bayer A.G. being the assignee, which was subsequently approved on 5 February 1991. This patent was scheduled to expire on 30 June 2009. However, this patent was extended for an additional two and one half years on 16 September 2004, and as such was not expected to expire until 2012. Moxifloxacin was subsequently (ten years later) approved by the FDA for use in the United States in 1999. At least four additional United States patents have been filed regarding moxifloxacin hydrochloride since the 1989 United States application, as well as patents outside of the US. Society and culture
Regulatory actions
Regulatory agencies have taken actions to address certain rare but serious adverse events associated with moxifloxacin therapy. Based on its investigation into reports of rare but severe cases of liver toxicity and skin reactions, the European Medicines Agency recommended in 2008 that the use of the oral (but not the IV) form of moxifloxacin be restricted to infections in which other antibacterial agents cannot be used or have failed. Similarly, the Canadian label includes a warning of the risk of liver injury.The U.S. label does not contain restrictions similar to the European label, but a carries a "black box" warning of the risk of tendon damage and/or rupture and warnings regarding the risk of irreversible peripheral neuropathy. | Moxifloxacin should also be avoided in patients with uncorrected hypokalemia, or concurrent administration of other medications known to prolong the QT interval (antipsychotics and tricyclic antidepressants).Moxifloxacin should be used with caution in patients with diabetes, as glucose regulation may be significantly altered.Moxifloxacin is also considered to be contraindicated within the pediatric population, pregnancy, nursing mothers, patients with a history of tendon disorder, patients with documented QT prolongation, and patients with epilepsy or other seizure disorders. Coadministration of moxifloxacin with other drugs that also prolong the QT interval or induce bradycardia (e.g., beta-blockers, amiodarone) should be avoided. Careful consideration should be given in the use of moxifloxacin in patients with cardiovascular disease, including those with conduction abnormalities. Children and adolescents
The safety of moxifloxacin in human patients under age 18 has not been established. Animal studies suggest a risk of musculoskeletal harm in juveniles. Interactions
Moxifloxacin is not believed to be associated with clinically significant drug interactions due to inhibition or stimulation of hepatic metabolism. Thus, it should not, for the most part, require special clinical or laboratory monitoring to ensure its safety. Moxifloxacin has a potential for a serious drug interaction with NSAIDs.The combination of corticosteroids and moxifloxacin has increased potential to result in tendonitis and disability.Antacids containing aluminium or magnesium ions inhibit the absorption of moxifloxacin. Drugs that prolong the QT interval (e.g., pimozide) may have an additive effect on QT prolongation and lead to increased risk of ventricular arrhythmias. The international normalised ratio may be increased or decreased in patients treated with warfarin. | 11
|
Imaging in pulmonary gangrene shows multiple small cavities joining together to form a large cavity. Mycobacterial
Mycobacteria that can cause cavitations include Mycobacterium tuberculosis and nontuberculous mycobacteria, most commonly Mycobacterium avium complex. Primary tuberculosis is caused by the initial infection with Mycobacterium tuberculosis and rarely results in the formation of lung cavities. 90% of people with primary tuberculosis are able to contain the infection and enter a latent phase. Reactivation tuberculosis, which is caused by the reactivation of latent tuberculosis, results in lung cavities visible on X-ray 30 to 50% of the time. There are frequently multiple cavities, and they most commonly occur in the apical and posterior segments of the upper lobes or the superior segment of the lower lobes. Cavitary tuberculosis is associated with worse outcomes, a higher rate of treatment failure, more frequent relapse after treatment, and a higher risk of transmitting the disease to others. Even after successful treatment with anti-tuberculosis drugs, 20-50% of patients with cavitary tuberculosis have persistent cavities, which results in decreased lung function and increased risk of opportunistic infections by Aspergillus fumigatus and other fungal pathogens.Nontuberculous mycobacteria (NTM) are all mycobacterial species other than Mycobacteria tuberculosis (which causes tuberculosis) and Mycobacterium leprae (which causes leprosy). NTM are found everywhere in the environment but are most commonly found in soil and water. Lung disease is caused by inhaling or ingesting nontuberculous mycobacteria. Unlike tuberculosis, NTM infection is not transmitted from person to person. | Congenital
Congenital lung cavities, or lung cavities present at birth, include bronchogenic cysts, congenital pulmonary airway malformation, and pulmonary sequestration. These congenital lesions are the most common cause of lung cavities in infants, children, and young adults. Bronchogenic cysts are due to abnormal budding of the bronchial tree. About 70% are found in the mediastinum, which is the central part of the chest where the heart is. Another 15 to 20% are intrapulmonary (within the lung), usually in the lower lobes. Congenital pulmonary airway malformation, formerly called congenital cystic adenomatoid malformation, is a benign tumor the results in the formation of single or multiple cysts. Pulmonary sequestration refers to abnormal lung tissue that gets its blood supply from the systemic circulation instead of the pulmonary circulation, like the rest of the lung. This lung tissue is also not connected to the trachea. See also
Focal lung pneumatosis, article comparing lung blebs, bullae, cysts, and cavities
== References == | 11
|
Factitious disorder is distinct from malingering in that people with factitious disorder imposed on self do not fabricate symptoms for material gain such as financial compensation, absence from work, or access to drugs. The exact cause of factitious disorder is not known, but researchers believe both biological and psychological factors play a role in the development of this disorder. Risk factors for developing factitious disorder may include childhood traumas, growing up with parents/caretakers who were emotionally unavailable due to illness or emotional problems, a serious illness as a child, failed aspirations to work in the medical field, personality disorders, and low self-esteem. While there are no reliable statistics regarding the number of people in the United States who have factitious disorder, FD is believed to be most common in mothers having the above risk factors. Those with a history of working in healthcare are also at greater risk of developing it.Arrhythmogenic Munchausen syndrome describes individuals who simulate or stimulate cardiac arrhythmias to gain medical attention.A related behavior called factitious disorder imposed on another has been documented in the parent or guardian of a child or the owner of a pet animal. The adult ensures that their child will experience some medical condition, therefore compelling the child to suffer through treatments and spend a significant portion during youth in hospitals. Furthermore, a disease may actually be initiated in the child by the parent or guardian. This condition is considered distinct from Munchausen syndrome. | The 2007 film The Diving Bell and the Butterfly is a screen adaptation of Baubys memoir. Jean-Dominique was instrumental in forming the Association du Locked-In Syndrome (ALIS) in France. See also
Alternating hemiplegia
Posterior cerebral artery syndrome
Middle cerebral artery syndrome
Anterior cerebral artery syndrome
References
== External links == | 0-1
|
Decamethonium and suxamethonium also have this same interonium distance. Uses in medicine
Pancuronium is used with general anesthesia in surgery for muscle relaxation and as an aid to intubation or ventilation. It does not have sedative or analgesic effects. Side-effects include moderately raised heart rate and thereby arterial pressure and cardiac output, excessive salivation, apnea and respiratory depression, rashes, flushing, and sweating. The muscular relaxation can be dangerous in the seriously ill and it can accumulate leading to extended weakness. Pancuronium is not preferable in long-term use in ICU-ventilated patients. In Belgium and the Netherlands, pancuronium is recommended in the protocol for euthanasia. After administering sodium thiopental to induce coma, pancuronium is delivered in order to stop breathing. Uses in execution and suicide
Procedure
Pancuronium is also used as one component of a lethal injection in administration of the death penalty in some parts of the United States. Controversy
Like all non-depolarising muscle relaxants, pancuronium has no effect on level of consciousness. Therefore, if the anaesthetic used is insufficient, the individual may be awake but unable to cry out or move due to the effect of the pancuronium. There have been several civil lawsuits alleging similar failures of adequate anaesthesia during general surgical procedures. These have been largely due to improper or insufficient dosages of anaesthetic in concert with normal dosages of muscle relaxants such as pancuronium. | In 2007, Michael Munro, a Scottish neonatologist at Aberdeen Maternity Hospital, was cleared of malpractice by the GMC Fitness to Practice panel after giving 23 times the standard dose of pancuronium to two dying neonates. Terminally ill, both dying babies were suffering from agonal gasping and violent body spasms, which was highly distressing for the parents to witness. Munro then administered pancuronium to the babies after advising the parents that this would ease their suffering and could also hasten death. It is on record that neither of the childrens parents were unhappy with Dr Munros treatment of their babies.Amnesty International has objected to its use in lethal injections on the grounds that it "may mask the condemned prisoners suffering during the execution," thereby leading observers to conclude that lethal injection is painless, or less cruel than other forms of execution. Export limitations
The United Kingdom bans the export of pancuronium bromide to the United States due to its use in lethal injections, but not to the Netherlands or Belgium. Uses in crime
Pancuronium was used in Efren Saldivars killing spree. It was also used by the Skin Hunters to kill patients in the Polish city of Łódź. Pavulon was also used by Richard Angelo in 1987 to kill at least 10 patients under his care at the Good Samaritan Hospital in New York. == References == | 11
|
A clinical jaundice scale, an adapted version of the Kramers scale, is used to quantify the severity of jaundice through the spread of skin discoloration from zone 1, the head, to zone 5, the palms and soles of the neonates body. Cephalocaudal progression of jaundice to zone 4 and 5 of the Kramers scale shows a significant positive correlation with serum bilirubin concentration of at least 11.0 mg per 100 ml, indicating the need for treatment. Jaundice Eye Colour Index (JECI)
Conjunctival icterus can be quantified by the Jaundice Eye Colour Index (JECI) through digital photography of the sclera, where a JECI of 0 indicates a white colour, and a JECI of 0.1 indicates an intense yellow colour, which is a sign of hemolytic jaundice. Screening laboratory tests
Multiple tests can be used to diagnose jaundice, but results of different parameters must be compared to determine its etiology. When a patient shows signs of jaundice such as the yellowing of the skin and sclera, a urine test is performed to check the levels of urobilinogen present. The presence of urobilinogen and its increased levels indicate that there are more than normal amounts of bilirubin in the intestine, showing that jaundice observed is not due to the blockage of bile flow, and is of pre-hepatic or hepatic causes. Normal colour of the patients urine indicates the absence of unconjugated bilirubin.Results from the urine test should be confirmed by a complete blood count (CBC) and serum testing for total serum bilirubin and fractionated bilirubin. | Hemolytic jaundice, also known as prehepatic jaundice, is a type of jaundice arising from hemolysis or excessive destruction of red blood cells, when the byproduct bilirubin is not excreted by the hepatic cells quickly enough. Unless the patient is concurrently affected by hepatic dysfunctions or is experiencing hepatocellular damage, the liver does not contribute to this type of jaundice.As one of the three categories of jaundice, the most obvious sign of hemolytic jaundice is the discolouration or yellowing of the sclera and the skin of the patient, but additional symptoms may be observed depending on the underlying causes of hemolysis. Hemolytic causes associated with bilirubin overproduction are diverse and include disorders such as sickle cell anemia, hereditary spherocytosis, thrombotic thrombocytopenic purpura, autoimmune hemolytic anemia, hemolysis secondary to drug toxicity, thalassemia minor, and congenital dyserythropoietic anemias. Pathophysiology of hemolytic jaundice directly involves the metabolism of bilirubin, where overproduction of bilirubin due to hemolysis exceeds the livers ability to conjugate bilirubin to glucuronic acid.Diagnosis of hemolytic jaundice is based mainly on visual assessment of the yellowing of the patients skin and sclera, while the cause of hemolysis must be determined using laboratory tests. Treatment of the condition is specific to the cause of hemolysis, but intense phototherapy and exchange transfusion can be used to help the patient excrete accumulated bilirubin. Complications related to hemolytic jaundice include hyperbilirubinemia and chronic bilirubin encephalopathy, which may be deadly without proper treatment. | 11
|
By enhancing miR-33 function, the level of ABCA1 is decreased, leading to decrease cellular cholesterol efflux to apoA-1. On the other hand, by inhibiting miR-33 function, the level of ABCA1 is increased and increases the cholesterol efflux to apoA-1. Suppression of miR-33 will lead to less cellular cholesterol and higher plasma HDL level through the regulation of ABCA1 expression.The sugar, cyclodextrin, removed cholesterol that had built up in the arteries of mice fed a high-fat diet. DNA damage
Aging is the most important risk factor for cardiovascular problems. The causative basis by which aging mediates its impact, independently of other recognized risk factors, remains to be determined. Evidence has been reviewed for a key role of DNA damage in vascular aging.8-oxoG, a common type of oxidative damage in DNA, is found to accumulate in plaque vascular smooth muscle cells, macrophages and endothelial cells, thus linking DNA damage to plaque formation. DNA strand breaks also increased in atherosclerotic plaques. Werner syndrome (WS) is a premature aging condition in humans. WS is caused by a genetic defect in a RecQ helicase that is employed in several repair processes that remove damages from DNA. WS patients develop a considerable burden of atherosclerotic plaques in their coronary arteries and aorta: calcification of the aortic valve is also frequently observed. These findings link excessive unrepaired DNA damage to premature aging and early atherosclerotic plaque development (see DNA damage theory of aging). | In a 2002 study involving 78 patients with a migraine or tension-type headache, CT scans showed abnormalities in over a third of the patients, though arachnoid cysts only accounted for 2.6% of patients in this study. A study found 18% of patients with intracranial arachnoid cysts had non-specific headaches. The cyst was in the temporal location in 75% of these cases. Seizures
Hydrocephalus (excessive accumulation of cerebrospinal fluid)
Increased intracranial pressure
Developmental delay
Behavioral changes
Nausea
Dysdiadokinesis
Hemiparesis (weakness or paralysis on one side of the body)
Ataxia (lack of muscle control)
Musical hallucination
Pre-senile dementia, a condition often associated with Alzheimers disease
In elderly patients (>80 years old) symptoms were similar to chronic subdural hematoma or normal pressure hydrocephalus:Dementia
Urinary incontinence
Hemiparesis
Headache
Seizures
Location-specific symptoms
A supratentorial arachnoid cyst can mimic a Ménières disease attack. Frontal arachnoid cysts have been associated with depression. Cysts on the left temporal lobe have been associated with psychosis. A left fronto-temporal cyst showed symptoms of alexithymia. Cyst on the right sylvian fissure resulted in new onset of schizophrenia-like symptoms at age 61. A patient with a cyst on the left middle cranial fossa had auditory hallucinations, migraine-like headaches, and periodic paranoia
Patients with left temporal lobe cysts had mood disturbances similar to manic depression (bipolar disorder) and were known to show outward aggression
Causes
The exact cause of arachnoid cysts is not known. Researchers believe that most cases of arachnoid cysts are developmental malformations that arise from the unexplained splitting or tearing of the arachnoid membrane.In some cases, arachnoid cysts occurring in the middle fossa are accompanied by underdevelopment (hypoplasia) or compression of the temporal lobe. | 0-1
|
Because of this, people with Bells palsy may present with loss of taste sensation in the anterior 2⁄3 of the tongue on the affected side.Although the facial nerve innervates the stapedius muscle of the middle ear (through the tympanic branch), sound sensitivity, causing normal sounds to be perceived as very loud (hyperacusis), and dysacusis are possible but hardly ever clinically evident.Although defined as a mononeuritis (involving only one nerve), people diagnosed with Bells palsy may have "myriad neurological symptoms" including "facial tingling, moderate or severe headache/neck pain, memory problems, balance problems, ipsilateral limb paresthesias, ipsilateral limb weakness, and a sense of clumsiness" that are "unexplained by facial nerve dysfunction". Cause
The cause of Bells palsy is unknown. Risk factors include diabetes, a recent upper respiratory tract infection, and pregnancy.Some viruses are thought to establish a persistent (or latent) infection without symptoms, e.g., the varicella zoster virus and the Epstein–Barr virus, both of the herpes family. Reactivation of an existing (dormant) viral infection has been suggested as a cause of acute Bells palsy. As the facial nerve swells and becomes inflamed in reaction to the infection, it causes pressure within the Fallopian canal, resulting in the restriction of blood and oxygen to the nerve cells. Other viruses and bacteria that have been linked to the development of Bells palsy include HIV, sarcoidosis and Lyme Disease. This new activation could be triggered by trauma, environmental factors, and metabolic or emotional disorders.Familial inheritance has been found in 4–14% of cases. | Bells palsy is a type of facial paralysis that results in a temporary inability to control the facial muscles on the affected side of the face. In most cases, the weakness is temporary and significantly improves over weeks. Symptoms can vary from mild to severe. They may include muscle twitching, weakness, or total loss of the ability to move one or, in rare cases, both sides of the face. Other symptoms include drooping of the eyelid, a change in taste, and pain around the ear. Typically symptoms come on over 48 hours. Bells palsy can trigger an increased sensitivity to sound known as hyperacusis.The cause of Bells palsy is unknown and it can occur in any age. Risk factors include diabetes, a recent upper respiratory tract infection, and pregnancy. It results from a dysfunction of cranial nerve VII (the facial nerve). Many believe that this is due to a viral infection that results in swelling. Diagnosis is based on a persons appearance and ruling out other possible causes. Other conditions that can cause facial weakness include brain tumor, stroke, Ramsay Hunt syndrome type 2, myasthenia gravis, and Lyme disease.The condition normally gets better by itself, with most achieving normal or near-normal function. Corticosteroids have been found to improve outcomes, while antiviral medications may be of a small additional benefit. The eye should be protected from drying up with the use of eye drops or an eyepatch. Surgery is generally not recommended. Often signs of improvement begin within 14 days, with complete recovery within six months. | 11
|
A complete skeletal radiographic survey is mandatory for diagnosis of Winchester or MONA syndrome together with a detailed musculoskeletal examination and craniofacial morphology assessment. It appears that Winchester syndrome is more common in women than men. Winchester syndrome is very rare. There have only been a few individuals worldwide who were reported to have this disorder. Treatment
There is no known cure for Winchester syndrome; however, there are many therapies that can aid in the treatment of symptoms. Such treatments can include medications: anti-inflammatories, muscle relaxants, and antibiotics. Many individuals will require physical therapy to promote movement and use of the limbs affected by the syndrome. Bisphosphonates have been used to improve bone quality and density or at least halt the progression of bone damages or osteolysis. Genetic counseling is typically prescribed for families to help aid in the understanding of the disease. There are a few clinical trials available to participate in. The prognosis for patients diagnosed with Winchester syndrome is positive. It has been reported that several affected individuals have lived to middle age; however, the disease is progressive and mobility will become limited towards the end of life. Eventually, the contractures will remain even with medical intervention, such as surgery. Research
In 2005, a patient with Winchester syndrome was shown to have mutations in the matrix metalloproteinase 2 (MMP2) gene. A 2006 study showed other mutations found in the MMP2 gene. This has led to the belief that there are many similar diseases within this family of mutations. | As of 2007, it was found that these mutations are also found in Torg and Nodulosis-arthropathy-osteolysis syndrome (NAO). This means that Torg, NAO, and Winchester syndrome are allelic disorders. In 2014, a new case of Winchester syndrome was reported. According to a recently published article, it was discovered that multicentric osteolysis, nodulosis, and arthropathy (MONA) and Winchester syndrome are different diseases. Mutations in MMPS and MT1-MMP result in similar but distinctly different "vanishing bone" syndromes. See also
Multicentric carpotarsal osteolysis syndrome
References
== External links == | 11
|
Laboratory
Lactate dehydrogenase (LDH) tests are often used to screen for metastases, although many patients with metastases (even end-stage) have a normal LDH; extraordinarily high LDH often indicates the metastatic spread of the disease to the liver. It is common for patients diagnosed with melanoma to have chest X-rays and an LDH test, and in some cases CT, MRI, PET, and/or PET/CT scans. Although controversial, sentinel lymph node biopsies and examination of the lymph nodes are also performed in patients to assess spread to the lymph nodes. A diagnosis of melanoma is supported by the presence of the S-100 protein marker. HMB-45 is a monoclonal antibody that reacts against an antigen present in melanocytic tumors such as melanomas. It is used in anatomic pathology as a marker for such tumors. The antibody was generated to an extract of melanoma. It reacts positively against melanocytic tumors but not other tumors, thus demonstrating specificity and sensitivity. The antibody also reacts positively against junctional nevus cells but not intradermal nevi, and against fetal melanocytes but not normal adult melanocytes. HMB-45 is nonreactive with almost all non-melanoma human malignancies, with the exception of rare tumors showing evidence of melanogenesis (e.g., pigmented schwannoma, clear cell sarcoma) or tumors associated with tuberous sclerosis complex (angiomyolipoma and lymphangiomyoma). Prevention
There is no evidence to support or refute adult population screening for malignant melanoma. Ultraviolet radiation
Minimizing exposure to sources of ultraviolet radiation (the sun and sunbeds), following sun protection measures and wearing sun protective clothing (long-sleeved shirts, long trousers, and broad-brimmed hats) can offer protection. | Familial benign copper deficiency, also known as Familial benign hypocupremia is a rare genetic disorder which is characterized by hypocupremia that causes symptoms such as epilepsy, hypotonia, seborrheic skin, thriving failure and mild anemia. Radiological findings include tibia and femur spurring. Transmission is thought to be either autosomal dominant or X-linked dominant.Symptoms are caused by a familial tendency of having low levels of copper within the body and can be improved (treated and managed) with oral supplements of copper.It has been described in members of a 3-generation Hungarian family. == References == | 0-1
|
It decomposes without melting at 1124 °C into magnesium oxide (MgO) and sulfur trioxide (SO3). Heptahydrate
The heptahydrate takes its common name "Epsom salt" from a bitter saline spring in Epsom in Surrey, England, where the salt was produced from the springs that arise where the porous chalk of the North Downs meets the impervious London clay. The heptahydrate readily loses one equivalent of water to form the hexahydrate. It is a natural source of both magnesium and sulphur. Epsom salts are commonly used in bath salts, exfoliants, muscle relaxers and pain relievers. However, these are different from Epsom salts that are used for gardening, as they contain aromas and perfumes not suitable for plants. Monohydrate
Magnesium sulfate monohydrate, or kieserite, can be prepared by heating the heptahydrate to 120 °C. Further heating to 250 °C gives anhydrous magnesium sulfate. Undecahydrate
The undecahydrate MgSO4·11H2O, meridianiite, is stable at atmospheric pressure only below 2 °C. Above that temperature, it liquefies into a mix of solid heptahydrate and a saturated solution. It has a eutectic point with water at −3.9 °C and 17.3% (mass) of MgSO4. Large crystals can be obtained from solutions of the proper concentration kept at 0 °C for a few days.At pressures of about 0.9 GPa and at 240 K, meridianiite decomposes into a mixture of ice VI and the enneahydrate MgSO4·9H2O. Enneahydrate
The enneahydrate MgSO4·9H2O was identified and characterized only recently, even though it seems easy to produce (by cooling a solution of MgSO4 and sodium sulfate Na2SO4 in suitable proportions). | Rectal pain is the symptom of pain in the area of the rectum. A number of different causes (68) have been documented. Differential diagnosis
Anal fissures
One of the most common causes of rectal pain is an anal fissure. It involves a tear in the anal canal probably due to trauma from defecation and are usually treated effectively with sitz baths, stool softeners, and analgesics. LAS and proctalgia fugax
Two more highly common causes of functional anorectal pain are levator ani syndrome (LAS) and proctalgia fugax. Both of these conditions are thought to be caused by muscle spasms of the either the levator ani muscle or the anal sphincter muscle respectively, and may overlap symptomatically with a third less-common condition called coccygodynia which is the result of previous trauma to the coccyx bone. Stress, prolonged sitting, and constipation all seem to be associated with LAS. The majority (90%) of those reporting chronic episodes of such pain are women. Some researchers group these conditions under the medical category of "tension myalgia of the pelvic floor". Less than a third of those experiencing these conditions seek medical treatment for them. Treatment can involve the use of antispasmodic medications as well as the down-training (conscious involvement and relaxation of previously unconscious muscle movements) so that spasms occur less frequently or not at all. Anorectal abscess
An anorectal abscess is an infection that forms a pocket of pus within the tissues around the anus. It is treated surgically by incision and drainage. | 0-1
|
TTP is a blood disorder and can lead to microangipathic hemolytic anemia (MAHA), neurologic abnormalities, fever, and renal disease. Pharmacology
Gemcitabine is hydrophilic and must be transported into cells via molecular transporters for nucleosides (the most common transporters for gemcitabine are SLC29A1 SLC28A1, and SLC28A3). After entering the cell, gemcitabine is first modified by attaching a phosphate to it, and so it becomes gemcitabine monophosphate (dFdCMP). This is the rate-determining step that is catalyzed by the enzyme deoxycytidine kinase (DCK). Two more phosphates are added by other enzymes. After the attachment of the three phosphates gemcitabine is finally pharmacologically active as gemcitabine triphosphate (dFdCTP). After being thrice phosphorylated, gemcitabine can masquerade as deoxycytidine triphosphate and is incorporated into new DNA strands being synthesized as the cell replicates.When gemcitabine is incorporated into DNA it allows a native, or normal, nucleoside base to be added next to it. This leads to "masked chain termination" because gemcitabine is a "faulty" base, but due to its neighboring native nucleoside it eludes the cells normal repair system (base-excision repair). Thus, incorporation of gemcitabine into the cells DNA creates an irreparable error that leads to inhibition of further DNA synthesis, and thereby leading to cell death.The form of gemcitabine with two phosphates attached (dFdCDP) also has activity; it inhibits the enzyme ribonucleotide reductase (RNR), which is needed to create new DNA nucleotides. The lack of nucleotides drives the cell to uptake more of the components it needs to make nucleotides from outside the cell, which also increases uptake of gemcitabine. | Gemcitabine, with brand names including Gemzar, is a chemotherapy medication. It treats cancers including testicular cancer, breast cancer, ovarian cancer, non-small cell lung cancer, pancreatic cancer, and bladder cancer. It is administered by intravenous infusion. It acts against neoplastic growth, and it inhibits the replication of Orthohepevirus A, the causative agent of Hepatitis E, through upregulation of interferon signaling.Common side effects include bone marrow suppression, liver and kidney problems, nausea, fever, rash, shortness of breath, mouth sores, diarrhea, neuropathy, and hair loss. Use during pregnancy will likely result in fetal harm. Gemcitabine is in the nucleoside analog family of medication. It works by blocking the creation of new DNA, which results in cell death.Gemcitabine was patented in 1983 and was approved for medical use in 1995. Generic versions were introduced in Europe in 2009 and in the US in 2010. It is on the WHO Model List of Essential Medicines. Medical uses
Gemcitabine treats various carcinomas. It is used as a first-line treatment alone for pancreatic cancer, and in combination with cisplatin for advanced or metastatic bladder cancer and advanced or metastatic non-small cell lung cancer. It is used as a second-line treatment in combination with carboplatin for ovarian cancer and in combination with paclitaxel for breast cancer that is metastatic or cannot be surgically removed.It is commonly used off-label to treat cholangiocarcinoma and other biliary tract cancers.It is given by intravenous infusion at a chemotherapy clinic. Contraindications and interactions
Taking gemcitabine can also affect fertility in men and women, sex life, and menstruation. | 11
|
On some trials, a stop signal is presented just prior to, or simultaneously with the go signal, and the subject must inhibit the impending response. The SSRT test is similar, except that the stop signal is presented after the go signal. This small modification increases the difficulty of inhibiting the go response, because the participant has typically already initiated the go response by the time the stop signal is presented. The participant is instructed to respond as fast as possible to the go signal while maintaining the highest possible inhibition accuracy (on no-go trials). During the task, the time at which the stop signal is presented (the stop signal delay or SSD) is dynamically adjusted to match the time after the go signal at which the participant is just able/unable to inhibit their go response. If the participant fails to inhibit their go response, the stop signal is moved slightly closer to the original go signal, and if the participant successfully inhibits their go response, the stop signal is moved slightly ahead in time. The SSRT is thus measured as the average go response time minus the average stop signal presentation time (SSD). Balloon Analogue Risk Task
The balloon analogue risk task (BART) was designed to assess risk-taking behavior. Subjects are presented with a computer depiction of a balloon that can be incrementally inflated by pressing a response key. As the balloon inflates, the subject accumulates rewards with each new key-press. The balloon is programmed with a constant probability of popping. | It is also used in surgery and post operative pain control in patients that are taking high dose buprenorphine for chronic pain because it is the only opioid that has a potency and binding affinity strong enough to displace buprenorphine from the opioid receptors in the central nervous system and provide analgesia.In 2018, the Food and Drug Administration (FDA) approved Dsuvia, a sublingual tablet form of the drug, that was developed in a collaboration between AcelRx Pharmaceuticals and the United States Department of Defense for use in battlefield settings where intravenous (IV) treatments may not be readily available. The decision to approve this new potent synthetic opioid came under criticism from politicians and from the chair of the FDA advisory committee, who fear that the tablets will be easily diverted to the illegal drug market. Side effects
It is essential for the administering medical professional to be trained in airway management with readily available airway equipment because the drug causes significant respiratory depression and may cause respiratory arrest if given too rapidly or in too high a dose. Other opioid side effects such as heart rhythm irregularity, blood pressure changes and nausea/vomiting can also be present in patients given this drug and should be dealt with accordingly. Sufentanil has been associated with extremely rare instances of life-threatening anaphylaxis. Overdose
Management
Because sufentanil is very potent, practitioners must be prepared to reverse the effects of the drug should the patient exhibit symptoms of overdose such as respiratory depression or respiratory arrest. | 0-1
|
Zoophilia is a paraphilia involving a sexual fixation on non-human animals. Bestiality is cross-species sexual activity between humans and non-human animals. The terms are often used interchangeably, but some researchers make a distinction between the attraction (zoophilia) and the act (bestiality).In most countries, bestiality is illegal under animal abuse laws or laws dealing with sodomy or crimes against nature. Terminology
General
Three key terms commonly used in regards to the subject—zoophilia, bestiality, and zoosexuality—are often used somewhat interchangeably. Some researchers distinguish between zoophilia (as a persistent sexual interest in animals) and bestiality (as sexual acts with animals), because bestiality is often not driven by a sexual preference for animals. Some studies have found a preference for animals is rare among people who engage in sexual contact with animals. Furthermore, some zoophiles report they have never had sexual contact with an animal. People with zoophilia are known as "zoophiles", though also sometimes as "zoosexuals", or even very simply "zoos". Zooerasty, sodomy, and zooerastia are other terms closely related to the subject but are less synonymous with the former terms, and are seldom used. "Bestiosexuality" was discussed briefly by Allen (1979), but never became widely established. Ernest Bornemann (1990, cited by Rosenbauer, 1997) coined the separate term zoosadism for those who derive pleasure – sexual or otherwise – from inflicting pain on animals. Zoosadism specifically is one member of the Macdonald triad of precursors to sociopathic behavior. | Serological assays are the best means of diagnosing this disease, with the indirect microimmunofluorescence assay (IFA) being considered the best tool. However, underlying illnesses, such as rheumatologic and other immune-mediated disorders, can lead to false positives. To combat these limitations, a PCR test may also be used; this test looks for rickettsial DNA. It can sensitively detect the target DNA in a sample taken from an eschar or blood during the first few days of infection. Prevention
There is no vaccine available for this disease, so to prevent infection, the US CDC recommends taking personal safety measures when venturing out into areas known to harbour ticks. Before going into these areas, the following preparations should be followed:
Wear protective clothing that will cover your arms and legs, with closed-toed shoes. Wearing long socks that you can tuck your pants into will provide an extra layer of safety, especially if you are walking in areas with tall grass for an extended period of time. Use strong insect repellent such as DEET on your body and Permethrin on your clothes
If you are taking a pet with you, they should also be updated on all preventative medications, and a veterinarian should be consulted for any extra precautions.After you return from these areas, the following precautions should be taken to prevent ticks from entering your home:
Check clothes and gear used for any ticks. Dry clothes should be put into a dryer on high heat for 10 minutes to effectively kill any small ticks that may not be visible to the naked eye. | 0-1
|
Myasthenia gravis (MG) is a long-term neuromuscular junction disease that leads to varying degrees of skeletal muscle weakness. The most commonly affected muscles are those of the eyes, face, and swallowing. It can result in double vision, drooping eyelids, trouble talking, and trouble walking. Onset can be sudden. Those affected often have a large thymus or develop a thymoma.Myasthenia gravis is an autoimmune disease of the neuro-muscular junction which results from antibodies that block or destroy nicotinic acetylcholine receptors (AChR) at the junction between the nerve and muscle. This prevents nerve impulses from triggering muscle contractions. Most cases are due to immunoglobulin G1 (IgG1) and IgG3 antibodies that attack AChR in the postsynaptic membrane, causing complement-mediated damage and muscle weakness. Rarely, an inherited genetic defect in the neuromuscular junction results in a similar condition known as congenital myasthenia. Babies of mothers with myasthenia may have symptoms during their first few months of life, known as neonatal myasthenia. Diagnosis can be supported by blood tests for specific antibodies, the edrophonium test, or a nerve conduction study.MG is generally treated with medications known as acetylcholinesterase inhibitors, such as neostigmine and pyridostigmine. Immunosuppressants, such as prednisone or azathioprine, may also be used. The surgical removal of the thymus may improve symptoms in certain cases. Plasmapheresis and high-dose intravenous immunoglobulin may be used during sudden flares of the condition. If the breathing muscles become significantly weak, mechanical ventilation may be required. | Two muscle fibers belonging to the same motor unit are identified, and the temporal variability in their firing patterns is measured. Frequency and proportion of particular abnormal action potential patterns, called "jitter" and "blocking", are diagnostic. Jitter refers to the abnormal variation in the time interval between action potentials of adjacent muscle fibers in the same motor unit. Blocking refers to the failure of nerve impulses to elicit action potentials in adjacent muscle fibers of the same motor unit. Ice test
Applying ice for 2–5 minutes to the muscles reportedly has a sensitivity and specificity of 76.9% and 98.3%, respectively, for the identification of MG. Acetylcholinesterase is thought to be inhibited at the lower temperature, which is the basis for this diagnostic test. This generally is performed on the eyelids when ptosis is present and is deemed positive if a ≥2-mm rise in the eyelid occurs after the ice is removed. Edrophonium test
This test requires the intravenous administration of edrophonium chloride or neostigmine, drugs that block the breakdown of acetylcholine by cholinesterase (acetylcholinesterase inhibitors). This test is no longer typically performed, as its use can lead to life-threatening bradycardia (slow heart rate) which requires immediate emergency attention. Production of edrophonium was discontinued in 2008. Imaging
A chest X-ray may identify widening of the mediastinum suggestive of thymoma, but computed tomography or magnetic resonance imaging (MRI) are more sensitive ways to identify thymomas and are generally done for this reason. | 11
|
Ménières disease
Chlortalidone reduces the volume and thereby reduces the pressure in the inner ear chambers; elevated endolymph pressure in the inner ear is thought to be the cause of Ménières disease or ’Endolymphatic hydrops.’ Synthesis of evidence from multiple small, low-quality studies indicates that chlortalidone or other thiazide diuretics are effective for Ménières Disease. Diabetes insipidus
Chlortalidone (or other thiazide medication) is a key component of treatment of nephrogenic diabetes insipidus. Nephrogenic diabetes insipidus occurs when the kidney is unable to produce concentrated urine because it has an inadequate response to vasopressin-dependent removal of free water from the renal tubular filtrate. By blocking sodium ion resorption in the distal convoluted tubule, chlortalidone induces an increase in excretion of sodium ion in urine (natriuresis). Giving chlortalidone while simultaneously restricting dietary sodium intake causes mild hypovolemia (low intravascular volume), which induces isotonic reabsorption of solute from the proximal renal tubule, reducing solute delivery in the renal collecting tubule and renal medullary collecting duct. This reduced delivery of solute to the collecting tubule and medullary collecting duct allows increased water resorption and higher concentration of urine, which leads to reversal of nephrogenic diabetes insipidus by a means that is independent of vasopressin. Adverse effects
Some reviews have found a similar risk as hydrochlorothiazide, while other reviews found a higher risk of side effects. | Hyperuricemia, high levels of uric acid in the blood
Hyperglycemia, high blood sugar is more common in persons who are magnesium deficient
Hyperlipidemia, high cholesterol and triglycerides
Headache
Nausea/vomiting
Photosensitivity increased susceptibility to sunburn of skin with sun exposure
Photoonycholysis detachment of nails from nailbed with sun exposure
Weight gain
Gout; approximately doubles the risk
PancreatitisThe frequency and severity of these adverse effects is much reduced when chlortalidone is used at lower doses (e.g., 12.5 mg per day). Mechanism of action
Chlortalidone reduces reabsorption of sodium and chloride primarily through inhibition of the Na+/Cl− symporter in the apical membrane of distal convoluted tubule cells in the kidney. Although chlortalidone is often referred to as a "thiazide-like" diuretic, it is unlike thiazide diuretics in that, in addition to its inhibition of the Na+/Cl− symporter, it also strongly inhibits multiple isoforms of carbonic anhydrase. Some of chlortalidones diuretic effect is also due to this inhibition of carbonic anhydrase in the proximal tubule. Chronic exposure to chlortalidone decreases the glomerular filtration rate. Chlortalidones diuretic effect is diminished in persons with kidney impairment. By increasing the delivery of sodium to the distal renal tubule, chlortalidone indirectly increases potassium excretion via the sodium-potassium exchange mechanism (i.e. apical ROMK/Na channels coupled with basolateral Na+/K ATPases). This can result in a low blood concentration of potassium and chloride as well as a mild metabolic alkalosis; however, the diuretic effect of chlortalidone is not affected by the acid-base balance of the person being treated. There is uncertainty about the mechanism of the blood pressure-lowering effect that occurs during chronic exposure to chlortalidone. | 11
|
These astrocytes have an unhealthily large amount of GFAP that affects astrocyte formation and function. Diagnosis
The degeneration of white matter, which shows the degeneration of myelin, can be seen in a basic MRI and used to diagnose leukodystrophies of all types. T-1 and T-2 weighted FLAIR images are the most useful. FLAIR stands for fluid-attenuated inversion recovery. Electrophysiological and other kinds of laboratory testing can also be done. In particular, nerve conduction velocity is looked at to distinguish between leukodystrophy and other demyelinating diseases, as well as to distinguish between individual leukodystrophies. For example, individuals with X-ALD have normal conduction velocities, while those with Krabbe disease or metachromatic leukodystrophy have abnormalities in their conduction velocities. Next generation multigene sequencing panels for undifferentiated leukodystrophy can now be offered for rapid molecular diagnosis after appropriate genetic counselling. Types
Specific types of leukodystrophies include the following with their respective ICD-10 codes when available:
(E71.3) Adrenomyeloneuropathy
(E75.2) Alexander disease
(E75.5) Cerebrotendineous xanthomatosis
Hereditary CNS demyelinating disease
(E75.2) Krabbe disease
(E75.2) Metachromatic leukodystrophy
(E75.2) Pelizaeus–Merzbacher disease
(E75.2) Canavan disease
(E75.2) Hypomyelinating leukodystrophy type 7 (4H syndrome)
(G93.49) Leukoencephalopathy with vanishing white matter
(E71.3) Adrenoleukodystrophy
(G60.1) Refsum disease
Treatment
With many different types of leukodystrophies and causes, treatment therapies vary for each type. Many studies and clinical trials are in progress to find treatment and therapies for each of the different leukodystrophies. Stem cell transplants and gene therapy appear to be the most promising in treating all leukodystrophies providing it is done as early as possible. For hypomyelinating leukodystrophies, therapeutic research into cell-based therapies appears promising. | Omphalitis of newborn is the medical term for inflammation of the umbilical cord stump in the neonatal newborn period, most commonly attributed to a bacterial infection. Typically immediately after an infant is born, the umbilical cord is cut with a small remnant (often referred to as the stump) left behind. Normally the stump separates from the skin within 3–45 days after birth. A small amount of pus-like material is commonly seen at the base of the stump and can be controlled by keeping the stump open to air to dry. Certain bacteria can grow and infect the stump during this process and as a result significant redness and swelling may develop, and in some cases the infection can then spread through the umbilical vessels to the rest of the body. While currently an uncommon anatomical location for infection in the newborn in the United States, it has caused significant morbidity and mortality both historically and in areas where health care is less readily available. In general, when this type of infection is suspected or diagnosed, antibiotic treatment is given, and in cases of serious complications surgical management may be appropriate. Signs and symptoms
Clinically, neonates with omphalitis present within the first two weeks of life with signs and symptoms of a skin infection (cellulitis) around the umbilical stump (redness, warmth, swelling, pain), pus from the umbilical stump, fever, fast heart rate (tachycardia), low blood pressure (hypotension), somnolence, poor feeding, and yellow skin (jaundice). Omphalitis can quickly progress to sepsis and presents a potentially life-threatening infection. | 0-1
|
The petition was supported by the American Public Health Association, the Consumer Federation of America, the Government Accountability Project, the National Consumers League, and Safe Tables Our Priority.None of the US Department of Health and Human Services targets regarding incidence of foodborne infections were reached in 2007.A report issued in June 2018 by NBCs Minneapolis station using research by both the CDC and the Minnesota Department of Health concluded that foodborne illness is on the rise in the U.S. Organizations
The World Health Organization Department of Food Safety and Zoonoses (FOS) provides scientific advice for organizations and the public on issues concerning the safety of food. Its mission is to lower the burden of foodborne disease, thereby strengthening the health security and sustainable development of Member States. Foodborne and waterborne diarrhoeal diseases kill an estimated 2.2 million people annually, most of whom are children. WHO works closely with the Food and Agriculture Organization of the United Nations (FAO) to address food safety issues along the entire food production chain—from production to consumption—using new methods of risk analysis. These methods provide efficient, science-based tools to improve food safety, thereby benefiting both public health and economic development. International Food Safety Authorities Network (INFOSAN)
The International Food Safety Authorities Network (INFOSAN) is a joint program of the WHO and FAO. INFOSAN has been connecting national authorities from around the globe since 2004, with the goal of preventing the international spread of contaminated food and foodborne disease and strengthening food safety systems globally. | Ethinylestradiol/drospirenone (EE/DRSP), sold under the brand name Yasmin among others, is a combination of ethinylestradiol (EE), an estrogen, and drospirenone (DRSP), a progestin, antimineralocorticoid, and antiandrogen, which is used as a birth control pill to prevent pregnancy in women. It is also indicated for the treatment of moderate acne, premenstrual syndrome (PMS), premenstrual dysphoric disorder (PMDD), and dysmenorrhea (painful menstruation) in women. The medication is taken by mouth and contains 30 μg EE and 3 mg DRSP per tablet (brand names Yasmin, others) or 20 μg EE and 3 mg DRSP per tablet (brand names Yaz, Yasminelle, Nikki, others). A formulation with levomefolic acid (vitamin B9) has also been marketed (brand names Beyaz, Safyral, others), with similar indications. EE/DRSP is marketed widely throughout the world.In 2019, it was the 148th most commonly prescribed medication in the United States, with more than 4 million prescriptions. See also
Ethinylestradiol/drospirenone/levomefolic acid
Ethinylestradiol/drospirenone/prasterone
Estradiol/drospirenone
List of combined sex-hormonal preparations § Estrogens and progestogens
References
External links
"Drospirenone mixture with estradiol". Drug Information Portal. U.S. National Library of Medicine. | 0-1
|
Results of recent systematic reviews and meta-analyses found opioids were not necessarily associated with more effectiveness in treatment for patients with advanced cancer.Ensuring that the balance between side effects and adverse effects from medications and potential improvements from medications needs to be carefully considered before prescribing medication. The use of systematic corticosteriods in palliative care for people with cancer is common, however the effectiveness and potential adverse effects of this approach in adults with cancer has not been well studied. Epidemiology
Shortness of breath is the primary reason 3.5% of people present to the emergency department in the United States. Of these individuals, approximately 51% are admitted to the hospital and 13% are dead within a year. Some studies have suggested that up to 27% of hospitalized people develop dyspnea, while in dying patients 75% will experience it. Acute shortness of breath is the most common reason people requiring palliative care visit an emergency department. Up to 70% of adults with advanced cancer also experience dyspnoea. Etymology and pronunciation
English dyspnea comes from Latin dyspnoea, from Greek dyspnoia, from dyspnoos, which literally means "disordered breathing". Its combining forms (dys- + -pnea) are familiar from other medical words, such as dysfunction (dys- + function) and apnea (a- + -pnea). The most common pronunciation in medical English is disp-NEE-ə, with the p expressed and the stress on the /niː/ syllable. | Some cases have been reported that the anemia is reversed or heme level is improved through use of moderate to high doses of pyridoxine (vitamin B6). In severe cases of SBA, bone marrow transplant is also an option with limited information about the success rate. Some cases are listed on MedLine and various other medical sites. In the case of isoniazid-induced sideroblastic anemia, the addition of B6 is sufficient to correct the anemia. Deferoxamine, a chelating agent, is used to treat iron overload from transfusions. Therapeutic phlebotomy can be used to manage iron overload. Prognosis
Sideroblastic anemias are often described as responsive or non-responsive in terms of increased hemoglobin levels to pharmacological doses of vitamin B6.1- Congenital: 80% are responsive, though the anemia does not completely resolve. 2- Acquired clonal: 40% are responsive, but the response may be minimal. 3- Acquired reversible: 60% are responsive, but course depends on treatment of the underlying cause. Severe refractory sideroblastic anemias requiring regular transfusions and/or that undergo leukemic transformation (5–10%) significantly reduce life expectancy. See also
Anemia
Siderosis
List of hematologic conditions
Hematopoietic stem cell transplantation
References
External links
GeneReviews/NCBI/NIH/UW entry on X-Linked Sideroblastic Anemia and Ataxia | 0-1
|
The largest multi-center study of lung function in people with PCD across many European countries found strong evidence refuting a common assumption that it is a mild disease. This study found that lung function of people with PCD is comparable to those with cystic fibrosis in childhood but is better in young adulthood. Both diseases, however, are progressive and lung function declines with age relative to peer groups. Survey data indicate that respiratory symptoms increase progressively and continuously beginning in the mid-20s relative to the population norm. History
The classic symptom combination associated with PCD was first described in 1904 by A. K. Siewert, while Manes Kartagener published his first report on the subject in 1933. The disorder is often now referred to as Siewerts syndrome or Siewert-Kartagener syndrome. References
Further reading
GeneReview/NCBI/NIH/UW entry on Primary Ciliary Dyskinesia
== External links == | Additionally, acetylcysteine has been shown to be a more effective antidote, particularly in patients presenting greater than 8 hours post-ingestion and for those who present with liver failure symptoms.If the person presents less than eight hours after paracetamol overdose, then acetylcysteine significantly reduces the risk of serious hepatotoxicity and guarantees survival. If acetylcysteine is started more than 8 hours after ingestion, there is a sharp decline in its effectiveness because the cascade of toxic events in the liver has already begun, and the risk of acute liver necrosis and death increases dramatically. Although acetylcysteine is most effective if given early, it still has beneficial effects if given as late as 48 hours after ingestion. If the person presents more than eight hours after the paracetamol overdose, then activated charcoal is not useful, and acetylcysteine is started immediately. In earlier presentations, charcoal can be given when the patient arrives and acetylcysteine is initiated while waiting for the paracetamol level results to return from the laboratory.In United States practice, intravenous (IV) and oral administration are considered to be equally effective and safe if given within 8 hours of ingestion. However, IV is the only recommended route in Australasian and British practice. Oral acetylcysteine is given as a 140 mg/kg loading dose followed by 70 mg/kg every four hours for 17 more doses, and if the patient vomits within 1 hour of dose, the dose must be repeated. Oral acetylcysteine may be poorly tolerated due to its unpleasant taste, odor, and its tendency to cause nausea and vomiting. | 0-1
|
one eyes optic nerve is more damaged than the other, it will produce an important sign called an afferent pupillary defect.Defective light perception in one eye causes an asymmetrical pupillary constriction reflex called the afferent pupillary defect (APD). Arteritic PION
A-PION most commonly affects Caucasian women, with an average age of 73. At onset vision loss is unilateral, but without treatment it rapidly progresses to involve both eyes. Vision loss is usually severe, ranging from counting fingers to no light perception. Associated symptoms are jaw pain exacerbated by chewing, scalp tenderness, shoulder and hip pain, headache and fatigue. Perioperative PION
Vision loss is usually apparent upon waking from general anesthesia. Signs observable to a bystander include long surgery duration and facial swelling. Vision loss is usually bilateral and severe, ranging from counting fingers to no light perception. Cause
PION is a watershed infarction of the optic nerve that may cause either unilateral or, more often, bilateral blindness. PION typically occurs in two categories of people:
People who have undergone non-ocular surgery that is particularly prolonged or is associated with a significant blood loss. People who have experienced significant bleeding from an accident or ruptured blood vessels. In these cases, the person may develop anemia (too few oxygen-delivering red blood cells in the bloodstream) and often have low blood pressure as well. This combination can produce circulatory shock, and PION has sometimes been called shock-induced optic neuropathy.The combination of anemia and low blood pressure means that the blood is carrying less oxygen to the tissues. | The mean patient age was 62 years in one series (range 18 to 90 years).The mean age varies by etiology category; patients with giant cell arteritis (GCA) are older (mean 78 years, range 50 to 82 years), while those with PION in the setting of spine surgery are younger on average.There is a higher than expected prevalence of atherosclerotic risk factors and comorbid vascular disease, especially in patients with nonarteritic (idiopathic) PION, with 87 percent of patients having at least one risk factor for, or one other manifestation of, atherosclerotic vascular disease. While anterior ischemic optic neuropathy (AION) appears to be more common than PION after cardiac surgery, PION is relatively more common in cases of spine surgery. References
Further reading
Luneau K, Newman NJ, Biousse V (November 2008). "Ischemic optic neuropathies". The Neurologist. 14 (6): 341–54. doi:10.1097/NRL.0b013e318177394b. PMID 19008740. S2CID 8445417. Remigio D, Wertenbaker C (2000). "Post-operative bilateral vision loss". Survey of Ophthalmology. 44 (5): 426–32. doi:10.1016/S0039-6257(00)00107-7. PMID 10734242. Buono LM, Foroozan R, Savino PJ, Danesh-Meyer HV, Stanescu D (June 2003). "Posterior ischemic optic neuropathy after hemodialysis". Ophthalmology. 110 (6): 1216–8. doi:10.1016/S0161-6420(03)00257-4. PMID 12799249. == External links == | 11
|
From the treatments of Ashanthi DeSilva in 1990 which is considered gene therapys first success until 2014 around 60 patients were treated for either ADA-SCID or X-SCID using retroviruses vectors but as previously mentioned the occurrence of cases developing leukemia forced to make changes to improve safety, more recently in 2019 a new method using an altered version of the HIV virus as a lentivirus vector was reported in the treatment of 8 children with X-SCID, and in 2021 the same method was used in 50 children with ADA-SCID obtaining positive results in 48 of them.There are also some non-curative methods for treating SCID. Reverse isolation involves the use of laminar air flow and mechanical barriers (to avoid physical contact with others) to isolate the patient from any harmful pathogens present in the external environment. A non-curative treatment for patients with ADA-SCID is enzyme replacement therapy, in which the patient is injected with polyethyleneglycol-coupled adenosine deaminase (PEG-ADA) which metabolizes the toxic substrates of the ADA enzyme and prevents their accumulation. Treatment with PEG-ADA may be used to restore T cell function in the short term, enough to clear any existing infections before proceeding with curative treatment such as a bone marrow transplant. Epidemiology
The most commonly quoted figure for the prevalence of SCID is around 1 in 100,000 births, although this is regarded by some to be an underestimate of the true prevalence; some estimates predict that the prevalence rate is as high as 1 in 50,000 live births. | A tophus (Latin: "stone", plural tophi) is a deposit of monosodium urate crystals, in people with longstanding high levels of uric acid in the blood, a condition known as hyperuricemia. Tophi are pathognomonic for the disease gout. Most people with tophi have had previous attacks of acute arthritis, eventually leading to the formation of tophi. Chronic tophaceous gout is known as Harrison Syndrome.Tophi form in the joints, cartilage, bones, and other places throughout the body. Sometimes, tophi break through the skin and appear as white or yellowish-white, chalky nodules. Without treatment, tophi may develop on average about ten years after the onset of gout, although their first appearance can range from three to forty-two years. The development of gouty tophi can also limit joint function and cause bone destruction, leading to noticeable disabilities, especially when gout cannot successfully be treated. When uric acid levels and gout symptoms cannot be controlled with standard gout medicines that decrease the production of uric acid (e.g., allopurinol, febuxostat) or increase uric acid elimination from the body through the kidneys (e.g., probenecid), this can be referred to as refractory chronic gout (RCG). They are more apt to appear early in the course of the disease in people who are older. Although less common, tophi can also form in the kidneys and nasal cartilage. Pathophysiology
It appears that monosodium urate crystals trigger a distinct physiological NETosis pathway that coats them in DNA. These coated crystals then persist in tissues as a foreign body granuloma constituting gouty tophus. | 0-1
|
In some cases, stretching of the abdominal wall to accommodate intestinal contents may be required. Non-operative therapy uses escharotic ointments. This is used for infants with large omphaloceles that have been born prematurely with respiratory insufficiency and associated chromosomal defects, as they would not be able to tolerate surgery. The ointment causes the sac to granulate and epithelialize, which leaves a residual large ventral hernia, which can be repaired later with surgery when the baby is more stable. After surgery, for larger omphaloceles, mechanical ventilation and parenteral nutrition is needed to manage the baby. Society and culture
Awareness Day
International Omphalocele Awareness Day is celebrated annually in the US on January 31, as part of Birth Defect Awareness Month. Several U.S. states have passed resolutions to officially recognize the date. References
Omphalocele Diagnosis and Treatment at SSM Health St. Louis Fetal Care Institute
The Brown Fetal Treatment Program - Providence, Rhode Island at Brown University
Fetal Treatment Center: Omphalocele at UCSF
Gastroschisis Exomphalos Extrophies Parent Support (GEEPS)
== External links == | Atrophic rhinitis is also associated with similar atrophic changes in the pharynx or larynx, producing symptoms pertaining to these structures. Hearing impairment can occur due to Eustachian tube blockage causing middle ear effusion. Etiology
Causes can be remembered by the mnemonic HERNIA:
Hereditary factors: the disease runs in families
Endocrine imbalance: the disease tends to start at puberty and mostly involves females
Racial factors: white people are more susceptible than natives of equatorial Africa
Nutritional deficiency: vitamins A or D, or iron
Infection: Klebsiella ozaenae, diphtheroids, Proteus vulgaris, E. coli, etc. Autoimmune factors: viral infection or some other unidentified insult may trigger antigenicity of the nasal mucosa. Secondary atrophic rhinitis
Specific infections, such as syphilis, leprosy and rhinoscleroma, may cause destruction of the nasal structures leading to atrophic changes. Atrophic rhinitis can also result from long-standing purulent sinusitis or radiotherapy of the nose, or as a complication of surgery of the turbinates. The United Kingdom National Health Service has stated that "Most cases of atrophic rhinitis in the UK occur when the turbinates are damaged or removed during surgery". Some authors refer to as Atrophic rhinitis secondary to sinus surgery as the empty nose syndrome. Unilateral atrophic rhinitis
Extreme deviation of nasal septum may be accompanied by atrophic rhinitis on the wider side. Pathology
The ciliated columnar epithelium of the nasal mucosa is replaced by stratified squamous epithelium. Atrophy of mucosa, turbinal bones and seromucinous glands tends to occur, due to obliterative endarteritis and periarteritis causing decreased blood supply, hence the supplying area atrophies. Arrested development of paranasal sinuses. | 0-1
|
The condition is classified as bipolar I disorder if there has been at least one manic episode, with or without depressive episodes, and as bipolar II disorder if there has been at least one hypomanic episode (but no full manic episodes) and one major depressive episode. It is classified as Cyclothymia if there are hypomanic episodes with periods of depression that do not meet the criteria for major depressive episodes. If these symptoms are due to drugs or medical problems, they are not diagnosed as bipolar disorder. Other conditions that have overlapping symptoms with bipolar disorder include attention deficit hyperactivity disorder, personality disorders, schizophrenia, and substance use disorder as well as many other medical conditions. Medical testing is not required for a diagnosis, though blood tests or medical imaging can rule out other problems.Mood stabilizers—lithium and certain anticonvulsants such as valproate and carbamazepine as well as atypical antipsychotics such as aripiprazole—are the mainstay of long-term pharmacologic relapse prevention. Antipsychotics are additionally given during acute manic episodes as well as in cases where mood stabilizers are poorly tolerated or ineffective. In patients where compliance is of concern, long-acting injectable formulations are available. There is some evidence that psychotherapy improves the course of this disorder. The use of antidepressants in depressive episodes is controversial: they can be effective but have been implicated in triggering manic episodes. The treatment of depressive episodes, therefore, is often difficult. Electroconvulsive therapy (ECT) is effective in acute manic and depressive episodes, especially with psychosis or catatonia. | : 84–5 In France, buprenorphine prescription for opioid use disorder has been permitted without any special training or restrictions since 1995, resulting in treatment of approximately ten times more patients per year with buprenorphine than with methadone in the following decade. In 2021, seeking to address record levels of opioid overdose, the United States also removed the requirement for a special waiver for prescribing physicians. Whether this change will be sufficient to impact prescription is unclear, since even before the change as many as half of physicians with a waiver permitting them to prescribe buprenorphine did not do so, and one third of non-waivered physicians reported that nothing would induce them to prescripe buprenorphine for opioid use disorder. Chronic pain
A transdermal patch is available for the treatment of chronic pain. These patches are not indicated for use in acute pain, pain that is expected to last only for a short period of time, or pain after surgery, nor are they recommended for opioid addiction. Potency
With respect to equianalgesic dosing, when used sublingually, the potency of buprenorphine is about 40 to 70 times that of morphine. When used as a transdermal patch, the potency of buprenorphine may be 100 to 115 times that of morphine. Veterinary uses
Veterinarians frequently administer buprenorphine for perioperative pain, particularly in cats, where its effects are similar to morphine. The drugs legal status and lower potential for human abuse makes it an attractive alternative to other opioids. | 0-1
|
Differential diagnosis
The parameters for normal menstruation have been defined as a result of an international process designed to simplify terminologies and definitions for abnormalities of menstrual bleeding. The causes of abnormal vaginal bleeding vary by age. In children
Bleeding in children is of concern if it occurs before the expected time of menarche and in the absence of appropriate pubertal development. Bleeding before the onset of pubertal development deserves evaluation. It could result from local causes or from hormonal factors. In children, it may be challenging to determine the source of bleeding, and "vaginal" bleeding may actually arise from the bladder or urethra, or from the rectum.Vaginal bleeding in the first week of life after birth is a common observation, and pediatricians typically discuss this with new mothers at the time of hospital discharge. During childhood, other possible causes include the presence of a foreign body in the vagina, trauma (either accidental or non accidental, i.e. child sexual abuse or molestation), urethral prolapse, vaginal infection (vaginitis), vulvar ulcers, vulvar skin conditions such as lichen sclerosus, and rarely, a tumor (benign or malignant vaginal tumors, or hormone-producing ovarian tumors). Hormonal causes include central precocious puberty, or peripheral precocious puberty (McCune–Albright syndrome), or primary hypothyroidism.While the symptom is typically alarming to parents, most causes are benign, although sexual abuse or tumor are particularly important to exclude. | Vaginal bleeding is any expulsion of blood from the vagina. This bleeding may originate from the uterus, vaginal wall, or cervix. Generally, it is either part of a normal menstrual cycle or is caused by hormonal or other problems of the reproductive system, such as abnormal uterine bleeding. Vaginal bleeding during pregnancy can be normal, especially in early pregnancy. However, bleeding may also indicate a pregnancy complication that needs to be medically addressed. During pregnancy bleeding is usually, but not always, related to the pregnancy itself. Regular monthly vaginal bleeding during the reproductive years, menstruation, is a normal physiologic process. During the reproductive years, bleeding that is excessively heavy (menorrhagia or heavy menstrual bleeding), occurs between monthly menstrual periods (intermenstrual bleeding), occurs more frequently than every 21 days (abnormal uterine bleeding), occurs too infrequently (oligomenorrhea), or occurs after vaginal intercourse (postcoital bleeding) should be evaluated.The causes of abnormal vaginal bleeding vary by age, and such bleeding can be a sign of specific medical conditions ranging from hormone imbalances or anovulation to malignancy (cervical cancer, vaginal cancer or uterine cancer). In young children, or elderly adults with cognitive impairment, the source of bleeding may not be obvious, and may be from the urinary tract (hematuria) or the rectum rather than the vagina, although most adult women can identify the site of bleeding. When vaginal bleeding occurs in prepubertal children or in postmenopausal women, it always needs medical attention. | 11
|
In 1832, Dr. JJ Hjort conducted the first leprosy survey, thus establishing a basis for epidemiological surveys. Subsequent surveys resulted in the establishment of a national leprosy registry to study the causes of leprosy and for tracking the rate of infection. Early leprosy research throughout Europe was conducted by Norwegian scientists Daniel Cornelius Danielssen and Carl Wilhelm Boeck. Their work resulted in the establishment of the National Leprosy Research and Treatment Center. Danielssen and Boeck believed the cause of leprosy transmission was hereditary. This stance was influential in advocating for the isolation of those infected by sex to prevent reproduction. Colonialism and imperialism
Though leprosy in Europe was again on the decline by the 1860s, Western countries embraced isolation treatment out of fear of the spread of disease from developing countries, minimal understanding of bacteriology, lack of diagnostic ability or knowledge of how contagious the disease was, and missionary activity. Growing imperialism and pressures of the industrial revolution resulted in a Western presence in countries where leprosy was endemic, namely the British presence in India. Isolation treatment methods were observed by Surgeon-Mayor Henry Vandyke Carter of the British Colony in India while visiting Norway, and these methods were applied in India with the financial and logistical assistance of religious missionaries. Colonial and religious influence and associated stigma continued to be a major factor in the treatment and public perception of leprosy in endemic developing countries until the mid-twentieth century. | A proven human case was verified by DNA taken from the shrouded remains of a man discovered in a tomb next to the Old City of Jerusalem, Israel, dated by radiocarbon methods to the first half of the 1st century.The oldest strains of leprosy known from Europe are from Great Chesterford in southeast England and dating back to AD 415–545. These findings suggest a different path for the spread of leprosy, meaning it may have originated in Western Eurasia. This study also indicates that there were more strains in Europe at the time than previously determined. Discovery and scientific progress
Literary attestation of leprosy is unclear because of the ambiguity of many early sources, including the Indian Atharvaveda and Kausika Sutra, the Egyptian Ebers papyrus, and the Hebrew Bibles various sections regarding signs of impurity (tzaraath). Clearly leprotic symptoms are attested in the Indian doctor Sushrutas Compendium, originally dating to c. 600 BC but only surviving in emended texts no earlier than the 5th century. They were separately described by Hippocrates in 460 BC. However, Hansens disease probably did not exist in Greece or the Middle East before the Common Era. In 1846, Francis Adams produced The Seven Books of Paulus Aegineta which included a commentary on all medical and surgical knowledge and descriptions and remedies to do with leprosy from the Romans, Greeks, and Arabs.Leprosy did not exist in the Americas before colonization by modern Europeans nor did it exist in Polynesia until the middle of the 19th century. | 11
|
Elisabeth Young-Bruehl maintained that despite the growing numbers of child advocates and interest in protecting children which took place, the grouping of children into "the abused" and the "non-abused" created an artificial distinction that narrowed the concept of childrens rights to simply protection from maltreatment, and blocked investigation of how children are discriminated against in society generally. Another effect of the way child abuse and neglect have been studied, according to Young-Bruehl, was to close off consideration of how children themselves perceive maltreatment and the importance they place on adults attitudes toward them. Young-Bruehl wrote that when the belief in childrens inherent inferiority to adults is present in society, all children suffer whether or not their treatment is labeled as "abuse". : 15–16
Definitions
Definitions of what constitutes child abuse vary among professionals, between social and cultural groups, and across time. The terms abuse and maltreatment are often used interchangeably in the literature. : 11 Child maltreatment can also be an umbrella term covering all forms of child abuse and child neglect. Defining child maltreatment depends on prevailing cultural values as they relate to children, child development, and parenting. Definitions of child maltreatment can vary across the sectors of society which deal with the issue, such as child protection agencies, legal and medical communities, public health officials, researchers, practitioners, and child advocates. Since members of these various fields tend to use their own definitions, communication across disciplines can be limited, hampering efforts to identify, assess, track, treat, and prevent child maltreatment. | According to the World Health Organization (WHO), estimates of the rates of child maltreatment vary widely by country, depending on how child maltreatment is defined, the type of maltreatment studied, the scope and quality of data gathered, and the scope and quality of surveys that ask for self-reports from victims, parents, and caregivers. Despite these limitations, international studies show that a quarter of all adults report experiencing physical abuse as children, and that 1 in 5 women and 1 in 13 men report experiencing childhood sexual abuse. Emotional abuse and neglect are also common childhood experiences.As of 2014, an estimated 41,000 children under 15 are victims of homicide each year. The WHO states that this number underestimates the true extent of child homicide; a significant proportion of child deaths caused by maltreatment are incorrectly attributed to unrelated factors such as falls, burns, and drowning. Also, girls are particularly vulnerable to sexual violence, exploitation and abuse in situations of armed conflict and refugee settings, whether by combatants, security forces, community members, aid workers, or others. United States
The National Research Council wrote in 1993 that "...the available evidence suggests that child abuse and neglect is an important, prevalent problem in the United States [...] Child abuse and neglect are particularly important compared with other critical childhood problems because they are often directly associated with adverse physical and mental health consequences in children and families". | 11
|
Many negative side effects can go along with these treatments, and treatments often are unsatisfying overall. Scarring, irritation, lighter patches of skin, and contact dermatitis are all commonly seen. Patients should avoid other precipitants, including hormonal triggers. Cosmetic camouflage can also be used to hide melasma. See also
Linea nigra
List of cutaneous conditions
References
External links
DermNet colour/melasma | Neurological examination may reveal a stiff neck in occasional cases (erroneously suggesting meningitis). Pathophysiology
Bacterial
Anaerobic and microaerophilic cocci and gram-negative and gram-positive anaerobic bacilli are the predominant bacterial isolates. Many brain abscesses are polymicrobial. The predominant organisms include: Staphylococcus aureus, aerobic and anaerobic streptococci (especially Streptococcus intermedius), Bacteroides, Prevotella, and Fusobacterium species, Enterobacteriaceae, Pseudomonas species, and other anaerobes. Less common organisms include: Haemophillus influenzae, Streptococcus pneumoniae and Neisseria meningitidis.Bacterial abscesses rarely (if ever) arise de novo within the brain, although establishing a cause can be difficult in many cases. There is almost always a primary lesion elsewhere in the body that must be sought assiduously, because failure to treat the primary lesion will result in relapse. In cases of trauma, for example in compound skull fractures where fragments of bone are pushed into the substance of the brain, the cause of the abscess is obvious. Similarly, bullets and other foreign bodies may become sources of infection if left in place. The location of the primary lesion may be suggested by the location of the abscess: infections of the middle ear result in lesions in the middle and posterior cranial fossae; congenital heart disease with right-to-left shunts often result in abscesses in the distribution of the middle cerebral artery; and infection of the frontal and ethmoid sinuses usually results in collection in the subdural sinuses. Other organisms
Fungi and parasites may also cause the disease. Fungi and parasites are especially associated with immunocompromised patients. Other causes include: Nocardia asteroides, Mycobacterium, Fungi (e.g. | 0-1
|
By increasing the quantity of an abnormal, but potentially functional, dystrophin protein, the objective is to slow or prevent the progression of DMD. Nature and sequence of oligo and target
Eteplirsen is a morpholino phosphorodiamidate antisense oligomer. CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488),
30-mer,
20% G,
43% CG,
Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement
CTAGAAATGCCATCTTCCTTGATGTTGGAG
DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT
CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC
GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA
GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Pharmacokinetics
Following single or multiple intravenous infusions, the majority of drug elimination occurred within 24 hours of intravenous administration. Elimination half-life of eteplirsen was 3 to 4 hours. History
New Drug Applications (NDA) for eteplirsen and a similar drug drisapersen were filed with the US Food and Drug Administration (FDA) in August 2015. The Prescription Drug User Fee Act (PDUFA) goal dates for these were December 27, 2015 for drisapersen and February 26, 2016, for eteplirsen. Following FDA rejection of drisapersen, the agency announced a three-month time extension for its review of eteplirsen. The FDA panel decision was controversial because the FDA staff and the panel used a stricter standard of evidence than Sarepta and patient groups used. The FDA panel said that it was required by law to apply the standard of "substantial evidence" of effectiveness. This required randomized, controlled trials showing effectiveness of a meaningful clinical outcome, such as the ability to function in daily life. | Tabloid may refer to:
Tabloid journalism, a type of journalism
Tabloid (newspaper format), a newspaper with compact page size
Chinese tabloid
Tabloid (paper size), a North American paper size
Sopwith Tabloid, a biplane aircraft
Tabloid (film), a 2010 documentary by Errol Morris
Tabloid (TV series), a Canadian television series
See also
The Tabloid (Matlock episode), 1994 episode of the television show Matlock
Tabloid Magazine (disambiguation) | 0-1
|
These clots can also be formed in other parts of the body. Once they enter the bloodstream, it makes it difficult for the organs in the body to receive blood, due to the blockage caused by the clots. This can impact other body systems as well and lead to other problems. Diagnosis
There are many techniques and tests used to diagnose an enlarged heart. The results of these tests can often be used to see how efficiently the heart is pumping, determine which chambers of the heart are enlarged, look for evidence of previous heart attacks and determine if a person has congenital heart disease. Chest X-Ray: X-ray images help see the condition of the lungs and heart. If the heart is enlarged on an X-ray, other tests will usually be needed to find the cause. A useful measurement on X-ray is the cardio-thoracic ratio, which is the transverse diameter of the heart, compared with that of the thoracic cage." These diameters are taken from PA chest x-rays using the widest point of the chest and measuring as far as the lung pleura, not the lateral skin margins. If the cardiac thoracic ratio is greater than 50%, pathology is suspected, assuming the x-ray has been taken correctly. The measurement was first proposed in 1919 to screen military recruits. A newer approach to using these x-rays for evaluating heart health takes the ratio of heart area to chest area and has been called the two-dimensional cardiothoracic ratio. | Fumarase deficiency (or fumaric aciduria) is an exceedingly rare autosomal recessive metabolic disorder in the Krebs cycle, characterized by a deficiency of the enzyme fumarate hydratase, which causes a buildup of fumaric acid in the urine and a deficiency of malate. Only 13 cases were known worldwide in 1990, after which a cluster of 20 cases was documented in a community in Arizona that has practiced successive endogamy. Presentation
Fumarase deficiency causes encephalopathy, severe intellectual disabilities, unusual facial features, brain malformation, and epileptic seizures due to an abnormally low amount of fumarase in cells. It can initially present with polyhydramnios on prenatal ultrasound. Affected neonates may demonstrate nonspecific signs of poor feeding and hypotonia. Laboratory findings in neonates may indicate polycythemia, leukopenia, or neutropenia. As they age, neurological deficits begin to manifest with seizures, dystonias, and severe developmental delay. Pathophysiology
Fumarase deficiency is caused by a mutation in the fumarate hydratase (FH) gene in humans, which encodes the enzyme that converts fumarate to malate in the mitochondria. Other mutant alleles of the FH gene, located on human Chromosome 1 at position 1q42.1, cause multiple cutaneous and uterine leiomyomata, hereditary leiomyomatosis and renal cell cancer. Fumarase deficiency is one of the few known deficiencies of the Krebs cycle or tricarboxylic acid cycle, the main enzymatic pathway of cellular aerobic respiration. The condition is an autosomal recessive disorder, and it is therefore usually necessary for an affected individual to receive the mutant allele from both parents. | 0-1
|
For example, Bromberg (1986) has argued that the syndrome is not due to or related to mental illness, but rather a sort of defense against legal punishment. Some see it as conscious lying, denial and repression, presenting Ganser syndrome symptoms as malingering instead of a dissociative or factitious disorder.One case study of Ganser syndrome presented a middle-aged man who had been in a car crash and wanted disability insurance benefits. Since he had a big incentive, psychologists took careful measures and implemented testing with malingering instruments, which showed that the man performed below chance on simple memory tests and claimed to experience non-existent symptoms. Upon further inspection of the collateral information, they found that the patient took part in high-level sports and other activities that were inconsistent with the cognitive dysfunctions he reported, and they determined it to be a case of malingering.Estes and New (1948) concluded that the motivation for the symptoms of the syndrome was escaping an "intolerable situation". Stern and Whiles proposed an alternative explanation, citing Ganser syndrome presented itself in individuals who, although not psychologically well, do not realize it, and want to appear so. Still others attribute the syndrome to inattention, purposeful evasion, suppression, alcoholic excess, head injury, and to unconscious attempts to deceive others as a means to free themselves from responsibility for their actions. | Water molecules freely diffuse through the plasma membrane in both directions, and as the rate of water diffusion is the same in each direction, the cell will neither gain nor lose water. == References == | 0-1
|
Arachnodactyly ("spider fingers") is a medical condition that is characterized by fingers and toes that are abnormally long and slender, in comparison to the palm of the hand and arch of the foot. In some cases, the thumbs of an individual with the condition are pulled inwards towards the palm. This condition is present at birth. Causes
This feature can occur on its own with no underlying health problems, or it can be associated with certain medical conditions, including Marfan syndrome, Ehlers–Danlos syndromes, Loeys–Dietz syndrome, and homocystinuria. It is also seen in congenital contractural arachnodactyly, which is caused by mutation in the gene encoding fibrillin-2 on chromosome 5q23. Notable cases
It remains unconfirmed whether composer Sergei Rachmaninoffs abnormally large reach on a piano was a result of arachnodactyly due to Marfan syndrome, as the pianist exhibited no other signs of the disease.It is also uncertain if blues guitarist and vocalist Robert Johnsons long fingers were attributed to the disease also due to Marfan syndrome. See also
Marfanoid
References
== External links == | Some key differences between EAE in mice, and MS in humans include:
B-cells: Some research points to anti-CD20 B-cells being the basis of the autoimmune attacks. This has been shown to be completely different in EAE and MS.
oxidative injury: Mitochondrial injury is seen in EAE and MS, but mitochondrial gene deletions have so far only been detected in MS lesions. microglia behaviour: In contrast to experimental models of inflammatory demyelination, lesion formation in multiple sclerosis occurs on a background of pro-inflammatory microglia activation, which is seen already in the normal white matter of age-matched controls, and this may contribute to neurodegeneration in the disease. pathological patterns: EAE is unable to reproduce MS pathological patterns III and IV. Secondary damage
Given that some conditions as MS show cortical damage together with the WM damage, there has been interest if this can appear as a secondary damage of the WM. Human Anti-MOG in mice
Anti-MOG associated encephalomyelitis can be passed from humans to mice, inducing MS type II demyelination (pattern II)
Immunogenetic interactions
Deficiency of TBX21 or STAT4 provides resistance against EAE, while interferon-γ-, interferon-γ-receptor-, interleukin-12 subunit α-, interleukin 12 receptor, β 2 subunit-, and interleukin 18-deficiency exacerbated disease. In humans
Sometimes the human equivalent to EAE has been triggered in humans by accident or medical mistake. The reactions have been diverse according to the sources of the disease The researchers in the last report have termed the condition "human autoimmune encephalitis" (HAE). | 0-1
|
On the bone-marrow biopsy, high-grade dysplasia (RAEB-I and RAEB-II) may show atypical localization of immature precursors, which are islands of immature precursors cells (myeloblasts and promyelocytes) localized to the center of the intertrabecular space rather than adjacent to the trabeculae or surrounding arterioles. This morphology can be difficult to differentiate from treated leukemia and recovering immature normal marrow elements. Also, topographic alteration of the nucleated erythroid cells can be seen in early myelodysplasia (RA and RARS), where normoblasts are seen next to bony trabeculae instead of forming normal interstitially placed erythroid islands. Differential diagnosis
Myelodysplasia is a diagnosis of exclusion and must be made after proper determination of iron stores, vitamin deficiencies, and nutrient deficiencies are ruled out. Also, congenital diseases such as congenital dyserythropoietic anemia (CDA I through IV) have been recognized, Pearsons syndrome (sideroblastic anemia), Jordans anomaly – vacuolization in all cell lines may be seen in Chanarin-Dorfman syndrome, aminolevulinic acid enzyme deficiency and other more esoteric enzyme deficiencies are known to give a pseudomyelodysplastic picture in one of the cell lines; however, all three cell lines are never morphologically dysplastic in these entities with the exception of chloramphenicol, arsenic toxicity, and other poisons.All of these conditions are characterized by abnormalities in the production of one or more of the cellular components of blood (red cells, white cells other than lymphocytes, and platelets or their progenitor cells, megakaryocytes). | The International Prognostic Scoring System is another tool for determining the prognosis of MDS, published in Blood in 1997. This system takes into account the percentage of blasts in the marrow, cytogenetics, and number of cytopenias. Genetic markers
Although not yet formally incorporated in the generally accepted classification systems, molecular profiling of myelodysplastic syndrome genomes has increased the understanding of prognostic molecular factors for this disease. For example, in low-risk MDS, IDH1 and IDH2 mutations are associated with significantly worsened survival. Epidemiology
The exact number of people with MDS is not known because it can go undiagnosed and no tracking of the syndrome is mandated. Some estimates are on the order of 10,000 to 20,000 new cases each year in the United States alone. The number of new cases each year is probably increasing as the average age of the population increases, and some authors propose that the number of new cases in those over 70 may be as high as 15 per 100,000 per year.The typical age at diagnosis of MDS is between 60 and 75 years; a few people are younger than 50, and diagnoses are rare in children. Males are slightly more commonly affected than females. History
Since the early 20th century, some people with acute myelogenous leukemia were begun to be recognized to have a preceding period of anemia and abnormal blood cell production. These conditions were lumped together with other diseases under the term "refractory anemia". The first description of "preleukemia" as a specific entity was published in 1953 by Block et al. | 11
|
However, both the possessive and nonpossessive forms remain in use by the general population. The term "trisomy 21" is also commonly used. Ethics
Most obstetricians argue that not offering screening for Down syndrome is unethical. As it is a medically reasonable procedure, per informed consent, people should at least be given information about it. It will then be the womans choice, based on her personal beliefs, how much or how little screening she wishes. When results from testing become available, it is also considered unethical not to give the results to the person in question.Some bioethicists deem it reasonable for parents to select a child who would have the highest well-being. One criticism of this reasoning is that it often values those with disabilities less. Some parents argue that Down syndrome should not be prevented or cured and that eliminating Down syndrome amounts to genocide. The disability rights movement does not have a position on screening, although some members consider testing and abortion discriminatory. Some in the United States who are anti-abortion support abortion if the fetus is disabled, while others do not. Of a group of 40 mothers in the United States who have had one child with Down syndrome, half agreed to screening in the next pregnancy.Within the US, some Protestant denominations see abortion as acceptable when a fetus has Down syndrome while Orthodox Christianity and Roman Catholicism do not. Some of those against screening refer to it as a form of eugenics. | Cognitive development
Hearing aids or other amplification devices can be useful for language learning in those with hearing loss. Speech therapy may be useful and is recommended to be started around nine months of age. As those with Down syndrome typically have good hand-eye coordination, learning sign language may be possible. Augmentative and alternative communication methods, such as pointing, body language, objects, or pictures, are often used to help with communication. Behavioral issues and mental illness are typically managed with counseling or medications.Education programs before reaching school age may be useful. School-age children with Down syndrome may benefit from inclusive education (whereby students of differing abilities are placed in classes with their peers of the same age), provided some adjustments are made to the curriculum. Evidence to support this, however, is not very strong. In the United States, the Individuals with Disabilities Education Act of 1975 requires public schools generally to allow attendance by students with Down syndrome.Individuals with Down syndrome may learn better visually. Drawing may help with language, speech, and reading skills. Children with Down syndrome still often have difficulty with sentence structure and grammar, as well as developing the ability to speak clearly. Several types of early intervention can help with cognitive development. Efforts to develop motor skills include physical therapy, speech and language therapy, and occupational therapy. Physical therapy focuses specifically on motor development and teaching children to interact with their environment. Speech and language therapy can help prepare for later language. Lastly, occupational therapy can help with skills needed for later independence. | 11
|
Micropsia is a condition affecting human visual perception in which objects are perceived to be smaller than they actually are. Micropsia can be caused by optical factors (such as wearing glasses), by distortion of images in the eye (such as optically, via swelling of the cornea or from changes in the shape of the retina such as from retinal edema, macular degeneration, or central serous retinopathy), by changes in the brain (such as from traumatic brain injury, epilepsy, migraines, prescription drugs, and illicit drugs), and from psychological factors. Dissociative phenomena are linked with micropsia, which may be the result of brain-lateralization disturbance.Micropsia is also commonly reported when the eyes are fixating at (convergence), or focusing at (accommodation), a distance closer than that of the object in accord with Emmerts law. Specific types of micropsia include hemimicropsia, a form of micropsia that is localized to one half of the visual field and can be caused by brain lesions in one of the cerebral hemispheres. Related visual distortion conditions include macropsia, a less common condition with the reverse effect, and Alice in Wonderland syndrome, a condition that has symptoms that can include both micropsia and macropsia. Signs and symptoms
Micropsia causes affected individuals to perceive objects as being smaller or more distant than they actually are.The majority of individuals with micropsia are aware that their perceptions do not mimic reality. Many can imagine the actual sizes of objects and distances between objects. | Treatment
Treatment varies for micropsia due to the large number of different causes for the condition.Treatments involving the occlusion of one eye and the use of a prism fitted over an eyeglass lens have both been shown to provide relief from micropsia.Micropsia that is induced by macular degeneration can be treated in several ways. A study called AREDS (age-related eye disease study) determined that taking dietary supplements containing high-dose antioxidants and zinc produced significant benefits with regard to disease progression. This study was the first ever to prove that dietary supplements can alter the natural progression and complications of a disease state. Laser treatments also look promising but are still in clinical stages. Epidemiology
Episodes of micropsia or macropsia occur in 9% of adolescents.10-35% of those with migraines experience auras, with 88% of these patients experiencing both visual auras (which include micropsia) and neurological auras.Micropsia seems to be slightly more common in boys than in girls among children who experience migraines.Approximately 80% of temporal lobe seizures produce auras that may lead to micropsia or macropsia. They are a common feature of simple partial seizures and usually precede complex partial seizures of temporal lobe origin.Central Serous Chorioretinopathy (CSCR) which can produce micropsia predominantly affects persons between the ages of 20 and 50. Women appear to be affected more than men by a factor of almost 3 to 1. | 11
|
In addition to observing that the majority of their female subjects could only have clitoral orgasms, they found that both clitoral and vaginal orgasms had the same stages of physical response. On this basis, they argued that clitoral stimulation is the source of both kinds of orgasms, reasoning that the clitoris is stimulated during penetration by friction against its hood; their notion that this provides the clitoris with sufficient sexual stimulation has been criticized by researchers such as Elisabeth Lloyd.Australian urologist Helen OConnells 2005 research additionally indicates a connection between orgasms experienced vaginally and the clitoris, suggesting that clitoral tissue extends into the anterior wall of the vagina and that therefore clitoral and vaginal orgasms are of the same origin. Some studies, using ultrasound, have found physiological evidence of the G-spot in women who report having orgasms during vaginal intercourse, but OConnell suggests that the clitoriss interconnected relationship with the vagina is the physiological explanation for the conjectured G-spot. Having used MRI technology which enabled her to note a direct relationship between the legs or roots of the clitoris and the erectile tissue of the "clitoral bulbs" and corpora, and the distal urethra and vagina, she stated that the vaginal wall is the clitoris; that lifting the skin off the vagina on the side walls reveals the bulbs of the clitoris—triangular, crescental masses of erectile tissue. | Though Dixson classifies humans as mildly polygynous in his survey of primate sexuality, he appears to have doubts, when he writes, "One might argue that ... the females orgasm is rewarding, increases her willingness to copulate with a variety of males rather than one partner, and thus promotes sperm competition." Ryan and Jethá use this as evidence for their theory that partible paternity and promiscuity were common for early modern humans. Adaptive or vestigial
The clitoris is homologous to the penis; that is, they both develop from the same embryonic structure. While researchers such as Geoffrey Miller, Helen Fisher, Meredith Small and Sarah Blaffer Hrdy "have viewed the clitoral orgasm as a legitimate adaptation in its own right, with major implications for female sexual behavior and sexual evolution," others, such as Donald Symons and Stephen Jay Gould, have asserted that the clitoris is vestigial or nonadaptive, and that the female orgasm serves no particular evolutionary function. However, Gould acknowledged that "most female orgasms emanate from a clitoral, rather than vaginal (or some other), site" and stated that his nonadaptive belief "has been widely misunderstood as a denial of either the adaptive value of female orgasm in general, or even as a claim that female orgasms lack significance in some broader sense". | 11
|
Four times the strength of the regular U.S.P." tincture, for $9.35 per pint; (2) Opium, Camphorated Conc. "1 oz. making 8 ozs. Tr. Opii Camphorated U.S.P (Paregoric)" for $2.00 per pint; (3) Opium, Concentrated (Deodorized and Denarcotized) "Four times the strength of tincture, Used when Tinct. Opii U.S.P. is contraindicated" for $9.50 per pint, and (4) Opium (Aqueous), U.S.P., 1890, "Tr. (assayed) Papaver Somniferum" for $2.25 per pint.In 1929–30, Parke, Davis & Co., a major US drug manufacturer based in Detroit, Michigan, sold "Opium, U.S.P. (Laudanum)", as Tincture No. 23, for $10.80 per pint (16 fluid ounces), and "Opium Camphorated, U.S.P. (Paregoric)", as Tincture No. 20, for $2.20 per pint. Concentrated versions were available. "Opium Camphorated, for U.S.P. Tincture: Liquid No. 338" was "exactly 8 times the strength of Tincture Opium Camphorated (Paregoric) [italics in original], U.S.P., "designed for preparing the tincture by direct dilution," and cost $7 per pint. Similarly, at a cost of $36 per pint, "Opium Concentrated, for U.S.P. Tincture: Liquid No. 336", was "four times the strength of the official tincture", and "designed for the extemporaneous preparation of the tincture". The catalog also noted: "For quarter-pint bottles add 80c. per pint to the price given for pints." Toward the middle 20th century, the use of opiates was generally limited to the treatment of pain, and opium was no longer a medically accepted "cure-all". Further, the pharmaceutical industry began synthesizing various opioids, such as propoxyphene, oxymorphone and oxycodone. | Myospherulosis, also known as spherulocytosis, is a foreign body-type granulomatous reaction to lipid-containing material and blood.It may be seen in various settings including:
Fat necrosis. Malignancy, e.g. renal cell carcinoma. Placement of topical tetracycline in a petrolatum base into a surgical site.The resultant histopathologic pattern is most unusual and initially was mistakenly thought to represent a previously undescribed endosporulating fungus. See also
Fat necrosis
== References == | 0-1
|
Smallpox vaccine was successfully maintained in cattle starting in the 1840s, and calf lymph vaccine became the leading smallpox vaccine in the 1880s. First-generation vaccines grown on the skin of live animals were widely distributed in the 1950s–1970s to eradicate smallpox. Second-generation vaccines were grown in chorioallantoic membrane or cell cultures for greater purity, and they were used in some areas during the smallpox eradication campaign. Third-generation vaccines are based on attenuated strains of vaccinia and saw limited use prior to the eradication of smallpox.All three generations of vaccine are available in stockpiles. First and second-generation vaccines contain live unattenuated vaccinia virus and can cause serious side effects in a small percentage of recipients, including death in 1–10 people per million vaccinations. Third-generation vaccines are much safer due to the milder side effects of the attenuated vaccinia strains. Second and third-generation vaccines are still being produced, with manufacturing capacity being built up in the 2000s due to fears of bioterrorism and biological warfare. First-generation
The first-generation vaccines are manufactured by growing live vaccinia virus in the skin of live animals. Most first-generation vaccines are calf lymph vaccines that were grown on the skin of cows, but other animals were also used, including sheep. The development of freeze-dried vaccine in the 1950s made it possible to preserve vaccinia virus for long periods of time without refrigeration, leading to the availability of freeze-dried vaccines such as Dryvax. : 115 The vaccine is administered by multiple puncture of the skin (scarification) with a bifurcated needle that holds vaccine solution in the fork. | All English stocks held at St Marys Hospital, London were transferred to more secure facilities at Porton Down and then to the U.S. at the Centers for Disease Control and Prevention (CDC) in Atlanta, Georgia in 1982, and all South African stocks were destroyed in 1983. By 1984, the only known stocks were kept at the CDC in the U.S. and the State Research Center of Virology and Biotechnology (VECTOR) in Koltsovo, Russia. : 1273–76 These states report that their repositories are for possible anti-bioweaponry research and insurance if some obscure reservoir of natural smallpox is discovered in the future. Anti-terrorism preparation
Among more than 270,000 US military service members vaccinated with smallpox vaccine between December 2002, and March 2003, eighteen cases of probable myopericarditis were reported (all in first-time vaccinees who received the NYCBOH strain of vaccinia virus), an incidence of 7.8 per 100,000 during the 30 days they were observed. All cases were in young, otherwise healthy adult white men and all survived.In 2002, the United States government started a program to vaccinate 500,000 volunteer health care professionals throughout the country. Recipients were healthcare workers who would be first-line responders in the event of a bioterrorist attack. Many healthcare workers refused or did not pursue vaccination, worried about vaccine side effects, compensation and liability. Most did not see an immediate need for the vaccine. Some healthcare systems refused to participate, worried about becoming a destination for smallpox patients in the event of an epidemic. | 11
|
Neonatal sepsis
In common clinical usage, neonatal sepsis refers to a bacterial blood stream infection in the first month of life, such as meningitis, pneumonia, pyelonephritis, or gastroenteritis, but neonatal sepsis also may be due to infection with fungi, viruses, or parasites. Criteria with regard to hemodynamic compromise or respiratory failure are not useful because they present too late for intervention. Management
Early recognition and focused management may improve the outcomes in sepsis. Current professional recommendations include a number of actions ("bundles") to be followed as soon as possible after diagnosis. Within the first three hours, someone with sepsis should have received antibiotics and, intravenous fluids if there is evidence of either low blood pressure or other evidence for inadequate blood supply to organs (as evidenced by a raised level of lactate); blood cultures also should be obtained within this time period. After six hours the blood pressure should be adequate, close monitoring of blood pressure and blood supply to organs should be in place, and the lactate should be measured again if initially it was raised. A related bundle, the "Sepsis Six", is in widespread use in the United Kingdom; this requires the administration of antibiotics within an hour of recognition, blood cultures, lactate, and hemoglobin determination, urine output monitoring, high-flow oxygen, and intravenous fluids.Apart from the timely administration of fluids and antibiotics, the management of sepsis also involves surgical drainage of infected fluid collections and appropriate support for organ dysfunction. | To minimize the risk of CRS and to offset some of the minor side effects patient experience, glucocorticoids (such as methylprednisolone), acetaminophen, and diphenhydramine are given before the infusion.Other adverse effects include leucopenia, as well as an increased risk for severe infections and malignancies typical of immunosuppressive therapies. Neurological side effects like aseptic meningitis and encephalopathy have been observed. Possibly, they are also caused by the T cell activation.Repeated application can result in tachyphylaxis (reduced effectiveness) due to the formation of anti-mouse antibodies in the patient, which accelerates elimination of the drug. It can also lead to an anaphylactic reaction against the mouse protein, which may be difficult to distinguish from a CRS. Contraindications
Except under special circumstances, the drug is contraindicated for patients with an allergy against mouse proteins, as well as patients with uncompensated heart failure, uncontrolled arterial hypertension or epilepsy. It should not be used during pregnancy or lactation. Etymology
Muromonab-CD3 was developed before the WHO nomenclature of monoclonal antibodies took effect, and consequently its name does not follow this convention. Instead, it is a contraction from "murine monoclonal antibody targeting CD3". == References == | 0-1
|
These procedures were all used in the pre-antibiotic era. There exists a myth that surgeons believed that the purpose was to deprive the organism of oxygen: it was however well known that the organism survives anaerobic conditions. Although these procedures may be considered barbaric by 21st centurys standards, it must be remembered that these treatments represented a potential cure for a disease that at the time had a mortality at least as bad as lung cancer in 2000s. Recurrent or persistent pneumothorax
The simplest and earliest procedure was to introduce air into the pleural space so as to collapse the affected lung and therefore the open cavity. There was always spontaneous resolution of the pneumothorax and the procedure had to be repeated every few weeks. Phrenic nerve crush
The phrenic nerve (which supplies the diaphragm) was cut or crushed so as to permanently paralyse the diaphragm on that side. The paralysed diaphragm would then rise up and the lung on that side would collapse, thus closing the cavity. Thoracoplasty
When the cavity was located in the apex of the lung, thoracoplasty could be performed. Six to eight ribs were broken and pushed into the thoracic cavity to collapse the lung beneath. This was a disfiguring operation, but it avoided the need for repeated procedures. In the Novosibirsk TB Research Institute (Russia), osteoplastic thoracoplasty (a variant of extrapleural thoracoplasty) has been used for the last 50 years for patients with complicated cavitary forms of TB for whom lung resection is contraindicated. Plombage
Plombage reduced the need for a disfiguring operation. | Located in India and Cambodia, Operation ASHA focuses on the development of "e-Compliance," which is a verification and SMS text messaging system where patients can use their fingerprints to access their medical records and be reminded daily via text when to take their medication. According to Operation ASHA, the e-Compliance treatment successive rate is 85%. Treatment failure
Patients who fail treatment must be distinguished from patients who relapse. Patients who responded to treatment and appeared to be cured after completing a course of TB treatment are not classed as treatment failures, but as relapses and are discussed in a separate section below. Patients are said to have failed treatment if they
fail to respond to treatment (cough and sputum production persisting throughout the whole of treatment), or
only experience a transient response to treatment (the patient gets better at first, but then get worse again, all the while on treatment).It is very uncommon for patients not to respond to TB treatment at all (even transiently), because this implies resistance at base-line to all of the drugs in the regimen. Patients who fail to get any response at all while on treatment should first of all be questioned very closely about whether or not they have been taking their medicines, and perhaps even be admitted to hospital to be observed taking their treatment. Blood or urine samples may be taken to check for malabsorption of TB drugs. | 11
|
This spun off many modern words, including "calculate" (use stones for mathematical purposes), and "calculus", which came to be used, in the 18th century, for accidental or incidental mineral buildups in human and animal bodies, like kidney stones and minerals on teeth.Tartar, on the other hand, originates in Greek as well (tartaron), but as the term for the white encrustation inside casks, aka potassium bitartrate commonly known as cream of tartar. This came to be a term used for calcium phosphate on teeth in the early 19th century. Calculus composition
Calculus is composed of both inorganic (mineral) and organic (cellular and extracellular matrix) components. The mineral proportion of calculus ranges from approximately 40–60%, depending on its location in the dentition, and consists primarily of calcium phosphate crystals organized into four principal mineral phases, listed here in order of decreasing ratio of phosphate to calcium:
whitlockite, Ca9(Mg,Fe)(PO4)6(PO3OH)
hydroxyapatite, Ca5(PO4)3OH
octacalcium phosphate, Ca8H2(PO4)6 · 5 H2O
and brushite, CaHPO4 · 2 H2OThe organic component of calculus is approximately 85% cellular and 15% extracellular matrix. Cell density within dental plaque and calculus is very high, consisting of an estimated 200,000,000 cells per milligram. The cells within calculus are primarily bacterial, but also include at least one species of archaea (Methanobrevibacter oralis) and several species of yeast (e.g., Candida albicans). The organic extracellular matrix in calculus consists primarily of proteins and lipids (fatty acids, triglycerides, glycolipids, and phospholipids), as well as extracellular DNA. | Laryngo-onycho-cutaneous syndrome (also known as Shabbir syndrome) is a rare epithelial disorder inherited in an autosomal recessive fashion. It is characterized by abnormalities in the larynx, nails ("onycho-"), and skin ("cutaneous"). The disorder is only found in Punjabi Muslims and only a few cases have been reported.It was characterized by Pakistani dermatologist Syed Ghulam Shabbir (1923–2002) in 1986.It may be associated with LAMA3. See also
Watson syndrome
List of cutaneous conditions
References
External links
Laryngo-onycho-cutaneous syndrome on MedlinePlus | 0-1
|
An underweight person is a person whose body weight is considered too low to be healthy. A person who is underweight is malnourished. Assessment
The body mass index, a ratio of a persons weight to their height, has traditionally been used to assess the health of a person as it pertains to weight: under the cut-off point at a BMI of 18.5, a person is considered underweight. The calculation is either weight in kilograms divided by height in meters, squared, or weight in pounds times 703, divided by height in inches, squared. Another measure of underweight is through comparison to the average weight of a cohort of people of a similar age and height: people who are at least 15% to 20% below the average weight for the group are considered underweight.Body fat percentage has been suggested as another way to assess whether a person is underweight. Unlike the body mass index, which is a proxy measurement, the body fat percentage takes into account the difference in composition between adipose tissue (fat cells) and muscle tissue and their different roles in the body. The American Council on Exercise defines the amount of essential fat, below which a person is underweight, as 10–13% for women and 2–5% for men. The greater amount of essential body fat in women supports reproductive function. Prevalence
Using the body mass index as a measure of weight-related health, with data from 2014, age-standardised global prevalence of underweight in women and men were 9.7% and 8.8%, respectively. | According to Robert E. Black of the Johns Hopkins School of Public Health (JHSPH), "Underweight status ... and micronutrient deficiencies also cause decreases in immune and non-immune host defenses, and should be classified as underlying causes of death if followed by infectious diseases that are the terminal associated causes." People who are malnourished raise special concerns, as not only gross caloric intake may be inadequate, but also intake and absorption of other vital nutrients, especially essential amino acids and micronutrients such as vitamins and minerals.In women, being severely underweight, as a result of an eating disorder or due to excessive strenuous exercise, can result in amenorrhea (absence of menstruation), infertility or complications during pregnancy if gestational weight gain is too low.Malnourishment can also cause anemia and hair loss. Being underweight is an established risk factor for osteoporosis, even for young people. This is seen in individuals suffering from relative energy deficiency in sport, formerly known as female athlete triad: when disordered eating or excessive exercise cause amenorrhea, hormone changes during ovulation leads to loss of bone mineral density. After this low bone mineral density causes the first spontaneous fractures, the damage is often irreversible. Although being underweight has been reported to increase mortality at rates comparable to that seen in morbidly obese people, the effect is much less drastic when restricted to non-smokers with no history of disease, suggesting that smoking and disease-related weight loss are the leading causes of the observed effect. Treatment
Diet
Underweight individuals may be advised to gain weight by increasing calorie intake. | 11
|
Small breast buds are present on both sexes. Head hair becomes coarse and thicker. Birth is imminent and occurs around the 38th week after fertilization. The fetus is considered full-term between weeks 37 and 40, when it is sufficiently developed for life outside the uterus. It may be 48 to 53 cm (19 to 21 in) in length, when born. Control of movement is limited at birth, and purposeful voluntary movements continue to develop until puberty. Variation in growth
There is much variation in the growth of the human fetus. When fetal size is less than expected, the condition is known as intrauterine growth restriction also called fetal growth restriction; factors affecting fetal growth can be maternal, placental, or fetal.Maternal factors include maternal weight, body mass index, nutritional state, emotional stress, toxin exposure (including tobacco, alcohol, heroin, and other drugs which can also harm the fetus in other ways), and uterine blood flow. Placental factors include size, microstructure (densities and architecture), umbilical blood flow, transporters and binding proteins, nutrient utilization and nutrient production. Fetal factors include the fetal genome, nutrient production, and hormone output. Also, female fetuses tend to weigh less than males, at full term.Fetal growth is often classified as follows: small for gestational age (SGA), appropriate for gestational age (AGA), and large for gestational age (LGA). SGA can result in low birth weight, although premature birth can also result in low birth weight. | Spondyloepiphyseal dysplasia congenita (abbreviated to SED more often than SDC) is a rare disorder of bone growth that results in dwarfism, characteristic skeletal abnormalities, and occasionally problems with vision and hearing. The name of the condition indicates that it affects the bones of the spine (spondylo-) and the ends of bones (epiphyses), and that it is present from birth (congenital). The signs and symptoms of spondyloepiphyseal dysplasia congenita are similar to, but milder than, the related skeletal disorders achondrogenesis type 2 and hypochondrogenesis. Spondyloepiphyseal dysplasia congenita is a subtype of collagenopathy, types II and XI. Presentation
People with spondyloepiphyseal dysplasia are short-statured from birth, with a very short trunk and neck and shortened limbs. Their hands and feet, however, are usually average-sized. This type of dwarfism is characterized by a normal spinal column length relative to the femur bone. Adult height ranges from 0.9 meters (35 inches) to just over 1.4 meters (55 inches). Curvature of the spine (such as kyphoscoliosis and lordosis) progresses during childhood and can cause problems with breathing. Changes in the spinal bones (vertebrae) in the neck may also increase the risk of spinal cord damage. Other skeletal signs include flattened vertebrae (platyspondyly), a hip joint deformity in which the upper leg bones turn inward (coxa vara), and an inward- and downward-turning foot (called clubfoot). Decreased joint mobility and arthritis often develop early in life. Medical texts often state a mild and variable change to facial features, including cheekbones close to the nose appearing flattened, although this appears to be unfounded. | 0-1
|
In Taiwan, those with mental disorders are subject to general publics misperception that the root causes of the mental disorders are "over-thinking", "having a lot of time and nothing better to do", "stagnant", "not serious in life", "not paying enough attention to the real life affairs", "mentally weak", "refusing to be resilient", "turning back to perfectionistic strivings", "not bravery" and so forth.Employment discrimination is reported to play a significant part in the high rate of unemployment among those with a diagnosis of mental illness. An Australian study found that having a mental illness is a bigger barrier to employment than a physical disability. The mentally ill are stigmatized in Chinese society and can not legally marry.Efforts are being undertaken worldwide to eliminate the stigma of mental illness, although the methods and outcomes used have sometimes been criticized. Media and general public
Media coverage of mental illness comprises predominantly negative and pejorative depictions, for example, of incompetence, violence or criminality, with far less coverage of positive issues such as accomplishments or human rights issues. Such negative depictions, including in childrens cartoons, are thought to contribute to stigma and negative attitudes in the public and in those with mental health problems themselves, although more sensitive or serious cinematic portrayals have increased in prevalence.In the United States, the Carter Center has created fellowships for journalists in South Africa, the U.S., and Romania, to enable reporters to research and write stories on mental health topics. | The hair is seen under a microscope with bumps in the hair strand. These cause the hair to be brittle and break in the thinner sections. Severe cases of monilethrix can also effect finger and toe nails causing abnormal growth. Monilethrix can also cause keratosis pilaris (small bumps on the skin). Less severe cases of Monilethrix may only affect certain parts of the scalp, usually the back of the head and neck. Diagnosis
Monilethrix may be diagnosed with trichoscopy and other forms of dermoscopy. Light microscopic examination is diagnostic and reveals elliptical nodes of normal thickness and intermittent constrictions, internodes at which the hair easily breaks. Under examination, the hair is beaded. The beading is the result of a periodic narrowing of the shaft with nodes separated by about 0.7 mm. In general, there is a tendency for spontaneous improvement with time, especially during puberty and pregnancy, but the condition never disappears completely. Genetics
Monilethrix is caused by mutations affecting the genes KRTHB1 (KRT81), KRTHB3 (KRT83), or KRTHB6 (KRT86) which code for type II hair cortex keratins. The disorder is inherited in an autosomal dominant manner. This means that the defective gene(s) responsible for the disorder is located on an autosome, and only one copy of the gene is sufficient to cause the disorder, when inherited from a parent who has the disorder. If an affected parent and an unaffected parent have children, 75% of the time they will be affected by Monilethrix. It can be equally present in both males and females. | 0-1
|
It is often difficult for the speaker to project their voice and speak loud enough to be heard in noisy environments, over background noise, or when speaking to someone from a distance. It is possible for symptoms to surface only in situations where the environmental acoustics are poor, such as outdoors. Patients may report feeling pain in the throat or experiencing bouts of choking. A patient presenting with diplophonia is of major concern as this typically means that the mass and tension of their vocal folds are asymmetrical which may also indicate vocal fold paresis.Swallowing difficulties (dysphagia) are not commonly seen in vocal fold paresis that results from RLN damage. Dysphagia may however, suggest SLN damage. Symptoms of sensory nerve damage include: chronic coughing, the feeling of having a lump in the throat (globus sensation), hypersensitivity or abnormal sensation, spasms of the vocal folds (laryngospasms), dysphagia, pain from vocal use, and voice loss in high pitch ranges. It is possible for both the RLN and the SLN to be damaged simultaneously, so the symptoms of RLN and SLN damage may be seen independently or alongside one another.If maladaptive compensatory strategies are used more and more to try to offset the voice difficulties, the vocal mechanisms will fatigue and the above symptoms will worsen. Causes
There are a wide variety of possible causes of vocal fold (VF) paresis, including congenital (i.e. present at birth) causes, infectious causes, tumors, traumatic causes, endocrinologic diseases (i.e. thyroid disease), and systemic neurologic diseases. | Vocal cord paresis, also known as recurrent laryngeal nerve paralysis or vocal fold paralysis, is an injury to one or both recurrent laryngeal nerves (RLNs), which control all intrinsic muscles of the larynx except for the cricothyroid muscle. The RLN is important for speaking, breathing and swallowing.The primary larynx-related functions of the mainly efferent nerve fiber RLN, include the transmission of nerve signals to the muscles responsible for regulation of the vocal folds position and tension to enable vocalization, as well as the transmission of sensory nerve signals from the mucous membrane of the larynx to the brain. A unilateral injury of the nerve typically results in hoarseness caused by a reduced mobility of one of the vocal folds. It may also cause minor shortages of breath as well as aspiration problems especially concerning liquids. A bilateral injury causes the vocal folds to impair the air flow resulting in breathing problems, stridor and snoring sounds, and fast physical exhaustion. This strongly depends on the median or paramedian position of the paralyzed vocal folds. Hoarseness rarely occurs in bilaterally paralyzed vocal folds. Signs and symptoms
Typically, patients with vocal fold paresis or paralysis are able to identify the onset of their symptoms. The most commonly reported symptom patients with either vocal fold paresis or paralysis make is having a rough voice quality. It is important to note that the symptoms of vocal fold paresis are not specific to the condition and tend to be common symptoms of other voice disorders as well. | 11
|
Excoriated acne is a mild acne accompanied by extensive excoriations caused by the person picking at the pimples (that is, scratching or squeezing them). See also
List of cutaneous conditions
References
== External links == | Hypoesthesia or numbness is a common side effect of various medical conditions that manifests as a reduced sense of touch or sensation, or a partial loss of sensitivity to sensory stimuli. In everyday speech this is generally referred to as numbness.Hypoesthesia primarily results from damage to nerves, and from blockages in blood vessels, resulting in ischemic damage to tissues supplied by the blocked blood vessels. This damage is detectable through the use of various imaging studies. Damage in this way is caused by a variety of different illnesses and diseases. A few examples of the most common illnesses and diseases that can cause hypoesthesia as a side effect are as follows:
Decompression sickness
Trigeminal schwannoma
Rhombencephalitis
Intradural extramedullary tuberculoma of the spinal cord
Cutaneous sensory disorder
Beriberi
Diseases
Decompression sickness
Decompression sickness occurs during rapid ascent, spanning 20 or more feet (typically from underwater). Decompression sickness may express itself in a variety of ways, including hypoesthesia. Hypoesthesia results because of air bubbles that form in blood, which prevents oxygenation of downstream tissue. In cases of decompression sickness, treatment to relieve hypoesthesia symptoms is quick and efficient. Hyperbaric oxygen is used to maintain long term stability, which includes breathing of oxygen at a level of 100%. Trigeminal schwannoma
Trigeminal schwannoma is a condition in which a tumor forms on the trigeminal nerve (also known as cranial nerve five). This prevents sensation in the area associated with the nerve. In the case of the trigeminal nerve, this is the face, meaning hypoesthesia of the face is experienced. | 0-1
|
There have been calls to reclassify sickle cell trait as a disease state, based on its malignant clinical presentations. Significance may be greater during exercise. Association with other medical conditions
Malaria
The sickle cell trait provides a survival advantage against malaria fatality over people with normal hemoglobin in regions where malaria is endemic. The trait is known to cause significantly fewer deaths due to malaria, especially when Plasmodium falciparum is the causative organism. This is a prime example of natural selection, evidenced by the fact that the geographical distribution of the gene for hemoglobin S and the distribution of malaria in Africa virtually overlap. Because of the unique survival advantage, people with the trait become increasingly numerous as the number of malaria-infected people increases. Conversely, people who have normal hemoglobin tend to succumb to the complications of malaria.The way in which sickle cell protects against malaria is attributed to several different things. One of the more common explanations is that the sickle hemoglobin inhibits the plasmodium parasite from infecting the red blood cells which reduces the number of malaria parasites to infect the host. Another factor is the production of heme oxygenase-1 (HO-1) enzyme, which is highly present in the sickle hemoglobin. This enzyme produces carbon monoxide which has been proven to protect against cerebral malaria. Established associations
Hematuria
Hyposthenuria
Renal medullary carcinoma, a cancer affecting the kidney, is a very rare complication seen in patients with sickle cell trait. Renal papillary necrosis (only considered "possible" by some sources)
Splenic infarcts at high altitude. Surgery may not always be necessary. | Deformability of the erythrocytes that cause the microcirculatory distress can be demonstrated through various other hemorheological characteristics. In order to determine the deformability of erythrocytes multiple factors including blood and plasma viscosity and hematocrit (a calculation of the percent of red blood cells present in the blood) are measured. Alpha-thalassemia
Alpha-thalassemia, like sickle cell trait, is typically inherited in areas with increased exposure to malaria. It manifests itself as a decreased expression of alpha-globin chains, causing an imbalance and excess of beta-globin chains, and can occasionally result in anemic symptoms. The abnormal hemoglobin can cause the body to destroy red blood cells, essentially causing anemia.In endurance-trained individuals with sickle cell trait the presence of alpha-thalassemia has been shown to act protectively against microvasculatory distress before, during, and after exercise. Signs, symptoms, and prevention
Because of the microcirculatory distress, a telltale sign or symptom of a potential sickling collapse is cramping. Specifically to sickle cell trait, cramping occurs in the lower extremities and back in athletes undergoing intense physical activity or exertion. In comparison to heat cramps, sickling cramps are less intense in terms of pain and have a weakness and fatigue associated with them, as opposed to tightly contracted muscles that lock up during heat cramps.A sickling collapse comes on slowly, following cramps, weakness, general body aches and fatigue. | 11
|
Type 1
Type 1 is characterised by congenital sensorineural hearing loss, pigmentary deficiencies of the hair such as a white lock of hair (poliosis) in the front-centre of the head or premature greying, pigmentary deficiencies of the eyes such as different-coloured eyes (complete heterochromia iridum), multiple colours in an eye (sectoral heterochromia iridum) or brilliant blue eyes, patches of skin depigmentation, and a wider gap between the inner corners of the eyes called telecanthus or dystopia canthorum. Other facial features associated with type 1 can include a high nasal bridge, a flat nose tip, a unibrow (synophrys), smaller edges of the nostrils (alae) or a smooth philtrum. Type 2
The difference that defines type 2 from type 1 is that patients do not have the wider gap between the inner corners of the eyes (telecanthus/dystopia canthorum). Sensorineural hearing loss tends to be more common and more severe in this type. By far the most common gene to cause this type when mutated is MITF (classified as type 2A). | Waardenburg syndrome is a group of rare genetic conditions characterised by at least some degree of congenital hearing loss and pigmentation deficiencies, which can include bright blue eyes (or one blue eye and one brown eye), a white forelock or patches of light skin. These basic features constitute type 2 of the condition; in type 1, there is also a wider gap between the inner corners of the eyes called telecanthus, or dystopia canthorum. In type 3, which is rare, the arms and hands are also malformed, with permanent finger contractures or fused fingers, while in type 4, the person also has Hirschsprungs disease. There also exist at least two types (2E and PCWH) that can result in central nervous system (CNS) symptoms such as developmental delay and muscle tone abnormalities.The syndrome is caused by mutations in any of several genes that affect the division and migration of neural crest cells during embryonic development (though some of the genes involved also affect the neural tube). Neural crest cells are stem cells left over after the closing of the neural tube that go on to form diverse non-CNS cells in different parts of the body, including melanocytes, various bones and cartilage of the face and inner ear and the peripheral nerves of the intestines. Type 1 is caused by a mutation in the PAX3 gene, while the gene that most often causes type 2 when mutated is MITF. | 11
|
This helped reassure them they could sleep without their pills.The authors also warned of the similarities in pharmacology and mechanism of action of the newer nonbenzodiazepine Z drugs.The elimination half-life of diazepam and chlordiazepoxide, as well as other long half-life benzodiazepines, is twice as long in the elderly compared to younger individuals. Many doctors do not adjust benzodiazepine dosage according to age in elderly patients. See also
References
External links
Benzodiazepines: How they work and how to withdraw by Professor Heather Ashton
The Minor Tranquilliser Project, For support, Camden, UK
Benzodiazepine withdrawal syndrome at Curlie | A mallet finger, also known as hammer finger or PLF finger or Hannan finger, is an extensor tendon injury at the farthest away finger joint. This results in the inability to extend the finger tip without pushing it. There is generally pain and bruising at the back side of the farthest away finger joint.A mallet finger usually results from overbending of the finger tip. Typically this occurs when a ball hits an outstretched finger and jams it. This results in either a tear of the tendon or the tendon pulling off a bit of bone. The diagnosis is generally based on symptoms and supported by X-rays.During injury, this tendon is torn from its attachment site on the bone (called a tendinous mallet finger). But, there are also cases whereby the force of impact causes a small fracture at the base of bone where the tendon is attached to (called a bony mallet finger). In both cases, the tendon is no longer attached to the last bone of the digit and is thus unable to pull the end joint into a straightened position, resulting in a fingertip that droops.Treatment is generally with a splint that holds the fingertip straight continuously for 8 weeks. The middle joint is allowed to move. This should be begun within a week of the injury. If the finger is bent during these weeks, healing may take longer. If a large piece of bone has been torn off surgery may be recommended. | 0-1
|
Endolymphatic hydrops is a disorder of the inner ear. It consists of an excessive build-up of the endolymph fluid, which fills the hearing and balance structures of the inner ear. Endolymph fluid, which is partly regulated by the endolymph sac, flows through the inner ear and is critical to the function of all sensory cells in the inner ear. In addition to water, endolymph fluid contains salts such as sodium, potassium, chloride and other electrolytes. If the inner ear is damaged by disease or injury, the volume and composition of the endolymph fluid can change, causing the symptoms of endolymphatic hydrops. Symptoms
The symptoms of endolymphatic hydrops include the feeling of pressure or fullness in the ears, hearing loss, tinnitus (ringing in the ears) and balance problems. Individuals who have Ménières disease have a degree of endolymphatic hydrops that is strong enough to trigger the symptoms of this disease, but individuals with endolymphatic hydrops do not always progress to Ménière’s disease. Causes
Endolymphatic hydrops may occur as a result of trauma such as a blow to the head, infection, degeneration of the inner ear, allergies, dehydration and loss of electrolytes or in extremely rare circumstances a benign tumor such as an endolymphatic sac tumor. In many cases, it is not clear what causes the disorder. Ménière’s attacks occur when there is an increase in endolymphatic volume in the inner ear, causing a temporary leak in the membrane separating the perilymph (potassium poor fluid) and the endolymph (potassium rich fluid). | The mix of these two fluids surrounding the vestibular sensory cells can lead to a temporary electrical blockade and loss of sensory function. The sudden change in the rate of the vestibular nerve firing results in a disturbance of signal processing in the corresponding brain regions, and thus to acute sensations of imbalance, otherwise known as vertigo. Diagnosis
Treatment
Low salt, low sugar diet and keeping hydrated. Medications may include corticosteroids and/or diuretics.Caffeine should be avoided. == References == | 11
|
Once a temperature of 30 °C (86 °F) has been reached, normal ACLS protocols should be followed. Prognosis
It is usually recommended not to declare a person dead until their body is warmed to a near normal body temperature of greater than 32 °C (90 °F), since extreme hypothermia can suppress heart and brain function. Exceptions include if there are obvious fatal injuries or the chest is frozen so that it cannot be compressed. If a person was buried in an avalanche for more than 35 minutes and is found with a mouth packed full of snow without a pulse, stopping early may also be reasonable. This is also the case if a persons blood potassium is greater than 12 mmol/L.Those who are stiff with pupils that do not move may survive if treated aggressively. Survival with good function also occasionally occurs even after the need for hours of CPR. Children who have near-drowning accidents in water near 0 °C (32 °F) can occasionally be revived, even over an hour after losing consciousness. The cold water lowers the metabolism, allowing the brain to withstand a much longer period of hypoxia. While survival is possible, mortality from severe or profound hypothermia remains high despite optimal treatment. Studies estimate mortality at between 38% and 75%.In those who have hypothermia due to another underlying health problem, when death occurs it is frequently from that underlying health problem. | Epidemiology
Between 1995 and 2004 in the United States, an average of 1560 cold-related emergency department visits occurred per year and in the years 1999 to 2004, an average of 647 people died per year due to hypothermia. Of deaths reported between 1999 and 2002 in the US, 49% of those affected were 65 years or older and two-thirds were male. Most deaths were not work related (63%) and 23% of affected people were at home. Hypothermia was most common during the autumn and winter months of October through March. In the United Kingdom, an estimated 300 deaths per year are due to hypothermia, whereas the annual incidence of hypothermia-related deaths in Canada is 8000. History
Hypothermia has played a major role in the success or failure of many military campaigns, from Hannibals loss of nearly half his men in the Second Punic War (218 B.C.) to the near destruction of Napoleons armies in Russia in 1812. Men wandered around confused by hypothermia, some lost consciousness and died, others shivered, later developed torpor, and tended to sleep. Others too weak to walk fell on their knees; some stayed that way for some time resisting death. The pulse of some was weak and hard to detect; others groaned; yet others had eyes open and wild with quiet delirium. | 11
|
Thousands of those Hell-hounds called Terrorists, whom they had shut up in Prison on their last Revolution, as the Satellites of Tyranny, are let loose on the people. (emphasis added)
The terms "terrorism" and "terrorist" gained renewed currency in the 1970s as a result of the Israeli–Palestinian conflict, the Northern Ireland conflict, the Basque conflict, and the operations of groups such as the Red Army Faction. Leila Khaled was described as a terrorist in a 1970 issue of Life magazine. A number of books on terrorism were published in the 1970s. The topic came further to the fore after the 1983 Beirut barracks bombings and again after the 2001 September 11 attacks and the 2002 Bali bombings. Modern definitions
In 2006 it was estimated that there were over 109 different definitions of terrorism. American political philosopher Michael Walzer in 2002 wrote: "Terrorism is the deliberate killing of innocent people, at random, to spread fear through a whole population and force the hand of its political leaders". Bruce Hoffman, an American scholar, has noted that it is not only individual agencies within the same governmental apparatus that cannot agree on a single definition of terrorism. Experts and other long-established scholars in the field are equally incapable of reaching a consensus.C. | London & Philadelphia: Jessica Kingsley Publishers. ISBN 9781846420153. OCLC 61493670. Flom, Peter (2016). Screwed up Somehow but Not Stupid, Life with a Learning Disability. Peter Flom Consulting. ISBN 9780692611692. External links
NVLD Project | 0-1
|
This, in turn, increases the duodenal compression, which worsens the underlying cause, creating a cycle of worsening symptoms.Fear of eating is commonly seen among those with the chronic form of SMA syndrome. For many, symptoms are partially relieved when in the left lateral decubitus or knee-to-chest position, or in the prone (face down) position. A Hayes maneuver, which corresponds to applying pressure below the umbilicus in cephalad and dorsal direction, elevates the root of the SMA, also slightly easing the constriction. Symptoms can be aggravated when leaning to the right or taking a face up position. Causes
Retroperitoneal fat and lymphatic tissue normally serve as a cushion for the duodenum, protecting it from compression by the SMA. SMA syndrome is thus triggered by any condition involving an insubstantial cushion and narrow mesenteric angle. SMA syndrome can present in two forms: chronic/congenital or acute/induced.Patients with the chronic, congenital form of SMA syndrome predominantly have a lengthy or even lifelong history of abdominal complaints with intermittent exacerbations depending on the degree of duodenal compression. Risk factors include anatomic characteristics such as: asthenic (very thin or "lanky") body build, an unusually high insertion of the duodenum at the ligament of Treitz, a particularly low origin of the SMA, or intestinal malrotation around an axis formed by the SMA. | Both transposition of the SMA and lysis of the duodenal suspensory muscle have the advantage that they do not involve the creation of an intestinal anastomosis.The possible persistence of symptoms after surgical bypass can be traced to the remaining prominence of reversed peristalsis in contrast to direct peristalsis, although the precipitating factor (the duodenal compression) has been bypassed or relieved. Reversed peristalsis has been shown to respond to duodenal circular drainage—a complex and invasive open surgical procedure originally implemented and performed in China.In some cases, SMA syndrome may occur alongside a serious, life-threatening condition such as cancer or AIDS. Even in these cases, though, treatment of the SMA syndrome can lead to a reduction in symptoms and an increased quality of life. Prognosis
Delay in the diagnosis of SMA syndrome can result in fatal catabolysis (advanced malnutrition), dehydration, electrolyte abnormalities, hypokalemia, acute gastric rupture or intestinal perforation (from prolonged mesenteric ischemia), gastric distention, spontaneous upper gastrointestinal bleeding, hypovolemic shock, and aspiration pneumonia. A 1-in-3 mortality rate for Superior Mesenteric Artery syndrome has been quoted by a small number of sources. However, after extensive research, original data establishing this mortality rate has not been found, indicating that the number is likely to be unreliable. While research establishing an official mortality rate may not exist, two recent studies of SMA syndrome patients, one published in 2006 looking at 22 cases and one in 2012 looking at 80 cases, show mortality rates of 0% and 6.3%, respectively. | 11
|
Developmental verbal dyspraxia (DVD), also known as childhood apraxia of speech (CAS) and developmental apraxia of speech (DAS), is a condition in which children have problems saying sounds, syllables and words. This is not because of muscle weakness or paralysis. The brain has problems planning to move the body parts (e.g., lips, jaw, tongue) needed for speech. The child knows what they want to say, but their brain has difficulty coordinating the muscle movements necessary to say those words.The exact cause of this disorder is usually unknown. Many observations suggest a genetic cause of DVD, as many with the disorder have a family history of communication disorders. The gene FOXP2 has been implicated in many studies of the condition, and when this is the cause, the condition is inherited in an autosomal dominant manner, however roughly 75% of these cases are de novo.There is no cure for DVD, but with appropriate, intensive intervention, people with this motor speech disorder can improve significantly. Presentation
"Childhood apraxia of speech (CAS) is a neurological childhood (pediatric) speech sound disorder in which the precision and consistency of movements underlying speech are impaired in the absence of neuromuscular deficits (e.g., abnormal reflexes, abnormal tone). CAS may occur as a result of known neurological impairment, in association with complex neurobehavioral disorders of known or unknown origin, or as an idiopathic neurogenic speech sound disorder. The core impairment in planning and/or programming spatiotemporal parameters of movement sequences results in errors in speech sound production and prosody." | These results show that it is clinically productive to target speech production, phonological awareness, letter knowledge, spelling, and reading all at once. This is particularly important since children with DVD/CAS often have continuous problems with reading and spelling, even if their production of speech improves. See also
Apraxia
Apraxia of speech
Developmental coordination disorder
Dysarthria
FOXP2 and human evolution
KE family
Origin of speech
Speech and language impairment
References
== External links == | 11
|
Vohwinkel syndrome (also known as "Keratoderma hereditaria mutilans," "Keratoma hereditaria mutilans," "Mutilating keratoderma of Vohwinkel",: 213 "Mutilating palmoplantar keratoderma") is a diffuse autosomal dominant keratoderma with onset in early infancy characterized by a honeycombed keratoderma involving the palmoplantar surfaces. : 512 Mild to moderate sensorineural hearing loss is often associated. It has been associated with GJB2. It was characterized in 1929. Olmsted syndrome (also known as "Mutilating palmoplantar keratoderma with periorificial keratotic plaques," "Mutilating palmoplantar keratoderma with periorificial plaques" and "Polykeratosis of Touraine") is a keratoderma of the palms and soles, with flexion deformity of the digits, that begins in infancy. : 510 : 214 Treatment with retinoids has been described. It has been associated with mutations in TRPV3. Aquagenic keratoderma, also known as acquired aquagenic palmoplantar keratoderma,: 788 transient reactive papulotranslucent acrokeratoderma, aquagenic syringeal acrokeratoderma, and aquagenic wrinkling of the palms, is a skin condition characterized by the development of white papules on the palms after water exposure. : 215 The condition causes irritation of the palms when touching certain materials after being wet, e.g., paper, cloth. An association with cystic fibrosis has been suggested. The association with cystic fibrosis suggests an increased salt content in the skin. Genetics
Epidermolytic palmoplantar keratoderma has been associated with keratin 9 and keratin 16.Nonepidermolytic palmoplantar keratoderma has been associated with keratin 1 and keratin 16. Treatment
Usually, a common form of treatment for the condition is a type of hand cream which moisturises the hard skin. Currently, the condition is incurable. See also
Keratoderma
List of cutaneous conditions
References
== External links == | Together, these findings strongly suggest that language impairments are the result of an underlying neurological defect in an area of the brain related to language. Studies looking at long-term outcomes for individuals with specific language impairments such as expressive language disorder track these individuals from childhood to adulthood. As Whitehouse and his colleagues suggest, "When childhood language problems persist into adulthood, they can have far reaching consequences in terms of academic, social and vocational outcomes." These researchers found that children diagnosed with an SLI would have persistent problems with language and are more likely to pursue vocational training rather than university, thereby avoiding professions requiring high levels of literacy. A lower socioeconomic status was also noted by adults who were diagnosed with an SLI as a child. Whitehouse also reported that these adults had more difficulties in establishing friendships, most likely due to a decreased ability to express themselves socially. Current educational interventions for students with an SLI
Specific language impairments are often secondary characteristics of other disorders such as autism spectrum disorder and attention deficit hyperactivity disorder. In these cases, issues with speech and language are often not treated specifically, but rather attention is given to the primary complaint. Due to the high correlation of an SLI with other disorders, it is difficult to tell the difference between "pure SLI" or language impairments due to the presence of another disorder. See also
Auditory processing disorder
Speech-Language Pathology
Mixed receptive-expressive language disorder
References
Further reading
Bacon C, Rappold GA (November 2012). | 0-1
|
Pyonephrosis (Greek pyon "pus" + nephros "kidney") is an infection of the kidneys collecting system. Pus collects in the renal pelvis and causes distension of the kidney. It can cause kidney failure. Cause
Pyonephrosis is sometimes a complication of kidney stones, which can be a source of persisting infection. It may also occur spontaneously. It can occur as a complication of hydronephrosis or pyelonephritis. Diagnosis
CECT is investigation of choice. Treatment
This requires drainage, best performed by ureteral stent placement or nephrostomy. Surgery - Nephrectomy, if the ureter affects - Nephroureterectomy. If the second kidney is not healthy, only drainage of the kidney or puncture nephrostomy is performed. See also
Pyelonephritis
Nephrotic syndrome
References
== External links == | Salpingitis isthmica nodosa (SIN), also known as diverticulosis of the Fallopian tube, is nodular thickening of the narrow part of the uterine tube, due to inflammation. Signs and symptoms
SIN is associated with infertility and ectopic pregnancy, and may present as either. Pathology
It is characterized by nodular thickening of the tunica muscularis of the narrow (isthmic) portion of the Fallopian tube. In severe cases, it leads to complete obliteration of the tubal lumen. It is uncommonly bilateral.Gross Findings:
One or more nodules 1–2 mm, spanning up to 2 cm
Smooth serosaMicroscopic Findings:
Glandular epithelium within tubal muscularis propria, in continuation with mucosa or (more commonly) discontinuous
Haphazard distribution (akin to adenomyosis) or pseudoinfiltrative
Banal epithelium with tubal differentiation
Diagnosis
Hysterosalpingography, a common technique in the work-up of infertility, is reliable in the diagnosis of SIN, which is seen as small globular collections within the tubal wall, either discontinuous or in continuity with the tubal lumen. Tubal obstruction and hydrosalpinx are commonly seen as well. Other techniques include laparoscopic chromopertubation, salpingoscopy, and transvaginal hydrolaparoscopy (the latter allows visualization of the tubal mucosa)
Treatment
Once suspected clinically and radiologically, patients with infertility and SIN can be managed with segmental resection with tubo-cornual anastomosis, and recanalization if tubal obstruction is detected. Success with gonadotrophin-releasing hormone analogues (GnRH-a) has been documented in terms of remission of nodularity and tubal patency. If fertility preservation is not desired, salpingectomy is recommended. See also
Vasitis nodosa
Salpingitis
== References == | 0-1
|
Following attachment of H. pylori to stomach epithelial cells, the type IV secretion system expressed by the cag PAI "injects" the inflammation-inducing agent, peptidoglycan, from their own cell walls into the epithelial cells. The injected peptidoglycan is recognized by the cytoplasmic pattern recognition receptor (immune sensor) Nod1, which then stimulates expression of cytokines that promote inflammation.The type-IV secretion apparatus also injects the cag PAI-encoded protein CagA into the stomachs epithelial cells, where it disrupts the cytoskeleton, adherence to adjacent cells, intracellular signaling, cell polarity, and other cellular activities. Once inside the cell, the CagA protein is phosphorylated on tyrosine residues by a host cell membrane-associated tyrosine kinase (TK). CagA then allosterically activates protein tyrosine phosphatase/protooncogene Shp2. Pathogenic strains of H. pylori have been shown to activate the epidermal growth factor receptor (EGFR), a membrane protein with a TK domain. Activation of the EGFR by H. pylori is associated with altered signal transduction and gene expression in host epithelial cells that may contribute to pathogenesis. A C-terminal region of the CagA protein (amino acids 873–1002) has also been suggested to be able to regulate host cell gene transcription, independent of protein tyrosine phosphorylation. A great deal of diversity exists between strains of H. pylori, and the strain that infects a person can predict the outcome. Cancer
Two related mechanisms by which H. pylori could promote cancer are under investigation. One mechanism involves the enhanced production of free radicals near H. pylori and an increased rate of host cell mutation. | Chorioangioma, or chorangioma, is a benign tumor of placenta. It is a hamartoma-like growth in the placenta consisting of blood vessels, and is seen in approximately 0.5 to 1% pregnancies. It is mostly diagnosed ultrasonically in the second trimester of pregnancy. Large chorioangiomas are known to cause complications in pregnancy, while the smaller ones are asymptomatic. Presentation
Most chorangiomas are not clinically significant, i.e. they do not have an adverse effect on placental function. Complications
Large (greater than 4 or 5 cm.) or multiple chorioangiomas may lead to complication. The complications are polyhydramnios, preterm labour, hemolytic anemia, fetal cardiomegaly, fetal thrombocytopenia, intrauterine growth retardation, preeclampsia, abruption of placenta and congenital anomalies. Pathogenesis
The origin of chorioangioma is from primitive chorionic mesenchyme. It develops when the blood vessels and stroma undergo rapid proliferation independent of the surrounding tissue. Based on histological features, chorioangioma is classified by Marchetti into three types:
Cellular type : This type is immature and contains mostly cellular elements packed compactly. Angiomatous (vascular) type : This is the most common type of choriocarcinoma. It is distinguished by the presence of numerous small blood vessels. Degenerative type : This is the mature type with degenerative changes.Each type is believed to represent a phase of tumor development. Chorioangioma has no malignant potential. Diagnosis
Most chorioangiomas are asymptomatic. They are generally picked up in second trimester scan. Chorioangioma is seen as a hypo- or hyperechoic circumscribed mass that is distinct from the placenta at gray-scale US examination. Large lesions may contain fibrous septa. | 0-1
|
The 2007 WHO Classification of Tumors of the Central Nervous System was the last classification mainly based on microscopy features. The new 2016 WHO Classification of Tumors of the Central Nervous System was a paradigm shift: some of the tumors were defined also by their genetic composition as well as their cell morphology. The grading of gliomas changed importantly and glioblastoma was now mainly classified according to the status of isocitrate dehydrogenase (IDH) mutation: IDH-wildtype or IDH-mutant. Molecular alterations
Four subtypes of glioblastoma have been identified based on gene expression:
Classical: Around 97% of tumors in this subtype carry extra copies of the epidermal growth factor receptor (EGFR) gene, and most have higher than normal expression of EGFR, whereas the gene TP53 (p53), which is often mutated in glioblastoma, is rarely mutated in this subtype. Loss of heterozygosity in chromosome 10 is also frequently seen in the classical subtype alongside chromosome 7 amplification. The proneural subtype often has high rates of alterations in TP53 (p53), and in PDGFRA, the gene encoding a-type platelet-derived growth factor receptor, and in IDH1, the gene encoding isocitrate dehydrogenase-1. The mesenchymal subtype is characterized by high rates of mutations or other alterations in NF1, the gene encoding neurofibromin 1 and fewer alterations in the EGFR gene and less expression of EGFR than other types. | The average age at diagnosis is 64, and the disease occurs more commonly in males than females. Signs and symptoms
Common symptoms include seizures, headaches, nausea and vomiting, memory loss, changes to personality, mood or concentration, and localized neurological problems. The kind of symptoms produced depends more on the location of the tumor than on its pathological properties. The tumor can start producing symptoms quickly, but occasionally is an asymptomatic condition until it reaches an enormous size. Risk factors
The cause of most cases is unclear. About 5% develop from another type of brain tumor known as a low-grade astrocytoma. Genetics
Uncommon risk factors include genetic disorders such as neurofibromatosis, Li–Fraumeni syndrome, tuberous sclerosis, or Turcot syndrome. Previous radiation therapy is also a risk. For unknown reasons, it occurs more commonly in males. Environmental
Other associations include exposure to smoking, pesticides, and working in petroleum refining or rubber manufacturing.Glioblastoma has been associated with the viruses SV40, HHV-6, and cytomegalovirus. Other
Research has been done to see if consumption of cured meat is a risk factor. No risk had been confirmed as of 2013. Similarly, exposure to radiation during medical imaging, formaldehyde, and residential electromagnetic fields, such as from cell phones and electrical wiring within homes, have been studied as risk factors. As of 2015, they had not been shown to cause GBM. Pathogenesis
The cellular origin of glioblastoma is unknown. Because of the similarities in immunostaining of glial cells and glioblastoma, gliomas such as glioblastoma have long been assumed to originate from glial-type cells. | 11
|
This means that people receiving intravenous linezolid may be switched to oral linezolid as soon as their condition allows it, whereas comparable antibiotics (such as vancomycin and quinupristin/dalfopristin) can only be given intravenously. Taking linezolid with food somewhat slows its absorption, but the area under the curve is not affected.Linezolids plasma protein binding is approximately 31% (range 4–32%) and its volume of distribution at steady state averages 36.1–47.3 liters in healthy adult volunteers. Peak plasma concentrations (Cmax) are reached one to two hours after administration of the drug. Linezolid is readily distributed to all tissues in the body apart from bone matrix and white adipose tissue. Notably, the concentration of linezolid in the epithelial lining fluid (ELF) of the lower respiratory tract is at least equal to, and often higher than, that achieved in serum (some authors have reported bronchial fluid concentrations up to four times higher than serum concentrations), which may account for its efficacy in treating pneumonia. However, a meta-analysis of clinical trials found that linezolid was not superior to vancomycin, which achieves lower concentrations in the ELF. Cerebrospinal fluid (CSF) concentrations vary; peak CSF concentrations are lower than serum ones, due to slow diffusion across the blood–brain barrier, and trough concentrations in the CSF are higher for the same reason. The average half-life is three hours in children, four hours in teenagers, and five hours in adults.Linezolid is metabolized in the liver, by oxidation of the morpholine ring, without involvement of the cytochrome P450 system. | Zinc gluconate is the zinc salt of gluconic acid. It is an ionic compound consisting of two anions of gluconate for each zinc(II) cation. Zinc gluconate is a popular form for the delivery of zinc as a dietary supplement providing 14.35% elemental zinc by weight. Gluconic acid is found naturally, and is industrially made by the fermentation of glucose, typically by Aspergillus niger, but also by other fungi, e.g. Penicillium, or by bacteria, e.g. Acetobacter, Pseudomonas and Gluconobacter. In its pure form, it is a white to off-white powder. It can also be made by electrolytic oxidation, although this is a more expensive process. The advantages are a lower microbiological profile, and a more complete reaction, yielding a product with a longer shelf life. Zinc gluconate and the common cold
Zinc gluconate has been used in lozenges for treating the common cold. However, controlled trials with lozenges which include zinc acetate have found it has the greatest effect on the duration of colds. Zinc has also been administered nasally for treating the common cold, but has been reported to cause anosmia in some cases. Safety concerns
Instances of anosmia (loss of smell) have been reported with intranasal use of some products containing zinc gluconate. In September 2003, Zicam faced lawsuits from users who claimed that the product, a nasal gel containing zinc gluconate and several inactive ingredients, negatively affected their sense of smell and sometimes taste. Some plaintiffs alleged experiencing a strong and very painful burning sensation when they used the product. | 0-1
|
Congenital pulmonary airway malformation (CPAM), formerly known as congenital cystic adenomatoid malformation (CCAM), is a congenital disorder of the lung similar to bronchopulmonary sequestration. In CPAM, usually an entire lobe of lung is replaced by a non-working cystic piece of abnormal lung tissue. This abnormal tissue will never function as normal lung tissue. The underlying cause for CPAM is unknown. It occurs in approximately 1 in every 30,000 pregnancies.In most cases the outcome of a fetus with CPAM is very good. In rare cases, the cystic mass grows so large as to limit the growth of the surrounding lung and cause pressure against the heart. In these situations, the CPAM can be life-threatening for the fetus. CPAM can be separated into five types, based on clinical and pathologic features. CPAM type 1 is the most common, with large cysts and a good prognosis. CPAM type 2 (with medium-sized cysts) often has a poor prognosis, owing to its frequent association with other significant anomalies. Other types are rare. Signs and symptoms
Three quarters of affected patients are asymptomatic. However, 25% develop cyanosis, pneumothorax, and show signs of increased breathing difficulty (tachypnoea and intercostal retractions).At examination, they may show hyper-resonance at percussion, diminished vesicular murmur and an asymmetrical thorax. Cause
The cause of CPAM is unknown. Diagnosis
CPAMs are often identified during routine prenatal ultrasonography. | Identifying characteristics on the sonogram include: an echogenic (bright) mass appearing in the chest of the fetus, displacement of the heart from its normal position, a flat or everted (pushed downward) diaphragm, or the absence of visible lung tissue.CPAMs are classified into three different types based largely on their gross appearance. Type I has a large (>2 cm) multiloculated cysts. Type II has smaller uniform cysts. Type III is not grossly cystic, referred to as the "adenomatoid" type. Microscopically, the lesions are not true cysts, but communicate with the surrounding parenchyma. Some lesions have an abnormal connection to a blood vessel from an aorta and are referred to as "hybrid lesions." Imaging
The earliest point at which a CPAM can be detected is by prenatal ultrasound. The classic description is of an echogenic lung mass that gradually disappears over subsequent ultrasounds. The disappearance is due to the malformation becoming filled with fluid over the course of the gestation, allowing the ultrasound waves to penetrate it more easily and rendering it invisible on sonographic imaging. When a CPAM is rapidly growing, either solid or with a dominant cyst, they have a higher incidence of developing venous outflow obstruction, cardiac failure and ultimately hydrops fetalis. If hydrops is not present, the fetus has a 95% chance of survival. When hydrops is present, risk of fetal demise is much greater without in utero surgery to correct the pathophysiology. | 11
|
Although the person may not recognise the connection, self-harm often becomes a response to profound and overwhelming emotional pain that cannot be resolved in a more functional way.The motivations for self-harm vary, as it may be used to fulfill a number of different functions. These functions include self-harm being used as a coping mechanism which provides temporary relief of intense feelings such as anxiety, depression, stress, emotional numbness and a sense of failure or self-loathing. There is also a positive statistical correlation between self-harm and emotional abuse. Self-harm may become a means of managing and controlling pain, in contrast to the pain experienced earlier in the persons life over which they had no control (e.g., through abuse).Other motives for self-harm do not fit into medicalized models of behavior and may seem incomprehensible to others, as demonstrated by this quotation:
"My motivations for self-harming were diverse, but included examining the interior of my arms for hydraulic lines. This may sound strange. "Assessment of motives in a medical setting is usually based on precursors to the incident, circumstances, and information from the patient. However, limited studies show that professional assessments tend to suggest more manipulative or punitive motives than personal assessments.A UK Office for National Statistics study reported only two motives: "to draw attention" and "because of anger". For some people, harming themselves can be a means of drawing attention to the need for help and to ask for assistance in an indirect way. | Aminoaciduria occurs when the urine contains abnormally high amounts of amino acids. In the healthy kidney, the glomeruli filter all amino acids out of the blood, and the renal tubules then reabsorb over 95% of the filtered amino acids back into the blood.In overflow aminoaciduria, abnormally high concentrations of amino acids in the blood plasma overwhelm the resorptive capacity of the renal tubules, resulting in high concentrations of amino acids in the urine. This may be caused by congenital disorders of amino acid metabolism, for example, phenylketonuria, or may be secondary to liver disease.In renal aminoaciduria, the renal tubules are unable to reabsorb the filtered amino acids back into the blood, causing high concentrations of amino acids in the urine. This may be caused by a defect in the transport proteins in the renal tubule, for example, as occurs in Hartnup disease, or may be due to damage to the kidney tubule, for example, as occurs in Fanconi syndrome. References
== External links == | 0-1
|
Treatment
Patients with HCAP are more likely than those with community-acquired pneumonia to receive inappropriate antibiotics that do not target the bacteria causing their disease.In 2002, an expert panel made recommendations about the evaluation and treatment of probable nursing home-acquired pneumonia. They defined probably pneumonia, emphasized expedite antibiotic treatment (which is known to improve survival) and drafted criteria for the hospitalization of willing patients. For initial treatment in the nursing home, a fluoroquinolone antibiotic suitable for respiratory infections (moxifloxacin, for example), or amoxicillin with clavulanic acid plus a macrolide has been suggested. In a hospital setting, injected (parenteral) fluoroquinolones or a second- or third-generation cephalosporin plus a macrolide could be used. Other factors that need to be taken into account are recent antibiotic therapy (because of possible resistance caused by recent exposure), known carrier state or risk factors for resistant organisms (for example, known carrier of MRSA or presence of bronchiectasis predisposing to Pseudomonas aeruginosa), or suspicion of possible Legionella pneumophila infection (legionnaires disease).In 2005, the American Thoracic Society and Infectious Diseases Society of America have published guidelines suggesting antibiotics specifically for HCAP. The guidelines recommend combination therapy with an agent from each of the following groups to cover for both Pseudomonas aeruginosa and MRSA. This is based on studies using sputum samples and intensive care patients, in whom these bacteria were commonly found. | While fatal in up to 20% of cases, ~80 of infants with TMD fully recover from the diseases within 4 months. However, ~10% of individuals with a history of symptomatic or silent TMD develop DS-AMKL within 4 years. During this interval, these individuals may acquire somatic mutations in those of their megakaryoblasts that bear the original truncating GATA1 mutation. These newly acquired mutations appear to result from the interactions of GATAT1 truncating mutations with excessive copies of chromosome 21 genes. The genes with these mutations include TP53, FLT3, ERG, DYRK1A, CHAF1B, HLCS, RUNX1, MIR125B2 (which is the gene for microRNA MiR125B2CTCF, STAG2, RAD21, SMC3, SMC1A, NIPBL, SUZ12, PRC2, JAK1, JAK2, JAK3, MPL, KRAS, NRAS, and SH2B3. At least one but probably several of these mutations, whether occurring in individuals with silent or symptomatic TMD, are presumed responsible for or to contribute to the development of DS-AMKL.Rare cases of transient myeloproliferative disease and DS-AMKL occur in individuals who do not have Down syndrome. These individuals usually have a history of TMD and invariably have megakaryoblasts which bear extra copies of key chromosome 21 genes, truncating mutations in GATA1, and somatic mutations in one or more of the genes listed in the previous section. These individuals have extra copies of only a portion of the genes on chromosome 21. | 0-1
|
A lubricant, typically talcum powder, can be used to reduce friction between skin and apparel in the short term. People put talcum powder inside gloves or shoes for this purpose, although this type of lubricant can actually increase the friction in the long term as it absorbs moisture. Increased friction makes blisters more likely. Other
Sunscreen and protective clothing should also be used during the hottest part of the day to avoid blisters from sunburn. Avoiding sunlight during midday is the best way to avoid blisters from sunburn. Protective gloves should be worn when handling detergents, cleaning products, solvents and other chemicals. References
External links
Media related to blisters at Wikimedia Commons
The dictionary definition of blister at Wiktionary | Infantile progressive bulbar palsy is a rare type of progressive bulbar palsy that occurs in children. The disease exists in both rapid and slow onsets, and involves inflammation of the gray matter of the bulb. Infantile PBP is a disease that manifests itself in two forms: Fazio–Londe syndrome (FL) and Brown–Vialetto–Van Laere syndrome (BVVL). == References == | 0-1
|
Chronic toxicity may occur following doses of 100 mg/kg per day for two or more days.Monitoring of biochemical parameters such as electrolytes and solutes, liver and kidney function, urinalysis, and complete blood count is undertaken along with frequent checking of salicylate and blood sugar levels. Arterial blood gas assessments typically find respiratory alkalosis early in the course of the overdose due to hyperstimulation of the respiratory center, and may be the only finding in a mild overdose. An anion-gap metabolic acidosis occurs later in the course of the overdose, especially if it is a moderate to severe overdose, due to the increase in protons (acidic contents) in the blood. The diagnosis of poisoning usually involves measurement of plasma salicylate, the active metabolite of aspirin, by automated spectrophotometric methods. Plasma salicylate levels generally range from 30–100 mg/L (3–10 mg/dL) after usual therapeutic doses, 50–300 mg/L in patients taking high doses, and 700–1400 mg/L following acute overdose. Patients may undergo repeated testing until their peak plasma salicylate level can be estimated. Optimally, plasma levels should be assessed four hours after ingestion and then every two hours after that to allow calculation of the maximum level, which can then be used as a guide to the degree of toxicity expected. Patients may also be treated according to their individual symptoms. Prevention
Efforts to prevent poisoning include child-resistant packaging and a lower number of pills per package. Treatment
There is no antidote for salicylate poisoning. | Initial treatment of an overdose involves resuscitation measures such as maintaining an adequate airway and adequate circulation followed by gastric decontamination by administering activated charcoal, which adsorbs the salicylate in the gastrointestinal tract. Stomach pumping is no longer routinely used in the treatment of poisonings, but is sometimes considered if the patient has ingested a potentially lethal amount less than one hour before presentation. Inducing vomiting with syrup of ipecac is not recommended. Repeated doses of activated charcoal have been proposed to be beneficial in cases of salicylate poisoning, especially in ingestion of enteric coated and extended release salicylic acid formulations which are able to remain in the gastrointestinal (GI) tract for longer periods of time. Repeated doses of activated charcoal are also useful to re-adsorb salicylates in the GI tract that may have desorbed from the previous administration of activated charcoal. The initial dose of activated charcoal is most useful if given within 2 hours of initial ingestion. Contraindications to the use of activated charcoal include altered mental status (due to the risk of aspiration), GI bleeding (often due to salicylates) or poor gastric motility. Whole bowel irrigation using the laxative polyethylene glycol can be useful to induce the gastrointestinal elimination of salicylates, particularly if there is partial or diminished response to activated charcoal.Alkalinization of the urine and plasma, by giving a bolus of sodium bicarbonate then adding sodium bicarbonate to maintenance fluids, is an effective method to increase the clearance of salicylates from the body. | 11
|
Pathophysiology
The mechanism of Hermansky–Pudlak syndrome indicates that platelets in affected individuals accumulate abnormally with thrombin, epinephrine, and adenosine diphosphate, furthermore platelets in these individuals have a lower amount of dense bodies
Diagnosis
The diagnosis of HPS is established by clinical findings of hypopigmentation
of the skin and hair, characteristic eye findings, and demonstration of absent
dense bodies on whole mount electron microscopy of platelets. Molecular
genetic testing of the HPS1 gene is available on a clinical basis for
individuals from northwestern Puerto Rico. Molecular testing of the HPS3 gene
is available on a clinical basis for individuals of central Puerto Rican or
Ashkenazi Jewish heritage. Sequence analysis is available on a clinical basis
for mutations in HPS1 and HPS4. Diagnosis of individuals with other types of
HPS is available on a research basis only. Treatment
While there is no cure for HPS, treatment for chronic hemorrhages associated with the disorder includes therapy with vitamin E and the antidiuretic dDAVP. Considerations for patients
A preoperative pulmonology consultation is needed. The anesthesia team should
be aware that patients may have postoperative pulmonary complications as part
of the syndrome.Preoperative hematology consultation is advisable prior to elective ocular
surgeries. Since patients with the syndrome have bleeding tendencies,
intraoperative, perioperative, and postoperative hemorrhages should be
prevented and treated. If platelet aggregation improves with desmopressin, it
may be administered in the preoperative period. However, sometimes
plasmapheresis is needed in the perioperative period.Ophthalmologists should try to avoid retrobulbar blocks in patients with the
syndrome. Whenever possible, patients with HPS may benefit from general
endotracheal anesthesia. Phacoemulsification may help prevent intraoperative
and postoperative bleeding in patients with the syndrome. | 12 is one of the two sublime numbers, with the other being 76 digits long. List of basic calculations
In science
The number of polynucleotide strands in a DNA double helix. The first magic number. The atomic number of helium. The ASCII code of "Start of Text". 2 Pallas, a large asteroid in the main belt and the second asteroid ever to be discovered. The Roman numeral II (usually) stands for the second-discovered satellite of a planet or minor planet (e.g. Pluto II or (87) Sylvia II Remus). A binary star is a stellar system consisting of two stars orbiting around their center of mass. The number of brain and cerebellar hemispheres. In sports
The number of points scored on a safety in American football
A field goal inside the three-point line is worth two points in basketball. The two in basketball is called the Shooting Guard
2 represents the catcher position in baseball. Other
In pre-1972 Indonesian and Malay orthography, 2 was shorthand for the reduplication that forms plurals: orang (person), orang-orang or orang2 (people). In Astrology, Taurus is the second sign of the Zodiac. For Pythagorean numerology (a pseudoscience) the number 2 represents duality, the positive and negative poles that come into balance and seek harmony. See also
List of highways numbered 2
Binary number
References
External links
Prime curiosities: 2 | 0-1
|
The p53 cell signaling system is not active in endometrial clear cell carcinoma. This form of endometrial cancer is more common in postmenopausal women. Mucinous carcinoma
Mucinous carcinomas are a rare form of endometrial cancer, making up less than 1–2% of all diagnosed endometrial cancer. Mucinous endometrial carcinomas are most often stage I and grade I, giving them a good prognosis. They typically have well-differentiated columnar cells organized into glands with the characteristic mucin in the cytoplasm. Mucinous carcinomas must be differentiated from cervical adenocarcinoma. Mixed or undifferentiated carcinoma
Mixed carcinomas are those that have both Type I and Type II cells, with one making up at least 10% of the tumor. These include the malignant mixed Müllerian tumor, which derives from endometrial epithelium and has a poor prognosis.Undifferentiated endometrial carcinomas make up less than 1–2% of diagnosed endometrial cancers. They have a worse prognosis than grade III tumors. Histologically, these tumors show sheets of identical epithelial cells with no identifiable pattern. Other carcinomas
Non-metastatic squamous cell carcinoma and transitional cell carcinoma are very rare in the endometrium. Squamous cell carcinoma of the endometrium has a poor prognosis. It has been reported fewer than 100 times in the medical literature since its characterization in 1892. For primary squamous cell carcinoma of the endometrium (PSCCE) to be diagnosed, there must be no other primary cancer in the endometrium or cervix and it must not be connected to the cervical epithelium. | Regular screening in those at normal risk is not called for.The leading treatment option for endometrial cancer is abdominal hysterectomy (the total removal by surgery of the uterus), together with removal of the Fallopian tubes and ovaries on both sides, called a bilateral salpingo-oophorectomy. In more advanced cases, radiation therapy, chemotherapy or hormone therapy may also be recommended. If the disease is diagnosed at an early stage, the outcome is favorable, and the overall five-year survival rate in the United States is greater than 80%.In 2012, endometrial cancers newly occurred in 320,000 women and caused 76,000 deaths. This makes it the third most common cause of death in cancers which only affect women, behind ovarian and cervical cancer. It is more common in the developed world and is the most common cancer of the female reproductive tract in developed countries. Rates of endometrial cancer have risen in a number of countries between the 1980s and 2010. This is believed to be due to the increasing number of elderly people and increasing rates of obesity. Signs and symptoms
Vaginal bleeding or spotting in women after menopause occurs in 90% of endometrial cancer. Bleeding is especially common with adenocarcinoma, occurring in two-thirds of all cases. Abnormal menstrual cycles or extremely long, heavy, or frequent episodes of bleeding in women before menopause may also be a sign of endometrial cancer.Symptoms other than bleeding are not common. Other symptoms include thin white or clear vaginal discharge in postmenopausal women. | 11
|
The list of twelve Horae representing the twelve hours of the day is recorded only in Late Antiquity, by Nonnus. The first and twelfth of the Horae were added to the original set of ten:
Auge (first light)
Anatole (sunrise)]
Mousike (morning hour of music and study)
Gymnastike (morning hour of exercise)
Nymphe (morning hour of ablutions)
Mesembria (noon)
Sponde (libations poured after lunch)
Elete (prayer)
Akte (eating and pleasure)
Hesperis (start of evening)
Dysis (sunset)
Arktos (night sky)
Middle Ages
Medieval astronomers such as al-Biruni and Sacrobosco, divided the hour into 60 minutes, each of 60 seconds; this derives from Babylonian astronomy, where the corresponding terms denoted the time required for the Suns apparent motion through the ecliptic to describe one minute or second of arc, respectively. In present terms, the Babylonian degree of time was thus four minutes long, the "minute" of time was thus four seconds long and the "second" 1/15 of a second.) In medieval Europe, the Roman hours continued to be marked on sundials but the more important units of time were the canonical hours of the Orthodox and Catholic Church. During daylight, these followed the pattern set by the three-hour bells of the Roman markets, which were succeeded by the bells of local churches. They rang prime at about 6 am, terce at about 9 am, sext at noon, nones at about 3 pm, and vespers at either 6 pm or sunset. Matins and lauds precede these irregularly in the morning hours; compline follows them irregularly before sleep; and the midnight office follows that. | A dermatofibroma, or benign fibrous histiocytomas, is a benign nodule in the skin, typically on the legs, elbows and chest of an adult. It is usually painless.Its size usually ranges from 0.2cm to 2cm, and have been reported to be larger. It typically results from mild trauma such as an insect bite. Risk factors for developing multiple dermatofibromas include lupus, HIV, blood cancer and some medicines that weaken immunity.It is usually diagnosed by its appearance, but a biopsy may be required. Other bumps such as granular cell tumor, melanoma, clear cell acanthoma and dermatofibrosis lenticularis disseminata may look similar. Reassurance is generally given and usually no treatment is needed. It can remain unchanged for years, but can resolve spontaneously. Signs and symptoms
Dermatofibromas are hard solitary slow-growing papules (rounded bumps) that may appear in a variety of colours, usually brownish to tan; they are often elevated or pedunculated. A dermatofibroma is associated with the dimple sign; by applying lateral pressure, there is a central depression of the dermatofibroma. Although typical dermatofibromas cause little or no discomfort, itching and tenderness can occur. Dermatofibromas can be found anywhere on the body, but most often they are found on the legs and arms. They occur most often in women; the male to female ratio is about 1:4. The age group in which they most commonly occur is 20 to 45 years. Some physicians and researchers believe dermatofibromas form as a reaction to previous injuries such as insect bites or thorn pricks. | 0-1
|
Special obtaining
Psychological inhibition– Psychotherapy
– Intercourses with special preservatives without lubricants or spermicides. In case of religion limitations we should use a SCD, or Seminal Collection Device, such as preservatives with holes. – Drug stimulation
– Percutaneous spermatozoa obtaining directly from epididymis, testes, etc. Neurological injury– Vibro-stimulation
– Electro-stimulation
Retrograde ejaculationThis type of ejaculation happens when there is a defect on prostate, so the sample is not ejaculated outside but to the bladder. So, in that case, what we have to do to obtain the sample is:
– Intake bicarbonate, about 25 grams, the night before and the morning of the sample obtaining. This will neutralize acidic urine and will turn it alkaline, near semens pH, so spermatozoa can survive. – Before masturbation we have to urinate to empty the bladder. This must go to the first recipient. – Just after that, the subject has to masturbate and ejaculate, obtaining then a new urine sample with ejaculation that will be stored on the second recipient. – Finally we have to obtain the next urine, 2nd urine, for potential ejaculation fraction, which will be stored in the third recipient. This may contain the most important fraction. Blood sample
Common hormonal test include determination of FSH and testosterone levels. A blood sample can reveal genetic causes of infertility, e.g. Klinefelter syndrome, a Y chromosome microdeletion, or cystic fibrosis. Ultrasonography
Scrotal ultrasonography is useful when there is a suspicion of some particular diseases. It may detect signs of testicular dysgenesis, which is often related to an impaired spermatogenesis and to a higher risk of testicular cancer. | An orchidometer can measure testicular volume, which in turn is tightly associated with both sperm and hormonal parameters. A physical exam of the scrotum can reveal a varicocele, but the impact of detecting and surgically correct a varicocele on sperm parameters or overall male fertility is debated. Sperm sample
Semen sample obtaining
Semen sample obtaining is the first step in spermiogram. The optimal sexual abstinence for semen sample obtaining is of 2–7 days. The first way to obtain the semen sample is through masturbation, and the best place to obtain it is in the same clinic, as this way temperature changes during transport can be avoided, which can be lethal for some spermatozoa. A single semen sample is not determining for disease diagnosis, so two different samples have to be analyzed with an interval between them of seven days to three months, as sperm production is a cyclic process. It is prudent to ask about possible sample loss, as that could mask true results of spermiogram. To obtain the sample, a sterile plastic recipient is put directly inside, always no more than one hour before being studied. Conventional preservatives shouldnt be used, as they have chemical substances as lubricants or spermicides that could damage the sample. If preservatives have to be used, for cases of religious ethics in which masturbation is forbidden, a preservative with holes is used. In case of paraplegia it is possible to use mechanic tools or electroejaculation. | 11
|
Social workers and other professionals in the field of adoption began changing terms of use to reflect what was being expressed by the parties involved. In 1979, Marietta Spencer wrote "The Terminology of Adoption" for The Child Welfare League of America (CWLA), which was the basis for her later work "Constructive Adoption Terminology". This influenced Pat Johnstons "Positive Adoption Language" (PAL) and "Respectful Adoption Language" (RAL). The terms contained in "Positive Adoption Language" include the terms "birth mother" (to replace the terms "natural mother" and "real mother"), and "placing" (to replace the term "surrender"). These kinds of recommendations encouraged people to be more aware of their use of adoption terminology. Honest adoption language (HAL)
"Honest Adoption Language" refers to a set of terms that proponents say reflect the point of view that: (1) family relationships (social, emotional, psychological or physical) that existed prior to the legal adoption often continue past this point or endure in some form despite long periods of separation, and that (2) mothers who have "voluntarily surrendered" children to adoption (as opposed to involuntary terminations through court-authorized child-welfare proceedings) seldom view it as a choice that was freely made, but instead describe scenarios of powerlessness, lack of resources, and overall lack of choice. It also reflects the point of view that the term "birth mother" is derogatory in implying that the woman has ceased being a mother after the physical act of giving birth. Proponents of HAL liken this to the mother being treated as a "breeder" or "incubator". | Collagenase clostridium histolyticum is an enzyme produced by the bacterium Clostridium histolyticum that dismantles collagen. It is used as a powder-and-solvent injection kit for the treatment of Dupuytrens contracture, a condition where the fingers bend towards the palm and cannot be fully straightened, and Peyronies disease, a connective tissue disorder involving the growth of fibrous plaques in the soft tissue of the penis. BioSpecifics Technologies developed the preparation, which is manufactured and marketed by Endo Pharmaceuticals as Xiaflex in the US and by Sobi as Xiapex in Europe. Biochemically, it is a mixture of two C. histolyticum collagenases, ColH and ColG. A similar ointment preparation called Santyl contains one or many collagenases from the same bacterium, but it is unclear which. Uses
In February 2010, the Food and Drug Administration of the United States approved Xiaflex for the treatment of Dupuytrens contracture. It is the first approved nonsurgical treatment for this condition. In a case of Dupuytrens contracture, collagen accumulates in the palmar fascia of the hands, so that the fingers cannot be straightened. A similar phenomenon occurs in Peyronies disease, a contracture of the penis. In February 2011, the European Commissions Committee for Medicinal Products for Human Use approved the product for the treatment of Dupuytrens contracture in adults with a palpable cord by properly trained doctors. Pfizer was reported to be working with Europes national medicines regulatory bodies to launch the new treatment, hoping doctors could prescribe the treatment by late 2011. | 0-1
|
The palliative care approach to spiritual care may, however, be transferred to other contexts and to individual practice.Spiritual, cultural, and religious beliefs may influence or guide patient preferences regarding end-of-life care. Healthcare providers caring for patients at the end of life can engage family members and encourage conversations about spiritual practices to better address the different needs of diverse patient populations. Studies have shown that people who identify as religious also report higher levels of well-being. Religion has also been shown to be inversely correlated with depression and suicide. While religion provides some benefits to patients, there is some evidence of increased anxiety and other negative outcomes in some studies. While spirituality has been associated with less aggressive end-of-life care, religion has been associated with an increased desire for aggressive care in some patients. Despite these varied outcomes, spiritual and religious care remains an important aspect of care for patients. Studies have shown that barriers to providing adequate spiritual and religious care include a lack of cultural understanding, limited time, and a lack of formal training or experience.Many hospitals, nursing homes, and hospice centers have chaplains who provide spiritual support and grief counseling to patients and families of all religious and cultural backgrounds. Attitudes of healthcare professionals
End-of-life care is an interdisciplinary endeavor involving physicians, nurses, physical therapists, occupational therapists, pharmacists and social workers. Depending on the facility and level of care needed, the composition of the interprofessional team can vary. | Sacrosidase (trade name Sucraid) is a medication used to replace sucrase in people lacking this enzyme. It is available as an oral solution. Sucraid is approved by the U.S. Food and Drug Administration (FDA) for the therapy of the genetically determined sucrase deficiency that is part of the Congenital Sucrase-Isomaltase Deficiency (CSID). Sacrosidase assists in the breakdown of sugar/sucrose into simpler forms and is useful for the relief of gastrointestinal symptoms that are associated with CSID. References
External links
Sucraid Oral Solution helps relieve the gastrointestinal symptoms that are associated with CSID (Congenital Sucrase-Isomaltase deficiency). | 0-1
|
Chronic myelomonocytic leukemia (CMML) is a type of leukemia, which are cancers of the blood-forming cells of the bone marrow. In adults, blood cells are formed in the bone marrow, by a process that is known as haematopoiesis. In CMML, there are increased numbers of monocytes and immature blood cells (blasts) in the peripheral blood and bone marrow, as well as abnormal looking cells (dysplasia) in at least one type of blood cell.CMML shows characteristics of a myelodysplastic syndrome (MDS); a disorder that produces abnormal looking blood cells, and a myeloproliferative neoplasm (MPN); a disorder characterised by the overproduction of blood cells. For this reason, CMML was reclassified as a MDS/MPN overlap disorder in 2002. For a diagnosis of CMML, the World Health Organization (WHO) states that the blood monocyte count must be >1x109/L, no Philadelphia chromosome or mutations in the PDGFRA or PDGFRB gene should be present, the blast count must be <20% and dysplasia of at least one lineage of myeloid blood cell should be present.Azacitidine is a drug used to treat CMML and is approved by the Food and Drug Administration (FDA) and the European Medicines Agency. Stem cell transplant is also used to treat CMML, and involves the transplantation of donor haematopoietic stem cells into the recipient. Blood transfusion and erythropoietin are used to treat disease associated anaemia. Signs and symptoms
One of the most common signs of CMML is splenomegaly, found in approximately half of cases. | The same phenomenon affects cyclists and exercise bike users, with prolonged pressure on the perineum from the bicycle saddle and the straining of the exercise causing the penis and scrotum to contract involuntarily. An incorrect saddle may ultimately cause erectile dysfunction (see crotch pressure for more information). Individuals with hard flaccid syndrome or other pelvic floor disorders may temporarily have an abnormally small penis. Stretched
Neither age nor size of the flaccid penis accurately predicted erectile length. Stretched length has correlated with erect length in some cases. However, studies have also shown drastic differences between stretched and erect length. One study found that a minimal tension force of approximately 450 g during stretching of the penis was required to reach a full potential erection length. this study also found that tension forces exerted in this study by the urologist were shown to be significantly (P<0.01) lower than 450g. This may account for differences between stretched and erect length. The 2015 study of 15,521 men found that the average length of a stretched flaccid penis was 13.24 cm (5.21 inches) long, which is near identical to the average length of an erect human penis which is 13.12 cm (5.17 inches) long. An 2001 study of about 3,300 men published in European Urology concluded that flaccid stretched length was measured on average to about 12.5 cm (4.9 in). In addition, they checked for correlations in a random subset of the sample consisting of 325 men. | 0-1
|
The placenta utilizes maternal cholesterol as the initial substrate, and most of the produced progesterone enters the maternal circulation, but some is picked up by the fetal circulation and used as substrate for fetal corticosteroids. At term the placenta produces about 250 mg progesterone per day. An additional animal source of progesterone is milk products. After consumption of milk products the level of bioavailable progesterone goes up. Plants
In at least one plant, Juglans regia, progesterone has been detected. In addition, progesterone-like steroids are found in Dioscorea mexicana. Dioscorea mexicana is a plant that is part of the yam family native to Mexico. It contains a steroid called diosgenin that is taken from the plant and is converted into progesterone. Diosgenin and progesterone are also found in other Dioscorea species, as well as in other plants that are not closely related, such as fenugreek. Another plant that contains substances readily convertible to progesterone is Dioscorea pseudojaponica native to Taiwan. Research has shown that the Taiwanese yam contains saponins — steroids that can be converted to diosgenin and thence to progesterone.Many other Dioscorea species of the yam family contain steroidal substances from which progesterone can be produced. Among the more notable of these are Dioscorea villosa and Dioscorea polygonoides. One study showed that the Dioscorea villosa contains 3.5% diosgenin. Dioscorea polygonoides has been found to contain 2.64% diosgenin as shown by gas chromatography-mass spectrometry. Many of the Dioscorea species that originate from the yam family grow in countries that have tropical and subtropical climates. | Usually, the large joints of the lower limb are aligned in a straight line, which represents the mechanical longitudinal axis of the leg, the Mikulicz line. This line stretches from the hip joint (or more precisely the head of the femur), through the knee joint (the intercondylar eminence of the tibia), and down to the center of the ankle (the ankle mortise, the fork-like grip between the medial and lateral malleoli). In the tibial shaft, the mechanical and anatomical axes coincide, but in the femoral shaft they diverge 6°, resulting in the femorotibial angle of 174° in a leg with normal axial alignment. A leg is considered straight when, with the feet brought together, both the medial malleoli of the ankle and the medial condyles of the knee are touching. Divergence from the normal femorotibial angle is called genu varum if the center of the knee joint is lateral to the mechanical axis (intermalleolar distance exceeds 3 cm), and genu valgum if it is medial to the mechanical axis (intercondylar distance exceeds 5 cm). These conditions impose unbalanced loads on the joints and stretching of either the thighs adductors and abductors.The angle of inclination formed between the neck and shaft of the femur (collodiaphysial angle) varies with age—about 150° in the newborn, it gradually decreases to 126–128° in adults, to reach 120° in old age. | 0-1
|
Familial exudative vitreoretinopathy (FEVR, pronounced as fever) is a genetic disorder affecting the growth and development of blood vessels in the retina of the eye. This disease can lead to visual impairment and sometimes complete blindness in one or both eyes. FEVR is characterized by incomplete vascularization of the peripheral retina. This can lead to the growth of new blood vessels which are prone to leakage and hemorrhage and can cause retinal folds, tears, and detachments. Treatment involves laser photocoagulation of the avascular portions of the retina to reduce new blood vessel growth and risk of complications including leakage of retinal blood vessels and retinal detachments. Information
Pathophysiology
FEVR is caused by genetic defects involving the regulation of blood vessel growth in developing eyes. As a result, there is poor blood vessel growth to the periphery of the retina. The lack of blood supply to the peripheral retina triggers the release of molecules that stimulate blood vessel growth, such as vascular endothelial growth factor (VEGF). However, this new blood vessel growth, also known as neovascularization, can lead to further complications such as the leakage and hemorrhage of retinal blood vessels, retinal tears, and detachments.Genetics
There have been several gene mutations associated with FEVR. These genes code for proteins involved in the WNT signaling pathway, which is involved in the development of the human eye and regulation of blood vessel growth. Depending on the genes involved, FEVR can follow an autosomal dominant, autosomal recessive, or X-linked inheritance pattern. There is varying penetrance and expressivity depending on the genes involved. | Telotristat ethyl (USAN, brand name Xermelo) is a prodrug of telotristat, which is an inhibitor of tryptophan hydroxylase. It is formulated as telotristat etiprate — a hippurate salt of telotristat ethyl.On February 28, 2017, the U.S. Food and Drug Administration (FDA) approved telotristat ethyl in combination with somatostatin analog (SSA) therapy for the treatment of adults with diarrhea associated with carcinoid syndrome that SSA therapy alone has inadequately controlled. Telotristat ethyl was approved for use in the European Union in September 2017.The U.S. Food and Drug Administration (FDA) considers it to be a first-in-class medication. Pharmacology
Telotristat is an inhibitor of tryptophan hydroxylase, which mediates the rate-limiting step in serotonin biosynthesis. Adverse effects
Common adverse effects noted in clinical trials include nausea, headache, elevated liver enzymes, depression, accumulation of fluid causing swelling (peripheral edema), flatulence, decreased appetite, and fever. Constipation is also common, and may be serious or life-threatening (especially in overdose). Formulations
It is marketed by Lexicon Pharmaceuticals (as telotristat etiprate). 328 mg telotristat etiprate is equivalent to 250 mg telotristate ethyl. References
Further reading
Kulke MH, ODorisio T, Phan A, Bergsland E, Law L, Banks P, et al. (October 2014). "Telotristat etiprate, a novel serotonin synthesis inhibitor, in patients with carcinoid syndrome and diarrhea not adequately controlled by octreotide". Endocrine-Related Cancer. 21 (5): 705–14. doi:10.1530/ERC-14-0173. PMC 4295770. PMID 25012985. External links
"Telotristat ethyl". Drug Information Portal. U.S. National Library of Medicine. "Telotristat etiprate". Drug Information Portal. U.S. National Library of Medicine. | 0-1
|
The sums of the first five non-primes greater than zero
1
{\displaystyle 1}
+
4
{\displaystyle 4}
+
6
{\displaystyle 6}
+
8
{\displaystyle 8}
+
9
{\displaystyle 9}
and the first five prime numbers
2
{\displaystyle 2}
+
3
{\displaystyle 3}
+
5
{\displaystyle 5}
+
7
{\displaystyle 7}
+
11
{\displaystyle 11}
both equal
28
{\displaystyle 28}
; the 7th triangular number and like
6
{\displaystyle 6}
a perfect number, which also includes
496
{\displaystyle 496}
, the 31st triangular number and perfect number of the form
2
p
{\displaystyle 2^{p}}
−1(
2
p
{\displaystyle 2^{p}}
−
1
{\displaystyle 1}
) with a
p
{\displaystyle p}
of
5
{\displaystyle 5}
, by the Euclid–Euler theorem.There are a total of five known unitary perfect numbers, which are numbers that are the sums of their positive proper unitary divisors. | See also
Five Families
Five Nations (disambiguation)
555 (number)
List of highways numbered 5
References
Wells, D. The Penguin Dictionary of Curious and Interesting Numbers London: Penguin Group. (1987): 58–67
External links
Media related to 5 (number) at Wikimedia Commons
The dictionary definition of five at Wiktionary
The Number 5
The Positive Integer 5
Prime curiosities: 5 | 11
|
Once it has become severe, treatment primarily involves valve replacement surgery, with transcatheter aortic valve replacement (TAVR) being an option in some who are at high risk from surgery. Valves may either be mechanical or bioprosthetic, with each having risks and benefits. Another less invasive procedure, balloon aortic valvuloplasty (BAV), may result in benefit, but for only a few months. Complications such as heart failure may be treated in the same way as in those with mild to moderate AS. In those with severe disease a number of medications should be avoided, including ACE inhibitors, nitroglycerin, and some beta blockers. Nitroprusside or phenylephrine may be used in those with decompensated heart failure depending on the blood pressure.Aortic stenosis is the most common valvular heart disease in the developed world. It affects about 2% of people who are over 65 years of age. Estimated rates were not known in most of the developing world as of 2014. In those who have symptoms, without repair the chance of death at five years is about 50% and at 10 years is about 90%. Aortic stenosis was first described by French physician Lazare Rivière in 1663. Signs and symptoms
Symptoms related to aortic stenosis depend on the degree of stenosis. Most people with mild to moderate aortic stenosis do not have symptoms. Symptoms usually present in individuals with severe aortic stenosis, though they may also occur in those with mild to moderate aortic stenosis. | In moderate cases echocardiography is performed every 1–2 years to monitor the progression, possibly complemented with a cardiac stress test. In severe cases, echocardiography is performed every 3–6 months. In both moderate and mild cases, the person should immediately make a revisit or be admitted for inpatient care if any new related symptoms appear. There are no therapeutic options currently available to treat people with aortic valve stenosis; however, studies in 2014 indicated that the disease occurs as a result of active cellular processes, suggesting that targeting these processes may lead to viable therapeutic approaches. Medication
Observational studies demonstrated an association between lowered cholesterol with statins and decreased progression, but a randomized clinical trial published in 2005 failed to find any effect on calcific aortic stenosis. The effect of statins on the progression of AS is unclear. A 2007 study found a slowing of aortic stenosis with rosuvastatin. In 2013 it was reported that trials did not show any benefit in slowing AS progression, but did demonstrate a decrease in ischemic cardiovascular events.In general, medical therapy has relatively poor efficacy in treating aortic stenosis. However, it may be useful to manage commonly coexisting conditions that correlate with aortic stenosis:
Any angina is generally treated with beta-blockers and/or calcium blockers. Nitrates are contraindicated due to their potential to cause profound hypotension in aortic stenosis. Any hypertension is treated aggressively, but caution must be taken in administering beta-blockers. Any heart failure is generally treated with digoxin and diuretics, and, if not contraindicated, cautious administration of ACE inhibitors. | 11
|