article
stringlengths 77
232k
⌀ | abstract
stringlengths 212
2.72k
| section_names
stringlengths 1
1.13k
⌀ |
|---|---|---|
cerebellar ataxia is a frequent and often - disabling syndrome that is mainly characterized by limb and gait ataxia as well as speech and ocular function impairment . in the majority of cases
so far , treatment of cerebellar ataxia has remained a difficult task as no medication has yet been proven really effective .
there were attempts in the past to treat cerebellar signs , for example downbeat nystagmus ( dbn ) , episodic ataxia type 2 ( ea2 ) , or cerebellar gait ataxia with aminopyridines .
physiotherapy is recommended and applied in clinical practice but has only moderate effects [ 57 ] .
therefore , new drugs are needed , as cerebellar ataxia often leads to a significant disability of the affected patients .
since 1957 , acetyl - dl - leucine ( tanganil ; pierre fabre , castres , france ) , an acetylated derivative of a natural amino acid , has been widely used mainly in france for the symptomatic treatment of acute vertigo and dizziness and to improve central vestibular compensation .
clinical experience has shown that it is a well - tolerated and safe drug without serious adverse effects [ 911 ] .
electrophysiological measurements have demonstrated that acetyl - dl - leucine modulates the activity of central vestibular neurons by normalizing the membrane potential of depolarized or hyperpolarized neurons , a mechanism that may lead to the observed improvement of central compensation .
furthermore , clinical studies with branched - chain amino acids demonstrated a symptomatic improvement of cerebellar symptoms .
as acetyl - dl - leucine is a branched - chain amino acid and in view of the phylogenetic and electrophysiological similarities and close interactions between vestibular and cerebellar neurons , we hypothesized that this agent might have a positive effect on ataxic symptoms in cerebellar disorders .
thirteen patients ( eight males ; median age 51 years , range 1368 ; median symptom duration 3 years , range 225 years ; for further details see table 1 ) were treated with acetyl - dl - leucine 5 g / day without titration ( 500 mg tablets of tanganil ) for 7 days .
all patients gave their informed consent for the compassionate use of acetyl - dl - leucine .
the measurements were based on the scale for the rating and assessment of ataxia ( sara ) [ 15 , 16 ] , an eight - item clinical rating scale ( gait , stance , sitting , speech , coordination ; range 040 ) , and the spinocerebellar ataxia functional index ( scafi ) [ 17 , 18 ] , which consists of the 8-m - walking - time ( 8mw ) , 9-hole - peg - test ( 9hpt ) for appendicular function and the number of pata repetitions over 10 s ( pata ) .
these tests were performed at baseline and during treatment ( on day 9 3 days).table 1patient characteristics , categorized by patient number , gender , age , etiology , age at onset , duration of disease , mri , and neuro - ophthalmological findingspatient no.sexagetypeage at onsetduration ( in years)brain mri findingsneurological findings1male60saoa582normal1 , 5 ( unilateral ) , 6 , 7 , horizontal hypermetric saccades , square wave jerks2male51saoa483normal1 , 2 , 3 , 6 , 7 hypometric saccades3male54saoa513normal1 , 2 , 7 , 84female63saoa3825atrophy of vermis1 , 2 , 3 , 4 , 6 , 75male23sca2203atrophy of cerebellum1 , 2 , 7 , slow saccades6
female57adca449atrophy of the vermis1 , 37
female68adca5414atrophy of the vermis1 , 2 , 3 , 6 , 7 , 8 , hypometric saccades , svv deviation8female47sca1443atrophy of the cerebellum1 , 2 , 5 ( bilateral ) , 6 , 7 , hypermetric saccades9female56saoa542atrophy of the vermis and anterior lobe1 , 610
male25aoa1213atrophy of cerebellum1 , 2 , 7pnp , muscle atrophy , dysarthrophonia , ocular apraxia11
male23aoa1112atrophy of cerebellum1 , 2 , 7pnp , muscle atrophy , dysarthrophonia , ocular apraxia12
male19aoa109atrophy of cerebellum1 , 7pnp , muscle atrophy , dysarthrophonia , ocular apraxia13
male13aoa112atrophy of cerebellum7dysarthrophonia
aoa ataxia with oculomotor apraxia ( aoa1 and aoa2 genetically excluded ) , saoa sporadic adult - onset ataxia of unknown etiology , adca autosomal dominant cerebellar ataxia , svv subjective visual vertical , pnp polyneuropathy , 1 saccadic smooth pursuit , 2 gaze - evoked nystagmus , 3 head - shaking nystagmus , 4 rebound nystagmus , 5 pathological head - thrust test ( uni- or bilateral ) , 6 impaired visual fixation suppression of the vor , 7 pathological optokinetic reflex , 8 downbeat nystagmus
relatives of family one ( cousins )
relatives of family two ( siblings ) patient characteristics , categorized by patient number , gender , age , etiology , age at onset , duration of disease , mri , and neuro - ophthalmological findings
aoa ataxia with oculomotor apraxia ( aoa1 and aoa2 genetically excluded ) , saoa sporadic adult - onset ataxia of unknown etiology , adca autosomal dominant cerebellar ataxia , svv subjective visual vertical , pnp polyneuropathy , 1 saccadic smooth pursuit , 2 gaze - evoked nystagmus , 3 head - shaking nystagmus , 4 rebound nystagmus , 5 pathological head - thrust test ( uni- or bilateral ) , 6 impaired visual fixation suppression of the vor , 7 pathological optokinetic reflex , 8 downbeat nystagmus
relatives of family one ( cousins )
relatives of family two ( siblings ) quality of life during this symptomatic treatment was evaluated by using the euro - qol-5d-3l questionnaire ( eq-5d-3l ) .
the known side effects such as skin reactions ( rash , urticaria , itching ) were also systemically evaluated .
figures were designed with graphpad prism ( v5 , graphpad software inc . , la jolla , ca , usa ) .
as data were not normally distributed , non - parametric testing was performed ( wilcoxon signed - rank test ) with a bonferroni correction .
1 did not perform the scafi , he was excluded from the statistical analysis of this test ) .
mean total sara decreased from a baseline of 16.1 7.1 to 12.8 6.8 ( p = 0.002 , wilcoxon signed - rank test ) . during treatment
the sara subsection scores were notably lower for gait ( p = 0.022 ) , speech disturbance ( p = 0.007 ) , finger - chase ( p = 0.042 ) , nose - finger - test ( p = 0.035 ) , rapid - alternating - hand - movements ( p = 0.002 ) and heel shin - slide ( p = 0.018 ) ( table 2 ; figs . 1 , 2 ) . the scafi items also improved , represented by the 8 mw ( p = 0.003 ) , the 9hpt of the dominant hand ( p = 0.011 ) and the pata rate ( p = 0.005 ) .
moreover , the eq-5d-3l changed from a baseline of 10.7 1.6 to 9.5 2.0 ( p = 0.003 ) , indicating that quality of life was higher during treatment . the visual analogue scale ( vas)as part of the eq-5d-3l rose from 0.57 0.21 to 0.63 0.19 ( p = 0.241 ) .
eleven out of 13 patients reported a subjective improvement on therapy ( nos . 1 , 3 , 4 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 ) .
the patients did not report any side effects.table 2clinical assessment of patients by sara and scafi at baseline and on medicationpatient no.baselineon medicationsara8 mwpata9hpt - d9hpt - nsara8 mwpata9hpt - d9hpt - n113.00
214.005.1020.0032.0038.0012.004.8026.0021.0041.00312.004.9014.0041.2038.209.504.7022.0037.8033.80411.508.6015.0028.8030.407.008.1024.0026.8027.10513.005.2023.0041.4040.709.004.4023.0030.4029.906
8.006.6016.0025.9025.406.006.0024.0024.6025.407
17.0010.1019.0037.6040.7011.008.0022.0029.7038.70817.0014.6024.0062.0049.8012.5012.7025.0059.1051.70913.006.7014.0045.0030.7012.006.5026.0035.7027.8010
27.00
11.00
27.00
11.00
11
27.0062.2017.00
23.0044.0018.00
12
29.0028.6011.00
22.0027.3013.00
sara scale for the assessment and rating of ataxia , scafi spinocerebellar ataxia functional index , 8 mw 8-m - walking - time , 9hptd 9-hole peg test of the dominant hand , 9hptn 9-hole peg test of the non - dominant hand
relatives of family one ( cousins )
relatives of family two ( siblings )
not performed for other reasons
not able to perform due to disabling reasonsfig .
1individual changes on a scale for the rating and assessment of ataxia ( sara ) and b quality of life questionnaire euro - qol-5d-3l ( eq-5d-3l ) on medication with acetyl - dl - leucine ( 5 g / day ) for 9 3 daysfig .
2value changes on a scale for the assessment and rating of ataxia ( sara ) and spinocerebellar ataxia functional index ( scafi ) sub - score items in terms of b 8 m walk ( 8 mw ) , c pata word count in 10 s and d 9-hole - peg - test ( 9hpt ) of the dominant and non - dominant hand before and during the therapy with acetyl - dl - leucine ( 5 g / day ) ( mean sd ) clinical assessment of patients by sara and scafi at baseline and on medication
sara scale for the assessment and rating of ataxia , scafi spinocerebellar ataxia functional index , 8 mw 8-m - walking - time , 9hptd 9-hole peg test of the dominant hand , 9hptn 9-hole peg test of the non - dominant hand
relatives of family one ( cousins )
relatives of family two ( siblings )
not performed for other reasons
not able to perform due to disabling reasons individual changes on a scale for the rating and assessment of ataxia ( sara ) and b quality of life questionnaire euro - qol-5d-3l ( eq-5d-3l ) on medication with acetyl - dl - leucine ( 5 g / day ) for 9 3 days value changes on a scale for the assessment and rating of ataxia ( sara ) and spinocerebellar ataxia functional index ( scafi ) sub - score items in terms of b 8 m walk ( 8 mw ) , c pata word count in 10 s and d 9-hole - peg - test ( 9hpt ) of the dominant and non - dominant hand before and during the therapy with acetyl - dl - leucine ( 5 g / day )
the 13 patients in this case series had ataxia as the leading symptom of cerebellar disorders of different etiologies .
patients on medication with acetyl - dl - leucine showed a significant improvement of both the ataxic symptoms measured by sara and scafi as well as quality of life .
the daily administration of 5 g / day used in this case series is in the upper range of the drug s recommended dosage , but lower than in studies on its use for acute vertigo [ 8 g / day ; for reference see ( https://www.clinicaltrialsregister.eu/ctr-search/trial/2010-023099-13/de ) ] . as expected from its safety profile , acetyl - dl - leucine was well tolerated ; patients did not report any side effects . currently there is no proven symptomatic pharmacotherapy for cerebellar ataxias .
drugs such as varenicline , riluzole or erythropoietin in friedreich s ataxia were tested in the past . in a placebo - controlled trial with varenicline
as mentioned above , aminopyridines are effective in a subset of symptoms ( dbn or ea2 ) . because there are no effective anti - ataxia drugs
the improvement of function after 4 weeks of intensive physiotherapy was 5.2 sara points ; patients regained functional performance equivalent to that after two or more years of disease progression .
compared to this , patients on treatment with acetyl - dl - leucine had an improvement of 3.3 sara points after treatment for 9 3 days .
it has to be mentioned that the patient group in this case series was inhomogeneous
so it is probable that the positive effects might be even be better in a more homogenous group of patients .
although acetyl - dl - leucine has been in use for more than 50 years , its exact pharmacological and electrophysiological modes of action have not been fully elucidated .
an animal model of acute unilateral labyrinthectomy in guinea pigs showed that acetyl - dl - leucine restored the membrane potential of both hyperpolarized and depolarized vestibular neurons [ 8 , 12 ] .
this effect is assumed to be mediated by its direct interactions with membrane phospholipids such as phosphatidylinositol 4,5-bisphosphate , which influences ion channel activity . on the basis of these findings
, acetyl - dl - leucine may also stabilize the membrane potential of cerebellar neurons .
the input from cerebellar purkinje cells and mossy / climbing fiber collaterals controls the action potential of cerebellar and vestibular nuclei , which in turn project to the brainstem , thalamus and spinal cord .
thus , acetyl - dl - leucine may act through afferent and efferent projections on upstream and downstream structures , thereby influencing motor control .
cerebellar network and be involved in the balancing of information between the cerebellum and effector muscles .
however , the modes of action of acetyl - dl - leucine in cerebellar disorders are still largely hypothetical and require further research .
our clinical findings on its efficacy in cerebellar ataxia must be carefully evaluated in electrophysiological studies and animal models of cerebellar ataxia as well as placebo - controlled and pet imaging studies in humans .
second , the change in the symptoms after termination of the treatment was not systematically evaluated .
third , we can not rule out either a placebo effect or a training effect on components of the ataxia assessment ( e.g. , 9hpt ) , but neither effect can explain the significant and clinically convincing effects documented by the standard ataxia scores sara and scafi . in conclusion , its improvement of cerebellar ataxia and the absence of adverse effects indicate that acetyl - dl - leucine is a worthy candidate for further clinical trials and also basic research . | no existing medication has yet been shown to convincingly improve cerebellar ataxia .
therefore , the identification of new drugs for its symptomatic treatment is desirable .
the objective of this case series was to evaluate the efficacy of treatment of cerebellar ataxia with the amino acid acetyl - dl - leucine ( tanganil ) .
thirteen patients ( eight males , median age 51 years ) with degenerative cerebellar ataxia of different etiologies ( sca1/2 , adca , aoa , saoa ) were treated with acetyl - dl - leucine ( 5 g / day ) without titration for 1 week .
motor function was evaluated by changes in the scale for the rating and assessment of ataxia ( sara ) and in the spinocerebellar ataxia functional index ( scafi ) during treatment compared to a baseline examination .
quality of life ( euroqol-5d-3l ) and side effects were also assessed .
mean total sara decreased remarkably ( p = 0.002 ) from a baseline of 16.1 7.1 to 12.8 6.8
( mean sd ) on medication .
there were also significant improvements in sub - scores for gait ( p = 0.022 ) , speech ( p = 0.007 ) , finger - chase ( p = 0.042 ) , nose - finger - test ( p = 0.035 ) , rapid - alternating - movements ( p = 0.002 ) and heel - to - shin ( p = 0.018 ) .
furthermore , patients showed better performance in the scafi consisting of the 8-m - walking - time ( 8 mw , p = 0.003 ) , 9-hole - peg - test of the dominant hand ( 9hptd , p = 0.011 ) and the pata rate ( p = 0.005 ) .
quality of life increased during treatment ( p = 0.003 ) .
no side effects were reported . in conclusion , acetyl - dl - leucine significantly improved ataxic symptoms without side effects and therefore showed a good risk
benefit profile .
these findings need to be confirmed in placebo - controlled trials . | Introduction
Design/methods
Results
Discussion |
there had been no pain or dysphonia but a bothersome sensation related to progressive surface roughness that prompted her to seek care .
she was otherwise healthy ; a small congenital melanocytic nevus affecting the right inner thigh had been excised during early childhood . on examination
, there was no palpable cervical lymphadenopathy . a well - demarcated , circular plaque ( 1.21.10.3 cm ) with a slight pebbled texture affected the left posterior hard palate . while predominantly erythematous , there was scattered light brown pigmentation ( figure 1 ) .
figure 1initial presentation of a non - homogenous brown - pigmented palatal plaque .
initial presentation of a non - homogenous brown - pigmented palatal plaque .
the underlying stroma contained sheets of nevus cells ( figure 2 ) exhibiting maturation and extending deep into the lamina propria and around minor salivary ducts ( figure 3 ) , nerves and blood vessels .
cells diffusely stained with melana ( figure 5 ) and ki-67 suggested a low proliferative index . only the superficial cells stained with hmb-45 ( figure 6 ) .
figure 2papillomatous oral squamous epithelium and sheets of nevus cells extending deep within the lamina propria ( h+e , 4 ) .
papillomatous oral squamous epithelium and sheets of nevus cells extending deep within the lamina propria ( h+e , 4 ) .
figure 4scant melanin pigmentation was seen only in superficial nevus cells ( h+e , 20 ) .
scant melanin pigmentation was seen only in superficial nevus cells ( h+e , 20 ) .
figure 5diffuse staining of nevus cells with melana .
diffuse staining of nevus cells with melana .
melanocytic nevi are separated into acquired and congenital subtypes with the latter identified at birth . the palate is not easily visualized , however , which may explain delayed identification . while it is recognized that parental history may not be accurate , there was certainty of identification during early infancy .
the larger size was suggestive of a congenital nevus as acquired nevi are usually less than 6 mm in diameter .
congenital nevi may have a papular , pebbly or verrucous surface as well as hypopigmented areas .
histologically , a congenital pattern was characterized by a diffuse infiltration of nevus cells extending around blood vessels , nerves , salivary ducts as well as between collagen bundles .
nevus cells may exist and proliferation in diverse anatomic locations as evidenced by identification of aggregates in the parenchyma of lymph nodes .
oral melanocytic nevi are uncommon , and to the best of these authors knowledge , only three well - documented cases of intraoral congenital melanocytic nevi have been reported in the english literature , ( table 1 ) .
other mucosal sites are also uncommonly affected with rare reports of conjunctival or genital congenital nevi .
characteristics of reported oral congenital melanocytic nevi classification of congenital melanocytic nevi is by size : small ( < 1.5 cm ) , medium ( 1.5 to 19.9 cm ) and large or giant ( > 20 cm ) .
the primary concern is malignant transformation and there is general agreement that the risk increases with the size . while a clear risk exists for larger lesions , such an association is controversial with small congenital nevi .
identified histologic features of congenital nevi in 8.1% of melanoma specimens . in another study , a melanoma risk of 2.64.9% was estimated for persons with small congenital nevi and it was concluded that small congenital nevi may represent precursors for at least some cases of cutaneous melanoma .
there is general agreement that the larger the congenital nevi the more likely the need for excision . for small congenital nevi
, management may be either excision or observation but there exists no clear consensus or guidelines .
excision seems reasonable as in most cases one would expect minimal surgical morbidity and excision facilitates comprehensive histologic sampling to exclude melanoma , and presumably , may prevent malignant transformation . from the patient 's perspective , as was the case with this patient failing to attend post - surgical assessment , excision may potentially mitigate the necessity for long - term observation .
ultimately , decisions require individualization with consideration of the size , anatomic restrictions as well as patient factors such as co - morbidities and ability to attend observation . | oral pigmented lesions are uncommon and congenital melanocytic nevi are especially rare .
we report a case of a patient with multiple congenital melanocytic nevi including a palatal lesion .
this is reported to add to the scant literature that exists on this subject .
prognosis and management are discussed . | Case Report
Discussion |
the production of nano-
and microfibers has gained increasing interest
due to the large number of promising applications , including filtration ,
textiles , medical , protective , structural , electrical , and optical
materials and coatings .
in particular , an intriguing feature of electrospun
fibers is the high surface - area , which is due to the combination of
small radius and extreme length of the fiber ( in principle up to kilometers
when polymer solutions with a high degree of molecular entanglement
are used to achieve stable electrified jets ) .
, several
studies have been focused on the production and characterization of
such structures . following the pioneering works of rayleigh and , later , zeleny
, the electrospinning
process relies on a strong electric field ( typically 1010 vm ) to elongate
and accelerate a polymeric fluid body from a nozzle toward a conductive
collector . during the development of the jet path , the stream cross - section
decreases by orders of magnitude , providing a jet , and consequently
solid fibers , with transversal size potentially well below the micrometer
scale .
the dynamic evolution of the polymer nanojet involves two different
stages : in the first , the pendent polymeric droplet is stretched by
the intense external electric field , providing a straight path . in
the second
, small perturbations induce bending instabilities , and
a complex jet path is consequently observed . in a typical electrospinning
experiment , hydrodynamic perturbations , as well as mechanical vibrations
nearby the nozzle , might misalign the jet axis . according to the earnshaw
theorem , an off - axis misalignment triggers
an electrostatic - driven bending instability , leading the fluid into
a region of spiral coils . as a consequence
, the jet travels a larger
distance between the nozzle and the collector , and the fiber diameter
undergoes a further decrease along the way , leading to a reduction
of the fiber diameter .
several studies were focused on experimental
parameters , such as
applied electric voltage , liquid viscosity , etc .
for instance , a gas stream
provided by suitable distributers and surrounding the electrospinning
nozzle can be used as additional stretching force , providing fibers
with small diameter .
nonetheless , many of the effects of gas flows on
electrospinning still need to be investigated in a systematic way ,
particularly with regard to the relationship between gas flow speed
and bending instabilities .
indeed , given the ubiquitous nature of
intentional or stochastic gas flows in the process atmosphere , understanding
in depth such points is very important for a correct design of electrospinning
experiments , when fibers with very small diameters are to be produced
with a given polymer solution . in this framework
, simulation
models can be useful for understanding
the key processing parameters and ultimately exerting a better control
on the resulting fiber morphologies , better elucidating the phenomenology
of electrified jets and providing valuable information for the development
of new spinning experiments .
for these reasons , various models have
been proposed for electrospinning in the recent years , which can be categorized on the
basis of the approach used for representing the jet . in the first
class of models ,
the filament is treated as obeying the equations
of continuum mechanics , whereas in the second the jet is described as a series of discrete
elements obeying the equations of newtonian mechanics , as it is the case of the present work .
developed
a one - dimensional model for studying the air drag effects on the early
stage of electrospinning process . in this approach ,
the liquid jet
was represented as a series of charged beads , connected by viscoelastic
springs according to the original picture proposed by reneker and
yarin .
the jet dynamics was the result of the combined
action of viscoelastic coulombic , external electrical forces , and
a dissipative term that models the air drag effect . on the basis of
experimental observations ,
the dissipative
air drag term was taken as nonlineary dependent on the jet geometry .
as consequence , the model included a nonlinear langevin - like stochastic
differential equation describing the fluid motion . however , an investigation
of the air drag effects on three - dimensional ( 3d ) bending instabilities
was still missing . here , we provide a 3d description of electrified
jets which includes
air drag , and study its effects in the dynamics of the bending instabilities .
in particular , our aim is to investigate the relation between the
dissipative - perturbing forces and the resulting deposition of electrospun
fibers .
furthermore , the extended model is used to set up an ideal
experiment of gas - assisted electrospinning , which involves a gas - injecting
system located at the collector and oriented toward the spinneret .
in this context , we probe the effects of a controlled gas counterflow
on the fiber diameter , which could be useful for designing new electrospinning
experiments .
we present the
3d model for electrospinning ,
with the set of stochastic differential equations of motion ( eom )
that govern the dynamics of system .
in this paper , we modify the 3d model of electrospinning
previously
implemented in the software package jetspin , a specifically developed ,
open - source and freely available code .
we use a lagrangian
discrete model that represents the polymer solution filament as a
series of n beads ( jet beads ) at mutual distance l , each pair of beads in the row being connected by viscoelastic
elements , as proposed in ref ( 21 ) ( figure 1 ) .
the length l is taken to be larger than the radius
of the filament . each ith bead has mass mi and charge qi , assumed equal for all the beads for simplicity .
the spinneret is represented by a single mass - less point of charge q0 fixed at x = 0 , which we
call the nozzle bead .
a typical simulation is started with a single
jet bead inserted at the nozzle and placed at a distance lstep from the nozzle along the x axis .
the onset of the jet takes place with a cross - sectional radius a0 , defined as the radius of the polymer solution
filament at the nozzle , before the stretching process occurs , leading
to the elongation and cross - section reduction in the fluid body .
furthermore ,
the starting jet bead has an initial velocity vs along the x axis equal to the bulk fluid
velocity in the needle of the extrusion syringe or reservoir . once
this traveling bead reaches a distance 2lstep away from the nozzle , a new particle ( third body )
is placed
at distance lstep from the nozzle along
the straight line joining the two previous bodies ( nozzle and previous
jet bead ) .
note that lstep defines the
length step used to discretize the liquid jet at the nozzle before
the stretching process starts taking place .
the procedure is then
repeated , leading to a series of n beads representing
the jet .
diagram
of the electrospinning model as implemented in the vanilla
version of jetspin without air drag and lift force terms ( which are
sketched in figure 2 ) .
each discrete element representing a jet segment is drawn by a
blue circle with a plus sign denoting the positive charge of segment .
we represent the maxwell viscoelastic force , fve , the gravitational force fg , the
surface tension force , fst , pointing to the
center of curvature to restore the rectilinear shape , and the coulomb
repulsive term , fc , which is the sum over
all the repulsive interactions between the beads .
the external electric
potential , v0 , is indicated by the red
arrow in figure , and the upper cyan cone represents the nozzle .
the
dashed red line represents the ideal straight line to which the filament
tends under the surface tension force .
the jet is therefore modeled as a body constituted by a viscoelastic
maxwell fluid , and the stress i on the ith dumbbell which connects the bead i with the bead i + 1 is given by the equation1where li is the length of the element , g is the elastic
modulus , the viscosity of the fluid jet , and t is the time ( figure 1 ) .
the length li is
computed as the mutual distance between the ith bead
and its previous bead .
being ai the fiber radius at the bead i , the viscoelastic
force , fve , pulling the bead i back to i 1 and toward i + 1 , reads as follows:2where ti is the unit vector pointing from bead i
1 to bead i. the force fst due to the surface tension for the ith
bead is given by3where is the surface tension coefficient , ki is the local curvature , and ci is the unit vector
pointing the center of the local curvature from bead i ( figure 1 ) .
the force fst tends to restore the rectilinear shape
acting on the bent part of the jet . in electrospinning processes
,
the jet stretch is mainly due to
an external electric potential v0 that
is applied between the spinneret and the conducting collector . denoted
by h , the distance of the collector from the injection
point
, each ith bead undergoes the electric force:4where x is the unit vector
pointing the collector from the spinneret ( figure 1 ) . note that whenever a jet bead touches
the collector , its position is frozen and its charge is set to zero .
the net coulomb force fc on the ith bead from all the other beads is given by5where rij2 = ( xi xj ) + ( yi yj ) + ( zi zj ) , and uij is the unit vector pointing the ith bead from the jth bead .
the force due to the gravity is also considered
in the model , and
it is computed by the usual expression6where g is the gravitational
acceleration .
next , we extend the
3d framework to include
the air drag terms and reproduce aerodynamic effects . consequently ,
code modifications have been implemented in jetspin . in particular
,
we model the air drag by adding a random term and a dissipative term
to the forces involved in the process .
the dissipative air drag term
is usually dependent on the geometry of the jet , which changes in
time , and it combines longitudinal and lateral components . on the
basis of experimental findings , the longitudinal component of the air drag dissipative force term
acting on a jet segment of length l is given by the
empirical formula7where a denotes the air
density , a the kinematic viscosity , t the tangent unit vector , and vt = ( v vflow)t represents the tangent
component of the total velocity with respect to the air flow given
as the difference between jet velocity v and air
flow velocity vflow
. the gas flow is assumed
to be oriented along the x - axis with opposite direction ,
but the choice is not mandatory . following the approach introduced
by lauricella et al . , we rearrange the
last eq as8rewriting eq 8 for the ith bead representing a jet
segment , and assuming a constant volume of the jet ai2li = a02lstep , so that9with lstep and a0 respectively the
length and the radius of
the jet segment at the nozzle before the stretching , we obtain10where we have collected several terms of the
empirical relationship in i which
is equal to11to obtain the dissipation
term of a non linear
langevin - like equation ( for further details see lauricella et al . ) .
it is worth stressing that i is derived by the empirical relationship of eq 7 , so that also eq 11 is a nondimensional
combination of physical parameters . in a 3d framework
following the expression introduced by yarin , under a high - speed air drag the lateral component flift , i of the aerodynamic dissipative
force related to the flow speed is given in the linear approximation
( for small bending perturbations ) by12the
combined action of such longitudinal and
lateral components ( figure 2 ) provide the dissipative force term acting on the ith bead13whereas the random force term for
the ith bead has the form14where dv denotes a generic diffusion
coefficient in velocity space
( which is assumed constant and equal for all the beads ) , and i is a 3d vector , whereof each component
is an independent stochastic process , namely , a nowhere differentiable
function with (t1 ) (t2) = (|t2 t1|)s , and (t) = 0 .
note that ,
for the sake of simplicity , we assume = d(t)/dt , where (t ) is a wiener process , namely , a stochastic processes with stationary
independent increments ( often called standard brownian motion ) .
diagram of the electrospinning model showing the dissipative
force ,
which is the sum of air drag force , fair ( black arrows ) and lift force , flift ( green arrows ) , when a gas flow of speed vflow is present ( red arrows ) . the sum of these forces governs the jet dynamics according
to the
newton s equation providing the following nonlinear langevin - like
stochastic differential equation:15where vi is
the velocity of the ith bead .
the velocity vi satisfies the kinematic relation:16where ri(xi , yi , zi ) is the position vector of the ith bead .
equations 1 , 15 , and 16 form the set of eom governing
the time evolution of the system .
it is worth noting that eq 15 recovers a deterministic
eom in the limit a and dv 0 .
furthermore , we define also the
eom of the nozzle bead located
to model fast mechanical perturbations at the spinneret . given the initial position of the nozzle yn0 = acos( ) and zn0 = asin( ) where a and
are the amplitude and the initial phase of the perturbation ,
respectively , the eom for the nozzle bead are17a17bwhere denotes the perturbation frequency .
the actual perturbation at the nozzle produces a characteristic annular
deposition of the fiber on the collector , as initially observed by
reneker et al .
altough the collected
fibers observed in experimental findings show less regular fiber patterns ,
we find it convenient to investigate counterflow effects avoiding
extra perturbations not directly related to the gaseous counterflow .
thus , we focus our investigation on the specific perturbation effect
due to a counterflow gas on the jet dynamics . following previous
works ,
first , the time is discretized as a uniform sequence ti = t0 + jt , j = 1 , ... , nsteps . at each time step and for each ith jet bead
, we first integrate the stochastic eq 15 using the explicit integration
scheme proposed by platen , with the order of accuracy
evaluated in the literature equal to 1.5 .
kutta integrator , where the vi(t+t ) value was previously obtained via the
platen scheme .
solutions
of polyvinylpyrrolidone ( pvp ) are largely used in electrospinning
experiments . in this work ,
we use a few simulation parameters developed
by lauricella et al . and based on the
experimental data provided by montinaro et al .
the process makes use of a solution of pvp ( molecular weight
= 1300 kda ) prepared by a mixture of ethanol and water ( 17:3 v : v ) ,
at a concentration ranging between 11 and 21 mg / ml .
the relevant parameters
include mass , charge density , viscosity , elastic modulus , and surface
tension , which were already included in the model as implemented in
jetspin .
the extra parameters related
to the gas environment are modeled on the air ( density a = 1.21 kg / m , kinematic viscosity a = 0.151 cm / s ) .
the parameter dv , i for the ith bead is set to be i for all the simulations .
all the i have the same value , and consequently , dv , i is constant for all the beads .
in addition , a perturbation is applied at the nozzle with frequency
= 10s , as proposed by reneker
et al . , whereas its amplitude a is equal to 0.01 mm .
the voltage bias between the nozzle
and the collector is 9 kv , and the collector is placed at 16 cm from
the nozzle .
the initial fluid velocity vs was estimated considering a solution pumped at constant flow rate
of 2 ml / h in a needle of radius 250 m . for convenience ,
we probe three different conditions of
air flow velocity , vflow . in the first
,
we study the electrospinning process in the absence of gas flow , vflow = 0 , which will be use as a reference case
( case i ) . in the second and third ,
we take vflow = 10 m / s ( case ii ) , and vflow = 20 m / s ( case iii ) , whose magnitudes are similar
to the jet velocity measured at the collector ( about 20 m / s ) in the
absence of gas streams .
it is worth stressing that the gas flow is
oriented along the x - axis , and the negative sign
of vflow indicates its opposite direction
( counterflow , from the collector toward the nozzle ) . for each of the
three conditions
all simulations were carried out by the modified
version of the software package jetspin , and the corresponding eom were integrated with a time step of 10 seconds over a simulation span of 0.5 s. the headings used are as follows :
, density ; q , charge density ; a0 , fiber radius at the nozzle ; vs , initial fluid velocity at the nozzle ; , surface
tension ; , viscosity ; g , elastic modulus ; v0 , applied voltage bias ; , frequency
of perturbation ; a , amplitude of perturbation ; a , air density ; a , air kinematic viscosity . for the sake of convenience
,
we report below the definition of
few observables , which will be used in the following .
we define the
jet length as18with ri the position vector , and n the number of
jet beads .
this observable takes note of the total length of the jet
from the collector up to the nozzle .
further , we introduce a suitable
observable to assess the tortuosity of the path , which is defined
as19where |r1|is
the position vector modulus of the closest bead to the collector .
note that tends to 1 for a rectilinear jet , and it takes larger
values depending on the complexity of the bending part of the jet .
we also define the instantaneous angular aperture of the instability
cone as20with x1 , y1 and z1 the coordinates
of the bead closest to the collector ( figure 1 ) . in all the simulations
, we observed
two different regimes of the
observables ( , , , etc . ) describing the process .
in the first stage , the jet has not yet reached the collector , and
we observe an initial transient of the observables . after the jet
touches the collector ,
the observables start to fluctuate around a
constant mean value , providing a stationary regime . as a consequence ,
we discern two stages of the jet dynamics , hereafter denoted as early
and late dynamics , respectively . for each case
, we
compute the average values of observables describing the jet dynamics
( figure 3 ) .
the averages
are assessed at every step of the time integration ; hence , we obtain
time - dependent mean values of observables along the jet evolution .
in table 2 we report
the average first - hitting - time , tfirst , defined as the time that the jet initially takes to touch
the collector .
in particular , we note that the presence of a gas counterflow
does not affect significantly the first - hitting - time , and the velocity
of the jet bead at the collector is almost the same for all the three
investigated cases ( within the margin of error ) . for the sake of completeness ,
we plot in figure 4 the time - dependent mean velocity of the first bead as a function
of time . on the contrary , a significant increase of the jet length
(tfirst)
this effect might be relevant for improving the quality of the
resulting fibers , because longer jet lengths usually correspond to
smaller cross sections of the deposited polymer filaments .
such an
increment of (tfirst)
is due to the greater complexity of the jet path , where bending instabilities
play a significant role in determining the distance traveled from
the nozzle to the collector .
this is well represented by the
parameter , which increases by 20% in case iii , when the gas flow is
set to vspeed = 20 m / s .
time - dependent mean values
of the observables jet length , (t)
( a ) and tortuosity degree , (t)
( b ) for the different cases of flow speed vflow . stars : times corresponding to the mean
value of the first - hitting - time , tfirst , for each case .
time - dependent mean value of the jet velocity v(t) ( meter per second ) as a function of
time ( second ) for all the three cases .
stars : times corresponding
to the mean value of the first - hitting - time , tfirst , for each case . the averages
were computed over
all the ten trajectories for each of the three cases of gas flow speed vflow .
the dynamics of bending instabilities also deserves
a few comments :
we show in figure 4 the time - dependent mean value of the jet length , (t , and tortuosity degree , (t) , for each case under investigation . here
, we
find that bending instabilities start earlier for case iii , triggering
a larger jet path in the subsequent dynamics .
this is well represented
by the initial hump of (t) ,
which is already equal to 5.0 after 0.002 s. the larger tortuosity
degree is likely due to the lift force , which increases the local
curvature of the jet , as shown in eq 12 .
hence , the synergic action of lift and coulomb repulsive
forces boost bending instabilities at an earlier stage , and case iii
shows a different dynamics , which is clearly evident in the initial
0.005 s. this effect substantially differs from what is reported in
literature for electrospinning models without external gas flows ,
where only coulomb repulsive forces contribute to the jet misalignement .
furthermore , we note that (t) increases for all the
cases both before and after
the jet has touched the collector for the first time , indicating that
bending instabilities reach a stationary regime of fluctuation at
least after the time tlim 2tfirst. we will consider this criteria
in the following subsection , to discard the initial transient of dynamics
for a correct statistical analysis of the stationary regime .
we perform a statistical
analysis of the positions of the jet beads over all the ten independent
simulations for each of the three cases under investigation .
in particular ,
we define an orthogonal box of dimensions 16 cm 8 cm
8 cm along the x , y , and z - axes , respectively .
the orthogonal box is discretized
in subcubic cells of side equal to 1 mm , and the normalized numerical
density field , denoted i , j , k , is computed over all the box
for each case . by construction , i , j ,
k provides the probability
to find a jet bead in the cubic cell identified by the indices i , j , k. as above , we
discard the initial part of each simulation , which corresponds to
the early dynamics , so that only the late dynamics describing the
stationary regime is considered .
hence , the dynamics of each trajectory
is evolved in time for 0.5 s. figure 5 displays the isosurface of n representing points of constant value 0.001 .
the jet paths
statistically lie on an empty cone , whose aperture slightly increases
upon increasing the flow speed vflow .
in addition , the chaotic behavior of jets is found to be enhanced
by high - speed gas flows .
this is shown both by the larger statistical
dispersion of the cone ( thickness of cone wall ) and by the different
shape of the electrospun coatings deposited on the collector , which
follow a fuzzier path ( gray fiber drawn in figure 5 ) .
the different depositions of fibers for
the three cases are highlighted by the normalized 2d maps in figure 6 , where we show the
probability of a jet bead hitting the collector at the coordinates y and z ( note that the plate is perpendicular
to x by construction ) . here , all the distributions
are found to draw almost regular circles , which subtend their relative
instability cones of aperture angle . the probability distribution
of hitting a specific point on the collector is remarkably peaked
in case i without gas flow , whereas the fiber deposition becomes less
regular in the other cases . in particular ,
the distributions lie within
two concentric circles , whose inner radius decreases , while the outer
increases , as the air gas flow is enforced .
the trend is a consequence
of the more complex paths with highest tortuosity degree ( see
case iii in table 3 ) drawn by the jets under the effects of strong perturbation forces
in the presence of a high speed gas counterflow .
the snapshot related
to case iii in figure 5 represents well the chaotic route followed by the viscoelastic jet
under the gas flow effects , which provides a longer jet path length
, whose mean value increases by increasing
the flow speed vflow , as reported in table 3 . on the contrary ,
the mean values of the aperture angle are not significantly
altered by the gas flow ( table 3 ) , showing that the instability mainly alters the statistical
dispersion of the cone , but not in its mean value .
simulation snapshots
of the three different cases . from left to
right the snapshots correspond to case i , vflow = 0 m / s , case ii , vflow = 10
m / s , and case iii , vflow = 20
m / s , respectively . the jet between the nozzle and the collector is
drawn in blue , and the fibers deposited on the collector are gray .
the isosurfaces in cyan represent the normalized numerical density
field of constant value equal to 0.001 .
normalized 2d maps computed over the coordinates y and z of the collector for the three
cases under
investigation .
the color palettes define the probability that a jet
bead hits the collector in coordinates y and z. the averages
were computed only
in the stationary regime over all the ten trajectories for each of
the three cases of gas flow speed vflow .
the high - speed gas flow significantly
affects the size distribution
of the deposited fibers . in figure 7
we report the probability of collecting fibers with
a given value of cross - sectional radius . here
, we observe a nontrivial
trend of the fiber radius as a function of the air counterflow velocity .
in particular , by applying an air flow velocity vflow of 10 m / s ( case ii )
, we note a decrease in
fiber radius by 10%15% , and the fiber radius probability distributions
become broader .
the latter effect is even more evident for case iii
( vflow = 20 m / s ) , where the distribution
computed over all the trajectories is spread out from its mean with
values of fiber radius oscillating between 3 and 8 m .
further ,
we observe a nonsymmetric distribution of the fiber radius for both
cases ii and iii , which may appear somehow counterintuitive .
nonetheless ,
we point out that skewed probability distributions are quite common
in the statistical behavior of complex nonlinear systems , such as
the one considered here .
although finding the coarse - grained dynamic
equations of motion with respect to the jet cross section is beyond
the aim of the present work , we investigate the phenomenon by computing
the average distribution of the jet radius along the curvilinear coordinate s , where s [ 0 , 1 ] is introduced
to parametrize the jet path ; s = 0 identifies the
nozzle , and s = 1 the filament at the collector .
in figure 8 we report
for all the three cases the median of the radius conditional distributions
computed along the curvilinear coordinate s ( the
condition is the given value of s ) .
we also report
the amplitudes of the conditional distributions evaluated as interquartile
range . here
, we observe that all the radius fluctuations are generated
close to the nozzle .
in particular , at s = 0.05 we
already note nonsymmetric fluctuations of the jet radius for cases
ii and iii .
further , we observe larger average values of the curvature k when the counterflow is activated .
for instance , the averaged
curvature measured at s = 0.05 is 1.1 , 1.6 , and 1.9
for cases i , ii and iii , respectively .
this is likely due to lift
perturbation forces acting in junction with the coulomb repulsive
forces , which produce sharp bends along the jet path already close
to the nozzle , providing large fluctuations in the jet cross section .
thus , the quality of the produced fibers is less controllable in the
presence of large counterflows ( as already evidenced in figure 6 for case iii ) , and the beneficial
effects of the gas stream in decreasing the fiber radius are largely
counteracted . therefore , with the aim of producing thinner fibers
and achieving narrower size distributions of the deposited polymer
filaments , the counterflow velocity vflow should be carefully tuned , to provide an optimal balance between
dissipative and perturbation forces as related to the gas stream .
meadian values of the jet radius distributions , a ( micrometer ) , computed along the curvilinear coordinate s for all the three cases .
summarizing , we have investigated the dynamics of electrified polymer
jets under different conditions of air drag force . in particular ,
we have probed the effects of a gas flow oriented toward the nozzle
on the viscoelastic jet ( counterflow ) during the electrospinning process ,
analyzing both the early and the late dynamics .
several observables
have been employed to analyze the air drag effects on the jet bending
instabilities , showing that the instability cone is altered in its
shape and aperture by the presence of a gas stream .
further , the results
in terms of fiber deposition were also investigated by a statistical
analysis of the late dynamics .
we have observed that a controlled
gas counterflow might lead to a decrease of the mean value of the
fiber cross sectional radius . in particular ,
our data show a nontrivial
trend of the fiber radius as a function of the air flow velocity applied
in electrospinning experiment .
in fact , the gas flow generates both
dissipative and perturbation forces , which provide opposite effects
on the resulting fiber cross section .
thinner fibers are obtained
by using a gas flow speed of 10 m / s .
the complex interplay
of effects due to air drag forces deserves a deeper investigation ,
which will be the subject of future work .
however , further investigations
will be needed and new terms have to be introduced to describe properly
the disordered fiber structure experimentally observed on the collector .
in particular , the effect of more complicated modeled perturbations
of the nozzle in the presence of air counterflow could provide a more
realistic pattern of the filament on the collector .
anyway , the released
model represents an important novelty and it might be used for designing
a new generation of devices with novel experimental components for
gas - assisted electrospinning , to further investigate experimentally
this process and to ultimately produce polymeric filaments with finely
controlled average diameters and size distribution . | we study the effects of a controlled
gas flow on the dynamics of
electrified jets in the electrospinning process .
the main idea is
to model the air drag effects of the gas flow by using a nonlinear
langevin - like approach .
the model is employed to investigate the dynamics
of electrified polymer jets at different conditions of air drag force ,
showing that a controlled gas counterflow can lead to a decrease of
the average diameter of electrospun fibers , and potentially to an
improvement of the quality of electrospun products .
we probe the influence
of air drag effects on the bending instabilities of the jet and on
its angular fluctuations during the process .
the insights provided
by this study might prove useful for the design of future electrospinning
experiments and polymer nanofiber materials . | Introduction
Model of Electrospinning
in a Gas Flow
Results and Discussion
Summary and Conclusions |
cataract development is one of the major causes of visual impairment and eventual blindness.1,2 while cataract surgery has the potential of decreasing blindness due to this disease , the problem is so huge that it is difficult to eliminate it to the desired level , even by 2020 .
in fact , despite enhancement of surgical programs being undertaken in certain countries , the number of people with such vision impairment has been estimated to either remain stationary or even increase because of the simultaneous rise in population of the people over the age of 50 .
for example , in india , where there is a highly serious effort to increase the number of surgery , the number of people with cataract - related visual impairment and blindness is projected to increase from 7.75 million noted in 2001 to 8.25 million in 2020 because of the increase in the population in general , as well in the population of people over 50 years of age.3 additionally , its overall incidence is expected to remain relatively stationary because of the replacement of people with cataracts by the newer people and increasing the global incidence of diabetes including that in the developing countries .
this is expected to have additional impact on the incidence of cataracts as well as some retinal diseases . as determined by the world health organization ( who )
, the overprevalence of blindness due to cataract has remained steady to approximately 50% through 2010 .
additionally , it is recognized that country - wise differences in cataract - related blindness is also related to certain other confounders such as genetics , environmental , and various nutritional factors known to be involved in maintaining the lens in a transparent state .
for example , the cataractogenic process starts at a much younger age in southeast asia than in the western countries .
the prevalence of cataract is also related to the intensity and duration of solar radiation at particular places .
we have previously shown that an intraocular penetration of visible and ultraviolet ( uv ) radiation initiates photochemical formation of certain highly reactive species of oxygen in the aqueous humor and lens .
the common species are superoxide , hydrogen peroxide , hydroxyl radical , and singlet oxygen that play a central role in inflicting oxidative stress to the tissue and its opacification.46 thus , the formation of cataract is expected to be highly modulated by the presence of antioxidant nutrients in the diet and their passage through the blood aqueous barrier , such as ascorbate and vitamin e , known to act as potent scavengers of the ros .
thus , the local nutritional culture , adopted or native , can have a significant modulating role .
an immediate effect of ros generation is to deplete the lens of its antioxidant reserves such as glutathi - one , which in turn can lead to oxidative modifications of its membrane lipids and proteins .
we have recently shown that this depletion of antioxidants can also be followed soon by an overall genetic dysregulation , induced by an upregulation of the generation of micrornas ( mirnas ) and consequent gene silencing.7,8 initial evidence to the involvement of oxidative stress in the etiology of cataract formation was provided by a number of organ culture studies showing biochemical and structural damage to the tissue induced by various ros .
addition of ros scavengers including vitamin c , -tocopherol , bioflavonoids , chlorogenic acid , and pyruvate to the culture medium has been found to be highly protective.914 the role of oxidative stress in the pathogenesis of cataract has been demonstrated in vivo by the preventive effect of ros scavengers against cataract formation in intact experimental animal models,1519 as well as by a number of human studies with antioxidant vitamins.2023 more recently , we have shown that caffeine , a common constituent of many food products , can also protect the lens against oxidative stress in vitro as well as in vivo.2428 the in vivo effectiveness has been demonstrated by its preventive effect against cataract formation in rats fed a diet rich in galactose , a highly active cataractogenic sugar that simulate the formation of diabetic cataracts .
it is effective if given systemically mixed with the diet,29 as well as when administered topically by application of caffeine drops.27,28 additionally , it also inhibits uv - induced cataract in vitro as well in vivo . in the former case ,
it was shown by its protective effect against damage to the lens organ culture in the absence as well as in the presence of kynurenine.24,25 in the latter case , its topical application has been found to be effective against cataract formation induced by exposing rabbits to uv - b.30 that its actions are attributable to its ability to act as scavenger of ros was further proven by electron spin resonance studies.3133 while acting as a ros scavenger , it also represses the transcription of toxic mirnas.34 based on these studies showing anticataractogenic effect of the compound in experimental animals , it was considered desirable to investigate if its use as a dietary constituent could be involved as a factor in modulating the formation of cataracts in humans also .
this possibility has been investigated by correlating the prevalence of cataract blindness in different countries with the amount of caffeine consumed there in , per person .
data on the prevalence of cataract blindness were obtained from the population - based studies , where the blindness due to cataract was determined along with the contribution of various other eye diseases such as glaucoma , age - related macular degeneration , corneal opacities , diabetic retinopathy , childhood blindness , trachoma , onchocerciasis , and others , consolidated by who in 2004.2 cataract has been found to account for approximately 50% of the total blindness , a figure found to be little affected at least until 2010 and expected to remain so at least till 2020 . since coffee is the primary source of caffeine , its intake was determined from its per capita coffee consumption ( kg / year ) .
this information was obtained from the food and agriculture organization of the united nations ( http://www.griequity.com/resources/businessguides/demographicsdata/energy/energy-resourceconsn.pdf table erc.5),35 as well as from the alphabetical listings and maps available online with www.chartsbin.com .
they all describe consumption of coffea arabica , the primary variety of the coffee used throughout the world.33,34 additional data were obtained from www.wisegeek.com.38 the amount of caffeine derived from the coffee consumed was calculated from its percentage composition in the arabica beans , which is close to 1% ( 10 mg / g ) . the beans for beverage preparation are normally roasted at 220c for improving its taste and aroma .
since its melting point is rather high ( 238c ) , its loss during the roasting process is small.39,40 on the other hand , other possible physiologically active agents present in the beans such as the chlorogenic acids,41 are destroyed by isomerization , hydrolysis , and pyrolysis during roasting .
the small traces likely to be left over during roasting are destroyed further by heating of the roast with steaming hot water during beverage preparation by the continuous drip method or by heating with microwave irradiation .
the physiological activity of the coffee is thus largely attributable to its caffeine content , acting by virtue of its effectiveness as a scavenger of hydroxyl radical or other modes such as the inhibition of phosphodiesterase or as an adenosine antagonist .
the amount of caffeine present in the beverage prepared from tea ( camellia sinensis ) , despite a higher concentration of caffeine per gram of the tea leaves , is known to be much lower than the coffee prepared from arabica .
this is due to the relatively much smaller quantity of the tea leaves used in the beverage preparation .
this is consistent also with the much higher incidence of cataracts in most tea - consuming countries instead of coffee , such as india , pakistan , bangladesh , myanmar , people s republic of china , and other southeast regions , as compared with the coffee - consuming countries with some exceptions where tea is used in excessive amounts , such as turkey where the use of tea is maximum in the world , deriving 376 mg of caffeine per day .
the caffeine they derive from the coffee is only approximately 10 mg / day , and yet they have lower incidence of cataract attributable to the high amounts they derive from tea .
table 1 summarizes the global data on the incidence of cataract blindness in different countries , expressed as a percentage of total blindness by who,1,2 along with the consumption of coffee in terms of caffeine intake per day , per person .
the grouping of the countries used in the table is identical to that done by who .
information on caffeine consumption ( mg / day / person ) in the individual countries of the groups was derived from the country - wise listing of per capita coffee consumption in sources as mentioned earlier .
a first glance of the table clearly suggests that the incidence of cataract blindness in the countries varies noticeably with the variation in caffeine intake .
it indicates a relatively higher incidence of cataracts in countries with lower intake of coffee , also showing vice versa that the incidence of cataract blindness is lower in countries with its higher intake , with expected data scatter .
however , a decreasing correlation between the increase in caffeine intake and lowering of cataract incidence was more convincingly demonstrated if the caffeine intake and the cataract prevalence data were analyzed interzonally , and group - wise , as summarized in table 2 .
as can be seen by reference to groups in table 2 , the percentage of cataract blindness in zone 1 is as high as 64% , which corresponds to coffee consumption of near zero .
the mean cataract blindness in this group was 55%6% . that a consumption of coffee by this group and consequent availability of caffeine in their diet could have attenuated this high incidence of cataract was inferable from the reference to the cataract incidence summarized in zone 2 .
the cataract blindness incidence in this group decreased perceptibly from the mean of 55% in zone 1 to 52% , with an increase in caffeine intake from 0 to 5.62.72 mg / day .
although this decrease in cataract was not statistically significant , it was adequate to suggest that a further increase in caffeine intake could lead to a more significant and visible decrease of cataract development .
that indeed has been found to be the case . as noticeable in zone 3 ,
increase in caffeine use to 34.2 mg / day was now associated with the further decrease in cataract generation to 44.21% .
increasing the caffeine consumption to 48 mg / day , the cataract blindness decreased to 26.2%3% .
increase of caffeine consumption to 198 mg / day , the cataract blindness was now highly minimized , the cataract incidence being now only approximately 7.6% , in the usa .
the effect of caffeine was significant also in the eastern european regions such as latvia , lithuania , hungary , ukraine , belarus , turkey , and turkmenistan .
other areas of the world including india , people s republic of china , and other south asian countries where caffeine consumption is < 2.05 mg / day , cataract is also known to be very high , the contribution of cataract to blindness reaching up to 70%.3 the lower consumption of coffee in turkey and turkmenistan with a relatively lower incidence of cataract blindness was initially intriguing . but
this is explainable by the finding that turkish ( culturally ) have the highest tea consumption in the world , 6.87 kg / year ( 18.8 g / day ) with a caffeine content of 20 mg / g .
the results therefore show a significant relationship between the higher caffeine intake and lower incidence of cataract blindness
it is clear that the significance of findings ( the t values determined by student s t - test and p - values determined from standard t table ) increases from lower to the higher level of caffeine consumption , the final p level reaching to 0.0001 .
the inhibitory effect of caffeine in humans is also indicated by the graphical representation of the total data in table 1 and the trend line as shown in figure 1 . a negative correlation between the caffeine intake and the incidence of cataract was exponential . with the regression line starting with the cataract incident of approximately 55%
, the r value comes out to near 0.8 , with the spearman s rank - order correlation coefficient of 0.89 and the p - value of < 0.0001 .
the cataract - lowering effect becomes highly visible as the caffeine consumption levels reach near 50 mg and then nearly complete at 100 mg / day .
therefore , there is evidence of saturation kinetics coming into play , characteristic of the biological effectiveness of treatment with exogenous agents . in the usa , using one cup of ordinary coffee ( 8 oz , 237 ml ) provides 95200 mg of caffeine .
thus , it lies close to the amount found positively correlated with lower incidence of cataract blindness .
the lower incident of cataract blindness in countries with higher levels of caffeine use is in line with the experimental findings referred earlier , showing inhibition of cataract formation in animals given caffeine either systemically with the diet or through topical eye drops in galactosemic animals , and also through eye drops in rabbits exposed to uv irradiation .
this is also in agreement with other studies , where we have shown that caffeine can inhibit cataractogenesis induced directly by photochemical generation of ros in vitro .
cataract development is the major cause of visual impairment and blindness throughout the world.13 etiologically , its origin and formation is related to several confounding factors such as aging by itself , genetic factors , increasing incidence of diabetes , nutritional deficiencies , smoking , continued penetration of light into the eye , and consequent induction of oxidative stress through intraocular formation of oxygen free radicals .
the latter has been suggested to be one of the primary factors involved in the formation of cataracts , as evident by its higher prevalence in countries that receive excessive solar radiation and consume diets that are low in nutritional antioxidants and scavengers of oxygen free radicals .
accordingly , the attempt of cataract surgery in removing blindness due to cataracts gets significantly minimized . in india , for example
, the number of people with cataract blindness is likely to remain the same as it is today or most likely to increase.3 further studies on the prevention of cataracts by methods such as preventing the increase in obesity and diabetes , modulating light exposure penetrating in the eye , and increasing use of antioxidant nutrients are considered highly desirable .
previously described studies with experimental animals as well as with certain human epidemiological studies strongly suggest that the use of certain antioxidant nutrients is highly effective in inhibiting the formation of cataracts .
therefore , the primary aim of this investigation was to assess the significance of these experimental studies with regard to the prevalence of cataract blindness in humans as determined by the consumption of coffee as a source of caffeine .
while coffee does contain certain other antioxidants , such as chlorogenic acids , they are destroyed while roasting the raw coffee beans before their use for the preparation of coffee .
the present investigations seeking to correlate the amount of coffee consumption with cataract incidence were also prompted by reports showing that its consumption decreases the risk of the development of type 2 diabetes,41,42 a disease known to accelerate the formation of age - dependent cataract . in addition , it has been suggested to prevent liver cirrhosis and certain cancers.4345 thus , the significance of any toxic effects of caffeine as reported in earlier literature has now been greatly minimized .
clinically , the most compelling evidence of its nontoxicity has been proven by its wide use in treating diseases associated with neural and muscular dysfunctions , such as the common age - associated dementia , and the alzheimer s and parkinson s diseases,4653 with significant success .
while the biochemistry of these diseases is yet only partially understood , it is widely believed that their pathogenesis is strongly related to oxidative damage55 to the neural and muscular tissues in question , especially in the case of alzheimer s disease.55 thus , there are significant similarities in the biochemistry of these diseases with that of the pathogenesis of cataracts , at least in terms of the formation of lipid peroxidation products such as malondialdehyde55 and the presence of dna degradation products such as 8-hydroxyguanosine and 8-hydroxydeoxyguanosine5658 in the neural tissues , similar to that in the lens .
their formation in the neural tissues may precede the formation of intracellular tau - based fibrous tangles and the appearance of extracellular plaques due to -amyloid deposition .
apparently , all these processes are initiated by an early generation of ros by the interaction of trace metals and oxygen.5961 the -amyloid can itself lead to the generation of oxygen free radicals.62 the concept of oxidative stress is also supported by the effectiveness of ascorbate in treating the disease,59 similar to that in the case of cataracts.2023 treatment with caffeine has also been seen to delay the formation of plaques and the tangles , while also minimizing memory loss .
in addition to its antioxidant effects , caffeine can help overcome the neural transmission defects by acting as an antagonist of adenosine , which is well known to modulate nerve transmission by binding to the g - protein ( gi)-linked receptors.6367 this binding is followed by the ultimate generation of the subunits ( gi and ) that de - energize the cells by inhibiting adenylyl cyclase and cyclic adenosine monophosphate synthesis , and inhibiting neurotransmitter release by inhibiting calcium transport into the presynaptic nerve terminals .
adenosine binding to the g - protein receptor ( instead of gi ) also inhibits dopamine release .
it is thus highly possible that the helpful effects of caffeine as an antioxidant are synergistically related to its action as an antagonist of adenosine .
similar to the action of caffeine against oxidative stress in neural tissue and the previously reported effect against cataract formation in animal studies , its effectiveness in the observed lowering in the incidence of cataract in humans consuming greater amounts of caffeine could also be due to its oxy - radical scavenging activity as one of the possible mechanisms .
the oxy - radical scavenging activity of caffeine has been more specifically confirmed in the organ culture studies showing it to act by scavenging the hydroxyl radicals detected by electron spin resonance spectroscopy .
another action of caffeine in humans when present at appropriately high levels , as likely to be the case in the group consuming more than 200 mg of caffeine per day , is to act as inhibitor of phosphodiesterase activity , helping to maintain a higher levels of cyclic adenosine monophosphate .
this is expected to activate protein kinases and subsequent stimulation of tissue metabolism including pathways leading to adenosine triphosphate generation .
indeed , we have shown that the levels of adenosine triphosphate are higher in the lenses cultured with caffeine as well as when it was given in vivo.23,24 the presence of caffeine has also been shown to accelerate synthetic processes associated with lens cell development,68 an effect also found useful in cloning of embryonic stem cells.69 we have recently reported that induction of oxidative stress during cataract formation , beside depleting the antioxidant reserves , triggers an onset of a genetic dysregulation process initiated by inducing an upregulation of certain mirnas and consequent gene silencing caused by deactivation of the mrnas involved in the translation of various antioxidant enzymes .
several mirnas known to exert such silencing have been shown to be significantly upregulated with the very beginning of cataract formation in the lenses of galactosemic animals .
interestingly , such upregulation has been found to be thwarted by caffeine , suggesting another pathway of the physiologically beneficial effects of caffeine in lens .
the results thus indicate to the likelihood that the observed protective effect of caffeine against cataract formation in humans and experimental animals is likely to be multifactorial in nature , involving its action as a scavenger of oxygen free radicals , acting in combination with its property of acting as an inhibitor of phosphodiesterase and preventing gene silencing .
it has been previously reported7072 that intake of a coffee drink by glaucoma patients can increase the intraocular pressure by 12 mmhg , suggesting the possibility of a toxic effect of caffeine in the long run .
additionally , this is not supported by studies with pure caffeine.73,74 the small rise in intraocular pressure with coffee drinking , if any , is obviously due to increase in water absorption in glaucoma,75,76 a fact used for diagnosis of the disease itself .
this study indicating a possible preventive effect of coffee and caffeine against cataract formation in humans is thus considered useful for further controlled clinical studies evaluating the effect of coffee and caffeine against cataract . in addition
, the study also points out the desirability of further mechanistic studies on the molecular mode caffeine s action using in vitro and in vivo experimental animal models . | previous biochemical and morphological studies with animal experiments have demonstrated that caffeine given topically or orally to certain experimental animal models has significant inhibitory effect on cataract formation .
the present studies were undertaken to examine if there is a correlation between coffee drinking and incidence of cataract blindness in human beings .
that has been found to be the case .
incidence of cataract blindness was found to be significantly lower in groups consuming higher amounts of coffee in comparison to the groups with lower coffee intake .
mechanistically , the caffeine effect could be multifactorial , involving its antioxidant as well as its bioenergetic effects on the lens . | Introduction
Methods
Results
Discussion |
we describe the first documented case of gallbladder agenesis where the clinical presentation was consistent with biliary colic , and radiological investigation suggested the presence of gallstones within a collapsed , fibrosed gallbladder .
subsequent operative findings revealed a solitary haemangioma of the liver sited in the normal position of the gallbladder fossa but with absence of the gallbladder .
a 23-year - old female presented with intermittent episodes of nausea , vomiting , right upper quadrant abdominal pain , and occasional diarrhoea .
routine haematological and biochemical investigations including full blood count profile , c - reactive protein , liver function tests ( including alanine aminotransferase , total bilirubin , -glutamyltransferase , and alkaline phosphatase ) , and amylase were unremarkable .
stool culture demonstrated no abnormality , and faecal elastase was within the normal range . abdominal ultrasonography suggested a contracted gallbladder containing gallstones . on clinical review following the ultrasound examination , the patient 's pain had improved but the vomiting persisted .
due to the continued vomiting , nonclassic symptoms of gallstones disease , and absence of dyspeptic symptoms , magnetic resonance cholangiopancreatography ( mrcp ) was performed .
the mrcp report commented that the gallbladder was difficult to identify but appeared to be contracted ( figure 1(a ) ) .
the common bile duct was not dilated , and there were no filling defects ( figure 1(b ) ) . at laparoscopy ,
the gallbladder and cystic duct could not be identified , either by direct vision or by the use of the intraoperative ultrasound probe .
a pear - shaped haemangioma was present on the surface of segment 6 of the liver within the gallbladder fossa mimicking the gallbladder ( figure 2 ) .
subsequently repeated mrcp , confirmed the absence of the gallbladder , a normal common bile duct and no change in the haemangioma .
congenital anomalies of the gallbladder are numerous , and in addition to agenesis , include location in an abnormal site ( ectopic gallbladder ) hypoplasia , diverticula , duplication , heterotrophic tissue , and septation defects .
agenesis of the gallbladder ( ag ) is a rare congenital anomaly of the biliary system and was first described by lemary in 1701 .
the average incidence of gallbladder agenesis at birth is about 0.02% , or 1 in 6000 live births .
ag has been observed in both children and adults , with a median age of 46 at the time of diagnosis .
clinical studies report a female - male ratio of 3 : 1 , while autopsy studies interestingly report an equal gender incidence .
approximately 70% of cases are thought to be isolated anomalies , and 9% are associated with biliary atresia .
the gallbladder is developed by the 4th week of gestation from the pars cystica ( caudal portion ) of the anterior diverticulum of the primitive gut .
the pars cystica originates from the anterior duodenum becoming the common bile duct after rotation of the duodenum .
the gallbladder is initially a hollow cord as the hollow portion of the pars cystica is obliterated by epithelial proliferation .
essentially , ag is an anomaly of the development of vessels located on each side of the gallbladder bud ( sinus venosus cordis , omphaloenteric , and umbilical veins ) which may explain the association of this anomaly in 21% of cases with cardiac , vascular , gastro - intestinal , and abdominal wall malformations observed in the multiple fetal anomaly group .
ag may be inherited , with several familial cases observed , including across two generations [ 611 ] .
they identified three groups : ( 1 ) multiple fetal anomalies , the most common malformations being cardiovascular , followed by gastrointestinal and genitourinary , ( 2 ) asymptomatic cases , in which agenesis of the gallbladder was found at autopsy or laparotomy for another reason and , in some cases , there was a familial association , and ( 3 ) symptomatic cases , with the most common associated symptoms being biliary colic ( 54% ) , dyspepsia ( 34% ) , and jaundice ( 27% ) [ 3 , 12 ] .
the presenting symptoms of agenesis of the gallbladder are compatible with hepatobiliary dysfunction such as right upper quadrant pain , nausea , vomiting , abnormal liver function , and jaundice , and these symptoms are found in 40% of cases .
it is believed that these symptoms are a consequence of biliary dyskinesia , but 98% of patients report resolution of symptoms postoperatively where no formal procedure was performed other than identification of an absent gallbladder .
this was the situation with our patient who did improve significantly following surgical exploration , but why this occurs remains unclear .
the majority of cases in the literature have been diagnosed at laparotomy , but with the increasing use of laparoscopic surgery , case reports describing the diagnosis of gallbladder agenesis at laparoscopy are common .
even with advances in imaging modalities , radiology reports are still frequently unable to be dogmatic , particularly in respect of anatomical findings , and uss often reveals what is thought to be a small , contracted gallbladder .
gallbladder agenesis encountered during a surgical procedure is almost always unexpected and usually presents the clinician with a surgical dilemma .
routine performance of laparoscopic cholecystectomy has produced changes in technique , and the more limited dissection and lack of tactile feedback give less information about the anatomical relationships .
this often prompts the conversion to an open procedure if a gallbladder can not be found .
frey emphasized the need for a thorough surgical exploration to exclude an ectopic gallbladder prior to being able to confidently confirm the diagnosis of gallbladder agenesis .
recognised ectopic locations are intrahepatic , left - sided , between the leaves of the lesser omentum , retroperitoneal , retrohepatic , within the falciform ligament , retroduodenal , and retropancreatic [ 3 , 1416 ] .
unfortunately , the wide distribution of these possible abnormal sites means that considerable open dissection and consequent morbidity would occur if an attempt was made to fulfill frey 's criteria rigorously . a potentially less invasive method would be to use intraoperative ultrasonography ( as was used in this case ) , which is able to give extremely clear images of all the potential ectopic sites . in cases reported in the literature , intraoperative cholangiogram
is felt to be essential to exclude or confirm the presence of common bile duct stones and to complete the diagnosis .
some groups recommend routine common bile duct exploration when its diameter is increased or a common bile duct stone has been found [ 3 , 14 , 1618 ] .
we elected not to perform an intraoperative cholangiogram or to explore the common bile duct because of reports of iatrogenic common bile duct injury produced during the search for an absent gallbladder .
in addition , the preoperative mrcp images ( which were reviewed intraoperatively ) were of good quality , and we could not identify any filling defect suggesting ductal stones . if frey 's criteria are not fulfilled intra - operatively , other authors advocate post - operative ct imaging to search for a potential ectopic gallbladder and confirm the diagnosis of gallbladder agenesis .
it can be extremely difficult to diagnose agenesis of the gallbladder preoperatively using routine ultrasound examination .
consequently , in this era of minimally invasive surgery , it is important that clinicians should keep this rare condition in mind when the gallbladder appears abnormal on preoperative imaging studies and can not be found at laparoscopy . as symptoms will improve in 98% of cases , it is very important to avoid unnecessary intervention in patients who have a negative laparoscopy .
laparoscopic exploration combined with laparoscopic ultrasonography and potentially post - operative ct or mri is helpful in establishing a definitive diagnosis of agenesis of the gallbladder .
they are also to refute a putative diagnosis of ectopic gallbladder , this approach will reduce the morbidity associated with more invasive surgery . when intra - operative imaging is able to exclude an ectopic location of the gallbladder and a diagnosis of gallbladder agenesis
is established , then pain will resolve in almost all cases and further investigation will be difficult to justify . | gallbladder agenesis is uncommon . in contrast , liver haemangiomas are the most common type of benign liver lesions .
we describe the first documented case of gallbladder agenesis where the clinical presentation was consistent with biliary colic , and radiological investigation suggested the presence of gallstones .
subsequent operative findings revealed a solitary haemangioma of the liver sited in the normal position of the gallbladder fossa but with absence of the gallbladder .
it is important that clinicians should keep gallbladder agenesis in mind when the gallbladder appears abnormal on preoperative imaging studies and can not be found at laparoscopy . as symptoms will improve in 98% of cases
, it is very important to avoid unnecessary intervention in patients who have a negative laparoscopy .
the clinical presentation , investigations , and operative findings are discussed with a review of other relevant reported cases in the literature . | 1. Introduction
2. Case Presentation
3. Discussion
4. Conclusion |
null | we report the first total synthesis
of the complex akuammiline
alkaloid picrinine , which was first isolated nearly five decades ago .
our synthetic approach features a concise assembly of the [ 3.3.1]-azabicyclic
core , a key fischer indolization reaction to forge the natural product s
carbon framework , and a series of delicate late - stage transformations
to complete the synthesis .
our synthesis of picrinine also constitutes
a formal synthesis of the related polycyclic alkaloid strictamine . | Supplementary Material |
null | the fundamental reactivity or stability of the chloroethylene molecules affects their hepatotoxic potential .
extent and symmetry of the chlorine substitution , which alters electron delocalization , charge polarization , and solubility , affect biologic response .
the most nonsymmetrically depolarized chloroethylene , 1,1-dichloroethylene ( 1,1-dce ) is the most hepatotoxic and causes a unique pattern of hepatocellular injury involving mitochondria , plasma membranes , and chromatin .
the injury caused by the other chloroethylenes examined appears to profoundly affect the structural integrity of the endoplasmic reticulum with toxic potential in the order : trichloroethylene ( tri ) greater than vinyl chloride ( vcm ) greater than perchloroethylene ( per ) .
pretreatments which increased cytochrome p-450 contents , thus presumably augmenting metabolic activation to a reactive intermediate such as an epoxide , enhanced or were synergistic to the hepatotoxic potential of tri , vcm and per but were protective or antagonistic to 1,1-dce hepatotoxicity .
biologic response to 1,1-dce may be expressed by a different metabolic pathway .
glutathione appears to be involved in the biologic response to all nonsymmetric chloroethylenes and toact as an antagonist against injury .
marked differences in the patterns of injury and the biologic responses suggest that more than one mechanism is involved in the production of injury by chloroethylenes.imagesfigure 3.figure 4 . | Images |
despite contemporary evidence - based care , including revascularization and dual antiplatelet therapy , patients with acute coronary syndromes ( acss ) remain at risk of recurrent ischaemic events .
oral vitamin k antagonists have been shown to prevent recurrent ischaemic events after acs , both as mono - therapy and in combination with aspirin , but substantially increase bleeding and are cumbersome to use because of multiple interactions with food and drugs , and the need for frequent laboratory monitoring .
evidence regarding the efficacy and safety of the combination of dual antiplatelet therapy and old oral anticoagulants , i.e. vitamin k antagonists , is limited but registry data indicate a high risk of major bleeding .
the first experience in this setting used an oral direct thrombin inhibitor , ximelagatran , later withdrawn from the market because of liver toxicity , and showed a reduction in the composite of death , myocardial infarction , and stroke when added to aspirin for 6 months after an acs .
another oral direct thrombin inhibitor , dabigatran , and three novel oral direct factor xa inhibitors apixaban , rivaroxaban , and darexaban added to single and/or dual antiplatelet therapy have recently been evaluated in phase ii trials in acs patients .
all phase ii trials have shown a definite increase in the incidence of bleeding with the combination of oral anticoagulation and antiplatelet therapy , but were under - powered for the evaluation of efficacy . the phase iii study with apixaban in high - risk acs patients , in doses shown to be effective for stroke prevention in atrial fibrillation , was terminated prematurely due to increased bleeding without evidence for efficacy . the phase iii study with rivaroxaban , in doses
lower than evaluated for stroke prevention in atrial fibrillation , showed significant reductions in the composite of death , myocardial infarction , and stroke overall and at each dose and reductions in mortality , but also an increased rate of major bleeding .
given the consistent increases in bleeding and the less consistent reduction in ischaemic events , the overall benefit
risk profile of adding new oral anticoagulants to antiplatelet treatment after an acs is unknown .
we hypothesized that the addition of a novel oral anticoagulant to antiplatelet therapy after an acs would decrease subsequent major adverse cardiovascular events ( maces ) but increase bleeding ; that these effects would vary by the number of concomitant antiplatelet drugs ; and that the effects on bleeding would be inversely related to the effects on maces .
information sources for identification of studies were pubmed , scopus , web of knowledge , reference lists of articles , and personal knowledge of the field through participation in the studies .
the search expression used in pubmed was ( ( antithrombins [ mesh terms ] or antithrombins[all fields ] ) or ( factor xa[mesh terms ] or factor xa[text word ] ) and inhibitor[all fields ] ) or ximelagatran[text word ] or dabigatran[text word ] or apixaban[text word ] or rivaroxaban[text word ] or darexaban[text word ] or ( n-(2-(((4-(aminoiminomethyl)phenyl)amino)methyl)-1-methyl-1h - benzimidazol-5-yl)carbonyl)-n-2-pyridinyl - beta - alanine[supplementary concept ] or [ n-(2-hydroxy-6-(4-methoxybenzamido)phenyl)-4-(4-methyl-1,4-diazepan-1-yl)benzamide[supplementary concept ] ) and acute coronary syndrome[majr ] or myocardial infarction[majr ] and randomized controlled trial [ publication type : noexp ] .
two researchers ( j.s . and b.j . ) performed the literature review independently of each other .
for this study , data from all published phase ii and iii studies ( seven in total ) of new oral anticoagulants after a recent acs were included ( the esteem , redeem , ruby-1 , appraise-1 and appraise-2 , atlas acs - timi 46 , and atlas acs 2timi 51 studies ) , irrespective of other study or report characteristics .
the collected data items included inclusion criteria , exclusion criteria , interventions ( the randomized anticoagulant treatment as well as treatment with antiplatelet drugs aspirin and/or clopidogrel ) , effect estimates from the comparisons made , follow - up time , and definition of outcomes ( maces and major bleeding events ) . in the esteem study only single antiplatelet therapy with aspirin was allowed , while the appraise-1 , appraise-2 , and atlas acs - timi 46 recruited patients either on single ( aspirin ) or dual antiplatelet therapy with aspirin and clopidogrel , see table 1 , and these patients were analysed stratified on their antiplatelet therapy status at the time of randomization in the present study . in the redeem , ruby-1 , and atlas acs 2timi 51 studies , the vast majority of patients received dual antiplatelet therapy at randomization , i.e. 98 , 95 , and 93% , respectively , and all patients in these studies were thus considered as receiving dual antiplatelet therapy in the present analysis .
table 1study characteristicsstudyno . of study patientsno . of patients in meta - analysisdurationageper cent
womenstudy treatmentantiplatelet drugsbleeding events used in the present studysingle ( % ) dual ( % ) esteem190018836 months6832ximelagatran 24 , 36 , 48 , or 60 mg b.i.d . , or placebo100isth major and clinically relevant non - major bleedsappraise-1171512106 months6124apixaban 2.5 mg b.i.d . , 10 mg o.d . , or placebo2476isth major and clinically relevant non - major bleedsatlas acs - timi46346219976 months5723rivaroxaban 5 mg o.d . , 5 mg b.i.d . , 10 mg o.d . , or placebo2575timi clinically significant bleeding ( timi major bleeding , timi minor bleeding , or bleeding requiring medical attention)redeem187818616 months6224dabigatran 50 , 75 , 110 . or 150 mg b.i.d . or placebo298isth major and clinically relevant non - major bleedsruby-1127912586 months5720darexaban 5 , 15 or 30 mg b.i.d . , 10 , 30 or 60 mg o.d . , or placebo595isth major and clinically relevant non - major bleedsappraise-2739273158 months6732apixaban 5 mg ( or 2.5 mg ) b.i.d . , or placebo1981timi major bleeds ; isth major and clinically relevant non - major bleedsatlas acs2-timi5115 52615 34213 months6225rivaroxaban 2.5 or 5 mg b.i.d . , or placebo793timi major ( non - cabg related ) bleeds , timi bleeding requiring medical attentiono.d .
, once daily ; b.i.d . , twice daily ; isth , international society on thrombosis and haemostasis ; timi , thrombolysis in myocardial infarction.see methods for description of inclusion and exclusion criteria .
single antiplatelet therapy includes patients not receiving any antiplatelet medication at randomization , dual antiplatelet treatment consists of aspirin and clopidogrel at randomization.no . of patients who received at least one dose of study drug.no . of patients treated with daily doses
also evaluated in phase iii study.mean or median.apixaban 2.5 mg b.i.d . in 8.5% of the patients with estimated creatinine clearance < 40 ml / min .
, twice daily ; isth , international society on thrombosis and haemostasis ; timi , thrombolysis in myocardial infarction .
single antiplatelet therapy includes patients not receiving any antiplatelet medication at randomization , dual antiplatelet treatment consists of aspirin and clopidogrel at randomization .
eligible patients were men or women with acs with or without st - elevation within 714 days before randomization .
in addition , patients had one or more of following additional risk factors ; age 65years , prior myocardial infarction , diabetes mellitus , congestive heart failure or a left ventricular ejection fraction < 40% , no revascularization for the index event , mild to moderate renal insufficiency , peripheral vascular disease , or previous ischaemic stroke in all studies , except the atlas acs - timi 46 in which no additional risk factor was required and the atlas acs 2timi 51 study in which subjects who were 1854 years of age had to have either diabetes mellitus or a prior myocardial infarction in addition to the presenting acs event . the main exclusion criteria for all seven trials were ; planned percutaneous coronary intervention , ongoing or planned treatment with vitamin k antagonist , recent stroke , conditions associated with an increased bleeding risk , e.g. anaemia , thrombocytopenia , and a history of severe bleeding .
the groups of patients receiving at least one dose of the studied dosages of the novel oral anticoagulants ximelagatran , dabigatran , and darexaban in the phase ii trials esteem , redeem , and ruby-1 , respectively , were included in the meta - analysis . to avoid the evaluation of doses deemed to have too high bleeding risk
, we only included the 1210 ( out of 1715 ) patients in the phase ii study appraise-1 receiving at least one dose of the apixaban doses later evaluated in the phase iii study appraise-2 , i.e. apixaban 5 and 10 mg daily .
likewise , only the 1997 ( out of 3491 ) patients receiving at least one dose of the rivaroxaban doses in the phase ii study atlas acs - timi 46 , i.e. rivaroxaban 5 and 10 mg daily , later taken forward to the phase iii study atlas acs 2timi 51 study were included . all the phase ii studies aimed at 6 months of treatment and follow - up .
the phase iii studies had a longer follow - up , in the appraise-2 study the mean follow - up was 8.2 months , while the atlas acs 2timi 51 had treatment duration of the mean 13 months and up to 31 months ; we therefore also analysed associations of treatment with risk of ischaemic and bleeding events in a subgroup of these phase iii studies .
the mace outcome was defined as the composite of all - cause mortality , myocardial infarction , or stroke in all studies in this meta - analysis .
myocardial ( re-)infarction was in all trials defined as elevated cardiac biomarkers together with ischaemic symptoms or ecg - changes ( st - elevation or -depression , new left bundle branch block , or new q - waves ) .
stroke was defined as an acute onset of focal neurological deficit of presumed vascular origin lasting for 24 h or more and further categorized as haemorrhagic or ischaemic after imaging .
we retrieved data for some non - published composite outcomes for dabigatran , apixaban , and darexaban studies after contact with the original study authors .
major bleeding events assessed by the international society of thrombosis and haemostasis ( isth ) definition were reported in the trials with ximelagatran , dabigatran , apixaban , and darexaban .
an isth major bleeding is defined as a bleeding that was fatal , occurred in a critical location ( intracranial , intraspinal , intraocular , retroperitoneal , intra - articular , intramuscular with compartment syndrome , or pericardial ) , or was associated with a fall in haemoglobin of 2 g / dl or more , or a transfusion of two units or more of whole blood or packed red blood cells .
clinically relevant minor bleeding was in these studies defined as a clinically overt bleed that did not meet the criteria for major bleed but prompted a clinical response , i.e. hospital admission for bleeding , medical or surgical treatment , or a change in antithrombotic therapy including interruption or discontinuation of study drug . in the present meta - analysis , a clinically significant bleeding was in all studies , except those with rivaroxaban , defined as the composite of major ( isth ) and clinically relevant minor bleeds , i.e. the primary outcome event for the phase ii studies with apixaban , dabigatran , and darexaban and a secondary safety outcome in the phase iii study with apixaban .
the studies with rivaroxaban , and also the studies with apixaban , reported bleeding events by the thrombolysis in myocardial infarction ( timi ) definitions .
a timi major bleeding is defined as any intracranial bleeding or clinically overt bleeding associated with a decrease in haemoglobin of 5 g / dl or an absolute drop in haematocrit of 15% .
timi minor bleeding is defined as any clinically overt bleeding event , including bleeding that is evident on imaging studies , that is associated with a decrease in haemoglobin 3 g / dl but < 5g / dl . bleeding requiring medical attention
is defined as any bleeding requiring medical or surgical treatment or laboratory evaluation without meeting criteria for timi major or minor bleeding . in the present meta - analysis , a clinically significant bleeding
was defined as a the composite of timi major bleeding , timi minor bleeding , or bleeding requiring medical attention in atlas acs - timi 46 study , and a timi bleeding requiring medical attention in the atlas acs 2timi 51 study . in the subgroup analysis of the two phase iii studies ,
the mace outcome was similarly defined as the composite of all - cause mortality , myocardial infarction , or stroke , while only major bleeding events were evaluated , defined as timi major bleeding in the appraise-2 study with apixaban , and timi major bleeding not related to coronary - artery bypass grafting in the atlas acs 2timi 51 study with rivaroxaban , which were the primary safety outcomes in these studies .
risk of bias within studies was judged by proper blinding and the presence / absence of a placebo - controlled arm .
the principal summary measure was the hazard ratio ( 95% confidence interval ) , supplemented by absolute risk reduction ( risk difference ) ( 95% confidence interval ) . because numbers needed to treat for an additional beneficial ( nntb ) or harmful ( nnth ) outcome must be calculated using a homogenous follow - up time , these properties were calculated from pooled hazard ratios using only the phase ii studies with 6 months follow - up , and using the pooled 6-month risks of control arms of these studies as assumed control risks .
subgroups based on single vs. dual concomitant antiplatelet therapy , and treatment with direct thrombin inhibitors vs. direct factor xa inhibitors , were compared using fixed - effects models with inverse variance weighting .
we assessed risk of publication bias using a funnel plot and egger 's test , involving all of the treatment arms and the primary outcome maces . to investigate the association between the intended effects on maces and the side effects of bleeding
, we performed a pre - specified random - effects meta - regression with the hazard ratio of maces as independent and hazard ratio hr of bleeding as dependent variable ( hazard ratios for both outcomes are comparing the active arm against placebo ) .
this meta - regression was stratified on the number of antiplatelet drugs ( the total weight was 100% within each stratum ) .
information sources for identification of studies were pubmed , scopus , web of knowledge , reference lists of articles , and personal knowledge of the field through participation in the studies .
the search expression used in pubmed was ( ( antithrombins [ mesh terms ] or antithrombins[all fields ] ) or ( factor xa[mesh terms ] or factor xa[text word ] ) and inhibitor[all fields ] ) or ximelagatran[text word ] or dabigatran[text word ] or apixaban[text word ] or rivaroxaban[text word ] or darexaban[text word ] or ( n-(2-(((4-(aminoiminomethyl)phenyl)amino)methyl)-1-methyl-1h - benzimidazol-5-yl)carbonyl)-n-2-pyridinyl - beta - alanine[supplementary concept ] or [ n-(2-hydroxy-6-(4-methoxybenzamido)phenyl)-4-(4-methyl-1,4-diazepan-1-yl)benzamide[supplementary concept ] ) and acute coronary syndrome[majr ] or myocardial infarction[majr ] and randomized controlled trial [ publication type : noexp ] .
two researchers ( j.s . and b.j . ) performed the literature review independently of each other .
for this study , data from all published phase ii and iii studies ( seven in total ) of new oral anticoagulants after a recent acs were included ( the esteem , redeem , ruby-1 , appraise-1 and appraise-2 , atlas acs - timi 46 , and atlas acs 2timi 51 studies ) , irrespective of other study or report characteristics .
the collected data items included inclusion criteria , exclusion criteria , interventions ( the randomized anticoagulant treatment as well as treatment with antiplatelet drugs aspirin and/or clopidogrel ) , effect estimates from the comparisons made , follow - up time , and definition of outcomes ( maces and major bleeding events ) . in the esteem study only single antiplatelet therapy with aspirin was allowed , while the appraise-1 , appraise-2 , and atlas acs - timi 46 recruited patients either on single ( aspirin ) or dual antiplatelet therapy with aspirin and clopidogrel , see table 1 , and these patients were analysed stratified on their antiplatelet therapy status at the time of randomization in the present study . in the redeem , ruby-1 , and atlas acs 2timi 51 studies , the vast majority of patients received dual antiplatelet therapy at randomization , i.e. 98 , 95 , and 93% , respectively , and all patients in these studies were thus considered as receiving dual antiplatelet therapy in the present analysis .
table 1study characteristicsstudyno . of study patientsno . of patients in meta - analysisdurationageper cent
womenstudy treatmentantiplatelet drugsbleeding events used in the present studysingle ( % ) dual ( % ) esteem190018836 months6832ximelagatran 24 , 36 , 48 , or 60 mg b.i.d . , or placebo100isth major and clinically relevant non - major bleedsappraise-1171512106 months6124apixaban 2.5 mg b.i.d . , 10 mg o.d . , or placebo2476isth major and clinically relevant non - major bleedsatlas acs - timi46346219976 months5723rivaroxaban 5 mg o.d . , 5 mg b.i.d . , 10 mg o.d . , or placebo2575timi clinically significant bleeding ( timi major bleeding , timi minor bleeding , or bleeding requiring medical attention)redeem187818616 months6224dabigatran 50 , 75 , 110 . or 150 mg b.i.d . or placebo298isth major and clinically relevant non - major bleedsruby-1127912586 months5720darexaban 5 , 15 or 30 mg b.i.d . , 10 , 30 or 60 mg o.d . , or placebo595isth major and clinically relevant non - major bleedsappraise-2739273158 months6732apixaban 5 mg ( or 2.5 mg ) b.i.d . , or placebo1981timi major bleeds ; isth major and clinically relevant non - major bleedsatlas acs2-timi5115 52615 34213 months6225rivaroxaban 2.5 or 5 mg b.i.d . , or placebo793timi major ( non - cabg related ) bleeds , timi bleeding requiring medical attentiono.d .
, once daily ; b.i.d . , twice daily ; isth , international society on thrombosis and haemostasis ; timi , thrombolysis in myocardial infarction.see methods for description of inclusion and exclusion criteria .
single antiplatelet therapy includes patients not receiving any antiplatelet medication at randomization , dual antiplatelet treatment consists of aspirin and clopidogrel at randomization.no . of patients who received at least one dose of study drug.no . of patients treated with daily doses
also evaluated in phase iii study.mean or median.apixaban 2.5 mg b.i.d . in 8.5% of the patients with estimated creatinine clearance < 40 ml / min .
, twice daily ; isth , international society on thrombosis and haemostasis ; timi , thrombolysis in myocardial infarction .
single antiplatelet therapy includes patients not receiving any antiplatelet medication at randomization , dual antiplatelet treatment consists of aspirin and clopidogrel at randomization .
eligible patients were men or women with acs with or without st - elevation within 714 days before randomization .
in addition , patients had one or more of following additional risk factors ; age 65years , prior myocardial infarction , diabetes mellitus , congestive heart failure or a left ventricular ejection fraction < 40% , no revascularization for the index event , mild to moderate renal insufficiency , peripheral vascular disease , or previous ischaemic stroke in all studies , except the atlas acs - timi 46 in which no additional risk factor was required and the atlas acs 2timi 51 study in which subjects who were 1854 years of age had to have either diabetes mellitus or a prior myocardial infarction in addition to the presenting acs event .
the main exclusion criteria for all seven trials were ; planned percutaneous coronary intervention , ongoing or planned treatment with vitamin k antagonist , recent stroke , conditions associated with an increased bleeding risk , e.g. anaemia , thrombocytopenia , and a history of severe bleeding .
the groups of patients receiving at least one dose of the studied dosages of the novel oral anticoagulants ximelagatran , dabigatran , and darexaban in the phase ii trials esteem , redeem , and ruby-1 , respectively , were included in the meta - analysis . to avoid the evaluation of doses deemed to have too high bleeding risk , we only included the 1210 ( out of 1715 ) patients in the phase ii study appraise-1 receiving at least one dose of the apixaban doses later evaluated in the phase iii study appraise-2 , i.e. apixaban 5 and 10 mg daily .
likewise , only the 1997 ( out of 3491 ) patients receiving at least one dose of the rivaroxaban doses in the phase ii study atlas acs - timi 46 , i.e. rivaroxaban 5 and 10 mg daily , later taken forward to the phase iii study atlas acs 2timi 51 study were included . all the phase ii studies aimed at 6 months of treatment and follow - up .
the phase iii studies had a longer follow - up , in the appraise-2 study the mean follow - up was 8.2 months , while the atlas acs 2timi 51 had treatment duration of the mean 13 months and up to 31 months ; we therefore also analysed associations of treatment with risk of ischaemic and bleeding events in a subgroup of these phase iii studies .
the mace outcome was defined as the composite of all - cause mortality , myocardial infarction , or stroke in all studies in this meta - analysis .
myocardial ( re-)infarction was in all trials defined as elevated cardiac biomarkers together with ischaemic symptoms or ecg - changes ( st - elevation or -depression , new left bundle branch block , or new q - waves ) .
stroke was defined as an acute onset of focal neurological deficit of presumed vascular origin lasting for 24 h or more and further categorized as haemorrhagic or ischaemic after imaging .
we retrieved data for some non - published composite outcomes for dabigatran , apixaban , and darexaban studies after contact with the original study authors .
major bleeding events assessed by the international society of thrombosis and haemostasis ( isth ) definition were reported in the trials with ximelagatran , dabigatran , apixaban , and darexaban .
an isth major bleeding is defined as a bleeding that was fatal , occurred in a critical location ( intracranial , intraspinal , intraocular , retroperitoneal , intra - articular , intramuscular with compartment syndrome , or pericardial ) , or was associated with a fall in haemoglobin of 2 g / dl or more , or a transfusion of two units or more of whole blood or packed red blood cells .
clinically relevant minor bleeding was in these studies defined as a clinically overt bleed that did not meet the criteria for major bleed but prompted a clinical response , i.e. hospital admission for bleeding , medical or surgical treatment , or a change in antithrombotic therapy including interruption or discontinuation of study drug . in the present meta - analysis , a clinically significant bleeding was in all studies , except those with rivaroxaban , defined as the composite of major ( isth ) and clinically relevant minor bleeds , i.e. the primary outcome event for the phase ii studies with apixaban , dabigatran , and darexaban and a secondary safety outcome in the phase iii study with apixaban .
the studies with rivaroxaban , and also the studies with apixaban , reported bleeding events by the thrombolysis in myocardial infarction ( timi ) definitions .
a timi major bleeding is defined as any intracranial bleeding or clinically overt bleeding associated with a decrease in haemoglobin of 5 g / dl or an absolute drop in haematocrit of 15% .
timi minor bleeding is defined as any clinically overt bleeding event , including bleeding that is evident on imaging studies , that is associated with a decrease in haemoglobin 3 g / dl but < 5g / dl .
bleeding requiring medical attention is defined as any bleeding requiring medical or surgical treatment or laboratory evaluation without meeting criteria for timi major or minor bleeding . in the present meta - analysis , a clinically significant bleeding
was defined as a the composite of timi major bleeding , timi minor bleeding , or bleeding requiring medical attention in atlas acs - timi 46 study , and a timi bleeding requiring medical attention in the atlas acs 2timi 51 study . in the subgroup analysis of the two phase iii studies ,
the mace outcome was similarly defined as the composite of all - cause mortality , myocardial infarction , or stroke , while only major bleeding events were evaluated , defined as timi major bleeding in the appraise-2 study with apixaban , and timi major bleeding not related to coronary - artery bypass grafting in the atlas acs 2timi 51 study with rivaroxaban , which were the primary safety outcomes in these studies .
risk of bias within studies was judged by proper blinding and the presence / absence of a placebo - controlled arm .
the principal summary measure was the hazard ratio ( 95% confidence interval ) , supplemented by absolute risk reduction ( risk difference ) ( 95% confidence interval ) . because numbers needed to treat for an additional beneficial ( nntb ) or harmful ( nnth ) outcome must be calculated using a homogenous follow - up time , these properties were calculated from pooled hazard ratios using only the phase ii studies with 6 months follow - up , and using the pooled 6-month risks of control arms of these studies as assumed control risks .
subgroups based on single vs. dual concomitant antiplatelet therapy , and treatment with direct thrombin inhibitors vs. direct factor xa inhibitors , were compared using fixed - effects models with inverse variance weighting .
we assessed risk of publication bias using a funnel plot and egger 's test , involving all of the treatment arms and the primary outcome maces . to investigate the association between the intended effects on maces and the side effects of bleeding
, we performed a pre - specified random - effects meta - regression with the hazard ratio of maces as independent and hazard ratio hr of bleeding as dependent variable ( hazard ratios for both outcomes are comparing the active arm against placebo ) .
this meta - regression was stratified on the number of antiplatelet drugs ( the total weight was 100% within each stratum ) .
the search strategy identified 168 potential articles , of which 13 were read in full text ( figure 1 ) . among these , seven phase ii and iii studies with new oral anticoagulants after a recent acs were identified and included in the analysis .
data from all seven studies ( esteem , redeem , ruby-1 , appraise-1 and appraise-2 , atlas acs - timi 46 , and atlas acs 2timi 51 ) rendered a study base of 30 866 patients with a recent acss , 4135 ( 13.4% ) in the single antiplatelet therapy group and 26 731 ( 86.6% ) in the dual antiplatelet therapy group . details of these studies are outlined in table 1 and supplementary material online , table s1 .
all of the studies were double blind , placebo - controlled , with outcome assessment by independent adjudication committees unaware of treatment assignment , and had descriptions of number and reasons for losses to follow - up ; therefore , risk of bias within studies was considered low . because all studies had very similar inclusion and exclusion criteria and length of follow - up , risk of bias across studies was also low .
no evidence of publication bias was observed ( egger 's bias coefficient 0.04 , p = 0.86 ; supplementary material online , figure s1 ) .
statistical analyses in the apixaban and rivaroxaban studies were performed by research organizations independent of the sponsors , i.e. duke clinical research institute , durham , nc , usa and the timi study group , brigham and women 's hospital and harvard medical school , boston , ma , usa , respectively .
statistical analyses in the ximelagatran , dabigatran , and darexaban studies were performed by the sponsors but the principal investigators of the studies had access to all data . in patients receiving single antiplatelet therapy ( aspirin ) , additional treatment with an oral anticoagulant on average decreased the rate of maces by 30% ( figure 2 ) , with similar effects for ximelagatran , apixaban , and rivaroxaban ( i= 0% ) . in those studies ,
the rate of clinically significant bleeding events increased with 79% ( figure 3 ) .
no heterogeneity of effects on bleeding could be discerned ( i = 0% ) . in patients on single antiplatelet therapy ,
6-month rates of maces were 15% ( 149/1000 ) and 6-month rates of clinically significant bleeding were 9% ( 89/1000 ) .
additional treatment with an oral anticoagulant for 6 months prevented 44 maces ( nntb 22 ) and caused 70 additional clinically significant bleeding events ( nnth 14 ) per 1000 patients .
figure 2effect of adding an oral anticoagulant to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy on rate of major adverse cardiovascular events after an acute coronary syndrome .
effect estimates of individual study arms with horizontal lines representing 95% ci ; coloured diamonds , subtotal effects and 95% ci from random effects models for direct thrombin inhibitors and factor xa inhibitors , respectively , and overall effects in addition to single and dual antiplatelet therapy ; open diamonds , subtotal summary effects and 95% ci from random effects models per trial ; hr , hazard ratio ; ci , confidence interval ; arr , absolute risk reduction ( risk difference ) ; b.i.d . , twice daily ; o.d .
, once daily ; mace , major adverse cardiovascular events , i.e. a composite of all - cause mortality , myocardial infarction and stroke .
figure 3effect of adding an oral anticoagulant to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy on rate of clinically significant bleeding events after an acute coronary syndrome .
effect estimates of individual study arms with horizontal lines representing 95% ci ; coloured diamonds , subtotal effects , and 95% ci from random effects models for direct thrombin inhibitors and factor xa inhibitors , respectively , and overall effects in addition to single and dual antiplatelet therapy ; open diamonds , subtotal summary effects , and 95% ci from random effects models per trial ; hr , hazard ratio ; ci , confidence interval ; arr , absolute risk reduction ( risk difference ) ; b.i.d . , twice daily ; o.d .
effect of adding an oral anticoagulant to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy on rate of major adverse cardiovascular events after an acute coronary syndrome .
effect estimates of individual study arms with horizontal lines representing 95% ci ; coloured diamonds , subtotal effects and 95% ci from random effects models for direct thrombin inhibitors and factor xa inhibitors , respectively , and overall effects in addition to single and dual antiplatelet therapy ; open diamonds , subtotal summary effects and 95% ci from random effects models per trial ; hr , hazard ratio ; ci , confidence interval ; arr , absolute risk reduction ( risk difference ) ; b.i.d .
, once daily ; mace , major adverse cardiovascular events , i.e. a composite of all - cause mortality , myocardial infarction and stroke .
effect of adding an oral anticoagulant to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy on rate of clinically significant bleeding events after an acute coronary syndrome .
effect estimates of individual study arms with horizontal lines representing 95% ci ; coloured diamonds , subtotal effects , and 95% ci from random effects models for direct thrombin inhibitors and factor xa inhibitors , respectively , and overall effects in addition to single and dual antiplatelet therapy ; open diamonds , subtotal summary effects , and 95% ci from random effects models per trial ; hr , hazard ratio ; ci , confidence interval ; arr , absolute risk reduction ( risk difference ) ; b.i.d . , twice daily ; o.d . , once daily . in patients treated with dual antiplatelet therapy ( aspirin and clopidogrel ) , the addition of an oral anticoagulant decreased the rate of maces by 13% ( figure 2 ) , with negligible heterogeneity between the drugs apixaban , rivaroxaban , dabigatran , and darexaban ( i = 0% ) .
in contrast , additional treatment with an anticoagulant led to an increase in clinically significant bleeding rate by 134% ( figure 4 ) , with low heterogeneity between treatment arms ( i = 19% , mainly explained by heterogeneity between the two rivaroxaban arms in the atlas acs 2timi 51 study ) . in patients on dual antiplatelet therapy ,
6-month rates of maces were 4% ( 43/1000 ) and 6-month rates of clinically significant bleeding were 3% ( 31/1000 ) .
additional treatment with an oral anticoagulant for 6 months prevented 5 maces ( nntb 187 ) and caused 42 additional clinically significant bleeding events ( nnth 24 ) per 1000 patients .
figure 4effect of adding an oral anticoagulant to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy on rates of major adverse cardiovascular events ( a ) and timi major bleeding events ( b ) after an acute coronary syndrome in a subgroup of phase iii studies .
effect estimates of individual study arms with horizontal lines representing 95% ci ; coloured diamonds , subtotal effects , and 95% ci from random effects models for direct thrombin inhibitors and factor xa inhibitors , respectively , and overall effects in addition to single and dual antiplatelet therapy ; open diamonds , subtotal summary effects , and 95% ci from random effects models per trial ; hr , hazard ratio ; ci , confidence interval ; arr , absolute risk reduction ( risk difference ) ; b.i.d . , twice daily ; o.d .
, once daily ; mace , major adverse cardiovascular events , i.e. a composite of all - cause mortality , myocardial infarction and stroke .
effect of adding an oral anticoagulant to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy on rates of major adverse cardiovascular events ( a ) and timi major bleeding events ( b ) after an acute coronary syndrome in a subgroup of phase iii studies .
effect estimates of individual study arms with horizontal lines representing 95% ci ; coloured diamonds , subtotal effects , and 95% ci from random effects models for direct thrombin inhibitors and factor xa inhibitors , respectively , and overall effects in addition to single and dual antiplatelet therapy ; open diamonds , subtotal summary effects , and 95% ci from random effects models per trial ; hr , hazard ratio ; ci , confidence interval ; arr , absolute risk reduction ( risk difference ) ; b.i.d . ,
, once daily ; mace , major adverse cardiovascular events , i.e. a composite of all - cause mortality , myocardial infarction and stroke . in the subgroup of phase iii studies , the addition of apixaban 5 mg b.i.d .
to single or dual antiplatelet therapy or the addition of rivaroxaban 2.5 or 5 mg b.i.d . to dual antiplatelet therapy on average decreased the rate of maces by 15% and increased the rate of timi major bleeding more than three - fold ( figure 4 ) , with low heterogeneity between treatment arms ( i = 0 and 19% , respectively ) although with wide confidence intervals for the smaller group of patients receiving apixaban and only one antiplatelet drug .
the gain in protection against maces was larger when adding an anticoagulant to single than to dual antiplatelet therapy ( figure 2 ) , p = 0.03 for heterogeneity between effects .
effects on bleeding were smaller when adding an anticoagulant to single than to dual antiplatelet therapy ( figure 3 ) , p = 0.02 .
no consistent differences were observed between subgroups of direct thrombin inhibitors and direct factor xa inhibitors regarding effects on maces or bleeding , either as addition to single or dual antiplatelet therapy , all p 0.19 . there was a non - significant tendency to an inverse association between the effect on maces and the effect on clinically significant bleeding when adding an anticoagulant to single antiplatelet therapy , but no association when adding an anticoagulant to dual antiplatelet therapy ( figure 5 ) .
figure 5association of effects of adding an oral anticoagulant to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy on rate of mace with effects on rate of clinically significant bleeding events after an acute coronary syndrome .
the area of a circle representing a study arm is proportional to its weight in the random - effects model .
hr , hazard ratio ; mace , major adverse cardiovascular events ; riv , rivaroxaban ; dab , dabigatran , api , apixaban ; dar , darexaban ; xim , ximelagatran ; b.i.d . , twice daily ; o.d .
association of effects of adding an oral anticoagulant to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy on rate of mace with effects on rate of clinically significant bleeding events after an acute coronary syndrome .
the area of a circle representing a study arm is proportional to its weight in the random - effects model .
hr , hazard ratio ; mace , major adverse cardiovascular events ; riv , rivaroxaban ; dab , dabigatran , api , apixaban ; dar , darexaban ; xim , ximelagatran ; b.i.d . , twice daily ; o.d . , once daily ; number denotes strength in milligram .
in this meta - analysis of patients with a recent acs , the addition of a new oral anticoagulant to antiplatelet therapy led to a modest reduction in cardiovascular events but a substantial increase in bleeding , most pronounced in patients receiving dual antiplatelet therapy .
the strength of the evidence was high for both outcomes and in patients using one as well as two antiplatelet drugs .
the results were similar in the phase ii trials and in the phase iii trials that provided the majority of events because of higher patient numbers and longer treatment exposure and follow - up .
there was no significant association between the oral anticoagulant treatments ' effects on maces and effects on clinically significant bleeding , implying that there is no simple trade - off between protective and adverse effects of these drugs after acss in patients receiving single or dual antiplatelet therapy . under the questionable assumption of equal clinical importance of bleedings and the components of maces ,
it tended to be better when adding an anticoagulant to single than to dual antiplatelet therapy , but some overlap between those two groups of studies was seen .
the results support the concept that treatment with new oral anticoagulants may reduce ischaemic events after an acs .
however , in combination with dual anti - platelet therapy , no specific treatment or dosing regimen avoided a substantial increase in major bleeding .
the reduction of ischaemic events by the new oral anticoagulants was most promising when added to single antiplatelet therapy with aspirin .
however , single antiplatelet treatment is rarely used because many acs patients are treated with percutaneous coronary interventions and stents , and current guidelines recommend that all post - acs patients should receive up to 12 months of dual antiplatelet treatment .
thus , the most striking results of this meta - analysis concern the high bleeding rates in combination with only modest reductions in maces in the large groups of patients receiving combinations of new oral anticoagulants with dual antiplatelet therapy .
the reviewed trials were all designed and performed at a time when clopidogrel was the only available p2y12 inhibitor .
recently , acute and long - term treatment combining aspirin and new p2y12 inhibitors , either prasugrel or ticagrelor , have been shown more effective than clopidogrel for the prevention of maces during and after acs , and prasugrel or ticagrelor is now considered the preferred p2y12 inhibitors in patients with acs .
long - term treatment with any of these new antiplatelet agents was , compared with clopidogrel , associated with a modest increase , up to 35% , in major non - cabg - related bleedings , in contrast to the findings of the present study of more than three - fold increase in major bleeding events when adding the new oral anticoagulants to aspirin and clopidogrel .
the addition of a new oral anticoagulant to aspirin and any of ticagrelor or prasugrel has not been thoroughly evaluated and might expose the patients to even larger risks of major bleeding with even more limited expectations for further reductions in maces .
therefore , in patients receiving oral anticoagulant therapy the combination of aspirin and clopidogrel will probably still be the most widely used dual antiplatelet strategy after an acs .
it will be challenging to identify settings where the incremental benefits of an oral anticoagulant in addition to aspirin in combination with prasugrel or ticagrelor can be utilized without exposing the patient to unacceptable risks of major bleeding , unless doses are drastically reduced .
the majority of the patients and events in this meta - analysis were accrued from the two phase iii trials .
the bleeding results in these two large trials were consistent with the phase ii experiences .
the bleeding outcomes were also very similar between the two phase iii trials , albeit with numerically larger relative increase in bleeding in the concluded atlas acs 2timi 51 trial than the prematurely terminated appraise-2 trial .
a modest reduction in maces was also seen in both these phase iii trials , significant only in the atlas acs 2timi 51 trial but not in the appraise-2 trial , although the premature termination and shorter duration of treatment in the latter trial may have limited the statistical power to detect associations with both bleeding and mace outcomes .
as both rivaroxaban and apixaban are factor xa inhibitors , it is likely that the meta - analysis result is the most plausible outcome when taking these treatments into real - life health care .
this information might be useful when considering patients with a combination of atrial fibrillation and acs , where a combination of anticoagulation and dual antiplatelet treatment is currently recommended for at least 16 months .
notably , the rivaroxaban doses , 2.5 or 5 and 5 mg twice daily , used in the atlas acs 2timi 51 trial in combination with asa and clopidogrel were lower than the 20 mg once daily dose shown to be efficacious for stroke prevention in atrial fibrillation , a setting where most patients are not receiving antiplatelet therapy . the strengths of this study are the inclusion of all published randomized , placebo - controlled phase ii and iii studies of novel oral anticoagulants ; that risk of publication bias was very low as assessed by two methods ; that the very few data points that were unavailable in the publications were successfully retrieved from the authors of the studies .
studies were all of high quality with low risk of within - study bias ; and a pre - specified subgroup analysis of the phase iii studies with longer follow - up gave similar results as the main analyses .
the latter is particularly important since phase ii dose ranging trials purposely explore the bleeding risk in relation to dose range and , therefore , may somewhat overestimate bleeding risk compared with the doses selected for testing in phase iii studies .
supportive of the combination of these studies in a meta - analysis is the fact that all studies had nearly identical inclusion and exclusion criteria , definitions of maces , and length of follow - up in the phase ii studies ; and that heterogeneity of effects , estimated using the i - statistic , was negligible in all comparisons . in a pooled analysis of several agents ,
it is nevertheless difficult to rule out an impact of the dose of these anticoagulants on clinical outcomes .
moreover , cross - trial comparisons should despite the similarities in inclusion and exclusion criteria and outcome definitions always be done with caution , e.g. regarding absolute risk reductions , and nntb or nnth .
the definition of clinically significant bleeds as the composite of major ( isth ) and clinically relevant minor bleeding was identical in the studies with apixaban , darexaban , dabigatran , and ximelagatran and this composite was judged to be sufficiently comparable with the composite of timi major , timi minor , and bleeding requiring medical attention in the phase ii study with rivaroxaban . since the latter composite of bleedings based on the timi scale was not available from the phase iii study with rivaroxaban , only timi bleedings requiring medical attention in this study were used in the present meta - analysis .
this limitation is in part overcome by the use of hazard ratios instead of absolute event rates , and the results are further strengthened by the similar results in the subgroup analysis of timi major bleeding outcomes in the phase iii studies .
we did not separately analyse the mace components , i.e. all - cause mortality , myocardial infarction or stroke in this meta - analysis since the event rates were deemed too low , mainly in the phase ii studies . single or dual antiplatelet therapy was in this analysis based on treatment at randomization , but antiplatelet therapy was persistent throughout most of the observation periods for these studies including the phase iii studies .
another limitation is the lack of separately evaluable results for the small proportions of patients on single antiplatelet treatment , i.e. 2 , 5 , and 7% , in redeem , ruby-1 , and atlas acs 2timi 51 studies , respectively . in patients with a recent acs
, the addition of a new oral anticoagulant to antiplatelet therapy leads to a modest reduction in cardiovascular events but a substantial increase in bleeding .
these results are most pronounced when oral anticoagulants are combined with dual anti - platelet therapy with aspirin and clopidogrel .
no new oral anticoagulant has been evaluated in addition to dual antiplatelet therapy with aspirin and any of the more efficacious novel p2y12 inhibitors ticagrelor or prasugrel , a combination which might expose the patients to even larger risks of major bleeding with even lower expectations for further reductions in ischaemic events .
further studies evaluating new oral anticoagulants in combination with effective single antiplatelet therapy or shorter duration of triple antithrombotic therapy are warranted .
the strengths of this study are the inclusion of all published randomized , placebo - controlled phase ii and iii studies of novel oral anticoagulants ; that risk of publication bias was very low as assessed by two methods ; that the very few data points that were unavailable in the publications were successfully retrieved from the authors of the studies .
studies were all of high quality with low risk of within - study bias ; and a pre - specified subgroup analysis of the phase iii studies with longer follow - up gave similar results as the main analyses .
the latter is particularly important since phase ii dose ranging trials purposely explore the bleeding risk in relation to dose range and , therefore , may somewhat overestimate bleeding risk compared with the doses selected for testing in phase iii studies .
supportive of the combination of these studies in a meta - analysis is the fact that all studies had nearly identical inclusion and exclusion criteria , definitions of maces , and length of follow - up in the phase ii studies ; and that heterogeneity of effects , estimated using the i - statistic , was negligible in all comparisons . in a pooled analysis of several agents , it is nevertheless difficult to rule out an impact of the dose of these anticoagulants on clinical outcomes .
moreover , cross - trial comparisons should despite the similarities in inclusion and exclusion criteria and outcome definitions always be done with caution , e.g. regarding absolute risk reductions , and nntb or nnth .
the definition of clinically significant bleeds as the composite of major ( isth ) and clinically relevant minor bleeding was identical in the studies with apixaban , darexaban , dabigatran , and ximelagatran and this composite was judged to be sufficiently comparable with the composite of timi major , timi minor , and bleeding requiring medical attention in the phase ii study with rivaroxaban . since the latter composite of bleedings based on the timi scale was not available from the phase iii study with rivaroxaban , only timi bleedings requiring medical attention in this study were used in the present meta - analysis .
this limitation is in part overcome by the use of hazard ratios instead of absolute event rates , and the results are further strengthened by the similar results in the subgroup analysis of timi major bleeding outcomes in the phase iii studies .
we did not separately analyse the mace components , i.e. all - cause mortality , myocardial infarction or stroke in this meta - analysis since the event rates were deemed too low , mainly in the phase ii studies . single or dual antiplatelet therapy was in this analysis based on treatment at randomization , but antiplatelet therapy was persistent throughout most of the observation periods for these studies including the phase iii studies .
another limitation is the lack of separately evaluable results for the small proportions of patients on single antiplatelet treatment , i.e. 2 , 5 , and 7% , in redeem , ruby-1 , and atlas acs 2timi 51 studies , respectively .
in patients with a recent acs , the addition of a new oral anticoagulant to antiplatelet therapy leads to a modest reduction in cardiovascular events but a substantial increase in bleeding .
these results are most pronounced when oral anticoagulants are combined with dual anti - platelet therapy with aspirin and clopidogrel .
no new oral anticoagulant has been evaluated in addition to dual antiplatelet therapy with aspirin and any of the more efficacious novel p2y12 inhibitors ticagrelor or prasugrel , a combination which might expose the patients to even larger risks of major bleeding with even lower expectations for further reductions in ischaemic events .
further studies evaluating new oral anticoagulants in combination with effective single antiplatelet therapy or shorter duration of triple antithrombotic therapy are warranted .
j.s . was funded by the swedish heart - lung foundation ( grant 20041151 ) and the swedish research council ( grants 20075942 and 20101078 ) .
reports institutional research grant from boehringer - ingelheim ; and consulting and lecture fees from bayer , boehringer - ingelheim , bristol - myers squibb , and pfizer .
has received consultant fees from astrazeneca , athera biotechnologies , boehringer - ingelheim , bristol - myers squibb , csl behring , evolva , glaxosmithkline , portola , regado bitoechnologies , and schering - plough / merck ; lecture fees from astrazeneca , boehringer ingelheim , bristol - myers squibb , glaxosmithkline , and schering - plough / merck ; and institutional research grants from astrazeneca , boehringer ingelheim , bristol - myers squibb , glaxosmithkline , merck , pfizer , and schering - plough .
has received consultant fees and honoraria from bayer , bristol - myers squibb , daiichi - sankyo , janssen pharmaceuticals , orexigen , pfizer and xoma , and institutional research grants from bristol - myers squibb , csl , the u.s .
has received institutional research grants from astrazeneca , bristol - myers squibb , and eli lilly ; and consultant / speaking fees from astrazeneca , eli lilly , and merck . b.j . reports no conflicts of interest .
dr steg has received research grant ( to inserm u-698 ) from nyu school of medicine , sanofi , and servier ; and consultant / speaking fees from ablynx , amarin , amgen , astellas , astrazeneca , bayer , boehringer - ingelheim , bms , daiichi / sankyo , eisai , glaxosmithkline , eli lilly , medtronic , merck sharpe & dohme , novartis , otsuka , pfizer , roche , sanofi , servier , the medicines company , and vivus ; and reports stockholding in aterovax . | backgroundoral anticoagulation in addition to antiplatelet treatment after an acute coronary syndrome might reduce ischaemic events but increase bleeding risk .
we performed a meta - analysis to evaluate the efficacy and safety of adding direct thrombin or factor - xa inhibition by any of the novel oral anticoagulants ( apixaban , dabigatran , darexaban , rivaroxaban , and ximelagatran ) to single ( aspirin ) or dual ( aspirin and clopidogrel ) antiplatelet therapy in this setting.methods and resultsall seven published randomized , placebo - controlled phase ii and iii studies of novel oral anticoagulants in acute coronary syndromes were included .
the database consisted of 30 866 patients , 4135 ( 13.4% ) on single , and 26 731 ( 86.6% ) on dual antiplatelet therapy , with a non - st- or st - elevation acute coronary syndrome within the last 714 days .
we defined major adverse cardiovascular events ( maces ) as the composite of all - cause mortality , myocardial infarction , or stroke ; and clinically significant bleeding as the composite of major and non - major bleeding requiring medical attention according to the study definitions . when compared with aspirin alone the combination of an oral anticoagulant and aspirin reduced the incidence of mace [ hazard ratio ( hr ) and 95% confidence interval 0.70 ; 0.590.84 ] , but increased clinically significant bleeding ( hr : 1.79 ; 1.542.09 ) . compared with dual antiplatelet therapy with aspirin and clopidogrel , adding an oral anticoagulant decreased the incidence of mace modestly ( hr : 0.87 ; 0.800.95 ) , but more than doubled the bleeding ( hr : 2.34 ; 2.062.66 ) .
heterogeneity between studies was low , and results were similar when restricting the analysis to phase iii studies.conclusionin patients with a recent acute coronary syndrome , the addition of a new oral anticoagulant to antiplatelet therapy results in a modest reduction in cardiovascular events but a substantial increase in bleeding , most pronounced when new oral anticoagulants are combined with dual antiplatelet therapy . | Introduction
Methods
Identification of studies
Outcomes, data collection, and quality assessment
Statistical analysis
Results
Discussion
Strengths and limitations
Conclusions
Supplementary material
Funding
Supplementary Material |
agitation , referring to a syndrome involving emotional distress , excessive psychomotor activity , aggression , irritability , disinhibition , and/or vocal disruptive behaviors unexplained by apparent needs , or confusion,1,2 is a very common phenomenon in the course of dementia.35 it can afflict patients at any level of dementia severity , but it occurs particularly in middle to later stages.3,6 agitation and resulting behavioral disturbances are closely associated with impairment in quality of life and more rapid cognitive decline on the part of the patient , caregiver distress , an increased likelihood of institutionalization , and increased health care costs.7 trials of clinical management often combine nonpharmacological behavioral interventions and pharmacotherapy .
nonpharmacological strategies , especially multisensory stimulation therapy , seem to be promising,8 yet evidence in support of their efficacy is still limited,9 and there is insufficient research for severely impaired patients .
pharmacotherapy usually involves psychotropic medication mostly antipsychotics ; however these show only modest benefits compared with placebo.10,11 moreover , adverse effects of antipsychotics , such as extrapyramidal symptoms and excessive sedation , can be particularly dangerous in demented patients and can outweigh the moderate improvement of agitation symptoms,8 emphasizing the need for other treatment options for dementia - related behavioral disturbances .
it is also noteworthy that there is a definite need for medications with regulatory approval for the indication of management of agitation in patients with dementia , in most countries .
electroconvulsive therapy ( ect ) is regarded as a highly efficient and safe treatment option in severe psychiatric disorders , with only few adverse effects . despite very rare serious adverse events , cognitive adverse effects in the elderly , including retrograde and anterograde amnesia , are common . especially in patients with preexisting cognitive impairments
, an acute cognitive deterioration occurs more often , but these impairments are reversible within weeks.12 in numerous studies , the effectiveness and safety of ect was confirmed for demented patients who also suffered from depression.1218 the evidence supporting the use of ect for the treatment of agitation and aggression in dementia is limited to several case reports,1922 two case series,23,24 and one recent study25 but is clearly suggestive of benefit for this indication.26
here , we report a case of successful use of ect in a patient with severe early - onset alzheimer s disease and severe agitation , after other nonpharmacological and pharmacological interventions were exhausted . the patient was a 57-year - old , right - handed woman with a 4-year history of rapid progressive dementia of alzheimer type , which was previously diagnosed outwards by neuropsychological examination .
the diagnosis was confirmed by magnetic resonance imaging , fluorodeoxyglucose positron emission tomography , and examination of cerebrospinal liquid with measurement of dementia parameters .
her psychiatric history included two depressive episodes 26 and 18 years previous , following critical life events , which remitted in the course of months without specific therapy .
she was admitted to our clinic for evaluation and treatment of severe behavior disturbances , including severe restlessness , yelling , crying , refusal to eat and drink , physical aggression , and resisting care , which made further caretaking of the patient at home by family members impossible . on hospital admission
, she exhibited highly agitated behavior with anxiety , near - continuous pacing , crying , and repetitive local outbursts , and could not be redirected .
partly responsible for the observed behavioral disturbances remained unclear . on the pittsburgh agitation scale ( pas ) , which rates the severity of four behavior groups ( aberrant vocalizations , motor agitation , aggressiveness , and resisting care ) on a scale of 0427 with higher scores indicating more severe agitation
verbal communication with the patient and neurocognitive evaluation was substantially hindered by impairment of language comprehension .
she had difficulties falling and staying asleep and failed to assist in performing activities of daily living .
her medication on admission included the acetylcholinesterase inhibitor rivastigmine patch ( 9.5 mg / d ) and antipsychotic agent quetiapine ( 50 mg / d ) .
complete blood count , electrolytes , thyroid , liver , and kidney function tests , urinalysis , electrocardiogram , and physical exam were all normal .
multiple trials of various psychopharmacologic agents were also ineffective : no improvement could be observed with quetiapine at increased doses ( up to 175 mg / d ) , risperidone ( up to 2.5 mg / d ) , melperone ( up to 100 mg / d ) , and pipamperone ( up to 80 mg / d ) . in due consideration of depressive episodes in her medical history
, we started an antidepressive combination therapy with sertraline ( 200 mg / d ) and mirtazapine ( 30 mg / d ) , which induced an improvement of sleep but no decrease in agitated behavior .
treatment with lorazepam ( up to 4 mg / d ) brought about a temporary affective loosening , which lasted only 4 days .
after 9 weeks in our hospital , ect was initiated . at this time , the patient was receiving rivastigmine ( 9.5 mg / d ) , sertraline ( 200 mg / d ) , and mirtazapine ( 30 mg / d ) . due to her inability to give informed consent , her daughters who were also her legal guardians
agreed to the treatment , after detailed information and discussion . to potentially minimize reversible cognitive adverse effects of ect we decided to use right unilateral electrode placement , dose titration ( ie , evaluation of the patient s individual seizure threshold ) , a treatment frequency of two sessions per week
, a pulse width of 0.25 ms , and s - ketamine for anesthesia.28,29 ect was administered with a thymatron iv device ( somatics , llc , lake bluff , il , usa ) .
weight - adjusted s - ketamine ( ~1.2 mg / kg ) was used for anesthesia induction , followed by succinylcholine for muscle relaxation .
following sessions were conducted at 150 mc ( second fifth session ) and 200 mc ( sixth eighth session ) .
sufficient seizures , with respect to quantified ictal parameters , were achieved.30 pas scores were determined weekly to assess the clinical severity of agitation symptoms . a marked difference in the clinical presentation of the patient was noted after just two ect treatments : the patient was noticeably less agitated , and crying occurred only for short episodes .
she stopped yelling and crying , showed no aggression , smiled spontaneously , and was more redirectable .
the patient continued to pace , but she was able to sit and lay down for longer periods .
she showed significant reduction in her total pas score from baseline ( 11 points ) during and after ect ( 2 points ) ( figure 1 ) .
the patient started to eat and drink by herself and was more cooperative in other daily care activities , like washing and dressing .
family members claimed to be able to verbally and nonverbally communicate better with the patient ( eg , she followed lowest level instructions ) .
the ect treatment was tolerated well , with signs of headache after the first three sessions . in the third week of treatment , a single self - limiting , spontaneous generalized seizure was observed .
the guardians refused maintenance ect since the patient moved away from our clinic to be taken care of by other family members .
katamnestic data on clinical presentation and behavioral symptoms of the patient were collected , by caregiver interviews , every 2 weeks over a period of 4 months after hospital discharge . based on this information , pas scores were determined .
the improvement of agitation symptoms initiated by ect lasted for approximately 12 weeks without any additional therapy other than rivastigmine , sertraline , and mirtazapine ( figure 1 ) . in the follow - up period ,
abnormalities of neurotransmission ( eg , gamma aminobutyric acid [ gaba]ergic and dopaminergic dysfunction , cholinergic and serotonergic deficiency , and noradrenergic hyperactivity ) have been implicated to play a role in behavior modulation , promoting agitation and aggression.31 it has been previously postulated that ect may mediate its beneficial effects through its known enhancement of gabaergic transmission and inhibition.24 it is also presumable that the efficacy of ect relies upon its antidepressant and antipsychotic features since agitation and aggression are frequently associated with psychotic symptoms , and the underlying cause of behavioral disturbances in demented patients might be an agitated mood disorder .
clinically , it is very challenging to establish the presence or absence of a mood disorder in a highly agitated patient with severe alzheimer s disease who can not be interviewed due to impairment of language comprehension . in our case ,
the patient had a history of two depressive episodes in her past , and the clinical improvement initiated by ect now persisted for approximately 3 months .
the overall time course of the treatment effect was thus comparable with ect applied in major depression.32 in previous case reports on ect use for dementia - related agitation in patients without a history of affective disorders , the time to relapse varied over a wide range , from 2 weeks21 to 1 year.20 successful application of maintenance ect as well as successful reapplication of ect in relapsed patients has been reported repeatedly.1923 the patient described here tolerated the ect treatment well without any adverse effects going beyond headache .
the occurrence of spontaneous seizures was considered to be a result of extensive neurodegeneration in the course of alzheimer s disease and not an adverse effect of the treatment since ect is known to have considerable anticonvulsant effects3336 and not to cause epilepsy.37 our observation of rapid effectiveness and good overall tolerance of the procedure corroborates previous reports .
the concern of greater long - term cognitive adverse effects of ect in patients with severe dementia17 is not supported by any evidence so far , considering that in most of the reported cases , patients suffering from behavioral disturbances were in the last stage of dementia .
furthermore , at least some evidence exists that in mild alzheimer s disease , most patients do not suffer from long - term cognitive adverse effects and some even improve , which has been attributed to an amelioration of pseudodementia.12 our case demonstrates that ect can be safely and effectively used in treating pharmacotherapy - resistant severe agitation in early - onset alzheimer s disease in its last stage , without any recognizable worsening of cognitive functions .
implementation of randomized and controlled trials with ect seems justified , to outline potential beneficial effects of this treatment compared with other clinical management strategies of dementia - associated agitation and aggression . | dementia - related behavioral disturbances are mostly treated with antipsychotics ; however , the observed beneficial effects are modest and the risk of serious adverse effects high .
we report the case of a 57-year - old woman with severe early - onset alzheimer s disease and severe agitation , whom we treated with electroconvulsive therapy ( ect ) .
a significant clinical improvement was achieved over eight ect sessions , which were tolerated well without cognitive worsening , and lasted approximately 3 months .
our case demonstrates the safe and effective use of ect in pharmacotherapy - resistant severe agitation in alzheimer s disease . the risk benefit profile of ect for dementia - related agitation should be further investigated in clinical trials . | Introduction
Case
Discussion |
during 20052010 ( time span needed to cover the study area ) and during the months more favorable for infection ( october april ) , foxes were either shot at night or trapped .
therefore , a grid of 5 km 5 km to 10 km 10 km , depending on the department size , was superimposed over the sampling area , and no more than 1 fox was collected in each square .
the geographic district where the sample was taken was then noted , and each fox was randomly allocated geographic coordinates within the commune ( a french administrative division of 10100 km ) .
staff were trained by the anses - nancy laboratory ( national reference laboratory for echinococcoses ) ; that laboratory also confirmed any unrecognized specimens .
for time- and cost - effectiveness during the analysis , we used the segmental and sedimentation counting technique ( 12 ) .
the distribution of e. multilocularis prevalence in foxes was modeled against geographic coordinates by using a generalized additive model with a logistic link function and a thin plate regression spline on 300 knots ( 13 ) .
analyses and graphic displays were conducted by using arcgis 9.3 , r 2.14.0 and the r packages maptools 0.810 , mgcv 1.712 , sp . 0.991 , and splancs 2.0129 .
eighty - five could not be assigned a commune code and were not kept for further analysis , except to compute e. multilocularis prevalence in departments .
the mean number of foxes collected by department was 84.95 ( sd 25.76 ) , which represents a mean of 1.56 foxes per 100 km ( sd 0.57 ) . for 4 departments , ( 36 , 61 , 67 , and 69 ) , full sampling
urban areas , such as departments 93 , 95 , and 91 , also were undersampled because of human population density and high urbanization , all factors preventing easy fox sampling .
the prevalence varied widely among departments , from 0 ( 95% ci 05% ) to 54% ( 95% ci 42%64% ) ( table 1 ) but was locally higher in some areas ( figure 2 ) .
the mean prevalence in the entire studied area was 17% ( n = 3,307 ; 95% ci 16%19% ) .
the prevalence in the historically echinococcosis - endemic area was 41% ( n = 789 ; 95% ci 37%44% ) and represented > 55% of all infected foxes and
furthermore , in comparing our results with those of earlier similar studies during the same season with the same technique , we detected a significant increase of e. multilocularis prevalence in foxes over time in most of these departments ( table 2 ) .
model - predicted prevalence ( a ) and standard error ( b ) of echinococcus multilocularis in foxes , france , 20052010 . 1 = 100%
our study confirms the presence of e. multilocularis in areas where it is known to be endemic and indicates its presence in 25 additional departments .
however , we can not discard the possibility that e. multilocularis was present but remained undetected during the 1980s1990s . that e. multilocularis could have remained undetected if it were not already at a very low prevalence in general
isolated human cases recorded in the early 2000s outside areas to which it is known to be endemic corroborate this possibility ( 3 ) .
the same uncertainty applies in other parts of europe ( 14 ) . taken as a whole ,
these findings indicate that the transmission intensity of e. multilocularis through fox populations in the occidental part of the european focus area is likely to have increased during the late 1990s and led to a much higher average prevalence than previously reported .
furthermore , infected foxes close to large - scale conurbations , such as paris and its large suburban surrounding departments ( 93 , 91 , and 77 ) ( figure 1 ) amounting to 11,728,240 inhabitants , may create new conditions for human exposure similar to those already described in other highly urbanized cities , such as in switzerland , germany , and eastern france ( nancy ) , but on a much larger scale .
we believe that the public needs to be proactively informed and protected , including through awareness initiatives among urban residents and , in specific areas ( 15 ) , more direct action toward the parasite may be considered . monitoring the possible further extension of the parasite westward and southward and the evolution of prevalence in foxes in the historically and the newly echinococcosis - endemic areas also are essential . | during 20052010 , we investigated echinococcus multilocularis infection within fox populations in a large area in france .
the parasite is much more widely distributed than hitherto thought , spreading west , with a much higher prevalence than previously reported .
the parasite also is present in the large conurbation of paris . | The Study
Conclusions |
the most recent 2009 usrds report observed high first- and second - month death rates after hd initiation .
the choice study reported 50% higher mortality rates in patients initiating hd with a tc as compared to patients with an avf .
there was a trend toward higher mortality rates ( 21% increased ) in incident hd patients with an avg compared to those with an avf ; however this did not achieve statistical significance . a recently published canadian study in 40,526
incident dialysis patients reported an 80% higher 1-year mortality for hd patients with a tc compared to pd patients and hd patients with an avf or avg .
potential reasons for these findings include the higher rate of infection and sepsis associated with tcs , relative to avfs ; however the contribution of the vascular access type , independent of infection , may also be a factor .
the prevalence of chronic inflammation is high ( 3565% ) in the chronic kidney disease ( ckd ) and end - stage renal disease ( esrd ) populations [ 47 ] .
inflammation , as assessed by using c - reactive protein ( crp ) level , is a strong predictor of all - cause and cardiovascular mortality in esrd patients [ 59 ] .
although several small studies reported an association between tcs and elevated crp levels and observed a substantial reduction in crp after tc removal with change of access to an avf , these findings were not reproduced in data collected for 1,826 prevalent hd patients enrolled in the hemodialysis ( hemo ) study [ 1520 ] .
in fact , in the hemo study , higher crp levels were inversely associated with tc use .
the hemo study investigators did not find a significant change in crp when access was changed from a tc to an avf or vice versa .
there are limited data on the longitudinal serial crp values and the relationship to the vascular access type in an incident hd population and on the contribution of noninfected arteriovenous grafts ( avg ) to inflammation .
furthermore , limited data exist for other inflammatory cytokines , such as interleukin-6 ( il-6 ) and interferon--induced protein ( ip-10 ) . to investigate the role of the vascular access type on serial inflammatory cytokines we studied a longitudinal cohort of incident hd patients .
this is a prospective , observational study in a cohort of pre - hd patients .
this study was approved by the committee of clinical investigation at montefiore medical center , ( protocol number 06 - 07 - 336 ) .
patients with stage-4 and -5 chronic kidney diseases ( ckd ) receiving their initial hd vascular access insertion were invited to participate .
patients were recruited from 2 adult outpatient renal clinics , 8 private nephrology practices , and the inpatient renal patient population at montefiore medical center , bronx , ny . exclusion criteria included the presence of an active inflammatory state : infection , malignancy , connective tissue disease , hiv infection , organ transplant recipient , and current use of immune modulating agents .
the type of vascular access to be inserted was determined by the patient 's physician .
patient data that were recorded included age , race , sex , etiology of ckd , body surface area , active tobacco use , diabetes mellitus ( dm ) , and a history of atherosclerotic diseases including cardiovascular disease , myocardial infarction ( mi ) , congestive heart failure ( chf ) , peripheral vascular disease ( pvd ) , and cerebral vascular accident ( cva ) . a subjective global assessment ( sga )
the conventional sga is a three - tiered , semiquantitative scoring system based on the history and physical examination and is commonly used in nephrology to quantify the degree of malnutrition .
all medications at time of randomization were documented and include the use of angiotensin - converting enzyme inhibitors ( acei ) , angiotensin receptor blockers ( arb ) , aspirin ( asa ) , nonsteroidal anti - inflammatory agents ( nsaid ) , erythropoiesis - stimulating agents ( esa ) , vitamin d supplements , beta - blockers , insulin , and the cholesterol - lowering statins .
the date of hd initiation , access thrombosis , interventional procedures , and access survival were noted .
blood samples were drawn at baseline ( within 1 month prior to access surgery ) , then postsurgery on days 7 , 30 , 90 , 180 , 270 , 365 . in patients who initiated hd ,
samples were immediately centrifuged ( 3000 rpm for 10 minutes ) and stored at 70 degrees .
all cytokine assays were performed at vanderbilt university medical center using cytometric bead array ( becton dickinsontm , san diego , calif ) .
the detection limits were as follows : crp , 0.124 mg / ml ; il-6 , < 2 pg / ml ; ip-10 , 2.7 pg / ml .
the intra - assay coefficient of variation ( cv ) for crp was 6% , il-6 was 7.7% , and for ip-10 was 6.2% .
baseline laboratory data are presented as mean s.d , and all cytokine values are presented as the median and interquartile range ( 25th to 75th percentile ) .
univariate analyses were performed using anova ( with bonferroni correction ) or chi - square analyses where appropriate .
all cytokine values were analyzed using nonparametric statistical testing , namely , the kruskal - wallis test .
patients who receive two concomitant vascular accesses initially ( tc / avf , or tc / avg ) were included in the tc group for all tables , figures , and analyses . significance was determined at p = 0.05 ( 2-tailed ) .
multivariate analyses for repeated measures were performed using mixed effects models , with crp , il-6 , and ip-10 as the dependent variables , and all were log transformed .
covariates that were included in the model ( selected a priori ) were age , sex , race , vascular access type , hd initiation , infection , vascular access thrombosis , cardiovascular disease , dm , and time period after vascular access surgery .
patients who had a tc and a second arteriovenous access ( arteriovenous fistula [ avf ] or graft [ avg ] ) were classified as being in the tc group for the mixed effects models .
a sensitivity analysis was performed to compare the effect of a tc alone versus an avf or avg on inflammation ( crp , il-6 , ip-10 ) .
the study period was from august 2006 until april 2008 . of the 79 patients who initially consented to participate in the study
, 14 patients did not show up for access surgery , and 1 patient withdrew from the study 1 week after access surgery .
the mean followup for the remaining 64 patients was 10 months ( range 0.2512 months ) .
the baseline patient demographic data are provided in table 1 . the mean patient age was 61 years , and 52% were women .
the racial distribution of the study population was 48% african american , 39% hispanic , 6% caucasian , and 6% other race .
the incidence of comorbid illnesses was : dm 69% , htn 98% , chf 38% , mi 17% , cva 14% , pvd 11% , hyperlipidemia 67% .
there was a history of tobacco use in 28% ( active use , 5% ) .
the etiology of esrd was dm 48% , htn 17% , unknown 16% , and polycystic kidney disease 6% , representative of the general esrd population in the united states .
the number of patients in each vascular access group was as follows : avf , n = 14 ; avg , n = 10 ; tc ,
n = 40 ( 24 with a tc only , 11 with concomitant tc and avf placement , and 5 with both tc and avg placement ) . in the avf group , there was a significantly higher representation of men , and patients were of younger age , relative to the avg and tc groups .
table 2 provides baseline laboratory data , and table 3 lists the medications upon study entry .
crp , il-6 , and ip-10 levels were significantly higher at baseline in the patients with a tc or avg compared to patients with an avf .
seven deaths occurred during the study period . in those 7 patients the initial vascular access and cause of death were as follows : avf group ( 1 cardiac ) , avg ( 2 sepsis , 1 cardiac death , 1 pneumonia ) , tc ( 1 sepsis , 1 pneumonia ) .
there were 9 patients whose initial vascular access was a tc with a developing avf , who subsequently had the tc removed once the avf was useable for hd .
although the median crp values declined after tc removal , this did not achieve statistical significance ( tc / avf : crp 8.35 mg / l 15.0 , versus avf alone : 3.16 mg / l 1.8 , p = 0.53 ) .
crp data were available for only 2 patients whose initial vascular access was an avf who then required a tc ( avf : 13.5 mg / l versus tc / avf : 7.7 mg / l ) .
mixed effects models ( tables 4 , 5 , and 6 ) were performed for crp , il-6 , and ip-10 , adjusting for the following covariates : access type , coronary artery disease , sex , age , race , hd initiation , diabetes mellitus , infection , access thrombosis , and number of days after access surgery .
the adjusted models take into account every cytokine measurement and the corresponding vascular access type for each available period .
the presence of a tc was a significant predictor of an elevated crp ( p = 0.03 ) and ip-10 ( 0.03 ) .
il-6 levels also positively correlated with a tc , although this did not reach statistical significance , ( p = 0.07 ) .
the presence of an avg also significantly correlated with an elevated crp ( p = 0.01 ) and with ip-10 ( p = 0.07 ) , although the latter did not reach statistical significance .
additional predictors of an elevated crp were a history of cad ( p < 0.001 ) , female sex ( p = 0.04 ) , and the presence of infection ( p = 0.02 ) .
levels of crp decrease over time , with the highest value at 7 days after insertion compared to the crp values at 365 days ( p = 0.02 ) .
il-6 levels significantly correlated with infection ( p = 0.02 ) , and ip-10 levels were directly associated with diabetes mellitus ( 0.02 ) , male sex ( 0.01 ) , and hispanic ethnicity ( 0.04 ) . to compare the impact of tcs with other types of vascular access on inflammation
, we performed a sensitivity analysis in patients with a tc exclusively ( n = 24 ) and compared them to the combined group of avf / avg ( n = 24 ) .
tcs remained a predictor of a higher crp level , ( estimate = 0.29 , p = 0.055 ) .
there was no significant association with il-6 and ip 10 levels in the sensitivity analysis .
this study is unique in that baseline cytokine values were obtained before first access placement and prior to hd initiation , which permitted assessing the degree of preexisting inflammation for patients in each vascular access group and comparing baseline cytokine values to those obtained at multiple time periods after access insertion . the prospective study design allowed for recording all intercurrent events ,
because patients were enrolled upon initial access placement , we were able to exclude the problem of preexisting inflammation related to abandoned accesses .
finally , the association of elevated crp levels after initial avg insertion adds to the relative paucity of data on avgs and inflammation in the previously existing literature .
the findings of our study may also shade light on discrepancies between the hemo and other studies .
first , the hemodialysis study ( hemo ) included only patients who were on hd therapy longer than 3 months , whereas our data and others included incident hd patients .
[ 18 , 20 ] we observed , in an adjusted analysis , that crp levels are significantly elevated only in the first week following access surgery , but , similar to the hemo study , crp levels were not elevated at 1 month or other points throughout the following year . secondly ,
in the hemo study , avfs and avgs were combined into one av access
group for the analysis , which may have obscured differences between the av access and tc group and differences within the av access group ( avfs versus avgs ) .
we observed significantly higher crp values associated with avgs , not present with avfs .
our data are consistent with those of goldstein et al . who measured crp in 73 incident hd patients ( 50 noninfected tcs and 23 avfs ) .
the median crps at initiation of hd were significantly higher in the tc group ( 44 mg / l ) versus the avf group ( 5 mg / l ) ( p < 0.001 ) . unfortunately , patients with avgs were not included in this study .
other criticisms of this study were that only 2 crp measurements were taken over a 6-month period , other inflammatory markers were not measured , and information about comorbid illnesses was lacking .
recently reported a strong association of comorbidity and clinical events with inflammation in hd patients .
similar to the findings of the current study , these investigators reported that a comorbidity score ( including ischemic heart disease ) was among those factors that were significantly associated with variations in the crp .
they did not find a significant association between vascular access type and crp in this prevalent hd population ; however as was the case in the hemo study , avf and avgs were combined into the same access group for the analysis .
there was a significant direct association between female sex and elevated crp values in the present study , which was observed in a multivariate model adjusting for differences in vascular access type .
in which female sex was associated with lower crp values , also a multivariate model . a third study by goldstein et al .
snaedel et al . reported widely fluctuating crp values in 68% of patients , indicating that frequent serial crp measurements are superior to a single measurement .
these authors also studied other inflammatory cytokines , including plasma tumor necrosis factor- ( tnf- ) and interleukin-10 ( il-10 ) , which were not found to be significant predictors of outcome . a significant association exists between elevated proinflammatory cytokines and the presence of an avg .
we found significantly higher crp levels associated with the presence of avgs ( estimate = 0.47 , p < 0.001 ) and with tcs ( estimate = 0.26 , p = 0.03 ) relative to avfs , in an adjusted analysis .
these results differ somewhat with those previously reported by movilli et al . in that in our cohort of incident hd patients crp was highest in avg patients . in movilli 's study , which included a cohort of infection - free prevalent hd patients , tcs were associated with the highest crp values , although both tcs ( estimate = 0.88 , p = 0.0001 ) and avgs ( estimate = 0.26 , p = 0.043 ) were associated with significantly higher crp levels than avfs ( adjusted analysis ) .
it is possible that new avgs placed in incident hd patients are associated with a period of peak inflammation which dampens over time as the avg endothelializes , as was observed in the prevalent hd cohort .
the three - step hierarchy of access - associated inflammation ( tc > avg > avf ) reported in the movilli study closely mimics the relationship of mortality risk and vascular access type in the choice study [ 2 , 15 ] . the choices for healthy outcomes in caring for esrd ( choice ) study group reported an association of mortality and vascular access type in a cohort of incident hd patients .
in this study , the adjusted relative hazard of death was 1.5 ( 95% ci , 1.0 to 2.2 ) in patients using a tc and 1.2 ( 95% ci , 0.8 to 1.8 ) in those with an avg , relative to patients with an avf .
a recent study by perl et al . also reported an adjusted , time - dependent , relative hazard of death of 1.8 ( 95% ci , 1.61.9 ) in incident hd patients with a tc compared to pd patients or hd patients with an avf / avg .
as with the hemo study , because avg and avf are combined , the exclusive effect of avgs with 1-year mortality is obscured .
short of a randomized controlled trial , one may conclude that it is possible that vascular access - induced inflammation , independent of comorbidities and intercurrent illnesses , may be contributing to the excess mortality reported in tc and avg patients in the first months of hd .
we also report that ckd patients whose future initial vascular access is a tc or avg have preexisting heightened inflammatory state characterized by higher baseline crp levels , which is present prior to access surgery and hd initiation , relative to those receiving avfs .
this was found despite efforts to exclude patients from the study with preexisting inflammatory states .
patients in the tc and avg groups were older and consisted of more female and diabetic patients .
furthermore , the subjective global assessment ( sga ) scores were higher at baseline in the tc and avg groups .
patients in the avg group were also more anemic and had more esa use before access , possible reflecting a chronic inflammatory state . elevated baseline crp values that are present in avf and tc patients may have influenced the crp levels observed in these groups during the follow - up period .
ortega et al . studied crp values in 66 pre - hd patients who were followed up for 1 year .
mg / l , and 35% of patients had an elevated crp level ( > 6 mg / l ) .
high crp levels at baseline were predictive of a constant inflammatory state at followup . although an association of tc use and higher esa requirements was reported by goldstein et al . in a small cohort ( n = 50 ) , more recent data reported by the dialysis outcomes and practice patterns study ( dopps ) in november 2010 did not find a significant association between catheter use and esa dosing in over 2,500 patients , although there was a significant association between higher crp levels and greater esa dosing ( presented at the american society of nephrology renal week 2010 ) .
data exploring the association between esa and tc use is not available in the present study .
lastly , dialysis vintage has not been shown to correlate with inflammation in two previous studies or in the present study [ 18 , 23 ] .
the major limitations of this study are the small size of the trial and the limited follow - up period of 1 year .
the study was not powered using mortality as an outcome . due to the relative low mortality rate in our cohort , associations between baseline cytokine values and mortality were not observed .
we attribute the low mortality due to the predetermined inclusion criteria for this study . in an attempt to isolate the hd access from other potential mediators of inflammation we chose a select patient population , excluding unstable patients and those with active infection , autoimmune diseases , use of immune modulating medications , and malignancy . a large study in an incident pre - hd population , with a longer follow - up period , is needed to better elucidate relationships between the contribution of individual hd vascular access types to noninfectious inflammation and possible excess mortality . |
background .
the contribution of the hemodialysis ( hd ) vascular access type to inflammation is unclear . methods .
we conducted a prospective observational study in an incident hd population .
c - reactive protein ( crp ) , interleukin-6 ( il-6 ) , and interferon--induced protein ( ip-10 ) were measured before and at 6-time points after access placement for 1 year .
results .
sixty - four incident hd patients were included ( tunneled catheter ( tc ) , n = 40 , arteriovenous fistula ( avf ) , n = 14 , and arteriovenous graft ( avg ) , n = 10 ) .
a mixed effects model was performed to adjust for age , sex , race , coronary artery disease , diabetes mellitus , infections , access thrombosis , initiation of hd , and days after access surgery . in comparison to avfs
, the presence of a tc was associated with significantly higher levels of crp ( p = 0.03 ) , il-6 ( p = 0.07 ) , and ip-10 ( p = 0.03 ) .
the presence of an avg was associated with increases in crp ( p = 0.01 ) and ip-10 ( p = 0.07 ) .
conclusions . patients who initiate hd with a tc or an avg
have a heightened state of inflammation , which may contribute to the excess 90-day mortality after hd initiation . | 1. Introduction
2. Subjects and Methods
3. Statistical Analysis
4. Results
5. Multivariate Analyses
6. Discussion |
with the increased incidence of chronic renal failure , radiocontrast studies are important for diagnosis and treatment .
therefore , the use of iodinated radiocontrast media in computed tomography ( ct ) and angiography is often required in these patients [ 13 ] . the european society for urogenital radiology guidelines , which were published in 1999 , did not recommend hemodialysis ( hd ) after the use of iodinated radiocontrast media in continuous ambulatory peritoneal dialysis ( capd ) patients [ 46 ] . however , a few studies have addressed the peritoneal clearance and safety of iodinated radiocontrast media in capd patients [ 79 ] .
peritoneal dialysis ( pd ) is effective for removing iodinated radiocontrast media from the body , but it takes longer time than hd .
the accumulation or delayed elimination of iodinated radiocontrast media may cause adverse events in chronic dialysis patients with anuria or cardiovascular dysfunction .
several reports have demonstrated acute adverse events such as heat sensations , acute urticaria , and iododerma , and delayed reactions such as vasculitis , skin disorders , submandibular swelling , and sialoadenitis even with the use of low osmolar nonionic contrast media [ 2 , 7 , 1013 ] .
however , not much is known about the adverse events caused by delayed elimination . in this study
, we evaluated the clearance of iopamidol , a low osmolar nonionic iodinated radiocontrast media , and the incidence of adverse events associated with its use in capd patients .
between 2002 and 2009 , 50 patients who had undergone a total of 64 angiographic ct scans while receiving capd at the akita city hospital and the oyokyo kidney research institute were enrolled in the study ( figure 1 ) .
patients had been stabilized on capd for more than 6 months at the time of the study .
all patients received 1.75- to 2.75-l bags , with glucose concentrations of 1.5% or 2.5% , and four dialysate exchanges per day .
this study was conducted in accordance with the declaration of helsinki and was approved by the institutional ethical committee at the akita city hospital .
forty - four patients who underwent a total of 58 angiographic ct scans did not undergo hd treatment ( the non - hd group ) , and six patients who underwent six angiographic ct scans underwent hd treatment ( the immediate hd group ) .
all ct scans were performed for annual screening of renal cell carcinoma caused by acquired cystic kidney disease .
each patient received a 50 ml / body ( 0.94 0.21 ml / kg ) intravenous bolus dose of iopamidol 300 ( 612.4 mg / ml ) for angiographic ct .
blood samples were obtained from the 11 patients at the following times : 0.5 , 1 , 2 , 3 , 6 , 12 , 24 , 36 , 48 , 72 , and 96 h after iopamidol administration .
total dialysate and urine were collected every 24 h for the 4 days following administration .
all samples were stored at 20c , and the iopamidol concentrations in patient plasma , dialysate , and urine were measured .
samples were pretreated with 0.5 mol / l of perchloric acid , and , after centrifugation , the supernatant was filtered and measured .
iopamidol concentrations in plasma , dialysate , and urine were analyzed by inductively coupled plasma atomic emission spectrometry ( sps3000 , seiko instruments inc . ,
chiba , japan ) . for safety analysis , we observed patients for adverse events , serum creatinine ( crea ) , estimated glomerular filtration rate ( egfr ) , and urine volume for 3 months after the angiographic ct scan .
12.0 , chicago , ill , usa ) and microsoft excel ( microsoft corporation , redmond , wash .
datasets were compared with paired t test . a p value of < 0.05 was considered significant .
we could not evaluate p values in table 1 ( n = 6 ) and 2 ( n = 2 ) , because the statistical power is insufficient to detect significant differences in small numbers of patients .
the characteristics of 11 patients in the clearance study are shown in table 2 . the mean plasma concentration versus time curve showed the mean iopamidol half - life ( t1/2 ) of 33.3 9.67 h ( figure 2(a ) ) .
the plasma iopamidol elimination ratio was 83.6% 7.6% for 96 h ( figure 2(b ) ) .
the mean concentrations of iopamidol in dialysate and urine are shown in figures 2(c ) and 2(d ) .
two patients with urine volumes of > 400 ml were regarded as having residual renal function ( rrf ) .
iopamidol clearance from the plasma of patients with rrf ( rrf ( + ) ) and without rrf ( rrf ( ) ) is illustrated in figures 3(a ) and 3(b ) .
clearance from rrf ( ) patients was earlier on the first day , but the elimination rate at day 4 was delayed .
the elimination rates of rrf ( + ) patients and rrf ( ) patients were 93.7% 3.90% and 80.1% 5.88% at day 4 , respectively .
the clearance t1/2 of iopamidol in rrf ( + ) patients and rrf ( ) patients were 21.9 2.92 h and 35.8 8.71 h , respectively . reflecting the plasma concentration results , iopamidol concentrations in the dialysate of rrf ( ) patients were higher than those in rrf ( + ) patients at day 4 .
results showing the incidence of adverse events , crea , egfr , and urine volume after angiographic ct scans are illustrated in table 3 . in the non - hd group ,
no acute or delayed adverse events associated with iopamidol administration were observed in patients , regardless of whether they were classified as rrf ( + ) or rrf ( ) . on the other hand , of the six patients in the immediate hd group
, two patients showed adverse events ; one had a skin disorder , and the other had atrial fibrillation .
there were no difference in crea , egfr , and urine volume after the angiographic ct for 3 months in non - hd group , but we could not evaluate statistical difference in immediate hd group because of small number of patients .
iopamidol is a nonionic water - soluble radiographic contrast media with low osmolarity , low chemical toxicity , and absence of ionic charge .
this sets it apart from other available nonionic radiocontrast media , such as iomeprol , iohexol , ioversol , iopentol , and iopromide . in our study , pd effectively removed iopamidol from the body , but iopamidol elimination from patient plasma was remarkably prolonged for more than 4 days .
the clearance t1/2 and elimination rates were comparable to previous reports ; one reported 37.9 h and 75.2% , and the other reported 32.6 h and 84.4% [ 7 , 9 ] .
plasma iopamidol concentration and iopamidol in capd dialysate were lower in rrf ( ) patients at first day .
however , at day 4 , the elimination rates and the clearance t1/2 of iopamidol in rrf ( ) patients showed about 14% and 14 h delay compared with rrf ( + ) patients , respectively . although we could not conclude the efficacy of rrf for the elimination of radiocontrast media because of small number of patients , these results suggest that renal excretion is an important elimination pathway even in the end stage kidney .
we observed no significant difference in crea , egfr , and urine volume after the angiographic ct for 3 months with or without rrf in non - hd group ( table 3 ) .
although egfr is not suitable for evaluation of renal function in dialysis patients , this suggests radiocontrast media has small effects on end - stage kidney .
we could not evaluate statistical difference because of small number of patients ( n = 6 ) in immediate hd group .
during the course of this study , there were no adverse events in patients in the non - hd group , but two adverse events were observed in the immediate hd group .
this suggests that the risk of adverse events due to iopamidol in capd patients is low , indicating that the use of immediate hd does not produce any benefits . however , the mechanisms and risks of related adverse events due to delayed elimination of iopamidol are still not well known , and larger studies are necessary to address the safety .
reported a case of bilateral submandibular swelling possibly occurring 20 h after the injection of iopamidol , which resolved over the next 7 days .
one study showed that conventional 4-h hd therapy immediately after the use of iodinated radiocontrast media eliminated 80% of the media and that this may reduce the possible risks associated with delayed reactions [ 9 , 15 ] .
our results suggest that immediate hd is not necessary as there were no adverse events reported in the non - hd group .
furthermore , there were negative reports about the effects of hd therapy immediately after the use of iodinated radiocontrast media because it takes several hd sessions to eliminate them completely [ 16 , 17 ] .
one report suggested that 3 weeks are required to eliminate iodinated radiocontrast media completely by capd in the regular setting .
frequent dialysate exchange with very short cycles may more effectively remove it from capd patients ' circulation ; however , it does not produce any benefit .
this is due to slower peritoneal permeability of iodinated radiocontrast media resulting from their high molecular weight .
these investigations suggest a decreased necessity for scheduled hd or frequent exchange of dialysate after the use of iodinated radiocontrast media in capd patients because of a lower incidence ratio of adverse events . because of insufficient statistical power to detect significant differences in small number of patients
we believe that our observations will serve to increase understanding of the potential risks of iodinated radiocontrast media and also assist further prospective studies to further evaluate the efficacy and safety in capd patients .
our results suggest that iopamidol can be eliminated from patients by regular capd schedules , and the incidence of adverse events due to iopamidol in capd patients is low .
however , high levels of iodinated radiocontrast media in the circulation may remain for several days , and this may increase the general risk of adverse events .
adequate preparation and careful observation for adverse events are essential for the safe use of radiocontrast media . | although the characteristics and safety of radiocontrast media in peritoneal dialysis ( pd ) patients are not yet well defined , their use in pd patients is considered generally safe . in this study , we evaluated clearance and adverse events of iopamidol in pd patients .
we measured the iopamidol concentration in the plasma , dialysate , and urine of 11 patients .
iopamidol clearance from patient plasma was delayed with a half - life of 33.3 h , and the elimination ratio was 83.6% for 96 h. we retrospectively investigated adverse events occurring in a total of 50 stable pd patients who underwent a total of 64 angiographic computed tomography ( ct ) scans .
in 64 angiographic ct scans , two cases of adverse events were observed .
our results suggest that iopamidol can be eliminated by regular pd and careful observation for adverse events are necessary for the safe use of radiocontrast media . | 1. Introduction
2. Subjects and Methods
3. Results
4. Discussion
5. Conclusion |
traumatic brain injury ( tbi ) caused by motor vehicle accidents , firearms , and falls are recorded as a leading cause of death and lifelong disability among young adults.[14 ] the glasgow coma scale ( gcs ) has been extensively studied for its ability to predict outcomes in tbi patients .
representative tbis that could induce unconsciousness include intracranial hematoma , cerebral contusion and axonal injury .
patients with severe major injuries in two or more different sites , who require surgical intervention to stabilize vital signs may often experience cardiac arrest in the prehospital arena and thus display poor prognosis .
this institute , which is a 15-year - old level 1 urban trauma center in japan , has no record of any patients with blunt injury who were alive on arrival and required life - saving surgical operations for two different sites of injury , one of which was the head .
however , patients have been encountered who showed diffuse axonal injury ( dai ) and required insertion of a sensor into the intracranial space to control intracranial pressure , and also underwent a major operation for injuries at other sites .
no reports to date appear to have indicated characteristics of extracranial injuries in patients with dai .
the present study therefore retrospectively investigated the characteristics of extracranial injuries in patients with dai .
the study was conducted by reviewing medical records from january 2003 to december 2007 . in this study ,
dai was defined as present in a patient who showed no focal lesions and prolonged unconsciousness lasting 24 h. accordingly , to identify dai , the study included patients meeting the following criteria : 1 ) head injury without cerebral contusion > 1 cm on computed tomography ( ct ) , subdural hematoma , or epidural hematoma ; 2 ) gcs on arrival < 15 ; and 3 ) magnetic resonance imaging ( mri ) including t2 * -weighted imaging performed during hospitalization .
the study excluded patients meeting the following criteria : 1 ) age > 60 years or 2 ) death due to head injury .
subjects were divided into two groups : severe tbi group ( patients with gcs 8 ) and moderate tbi group ( patients with gcs > 8) . in this study ,
the term tbi was used in place of dai because some unconscious patients with tbi did not show any traumatic lesions on mri .
the following variables were analyzed between the severe tbi group : sex , age , mechanism of injury , incidence of skull fracture , gcs on arrival , systolic blood pressure , shock index ( i.e. , heart rate / systolic blood pressure ) , status of light reflex , abbreviated injury scale ( ais ) of the extracranial regions ( face , thorax , abdomen , extremities and external structures ) , sum of extracranial ais scores , value of arterial base excess ( base excess is defined as the amount of strong acid that must be added to each liter of fully oxygenated blood to return the ph to 7.40 at a temperature of 37c and a pco2 of 40 mmhg ) as measured by blood gas analysis on arrival ; presence of traumatic microbleeds detected by t2 * -weighted imaging , duration of hospitalization , and glasgow outcome score at 3 months after admission .
the ais is an anatomical scoring system in which injuries are ranked on a scale of 16 ( 1 , minor ; 2 , moderate ; 3 , serious ; 4 , severe ; 5 , critical ; 6 , unsurvivable injury ) . t2
* -weighted imaging was performed in the axial plane using the following parameters : repetition time , 900 ms ; echo time , 30 ms ; excitations , 2 ; flip angle , 200 ; matrix , 256 192 ; section thickness , 5 mm with a 2.5-mm gap , and imaging time , 2 min 56 s. all foci > 1 mm in diameter showing signal hypointensity on t2 * -weighted imaging were defined as traumatic microbleeds .
statistical analyses were performed using the unpaired student 's t - test and the test .
a total of 469 patients with head injury were admitted during the investigation period . of these ,
138 patients > 60 years old , 53 patients with cerebral herniation , and 100 patients with intracranial mass lesions due to cerebral contusion and/or intracranial hematoma were excluded . of the remaining 178 patients , 113 were alert on arrival and were excluded .
thirty - five of the remaining 65 patients showed persistent disturbance of consciousness for 24 h after admission and underwent mri , and were thus defined as subjects in this study ( the severe tbi group , n=19 ; the moderate tbi group , n=16 ) .
no significant differences were apparent between the two groups with regard to sex , age , mechanism of injury or incidence of skull fracture [ table 1 ] .
subject background data shock index was significantly higher in the severe tbi group than in the moderate tbi group , while base excess on arrival was lower in the severe tbi group than in the moderate tbi group [ table 2 ] .
physiological data and ais on arrival ais of the face , thorax , extremities and external structures showed no significant differences between the two groups , but ais of the abdomen and the sum of extracranial ais scores were higher in the severe tbi group than in the moderate tbi group [ table 3 ] .
four patients in the severe tbi group showed abdominal injury requiring surgery ( diaphragmatic rupture , n=2 ; splenic rupture , n=1 ; bladder rupture , n=1 ) , but the moderate tbi group included no such cases ( p=0.1 ) .
in addition , the severe tbi group included four patients with pelvic fractures , whereas the moderate tbi group had no such cases ( p=0.1 ) .
ais for extracranial injury on arrival the number of traumatic microbleeds detected by mri was higher in the severe tbi group than in the moderate tbi group [ table 4 ] .
duration of hospitalization was longer and outcomes were worse in the severe tbi group than in the moderate tbi group [ table 5 ] .
none of the remaining 434 patients with blunt trauma who were excluded from the study and were alive on arrival required life - saving surgery for two different sites of injury , one of which was the head .
only one of the patients excluded from the study showed dai and acute subdural hematoma requiring surgery , and underwent delayed repair for diaphragmatic rupture .
this study demonstrated that patients with severe tbi were more likely to have abdominal injury than patients with moderate tbi , representing the first investigation to report such a relationship .
the combination of head and abdominal injuries is usually rare , maybe because the abdomen is relatively far from the head compared to other regions , and is protected by the bony thorax and pelvis . as a result
, the abdomen and head might rarely receive the same high - energy impact at the same time .
dai forms when axons undergo rapid stretching as a result of angular acceleration , damaging the axonal cytoskeleton and resulting in a loss of elasticity and impairment of axoplasmic transport.[1215 ] subsequent swelling of the axon occurs with discrete bulb formations or elongated varicosities that accumulate transported proteins .
these swollen axons may become disconnected and contribute to additional neuropathological changes in brain tissue , resulting in the formation of dai .
dai occurs more frequently with force applied in the coronal plane , rather than in the sagittal or axial planes.[1518 ] the severity of dai depends on the energy of the impact .
two cases in the severe tbi group showed diaphragmatic rupture , induced when the body quickly decelerated while the organs continued to move downward or forward at a much higher velocity , tearing vessels and tissues from the normal points of attachment .
rapid changes in acceleration or deceleration to the head and abdomen , such as moving rapidly and then suddenly hitting the ground in a traffic accident or fall , could be associated with a rare combination of injuries to the head and abdomen .
shock index was higher in the severe tbi group than in the moderate tbi group in the current series , while base excess on arrival was lower in the severe tbi group than in the moderate tbi group .
in addition , no correlation has been observed between base excess and severity of head injury .
hemorrhaging from extracranial injuries in a patient with severe tbi tends to result in hemorrhagic shock following a reduction in base excess due to hypoperfusion of tissues , as severe tbi is obviously associated with more severe extracranial injuries than moderate tbi .
such hypotension could induce a second brain insult to the head injury , so hypotension may affect the outcomes in severe tbi .
the association seen between the number of traumatic microbleeds detected on mri and outcomes has also been reported in several previous studies .
tbi itself does not necessarily represent a medical emergency requiring treatment ; immediate concerns are amnesia ( a mild form of dai ) and damage to the brainstem ( a severe form of dai ) .
both these possibilities may be excluded in the present case , as we selected surviving patients with prolonged unconsciousness .
clinically , patients with amnesia could still complain of pain induced by any concomitant organ injury , so there is little chance of overlooking hidden injuries . in contrast , severe brainstem injuries can easily prove lethal by causing malfunctions in respiration and circulation .
patients with such injuries tend to present in a deeply comatose state , and thus may be more likely to have abdominal injuries in comparison with patients with severe tbi , as more severe unconsciousness was associated with a greater risk of the presence of abdominal injury according to the present results .
patients with severe tbi were more likely to have abdominal injuries when compared with patients showing moderate tbi .
hidden organ injuries could be missed because unconscious patients are unable to complain about injuries . from this retrospective study
, it appears that physicians should be aware of the possibility of such co - morbidities when treating severe dai .
patients with severe tbi are more likely to have abdominal injury than patients with moderate tbi .
physicians should thus be aware of the possibility of such complications when treating severe tbi . | background : characteristics of extracranial injury in patients with diffuse axonal injury ( dai ) have not been clarified.materials and methods : this retrospective study reviewed medical records from january 2003 to december 2007 .
subjects comprised 35 patients meeting the following criteria : 1 ) head injury without mass lesion ; 2 ) glasgow coma scale ( gcs ) on arrival < 15 ; and 3 ) magnetic resonance imaging ( mri ) examination including t2 * -weighted imaging .
subjects were divided into two groups : severe traumatic brain injury ( tbi ) group ( patients with gcs 8 , n=19 ) and moderate tbi group ( patients with gcs > 8 , n=16).results : shock index ( heart rate / systolic blood pressure ) was significantly higher in the severe tbi group than in the moderate tbi group , while base excess on arrival was significantly lower in the severe tbi group than in the moderate tbi group . the abbreviated injury scale ( ais ) for the face , thorax , extremities and external structures showed no significant differences between the severe tbi group , but ais for the abdomen and the sum of extracranial ais was greater in the severe tbi group than in the moderate tbi group .
duration of hospitalization was longer and outcomes were worse in the severe tbi group than in the moderate tbi group.conclusion:because patients with severe tbi are more likely to have abdominal injury than patients with moderate tbi , physicians should be aware of the potential for such complications when treating severe tbi . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUSION |
the subversionary thoughts of many researchers in the field of implants have resulted in an unprecedented rise of several implant surfaces and research .
the osteoblastic cell behavior acts as a yardstick to assess the success of such surfaces .
the quest for better osseointegration has not only fuelled the demand of more implant surfaces , but also has evoked interest in the field of nanotechnology . the extensive work by the swedish orthopedic surgeon p.i .
brnemark led to the discovery that commercially pure titanium , when placed in a suitably prepared site in the bone , could become fixed in place due to a close bond that developed between the two , a phenomenon that he later described as osseointegration .
the present studies have shown that the components of the initial healing cascade are on the nanometer scale , and the binding sites where they act are even smaller . the lamellar bone formed at the interface after an adequate healing phase exhibits nanostructures such as abundant collagen fibrils and apatite crystals .
there were many studies undertaken for improving the implant surface , but still more studies are needed to specify the ideal implant surface for better osseointegration and faster healing .
surface modifications are done on the surface substrate on endless applications , primarily to improve surface properties of the substrate , including binding , adhesion , corrosion , wear resistance , and scratch resistance .
coating is a controlled process at the nano level to significantly enhance the ability of a coating to improve surface properties .
nano coatings can be applied with chemical vapor deposition , pulse laser deposition , electron beam deposition , and electroplating each with its own advantages and disadvantages .
ultimately , the success and quality of nano coatings , on a given substrate , must be reliable and controlled .
it was hypothesized when the nano coatings stimulate the chemical composition of natural bone ; the nanometer surface features will enhance bone formation compared to materials with conventional ( or micron - scale ) surface features .
the recent studies have showcased the importance of nano network titanium dioxide coating on titanium surfaces to improve the osseointegration rate .
hence , the aim of the study was to comparatively analyze the in vitro cell adhesion between nano coated titanium dioxide , and calcium hydroxyapatite ( ha ) coated titanium samples .
in this study , the grade ii titanium samples were sectioned into 60 discs and grouped into three groups of 20 samples .
the nano particles of titanium dioxide and calcium ha were dispersed in 2% nafion anion exchange membrane and coated on to the surfaces of titanium discs .
the coated samples were then cultured with human osteoblastic sarcoma ( hos ) cells for 48 h and fixed with 2.5% glutaraldehyde .
the scanning electron microscopy ( sem ) analysis with fluoroscope microscopy was done to evaluate the cell adhesion .
the three groups of samples were the following :
group a - untreated machinedgroup b - titanium dioxide nano oxide coatedgroup c - calcium ha nano coated .
group a - untreated machined group b - titanium dioxide nano oxide coated group c - calcium ha nano coated .
it is the simplest method used to create thin films from solution using centrifugal force .
small amount of polymer solution ( or chemical solution ) was dropped onto spinning head ( mold or surface ) and depending on the evaporation kinetics and particle interaction with liquid - air interface , the morphology of the nano particle film can be controlled .
the nano particle islands nucleate and grow as a result of rapid early - stage evaporation producing a two - dimensional solution of nano particles at the liquid - air interface , provided there is a favorable particle - interface interaction
. two milliliter of 1% nafion anion - exchange membrane was dispersed along with 200 mg of tio2 nano particles for a period of 30 min .
the resultant mixture was drop casted on to the titanium disk of 6 mm diameter and 2 mm in thickness and kept for drying overnight .
the nano scale cavities present in the nafion membrane is able to hold the nano particles tightly .
nafion membrane consists of an equal distribution of sulfonate ion clusters of 40 ( 4 nm ) diameter held within a continuous fluorocarbon lattice and the clusters are interconnected by narrow channels of diameter 10 ( 1 nm ) [ figure 2 ] .
the architecture of nafion membrane the titanium discs were coated with spherical titanium dioxide nano particles by drop - casting method .
the formation of titanium dioxide nano particles , as well as their morphological dimensions in the sem study , demonstrated that the average size was from 100 to 150 nm with inter - particle distance , whereas the shapes were uniformed spherical [ figure 3 ] . the coated nano titanium dioxide sample and
the scanning electron microscopy of the nano titanium dioxide energy - dispersive x - ray ( edx ) spectroscopy ( eds or edx or edax ) is an analytical technique used for the elemental analysis or chemical characterization of a sample .
it relies on the investigation of the interaction of x - ray excitation and a sample .
its characterization capabilities are due in large part to the fundamental principle that when high energy electron or proton is focused on to an element , the movement of the electron from high energy outer shell to lower energy inner shell results in release of x - ray which is specific to a particular element and is recorded by an energy - dispersive spectrometer .
figure 4 shows even after 100 continuous cycles the nano tio2 is held tight on the titanium disk with the help of the nafion membrane .
the nano scale cavities present the nafion membrane is able to hold the nanoparticles tightly . even after 100 continuous cycles
the nano tio2 is held tight on the titanium disk with the help of the nafion membrane calcium hydroxyapatite nano particle coated samples .
the titanium discs were coated with calcium ha nano particles by drop - casting method .
the sem analysis showed that nano ha particles were having an appearance of needle - like crystal that characterizes ha crystals [ figures 5 and 6 ] .
nano calcium hydroxyapatite coated sample and scanning electron microscopy analysis of the sample energy dispersive spectroscopy for nano calcium hydroxyapatite particles cell adhesion test was performed with test materials nanoparticles - ( tio2 ) , nano particles - ( hap ) and control group of uncoated titanium disc .
hos cells were seeded on test materials at density of 1 104 cells / cm and incubated for 48 h at 37 + 1c under humidified atmosphere containing 5% co2 .
after 48 h cell - seeded the test materials and glass cover slips were fixed with 2.5% glutaraldehyde .
the dry specimen is usually mounted on a specimen stub using an adhesive such as epoxy resin or electrically conductive double - sided adhesive tape , and sputter - coated with gold before examination in the microscope .
the portion of the image that appears acceptably in focus is called the depth of field .
the first field of interest was chosen by automatically setting the specimens to a central position in the microscope .
the following consecutive micrograph was then taken in one direction . in this study , for each group , micrographs were taken , two micrographs before cell culture and two micrographs following cell culture .
it is the simplest method used to create thin films from solution using centrifugal force .
small amount of polymer solution ( or chemical solution ) was dropped onto spinning head ( mold or surface ) and depending on the evaporation kinetics and particle interaction with liquid - air interface , the morphology of the nano particle film can be controlled .
the nano particle islands nucleate and grow as a result of rapid early - stage evaporation producing a two - dimensional solution of nano particles at the liquid - air interface , provided there is a favorable particle - interface interaction
. two milliliter of 1% nafion anion - exchange membrane was dispersed along with 200 mg of tio2 nano particles for a period of 30 min .
the resultant mixture was drop casted on to the titanium disk of 6 mm diameter and 2 mm in thickness and kept for drying overnight .
the nano scale cavities present in the nafion membrane is able to hold the nano particles tightly .
nafion membrane consists of an equal distribution of sulfonate ion clusters of 40 ( 4 nm ) diameter held within a continuous fluorocarbon lattice and the clusters are interconnected by narrow channels of diameter 10 ( 1 nm ) [ figure 2 ] .
the titanium discs were coated with spherical titanium dioxide nano particles by drop - casting method .
the formation of titanium dioxide nano particles , as well as their morphological dimensions in the sem study , demonstrated that the average size was from 100 to 150 nm with inter - particle distance , whereas the shapes were uniformed spherical [ figure 3 ] . the coated nano titanium dioxide sample and the scanning electron microscopy of the nano titanium dioxide energy - dispersive x - ray ( edx ) spectroscopy ( eds or edx or edax ) is an analytical technique used for the elemental analysis or chemical characterization of a sample .
it relies on the investigation of the interaction of x - ray excitation and a sample .
its characterization capabilities are due in large part to the fundamental principle that when high energy electron or proton is focused on to an element , the movement of the electron from high energy outer shell to lower energy inner shell results in release of x - ray which is specific to a particular element and is recorded by an energy - dispersive spectrometer .
figure 4 shows even after 100 continuous cycles the nano tio2 is held tight on the titanium disk with the help of the nafion membrane .
the nano scale cavities present the nafion membrane is able to hold the nanoparticles tightly . even after 100 continuous cycles
the nano tio2 is held tight on the titanium disk with the help of the nafion membrane calcium hydroxyapatite nano particle coated samples .
the titanium discs were coated with calcium ha nano particles by drop - casting method .
the sem analysis showed that nano ha particles were having an appearance of needle - like crystal that characterizes ha crystals [ figures 5 and 6 ] .
nano calcium hydroxyapatite coated sample and scanning electron microscopy analysis of the sample energy dispersive spectroscopy for nano calcium hydroxyapatite particles
cell adhesion test was performed with test materials nanoparticles - ( tio2 ) , nano particles - ( hap ) and control group of uncoated titanium disc .
hos cells were seeded on test materials at density of 1 104 cells / cm and incubated for 48 h at 37 + 1c under humidified atmosphere containing 5% co2 .
after 48 h cell - seeded the test materials and glass cover slips were fixed with 2.5% glutaraldehyde .
the dry specimen is usually mounted on a specimen stub using an adhesive such as epoxy resin or electrically conductive double - sided adhesive tape , and sputter - coated with gold before examination in the microscope .
the portion of the image that appears acceptably in focus is called the depth of field .
the first field of interest was chosen by automatically setting the specimens to a central position in the microscope .
the following consecutive micrograph was then taken in one direction . in this study , for each group , micrographs were taken , two micrographs before cell culture and two micrographs following cell culture .
as compared to nano coated samples of ha and titanium dioxide , it showed less colonies of osteoblastic cell growth .
development of radiate cell filopodia was not that apparent as in the case of nano coated ha [ figure 7 ] .
scanning electron microscopy analysis showing osteoblastic cell adhesion for control the sem analysis showed that osteoblastic cell was deposited on the surfaces of nano coated ha .
it showed more filopodial attachments than the control and nano coated titanium surfaces [ figure 8 ] .
scanning electron microscopy analysis shows osteoblastic cell adhesion for nano calcium hydroxyapatite the sem analysis showed more osteoblastic colonies with characteristic cell morphology .
prominent looking osteoblastic cells were scattered throughout the sample and showed better adhesion as compared to control and nano coated ha group .
these cells have been observed to grow into the pores of the metal surface and form an extracellular matrix [ figure 9 ] .
scanning electron microscopy analysis shows osteoblastic cell adhesion for nano titanium dioxide the protein adsorption and fluorescence spectroscopy further confirmed that the titanium dioxide nano coated samples showed wider spread osteoblastic cell growth than the control and the calcium hydroxyapatite nano coated samples [ figure 10 ] .
fluorescence spectroscopy as seen in ( a ) control , ( b ) nano coated calcium hydroxide apatite and ( c ) nano coated titanium dioxide there was cell adhesion seen on all the samples .
sem analysis showed titanium dioxide nano particle coated samples having marked osteoblastic cell colonies as compared to control and ha nano particles coated samples .
the sem analysis showed that osteoblastic cell was deposited on the surfaces of nano coated ha .
it showed more filopodial attachments than the control and nano coated titanium surfaces [ figure 8 ] .
prominent looking osteoblastic cells were scattered throughout the sample and showed better adhesion as compared to control and nano coated ha group .
these cells have been observed to grow into the pores of the metal surface and form an extracellular matrix [ figure 9 ] .
the protein adsorption and fluorescence spectroscopy further confirmed that the titanium dioxide nano coated samples showed wider spread osteoblastic cell growth than the control and the calcium hydroxyapatite nano coated samples [ figure 10 ] .
fluorescence spectroscopy as seen in ( a ) control , ( b ) nano coated calcium hydroxide apatite and ( c ) nano coated titanium dioxide there was cell adhesion seen on all the samples .
sem analysis showed titanium dioxide nano particle coated samples having marked osteoblastic cell colonies as compared to control and ha nano particles coated samples .
in the past studies have shown substratum composition and microtopography are important factors influencing growth and differentiation of osteoblasts .
most commercially available oral implants are moderately rough on the micrometer scale , but no specific attention has been given to investigate an implant with nanostructures .
the present study was designed so as to foresee enhanced osseointegration on nano textured implant .
jger et al . in 2007 found that nanostructured surfaces enhance the surface area of biomaterials and promote cellular adherence .
zhao et al . in 2010 had compared nano topography with microtopography , and found the enhancement of multiple cell functions from the hierarchical micro / nano textured surfaces which lead to faster bone maturation around the titanium implants without compromising the bone mass .
in addition , the hierarchical micro / nano textured surfaces retained the mechanical interlocking ability of the micro topography thereby bonding well for osseointegration zhu et al . stated that porous structures at either micro- or sub - micrometer scale supply positive guidance cues for anchorage - dependent cells to attach , leading to enhanced cell attachment in contrast , the cells attached to a smooth titanium surface by focal contacts around their periphery but as predominant adhesion structures , send repulsive signals from the environment and lead to retraction of the filopodia back to the cell bodies .
the regulation of bone formation and resorption ( bone remodeling ) is affected in old age as a result of the decrease in the number of osteoblastic cells .
osteoblasts have demonstrated a biological dilemma where there exists an inverted correlation between proliferation and differentiation rates .
the bone mass , however , is smaller than that around the machined surface , due to the diminished osteoblastic proliferation . to compensate for the reduced rate of proliferation in the differentiating osteoblasts , the treatment of the cells with growth factors , e.g. ,
transforming growth factors , increasing binding sites that specifically stimulate their proliferation , may be a biological strategy . to improve the osseointegration and bone response to titanium implants ,
an enhanced proliferation and differentiation of undifferentiated mesenchymal cells , osteoprogenitor cells , and preosteoblasts into osteoblasts is necessary .
the adhesion of plasma proteins on the surface of titanium implants has been reported to play an essential role in the process of osseointegration .
the specific pattern of adsorbed proteins determines the type of tissue that will develop at the interface between the implanted material and the host cytokines have also been suggested to stimulate a deposition of cells with the capacity of regenerating the desired tissue ( liu et al .
it is among the few bioactive materials , meaning that it will support bone in growth and osseointegration when used in orthopedic , dental and maxillofacial applications .
ha nano coatings are most commonly applied to metallic implants like stainless steel or titanium alloys . in terms of cell adherence in this study ,
the nano ha have shown pronounced radiating filopodial attachments and better osteoblastic cell colonies than the control .
the property of hydroxyl apatite favors the formation of direct and strong bond between the implant and bone tissue . the ha coating ( ca10(po4 ) 6(oh ) 2 )
is considered as bioactive because of the sequence of events that results in precipitation of a cap rich layer on the implant material through a solid solution ion exchange at the implant bone interface .
the cap incorporated layer will gradually be developed , via octacalcium phosphate , in a biologically equivalent ha that will be incorporated in the developing bone .
ducheyne and cuckler in 1992 studied the synthetic form of ha due its similar composition to the mineral matrix of the bone .
hee lee and kim mentioned in his studies that fragmentation and breakdown of the ha coated layer and its mechanical instability leads to an acute inflammatory reaction .
barrere et al . stated that the surface roughness did not affect the development of the ha globules .
however , a rougher substrate allowed the final ha coating to remain on the surface , whereas a smoother substrate was not efficient for the anchorage of the final ha coating .
in this study , prominent looking osteoblastic cells were scattered throughout the sample and showed better adhesion as compared to control and nano coated ha group .
the topography and surface oxide layer of the implant can be altered by means of an electrochemical process called anodic oxidation .
it increases the tio2 surface layer and roughness thereby changing the characteristic of the oxide layer and makes it more biocompatible .
the process is similar to an electrochemical cell where , implant is placed in a suitable electrolytic solution and acts as the anode .
when a potential is applied , there is deposition of oxide film on the anode ( implant ) as a result of ionic transport of charge .
chiang et al . has demonstrated the formation of multilayer tio2 nano network on the titanium surface using a simple electrochemical anodization treatment .
this network layer significantly improved in vitro and in vivo human mesenchymal stem cells ( hmsc ) growth , as assessed by measurement of green fluorescent protein fluorescence , relative to hmsc growth on untreated ti surface .
for successful cell growth , tio2 nanotubes with lateral openings 3050 nm in diameter are critical , as it favors integrin clustering and the formation of focal adhesion complexes .
it is among the few bioactive materials , meaning that it will support bone in growth and osseointegration when used in orthopedic , dental and maxillofacial applications .
ha nano coatings are most commonly applied to metallic implants like stainless steel or titanium alloys . in terms of cell adherence in this study ,
the nano ha have shown pronounced radiating filopodial attachments and better osteoblastic cell colonies than the control .
the property of hydroxyl apatite favors the formation of direct and strong bond between the implant and bone tissue . the ha coating ( ca10(po4 ) 6(oh ) 2 ) is considered as bioactive because of the sequence of events that results in precipitation of a cap rich layer on the implant material through a solid solution ion exchange at the implant bone interface .
the cap incorporated layer will gradually be developed , via octacalcium phosphate , in a biologically equivalent ha that will be incorporated in the developing bone .
ducheyne and cuckler in 1992 studied the synthetic form of ha due its similar composition to the mineral matrix of the bone .
hee lee and kim mentioned in his studies that fragmentation and breakdown of the ha coated layer and its mechanical instability leads to an acute inflammatory reaction .
barrere et al . stated that the surface roughness did not affect the development of the ha globules .
however , a rougher substrate allowed the final ha coating to remain on the surface , whereas a smoother substrate was not efficient for the anchorage of the final ha coating .
in this study , prominent looking osteoblastic cells were scattered throughout the sample and showed better adhesion as compared to control and nano coated ha group .
the topography and surface oxide layer of the implant can be altered by means of an electrochemical process called anodic oxidation .
it increases the tio2 surface layer and roughness thereby changing the characteristic of the oxide layer and makes it more biocompatible .
the process is similar to an electrochemical cell where , implant is placed in a suitable electrolytic solution and acts as the anode . when a potential is applied , there is deposition of oxide film on the anode ( implant ) as a result of ionic transport of charge .
chiang et al . has demonstrated the formation of multilayer tio2 nano network on the titanium surface using a simple electrochemical anodization treatment .
this network layer significantly improved in vitro and in vivo human mesenchymal stem cells ( hmsc ) growth , as assessed by measurement of green fluorescent protein fluorescence , relative to hmsc growth on untreated ti surface .
for successful cell growth , tio2 nanotubes with lateral openings 3050 nm in diameter are critical , as it favors integrin clustering and the formation of focal adhesion complexes .
the cell adhesion seen in simple machined samples were having less spreading of the human osteoblastic cells and had fewer osteoblastic cell coloniesthe cell adhesion seen in nano calcium ha coated sample was having more and distinct spreading of cells .
however , they had fewer osteoblastic cell coloniesthe cell adhesion seen in nano titanium dioxide coated samples were showing more prominent looking osteoblastic cells were scattered throughout the sample and showed better adhesion as compared to control and nano coated ha group .
the cell adhesion seen in simple machined samples were having less spreading of the human osteoblastic cells and had fewer osteoblastic cell colonies the cell adhesion seen in nano calcium ha coated sample was having more and distinct spreading of cells .
however , they had fewer osteoblastic cell colonies the cell adhesion seen in nano titanium dioxide coated samples were showing more prominent looking osteoblastic cells were scattered throughout the sample and showed better adhesion as compared to control and nano coated ha group . | aim : the aim of the study was to comparatively analyze the in vitro cell adhesion between nano coated titanium dioxide , and calcium hydroxyapatite ( ha ) coated titanium samples.materials and methods : nano coated titanium dioxide , and calcium ha were coated onto the titanium samples by drop casting with nafion membrane and cell culture was done by seeding human osteoblastic sarcoma cells on the coated samples.results and conclusion : there was marked cell adhesion seen in the samples coated by titanium dioxide nano particles and more cells spreading as compared to calcium ha nano particles . | INTRODUCTION
MATERIALS AND METHODS
Coating of nano particles of titanium dioxide and hydroxyapatite
Titanium dioxide nano particle coated samples
Elemental analysis of the coated titanium dioxide
Cell culture
Scanning electron microscope: Analysis
RESULTS
Calcium hydroxyapatite nano particles with osteoblastic cell growth
Titanium dioxide nano particle samples with osteoblastic cell growth
Fluorescence microscopy
DISCUSSION
Nano calcium hydroxyapatite coated titanium surfaces
Nano titanium dioxide coated titanium samples
CONCLUSION |
recently , endoscopic papillotomy ( e.p.t . ) has achieved wide acceptance as an alternative to surgery for the management of choledocholithiasis . however , there are several of problems , one of which relates to the size of the stone .
a stone larger than 2.5 cm in diameter has been regarded as a contraindication of endoscopic papillotomy due to complications and frequent failures . a new method in which the stone is partially crushed in place and then extracted has been developed and has been successfully used on large stones .
we experienced a patient who had a cholecystectomy and presented with a very large stone ( 6 2 2 cm ) ( fig .
although endoscopic papillotomy was contraindicated in this case , it was performed with the usual lithotripter , because the patient refused surgery .
a 34 year - old man was admitted to the department of internal medicine complaining of a colicky right - upper abdominal pain accompanied by chills and fever of 2 days duration .
he was healthy until 5 months earlier when he experienced the abrupt onset of right - upper abdominal pain accompanied by mildly icteric sclera . under the impression of postcholecystectomy syndrome ,
endoscopic retrograde cholangiopancreatography was performed which revealed a large stone in the distal common bile duct .
endoscopic papillotomy and irrigation of common bile duct were done in the endoscopic room at that time .
thereafter he was healthy until 2 days prior to his present admission , when right - upper abdominal pain accompanied by chills , fever and cold sweats recurred .
all vital signs were within normal limits except body temperature which was 38c . on physical examination his sclera was icteric , the hepatic edge was not palpable and no other abnormal findings were noted .
laboratory data included wbc 11,600 with 76% neutrophils ; alkaline phosphatase , 21.6 ka / u ( normal 2.710 ) ; serum asparate aminotransferase ( got / gpt ) , 351/318 iu./l ; and total bililubin / direct bililubin 3.7/1.5 mg / dl .
initially the patient s condition was diagnosed as obstructive jaundice with cholangitis . on the 2nd hospital day
, endoscopic retrograde cholangiography was performed revealing a large stone ( 622.0 ) ( fig .
1 ) in the common bile duct which was partially removed by endoscopic papillotomy and lithotripsy with irrigation . 4 days later , right - upper abdominal pain returned and a follow - up e.r.c.p . showed a large stone ( 333 ) impacted in the orifice of the papillotomy site ( fig .
after widening the papilla by cauterization and incision a wire was inserted through the papillotomy site into the bile duct , and by repeated crushing and extraction the remaining stones were removed ( fig .
3 ) . the e.r.c.p . performed 2 days after those procedures showed air bubbles in the common bile duct but no definite stone shadows were visualized ( fig .
the development of endoscopic retrograde cholangiography as a diagnostic tool for biliary tract and pancreatic disease , has resulted in nonsurgical treatment for diseases of the biliary tract ( 14 , 8) . since endoscopic papillotomy was performed succefully in 1973(9 ) ,
it has also contributed to the therapeutic procedures for common bile duct stone and papillary stenosis .
the main indication for endoscopic papillotomy is the extraction of common bile duct stones from cholecystectomized elderly or high risk patients .
however , endoscopy should not be routinely performed in patients with common bile duct stones larger than 2.5 cm in diameter because of complications and frequent failures ( 5 , 6 ) .
following papillotomy the majority of common bile duct stones were extracted with the aid of a basket or passed spontaneously ( 6 ) , but more than 10% of the stone were not extracted easily due to their large size or a narrowing of the bile duct above the papilla . although there is a report that some large stones may pass spontaneously ( 10 , 11 ) , most can not be extracted despite a large papillotomy which may result in complications . to overcome these problems , nonsurgical mechanical procedures such as electrohydraulic lithotripsy , dissolution therapy , and lithotripter have been developed with varing sucess(12 ) .
while ejectrohydraulic lithotripsy and dissolution therapy have failed to gain wide acceptance because of technical problems and adverse reactions(13 , 14 ) , mechanical lithotripsy has proved to be of value(14 , 15 ) . presently some centers report a high suscess rate(97% ) with few complications using this method(12 ) .
it is difficult to conclude that the endoscopic papillotomy is always more effective than surgical procedures for the treatment of common bile duct stones ( including large ones ) , but it has definite advantages in some selected cases . | a previously cholecystectomized man presented on endoscopic retrograde cholangiography with a large stone ( 622 cm ) in the common bile duct.the patient refused surgical removal of the stone , so although endoscopic papillotomy was contrainicated , it was attempted .
herein is presented a case report of successful removal of a large stone by endoscopic papillotomy and lithotripsy with no significant complications . | INTRODUCTION
REPORT OF CASE
DISCUSSION |
massively parallel sequencing , also called next - generation sequencing , has dramatically lowered the cost of genomic sequencing for multiple genetic conditions . best ethical and clinical practice for clinical diagnostic testing using traditional targeted sequencing technologies requires obtaining informed consent and ensuring the availability of genetic counseling . testing for specific genetic conditions using massively parallel sequencing
poses new challenges in terms of ensuring that informed consent is obtained because testing may discover off - target genetic conditions , known as incidental findings ( ifs ) .
the american college of medical genetics and genomics ( acmg ) recently published recommendations proposing the mandated clinical reporting of ifs for 24 autosomal dominant ( ad ) ( including one semidominant ) conditions .
these conditions were selected because they are highly penetrant , asymptomatic for long periods of time , and amenable to preventive measures and/or treatments .
controversially , the acmg recommended that genetic identification of the 24 conditions be sought and reported without reference to patient preferences both because of the high potential benefit to patients and because individual informed consent seemed logistically unfeasible . in its policy statement
the acmg predicted 1% of sequencing reports will include an incidental variant from the list of 24 .
other authors applied the acmg recommendations to various data sets and found rates of ifs varying from 1.2 to 11% .
we describe a simple mathematical model that calculates the rate at which ad ifs would occur in a data set or a population .
our model is based on binomial distribution , and input requires only an estimate ( or range of estimates ) of gene frequencies of variants ( including mutations ) .
we then validated the model by comparing its predicted rates of ifs with those found from other data sets . assuming that exome and whole - genome sequencing becomes increasingly routine , it is likely that the lists of recommended conditions to be reported will expand .
the acmg has recommended that only variants highly likely to be pathogenic be included among the genes for which reporting is mandatory . as the establishment of reference databases of variation continues to expand ,
new variants are being found and the classification of variants into pathogenic versus nonpathogenic is continuing to change .
we used our model to study the effects of increasing the number of ad conditions included .
we also used our model to predict how changes in the frequencies of variants , or of variants of unknown significance ( vus ) , might affect the rates of reporting of ifs ; finally , we define the theoretical limits of rates of reporting of ifs .
p(x ) represents the probability of reporting at least one if , and p1 to pn are the pathogenic variant frequencies of the various genetic conditions .
for those conditions for which variant prevalence data were not available , we estimated them by assuming they were the same as the observed disease prevalence with 100% penetrance .
variations in penetrance were addressed by sensitivity analysis over a range of variant rates ( described below ) .
a diagnostic panel was constructed in silico based on the 24 acmg - recommended minimum list of genes to be reported .
prevalence data were obtained from the literature ( table 1 ) . when a range of prevalence data was available , the lowest and highest values were selected , and the most likely estimate was calculated as the geometric mean .
alternatively , when only a single datum was available , half and twice this prevalence were selected as the low and high estimates , respectively .
the predicted rate of ifs was calculated by applying these gene frequencies ( table 1 ) to our model ( eq .
calculations were repeated separately for the lower and higher limits . to simulate the effect of altering variant prevalence rates ( because of changes in variant classification , variations in disease penetrance , inaccuracies in the literature data , or differences in populations ) , we performed sensitivity analysis by repeating our calculations over a range of three log2 orders of magnitude of variant frequencies , using one - quarter or one - half the lower or twice the upper reported estimates of prevalence for all conditions in table 1
. this simulation would also account for errors in sequencing or incorrect annotations in variant databases resulting in incorrectly calling variants pathogenic , nonpathogenic , or vus .
the range of values was chosen to cover the range of described inaccuracies of current variant databases . to calculate the increase in reporting frequency that occurs with the inclusion of additional conditions
we then successively considered including only the most common condition , the two most common conditions , the three most common conditions , and so forth , until all conditions were included for the calculation of the cumulative frequency of predicted significant findings . to determine the incremental contribution of each additional condition tested to the overall rate of findings , we calculated the percentage difference between the predicted frequency of findings for the first n most common conditions and the ( n + 1 ) next most common condition .
we identified the value of n at which there was less than a 1% relative increase in findings , as well as the value of n at which the relative increase in findings was less than 0.1% . to simulate the effect of further increasing the number of included conditions in some future panel of recommended reporting conditions
we allocated each of the conditions examined into one of 10 bins based on orders of magnitude of variant frequency ; these bins ranged from 2 , 1 , 0.1 , 0.01 , and 0.001 down to 10% .
each condition was initially assigned to the bin with the closest frequency that it did not exceed ( to produce a maximum estimate ) , and then each was assigned to the bin with closest frequency that it did exceed ( to produce a minimum estimate ) .
we repeated the in silico simulation of all conditions in table 1 to validate the modification of the model .
we then observed the effects of changing the number of conditions in each variant frequency bin .
p(x ) represents the probability of reporting at least one if , and p1 to pn are the pathogenic variant frequencies of the various genetic conditions .
for those conditions for which variant prevalence data were not available , we estimated them by assuming they were the same as the observed disease prevalence with 100% penetrance .
variations in penetrance were addressed by sensitivity analysis over a range of variant rates ( described below ) .
a diagnostic panel was constructed in silico based on the 24 acmg - recommended minimum list of genes to be reported .
prevalence data were obtained from the literature ( table 1 ) . when a range of prevalence data was available , the lowest and highest values were selected , and the most likely estimate was calculated as the geometric mean .
alternatively , when only a single datum was available , half and twice this prevalence were selected as the low and high estimates , respectively .
the predicted rate of ifs was calculated by applying these gene frequencies ( table 1 ) to our model ( eq .
to simulate the effect of altering variant prevalence rates ( because of changes in variant classification , variations in disease penetrance , inaccuracies in the literature data , or differences in populations ) , we performed sensitivity analysis by repeating our calculations over a range of three log2 orders of magnitude of variant frequencies , using one - quarter or one - half the lower or twice the upper reported estimates of prevalence for all conditions in table 1 .
this simulation would also account for errors in sequencing or incorrect annotations in variant databases resulting in incorrectly calling variants pathogenic , nonpathogenic , or vus .
the range of values was chosen to cover the range of described inaccuracies of current variant databases .
to calculate the increase in reporting frequency that occurs with the inclusion of additional conditions , we first ordered the list of variant frequencies from most to least frequent .
we then successively considered including only the most common condition , the two most common conditions , the three most common conditions , and so forth , until all conditions were included for the calculation of the cumulative frequency of predicted significant findings . to determine the incremental contribution of each additional condition tested to the overall rate of findings , we calculated the percentage difference between the predicted frequency of findings for the first n most common conditions and the ( n + 1 ) next most common condition .
we identified the value of n at which there was less than a 1% relative increase in findings , as well as the value of n at which the relative increase in findings was less than 0.1% . to simulate the effect of further increasing the number of included conditions in some future panel of recommended reporting conditions
we allocated each of the conditions examined into one of 10 bins based on orders of magnitude of variant frequency ; these bins ranged from 2 , 1 , 0.1 , 0.01 , and 0.001 down to 10% .
each condition was initially assigned to the bin with the closest frequency that it did not exceed ( to produce a maximum estimate ) , and then each was assigned to the bin with closest frequency that it did exceed ( to produce a minimum estimate ) .
we repeated the in silico simulation of all conditions in table 1 to validate the modification of the model .
we then observed the effects of changing the number of conditions in each variant frequency bin .
applying our model to the proposed acmg - recommended screening panel of 24 conditions ( table 1 ) , we calculated that ~2.7% ( range : 1.56.5% ) of screened individuals would have an if ( tables 2 and 3 ) .
we considered the impact of ifs on the rate of reporting if variant frequencies were to change or if there were sequencing errors or errors in the subsequent bioinformatics analyses and database annotations . for each condition in table 1 , we repeated our calculations by assuming the highest and lowest variant prevalence rates were incorrect by a factor of two or four ( figure 1 and tables 2 and 3 ) .
we studied the effects of increasing the number of tested ad conditions on the predicted number of ifs reported . commencing with the one condition in the acmg list with the highest variant prevalence
, we simulated the effects of testing for only that one condition , or for that condition plus the next most prevalent condition , or for those two conditions plus the next most prevalent condition , and so on , until all 24 conditions were included .
the resulting rates of ifs and the marginal increase in ifs with each addition to the number of conditions tested are shown in figure 2 . using only the seven genes with the highest variant prevalence of the 24 genes recommended for mandatory reporting contributed 97% toward the total number of predicted ifs ; including the 11 most prevalent of the 24 genes contributed 99% , and by the time 19 of the 24 genes had been considered , more than 99.9% of all ifs discoverable with the full acmg list
would have been reported . to generalize our understanding of the rate at which significant findings will be reported as the number of conditions being considered
is increased , we modified our model slightly by introducing bins of logarithmic variant frequencies .
this modification did not significantly change our calculation of the rate of ifs for the acmg panel of ad conditions : the range of ifs predicted by our original model ( 1.56.5% ; table 1 ) became 1.56.3% using the binned model . however , using the binned model , we were able to simulate the effect of introducing additional conditions .
we found that increasing the number of conditions being considered had very different effects , depending on the variant frequencies of those conditions . adding only a small number of conditions with high variant frequencies ( > 0.1% ) has a large effect on the number of ifs .
by contrast , the addition of 100 conditions with variant frequency of ~10 , or even 1,000 conditions with variant frequency of ~10 , did not have as large an effect on the number of ifs ( figure 3 ) .
applying our model to the proposed acmg - recommended screening panel of 24 conditions ( table 1 ) , we calculated that ~2.7% ( range : 1.56.5% ) of screened individuals would have an if ( tables 2 and 3 ) .
we considered the impact of ifs on the rate of reporting if variant frequencies were to change or if there were sequencing errors or errors in the subsequent bioinformatics analyses and database annotations . for each condition in table 1 , we repeated our calculations by assuming the highest and lowest variant prevalence rates were incorrect by a factor of two or four ( figure 1 and tables 2 and 3 ) .
we studied the effects of increasing the number of tested ad conditions on the predicted number of ifs reported . commencing with the one condition in the acmg list with the highest variant prevalence
, we simulated the effects of testing for only that one condition , or for that condition plus the next most prevalent condition , or for those two conditions plus the next most prevalent condition , and so on , until all 24 conditions were included .
the resulting rates of ifs and the marginal increase in ifs with each addition to the number of conditions tested are shown in figure 2 . using only the seven genes with the highest variant prevalence of the 24 genes recommended for mandatory reporting contributed 97% toward the total number of predicted ifs ; including the 11 most prevalent of the 24 genes contributed 99% , and by the time 19 of the 24 genes had been considered , more than 99.9% of all ifs discoverable with the full acmg list
would have been reported . to generalize our understanding of the rate at which significant findings will be reported as the number of conditions being considered
is increased , we modified our model slightly by introducing bins of logarithmic variant frequencies .
this modification did not significantly change our calculation of the rate of ifs for the acmg panel of ad conditions : the range of ifs predicted by our original model ( 1.56.5% ; table 1 ) became 1.56.3% using the binned model . however , using the binned model , we were able to simulate the effect of introducing additional conditions .
we found that increasing the number of conditions being considered had very different effects , depending on the variant frequencies of those conditions . adding only a small number of conditions with high variant frequencies ( > 0.1% ) has a large effect on the number of ifs .
by contrast , the addition of 100 conditions with variant frequency of ~10 , or even 1,000 conditions with variant frequency of ~10 , did not have as large an effect on the number of ifs ( figure 3 ) .
massively parallel sequencing technologies will greatly increase the number of genetic diagnoses made primarily through laboratory testing .
high rates of reporting of significant genetic findings will result in downstream costs to and impact on the health system because of the need for genetic counseling , confirmatory testing , medical consultation , and potential intervention .
however , the individuals identified may derive significant benefit from identification of these findings , and the high rates of reporting may ultimately provide cost benefits through improved screening and early medical intervention .
the costs to implement the recommendations need to be compared with the potential benefits , cost offsets , and utility of reporting and acting on these findings .
we have developed a model to simulate the impact of changes in variant frequencies and classification and of expanding the list of conditions recommended for mandatory reporting .
the impact of expanding the list of conditions for reporting can also be considered a model to demonstrate the impact of reporting vus in addition to pathogenic mutations .
we used this model to explore the likely impact of expanded testing on the rates of diagnoses of ad conditions ( and especially ifs ) .
the implementation of the acmg recommendations for clinical reporting of incidental findings suggested only a modest increase in the use of health system resources , with an estimated if frequency of ~1% .
recent studies by others have begun to explore these implications , initially by applying the acmg recommendations to various large data sets .
these studies suggest that the rate of ifs may be higher than originally anticipated but that some of this increase may be artifactual because of measurement uncertainty in the sequencing or bioinformatics phases , or even the incorrect classification of pathogenicity .
our modeling of the acmg recommendations for clinical reporting of incidental findings confirms that a nontrivial percentage ( 1.56.5% ) of screened individuals will have a significant reportable finding ( tables 2 and 3 ) .
although slightly higher than the value of ~1% ifs originally forecast by the acmg , it is in broad agreement with experimental values of 1.2% ( americans with african ancestry ) and 3.4% ( americans with european ancestry ) . this value is lower than those found by xue et al . , who reported a rate of ifs of 11% among 179 individuals from the 1000 genomes project , and by cassa et al . , who reported a rate of 8.5% from a set of 1,092 individuals drawn from various studies in the literature
however , both these studies included in their data sets a wider range of inheritance modes than those considered in our model .
the acmg recommendations were based on an ad mode of inheritance , whereas xue et al .
included both ad and homozygous autosomal recessive conditions in their calculations . if one corrects the findings of xue et al . to include only ad inherited conditions ( as listed in their table 2 ) , a revised rate of ifs of 6.9% is obtained ; further reduction in their rate of ifs
included yet more conditions , some of which ( e.g. , loose anagen hair syndrome ) were pathogenic but had significantly less serious consequences to patients and some of which were disease - causing variants from databases that were incompletely validated . noting these qualifications of xue et al .
, their adjusted rate of ifs of 6.9% is consistent with the upper limit of 6.5% predicted by our model .
similarly included in their study a broader range of conditions and inheritance modes ( and thus diagnostic triggers for reporting an if ) than the specific set of 24 conditions defined in the acmg recommendations ; ~24% of their reported conditions were homozygous minor variants . to make their data more comparable with the ad recommendations of the acmg , correcting their findings by excluding these 24% homozygous variants obtained a revised rate of ifs of 6.5% , and further reduction in their rate of ifs might be appropriate by noting their conclusions that at least some of the variants detected may be erroneous findings or have lower penetrance than previously expected .
again , this revised rate of 6.5% is consistent with the upper limit predicted by our model .
we conclude that our base model is fit for the purpose of describing the expected rates of ifs .
however , we note the many cautions expressed by these investigators regarding erroneous reports and the source of possible errors , and we used our model to explore the significance of these factors .
information about the population frequencies of rare conditions is necessarily limited , and calculations based on such limited information must be regarded with caution .
most of the estimates of variant frequency for these rare conditions are based on the prevalence of a particular disorder in a population , rather than the prevalence of pathogenic allelic variants for that condition . because our model relies on estimated rates of variants of these genetic conditions rather than prevalence of the conditions themselves , we must rely on some implicit assumptions . to derive rates of variant prevalence from rates of condition prevalence , our calculations assume 100% penetrance , 100% identification of causative variants ( sensitivity ) , and 100% specificity . in reality , these assumptions are unlikely to hold true .
for example , the degree of penetrance and expressivity , and thus the true variant frequency , is not known for many genetic conditions ; this would lead to an incorrect estimation of the predicted number of ifs .
some conditions ( such as malignant hyperthermia ) may manifest themselves only after a rare environmental event , and should this event not be encountered during the life of the individual , then the true incidence of these conditions will be underestimated .
furthermore , diseases such as these , which have had their genetic basis determined by sequencing high - risk patients and looking for the common themes , are likely to overestimate the penetrance of the associated genetic cause . finally , because some pathogenic phenotypes will be due to genetic variations not yet described or currently considered vus , estimation of the number of reported ifs will contain additional imprecision .
even experts may disagree when clinical cases are reviewed : manual curation is time consuming and , even then , what is actionable may not always be agreed on . to attempt to account for these various uncertainties in the estimates
we studied the effect on the predicted rate of ifs by varying the estimated prevalence of all conditions over a range of values .
we chose factors of two- and fourfold increase above or decrease below the most likely values ; this range would be sufficient to encompass reported alterations in misclassifications of variants in major databases . as noted by johnston et al .
, when the goal is to identify only variations likely to be causative and to minimize false positives , laboratory and bioinformatics decisions need to make a trade - off between diagnostic sensitivity and specificity because small variations in the diagnostic decision matrix will greatly affect the apparent rate of ifs .
we found that the rate at which ifs are reported is highly dependent on the actual clinical prevalence of the condition and the prevalence of pathogenic variants for that gene ( figure 1 ) . adding to this uncertainty , the analytical processes involved in massively parallel sequencing / whole - genome sequencing are not error free .
sequencing errors , variations in bioinformatics assembly and pipelines , and limitations , inadequacies , or errors in the annotations of current databases all introduce significant measurement uncertainty and analytical error , which can lead to over- or underreporting of ifs .
figure 1 shows that errors in sequencing and in bioinformatics analysis after sequencing , errors in database annotations , and difficulties in determining the true incidence of disease and the true prevalence of pathogenic variants all are major determinants of the rate of ifs .
when other parameters are held constant , a 4-fold change in the value of any one of these key drivers can produce up to a 10-fold difference in the rate of ifs ( tables 2 and 3 ) .
although the number of ifs reported will increase as the number of tested conditions increases , our modeling suggests this increase is not linear .
this nonlinearity is partly because of the underlying mathematics of the binomial calculations used in the model and partly because ( we assume ) the most common monogenic , ad , highly penetrant conditions have already been identified and included .
a consequence of this nonlinear behavior is that there is a diminishing marginal increase in reported ifs as more conditions are added . from the acmg - recommended list of 24 conditions , those with the highest variant frequencies contribute between 99 and 99.9% ( the top 11 and 19 conditions ,
we modeled the effects of expanding the list of conditions tested by adding more ad conditions .
we found that the most significant driver of the rate of ifs is not the number of additional conditions per se ( figure 2 ) but rather the variant frequency of the most common of these additional conditions ( figure 3 ) .
if we assume that the current acmg list already contains the most frequent of the ad conditions to be considered , then expanding the list to 100 or even 1,000 additional conditions only modestly increases the rate of ifs .
however , adding even a single condition whose variant frequency is of the order of 1% sharply increases the number of ifs .
these effects of variant frequencies on increasing numbers of ifs can also be used to model the effect of reporting vus for these conditions .
we developed and validated a simple model that allows the effects of various lists of ad conditions to be simulated and allows the rates of reporting of ifs and genetic carriers to be readily estimated .
our model shows that these rates are highly dependent on the apparent prevalence of included conditions , the actual prevalence of the genetic variants that cause these conditions , and the accuracy and quality of the sequencing and bioinformatics analyses .
this study has two key findings : ( i ) the accuracy of variant annotation of the underlying genomic databases is a significant factor in the proportion of individuals who will be flagged with a reportable finding .
( ii ) the proportion of individuals with ifs rapidly becomes asymptotic and self - limiting , even with the addition of many more highly penetrant ad condition / gene pairs to the list of reportable findings .
the major benefits in identifying the most clinically significant ifs may be achieved by including as few as 11 ( for 99% benefits ) or 19 ( for 99.9% benefits ) of the currently recommended acmg panel of 24 conditions . however , although the proportion of individuals with ifs may become limiting and constant , different challenges will emerge as the range of potential condition / gene pairs is expanded .
these will include issues such as the need for clinicians to be familiar with an ever - widening corpus of knowledge and information and the assessment of cost / utility of testing for this broadening range of conditions balanced by the availability , cost , and complexity of potential therapeutic options that may in turn be offset by a reduction in later costs through early intervention and disease prevention .
the implementation of the acmg recommendations for clinical reporting of incidental findings suggested only a modest increase in the use of health system resources , with an estimated if frequency of ~1% .
recent studies by others have begun to explore these implications , initially by applying the acmg recommendations to various large data sets .
these studies suggest that the rate of ifs may be higher than originally anticipated but that some of this increase may be artifactual because of measurement uncertainty in the sequencing or bioinformatics phases , or even the incorrect classification of pathogenicity .
our modeling of the acmg recommendations for clinical reporting of incidental findings confirms that a nontrivial percentage ( 1.56.5% ) of screened individuals will have a significant reportable finding ( tables 2 and 3 ) . although slightly higher than the value of ~1% ifs originally forecast by the acmg , it is in broad agreement with experimental values of
1.2% ( americans with african ancestry ) and 3.4% ( americans with european ancestry ) .
this value is lower than those found by xue et al . , who reported a rate of ifs of 11% among 179 individuals from the 1000 genomes project , and by cassa et al . , who reported a rate of 8.5% from a set of 1,092 individuals drawn from various studies in the literature
however , both these studies included in their data sets a wider range of inheritance modes than those considered in our model .
the acmg recommendations were based on an ad mode of inheritance , whereas xue et al . included both ad and homozygous autosomal recessive conditions in their calculations .
only ad inherited conditions ( as listed in their table 2 ) , a revised rate of ifs of 6.9% is obtained ; further reduction in their rate of ifs might be appropriately made by noting that xue et al . included yet more conditions , some of which ( e.g. , loose anagen hair syndrome ) were pathogenic but had significantly less serious consequences to patients and some of which were disease - causing variants from databases that were incompletely validated . noting these qualifications of xue et al .
, their adjusted rate of ifs of 6.9% is consistent with the upper limit of 6.5% predicted by our model .
similarly included in their study a broader range of conditions and inheritance modes ( and thus diagnostic triggers for reporting an if ) than the specific set of 24 conditions defined in the acmg recommendations ; ~24% of their reported conditions were homozygous minor variants . to make their data more comparable with the ad recommendations of the acmg , correcting their findings by excluding these 24% homozygous variants obtained a revised rate of ifs of 6.5% , and further reduction in their rate of ifs might be appropriate by noting their conclusions that at least some of the variants detected may be erroneous findings or have lower penetrance than previously expected .
again , this revised rate of 6.5% is consistent with the upper limit predicted by our model .
we conclude that our base model is fit for the purpose of describing the expected rates of ifs . however , we note the many cautions expressed by these investigators regarding erroneous reports and the source of possible errors , and we used our model to explore the significance of these factors .
information about the population frequencies of rare conditions is necessarily limited , and calculations based on such limited information must be regarded with caution . most of the estimates of variant frequency for these rare conditions are based on the prevalence of a particular disorder in a population , rather than the prevalence of pathogenic allelic variants for that condition . because our model relies on estimated rates of variants of these genetic conditions rather than prevalence of the conditions themselves , we must rely on some implicit assumptions . to derive rates of variant prevalence from rates of condition prevalence , our calculations assume 100% penetrance , 100% identification of causative variants ( sensitivity ) , and 100% specificity . in reality
for example , the degree of penetrance and expressivity , and thus the true variant frequency , is not known for many genetic conditions ; this would lead to an incorrect estimation of the predicted number of ifs .
some conditions ( such as malignant hyperthermia ) may manifest themselves only after a rare environmental event , and should this event not be encountered during the life of the individual , then the true incidence of these conditions will be underestimated .
furthermore , diseases such as these , which have had their genetic basis determined by sequencing high - risk patients and looking for the common themes , are likely to overestimate the penetrance of the associated genetic cause . finally , because some pathogenic phenotypes will be due to genetic variations not yet described or currently considered vus , estimation of the number of reported ifs will contain additional imprecision .
even experts may disagree when clinical cases are reviewed : manual curation is time consuming and , even then , what is actionable may not always be agreed on . to attempt to account for these various uncertainties in the estimates , we performed a sensitivity analysis of our model .
we studied the effect on the predicted rate of ifs by varying the estimated prevalence of all conditions over a range of values .
we chose factors of two- and fourfold increase above or decrease below the most likely values ; this range would be sufficient to encompass reported alterations in misclassifications of variants in major databases . as noted by johnston et al .
, when the goal is to identify only variations likely to be causative and to minimize false positives , laboratory and bioinformatics decisions need to make a trade - off between diagnostic sensitivity and specificity because small variations in the diagnostic decision matrix will greatly affect the apparent rate of ifs .
we found that the rate at which ifs are reported is highly dependent on the actual clinical prevalence of the condition and the prevalence of pathogenic variants for that gene ( figure 1 ) . adding to this uncertainty , the analytical processes involved in massively parallel sequencing / whole - genome sequencing are not error free .
sequencing errors , variations in bioinformatics assembly and pipelines , and limitations , inadequacies , or errors in the annotations of current databases all introduce significant measurement uncertainty and analytical error , which can lead to over- or underreporting of ifs .
figure 1 shows that errors in sequencing and in bioinformatics analysis after sequencing , errors in database annotations , and difficulties in determining the true incidence of disease and the true prevalence of pathogenic variants all are major determinants of the rate of ifs .
when other parameters are held constant , a 4-fold change in the value of any one of these key drivers can produce up to a 10-fold difference in the rate of ifs ( tables 2 and 3 ) .
although the number of ifs reported will increase as the number of tested conditions increases , our modeling suggests this increase is not linear .
this nonlinearity is partly because of the underlying mathematics of the binomial calculations used in the model and partly because ( we assume ) the most common monogenic , ad , highly penetrant conditions have already been identified and included .
a consequence of this nonlinear behavior is that there is a diminishing marginal increase in reported ifs as more conditions are added . from the acmg - recommended list of 24 conditions , those with the highest variant frequencies contribute between 99 and 99.9% ( the top 11 and 19 conditions ,
we modeled the effects of expanding the list of conditions tested by adding more ad conditions .
we found that the most significant driver of the rate of ifs is not the number of additional conditions per se ( figure 2 ) but rather the variant frequency of the most common of these additional conditions ( figure 3 ) .
if we assume that the current acmg list already contains the most frequent of the ad conditions to be considered , then expanding the list to 100 or even 1,000 additional conditions only modestly increases the rate of ifs .
however , adding even a single condition whose variant frequency is of the order of 1% sharply increases the number of ifs .
these effects of variant frequencies on increasing numbers of ifs can also be used to model the effect of reporting vus for these conditions .
we developed and validated a simple model that allows the effects of various lists of ad conditions to be simulated and allows the rates of reporting of ifs and genetic carriers to be readily estimated .
our model shows that these rates are highly dependent on the apparent prevalence of included conditions , the actual prevalence of the genetic variants that cause these conditions , and the accuracy and quality of the sequencing and bioinformatics analyses .
this study has two key findings : ( i ) the accuracy of variant annotation of the underlying genomic databases is a significant factor in the proportion of individuals who will be flagged with a reportable finding .
( ii ) the proportion of individuals with ifs rapidly becomes asymptotic and self - limiting , even with the addition of many more highly penetrant ad condition / gene pairs to the list of reportable findings .
the major benefits in identifying the most clinically significant ifs may be achieved by including as few as 11 ( for 99% benefits ) or 19 ( for 99.9% benefits ) of the currently recommended acmg panel of 24 conditions . however , although the proportion of individuals with ifs may become limiting and constant , different challenges will emerge as the range of potential condition / gene pairs is expanded .
these will include issues such as the need for clinicians to be familiar with an ever - widening corpus of knowledge and information and the assessment of cost / utility of testing for this broadening range of conditions balanced by the availability , cost , and complexity of potential therapeutic options that may in turn be offset by a reduction in later costs through early intervention and disease prevention . | purpose : the american college of medical genetics and genomics released practice guidelines recommending reporting of incidental findings from exome and whole - genome sequencing by massively parallel ( next - generation ) sequencing for multiple conditions .
policy statements from other agencies are still being developed , and many attempt to take into consideration the predicted increase in workload caused by reporting incidental findings .
we describe the effects of changing the sensitivity and the specificity , as well as the implications of varying diagnostic criteria and a priori prevalence , and those of increasing the number of included conditions , on rates of incidental findings.methods:we developed a simple mathematical model based on binomial probability for predicting rates of incidental findings .
we primed and validated the model using published variant frequencies.results:the model correctly calculates observed rates of incidental findings . changing the model 's parameters
shows that even minor changes in diagnostic criteria or sequencing accuracy cause large variation in rates of incidental findings.conclusion:our model correctly explains observed rates of incidental findings .
key drivers of rates include diagnostic criteria , variant frequency , disease penetrance , and sequencing and bioinformatics accuracy .
rates of incidental findings are relatively insensitive to even large increases in the number of conditions included . | Introduction
Materials and Methods
In silico model
Validation of model
Assessing the impact of deviations from reported variant prevalence rates
Simulating the effects of increasing the number of tested conditions
Results
IFs and AD inheritance
Increasing the list of mandatory reporting conditions
Discussion
The rate of IFs
Effects on IFs of changing the input parameters
Effects of increasing the number of AD conditions in the ACMG recommendations
Conclusion
Disclosure |
personality disorders are made up of a group of psychiatric disorders that all share a common feature of an enduring , maladaptive behavior pattern markedly deviating from social expectations .
personality disorders are often diagnosed in early adulthood , and though some symptoms can be mitigated , they last a lifetime . these disorders are prevalent in the general population , with an estimated prevalence rate of 3.915.7% .
individuals with personality disorders were more likely to be male , younger , not in marriage , and comorbid with other disorders .
like other mental disorders , personality disorders can lead to some disability ; indeed , a significant increase in disability is observed among people with personality disorders .
people with personality disorders were more disabled than those without personality disorders according to the score of short form health survey-12 .
several studies have revealed that personality disorders are strongly associated with disability benefits , even more significantly than mood disorders and anxiety disorders .
a study found that personality disorders even accounted for more impairment in function than major depressive disorder alone .
another study by soeteman et al . indicated that patients with personality disorders experienced a high burden of disease , comparable to that of severe somatic illnesses .
ansell et al . also found that personality disorders were a source of considerable psychological distress and functional impairment equivalent to , and at times exceeding , the distress of mood and anxiety disorders .
furthermore , some studies have found that personality disorders had similar or higher costs to society compared to mood and anxiety disorders .
nevertheless , a study by rymaszewska et al . indicated a lower degree of social disability from personality disorders than affective or anxiety disorders . to some extent , personality disorders can generally cause disability , decrease quality of life , and pose a burden to society . among studies conducted on personality disorders ,
furthermore , only a few large - scale studies on personality disorders have been conducted in china ; consequently , little is known about the disability prevalence and function impairments . in 2006 ,
the chinese government conducted the second china national sample survey on disability , a national representative population - based survey , to get information on the disability attributed to a variety of diseases , including personality disorders .
the survey was designed to describe the prevalence and causes of disability , and to explore the characteristics of people with disabilities in china .
the present study utilized the data of the national representative survey and aimed to describe the disability prevalence rate attributed to personality disorders , their distribution among different populations and regions , and the impairments on daily activity and social function associated with them .
the significance of the present study was to demonstrate that people with personality disorder damage their social functions and even lead to mental disability , using an epidemiological method .
therefore , the hypotheses for the study were : ( 1 ) personality disorder is a cause of disability though the prevalence rate attributed to personality disorders is low comparing with other mental disorder ; and ( 2 ) the disability attributed to personality disorders is more likely to be male , younger , not in marriage , and less educated .
the data of this study were derived from the second china national sample survey on disability , which was conducted from april 1 to may 31 , 2006 .
a total of 734 counties , 2980 towns , and 5964 communities were selected in the survey . among all , 2,526,145 respondents in 771,797 households from 31 different provinces were investigated .
the survey included two phases : screening and diagnosis . for children under 7 years of age
if any question about psychiatric disability was positive , the subjects were suspected to be disabled , and were examined and diagnosed by trained psychiatrists .
the subjects psychiatric disability and severity were assessed using the world health organization disability assessment schedule 2.0 ( whodas 2.0 ) .
the subjects whose score of whodas 2.0 higher than 51 were identified as disability . psychiatric disability was classified into four degrees : mild , moderate , severe , and extremely severe .
furthermore , mental disorders in this survey were diagnosed according to the criteria found in the 10 revision of the international statistical classification of diseases ( icd-10 ) ; mental disability could only be attributed to a maximum of two kinds of mental disorders .
impairments of daily activities and social function of people with disabilities were evaluated in six domains by psychiatrists : understanding and communicating , physical movement , self - care , getting along with people , life activities , and social participation .
every domain was graded into five categories : without difficulty , mild difficulty , moderate difficulty , severe difficulty , and extreme difficulty .
all the classifications , grading standards , and instruments were pretested in the pilot study with satisfied reliability and validity .
this second china national sample survey on disability was approved by the chinese state council , and informed consent was obtained from the participants or their next of kin .
chi - square test was used to compare the different distribution of disability prevalence rates in different people and regions and to examine the difference in proportions of people with difficulty severities in daily activities and social functions between those of disabled people with personality disorders and those of disabled people with other mental disorders . to investigate the risk factors of disability attributed to personality disorders
, we conducted a 1:3 case - control study ; cases included all respondents with disability attributed to personality disorders . each case
was matched to three healthy controls in the original database by gender and age using a propensity score .
the data of this study were derived from the second china national sample survey on disability , which was conducted from april 1 to may 31 , 2006 .
a total of 734 counties , 2980 towns , and 5964 communities were selected in the survey . among all , 2,526,145 respondents in 771,797 households from 31 different provinces were investigated .
for children under 7 years of age , pediatricians made the health examination . for subjects aged 7 years and above
if any question about psychiatric disability was positive , the subjects were suspected to be disabled , and were examined and diagnosed by trained psychiatrists .
the subjects psychiatric disability and severity were assessed using the world health organization disability assessment schedule 2.0 ( whodas 2.0 ) .
psychiatric disability was classified into four degrees : mild , moderate , severe , and extremely severe .
furthermore , mental disorders in this survey were diagnosed according to the criteria found in the 10 revision of the international statistical classification of diseases ( icd-10 ) ; mental disability could only be attributed to a maximum of two kinds of mental disorders .
impairments of daily activities and social function of people with disabilities were evaluated in six domains by psychiatrists : understanding and communicating , physical movement , self - care , getting along with people , life activities , and social participation .
every domain was graded into five categories : without difficulty , mild difficulty , moderate difficulty , severe difficulty , and extreme difficulty .
all the classifications , grading standards , and instruments were pretested in the pilot study with satisfied reliability and validity .
this second china national sample survey on disability was approved by the chinese state council , and informed consent was obtained from the participants or their next of kin .
chi - square test was used to compare the different distribution of disability prevalence rates in different people and regions and to examine the difference in proportions of people with difficulty severities in daily activities and social functions between those of disabled people with personality disorders and those of disabled people with other mental disorders . to investigate the risk factors of disability attributed to personality disorders
, we conducted a 1:3 case - control study ; cases included all respondents with disability attributed to personality disorders . each case
was matched to three healthy controls in the original database by gender and age using a propensity score .
a total of 2,526,145 people were interviewed in this survey and 1,909,205 people were over 18 years old . for the sample aged 18 years and over ,
49.8% were male , 79.8% were married , and the average age was 44.6 16.4 years .
however , only 21.2% of the respondents had received at least a high school education . among the 151,627 disabled people aged 18 years and over who were identified in the survey , 15,155 ( 10.0% )
a total of 112 people had personality disorders according to the icd-10 , including 22 who had multiple disabilities .
table 1 shows the disability prevalence attributed to personality disorders and prevalence ratios by different distributions in chinese adults .
overall , the disability prevalence rate of males was 1.6 times higher than that of females ( p = 0.012 ) .
the disability prevalence rate of unmarried and divorced / widowed people was significantly higher than that of married people ( p < 0.001 ) , while the prevalence rate of the unemployed was 4.4 times higher than that of the employed ( p < 0.001 ) .
furthermore , people with higher education levels had statistically lower prevalence rates compared to people with lower education levels ( p < 0.001 ) . although the disability prevalence rates attributed to personality disorders varied in three economic areas without statistical differences ( p = 0.551 ) , the highest was in the central area , followed by the western area and eastern area .
disability prevalence attributed to icd-10 personality disorders and its distribution by demographic factors in chinese adults ( n = 112 ) icd : international statistical classification of diseases .
the severity of disability attributed to personality disorders in the ninety disabled people with personality disorders ( excluding those with multiple disabilities ) , 24 people ( 26.7% ) had severe or extremely severe disability . however , 54 people had mild disability , accounting for 60.0% . in the 22 people who had multiple disabilities , 36.4% had severe or extremely severe disability .
impairment of daily activities and social function the disability attributed to personality disorders had little impairment with regard to physical movement ; in contrast , it always caused severe or extremely severe impairment in the daily activities , getting along with people , and social participation , accounting for 41.1% , 33.3% , and 28.8% , respectively [ table 2 ] .
compared to disabled people with other mental disorders , disabled people with personality disorders revealed less severe or extremely severe function impairment in understanding and communication ( p = 0.011 ) [ table 3 ] .
severity of disability attributed to personality disorder disabilities in daily activities and social function ( n = 90 ) , n ( % ) comparison of severe function impairment in disabled people with personality disorders and other mental disorders , n ( % ) in total , 112 cases were successfully matched to 336 controls .
table 4 shows the association between the disability attributed to personality disorders and some sociodemographic characteristics according to multivariate conditional logistic regression .
unmarried people were more likely to suffer from disability attributed to personality disorders compared to married people ( or = 2.31 , p = 0.001 ) . compared to the employed population ,
the unemployed had greatly increased odds of disability ( or = 2.89 , p < 0.001 ) .
multivariate conditional logistic regression of risk factors for disability with personality disorders , n ( % ) or : odds ratios ; ci : confidence interval .
a total of 2,526,145 people were interviewed in this survey and 1,909,205 people were over 18 years old . for the sample aged 18 years and over ,
49.8% were male , 79.8% were married , and the average age was 44.6 16.4 years .
however , only 21.2% of the respondents had received at least a high school education .
among the 151,627 disabled people aged 18 years and over who were identified in the survey , 15,155 ( 10.0% ) people were identified as mentally disabled and 3647 ( 2.4% ) had multiple disabilities .
a total of 112 people had personality disorders according to the icd-10 , including 22 who had multiple disabilities .
table 1 shows the disability prevalence attributed to personality disorders and prevalence ratios by different distributions in chinese adults .
overall , the disability prevalence rate of males was 1.6 times higher than that of females ( p = 0.012 ) .
the disability prevalence rate of unmarried and divorced / widowed people was significantly higher than that of married people ( p < 0.001 ) , while the prevalence rate of the unemployed was 4.4 times higher than that of the employed ( p < 0.001 ) .
furthermore , people with higher education levels had statistically lower prevalence rates compared to people with lower education levels ( p < 0.001 ) . although the disability prevalence rates attributed to personality disorders varied in three economic areas without statistical differences ( p = 0.551 ) , the highest was in the central area , followed by the western area and eastern area .
disability prevalence attributed to icd-10 personality disorders and its distribution by demographic factors in chinese adults ( n = 112 ) icd : international statistical classification of diseases .
the severity of disability attributed to personality disorders in the ninety disabled people with personality disorders ( excluding those with multiple disabilities ) , 24 people ( 26.7% ) had severe or extremely severe disability . however , 54 people had mild disability , accounting for 60.0% . in the 22 people who had multiple disabilities , 36.4% had severe or extremely severe disability .
impairment of daily activities and social function the disability attributed to personality disorders had little impairment with regard to physical movement ; in contrast , it always caused severe or extremely severe impairment in the daily activities , getting along with people , and social participation , accounting for 41.1% , 33.3% , and 28.8% , respectively [ table 2 ] .
compared to disabled people with other mental disorders , disabled people with personality disorders revealed less severe or extremely severe function impairment in understanding and communication ( p = 0.011 ) [ table 3 ] .
severity of disability attributed to personality disorder disabilities in daily activities and social function ( n = 90 ) , n ( % ) comparison of severe function impairment in disabled people with personality disorders and other mental disorders , n ( % )
table 4 shows the association between the disability attributed to personality disorders and some sociodemographic characteristics according to multivariate conditional logistic regression .
unmarried people were more likely to suffer from disability attributed to personality disorders compared to married people ( or = 2.31 , p = 0.001 ) . compared to the employed population ,
the unemployed had greatly increased odds of disability ( or = 2.89 , p < 0.001 ) . disability was also strongly associated with education level .
multivariate conditional logistic regression of risk factors for disability with personality disorders , n ( % ) or : odds ratios ; ci : confidence interval .
in this study , we described the disability prevalence rate attributed to personality disorders in chinese adults , its distribution in different populations and regions , the impairment of daily activities and social function , and related risk factors .
we found that nearly 4/100,000 people suffer from disability attributed to personality disorders . to the best of our knowledge
most of the current epidemiological studies on personality disorders have just described the prevalence of personality disorders . according to the data of the world mental health survey ( wmhs ) , the prevalence of personality disorders in china was 4.1% . obviously , the disability prevalence attributed to personality disorders in this study was much lower than any of the reports above . because the survey population of the second china national sample survey on disability included people with any disability , the disability prevalence rate is definitely lower than the prevalence rate of mental disorders . compared with the prevalence rate of disability attributed to mood disorders ( 36.6/100,000 ) ,
however , the gap of disability prevalence between the two diseases was larger than that of the disease prevalence . according to this
findings from this study showed that the disability prevalence rate of males was higher than that of females .
the results of most epidemiological studies on personality disorders have indicated that the prevalence of personality disorders of males was higher than that of females .
a study conducted by hopkins in 2002 found that cluster a and cluster b disorders were more prevalent in men .
the results of the wmhs also strongly indicated that male gender is a risk factor for personality disorders .
it could be inferred that the high prevalence rate of males lead to a similarly high disability prevalence rate .
our survey found that the distribution of prevalence was different based on different marital statuses .
marriage was a protective factor for disability attributed to personality disorders ; one explanation may be that individuals with personality disorders are problematic for the people around them , especially their spouses .
it is more likely that it is relatively difficult for people with personality disorders to maintain close relationships with others or stable marriages .
consistently , the findings from the wmhs suggested that previously married was a risk factor for patients with cluster a personality disorders . with regard to education level ,
the lower education group was more likely to suffer from disability attributed to personality disorders and a higher education level seemed to be a protective factor .
the results of the wmhs also suggested that less educated people are more sensitive to personality disorders .
it may be that people with personality disorders or personality dysfunction could probably not finish school or get along with those around them .
as for employment status , our data indicated that unemployed individuals were more likely to suffer from personality disorders , which was also consistent with most related surveys .
a study on the association between personality disorders and occupational functioning suggested that most of the personality disorders were found to be significantly related to occupational dysfunction , especially cluster a and b disorders .
nevertheless , cluster c disorders were less strongly related to occupational dysfunction compared to other personality disorders .
the study also indicated that the majority of individuals with disability attributed to personality disorders suffered from mild disability and less severe impairment in daily activities and social function , which was consistent with some of the previous studies .
the impairment of understanding and communicating was even less severe than other mental disorders . due to the nature of personality disorders
a study also found that personality disorders mainly impaired interpersonal relationships with regard to work , social , and leisure functions .
the wmhs also found that impairment of physical movement and self - care was the weakest compared to other domains .
however , it still went against the conclusion of some related studies , which indicated that personality disorders are a heavy burden to society , even higher than mood or anxiety disorders . in recent years
, some have regarded personality disorders as mental disorders with great harm , and declared that personality disorders need more research . nevertheless , according to our research
, personality disorders led to less and milder disability compared to other mental disorders ; we have also found that disability attributed to personality disorders was not as prevalent as some researchers had thought .
furthermore , we could also speculate that people with this less severe disability or disease were more likely to live in a community and would not seek help .
recovery of function would be promoted by means of health education and group activities in the community . at this stage , that may be more effective than clinical treatment , considering the low rate of utilization of health service .
the results may not be applicable to patients who have personality disorders but no disability or to other populations .
second , though personality disorders consist of several subtypes , the study did not clarify the specific subtypes , which may confine further exploration to reveal the results of the subtypes .
third , in the second china national sample survey on disability , mental disability could only be recorded based on two main causes .
personality disorders are a group of mental disorders that are not as serious compared to other mental disorders , such as schizophrenia and mood disorders . therefore , the identification was not so exact for disabled comorbidities with more than two kinds of mental disorders , and the results could not be generalized to complicated comorbidities .
fourth , personality disorders have a strong link with parenting styles . we have no information about the parenting style of the disability attributed to personality disorders , which further studies could consider . in summary , the results of the present study concluded that the prevalence of disability attributed to personality disorders is relatively lower than most of other mental disorders in china , and always leads to mild disability .
the study was supported by a grant from the national social science foundation of china ( no .
the study was supported by a grant from the national social science foundation of china ( no . | background : personality disorders can lead to some disability .
however , little is known about the disability prevalence and function impairments . this study aimed to describe the disability prevalence attributed to personality disorders ,
its distribution , impairments of daily activities and social functions , and risk factors in china.methods:using a descriptive and analytic epidemiological method , data from the second china national sample survey on disability in 2006 were analyzed . the disability prevalence attributed to personality disorders ,
its distribution in different people and regions , and risk factors were statistically calculated.results:respondents included 1,909,205 adults .
the disability prevalence rate attributed to personality disorders in china was 5.9/100,000 .
the disability rate attributed to personality disorders of males was higher than that of females ( p = 0.012 ) , while the rate of the unemployed was higher than that of the employed ( p < 0.001 ) .
furthermore , the rates of unmarried / divorced / widowed people and the illiterate population were higher than those of married and educated people ( p < 0.001 ) . regarding the severity of disability attributable to personality disorders , mild disability accounted for a majority or 60% of the respondents . the data showed that disability mainly impaired respondents ability to engage in daily activities , get along with people , and participate in social situations . according to the case - control study ,
marriage , employment , and higher education were protective factors of disability.conclusions:the prevalence of disability attributed to personality disorders is low in china and always leads to mild disability .
the distribution of disability attributed to personality disorders also varies in the chinese population . | I
M
Study population
Screening and diagnosis of disability attributed to personality disorders
Statistical analysis
R
Demographic distribution
Disability prevalence rate attributed to personality disorders in Chinese adults and its sociodemographic distribution
The severity of disability attributed to personality disorders and impairment of daily activities and social function
Risk factors for disability attributed to personality disorders
D
Financial support and sponsorship
Conflicts of interest |
the differential diagnosis of predominant plasmacytoid cells on thyroid fine - needle aspirates should also include ptl with extensive plasmacytic differentiation , besides plasmacytoma .
further studies are required to assess plasmacytic differentiation in various thyroid lymphomas so as to differentiate them from plasmacytomas , the two entities having a different line of management .
primary thyroid gland lymphomas ( ptls ) are uncommon tumors that have been estimated to represent approximately 5% of all thyroid neoplasms and 2.5 - 7% of all extranodal lymphomas .
studies have shown that ptls typically occur in middle - to older - aged women and arise in the setting of autoimmune thyroiditis ( lymphocytic thyroiditis , hashimoto 's disease ) . the term
primary designates patients with lymphomatous involvement of the thyroid at diagnosis , the disease being localized or disseminated to nodal or extranodal sites .
patients present with a mass in the thyroid , usually noticeably enlarging , and commonly have symptoms related to compression of neck structures by the tumor .
with radioisotopic i scanning , a cold nodule or areas of decreased uptake are common .
( dlbcl ) and mucosa - associated lymphoid tissue lymphoma ( malt ) are the two most common histologic subtypes of ptl .
small lymphocytic b - cell lymphoma ( sll ) is an extremely rare type of thyroid lymphoma ( about 4% of cases ) .
cervical lymph nodes are the most frequently involved site , followed by a variety of other nodal and extranodal sites , including mediastinal lymph nodes , gastrointestinal tract , bone marrow , lung , bladder , liver , and spleen .
chronic lymphocytic leukemia / small lymphocytic lymphoma ( cll / sll ) presenting initially as a thyroid abnormality is extremely rare , with very few reported cases in the literature .
a 60-year - old postmenopausal female presented with swelling involving the midline of the neck measuring 6 cm in largest dimension for the past 1 month .
she also had an enlarged lymph node of 1.5 cm diameter in the left cervical region .
routine laboratory tests were normal and hormonal evaluation showed subclinical hypothyroidism ( serum thyroid - stimulating hormone ( tsh ) , 12.8 iu / ml ( normal range 0.25 - 5.25 iu / ml ) ; free t3 and free t4 were within normal range ) .
cytological examination of thyroid and left cervical lymph node obtained during fine - needle aspiration revealed a similar appearance with a predominant cell population of small - to medium - sized cells revealing paracentral to eccentric nuclei with clock - face chromatin and abundant sky - blue cytoplasm along with few hurthle cells ( fig . 1 , 2 ) .
a provisional diagnosis of lymphoma / plasmacytoma was made and patient was advised immunoelectrophoretic studies and skeletal imaging for confirmation , however all turned out to be normal . subsequently , a biopsy was performed from cervical lymph node .
histopathological and immunohistochemistry findings in the specimen led to the diagnosis of small lymphocytic b - cell lymphoma ( sll cd20 + , cd19 + , cd5 + , cd23 + , + , - ) ( fig .
3 ) . to confirm thyroid involvement , flow cytometry of the biopsy material sampled from the thyroid was performed showing b - cell immunophenotype with plasma cell differentiation : cd19+/cd20 + , cd23+/cd5 + , scd79b-+ , cd38 + , cd10- , + and -/weak reaction .
staging procedures including peripheral blood and bone marrow examination , ct scan of thorax , abdomen and pelvis did not reveal any other involvement .
the patient was started on chemotherapy according to a cop ( cyclophosphamide , vincristine and prednisolone ) regimen with good response and is still under follow - up .
ptl , with an estimated annual incidence of 2 cases per million , is a rare thyroid malignancy .
the most common clinical presentation is a rapidly growing neck mass , which is reported in 70% of patients , whereas compression symptoms and signs are present in 30% and b symptoms are reported in 10% of patients .
cervical / perithyroidal lymph nodes were the most common nodal sites involved , usually identified at , or shortly after initial surgery , followed by mediastinal and abdominal lymph nodes .
malt is the second most common subtype , and sll is one of the rarest .
a vast majority of cases of ptl arise in the setting of hashimoto 's thyroiditis .
it is estimated that the relative risk of developing a thyroid lymphoma is increased 67-to 80-fold in patients with hashimoto 's thyroiditis .
the few cases ( < 7% ) that did not have documented lymphocytic thyroiditis may have been either inadequately sampled or the lymphoma may have completely obliterated any residual thyroid tissue .
the initial diagnostic method for thyroid lymphoma should consist of a fine - needle aspiration biopsy with the use of ancillary techniques such as flow cytometry and immunohistochemistry for improved diagnostic accuracy .
cll / sll is one of the rarest subtypes of lymphoma that can involve the thyroid gland .
diagnosis of this entity is difficult , particularly before the recognition of systemic involvement , requiring the expertise of a multidisciplinary team for early detection and optimal management .
the cases previously reported in various studies as extramedullary plasmacytomas of the thyroid represented marginal zone b - cell lymphoma ( mzbl ) with extreme plasma cell differentiation .
overall , ptls have a favorable outcome with appropriate therapy , but prognosis depends on both clinical stage and histology .
mzbl and stage ie tumors have an excellent prognosis , whereas tumors with a large cell component or dlbcl or stage greater than ie have the greatest potential for a poor outcome .
the treatment of primary lymphomas of the thyroid gland , as well as infiltration changes associated with cll / sll , remains controversial .
the recommended strategy includes chemotherapy , radiotherapy , and in particular cases also surgery and immunochemotherapy with monoclonal antibodies .
it should be emphasized that the diagnosis of ptl based on fine - needle aspiration biopsy is not always possible with extensive plasmacytic differentiation posing a major diagnostic problem .
further studies are required to assess plasmacytic differentiation in various thyroid lymphomas so as to differentiate them from plasmacytoma the two entities having a different line of management and prognosis .
the authors declare that no financial or other conflicts of interest exist in relation to the content of the article . | primary thyroid gland lymphomas ( ptls ) typically occur in middle - to older - aged individuals in the setting of lymphocytic thyroiditis with a predilection for females . diffuse large b - cell lymphoma is the most frequent histologic subtype of thyroid lymphomas .
small lymphocytic lymphoma ( sll ) belongs to the least common subtypes of thyroid lymphoma .
it is often associated with the involvement of lymph nodes , bone marrow , spleen , liver and , extremely rarely , other organs .
ptls with plasmacytic differentiation or extensive infiltration by plasma cells have been observed in marginal zone b - cell lymphomas in the thyroid but have never been described in a setting of sll .
here , we present a case of primary sll of the thyroid mimicking extramedullary plasmacytoma on fine - needle aspiration cytology . | What Is Known about This Topic
What Does This Case Report Add
Introduction
Case Report
Discussion
Conclusion
Disclosure Statement |
partial sacrectomy is usually performed when a sacral tumor involves high - level sacral vertebra .
traditionally , surgical treatment without reconstruction often damaged the sacroiliac joint and the ligaments around it , and was often associated with prolonged immobilization during the recovery phase .
thus , lumbosacral reconstruction was often performed to achieve early ambulation for patients . modified galveston technique ( mgt ) is one of the most commonly used methods in lumbosacral reconstruction .
the biomechanical property of mgt for patients who underwent partial sacrectomy is not well documented . in this study , a finite element analysis was carried out to evaluate the stiffness of mgt reconstruction and the stress of instruments in detail .
three finite element models ( fems ) of the lumbosacral region were established : 1 ) an intact model ( int ) , 2 ) a defective model in which partial sacrectomy was performed cephalad to the s1 foramina ( def ) , and 3 ) a reconstructed model ( rec ) . to create this model , computed tomography ( ct ) scans of l3-pelvis of a 53-year - old healthy man were obtained .
the commercially available finite element program abaqus 6.7 ( simulia inc . , providence , ri , usa ) was used to model the lumbosacral region .
the fem of the intact lumbosacral region included l3l5 vertebrae , intervertebral discs , endplates , posterior elements , sacrum , and the superior part of the bilateral ilia .
the material properties were assumed to be homogeneous and isotropic , and the data were adopted from the literature ( table 1 ) .
a 10-node solid element ( c3d10 m ) was used for modeling the cortical bone , cancellous bone , endplate , and disc .
the facet joint was treated as a nonlinear 3-dimensional contact problem using surface - to - surface contact element , and the friction coefficient was set 0.1 . to stimulate sacroiliac joint motion , spring elements were used to connect the joint faces of the sacroiliac joint .
the spring stiffness was set as 200 n / mm according to validation in the literature .
the fem of intact lumbosacral region ( int ) consisted of 161 966 c3d10 m elements , 160 spring elements , and 246 555 nodes ( figure 1a ) .
the material properties ( table 1 ) and the stiffness of spring elements were the same as those in the int model .
the def model consisted of 147 927 c3d10 m elements , 120 spring elements , and 225 450 nodes ( figure 1b ) .
instruments used in mgt reconstruction were mainly screws and rod . in this study , 6 pedicle screws ( diameter 6.5 mm , length 45 mm ) and 2 iliac screws ( diameter 7 mm , length 45 mm ) were inserted into the def model , and then connected by 2 rods ( diameter 6 mm ) and 2 cross - linkers ( diameter 3 mm ) .
the instrument morphology parameters were set according to commercially available products ( isola , depuy , inc . ) . in this study , the connection between screws and bone was assumed as firm , so the thread part of the screw was ignored .
the material properties ( table 1 ) and the stiffness of spring elements were the same as those in the def model , and the material properties of instrument were considered as titanium or stainless steel .
the rec model consisted of 216 403 c3d10 m elements , 120 spring elements , and 260 677 nodes ( figure 1c ) . a mean vertical load of 500n transmitted along the lower lumbar spine in upright standing position
the inferior surfaces of the bilateral ilia were fixed completely , with a vertical load of 500 n imposed on the superior surfaces of the l3 vertebral body .
the middle point of superior endplate on the l3 vertebrae was taken as the anchor point to compare the displacement of the 3 finite element models .
the stress results are expressed in term of von mises stresses , and stress distribution of instruments and sacroiliac joints in the rec model were evaluated . under the same vertical load ,
the stiffness of int and def model were compared with the data of hugate et al .
in addition , the intact results served as baseline data for our interpretation of the results of other models .
three finite element models ( fems ) of the lumbosacral region were established : 1 ) an intact model ( int ) , 2 ) a defective model in which partial sacrectomy was performed cephalad to the s1 foramina ( def ) , and 3 ) a reconstructed model ( rec ) .
to create this model , computed tomography ( ct ) scans of l3-pelvis of a 53-year - old healthy man were obtained .
the commercially available finite element program abaqus 6.7 ( simulia inc . , providence , ri , usa ) was used to model the lumbosacral region .
the fem of the intact lumbosacral region included l3l5 vertebrae , intervertebral discs , endplates , posterior elements , sacrum , and the superior part of the bilateral ilia .
the material properties were assumed to be homogeneous and isotropic , and the data were adopted from the literature ( table 1 ) . a 10-node solid element ( c3d10 m )
was used for modeling the cortical bone , cancellous bone , endplate , and disc .
the facet joint was treated as a nonlinear 3-dimensional contact problem using surface - to - surface contact element , and the friction coefficient was set 0.1 .
to stimulate sacroiliac joint motion , spring elements were used to connect the joint faces of the sacroiliac joint .
the spring stiffness was set as 200 n / mm according to validation in the literature .
the fem of intact lumbosacral region ( int ) consisted of 161 966 c3d10 m elements , 160 spring elements , and 246 555 nodes ( figure 1a ) .
the material properties ( table 1 ) and the stiffness of spring elements were the same as those in the int model .
the def model consisted of 147 927 c3d10 m elements , 120 spring elements , and 225 450 nodes ( figure 1b ) .
instruments used in mgt reconstruction were mainly screws and rod . in this study , 6 pedicle screws ( diameter 6.5 mm , length 45 mm ) and 2 iliac screws ( diameter 7 mm , length 45 mm ) were inserted into the def model , and then connected by 2 rods ( diameter 6 mm ) and 2 cross - linkers ( diameter 3 mm ) .
the instrument morphology parameters were set according to commercially available products ( isola , depuy , inc . ) . in this study , the connection between screws and bone was assumed as firm , so the thread part of the screw was ignored .
the instruments were also meshed with the c3d10 m element . the material properties ( table 1 ) and the stiffness of spring elements were the same as those in the def model , and the material properties of instrument
the rec model consisted of 216 403 c3d10 m elements , 120 spring elements , and 260 677 nodes ( figure 1c ) .
a mean vertical load of 500n transmitted along the lower lumbar spine in upright standing position was identified in the literature .
the inferior surfaces of the bilateral ilia were fixed completely , with a vertical load of 500 n imposed on the superior surfaces of the l3 vertebral body .
the middle point of superior endplate on the l3 vertebrae was taken as the anchor point to compare the displacement of the 3 finite element models .
the stress results are expressed in term of von mises stresses , and stress distribution of instruments and sacroiliac joints in the rec model were evaluated .
under the same vertical load , the stiffness of int and def model were compared with the data of hugate et al . study .
in addition , the intact results served as baseline data for our interpretation of the results of other models .
the displacement of anchor point in int , def , and rec models were 6.63 mm , 10.62 mm , 4.29 mm ( titanium ) and 3.86 mm ( stainless steel ) , respectively .
thus , the stiffness of the 3 models was 140 n / mm , 87 n / mm , 216 n / mm ( titanium ) , and 240 n / mm ( stainless steel ) .
these results suggest that lumbosacral reconstruction can significantly increase the stiffness of the lumbosacral region of patients who underwent partial sacrectomy . a good agreement between our stiffness results and reported data ( int 140 n / mm vs. 353231 n / mm reported ; def 87 n / mm vs. 10149 n / mm reported )
excessive concentration on the caudal spinal rod could be observed , which may cause rod failure between spine and ilia .
the maximum stress of the stainless steel instrument was significantly higher than that of titanium instruments ( 992 mpa vs. 655 mpa ) .
the value of stress of the anchor point was 26.4 mpa with titanium instruments and 23.9 mpa with stainless steel instruments .
our results strongly indicate that stainless steel instruments had higher maximum stress and greater stress shielding effect than titanium instruments .
the displacement of anchor point in int , def , and rec models were 6.63 mm , 10.62 mm , 4.29 mm ( titanium ) and 3.86 mm ( stainless steel ) , respectively .
thus , the stiffness of the 3 models was 140 n / mm , 87 n / mm , 216 n / mm ( titanium ) , and 240 n / mm ( stainless steel ) .
these results suggest that lumbosacral reconstruction can significantly increase the stiffness of the lumbosacral region of patients who underwent partial sacrectomy . a good agreement between our stiffness results and reported data ( int 140 n / mm vs. 353231 n / mm reported ; def 87 n / mm vs. 10149 n / mm reported )
stress distribution of instruments in the rec model is shown in figure 3 . excessive concentration on the caudal spinal rod
the maximum stress of the stainless steel instrument was significantly higher than that of titanium instruments ( 992 mpa vs. 655 mpa ) .
the value of stress of the anchor point was 26.4 mpa with titanium instruments and 23.9 mpa with stainless steel instruments .
our results strongly indicate that stainless steel instruments had higher maximum stress and greater stress shielding effect than titanium instruments .
partial sacrectomy is performed when a sacral tumor involves high - level sacral vertebra , which often breaks the sacroiliac joint and the ligaments around it .
traditionally , surgical treatment without reconstruction was often associated with prolonged immobilization during the recovery phase .
thus , lumbosacral reconstruction was usually performed to achieve early ambulation for patients . however , the biomechanical behavior of lumbosacral reconstruction for sacrectomy was not well documented .
since being first introduced by gokaslan in 1997 with development of flap surgery skills , mgt has become one of the most common methods in lumbosacral reconstruction for sacrectomy . in this study , we evaluated mgt reconstruction for partial sacrectomy using a finite element analysis , which is an effective procedure for biomechanically evaluating a reconstruction in detail .
because of the variability of different human tissues , the fem does not necessarily reflect the behavior of all specimens tested in the experimental part of the study .
thus , major differences may occur when compared with results of in vitro studies , as have been observed in previous studies .
the validation of finite element models is generally done through a comparison between the results yielded by models and experimental studies . based on the results of the validation process as described ,
our fems have been sufficiently validated . however , the small numbers of specimens used in hugate et al .
study limit the statistical power of the study and we can not ensure the trends we report would occur clinically given the small numbers and the limited range of in vivo loading situations .
destabilization of the spinopelvic segment may require bony stabilization and reconstruction using complex methods that involve lumboiliac arthrodesis .
a partial sacrectomy below the s2 foramina typically would not involve resection of the sacroiliac joints and would likely have little effect on stability .
transverse osteotomy involving the s2 and s1 sacral bodies has been previously investigated by gunterberg et al .
it is believed that lumbosacral reconstruction should be performed for patients who underwent sacrectomy cephalic to the s1 foramina to achieve early ambulation .
lumbosacral reconstruction can significantly increase the stiffness of the lumbosacral region of the patient who underwent partial sacrectomy .
however , the rod between l5 and ilia is the weakest region of all the instruments , which is the same as the stress distribution in zhu et al . study .
it is suggested that the bending of the rod should be conducted carefully and smoothly to avoid significant stress concentration and to reduce the risk of rod failure .
stainless steel instruments reconstruction had higher maximum von mise stress and significantly greater stress shielding effect than titanium instruments , which means stainless steel instruments have higher risk of rod failure and are less suitable for lumboiliac arthrodesis than titanium instruments .
we believe our findings contribute to better understanding of the mechanical consequences of lumbosacral reconstruction after partial sacrectomy .
the fem established in our study may be useful in designing better reconstruction instruments for lumbosacral reconstruction .
however , the rod between l5 and ilia is the weakest region of all the instruments .
it is suggested that the bending of the rod should be conducted carefully and smoothly to avoid significant stress concentration and to reduce the risk of rod failure .
stainless steel instruments have higher maximum stress and significantly greater stress shielding effect than titanium instruments , which means stainless steel instruments have higher risk of rod failure and are less suitable for use in lumboiliac arthrodesis than titanium instruments . | backgroundthe biomechanical property of mgt for patients who underwent partial sacrectomy is not well documented , so this study aimed to investigate biomechanical property of lumbosacral reconstruction after partial sacrectomy.material/methodsthree 3-dimensional finite element models of lumbosacral region were established : 1 ) an intact model ( int ) , 2 ) a defective model in which partial sacrectomy was performed cephalad to s1 foramina ( def ) , and 3 ) a reconstructed model ( rec).resultsdisplacements of anchor point on l3 vertebrae in int , def , and rec model were 6.63 mm , 10.62 mm , 4.29 mm ( titanium ) , and 3.86 mm ( stainless steel ) , respectively . stress distribution of the instrument in rec model showed excessive concentration on the caudal spinal rod , which may cause rod failure between spine and ilia .
maximum von mise stress of the stainless steel instrument was higher than titanium instruments , and values of stress of the anchor point around the sacroiliac joint in the rec model were 26.4mpa with titanium instruments and 23.9 mpa with stainless steel instruments.conclusionslumbosacral reconstruction can significantly increase stiffness of the spinopelvis of patients who underwent partial sacrectomy .
however , the rod between l5 and ilia is the weakest region of all instruments .
stainless steel instruments have higher risk of rod failure and are less suitable for lumboiliac arthrodesis than titanium instruments . | Background
Material and Methods
Design
FEM of intact lumbosacral region (INT)
FEM of defective lumbosacral region (DEF)
FEM of reconstructed lumbosacral region (REC)
Boundary and loading condition
Model validation
Results
Displacement and stiffness of models
Stress of instruments
Discussion
Conclusions |
laparoscopic surgery provides a higher degree of patient satisfaction than does open surgery from a cosmetic perspective , and it is also effective in reducing postoperative pain , operative wound complications , blood loss , and the length of hospital stay . accordingly , it has been remarkably developed in the field of urology over the past 20 years .
it has also been performed prevalently as a treatment regimen , which is comparable to open surgery .
usually , the laparoscopic technique requires three to six ports . with technical advancements and the increased demand for minimally invasive surgery ,
however , laparoendoscopic single - site surgery ( less ) performed via a single incision window has recently been introduced .
there is still only one type of less port that has become commercially available in korea up to the present .
various studies have been conducted with the r - port ( advanced surgical concepts , dublin , ireland ) , which has been frequently used worldwide , but this port can not be used in a korean clinical setting .
many surgeons in korea therefore perform less by using a homemade single - port device . in this study
, we report our initial experiences with less performed by a single surgeon using a homemade single - port device in the field of urology .
between april 2009 and april 2010 , a total of 30 patients underwent less performed by a single surgeon .
of these , there were seven cases of nephrectomy ( 5 radical nephrectomies ) , five cases of nephroureterectomy with bladder cuff excision , four cases of ureterolithotomy , eight cases of marsupialization , and six cases of varicocelectomy .
, a single incision was made at the umbilicus and the peritoneum was confirmed accordingly .
then , after an incision was made , an alexis wound retractor ( applied medical , rancho santa margarita , ca , usa ) was placed .
the exterior side was connected to a surgical glove and then fixed by using a silk ( fig .
this was followed by the placement of a homemade single - port device ( fig .
the homemade single - port device was prepared by fixing 3 to 4 general type laparoscopic ports in each finger .
a 10 mm rigid laparoscope or flexible laparoscope ( endoeye , olympus surgical , orangebur , sc , usa ) was inserted into the peritoneum through the 12 mm trocar and the flexible laparoscopic instruments ( laparoangle , cambrigeendo , framingham , ma , usa ; and roticulator , autosuture , norwalk , ct , usa ) were inserted through the remaining trocars ( fig .
in which a nephrectomy or nephroureterectomy was performed , a 4.0 cm incision was made .
resected specimens of renal cell carcinoma ( rcc ) or renal pelvis tumor were entrapped by use of a lap - bag ( sejong medical , paju , korea ) and extracted along the longitudinal axis , and there were no morcellated specimens in our cases . in cases with right - sided disease , the liver was retracted by use of a diamond flex angled circular retractor ( snowden pencer , cardinal health , dublin , oh , usa ) through a 5 mm port . in other cases ,
for the methods in which the instruments were crossed in both hands , a laparoscopic triangle was secured .
the surgical procedure was performed by using laparoscopic instruments that can be flexed ( fig .
after the surgical procedure was completed , the homemade single - port device and alexis wound retractor were removed .
the surgical procedure was completed after the application of dermabond ( ethicon , somerville , nj , usa ) .
mean visual analogue pain scales on the operative day and the first postoperative day were 6.3/10 and 3.1/10 , respectively .
cases that were converted to conventional surgery were found to correspond to patients who concurrently had xanthogranulomatosis and a ureteropelvic junction stone in the right kidney . in these patients , a simple nephrectomy was attempted . because of the severe adhesion to the adjacent tissues and the persistent presence of bleeding , however , no further surgical procedures were available . accordingly , surgical procedures progressed after the additional insertion of two ports .
the operative time was 405 minutes , and the estimated blood loss was 2,050 ml .
two cases that were converted to open surgery were cases of nephroureterectomy for a ureteral tumor .
one incision extension was performed because of complete renal hilar lymphadenectomy by the open technique , and one open conversion with gibson 's incision was performed because of severe adhesion around the distal ureter .
lymphadenectomy around the renal pedicles and external iliac vessels , which was similar to conventional laparoscopic surgery , was performed in most cases .
bladder cuff excision was performed by the extravesical approach and the bladder repair was performed by suture with a conventional laparoscopic needle holder using 3 - 0 vicryl with laparoty clips ( ethicon endosurgery , cincinnati , oh , usa ) in 4 cases .
cumulative perioperative outcomes for each operation are presented in table 2 . in all surgical cases ,
there were no accidents or complications in association with the use of a homemade single - port device during the surgery . for cases in which surgery
was performed for more than 2 hours , however , the surgical glove was stretched in three cases . in one case of ureterolithotomy ,
less via an umbilicus was first performed by piskun in 1999 for a cholecystectomy . since then
, it has been frequently performed in the field of urology as well as in the field of surgery .
kaouk et al reported that less was successfully performed in a total of 10 cases .
less was also reported to be successfully performed in the first 100 cases of a single center .
the conventional type of laparoscopic surgery requires 3 to 6 ports , and as a result many patients complain of transient pain at the incision site .
besides , in cases of pelvic surgery , damage to the inferior epigastric artery sometimes occurs after the insertion of a lateral port . in the case of less via an umbilicus , however , a single port only is used while maintaining the advantages of the conventional type of laparoscopic surgery .
in addition , it is also excellent from a cosmetic perspective compared with the open technique .
less leaves almost no operative scars . besides , because an incision is made via the umbilicus , damage to the organs on the peritoneal wall can be minimized .
furthermore , it may also be effective for bilateral cases . in the cases reported here ,
patients who had a bilateral lesion were also able to undergo bilateral less by using a single incision via a single umbilicus .
this implies that a single incision can be maximally used as compared with cases in which a laparoscopic port must be inserted , including those with a bilateral ureteral stone or bilateral renal tumor , which are often encountered in the field of urology . despite these advantages ,
however , the laparoscopic instruments are crossed in an x - shape as compared with the conventional types of laparoscopic surgery . accordingly , because it is difficult to manipulate the laparoscopic instruments , the surgical time is prolonged and refined surgery is difficult ; there are therefore some patients who are unwilling to undergo single - incision laparoscopic surgery . in our 30 patients ,
this patient was found to have xanthogranulomatosis pyelonephritis and was suspected of having an adhesion to the adjacent tissue .
actually , in the operation field , the adhesion was more severe than what was expected . within 3 hours
the learning curve for less can be overcome within a relatively short time . in all surgical cases ,
it was found to be decreased without a great difference from the surgical time of conventional laparoscopic procedures . in cases in which the surgical procedure was difficult due to adhesion or to difficulty in manipulating the laparoscopic instruments after a single incision was attempted ,
the scope of the surgical procedure could be widened because a conversion to conventional laparoscopy could be made at any time .
the laparoscopic ports that were used herein have been used overseas as well as in korea .
only one type of less port is approved for human use in korea , and this is commercially available only in korea . in association with this , park et al first reported nephrectomy in pediatric patients .
han et al reported their initial experiences with nephrectomy by using a homemade single - port device .
jeong et al compared the surgical outcomes of conventional laparoscopic adrenalectomy with those of less adrenalectomy .
park et al first reported their initial experiences with nephroureterectomy for a renal pelvis tumor .
in overseas countries , the r - port ( advanced surgical concepts , dublin , ireland ) is the representative less port .
the homemade single - port device that was used herein has advantages compared with the conventional types of r - port in that it is less expensive ( r - port vs. less port , 550,000 krw vs 350,000 krw ) , the instruments can be manipulated more freely , and a maximal number of five ports can be used .
based on these advantages , various types of laparoscopic ports can be designed according to the surgery or individual preferences . however , there are also disadvantages as follows
. the glove can become bulged following a long - term surgery and this may interfere with the surgical procedure .
the glove can also be pierced while a needle is inserted and then pulled out .
compared with the commercially available less port , there are additional processes where a port is made and then placed .
less is a relatively safe , effective treatment technique in benign disease . for malignant disease , however , prospective study of less with large samples is needed .
less was very difficult to perform in advanced disease in our cases as compared with conventional laparoscopic surgery .
various types of single - port devices have now become commercially available , but we consider the homemade single - port device to be a relatively cost - effective and convenient device .
if various types of surgical instruments for less and appropriate ports specified for less are developed , less should be an alternative to the conventional types of laparoscopic surgery . | purposewe present our initial experience with laparoendoscopic single - site surgery ( less ) by a single surgeon in the urologic field.materials and methodsfrom may 2009 to april 2010 , 30 consecutive patients underwent less including seven cases of nephrectomy , five cases of nephroureterectomy with bladder cuff excision , four cases of ureterolithotomy , eight cases of marsupialization , and six cases of varicocelectomy .
we performed a retrospective analysis of the medical records of the above patients .
the single port was made with a surgical glove and an alexis wound retractor ( applied medical , rancho santa margarita , ca , usa ) .
the wound retractor was put into the peritoneal space through an umbilical incision , and a laparoscopic triangle was secured by crossing both instruments .
all operations were performed by the transperitoneal approach.resultsmean patient age was 54.8 years .
mean operative time was 171.2109.1 minutes .
mean estimated blood loss was 265.0395.5 ml .
mean incision length was 3.21.4 cm .
mean length of hospitalization was 5.22.9 days .
there was one laparoscopic conversion and two open conversions .
there were two cases of transient ileus that improved with conservative treatment .
mean visual analogue pain scales on the operative day and first postoperative day were 6.3/10 and 3.1/10 , respectively.conclusionsin our experience , less for urologic surgery is feasible , safe , and clinically applicable .
we consider the homemade single - port device to be a relatively cost - effective and convenient device .
if surgical instruments for less and appropriate ports specified for less are developed , less would be a surgical treatment technique that could be used as an alternative to the conventional types of laparoscopic surgery . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUSIONS |
nonscalpel vasectomy ( nsv ) is a modified and sophisticated technique of vasectomy that requires no incision but only a small puncture and no stitches .
this is a safe and simple procedure that can be performed in low - resource settings .
nsv technique was introduced in india in 1992 to increase male participation in family planning . despite being a simple and safe method
, nsv seems to have failed to achieve its goal . according to the national family health survey-3 ( nfhs-3 ) ,
the current acceptance of nsv in india has declined from 1.9% to 1% in nfhs-2 .
this questionnaire - based survey was conducted to get insight into apathy of men towards nsv and their current family planning practices .
sample size was calculated using the following formula . considering 50% awareness of population about nsv ( p = 0.5 ) , sample size was calculated to be 384 with 95% confidence level and 5% precision of estimate ( d = 0.05 ) :
( 1)n = z2(p)(1p)d2 .
healthy male attendants ( aged 1850 years ) of the patients admitted to a tertiary teaching hospital of north india .
the participants were married , having at minimum one child , and had not been sterilized previously .
first part consisted of eight questions about demographic data ( e.g. , age of the respondents , age of their wife , number of alive children , age of their youngest child , and information to calculate their kuppuswamy 's socioeconomic status scale ( education , occupation , and family income ) ) .
no question which could have identified their identity including name , address , caste , or religion was asked .
second part consisted of 13 close - ended questions : eight questions to assess their knowledge about nsv , four to assess their attitude towards male sterilization and nsv , and one to assess if they had been using any contraception .
there were two open - ended questions also in the second part of questionnaire : one to assess their present choice of contraception if they had been using , while another question was to know their source of information about nsv .
mean age of the respondents was 32.43 5.92 years and mean age of their wives was 28.60 5.45 .
the number of children they had ranged from 1 to 7 ( median = 2 ) .
their mean kuppuswamy 's socioeconomic score was 14.25 4.80 , corresponding to lower middle class iii .
there were 74.1% respondents who believed that limiting family size will help them stabilize their financial condition .
barrier method and copper t were the most popular methods used by 36.3% and 35.9% respondents using family planning methods , respectively .
tubectomy ( female sterilization ) , oral contraceptive pills , and injectable contraceptives were used by 12.1% , 11.7% , and 3.8% respondents , respectively .
most of the respondents ( 97.4% ) were aware of vasectomy as a method for permanent male sterilization ( table 1 ) .
television was reported to be their main source of information ( 47.7% respondents ) followed by friends ( 24.2% ) .
other sources of information were radio ( 16.7% ) , magazines ( 4.5% ) , posters ( 3.5% ) , newspaper ( 2.3% ) , and pamphlets ( 0.7% ) .
the majority of them ( 97.2% ) knew that nsv is done without any charge and cash incentive is given to the nsv client after the procedure .
however , only half of the respondents ( 50.9% ) had knowledge that a monetary compensation is given to the nsv client in case a complication occurs following the procedure , or if the procedure fails . as high as 75.2%
the fact that nsv does not require prolonged bed rest and does not affect sexual performance was known to 62.9% and 69.6% respondents .
a large number of respondents ( 89.7% ) believed that males must also take family planning responsibility .
seven out of ten ( 68.0% ) respondents agreed that permanent sterilization is a possible option for them .
however , only 34.1% respondents were willing to adopt nsv as a method of family planning .
reasons cited by the respondents for unwillingness to adopt nsv were fear of surgical procedure ( 40.7% ) , permanent nature of procedure ( 22.2% ) , religious beliefs ( 19.0% ) , decrease in sexual function ( 10.5% ) , and requirement of prolonged bed rest following procedure affecting daily earnings ( 7.5% ) .
provisional total of population of india is reported to be 1210.2 million after 2011 census .
the percentage decadal growth during 20012011 has registered the sharpest decline since independence a decrease of 3.9 percentage points from 21.54 to 17.64 . however
, this decline does not undermine the importance of continued efforts to promote family planning measures .
data from national family health survey- ( nfhs-)3 indicated that 56.3% of currently married women were using some method of contraception in 2005 - 2006 .
our study also corroborates the same as 54.0% respondents in our study confirmed to be practicing some method of contraception .
nfhs-3 indicated that only 1% currently married women reported male sterilization as a method of family planning in this survey .
this reported use of male sterilization was even worse than indicated by the national family health survey- ( nfhs-)2 during 1998 - 1999 .
nfhs-2 showed that 1.9% currently married women reported male sterilization as a method of family planning .
almost all the respondents ( 97.4% ) were aware of the nsv as a family planning method .
their source of information was mainly television and friends while printed advertisements ( magazines , pamphlets , and posters ) hardly contributed anything in spreading knowledge .
it seems that circulation of information about family planning by word of mouth is very important .
there has been a general assumption that men , exercising dominations in gender relations , end up shunning of their responsibility of family planning .
however , our study provides a new insight as almost nine of ten respondents believed that family planning is also the responsibility of males .
it is further important to highlight the fact that only 68.0% of the male respondents approve male sterilization as a possible option of family planning for them .
this highlights the fact that there is large gap in their knowledge about advantages of vasectomy which contribute to their reluctance to undergo vasectomy .
fear of surgical procedure was cited as the most frequent cause ( 40.7% ) for unwillingness to accept nsv .
many advantages of nsv including no incision , no stitches , and minimal pain were known to only two - thirds of the respondents .
it becomes imperative that the procedure should be promoted as simple and painless , and campaign materials should refrain from using the word operation in conjunction with nsv .
furthermore , it also merits to be highlighted that a monetary compensation would be given to the client if any complication occurs due to the procedure or in case of failure of the procedure ; this fact is known to only half of the respondents ( 50.9% ) .
permanent nature of vasectomy was the second common cause ( 22.2% ) for unwillingness to accept nsv .
there are a number of reasons for the concern including difficult or impossible remarriage if the current wife dies as person will not be able to father any children after being permanently sterilized , or what he would do if all of his living children died [ 79 ] .
these worries may be overcome by propagating advantages of permanent family planning method , in case family is complete .
nsv needs to be propagated as one - time simple and safe solution to the worry felt at the time of intercourse .
awareness of problems associated with other family planning methods ( side effects of intrauterine device , associated uneasiness with condoms , and problem of daily intake of oral contraceptive pills ) may prove a trigger for promoting a person to take a final decision about nsv .
religious reasons were cited by the respondents as a third common barrier to nsv uptake .
it may definitely be inferred that involvement of community leaders may enhance the acceptability of nsv .
requirement of prolonged bed rest after vasectomy was another important reason cited by the respondents for their reluctance to adopt nsv .
this is highlighted by the fact that only 37.1% respondents were not of clear opinion that nsv does not require prolonged bed rest .
this aspect is likely to be important for the people who work on the basis of daily wages .
promotional activities should specifically highlight this important issue that the clients may join their work the next day following the nsv .
worry about the impact on sexual life following nsv was another barrier to nsv uptake .
a large number of respondents ( 31.4% ) were not sure that sexual performance would not be affected following nsv .
this aspect was also highlighted in another survey where it was noted that men would not tell other people if they had been sterilized , fearing being shamed and taunted by community members , who might refer to them using such words as namard ( meaning infertile ) . in a survey conducted to study the factors affecting vasectomy acceptability in the kigoma region of tanzania , it was pointed out rumors that vasectomy results in decreased sexual desire or performance or that the procedure is equivalent to castration were prevalent and were mentioned by respondents . in conclusion
, the nsv promotional activities should focus on bridging the prevailing information gap regarding nsv among the potential clients . a client satisfied with nsv
kaza , nsv master trainer to the government of india as follows : nsv is as much an iec operation as a surgical operation .
airing positive stories and examples of successful nsv cases through the powerful media of television is likely to improve the acceptability of nsv among the masses .
there is a need to design and develop a need - based iec strategy to bridge the existing information gap among the eligible couples regarding nsv to improve its adoption .
involvement of community leaders and satisfied clients in the promotional activities and utilization of television and radio would enhance the effectiveness of such interventions . | though nonscalpel vasectomy ( nsv ) technique was introduced in india in 1992 to increase male participation in family planning , it has failed to get adequate momentum and to achieve its goal .
we conducted a cross - sectional questionnaire - based survey to get insight into apathy of men towards nsv .
the study included 428 respondents .
most of the respondents ( 97.4% ) were aware of nsv as a method for permanent male sterilization .
the majority of them ( 97.2% ) knew that nsv is done without any charge and cash incentive is given to the nsv client after the procedure .
though 68.0% respondents agreed that permanent sterilization is a possible option for them , only 34.1% respondents were willing to adopt nsv as a method of family planning .
fear of surgical procedure ( 40.7% ) , permanent nature of procedure ( 22.2% ) , and religious belief ( 19.0% ) were the common reasons for unwillingness to adopt nsv .
we conclude that there is a need to design and develop need - based information , education and communication ( iec ) strategy to bridge the existing information gap among the eligible couples regarding nsv to improve its adoption .
involvement of community leaders and satisfied clients and utilization of television and radio would enhance the effectiveness of such interventions . | 1. Introduction
2. Methods
3. Results
4. Discussion |
with the proliferation of cross - sectional imaging , detection of an incidental adrenal mass has become a common problem .
adrenal incidentalomas are detected on approximately 5 to 8% of all high - resolution abdominal imaging studies .
the diagnostic strategy is well established for adrenal adenomas and relies on the detection of intracellular lipids ( using noncontrast ct or chemical shift mri ) and on the measurement of contrast washout kinetics on multiphasic ct [ 27 ] . however , about 12% of adrenal incidentalomas , including benign tumors , can not be characterized by ct or mri : these indeterminate adrenal masses are considered as suspect and may have ct follow - up and pet - ct exploration , and some may be surgically removed or biopsied in oncology patients .
being able to identify those indeterminate adrenal masses would avoid unnecessary follow - up , surgery , and making erroneous staging in oncology patients .
the objective of our research is to study the value of 18-fdg pet / ct and reassess the value of ct for the characterization of indeterminate adrenal masses .
imaging files of 205 patients with 208 adrenal masses consecutively surgically resected or biopsied ( 2 metastases ) between june 2006 and june 2010 were retrospectively reviewed .
all patients had undergone thin - collimation computed tomography ( ct ) ( unenhanced ct , contrast material - enhanced , with 10-minute delayed ct scan ) or 18-f - fdg pet / ct .
19 patients ( 21 masses ) for which ct or 18f - fdg pet / ct images were not available were excluded .
adrenal masses with typical imaging features of adenomas ( 92 masses with unenhanced density of less than 10 hu , an absolute percentage washout above 60% , or a signal intensity index above 20% ) , pheochromocytomas ( 23 masses ) , cysts ( 1 mass ) , and hematomas ( 4 masses ) were excluded from the study .
our hospital includes a department of endocrinology , which is also a reference center for adrenal cortical carcinomas , contributing to their relatively large proportion ( figure 1 ) .
our institutional review board approved this retrospective study and waived the requirement for informed consent .
adrenal masses were examined by siemens sensation scanner ( 16-detector ) or siemens definition scanner ( 64-detector ) .
ct acquisition was performed before injection , at one minute after intravenous injection of 100 ml of nonionic contrast material with an iodine concentration of 300 mg / ml and at a delayed phase fixed at 10 min .
15-minute delayed protocol is classically used for washout analysis ; however several studies have shown the absolute contrast enhanced percentage washout test accuracy using 10-minute delayed contrast enhanced ct [ 9 , 10 ] . imaging with 18-f - fdg - pet / ct
was performed on a gemini dual philips medical system ( between 2006 and 2008 ) and on a gemini tf 16 philips medical system ( between 2008 and 2010 ) that combines a helical dual slice ct and a pet machine , with an emission scan of 3 min duration per bed position .
patients fasted 12 h. diabetic patients were prepared with oral antidiabetic medications or insulin the days before 18-f - fdg - pet / ct to obtain a glycemia less than 150 mg / dl .
they were premedicated with diazepam and rested for 1 h. imaging was performed 60 min after iv administration of 18-f - fdg ( 5 mbq / kg ) .
mr images were obtained using siemens avento mri 1.5 t ( erlangen , germany ) or ge signa mri 1.5 t ( milwaukee , wi ) closed mr system .
a phased - array body multicoil was used in all mr sequences ( including t1 , t2 , diffusion , and in and out of phase acquisitions ) .
all ct of 67 adrenal masses were retrospectively reviewed independently by two senior radiologists with more than ten years ' experience in abdominal imaging ( pl , ss ) , who were blinded to the pathologic diagnosis , and a junior radiologist with more than three years ' experience ( nl ) .
ct scans were evaluated for their morphologic and enhancement features with the soft - tissue window setting . to assess the morphologic features of the masses , the observers measured the maximal diameter of the tumors , attempted to determine the contour , the homogeneity of the lesions on unenhanced images , the presence of macroscopic fat , calcifications , hemorrhage , solid tissue nodules , walls , and cystic / necrotic regions .
the textures of the lesions were classified as homogeneous or heterogeneous on unenhanced ct images . for analysis of tumor enhancement features ,
the observers determined the following : homogeneous or heterogeneous enhancement patterns and the relative and absolute washout values . for the ct images , an absolute percentage washout ( apw )
was calculated as follows from the attenuation values recorded on the unenhanced , dynamic , and delayed images absolute : apw = ( enhanced delayed)/(enhanced unenhanced ) 100% .
concerning 18-f - fdg pet / ct data , suvmax and adrenal to liver maxsuv ratio were considered for statistical analysis , as previously described by groussin et al . who proposed an adrenal to liver maxsuv ratio cutoff value of 1.45 to distinguish between adrenocortical carcinomas and adrenal adenomas , with a sensitivity of 100% and a specificity of 88% , which was higher than the specificity of 70% obtained with the suvmax cutoff value . to determine the differences in imaging features between atypical adenomas , metastases , and adrenocortical carcinomas , the student test , the mann - whitney test , the -test , and the fisher exact test were used .
the discriminative properties of 18f - fdg pet / ct were investigated by receiver - operating characteristic ( roc ) analysis .
the area under the curve was assessed , and the sensitivity and specificity were determined for an optimal cutoff of the suvmax and of the adrenal to liver maxsuv ratio .
sixteen adenomas , eighteen metastases , and thirty - one adrenocortical carcinomas were examined by ct .
twelve adenomas , eight metastases , and twenty - three adrenocortical carcinomas were examined by 18f - fdg pet / ct .
the mean age of the patients with adrenocortical adenomas was 64 years 4 ( nine women ( mean age , 64.1 8.4 ; age range , 55.772.5 years ) ) ( seven men ( mean age , 63.9 3 ; age range , 6167 years ) ) .
87.5% of the atypical adenomas were nonsecreting adenomas and 12.5% were cushing 's adenomas ( urinary free cortisol > 100 mcg/24 h and adrenocorticotropic hormone ( acth ) < 6 pg / ml ) .
sixteen adrenocortical adenomas were examined by ct : their margins were regular and well - defined in all cases ; 93.75% of them were heterogeneous presenting macroscopic fat ( 62.5% ) ( evaluated with ct sequences with an unenhanced density lower than 40 hu ) ( figures 2 and 3 ) , 31.3% of them contained cystic areas , 12.5% of them contained hemorrhagic areas and 81.3% of them contained calcifications .
their mean unenhanced density was 27 hu 6.7 ( range , 1437 hu ) .
eleven adenomas were examined by multiphase ct : 36.3% of them presented a washout , with a mean absolute value of 30.5% ( range , 1751% ) .
the other adenomas ( 63% ) showed persistent enhancement throughout the 10 min delayed phase ( zero washout ) .
their mean suvmax was 3.24 ( range , 1.694.79 ) and their mean ( suvmax)/(suv liver ) value was 1.33 ( range , 0.572.09 ) .
18f - fdg pet / ct images did not show significant uptake ( > 2 times liver uptake value ) for 11 adenomas .
however one adenoma showed a high uptake value ( suvmax : 10.3 , adrenal to liver maxsuv ratio : 5 ) ; this adenoma at pathological analysis had a weiss score of 2 .
adrenal tumors with a weiss score of between 0 and 2 are considered to be benign , while adrenal tumors with a weiss score of more than 3 are considered to be malignant . at pathologic examinations ,
thirteen adrenal adenomas ( 81.2% ) presented a weiss score of 0 , two ( 12.5% ) presented a weiss score of 1 , and one ( 6.2% ) presented a weiss score of 2 .
six adenomas ( 37.5% ) contained focal regions of hemorrhage , and three ( 18.7% ) contained macroscopic fat .
mean unenhanced density was 34 hu . six metastases were examined by multiphasic ct and their mean washout value was 11% .
adrenal metastases showed high uptake value ( figure 4 ) with a mean suvmax of 7.56 ( range , 4.910.2 ) and an adrenal to liver maxsuv ratio of 2.68 ( range , 1.73.6 ) . at pathologic examinations ,
mean age was 49.6 years 6.5 for adrenal cortical carcinomas and female / male ratio was 1.9 .
56% of the adrenocortical carcinomas with available biological data ( 26 masses ) were nonsecreting .
18.5% secreted both androgen and steroid hormones , 15% caused cushing syndrome , 7.4% secreted only androgen , and 3.7% secreted estrogen .
58.8% of the adrenal cortical carcinomas presented ill - defined heterogeneous cystic areas ( figure 5 ) .
mean suvmax was 11.38 ( range , 8.6114.15 ) and mean adrenal to liver maxsuv ratio was 4.3 ( range , 3.315.28 ) for adrenal cortical carcinomas ( figure 5 ) .
the mean unenhanced density was 27 hu for adrenocortical adenomas and 34 hu for metastasis on ct ( p = 0.016 ) ( table 1 ) .
62.5% of adrenal adenomas presented macroscopic fat , while none of the metastases contained macroscopic fat ( table 1 ) .
81.3% of the adrenocortical adenomas were calcified , while none of the metastases contained calcifications .
12.5% of the adrenocortical adenomas and 6% of the adrenal metastasis contained hemorrhagic deposits ( p > 0.05 ) .
on 18f - fdg pet / ct , maximum standardized uptake values ( suvmax ) were significantly lower for adenomas ( 3.24 ) than for metastases ( 7.56 ) ( p < 0.05 ) .
adrenal to liver maxsuv ratio was significantly lower for adenomas ( 1.33 ) than for metastases ( 2.68 ) ( table 1 ) .
mean age was 64 years 4 for adrenocortical adenomas and 49.6 years 6.5 for adrenal cortical carcinomas ( < 0.05 ) .
the mean of maximum diameters was 4.8 cm 1.4 for adrenocortical adenomas and 8.3 cm 1.2 for adrenal cortical carcinomas ( p = 0.001 ) ( table 1 ) .
all adenomas had well - defined margins , while only 41.2% of adrenal cortical carcinomas did .
62.5% of the adrenal adenomas presented macroscopic fat on ct , while none of the adrenal cortical carcinomas did .
on 18f - fdg pet / ct , maximum standardized uptake values ( suvmax ) were significantly lower for adrenal adenomas ( 3.24 ) than for adrenal cortical carcinomas ( 11.1 ) ( p < 0.05 ) .
adrenal to liver maxsuv ratio was significantly lower for adenomas ( 1.33 ) than for adrenocortical carcinomas ( 4.3 , p < 0.05 ) .
81.3% of the adrenocortical adenomas and 20.6% of the adrenal cortical carcinomas were calcified ( p < 0.001 ) .
62.5% of adrenal adenomas presented macroscopic fat on ct , while none of the malignant masses did ( p < 0.05 ) .
calcifications , hemorrhagic areas , heterogeneity , and the presence of walls had no diagnostic value for or against malignancy . on 18f - fdg pet
/ ct , maximum standardized uptake values ( suvmax ) were significantly lower in the adenomas ( 3.24 ) than in malignant tumors ( 10.3 ) ( p < 0.05 ) .
adrenal to liver maxsuv ratio was significantly lower in atypical adenomas ( 1.33 ) than in malignant tumors ( 3.9 , p < 0.05 ) .
figure 6(a ) displays the roc plots for maxsuv : discrimination was very good with an area under roc curve of 0.93 ( 95% confidence interval ( ci ) 0.841.00 ) . using 3.7 as a cutoff value for suvmax , a sensitivity of 96.7% ( 95% ci 0.830.99 ) and a specificity of 83.3% ( 95% ci 0.550.95 )
figure 6(b ) displays the roc plots for adrenal to liver maxsuv ratio : discrimination was good with an area under roc curve of 0.91 ( 95% confidence interval ( ci ) 0.791.00 ) . using 1.29 as a cutoff value for adrenal to liver maxsuv ratio , a sensitivity of 96.7% ( 95% ci 0.830.99 ) and a specificity of 83.3% ( 95% ci 0.550.95 )
although progress has been made at imaging with ct and mri for the diagnosis of adrenal masses , some incidentalomas remain undetermined .
though the diagnostic strategy is well established for typical adrenal adenomas , pheochromocytomas , cysts , myelolipomas , or hematomas , a significant number of adrenal masses remain indeterminate .
these tumors are usually removed , with potential surgical complications , such as splenectomy , kidney removal , or massive hemorrhage . among these tumors , adenomas with atypical imaging features , which are benign ,
the characterization of the atypical adenomas is crucial in the following 3 cases.incidentalomas : the diagnosis of an adenoma would be followed up by ct examinations only , whereas further investigations and treatments would be necessary for metastases or adrenocortical carcinomas.secreting masses : it is important to differentiate adenomas and adrenal cortical carcinomas in the case of cushing syndrome .
the prognosis and the treatment would be different depending on the nature of the tumor .patients with known cancer : the prognosis and the treatment would completely change according to the tumor 's nature ( adenoma or metastases ) .
incidentalomas : the diagnosis of an adenoma would be followed up by ct examinations only , whereas further investigations and treatments would be necessary for metastases or adrenocortical carcinomas .
secreting masses : it is important to differentiate adenomas and adrenal cortical carcinomas in the case of cushing syndrome .
the prognosis and the treatment would be different depending on the nature of the tumor .
patients with known cancer : the prognosis and the treatment would completely change according to the tumor 's nature ( adenoma or metastases ) . until now , only one study focused on a series of large adrenal adenomas with histologically atypical features .
30 adenomas larger than 5 cm with histologically atypical features were compared to 24 adrenal cortical carcinomas .
this study could not show any significant difference between the imaging features of atypical large adenomas and adrenal cortical carcinomas .
more recent studies focused on the evaluation of new techniques such as spectroscopy mri , dynamic enhanced mri , diffusion weighted mri , perfusion ct , and contrast - enhanced ultrasonography for the characterization of adrenal masses [ 1624 ] . a recent study focused on the value of spectroscopy mri in order to distinguish adrenal adenomas , pheochromocytomas , metastases , and adrenal cortical carcinomas , with interesting results concerning choline / creatine and 4.04.3/creatine ratios
however , most of the 38 adenomas included presented typical imaging features , except one which could not be characterized by ct .
another study examined the value of dynamic contrast enhanced mri in the differential diagnosis of adrenal adenomas and malignant adrenal masses , with promising results concerning contrast enhancement patterns and time - to - peak values .
however most of the 48 adenomas included were typical , except 4 adenomas which could not be characterized after chemical shift on mri .
other studies focused on the improvement of techniques already used to characterize adrenal masses , such as chemical shift sequences [ 2527 ] or contrast washout kinetics on multiphase ct . in our study ,
macroscopic fat was only found in adenomas : 62.5% of adrenal adenomas presented macroscopic fat on ct , while none of the malignant masses did ( p < 0.05 ) . in the literature , however , 3 cases of adrenocortical carcinomas containing macroscopic fat were reported [ 2830 ] .
the reported cases presented similar imaging features including large size , heterogeneous peripheral enhancement , and a relative small amount of macroscopic fat .
though the presence of macroscopic fat in an adrenal tumor usually indicates benignity , adrenocortical carcinomas should be considered as differential diagnosis if features suggesting malignancy are associated .
calcifications , hemorrhagic areas , heterogeneity , and the presence of walls ( except for metastasis ) had no diagnostic value for or against malignancy .
our study results show that poorly defined margins tend to indicate malignancy ( p < 0.05 ) . on 18f - fdg pet
/ ct , maximum standardized uptake values ( suvmax ) were significantly lower in the adenomas ( 3.24 ) than in malignant tumors ( 10.3 ) ( p < 0.05 ) .
adrenal to liver maxsuv ratio was significantly lower in atypical adenomas ( 1.33 ) than in malignant tumors ( 3.9 , p < 0.05 ) .
one benign atypical adenoma showed a high suvmax ; however it also presented the highest weiss score , 2 , among our series of adenoma . using 3.7 as a cutoff value for suvmax or 1.29 as a cutoff value for adrenal to liver maxsuv ratio , a sensitivity of 96.7% ( 95% ci 0.830.99 ) and a specificity of 83.3% ( 95%
demonstrated that quantitative pet with the use of mean or maximal suvs had a sensitivity of 97% and a specificity of 87% for characterizing adrenal masses as malignant .
their meta - analysis showed that qualitative pet had the same sensitivity ( 97% ) and a better specificity ( 91% ) for characterizing adrenal masses as malignant .
our results also are similar to those demonstrated by groussin et al . who demonstrated a high sensitivity and specificity of quantitative pet / ct for distinguishing between adrenal adenomas and adrenocortical carcinomas especially using liver maxsuv ratio with a sensitivity of 100% and a specificity of 88% for the cutoff value of 1.45 and a sensitivity of 100% and a specificity of 70% using suvmax with a cutoff value of 3.4 .
18f - fdg pet / ct allowed a correct diagnosis in 13 of 15 adenomas which remained undetermined at ct .
18f - fdg pet / ct has a high sensitivity and specificity to characterize undetermined adrenal masses [ 31 , 32 ] and the value of suvmax may be correlated to the weiss score . in oncology patients presence of macroscopic fat as well as low suv uptake in undetermined adrenal masses at ct and mri should be taken in consideration together with biopsy in order not to worsen prognosis .
same imaging features should be used to evaluate diagnosis of adrenocortical adenomas versus malignant masses .
presence of macroscopic fat in the case of well - defined adrenal incidentalomas of less than 5 cm would be a good indicator to follow up the mass instead of resecting it .
however , our study provides a relatively large series of pathologically proven adrenocortical atypical adenomas , adrenal metastases , and adrenocortical carcinomas , seen on ct , mri , or 18-f - fdg pet / ct .
second , the study only focused on excised masses , because a pathologically proven diagnosis was necessary . moreover , diagnostic problems generally occurred for operable patients without extensive metastatic diseases .
it may be assumed that in a different patient demographic with fewer adrenocortical carcinomas the sensitivity reported for the 3.7 suv cutoff will decrease and the specificity will not be significantly impacted . in conclusion , this large series of all pathologically confirmed adrenal masses including adrenocortical atypical adenomas , adrenal metastases , and adrenocortical carcinomas showed that the presence of macroscopic fat on ct is an important indicator of benignity for adrenal tumors that remain indeterminate .
18f - fdg pet / ct is highly sensitive and specific for distinguishing between benign and malignant adrenal tumors especially in case of indeterminate adrenal masses . | the purpose of this paper was to study the value of 18-fdg pet / ct and reassess the value of ct for the characterization of indeterminate adrenal masses .
66 patients with 67 indeterminate adrenal masses were included in our study .
ct / mri images and 18f - fdg pet / ct data were evaluated blindly for tumor morphology , enhancement features , apparent diffusion coefficient values , maximum standardized uptake values , and adrenal - to - liver maxsuv ratio . the study population
comprised pathologically confirmed 16 adenomas , 19 metastases , and 32 adrenocortical carcinomas .
macroscopic fat was observed in 62.5% of the atypical adenomas at ct but not in malignant masses .
on 18f - fdg pet / ct , suvmax and adrenal - to - liver maxsuv ratio were significantly lower in adenomas than in malignant tumors .
an suvmax value of less than 3.7 or an adrenal - to - liver maxsuv ratio of less than 1.29 is highly predictive of benignity . | 1. Introduction
2. Materials and Methods
3. Results
4. Discussion |
classical ( pre-1950 ) biophysics ( reviewed in gratzer , 2011 ; pederson , 2014 ) did not worry much about differences between nucleus and cytoplasm , mainly because the focus of physiology was on the latter compartment ( needham , 1971 ) and in particular on actomyosin function ( hanson and huxley , 1953 ) .
francis crick studied the viscosity of cytoplasm ( crick , 1950 ; crick and hughes , 1950 ) , which is a still - intriguing issue .
the nucleus sat in crick 's field of microscope observation as a sideshow , its dna waiting quietly for his future attentions .
the nucleus was of necessity destroyed in early dna studies , in which pus - filled bandages were the source and harsh extraction conditions were applied ( portugal and cohen , 1977 ) , but subsequently , the organelle was isolated and studied ( pederson , 2011 ) .
it soon became apparent that nuclei , both isolated and studied within intact cells , had physical properties different from the cytoplasm .
for example , the nuclear envelope can display a membrane resting potential of about 15 mv ( loewenstein and kanno , 1962 , 1963 ) .
electrical and related osmotic responses of isolated ( anderson and wilbur , 1952 ) and in - cell nuclei ( robbins et al . , 1970 ) , when differentially responding to elevated extracellular na , clearly indicate a basal osmotic strength different from cytoplasm .
these early studies illustrate the key fact that the nucleus is a distinct place not just in macromolecule populations but in basic physical properties .
electron microscopy of the 1950s presented the nucleus in high resolution , revealing that there are no internal membranes and that the chromatin , nucleolus , and other nuclear components are mixed together .
this suggested that dna replication , transcription , rna processing , and other nuclear functions occurred via a wild melee of molecular interactions .
later this was refined by the realization that many dna - acting ( and some rna - acting ) proteins are confined to nucleic acid by nonspecific interactions that provide efficient kinetic pathways to search for specific targets ( von hippel et al .
the notion followed that many nuclear functions may depend on the tethering of key factors to pre - existing entities .
the scheme of folding of the gigantic lengths of dna ( 2 m in the human case ) inside the interphase nucleus remains a deep puzzle .
even the question of the physiological relevance of the 30-nm fiber observed in biochemical studies remains open ( joti et al .
individual interphase chromosomes lie in close apposition to one or more others , occupying distinct territories ( cremer and cremer , 2010 ) .
2002 ) has suggested a space - filling fractal globule folding scheme with intriguing functional consequences , most notably reduction of chromosome entanglements relative to the null hypothesis of random coil - like polymer organization ( lieberman - aiden et al .
. meanwhile , in the nuclear space not occupied by the genome , rnas move by diffusion ( mor et al .
, 2010 ; pederson , 2011 ) , or more precisely by anomalous subdiffusion ( saxton , 2007 , 2012 ) arising from nuclear cul - de - sacs and short - lived contacts with chromatin . here , in the interphase nucleoplasm between the chromosomes ,
various nuclear bodies are found and , in many cases , dynamically accrete and shed their parts ( e.g. , deryusheva and gall , 2004 ) . all this choreography
after years of being perceived as static , the nuclear lamina has recently become recognized as one of the most dynamic regions of the nucleus ( shimi et al . , 2008 ) .
after this lightning review of nuclear biology , we turn to brief consideration of physical perspectives concerning cell nuclei . to date , only occasional efforts along this line have been mounted ( e.g. , o'brien et al . , 2003 ) , and it is most timely to take this up once again .
like all objects at nonzero temperature , chromosomes are subject to random thermal motion ( marshall et al . , 1997 ) .
recombination and translocations are depicted in textbooks as neat deterministic processes , but the reality must be much more stochastic .
the discoveries that the dna repair machinery ( houtsmuller et al . , 1999 ) and the internucleosomal histone h1 ( lever et al . , 2000 ; misteli et al . , 2000
) display remarkably rapid exchange on and off the dna revealed a highly dynamic molecular dance .
this applies also to the conformation of chromatin itself , which must be undergoing thermal agitation of its shape .
remarkably , we still have only a rather poor understanding of the polymer properties of chromatin in vivo which may be related to the imbroglio of the 30-nm fiber structure isolated fibers may well behave very differently from fibers in a chromatin - crowded and highly reactive nuclear environment .
even poorer is our understanding of exactly how interphase chromatin is put into and maintained in its folded ( fractal globule ? ) form a form that requires control of distant site correlations . and how do smc complexes and topoisomerases achieve the feat of mitotic chromosome compaction with such efficient individualization of chromosomes and resolution of sister chromatids within them in the confinement of the nucleus ? these are compelling questions for physical biologists that might be addressed using single - molecule and micromanipulation approaches ( strick et al . , 2004 ; marko , 2008 ) .
these issues bear on how genes might spatially congress or disperse during embryonic development or a cell differentiation pathway .
a controversial claim that this involves an intranuclear motor has not been replicated ( reviewed by belmont , 2010 ) .
yet it would seem that moving a pair of genes , residing on two chromosomes or within one , from distal to vicinal locations within a genome with regulated three - dimensional folding could not be left to diffusion alone which would be a threat to the fractal architecture .
after half a century of skepticism , actin and myosin have been now been convincingly demonstrated in the nucleus ( gall , 2006 ; pederson , 2008 ; belin and mullins , 2013 ; belin et al . , 2013 ) , but the jury remains out on them having any role in gene relocation .
the fluid viscosity of the nucleoplasm has been measured to be five times that of water ( wachsmuth et al . , 2000 ) , and as mentioned above , proteins and rna move within the nucleoplasm by anomalous diffusion .
the nucleoli and histone locus bodies arise from activity of proximal genes , with their activities producing proximal cytological entities .
cajal bodies , which are not always located near chromosomes , can be induced to form by artificially tethering their protein components to a chromosomal site ( kaiser et al . , 2008 ) ; indeed , various nuclear bodies can be nucleated by chromosome - tethered coding or noncoding rnas ( reviewed by shevstov and dundr , 2011 ) . in a related study
, it was demonstrated that one type of nucleoplasmic body , the paraspeckle , can be nucleated by a nascent rna transcript ( mao et al . , 2011 ) , implying that the aforementioned experiments targeting proteins or rnas artificially to chromosomes are mimicking the in vivo situation .
while it is possible that these nuclear body assembly processes involve solely second - order ( molecular collision dependent ) kinetics , one is reminded of how molecular crowding can influence such events ( zhou et al . , 2008 ; hancock , 2014 ) , and we would point to ( bio)physical chemistry as a fertile ground for new explorations in the nucleus .
in general , the problem of programmed self - assembly of nuclear structures , including the influence of nonthermal reactions , is one that merits increased experimental and theoretical study .
another quite recent development has been the notion that some nuclear structures might arise by actual phase transitions ( toretsky and wright , 2014 ) .
the first example of this new line of thinking arose in a study of the extrachromosomal , amplified nucleoli in the germinal vesicle ( nucleus ) of xenopus oocytes in which the investigators observed these organelles to possess a liquid droplet - like behavior and a size distribution indicative of a scale - free power law ( brangwynne et al .
subsequent studies have suggested that phase transition based phenomena may be at play in the assembly of rna protein complexes in the nucleus , although these latter biochemical studies still need to be related to the in vivo situation ( han et al . , 2012 ;
, 2012 ; weber and brangwynne , 2012 ; reviewed by brangwynne , 2013 ) . a key finding by kato et al .
implicated protein used in this study underlie the in vitro assembly of rna granules , which raises the possibility that amyloid - like protein associations with rna may be a factor in this and other neurodegenerative diseases .
we suggest that , like macromolecular crowding , phase - transition principles need consideration in current research on nuclear organization and dynamics .
the nucleus is surrounded by a double membrane , the nuclear envelope , the outer membrane of which is contiguous with the endoplasmic reticulum , forming a structure of impressive complexity ( what is the topological genus of the nuclear envelope
endoplasmic reticulum structure how many handles does it have ? ) . a plausible but unproven idea ( dolan , 2012 ; dolan et al .
, 2002 ; pederson , 2013 ) is that the inner nuclear membrane of eukaryotic cells is an artifact of the cell membrane of an ancient protist , whose invasion of another anucleate cell triggered the evolution of the eukarya .
the inner and outer nuclear membranes are compositionally distinct , as are their physical properties . lying beneath , on the nucleoplasmic side ,
as mentioned above , the nuclear lamina was once thought to be relatively static but is now known to be highly dynamic and perhaps rather less dense than implied by the pictures in many cell biology textbooks .
stationed within the nuclear envelope are nuclear pores , more recently known as nuclear pore complexes due to their molecular complexity , through which pass rna and proteins in either direction .
given the enabling history of physics - oriented plasma membrane research ( danielli and davson , 1935 ; frye and edidin , 1970 ; edidin and weiss , 1972 ; yguerabide and stryer , 1971 ; singer and nicholson , 1972 ) , the nuclear envelope is a domain of the nucleus in which thinking in terms of physics might have been anticipated to be especially lively . and yet , overall , this had not been the case .
that said , recent studies illuminate how physics can be applied . in a creative study , tugging on the nuclear envelope with a glass harpoon has been used to get a sense of its resistance to deformation ( rowat et al . , 2006 ) .
but because the chromosomes themselves are attached to the nuclear envelope , it is not clear what components of nuclear structure underlie this observed resistance to deformation .
nonetheless , we believe that this is an important area for future work , because compressibility of the nucleus ( as well as that of the cell itself ) may be at play in a primary tumor cell 's passage through the basement membrane to initiate metastasis , as well as in its subsequent extravasation from the bloodstream .
an analogous recent observation is that the composition of the nuclear envelope in neutrophils is related to the ability of these cells to transit constrictions that are an order of magnitude less than their own diameter ( rowat et al . , 2013 ) .
the nuclear envelope can be fusigenic in some cases , for example , during syngamy , when the nuclei of an egg and sperm meet .
recently it was discovered that , in addition to the recognized export pathway of mrna through nuclear pores , some mrnas leave by a nuclear envelope budding process ( speese et al .
these recently discovered mrna - containing nuclear buds appear to be different in their design and propulsion than those that have been observed in the premature aging syndrome hutchinson - gifford progeria ( goldman et al .
intriguingly , deep internal invaginations of the nuclear envelope have also been reported ( fricker et al . , 1997 ) .
cytoplasm incursions deep into the nucleus bear on issues of nucleo - cytoplasmic transport and make one wonder just how pure a nuclear fraction can be obtained from cells if such invaginations seal off during nuclear isolation . because of the wealth of physical chemistry foundations in membrane research , the nuclear envelope , and its dynamics particularly , await the input of physics going forward .
physics had arguably its greatest moment in biology in the application of x - ray diffraction to biological molecules , first by dorothy crowfoot hodgkin and later by legions of those who followed .
cell biology has had certain tributaries from physics ( recall francis crick 's cytoplasmic viscometry ) , and the current momentum in the application of physics to the cell is exciting to see . in this paper , we have presented a number of perspectives that convey our belief that the time is now at hand when considering the nucleus as a physical landscape can and will be exciting and enabling . | the nucleus is physically distinct from the cytoplasm in ways that suggest new ideas and approaches for interrogating the operation of this organelle .
chemical bond formation and breakage underlie the lives of cells , but as this special issue of molecular biology of the cell attests , the nonchemical aspects of cell nuclei present a new frontier to biologists and biophysicists . | THE NUCLEUS BACK THEN
THE MODERN AND POSTMODERN NUCLEUS
PHYSICAL BIOLOGY OF THE NUCLEUS
THE CHROMOSOMES
THE NUCLEOPLASM
THE NUCLEAR PERIPHERY
SUMMARY |
it occurs in 0.4% to 2% of patients with ibd , with a slightly higher prevalence in patients with uc than in those with cd.12 approximately 36% to 50% of patients with pg have underlying ibd.2 the correlation between clinical activity of the intestinal disease and the appearance of skin lesions is controversial .
as this is a highly debilitating skin condition , rapid healing is the primary therapeutic objective in these patients .
the conventional treatment of pg includes local wound care , antibiotics , various systemic and topical immunomodulators , and corticosteroids.34 however , responses to these therapies are highly variable . with the advent of biologics ,
especially anti - tumor necrosis factor ( anti - tnf ) inhibitors , there has been an increased interest in their role in the management of pg . despite limited published literature ,
biologics have caused a paradigm shift in the management of this difficult - to - treat skin condition.567 here , we report three cases of pg with uc , successfully treated using biologics . prior to this report ,
there have only been two brief reports of pg treated with biological therapy , from asia.89
the clinical data of three patients with active uc and pg admitted to the gastroenterology ward of our institute between 2012 and 2016 and treated with biologics were reviewed .
a total of 324 uc patients were seen in the department of gastroenterology between 2012 and 2016 .
data collected included age , duration and severity of bowel disease ; the location , number , and duration of the skin lesions ; prior treatment , time to response and healing of pg lesions following treatment with biologics ; and status of bowel disease following treatment with biologics .
the improvement of the skin lesions was based on the decrease in the size and depth of the ulcer , and the appearance of healthy granulation tissue over the previously exposed deep fascia .
a 40-year - old male presented with complaints of bloody diarrhea of 3 months ' duration .
five days after the onset of blood in stools , he noticed small vesicular lesions over the dorsum of the right foot , followed by the appearance of similar lesions on the left foot , buttocks , and hands .
the base of the penetrating ulcer exposed the deep fascia of the tendon of his foot , with complete denudation of the skin and subcutaneous tissue ( fig .
he had pallor , as well as ulcers over dorsum of both feet ( fig .
laboratory evaluation revealed a hemoglobin level of 8.6 g / dl , total leukocyte count of 10,800 cells/l , total serum protein level of 5.2 g / dl , and a serum albumin level of 2.9 g / dl .
colonoscopic evaluation revealed diffuse loss of vascular pattern , multiple superficial ulcers , and oozing of blood involving the entire length of the colon .
the extent of the disease was therefore classified as e3 as per the montreal classification , and the colonoscopic severity was 7 as per ulcerative colitis endoscopic index of severity ( uceis ) . a diagnosis of uc with acute exacerbation and pg was made .
the patient was started on intravenous hydrocortisone ( 100 mg every 8 hours ) , mesalamine , and azathioprine .
the patient showed partial improvement of bowel symptoms ; however , there was no improvement in the skin lesions , even after 1 week of intensive steroid therapy .
hence , he was started on intravenous infliximab at a dose of 5 mg / kg .
following infliximab administration , he showed signs of healing at the peripheral margin of the skin lesions , coupled with appearance of granulation tissue over the previously visible deep fascia of the foot within 1 week of receiving the first dose ( fig .
the transverse diameter of the lesion on the lateral malleolus of the right foot was decreased by approximately 1 cm within 1 week .
subsequently , he received the remaining two induction doses of infliximab at weeks 2 and 6 .
the skin lesions continued to heal , and he was discharged with a prescription of oral mesalamine and azathioprine .
after 6 months , the skin lesions had healed completely , albeit with extensive scarring on the dorsum of the foot ( fig .
his bowel symptoms were also in remission at the time of the last follow - up . a 36-year - old male who had been diagnosed with uc 8 years prior presented with a 2-month history of loose stools mixed with blood , as well as ulcers over the left foot and the dorsum of the left thumb . at admission , the patient had a clinical mayo score of 8 .
he had deep ulcers over the lateral malleolus of the left foot and the left thumb ( fig .
the patient was treated with intravenous hydrocortisone ( 100 mg every 8 hours ) , mesalamine , azathioprine , local therapy with topical antibiotics , and steroids , and daily dressing of the wound .
the skin lesions showed improvement by the fourth day , with the appearance of healthy granulation tissue .
the patient was gradually weaned off steroids , and administered a second dose of 80-mg adalimumab after 2 weeks .
his skin lesions had healed significantly , but he had to undergo an emergency colectomy following colonic perforation during the colonoscopy that was performed to evaluate the extent of the disease . during surgery ,
a 0.50.5 cm perforation was detected in the sigmoid colon , with minimal peritoneal soiling .
adalimumab was discontinued after the second dose , as the skin lesions had healed considerably , and the patient had already undergone a colectomy .
a 22-year - old male , diagnosed with uc 6 years prior with a disease extent of e3 as per the montreal classification , presented with a 1-month history of increased frequency of stools mixed with blood . with the worsening of bowel symptoms , he also noticed a vesicular lesion on his left arm , which gradually progressed to a large ulcerative lesion .
the patient had been on mesalamine and azathioprine prior to the current presentation . at admission
laboratory investigations revealed a hemoglobin level of 8.3 g / dl , an esr of 55 mm / h , and a serum albumin level of 2.8 g / dl .
the patient received intravenous hydrocortisone ( 100 mg every 8 hours ) , mesalamine , and azathioprine , as well as local therapy using topical antibiotics , steroids , and daily dressing .
he showed improvement in his bowel symptoms after 1 week of therapy ; however , there was no improvement in skin lesions .
hence , he was started on intravenous infliximab at a dose of 5 mg / kg .
the skin lesions showed considerable improvement , evidenced by the reduction in size and the appearance of healthy granulation tissue at the periphery after the second dose of infliximab .
after 6 months , the patient showed complete resolution of the skin lesion ( which was replaced by scar tissue ) , and his bowel symptoms were in complete remission .
a 40-year - old male presented with complaints of bloody diarrhea of 3 months ' duration .
five days after the onset of blood in stools , he noticed small vesicular lesions over the dorsum of the right foot , followed by the appearance of similar lesions on the left foot , buttocks , and hands .
the base of the penetrating ulcer exposed the deep fascia of the tendon of his foot , with complete denudation of the skin and subcutaneous tissue ( fig .
he had pallor , as well as ulcers over dorsum of both feet ( fig .
laboratory evaluation revealed a hemoglobin level of 8.6 g / dl , total leukocyte count of 10,800 cells/l , total serum protein level of 5.2 g / dl , and a serum albumin level of 2.9 g / dl .
colonoscopic evaluation revealed diffuse loss of vascular pattern , multiple superficial ulcers , and oozing of blood involving the entire length of the colon .
the extent of the disease was therefore classified as e3 as per the montreal classification , and the colonoscopic severity was 7 as per ulcerative colitis endoscopic index of severity ( uceis ) . a diagnosis of uc with acute exacerbation and pg was made .
the patient was started on intravenous hydrocortisone ( 100 mg every 8 hours ) , mesalamine , and azathioprine . topical antibiotics and dressing
the patient showed partial improvement of bowel symptoms ; however , there was no improvement in the skin lesions , even after 1 week of intensive steroid therapy .
hence , he was started on intravenous infliximab at a dose of 5 mg / kg .
following infliximab administration , he showed signs of healing at the peripheral margin of the skin lesions , coupled with appearance of granulation tissue over the previously visible deep fascia of the foot within 1 week of receiving the first dose ( fig .
the transverse diameter of the lesion on the lateral malleolus of the right foot was decreased by approximately 1 cm within 1 week .
subsequently , he received the remaining two induction doses of infliximab at weeks 2 and 6 .
the skin lesions continued to heal , and he was discharged with a prescription of oral mesalamine and azathioprine .
after 6 months , the skin lesions had healed completely , albeit with extensive scarring on the dorsum of the foot ( fig .
his bowel symptoms were also in remission at the time of the last follow - up .
a 36-year - old male who had been diagnosed with uc 8 years prior presented with a 2-month history of loose stools mixed with blood , as well as ulcers over the left foot and the dorsum of the left thumb . at admission ,
he had deep ulcers over the lateral malleolus of the left foot and the left thumb ( fig .
the patient was treated with intravenous hydrocortisone ( 100 mg every 8 hours ) , mesalamine , azathioprine , local therapy with topical antibiotics , and steroids , and daily dressing of the wound .
the skin lesions showed improvement by the fourth day , with the appearance of healthy granulation tissue .
the patient was gradually weaned off steroids , and administered a second dose of 80-mg adalimumab after 2 weeks .
his skin lesions had healed significantly , but he had to undergo an emergency colectomy following colonic perforation during the colonoscopy that was performed to evaluate the extent of the disease . during surgery ,
a 0.50.5 cm perforation was detected in the sigmoid colon , with minimal peritoneal soiling .
adalimumab was discontinued after the second dose , as the skin lesions had healed considerably , and the patient had already undergone a colectomy .
a 22-year - old male , diagnosed with uc 6 years prior with a disease extent of e3 as per the montreal classification , presented with a 1-month history of increased frequency of stools mixed with blood . with the worsening of bowel symptoms , he also noticed a vesicular lesion on his left arm , which gradually progressed to a large ulcerative lesion .
the patient had been on mesalamine and azathioprine prior to the current presentation . at admission
laboratory investigations revealed a hemoglobin level of 8.3 g / dl , an esr of 55 mm / h , and a serum albumin level of 2.8 g / dl .
the patient received intravenous hydrocortisone ( 100 mg every 8 hours ) , mesalamine , and azathioprine , as well as local therapy using topical antibiotics , steroids , and daily dressing .
he showed improvement in his bowel symptoms after 1 week of therapy ; however , there was no improvement in skin lesions .
hence , he was started on intravenous infliximab at a dose of 5 mg / kg .
the skin lesions showed considerable improvement , evidenced by the reduction in size and the appearance of healthy granulation tissue at the periphery after the second dose of infliximab . a third dose of infliximab was administered at 6 weeks .
after 6 months , the patient showed complete resolution of the skin lesion ( which was replaced by scar tissue ) , and his bowel symptoms were in complete remission .
the treatment of pg has seen a paradigm shift after the introduction of therapy directed against tnf- , which is a proinflammatory cytokine expressed in skin tissue of patients with pg .
it contributes to the recruitment of inflammatory cells to the skin by increasing the expression of adhesion molecules in the vasculature of the inflamed tissue.10 initially , the successful use of anti - tnf blockers such as infliximab and adalimumab in the treatment of pg was reported in anecdotal case reports.567 three of the major studies on the use of biologics in pg with ibd have been tabulated in table 1 . in the only randomized controlled trial of infliximab for the treatment of pg , 13 patients were randomized to infliximab , and 17 were randomized to the placebo group .
after 2 weeks , 46% of the patients in the infliximab group showed improvement , in comparison to only 6% in the placebo group .
complete remission of the skin lesions at week 6 was documented in 21% of the patients.5 however , even in this study , only six patients with pg had uc , of which only two were randomized to receive infliximab . prior to this
randomized controlled trial , regueiro et al.6 treated 13 patients with ibd ( cd , 12 ; uc , 1 ) and medically refractory pg with 5 mg / kg infliximab .
all 13 patients showed complete remission of the skin lesions , although 10 of the 13 patients required further maintenance dosing .
all the patients were successfully tapered off corticosteroids completely . though the data showing results of treatment of uc - associated pg with biological therapy is still rather limited , there is compelling evidence for the use of biologics . even though both infliximab and adalimumab have been used successfully in the management of uc - associated pg ,
infliximab is more effective , making it the first choice therapy ( table 1 ) . in our report
, all three patients showed a successful outcome despite the fact that some of the lesions of pg had penetrated to the deep fascia of the foot .
complete healing of the skin wound ( albeit with scarring ) was documented at 6 months after initiation of the biologic therapy . in all three patients ,
we used only the induction doses of the biologics , and there was no recurrence of pg after the discontinuation of the drugs . in conclusion , in view of the rapid healing of the skin lesions , superior response rate , and the additional benefit of improvement in the underlying colonic disease following treatment with these agents , anti - tnf blockers should be considered as a first line therapy in the management of pg .
the rationale for the use of biologic therapy is even stronger in the sub - group in which pg is associated with steroid refractory active colonic disease . | pyoderma gangrenosum ( pg ) is an uncommon extra - intestinal manifestation of inflammatory bowel disease ( ibd ) . despite limited published literature ,
biologics have caused a paradigm shift in the management of this difficult - to - treat skin condition .
the clinical data and outcomes of three patients with active ulcerative colitis and concurrent pg treated with biologics ( infliximab two and adalimumab one ) are reviewed in this report .
biologics were added because of the sub - optimal response of the colonic symptoms and skin lesions to parenteral hydrocortisone therapy .
all three patients showed a dramatic response to the addition of the biologics . in view of the rapid healing of the skin lesions , superior response rate , and the additional benefit of improvement in the underlying colonic disease following treatment , anti - tumor necrosis factor blockers
should be considered as a first line therapy in the management of pg with underlying ibd . | INTRODUCTION
CASE REPORTS
1. Case 1
2. Case 2
3. Case 3
DISCUSSION |
medical education aims to prepare medical students for clinical practice . educational environment is the most important factor effecting on students training and achievements ( 1 - 3 ) .
therefore , evaluating the educational setting can show defects in medical education and help to solve them ( 4 ) .
this study was designed for evaluating medical educational environment in a tertiary pediatric hospital in tehran , using an international questionnaire known as dundee ready educational environment measure ( dreem ) .
this instrument was used in several medical schools of different countries , such as sri lanka ( 5 ) , saudi arabia ( 4 , 6 , 7 ) , united arab emirates ( 8) , turkey ( 9 ) , germany ( 10 ) , sweden ( 11 ) , united kingdom ( 12 - 14 ) , and canada ( 15 , 16 ) for different types of undergraduate educational studies . in spite of excellent clinical services ,
there were many educational problems in this subspecialty referral pediatric center which was similar to other tertiary centers around the world ( 17 , 18 ) .
thus , we tried to address under - graduate educational deficits in this hospital and find feasible solutions .
in order to investigate whether these educational problems were student dependent , we examined the relation between students knowledge and their perception of this educational environment .
this cross - sectional study was done in the children s medical center , the pediatrics center of excellence in iran affiliated to tehran university of medical sciences during 2012 .
seventeen students did not fill the questionnaire ( response rate = 78% ) ; and therefore were excluded from the study .
knowledge of students is best determined by cumulative grade point average ( cgpa ) , medical students comprehensive basic sciences exam ( cbse ) score , and national university entrance exam ( known as konkoor ) rank ( 19 ) .
clerkship period ( before internship ) in tehran university of medical science lasts about 2.5 years ; during this period , 3 months are devoted to pediatrics .
the curriculum of pediatric course started with 2 weeks of classes and lectures ; then students are divided into 10 groups of 7 or 8 and each group spent a week in one specialized ward , including emergency department , infectious disease , neurology , immunology and rheumatology , gastrointestinal , hematology , cardiology , endocrinology , and neonatology . during each week
each day was planned for one teacher to train the group of students in ward or clinic .
we used dreem questionnaire for assessing the educational environment of this sub - specialty pediatric hospital .
it consists of 50 items divided into 5 categories : student perception of learning , 12 questions , student perception of teachers , 11 questions , student academic self - perception , 8 questions , student perception of atmosphere , 12 questions , and student social self - perception , 7 questions .
items were scored with likert scale as follows : 4 = strongly agree , 3 = agree , 2 = unsure , 1 = disagree , and 0 = strongly disagree .
two questions ( numbers 10 and 26 ) were changed slightly according to particular condition of this pediatric course .
items scored above 3.5 have good condition ; those scored between 2 and 3.5 can be improved , while those less than 2 show areas of shortage and deficit .
guideline for interpretation of each subscale score is summarized in table 1 ( 21 ) . as most of the items had low scores and were placed in the weak category ( < 2 ) ,
we used first and third quartile as a cut - off ( 1.44 , 2.32 ) to select the most problematic and strongest items . translated version of dreem questionnaire was prepared previously by other researchers ( 22 ) .
construct validity was checked by confirmatory factor analysis which moderately fit with five predefined subscales .
the reliability of this questionnaire in our population was calculated with cronbach s alpha method .
the internal consistency of total items was 0.93 and of subscales 1 to 5 were 0.89 , 0.76 , 0.84 , 0.89 , and 0.7 , respectively .
the forms were anonymous ; also , there were five questions in advance of main questions , including gender , cgpa , cbse score , and konkoor rank .
sheets with open questions were also spread among students separately and comments were extracted and classified . before distribution of questionnaires the aim of the study was explained in a session and the students were asked to answer the questions according to their general view of this course rather than individual events .
kruskal - wallis h test was used to compare students based on their gpa , cbse , and konkoor ranks .
this cross - sectional study was done in the children s medical center , the pediatrics center of excellence in iran affiliated to tehran university of medical sciences during 2012 .
seventeen students did not fill the questionnaire ( response rate = 78% ) ; and therefore were excluded from the study .
in the iranian medical schools , knowledge of students is best determined by cumulative grade point average ( cgpa ) , medical students comprehensive basic sciences exam ( cbse ) score , and national university entrance exam ( known as konkoor ) rank ( 19 ) . clerkship period ( before internship ) in tehran university of medical science lasts about 2.5 years ; during this period , 3 months are devoted to pediatrics .
the curriculum of pediatric course started with 2 weeks of classes and lectures ; then students are divided into 10 groups of 7 or 8 and each group spent a week in one specialized ward , including emergency department , infectious disease , neurology , immunology and rheumatology , gastrointestinal , hematology , cardiology , endocrinology , and neonatology . during each week
each day was planned for one teacher to train the group of students in ward or clinic .
we used dreem questionnaire for assessing the educational environment of this sub - specialty pediatric hospital .
it consists of 50 items divided into 5 categories : student perception of learning , 12 questions , student perception of teachers , 11 questions , student academic self - perception , 8 questions , student perception of atmosphere , 12 questions , and student social self - perception , 7 questions .
items were scored with likert scale as follows : 4 = strongly agree , 3 = agree , 2 = unsure , 1 = disagree , and 0 = strongly disagree . some items were negative questions ; thus they were coded reversely .
two questions ( numbers 10 and 26 ) were changed slightly according to particular condition of this pediatric course .
items scored above 3.5 have good condition ; those scored between 2 and 3.5 can be improved , while those less than 2 show areas of shortage and deficit .
guideline for interpretation of each subscale score is summarized in table 1 ( 21 ) . as most of the items had low scores and were placed in the weak category ( < 2 ) ,
we used first and third quartile as a cut - off ( 1.44 , 2.32 ) to select the most problematic and strongest items . translated version of dreem questionnaire was prepared previously by other researchers ( 22 ) .
construct validity was checked by confirmatory factor analysis which moderately fit with five predefined subscales .
the reliability of this questionnaire in our population was calculated with cronbach s alpha method .
the internal consistency of total items was 0.93 and of subscales 1 to 5 were 0.89 , 0.76 , 0.84 , 0.89 , and 0.7 , respectively .
the forms were anonymous ; also , there were five questions in advance of main questions , including gender , cgpa , cbse score , and konkoor rank .
sheets with open questions were also spread among students separately and comments were extracted and classified . before distribution of questionnaires the aim of the study was explained in a session and the students were asked to answer the questions according to their general view of this course rather than individual events .
nonparametric tests were used to analyze the data . kruskal - wallis h test was used to compare students based on their gpa , cbse , and konkoor ranks .
among 60 students who answered the questionnaire 24 were male ( 40% ) and 36 were female ( 60% ) , aged from 23 to 24 years .
forty two ( 70% ) students had cgpa between 16 to 17.9 out of 20 ; nineteen ( 32% ) students gained cbse score between 120 to 139.9 out of 200 , and 23 ( 38% ) of them had konkoor rank of less than 50 ( table 2 ) .
abbreviations : cbse , comprehensive basic science exam , cgpa , cumulative grade point average ; sd , standard deviation .
the least ( l ) and most ( m ) scored items in each subscale are as follows : learning category : l : the teaching is too teacher centered . was weakest .
m : learning strategies which worked for me before , continue to work for me now .
atmosphere category : l : the atmosphere motivates me as a learner . m : i feel able to ask the questions i want . social self - perception category : l :
comparison between different cgpa , cbse , and konkoor groups showed no considerable difference ( p value > 0.05 ) .
although there is no published study comparing clinical skills of medical students in tehran university of medical sciences with other universities , according to konkoor ranks and cbse scores , it could be noted that they are the best among their peers in iran . considering that , educational environment of this subspecialty pediatric hospital obtained a mean total score of 95.8 .
as said by mcaleer and roff ( 21 ) this score enlightens plenty of problems in educational environment . besides , we found that both weak and strong students with low and high cgpa , cbse , and konkoor rank were dissatisfied with this educational environment ; emphasizing that these problems were not related to students incompetency . in comparison to most of studies surveying whole courses of undergraduate education ,
therefore , comparing it with other studies in different countries is roughly inferable ; nevertheless they are summarized in table 6 . by means of mcaleer and roff guideline ( 21 ) ,
teacher moving in the right direction , academic self - perception has many negative aspects
, atmosphere has many issues which need changing , and social self - perception is not a nice place . in order to discuss about the strengths and weaknesses , we used the individual item scores in each subscale . learning : consecutive lecture - based classes conveying large amount of information , made the theory classes unsatisfactory , as was shown by low scores in items 7 , 13 , 25 , 44 , 48 and found in students comments ( tables 4 and 5 ) .
regarding that all items in this section scored below the third quartile ( less than 2.32 ) , fundamental reforms should be made .
teacher : high scores in items 2 , 8 , 18 , 37 , 39 , 49 , and 50 ( table 4 ) elucidate that there are knowledgeable and experienced pediatricians in this center , practicing scientifically and making moral interaction with students and patients .
academic self - perception : there was lack of an explicit plan to prepare students for general practice .
also most of the lectures and rounds were pertained to subspecialty issues and rare cases , as low scores in 22 , 26 , and 41 items ( table 4 ) .
atmosphere : items 33 and 50 ( table 4 ) showed that students were able to interact with their teachers easily ; however , the atmosphere of classes and rounds were not motivating , as shown by item 43 ( table 4 ) .
other important de - motivating factors were stressful attendance checking and authoritarian educational office , as was also noted in students comments ( table 5 ) .
numerous tasks of attending caused interference between their educational activity and the written timetable , explaining low score in item 12 .
social self - perception : because of 3 months of tight classes , large amount of tasks and two heavy exams with limited time to prepare , students became jaded , as shown by item 14 ( table 4 ) .
low score in item 3 is due to lack of friendly relationship between teachers and students out of teaching classes , which led students to feel ineffective and having no social supports ( table 4 ) .
we believe that most of these mentioned educational problems are due to subspecialty nature of this center .
many studies showed advantages of medical education in general practice setting versus tertiary referral hospitals ( 18 , 28 - 30 ) .
learning medicine in general view , engagement in medical team , doing some clinical tasks and following patients are explained reasons for this preference . we think that training students for general practice needs separate setting in this tertiary hospital ; for instance , making 1 or 2 general pediatric wards may be helpful . at last ,
the results were discussed with manager and attending of this hospital and few changes were made in the curriculum .
limitation of our study was small number of participants , short period of this course and inability to reevaluate perception of this group of students after modification of curriculum .
precise distribution of questionnaire , non - parametric analysis of our data , good cooperation of students for giving comments , and discussing it to hospital authorities were the strengths of our study .
further studies on subsequent semesters and modifying the environment and re - evaluation of the program can improve this educational environment . in spite of excellent pediatric health care , several educational problems could be noted in this tertiary pediatric center .
the most problematic areas were learning , academic self - perception , and social self - perception .
feasible solutions for improving this educational setting are having an accurate schedule to educate general practitioner by emphasizing on the most prevalent necessary subjects , using new teaching methods that involve students , and providing a non - stressful and friendly atmosphere .
this study can be used as a baseline to be compared with new curriculum and educational reforms . | background : tertiary pediatric hospitals usually provide excellent clinical services , but such centers have a lot to do for educational perfection.objectives:this study was performed to address under - graduate educational deficits and find feasible solutions.patients and methods : this cross - sectional study was done in a target population of 77 sixth year undergraduate medical students ( response rate = 78% ) who spent their 3-month pediatric rotation in the children s medical center , the pediatrics center of excellence in tehran , iran .
the dundee ready educational environment measure ( dreem ) instrument was used for assessing educational environment of this subspecialized pediatric hospital.results:among 60 students who answered the questionnaires , 24 were male ( 40% ) .
participants age ranged from 23 to 24 years .
the mean total score was 95.8 ( 48% ) .
comparison of scores based on students knowledge showed no significant difference .
problematic areas were learning , academic self - perception , and social self-perception.conclusions:having an accurate schedule to train general practitioner , using new teaching methods , and providing a non - stressful atmosphere were suggested solutions . | 1. Background
2. Objectives
3. Patients and Methods
3.1. Participants
3.2. Medical Setting
3.3. Instrument
3.4. Statistical Analysis
4. Results
5. Discussion |
null | neurotoxic substances affect the nervous system in a selective manner . one possible basis for this selectivity is blood vessel permeability . in general , the central nervous system and
the peripheral nerve trunks have impermeable blood vessels , but in certain parts the capillaries are " leaky , " allowing the passage of a plasma filtrate .
intravenously injected protein tracers rapidly reach nerve cells in these regions , with the implication that these nerve cells are also readily accessible to circulating neurotoxic substances .
some examples of neurotoxicity in the central nervous system show a selectivity that could be due to capillary permeability . in experimental methylmercury poisoning ,
cranial nerve v and sensory dorsal root ganglia , which lie in regions of vascular permeability , are particularly susceptible .
a number of drug and chemically induced neuropathies are predominantly sensory , and may be due , directly or indirectly , to the accessibility of neurotoxic substances to sensory neurons .
examination of areas of potential vulnerability to circulating toxic substances may be of value in the experimental testing of substances for neurotoxicity , where pharmacological tests may be negative and clinical symptoms difficult to assess.imagesfigure 1 .
( a)figure 1 .
( b)figure 1 .
( c)figure 2.figure 3 .
( a)figure 3 .
( b)figure 4.figure 5 .
( a)figure 5 .
( b)figure 6 .
( a)figure 6 .
( b ) | Images |
thousands of dental restorations are placed everyday in children by dentists , dental students and ancillary personnel with reasonable clinical background knowledge in the management of dental caries .
these restorations are performed at any time and place on the planet earth , yet it is well known that the earth does not have uniform climatic conditions .
what might not be so clear to the operators involved in restoring the teeth is whether the different climatic conditions are able to influence the survival outcomes of these restorations .
changes in environmental temperatures and humidity , among other changes , could have a potential influence on the restorative material used and subsequently on the survival results of the restorations made out of them .
it is , therefore , possible that defective proportionation and mixing process could result in poor material mixture consistency and , consequently , changes in the integrity of the restoration .
glass ionomer cement ( gic ) is a restorative material that is mixed prior to placing it in the prepared cavity .
the material sets through a simple acid base chemical reaction . during the mixing stage of the material ,
the powder part is combined with the liquid part thus commencing the setting phase of the material . on exposure to aqueous solution
, the cement powder part of the material reacts with the polycarboxylic acid part , setting up an acid base reaction that ensues in the formation of a bonding matrix .
initially , the polycarboxylic acid dissociates into negatively charged carboxylate anions ( rcoo- ) and positively charged protons ( h+ ) .
the h+ reacts with the surface of the glass filling of the gic material , the cement - forming metal ions , i.e. al3 + and ca2 + . in the presence of water
, these ions activate the primary setting phase of the gic reaction that forms a salt gel and complexes with the carboxylate residues of the polycarboxylic acid component .
the second stage follows with the release of aluminum ions that get incorporated into the pre - formed matrix to result in a three - dimensional , water - insoluble calcium aluminum carboxylate gel that is no longer susceptible to moisture or dehydration .
changes in ambient temperature , the presence of water , the powder particle size and powder / liquid ratio of the material , the mode of mixing the material and the presence of other chemicals like fluoride material and tartaric acid are likely to influence the rate of this reaction process . the use of gic with the atraumatic restorative treatment ( art ) approach for the management of dental caries , especially in the primary dentition , is well documented .
the art approach involves the removal of dental caries with exclusive use of hand instruments and restoring the cavity formed and sealing the adjacent fissures using gic , an adhesive restorative material .
the ease of mixing the gic material , the self - setting properties , biocompatibility with the oral tissues and fluoride release mechanisms make gic an ideal material for use with the art approach in the prevention and management of dental caries .
ideally , restorations placed in the primary dentition should last until the teeth exfoliate , meaning a maximum period of approximately 8 years .
good survival results have been obtained in single - surface art restorations , but not in multi - surface art restorations .
short - term studies ( evaluation after 1 year ) using the art approach have indicated success rates of approximately 80 - 95% for class i and 30 - 75% for class ii restorations .
long - term studies ( evaluation after more than 2.5 years ) have reported success rates of approximately 43.4 - 86.1% for class i and 12.2 - 82.1% for class ii restorations .
the causes of the art restoration failures have been found to be multi - factorial and include operator factors like improper caries removal , deficiency in proportionation of the material , poor mixing of gic , material handling time and poor application of the restorative material , the type of cavity to be restored , the experience of the operator / assistant , poor tooth isolation method and the consistency of the food taken soon after placing the restoration .
the aim of the present study was to determine what influence the ambient temperature and the mixing time of gic material have on the survival rate of proximal art restorations placed in primary molars .
a total of 804 children aged 6 - 8 years from 30 local schools in matungulu and kangundo , machakos county in kenya , participated in the study that lasted for 2 years ( 2006 - 2008 ) .
random numbers were used to select the children who participated in the study , out of a group that had been previously selected on the basis of having appropriate proximal carious lesions restorable using the art approach .
the selection of teeth was performed by trained , experienced and pre - tested examiners using the criteria described by kemoli et al .
written consents were obtained from the parents / guardians and the children also assented to it , prior to their inclusion into the study .
the study received ethical approval from the university of nairobi and kenyatta national hospital ethical committee prior to its commencement .
one proximal cavity was restored in each of the participating children , and then followed .
the restoration phase took place in a specially prepared classroom at each of the 30 schools that participated in the study .
fuji ix ( gc europe ) , ketac molar easymix ( 3 m espe , ag ) and ketac molar applicap ( 3 m espe , ag ) were the three gic materials that were randomly used during the study to restore the carious primary molars .
two tooth isolation methods were randomly applied ( rubberdam ; medium - dark , hygienic dental dam , hcm - hygienic corporation , malaysia ) with a rubber dam clamp ( fit - kofferdam klammer , u67 , hager and werken gmbh and co. , kg germany ) and cotton wool roll ( hartmann celluron , de - paul hartmann ag-89522 , helderheim , germany ) .
two sets of operators and assistants categorized as experienced and inexperienced as described by kemoli et al .
experienced and four inexperienced operators assisted by four experienced and four inexperienced assistants participated in the operative phase . by rotation , one assistant always rested each day of the restorative phase . before taking part in the study , all the operators and assistants received adequate training and practice for their respective category .
the operators were composed of dentists , final - year dental students and community oral health officers , whereas the assistants were community oral health officers and dental assistants . during the restoration phase , the child lay prone on a table / desk with the head supported with a pillow and the operator sitting on an ordinary chair placed at the head of the table / desk . using natural sunlight augmented with an artificial battery - powered headlamp ,
the operator isolated the cavity and widened the cavity access and removed enamel overhangs with a hatchet and the soft dentine within the cavity was removed using a spoon excavator aided by a caries - detector dye .
wet and dry cotton pellets were utilized to clean and dry the prepared cavity before a matrix band ( union broach moyco ) was applied to the tooth and held interdental with wooden wedges ( sycomore interdental wedges no .
the cavity size was measured through its center in the mesio - distal and bucco - lingual directions using michigan o with william 's markings periodontal probe in the same manner as described by kemoli and van amerongen . for deep cavities ,
a thin layer of calcium hydroxide ( dycal , caulk ) was applied at the deepest point before pre - treating the dentine surfaces of the tooth for 15 s using the diluted part of the liquid for fuji ix and the manufacturer 's conditioner for the other two materials .
once the assistant had finished mixing the gic material , either manually ( fuji ix and ketac molar easymix ) or mechanically at 4300 oscillations per minute using a duomat 2 amalgamator , germany ( ketac molar applicap ) in accordance with the instructions of the manufacturer , the material was handed to the operator to restore the prepared cavity .
once the operator had placed adequate gic material into the cavity and slightly overfilling the cavity , the operator applied petroleum jelly over the gloved finger and pressed the material firmly into the cavity and over the adjacent fissures in a technique referred to as finger press .
the excess gic material was removed using the applier before the occlusion was corrected with the use of a spoon excavator and with the aid of articulating paper ( bausch articulating paper , nashua , nh03060 , usa ) .
the assistant then recorded the time taken to mix the material and the time taken by the operator to complete restoring the cavity . for the mechanical mixing , although the time was constant , it was still recorded .
the ambient temperature at the time of completing the restoration was also recorded by the assistant .
afterwards , the child was released with specific instructions not to eat within the next hour .
the restorations were clinically evaluated soon after placement ( within 2 h ) , after 1 week , 1 month , 5 months and then 6-monthly for the remaining period of 2 years using the criteria described in table 1 .
the criteria used to evaluate the survival of the proximal restorations the evaluators , who were final year dental students , were trained and calibrated in the manner described by kemoli et al . during the evaluation , the principal investigator ( pi )
the results of the calibrations showed a mean kappa value of kappa 0.92 ( n = 20 ) .
the mean kappa values for the evaluations ranged from 8.4 to 0.86 ( n = 52 - 63 ) , with the mean inter - evaluator consistency of kappa 0.82 - 0.92 ( n = 48 - 52 ) . the daily intra - examiner agreements on 10% of the restorations evaluated ranged from kappa 0.80 to 1.0 .
spss ( spss inc , chicago , il , usa ) data entry computer program was used to process the data collected in the study .
chi - square , kaplan meier survival analysis and cox proportional hazard tests with the significant value pegged at p < 0.05 were used for comparison of the survival rate of the restorations in relation to the type of gic material , operator and dental assistant experience , the method of tooth isolation , the mixing time for the material and temperature at the time of finishing the restoration .
a total of 804 children aged 6 - 8 years from 30 local schools in matungulu and kangundo , machakos county in kenya , participated in the study that lasted for 2 years ( 2006 - 2008 ) .
random numbers were used to select the children who participated in the study , out of a group that had been previously selected on the basis of having appropriate proximal carious lesions restorable using the art approach .
the selection of teeth was performed by trained , experienced and pre - tested examiners using the criteria described by kemoli et al .
written consents were obtained from the parents / guardians and the children also assented to it , prior to their inclusion into the study .
the study received ethical approval from the university of nairobi and kenyatta national hospital ethical committee prior to its commencement .
one proximal cavity was restored in each of the participating children , and then followed .
the restoration phase took place in a specially prepared classroom at each of the 30 schools that participated in the study .
fuji ix ( gc europe ) , ketac molar easymix ( 3 m espe , ag ) and ketac molar applicap ( 3 m espe , ag ) were the three gic materials that were randomly used during the study to restore the carious primary molars .
two tooth isolation methods were randomly applied ( rubberdam ; medium - dark , hygienic dental dam , hcm - hygienic corporation , malaysia ) with a rubber dam clamp ( fit - kofferdam klammer , u67 , hager and werken gmbh and co. , kg germany ) and cotton wool roll ( hartmann celluron , de - paul hartmann ag-89522 , helderheim , germany ) .
two sets of operators and assistants categorized as experienced and inexperienced as described by kemoli et al .
experienced and four inexperienced operators assisted by four experienced and four inexperienced assistants participated in the operative phase . by rotation , one assistant always rested each day of the restorative phase . before taking part in the study , all the operators and assistants received adequate training and practice for their respective category .
the operators were composed of dentists , final - year dental students and community oral health officers , whereas the assistants were community oral health officers and dental assistants . during the restoration phase , the child lay prone on a table / desk with the head supported with a pillow and the operator sitting on an ordinary chair placed at the head of the table / desk . using natural sunlight augmented with an artificial battery - powered headlamp ,
the operator isolated the cavity and widened the cavity access and removed enamel overhangs with a hatchet and the soft dentine within the cavity was removed using a spoon excavator aided by a caries - detector dye .
wet and dry cotton pellets were utilized to clean and dry the prepared cavity before a matrix band ( union broach moyco ) was applied to the tooth and held interdental with wooden wedges ( sycomore interdental wedges no .
the cavity size was measured through its center in the mesio - distal and bucco - lingual directions using michigan o with william 's markings periodontal probe in the same manner as described by kemoli and van amerongen . for deep cavities ,
a thin layer of calcium hydroxide ( dycal , caulk ) was applied at the deepest point before pre - treating the dentine surfaces of the tooth for 15 s using the diluted part of the liquid for fuji ix and the manufacturer 's conditioner for the other two materials .
once the assistant had finished mixing the gic material , either manually ( fuji ix and ketac molar easymix ) or mechanically at 4300 oscillations per minute using a duomat 2 amalgamator , germany ( ketac molar applicap ) in accordance with the instructions of the manufacturer , the material was handed to the operator to restore the prepared cavity .
once the operator had placed adequate gic material into the cavity and slightly overfilling the cavity , the operator applied petroleum jelly over the gloved finger and pressed the material firmly into the cavity and over the adjacent fissures in a technique referred to as finger press .
the excess gic material was removed using the applier before the occlusion was corrected with the use of a spoon excavator and with the aid of articulating paper ( bausch articulating paper , nashua , nh03060 , usa ) .
the assistant then recorded the time taken to mix the material and the time taken by the operator to complete restoring the cavity .
for the mechanical mixing , although the time was constant , it was still recorded .
the ambient temperature at the time of completing the restoration was also recorded by the assistant .
afterwards , the child was released with specific instructions not to eat within the next hour .
the restorations were clinically evaluated soon after placement ( within 2 h ) , after 1 week , 1 month , 5 months and then 6-monthly for the remaining period of 2 years using the criteria described in table 1 .
the criteria used to evaluate the survival of the proximal restorations the evaluators , who were final year dental students , were trained and calibrated in the manner described by kemoli et al . during the evaluation , the principal investigator ( pi )
the results of the calibrations showed a mean kappa value of kappa 0.92 ( n = 20 ) .
the mean kappa values for the evaluations ranged from 8.4 to 0.86 ( n = 52 - 63 ) , with the mean inter - evaluator consistency of kappa 0.82 - 0.92 ( n = 48 - 52 ) . the daily intra - examiner agreements on 10% of the restorations evaluated ranged from kappa 0.80 to 1.0 .
spss ( spss inc , chicago , il , usa ) data entry computer program was used to process the data collected in the study .
chi - square , kaplan meier survival analysis and cox proportional hazard tests with the significant value pegged at p < 0.05 were used for comparison of the survival rate of the restorations in relation to the type of gic material , operator and dental assistant experience , the method of tooth isolation , the mixing time for the material and temperature at the time of finishing the restoration .
the restoration phase of the study lasted 3 weeks , spread over a period of 1.5 months . from the initial number of participants of 804 aged 6 - 8 years , at the end of 2 years , a total of 648 participants aged 8 - 10 years could be evaluated , with the rest having fallen out due to various reasons ranging from absenteeism , truancy and one death .
most of the restored teeth were in the mandibular arch ( 66.8% ) , with the rest drawn from the maxillary arch .
the initial evaluation of the proximal restorations in the study showed an initial cumulative survival rate of 94.4% , which dropped to 30.8% after 2 years . during the 2 years when the restorations were followed ,
no significant differences were noted in the survival rates of the restorations in relation to the type of gic material used .
operators when related to the inexperienced operators , and the difference was statistically significant ( log - rank , chi - square 92.04 , 1 df , p = 0.15 ) .
the cumulative survival of the restorations placed using rubber dam were much higher when related to those where cotton wool rolls were used , and the difference was statistically significant irrespective of the jaw in which the restoration was placed , the operator and the assistant experience used in placing the restorations ( cox ph model , p > 0.05 ) . in the present study , the assistants did all the mixing of the gic materials that were used in restoring the cavities besides documenting the mixing and restoration times .
analysis of the survival rate of the proximal restorations in relation to the experience of the assistant indicated that experienced
assistants were associated with significantly higher survival rate of the restorations they helped place when related to the inexperienced assistants ( log - rank , chi - square 12.41 , 1 df , p = 0.0004 ) .
further , the results indicated that there was a significant interaction ( log - rank = chi - square of 15.8181 , 3 df , p = 0.0012 ) between the assistant and the operator experience , and that the inexperience of both the operator and the assistant increased the failure rate of the restorations .
the mixing times for all the assistants during the restoration phase ranged from 11 s to 2 min , with a mean value of 30 s ( sd 0.25 ) .
the mixing times , recorded by the assistants , were categorized as less than 30 s , 30 - 60 s and more than 60 s. the majority of the mixing times were found within either the less than 30 s or the 30 - 60 s categories .
the grouped times were related to the survival rate of the restorations as shown in figure 1 .
when the survival rate of the restorations was related to the mixing times as grouped , no statistical significant difference was detected ( cox proportional hazards model , est = -0.112 , se = 0.607 , chi - square = 0.034 , p = 0.853 ) .
however , the highest survival rate of the restorations was associated with the mixing times between 30 and 60 s , followed by those where the mixing times were below 30 s. the experienced assistants were also associated with a higher survival rate of the restorations , and their mixing times fell between 30 and 60 s [ figure 1 ] .
the majority of the inexperienced assistants inched toward achieving these times toward the end of the restorative phase of the study [ figure 1 ] , when the survival rate of the restorations they helped in placing became closer or equal to those of the experienced assistants . the time taken for the assistant to deliver the material to the operator and for the operator to restore the tooth
there was no significant statistical difference ( chi - square , p > 0.05 ) .
assistants was higher and statistically significant ( chi - square , p < 0.05 ) when related to those by
meier survival analysis for 2 years with regard to the assistant experience , the week of the restoration and the time taken in seconds to mix the glass ionomer cement material during the restoration phase of the study multiple logistic model with backward selection for the best model of dichotomized restoration survival in relation to factors as size of restoration , gic material , isolation method , mixing time , the week when restoration was done and the assistant used showed that there was a significant intercept ( df = 1 , est = -1.0516 , se = 0.2907 , chi - square = 13.086 , p = 0.0003 ) .
the survival rate of the restorations in relation to the these factors was statistically significant with regard to restoration size df = 1 , est = 0.017 , se = 0.00611 , chi - square = 7.7033 , p = 0.0055 ) , rubber dam isolation method ( df = 1 , est = -0.1673 , se = 0.0850 , chi - square = 3.8694 , p = 0.0492 ) and assistant experience ( df = 1 , est = 0.2028 , se = 5.6875 , p = 0.0171 ) and the week when restored ( df = 1 , se = 0.2954 , chi - square = 0.1136 , wald = 0.2954 , p = 0.0093 ) .
however , this model for predicting the best survival of the proximal art restorations found that the mixing time did not significantly affect the survival of these restorations ( df = 1 , se = -0.0875 , chi - square = 0.3337 , wald test = 0.0612 , p = 0.8046 ) . during the restoration phase , the temperature at the time of placing the restoration ranged from 19c to 31c , with a mean temperature of 24.5c ( 5 ) .
the temperatures were grouped as less than 20c , 20 - 30c and above 30c .
when the survival rate of the proximal restorations was related to the ambient temperatures as grouped , there was no significant statistical difference noted . however , those restorations placed when the ambient temperatures were close to the manufacturer 's recommended temperature that was within the group 20 - 30c , had the highest survival rate .
when the tooth isolation method , assistant experience , dental arch , temperature and mixing time as factors were again fitted in the cox proportional hazards model test , the results were as shown in table 2 .
the parameter estimates from the cox proportional hazards model for survival of the restorations in relation to the isolation method , assistant experience , dental arch in which restoration was placed , ambient temperature and mixing time as risk factors from table 1 , the experienced assistants and the use of the rubber dam isolation method appeared to reduce the risk of failure of the restorations .
the phenomenon was more pronounced during the third week of the restoration phase and less during the first and second weeks .
the longevity of the retention of dental restorations is the most important parameter for determining the success of a dental restorative material . for a long time
, amalgam has been the dental restorative material of choice for the treatment of cavitated posterior primary or permanent teeth .
however , there has been a recent surge in the number of alternative dental restorative materials .
these new materials have been developed to fulfill certain characteristics that amalgam was found to lack , for example , adhesion to the tooth surface , aesthetics , etc .
gic is one of the newer restorative materials first developed in 1972 by wilson and kent .
studies conducted to determine the survival rate of restorations placed using gic have reported varied results .
the longevity of art occlusal restorations in the permanent teeth have been reported to be equal to or greater than the amalgam restorations placed in the same teeth , but in the primary dentition the studies have shown no difference in their survival rate . the failure of these restorations has been attributed to the poor material strength , experience of the operator , the type of cavity , etc . however , being a tooth - colored material with tooth adhesive properties , gic continues to be a preferred restorative material for cavitated primary teeth .
further , gic has been used in situations where a more conservative cavity preparation is followed ( minimal destruction of the tooth ) and where its fluoride release characteristics provide further benefits to the affected tooth . in the present study ,
the gic materials used were tested for the longevity of the restorations made out of them in relation to the ambient temperature and the mixing time for the material during the restoration phase of the study .
changes in the ambient temperature would be expected to affect the chemical reaction of gic .
there are countries where temperature fluctuates from the very lowest during the winter season or cold season to the very highest in the summer season or hot season .
the open air environment in which the art approach is carried out might have some effects on the material , considering the seasonal changes for some places .
this might be particularly noticeable when the working area is poorly air - conditioned with the temperature not constantly maintained .
the possibility that the setting reaction of gic material will be affected becomes likely in such conditions , by taking a longer or shorter period to set at lower or higher temperatures , respectively .
the possibility of the operator leaving the material in the cavity before it is fully set or placing the material in the cavity in its advanced stages of setting is yet another very likely scenario . in the present study , the changes in temperature ranged between 19c and 31c during the restoration phase .
the temperature range of 12 appears large , yet the results in the present study indicated that there was no significant statistical difference in the survival rate of the restorations in the study . this could have been be due to the varied number of restorations within the two extreme temperatures , compensating for ( canceling the effect of each other ) what could have probably shown a statistical difference in the survival of the restorations .
the manufacturer 's recommended ambient working temperature was 23c for ketac molar aplicapat , 20 - 25c for kme and 23c for fuji ix .
it was evident that restorations that had been placed at temperatures recommended by the manufacturer for the material used in the study had a higher survival rate when related to those placed with temperatures further away from that recommended by the manufacturer .
however , the difference between the survival rates was not statistically significant , implying that for the best survival results the material should be mixed at a temperature close to or within that recommended by the manufacturer . outside the recommended levels , the survival rate of the restorations could be negatively affected .
quality mixture of the restorative material ( an assistant - dependent factor ) should be expected to enhance the survival rate of the restorations made out of the material
. it would be reasonable to imagine that the proportionation of the gic material ( powder and liquid ) might not be consistent for the hand - mixed type of gic compared with that already pre - portioned by the manufacturer . in turn
, variations in the mixture of the gic material mixture produced could arise , leading to possible variations in the survival rate of the restorations placed using the material .
mechanical mixing is likely to produce a mixture of gic with good consistency and results in better survival rate of the restorations .
for the materials used in the study , the manufacturer 's recommended mixing times were 10 , 30 and 20 s , respectively , for kma , kme and fuji ix . in the study , the assistants hand - mixed fuji ix and ketac molar easymix , but the ketac molar applicap material had already been pre - portioned by the manufacturer and only mixed by the assistant using the duomat machine .
yet , there were no significant differences noted between the survival rate of the restorations made out of the hand - mixed and the mechanically mixed gic .
this could imply that the assistants proportioned the two hand - mixed materials rather well .
the experienced assistants , in the present study , were associated with a higher survival rate of the restorations after 2 years .
probably , they were able to accurately proportionate and quickly manipulate the hand - mixed material and quickly avail to the same to the operator , while in the case of the mechanically mixed material the handling process was probably performed expeditiously .
assistant also simultaneously helped the operator to allay any anxiety in the child thus allowing the operator to concentrate on the critical areas of the restoration process .
the reduction in the mixing times for the inexperienced assistants with time to mostly 30 - 60 s and less than 30 s categories during the third operative week could be a pointer to the gain in skills and competence by the assistant .
changes in the ambient temperature would be expected to affect the chemical reaction of gic .
there are countries where temperature fluctuates from the very lowest during the winter season or cold season to the very highest in the summer season or hot season .
the open air environment in which the art approach is carried out might have some effects on the material , considering the seasonal changes for some places .
this might be particularly noticeable when the working area is poorly air - conditioned with the temperature not constantly maintained .
the possibility that the setting reaction of gic material will be affected becomes likely in such conditions , by taking a longer or shorter period to set at lower or higher temperatures , respectively .
the possibility of the operator leaving the material in the cavity before it is fully set or placing the material in the cavity in its advanced stages of setting is yet another very likely scenario . in the present study , the changes in temperature ranged between 19c and 31c during the restoration phase .
the temperature range of 12 appears large , yet the results in the present study indicated that there was no significant statistical difference in the survival rate of the restorations in the study . this could have been be due to the varied number of restorations within the two extreme temperatures , compensating for ( canceling the effect of each other ) what could have probably shown a statistical difference in the survival of the restorations .
the manufacturer 's recommended ambient working temperature was 23c for ketac molar aplicapat , 20 - 25c for kme and 23c for fuji ix .
it was evident that restorations that had been placed at temperatures recommended by the manufacturer for the material used in the study had a higher survival rate when related to those placed with temperatures further away from that recommended by the manufacturer .
however , the difference between the survival rates was not statistically significant , implying that for the best survival results the material should be mixed at a temperature close to or within that recommended by the manufacturer .
outside the recommended levels , the survival rate of the restorations could be negatively affected .
quality mixture of the restorative material ( an assistant - dependent factor ) should be expected to enhance the survival rate of the restorations made out of the material
. it would be reasonable to imagine that the proportionation of the gic material ( powder and liquid ) might not be consistent for the hand - mixed type of gic compared with that already pre - portioned by the manufacturer . in turn
, variations in the mixture of the gic material mixture produced could arise , leading to possible variations in the survival rate of the restorations placed using the material .
mechanical mixing is likely to produce a mixture of gic with good consistency and results in better survival rate of the restorations . for the materials used in the study ,
the manufacturer 's recommended mixing times were 10 , 30 and 20 s , respectively , for kma , kme and fuji ix . in the study , the assistants hand - mixed fuji ix and ketac molar
easymix , but the ketac molar applicap material had already been pre - portioned by the manufacturer and only mixed by the assistant using the duomat machine .
yet , there were no significant differences noted between the survival rate of the restorations made out of the hand - mixed and the mechanically mixed gic .
this could imply that the assistants proportioned the two hand - mixed materials rather well .
the experienced assistants , in the present study , were associated with a higher survival rate of the restorations after 2 years . probably , they were able to accurately proportionate and quickly manipulate the hand - mixed material and quickly avail to the same to the operator , while in the case of the mechanically mixed material the handling process was probably performed expeditiously .
assistant also simultaneously helped the operator to allay any anxiety in the child thus allowing the operator to concentrate on the critical areas of the restoration process .
the reduction in the mixing times for the inexperienced assistants with time to mostly 30 - 60 s and less than 30 s categories during the third operative week could be a pointer to the gain in skills and competence by the assistant .
the changes in ambient temperature and the mixing time for gic material during the restorations of proximal cavities in primary molars using the art approach did not significantly influence the survival rate of the restorations . | objective : temperature fluctuations and material mixing times are likely to affect the consistency and integrity of the material mixture , and hence the restoration made out of it .
the purpose of the present study was to determine the influence of the ambient temperature and the mixing time of glass ionomer cement ( gic ) restorative material on the survival rate of proximal atraumatic restorative treatment ( art ) restorations placed in primary molars.materials and methods : a total of 804 restorations were placed in the primary molars of 6 - 8-year - olds using the art approach .
the restorations were then followed for a period of 2 years and evaluated at given intervals .
the data collected were analyzed using spss computer statistical program , and the results tested and compared using the chi - square , kaplan meier survival analysis and cox proportional hazard statistical tests.results:the cumulative survival rate of the restorations dropped from the initial 94.4% to 30.8% at the end of 2 years .
the higher survival rate of the restorations was associated with the experienced operators and assistants when using the rubber dam isolation method .
however , there was no statistically significant difference in the survival rate of the restorations when related to the room temperature and the mixing time of the gic materials used in spite of the variations in the temperature recoded and the methods used in mixing the materials.conclusion:the ambient temperature and mixing time of gic did not have a significant effect on the survival of the proximal art restorations . | Introduction
Materials and Methods
Subjects
Procedure
Evaluations
Statistical analysis
Results
Discussion
Temperature as a factor
Mixing time as a factor
Conclusion |
the 21-day experimental gingivitis model is an established noninvasive model in humans for investigating the induction and resolution of inflammation in response to increasing bacterial accumulation . from its inception in 1965 , this model of inflammation has been used to assess how drugs,(3 ) bioactive compounds in dentifrices and environmental toxins , such as tobacco smoke , affect the development of inflammation .
the model is designed to enable the study of both the induction and resolution of inflammation , which can also be assessed over a relatively short period of time ( 35 days ) and in a controlled manner .
the model involves periodontally and systemically healthy volunteers , who do not brush specified test teeth in one sextant of the dentition , but continue to brush the remaining control teeth over a 21 day period .
accidental brushing of test teeth is prevented by the use of a vinyl shield ( mouth guard ) to cover them during cleaning . on day 21
, the accumulated plaque on all teeth is removed by a trained hygienist and study participants resume their normal oral hygiene practices . clinical assessment of plaque accumulation and gingival inflammation are made at baseline , day 7 , 14 , 21 on test and control teeth , following plaque accumulation on test teeth , and normal plaque removal from control teeth .
assessments are repeated again on day 35 , following 14 days of resolution of inflammation at test sites , and maintenance of health at control sites . when performed by trained and calibrated experts ,
these measures show consistent increases in plaque - induced inflammation up to day 21 followed by a return to baseline , preinflammation levels at day 35 .
however none of these assessments could potentially form the basis for a predictor of disease as they are all measures of existing inflammation or inducers of inflammation . a further and more objective assessment that can be made during the experimental gingivitis
is that of the volume and composition of gingival crevicular fluid ( gcf ) and at individual sites around individual teeth .
this fluid flows from the crevice between the tooth and the gum and comprises both a serum transdate(11 ) and tissue exudates . during inflammation , the volume and flow of this fluid increases,(1 ) and
this alone can be used to demonstrate induction and/or presence of gingivitis and periodontitis . however , due to its very nature , as a mixed serum transudate and tissue exudate , gcf carries with it proteins from the crevice .
thus its composition also provides a biological and pathological fingerprint of the various physiological and biochemical processes occurring within the gingival tissues . in 1980 , novaes et al.(15 ) demonstrated that the total protein present in gcf increased with increasing severity of periodontitis , although this was probably due to increases in gcf volume . by 1985 ,
lamster et al.(16 ) had measured differences in lactate dehydrogenase , beta - glucuronidase and arylsulfatase activity in gcf collected from experimental gingivitis sites and demonstrated increases in these biomarkers over the course of the 21 day study . since then
, studies have targeted particular cytokines , antibacterial peptides and proteins(19 ) and many more individual proteins and peptides , revealing increases in pro - inflammatory species during disease .
studies have also examined the effect of diseases , such as type i diabetes mellitus,(23 ) analysis of many anti - inflammatory or antimicrobial compounds , and environmental conditions , such as smoking,(8 ) on experimental gingivitis .
surface enhanced laser desorption / ionization time - of - flight mass spectrometry ( seldi tof ms ) has been used to examine small proteins and peptides ( 2.530 kda ) from healthy volunteers and gingivitis patients.(24 ) that study employed a targeted approach to investigate neutrophil defensins .
unfractionated gcf samples were also examined by matrix assisted laser desorption / ionization ( maldi)-tof ms , for neutrophil defensins.(25 ) similarly , pisano et al(26 ) used electrospray ionization(27 ) ( esi)ms to examine the acid - soluble protein content of gcf from healthy volunteers .
they , too , identified the neutrophil defensins , along with cystatin a , statherin and serum albumin . only in the last year
have tandem mass spectrometry ( ms / ms ) techniques been employed in the examination of gcf .
ngo et al.(28 ) used both maldi - tof / tof and esims / ms to identify 66 proteins that had been separated by gel electrophoresis from a single patient , who had a history of periodontal disease but who was in the maintenance phase following treatment .
proteins identified included a number of serum - derived proteins , such as albumin , complement and transferrin .
other proteins that were present included : antimicrobial proteins calgranulin a and b ; amylase ; cytatin s ; and histone h4 .
bostanci et al.(29 ) used a lcms label - free quantitative technique to identify 154 proteins from either healthy volunteers or patients with aggressive periodontitis .
bostanci et al.(29 ) identified a wide range of proteins including those mentioned already and a large number of keratins , immunoglobulins , and other intracellular proteins .
the majority of mass spectrometry - based proteomics is performed using the bottom - up(30 ) liquid chromatography tandem mass spectrometry ( lcms / ms ) approach .
generally , proteins are digested with trypsin prior to online lc separation . as the peptides elute into the mass spectrometer ,
they are fragmented typically by collision induced dissociation(31 ) ( cid ) resulting in b and y ion series.(32 ) the ms / ms spectra are searched against protein databases by use of algorithms ( e.g. , mascot,(33 ) sequest,(34 ) omssa(35 ) ) which match the data to theoretical spectra from in - silico digests of proteins .
two of the most popular are stable isotope labeled amino acids in cell culture(36 ) ( silac ) and isobaric tags for relative and absolute quantitation ( itraq).(37 ) in silac , cells are grown in media lacking essential amino acids . the media is supplemented with heavy or light amino acids . the labeled and unlabeled peptides elute together and the intensity of the peptide ions can be compared .
a common approach for quantitation of biological fluids(38 ) and tissue samples(39 ) is postdigestion labeling with itraq(40 ) labels .
itraq labels consist of a reporter ion with a m / z value of between 113 and 121 and a balance mass ( 191183 da ) such that all labeled peptides of the same sequence have the same nominal mass shift ( 304 da ) .
test and control samples are treated with separate itraq labels postdigestion and combined prior to ms analysis .
when the peptide ions are fragmented with cid , the reporter ions are cleaved from the peptide and detected in the mass spectrometer . the intensity of the reporter ions
quantitation with itraq , allows for the analysis up to eight different treatment groups(41 ) simultaneously .
one of the disadvantages of performing cid in ion traps is the instability of ions with m / z values approximately 1/3 that of the parent ion,(42 ) that is , fragment ions with m / z less than 1/3 of the precursor ions are not detected .
itraq reporter ions have m / z 113121 and therefore ion trap cid of itraq labeled peptides often does not result in quantification .
the recent introduction of pulsed - q dissociation(43 ) ( pqd ) has allowed for the analysis of itraq labeled samples in linear ion trap mass analysers .
pqd excites ions with a high amplitude q value ; q is a resonance excitation pulse .
when the ions are excited , they collide with neutral gas molecules in a similar manner to cid .
the activation profile applied in pqd is different to that of cid meaning that low mass ions are stable and can be detected . to date
, the proteomic profile of gcf during the active induction and subsequent resolution of inflammation under controlled conditions using the 21 day experimental gingivitis model has not been described .
herein we describe the quantitative analysis of gcf , collected from volunteers undergoing experimental gingivitis , by lcms / ms using fourier transform ion cyclotron resonance(44 ) ( ft - icr ) ms and itraq isobaric mass tags , to establish a profile of changes in proteins in healthy young volunteers that may be used to compare to the inflammatory response in other subsets of the population , such as those predisposed to periodontitis .
the experimental gingivitis model previously described by chapple et al.(9 ) was used , and the study was approved by the south birmingham local research ethical committee ( lrec 2004/074 ) .
ten nonsmoking volunteers ( mean age 21 years ; range 1928 , 4 males and 6 females ) who had unremarkable medical histories , no periodontal problems ( past or present ) , were not undergoing orthodontic or prosthetic appliance therapy or taking medication that may have affected results were enrolled into the study , and informed consent was obtained .
a split mouth design was employed with test sites being the maxillary left 4 , 5 , and 6 ( first and second premolars and first molar on the left - hand side of the upper jaw ) in right - handed individuals ( n = 9 ) and the equivalent teeth on the maxillary right side in left - handed individuals ( n = 1 ) .
plaque accumulation was assessed using a modified quigley - hein index(45 ) ( pi ; scores 05 ) and the gingival index ( gi ) of le(46 ) ( scores 03 ) was used to measure gingival inflammation .
bleeding was measured dichotomously as presence or absence following gentle probing and expressed as the percentage of sites that bled upon probing .
all volunteers had no evidence of attachment loss ( destruction or loss of the connective tissues and bone holding the teeth within their sockets ) when admitted to the study .
a soft vinyl splint was constructed to cover five teeth , with a 5 mm clearance at each free surface from the marginal tissues .
the splint was inserted gently over test teeth before brushing , to ensure against any mechanical or chemical cleaning .
the test and control teeth were given a thorough prophylaxis and oral hygiene was closely monitored for 2 weeks prior to the study commencing to ensure pristine gingival health at baseline ( see introduction and figure 1 ) .
gcf samples were collected from both test and control sites on days 0 ( baseline ) , 7 , 14 , and 21 . on day 21 ,
following plaque accumulation at test sites and after gcf sampling and recording of clinical indices , volunteers were given a full mouth prophylaxis and recommenced brushing without using the splint , in order to resolve the experimentally induced inflammation at test sites .
fourteen days later ( day 35 ) , the final set of gcf samples was collected and clinical indices recorded .
control sites were treated identically until baseline , but normal plaque removal then continued until day 35 .
gingival crevicular fluid was collected on periopaper strips ( oraflow , plainview , ny ) over a period of 30 s as previously described.(9 ) gcf volume was measured using a precalibrated periotron 8000 ( oraflow , plainview , ny),(47 ) from the 3 test teeth and the 3 control teeth .
the three test strips were then placed into a cryotube ( appleton woods , birmingham , u.k . ) containing ammonium bicarbonate ( 100 mm , 200 l ) , sealed and immediately frozen in liquid nitrogen , prior to storage at 80 c .
this procedure was repeated for the 3 control strips , thereby providing one pooled sample from test teeth and one pooled sample from control teeth for each volunteer .
periopaper strips , showed a percentage recovery of 62 5% from spiked plasma ( 1 l ) ( data not shown ) as analyzed by the number of proteins identified .
samples were defrosted on ice . from each sample within a time point and test or control site , 200 l of solution was removed and pooled to give rise to 10 1 ml samples : 5 from test sites and 5 from control sites , covering all time points .
to each pooled sample dithiothreitol ( fisher scientific , u.k . ) ( 20 l , 50 mm ) was added and the samples incubated at 60 c for 40 min .
the sample was returned to room temperature before iodoacetamide ( fisher scientific , u.k . )
( 100 l , 22 mm ) was added and the samples incubated at room temperature for 25 min . to consume any remaining iodoacetamide , dithiothreitol ( 2.8 l , 50 mm )
the samples were digested overnight with trypsin gold ( 500 ng , promega , madison , wi ) at 37 c .
the samples were vacuum centrifuged to dryness , resuspended in trifluoroacetic acid ( fisher scientific , u.k . ) ( tfa , 0.5% , 200 l ) and desalted using a michrom desalting macrotrap ( michrom , auburn , ca ) .
the trap was wetted using acetonitrile : water ( 50:50 , 300 l ) and washed with tfa ( 0.1% , 200 l ) .
the sample was loaded onto the trap and washed with tfa ( 0.1% , 200 l ) and eluted in acetonitrile / water ( 70:30 , 200 l ) .
samples were resuspended in dissolution buffer ( 0.5 m triethylammonium bicarbonate , 30 l ) .
the two day 0 samples were combined and half the sample was taken forward for labeling .
the day 7 control was omitted such that 8 samples were labeled in total , as follows .
the itraq 8-plex labels ( applied biosystems , foster city , ca ) were resuspended in isopropanol ( 50 l ) , added to the 8 samples as below , vortexed for 1 min and incubated at room temperature for 2 h. the labels were applied in the following order ( sampling time and condition , sample i d ) : day 0 , 113 ; day 7 test , 114 ; day 14 control , 115 ; day 14 test , 116 ; day 21 control , 117 ; day 21 test , 118 ; day 35 control , 119 ; and day 35 test , 121 .
the pooled sample was desalted as above and resuspended in mobile phase a ( see below , 200 l ) .
the sample was separated using strong cation exchange high performance liquid chromatography ( scx - hplc ) and fractions collected .
the chromatography was performed on an ettan lc ( ge healthcare life science , u.k . ) with a frac-950 fraction collection system .
the sample was separated on a polysulfethyl a column ( 100 mm 2.1 mm , 5 m particle size , 200 pore size .
polylc , columbia , md ) with a javelin guard cartridge ( 10 mm 2.1 mm , 5 m particle size , 200 pore size .
mobile phase a was potassium dihydrogen orthophosphate ( 10 mm , ph 3 ) dissolved in water : acetonitrile ( 80:20 ) .
mobile phase b was potassium dihydrogen orthophosphate ( 10 mm ) , potassium chloride ( 500 mm , ph 3 ) dissolved in water / acetonitrile ( 80:20 ) .
half of the sample was loaded onto the column and eighteen fractions were collected in eppendorf tubes ( 1.5 ml ) .
fractions were combined to give a total of 8 fractions ( fractions 2 , 18 , and 19 were combined ; 3 , 16 , and 17 combined ; 4 and 15 combined ; 5 and 14 combined ; 6 and 13 combined ; 7 and 12 combined ; 8 and 11 combined ; 9 and 10 combined ) .
online liquid chromatography was performed by use of a micro as autosampler and surveyor ms pump ( thermo fisher scientific , bremen , germany ) .
peptides were loaded onto a 75 m ( internal diameter ) integrafrit ( new objective , woburn , ma ) c8 resolving column ( length 10 cm ) and separated over a 40 min gradient from 0% to 40% acetonitrile ( baker , holland ) .
peptides were eluted directly ( 350 nl / min ) via a triversa nanospray source ( advion biosciences , ithaca , ny ) into a 7 t ltq ft mass spectrometer ( thermo fisher scientific ) , where they were subjected to data - dependent pqd . the mass spectrometer alternated between a full ft - ms scan ( m / z 4002000 ) and subsequent pqd ms / ms scans of the three most abundant ions above a threshold of 1500 .
survey scans were acquired in the icr cell with a resolution of 100 000 at m / z 400 .
pqd was performed with helium gas at a normalized collision energy of 45% , activation q 0.8 and activation time 200 ms .
automated gain control was used to accumulate sufficient precursor ions ( target value 5 10 , maximum fill time 0.2 s ) .
dynamic exclusion was used with a repeat count of 1 and exclusion duration of 180 s. data acquisition was controlled by xcalibur software v2.1.0 ( thermo fisher scientific inc . ) .
the ms / ms spectra were searched against a concatentated forward and reverse ipi human database v3.66 supplemented with bacterial proteins ( 224 902 entries ) using the sequest algorithm in proteome discoverer sp 1.0 ( thermo fisher scientific ) . only the itraq labels were specified as variable modifications , with carboxyamidomethylation of cysteine as a static modification .
the data were searched with a precursor mass error of 20 ppm and a fragment mass error of 0.5 da .
the search results were filtered using xcorr vs charge state ( peptides reporting xcorr values < 2 for 2 + ions , < 2.25 for 3 + ions and < 2.5 for 4 + or greater ions are rejected ) resulting in a false discovery rate of less than 1% .
the database used was compiled of human fasta proteins from the ipi database supplemented with bacterial families identified by socransky(48 ) as being associated with periodontal health or periodontal disease .
these families were porphyromonas , bacterioides , treponema , fusobacterium , prevotella , campylobacter , eubacterium , streptococcus , capnocytophaga , eikenella , actinobaccillus , actinomyces , selenomonas and aggregaterbacter .
these were filtered for proteins identified in at least three fractions by at least 2 peptides and quantified at all time points .
the temporal quantitative profiles of these proteins were analyzed using polysnap3 software.(49 ) polysnap3 compares trends using a weighted mean of the pearson parametric and spearman nonparametric correlation coefficients employing every measured intensity data point common to all one - dimensional patterns .
cluster numbers are estimated by : principal components analysis using transformed and nontransformed matrices ; multidimensional metric scaling ( mmds ) ; gamma statistic , calinski - harabasz statistic and c - statistic using either single linkage , group averages , ward method or complete linkage .
clinical measurements revealed that the volunteers had complied with the study criteria as shown in figure 2 , where it can be seen that plaque accumulated significantly at the test sites but not the control sites , as assessed by the plaque index .
after removal of all plaque from both test and control sites at day 21 microbial recolonization to baseline levels was observed at day 35 .
clinical measurements also demonstrated that at test sites inflammation had been induced , as measured by the modified gingival index ( figure 3 ) and the bleeding index ( figure 4 ) .
both these indices showed significant increases at test sites but not at control sites during plaque accumulation and returned to baseline levels , at day 35 , after removal of the inflammatory stimulus at day 21 and resumption of manual brushing ( figure 1 ) .
similarly , gcf volume increased with plaque accumulation at test sites but not at control sites and returned to baseline levels after removal of the inflammatory stimulus ( figure 5 ) .
data were analyzed by a kruskalwallis test with a dunn s post test . * * * represents p < 0.001 and * * represents p < 0.01 in comparison to day 0 ; $ represents p < 0.05 in comparison to control site at the same time point .
* represents p < 0.01 in comparison to day 0 . bleeding on probing was measured dichotomously as presence or absence following gentle probing and expressed as percentage of sites that bled upon probing .
data were analyzed by a kruskalwallis test with a dunn s post test . * * * represents p < 0.001 and * represents p < 0.05 in comparison to day 0 ; $ represents p < 0.05 in comparison to control site at the same time point .
gcf was collected on periopaper tm strips over 30s and the volume was measured using a precalibrated periotron 8000tm .
* * * represents p < 0.001 and * * represents p < 0.01 in comparison to day 0 ; $ represents p < 0.05 in comparison to control site at the same time point . using a meta - proteomics approach ,
the bacterial proteins showed little temporal variance across the course of the experimental gingivitis , from day 0 to day 35 .
temporal changes in the abundance of human proteins across the course of the experiment at control sites were analyzed with polysnap3 software for patterns different from a stable unchanging profile .
170 proteins showed no change over the course of the experiment ( cluster 1 , not deviating from a ratio of 1 from day 0 ) at control sites , and 16 showed decreases from day 0 to day 35 ( clusters 25 ) , at control sites , that did not cluster with the other proteins ( maximum number of clusters : 5 , range 15 , median number of clusters 3 , figure 6 ) .
the proteins in cluster 1 were then used to filter the data from the test sites , which were normalized to control sites .
the normalized data for the 170 proteins were analyzed using polysnap3 to identify the proteins whose abundances showed the greatest change with development of experimental gingivitis .
five clusters were determined ( clusters ae , maximum number of clusters : 6 , range 26 , median number of clusters 3 , figure 7 ) .
clusters a and e , containing 3 proteins each , increased to a maximum value at day 14 and day 21 respectively before returning to baseline levels at day 35 .
clusters c ( 1 protein ) and d ( 2 proteins ) , both decreased at day 14 and then either returned to baseline at days 21 and 35 ( cluster c ) or returned to baseline at day 21 and continued to increased to a maximum value at day 35 .
cluster b , ( 161 proteins ) , appeared to remain constant at baseline levels and throughout the course of the experimental gingivitis .
group 1 showed no changes from baseline , whereas groups 25 differed from baseline over the course of the experiment ( control clusters ) .
below the flow diagram are graphs representing the mean ( sem ) changes of the proteins in each cluster , which are followed beneath by 3-dimensional metric multidimensional scaling ( mmds ) plots and dendrograms showing the relationships of individual proteins with others in the analysis group .
colors of lines on graphs , spheres on 3d plots and bars on dengrograms coordinate to show the same clustering .
proteins identified from group 1 were used for the next step of the analysis using normalized test data which were clustered using polysnap3 .
five clusters ( clusters a - e ) were generated ( cluster round 1 summary ) , with 161 proteins identified in cluster b. the proteins in cluster b were then further analyzed by polysnap3 to generate 6 clusters ( clusters b16 ; cluster round 2 summary ) .
this group was then further analyzed using polysnap3 to generate 6 clusters ( clusters b2i - vi , cluster round 3 summary ) .
below the flow diagram are graphs representing the mean ( sem ) changes of the proteins in each cluster , which are followed beneath by 3-dimensional metric multidimensional scaling ( mmds ) plots and dendrograms showing the relationships of individual proteins with others in the analysis group .
colors of lines on graphs , spheres on 3d plots and bars on dendrograms coordinate to show the same clustering .
it should be noted that the highlighted , largest group on each dendrogram was the group taken forward into the subsequent round of clustering analysis .
inspection of the dendrogram from this clustering analysis demonstrated that there were still many clusters within group b. thus further analysis of this group was performed .
the second round of clustering revealed a further 6 clusters ( clusters b16 , maximum number of clusters : 6 , range 36 , median number of clusters 4 , figure 7 ) .
clusters b4 ( 4 proteins ) and b5 ( 2 proteins ) demonstrated increases across the course of the experimental gingivitis peaking at days 14 and 21 respectively and remaining elevated at the peak level at day 35 .
clusters b1 , b3 and b6 , containing 8 , 20 , and 4 proteins respectively , decreased during the course of the study .
cluster b1 showed a small decrease at day 14 and then returned to baseline levels before decreasing greatly at day 35 .
cluster b6 decreased at day 14 and remained at this level for the rest of the experimental gingivitis .
cluster b2 ( 123 proteins ) did not fluctuate at this level of detail across the course of the experimental gingivitis and these proteins were again taken for further clustering analysis .
that analysis gave rise to another 6 clusters ( clusters b2i - vi , maximum number of clusters : 6 , range 36 , median number of clusters 4 , figure 7 ) .
at this point two observations were made : ( 1 ) the largest group ( b2i ) showed a slight increase at day 21 , i.e. , no longer showed little variation across the course of the experimental gingivitis and ( 2 ) the variation in the ratio to day 0 for all the clusters was now between 01 unit at its maximum .
therefore , further rounds of clustering analysis were not pursued , even though there were still a large number of proteins in the largest cluster ( cluster b2i , n = 86 ) .
inspection of the patterns generated from this third and final clustering showed that cluster b2ii ( 1 protein ) showed a peak at day 21 ; cluster b2iii ( 4 proteins ) peaked at day 14 and then decreased at days 21 and 35 ; cluster b2iv ( 13 proteins ) showed little change over 14 and 21 days but an increase at day 35 ; cluster b2v ( 1 protein ) showed a decrease at day 21 ; and cluster b2vi ( 18 proteins ) showed an increase at day 14 that was sustained to day 21 before returning to baseline at day 35 .
fold changes for all proteins in cluster 1 can be found in the supplemental table 1 .
gene ontology analysis for location revealed the majority of proteins identified to cover the entire range of nuclear , plasma membrane , cytoplasmic and extracellular compartments ( figure 8) .
gene ontology analysis for function identified a wide range of possibilities with the greatest numbers of proteins for cellular transcription , dna binding , cytoskeletal functions , cell adhesion , defense against bacteria and cilia ( figure 8) .
particular clusters did not preferentially fall into one of these categories and the proteins functions were diverse throughout the individual clusters .
it should be noted that between 35 and 40% proteins did not have gene ontology terms that could be used .
gene otology pie charts were generated using swiss - prot database with inforsense , embedded in proteome discoverer sp1.0 from thermo fisher scientific inc .
across the course of experimentally induced gingivitis , we identified 16 bacterial and 186 human proteins by combining itraq and lcms / ms on an ft - icr mass spectrometer .
this observation may be used as confirmation that the gcf samples were not significantly contaminated with plaque during sampling . furthermore , fusobacterium species ( fusobacterium outer membrane proteins ) were detected and although this family , particularly fusobacterium nucleatum which is part of the orange complex identified by socransky et al,(48 ) has being associated with increased periodontal pocket depth and worsening clinical parameters , it is also associated with nonperiodontitis sites.(48 ) other bacterial proteins identified were not immediately obvious candidates from oral pathogens .
as gcf comprises both a serum transudate and tissue exudates , it is unsurprising to find both extracellular and intracellular components within samples . with respect to the extracellular components , serum proteins , such as albumin , igg3 and apolipoprotein b-100 ; as well as proteins displaying antibacterial properties , such as neutrophil defensin , cystatins b and s and annexins a1 and a3 , were found .
the serum components ( albumin and igg3 ) clustered together ( cluster b3 ) and showed a decrease at day 14 at test sites . at this time point , the gcf volume from test sites was already significantly increased above control sites . on
the other hand apolipoprotein b-100 falls into cluster b2vi , which follows the profile of the increase in gcf volume and bleeding index at test sites .
apolipoprotein b-100 is the protein component of low density lipoprotein , which has a diameter of approximately 26 nm . this particle is unlikely to be able to pass across the permeable sulcular membrane and could potentially be used as a marker of increased microulceration of the sulcular epithelium .
cystatins b and s and annexins a1 and a3 were found in cluster b2i , which was largely unchanged across the course of the experimental gingivitis .
cystatin b and annexin a1 were found by bostanci et al.(29 ) only in healthy volunteers and not in developing inflammatory disease .
that they seem not to change across the course of our experiment would support the idea that they are not associated with the development of moderate gingival inflammation .
neutophil defensin was found in cluster b2iv that showed the greatest increases at day 35 for the test sites .
bostanci et al.(29 ) also detected this protein at healthy sites , although the gcf volume at these sites is equivalent to day 7 in this experimental gingivitis study , perhaps highlighting a potential role of neutrophil defensin in population based health screening .
intracellular proteins identified had functions such as cellular transcription , dna binding , cytoskeletal functions , cell adhesion , and cilia proteins . starting with cytoskeletal proteins , a large number of keratins were identified , which was expected from sampling adjacent to epithelial tissues .
the oral epithelium has one of the highest turnover rates(50 ) and this will have contributed to the large number of keratins seen .
the majority of keratins were clustered together in cluster b2i , which showed the least variation across the course of the experimental gingivitis , perhaps indicating that the differentiation or proliferation of the epithelium was not affected during the course of the induced inflammation , again consistent with a sulcular rather than a pocket lining epithelium that characterizes periodontitis .
however , it is acknowledged that some keratin contamination could have occurred during sample handling . other cytoskeletal and associated proteins , such as titin and actin- and microtubule- associated proteins , also fell into cluster b2i .
these proteins could be components of desquamated epithelial cells released during the turnover of the epithelium .
to our knowledge , these cilia - associated proteins have not been identified in gcf before . however , a number of studies have used histology to investigate changes in the gingivae in periodontal disease .
saglie et al.(53 ) used scanning electron microscopy to investigate the pocket epithelium from patients with advanced periodontal disease . at high resolution
they observed individual epithelial cells , bacteria and erythrocytes ; however , large amounts of cilia were not seen , such as might be expected with lung epithelium . primary cilia , however , are present on nearly all cells , including internal stratified oral epithelium,(54 ) and play a chemo- or mechano - sensory role.(55 ) although they are not changed in this experimental gingivitis model , it will be interesting to determine how cilia proteins change with chronic periodontal diseases as it has been proposed that ciliopathies may impair wound healing.(55 ) among the cellular transcription and dna binding proteins that were identified were two histone proteins : histone h4 and histone h1.2 .
they did not cluster together ; however , they were both in clusters ( b2iii and b2vi , respectively ) that showed an increase at test sites at day 14 .
these proteins are associated with chromatin and may indicate the presence of neutrophil extracellular traps ( nets).(56 ) in addition to phagocytosis , neutrophils can discharge decondensed chromatin and associated proteins to trap and immobilize bacteria .
these nets have been shown to be present in the gingival crevice of periodontitis patients.(57 ) neutrophils are the most important leukocytes in the periodontal tissues and have been implicated in periodontitis patients as being hyper - active and hyper - reactive .
further evidence for neutrophils may be taken from the presence of plastin-2 ( or l - plastin ) , which was also identified by bostanci et al.(29 ) plastin-2 is an actin bundling protein that plays a role in signaling following fc receptor stimulation in adherent neutrophils .
here we found plastin-2 clusters within cluster b3 , which demonstrated a decrease at day 14 at test sites , which might indicate a less adherent phenotype in neutrophils at this stage of the inflammatory response .
bostanci et al.(29 ) reported this protein in aggressive periodontitis patients only , perhaps showing a further change in the behavior of neutrophils in diseased rather than healthy volunteers .
in this study , we have used polysnap3 clustering software in a multilayered analytical approach .
for ease of comprehension , an analogy may be used of examining the clusters of proteins in a manner similar to peeling away the layers of an onion or zooming in to different levels of detail in the clustering .
the first layer isolated those proteins that did not maintain a broadly steady flat baseline in the control sites during the course of the experimental gingivitis .
the greatest change was seen with nebulin ( cluster 5 ) ; however , other isoforms of this protein ( nebulin isoform 1 and 2 ) were clustered to cluster b2i which showed the least variation across the course of the experimental gingivitis .
cluster analysis of the entire data set ( not shown ) always showed these particular proteins as lying outside the central core ( figure 6 control cluster 3d mmds plot ) , thus they may be viewed as outliers . following the exclusion of these proteins
the normalized test data was clustered revealing the clusters that changed the most across the course of the experimental gingivitis and then subsequent clustering of the largest group showed the next level of changes , and so on in the third round of clustering .
two groups ( clusters a and e ) in the first round of clustering and one ( cluster b2vi ) in the third round of clustering showed increases at days 14 , 21 , and 14 respectively , which were similar to increases in the clinical parameters . cluster a contained disparate proteins involved in neuronal axons , transcription and protein production ; cluster e contained proteins involved in signal transduction , actin - myosin based movement and synaptic transmission ; and cluster b2vi contained many proteins including actin - myosin based movement and synaptic transmission again
. a common theme from these clusters might be the presence of neuronal and synapse associated proteins .
sterling and matthews ( 2005)(60 ) suggest that ribbon synapses occur wherever synaptic exocytosis is evoked by graded depolarisation and where signalling requires a high rate of sustained release such as in the terminals of photoreceptors and auditory and vestibular hair cells .
these synapses use glutamate as their primary neurotransmitter and this would fit with the identification of metabotropic glutamate receptors in cluster b2vi .
histological investigations of gingival biopsies will be required to verify the presence of ribbon synapses within the gingivae as their presence has not been seen before .
the role of their destruction during experimental gingivitis remains to be fully investigated , particularly with the knowledge that substance p , a neuropeptide , released from sensory neurones and an inducer of inflammation and pain , is increased in gingivitis and periodontitis,(61 ) and that in a recent transcriptomics investigation offenbacher et al ( 2009)(62 ) found that after changes to immune response pathways , neural process pathways where the second most abundant pathways activated during a similar experimental gingivitis model .
lastly , cytokines have been investigated extensively in gcf as biomarkers of gingival inflammation . however , in this study we have not been able to detect any cytokines , consistent with bostanci et al.(29 ) this is probably due to the cytokines being at low , subattomol , concentrations . to conclude , here
we have shown for the first time the quantitative analysis of temporal changes of proteins in gingival crevicular fluid , using a nonpresumptive approach .
proteins identified included proteins already known to the dental community and verification of newly identified proteins in other mass spectral studies .
we have also identified new proteins that highlight structural components of the gingivae that have not been seen before and that warrant further investigation . | the 21-day experimental gingivitis model , an established noninvasive model of inflammation in response to increasing bacterial accumulation in humans , is designed to enable the study of both the induction and resolution of inflammation . here
, we have analyzed gingival crevicular fluid , an oral fluid comprising a serum transudate and tissue exudates , by lcms / ms using fourier transform ion cyclotron resonance mass spectrometry and itraq isobaric mass tags , to establish meta - proteomic profiles of inflammation - induced changes in proteins in healthy young volunteers . across the course of experimentally induced gingivitis , we identified 16 bacterial and 186 human proteins .
although abundances of the bacterial proteins identified did not vary temporally , fusobacterium outer membrane proteins were detected .
fusobacterium species have previously been associated with periodontal health or disease .
the human proteins identified spanned a wide range of compartments ( both extracellular and intracellular ) and functions , including serum proteins , proteins displaying antibacterial properties , and proteins with functions associated with cellular transcription , dna binding , the cytoskeleton , cell adhesion , and cilia . polysnap3 clustering software was used in a multilayered analytical approach .
clusters of proteins that associated with changes to the clinical parameters included neuronal and synapse associated proteins . | Introduction
Materials and Methods
Results
Discussion |
infertility , a reproductive health condition prevalent among one in every four couples in the developing countries , is a neglected problem .
india alone accounts for 30 million couples of infertility of the total 48.5 million globally affected couples .
assisted reproductive technologies ( art ) such as in vitro fertilization ( ivf ) and intracytoplasmic sperm injection ( icsi ) have emerged as a promising treatment option for infertility .
ivf / icsi may involve the use of own oocyte , donor oocyte , or vitrified embryo .
however , these treatment options have been reported to be associated with the risk of various maternal and perinatal complications which include hemorrhage , puerperal sepsis , preeclampsia , pregnancy - induced hypertension ( pih ) , gestational diabetes mellitus ( gdm ) , preterm birth , low birth weight ( lbw ) , small for gestational age ( sga ) , congenital abnormalities , and perinatal death .
a woman 's chances of having a pregnancy and a live birth when using ivf / icsi are influenced by many factors , some of which are patient - related and outside a clinic 's control ( e.g. , the woman 's age or the cause of infertility ) . with the rise in the number of ivf / icsi cycles carried out world over where clinics only present success rates in terms of pregnancy rates to couples who require ivf / icsi , more robust data are required in terms of pregnancy outcomes ( clinical pregnancy rates [ cprs ] , clinical abortion rates [ car ] , ectopic pregnancy rates [ eprs ] , multiple pregnancy rates [ mprs ] ) , live birth rates ( lbrs ) , maternal and perinatal complications associated with ivf / icsi of each clinic , to inform such increasing number of couples who opt for ivf / icsi . as per society for art ( sart ) register in 2013 across 467 clinics in the usa , a total of 160,554 ivf / icsi cycles were performed , resulting in a total 135,423 embryo transfers ( ets ) . among patients undergoing fresh ets using own oocytes , cpr and lbr ranging from 6.9% to 54.3% and 2.9% to 47.4% were reported among different age groups . in thaw
et cycles using own oocytes , cpr and lbr ranging from 23.4%54.2% and 14.2%44.1% were reported among different age groups . in donor oocyte transfer cycles , patients undergoing fresh ets , cpr and lbr were 66% and 55.9% , respectively , and in patients undergoing frozen thawed ets were 50.1% and 40.2% , respectively .
the frequency and type of these complications may vary depending on the type of oocytes used , i.e. , self - oocyte , donated oocyte , and vitrified embryo in ivf / icsi .
several studies have compared the incidence of obstetric and perinatal complications associated with the type of oocyte used in the treatment . a study by liu et al . compared the obstetric and neonatal complications associated with the transfer of fresh , slow freezing , and vitrified embryos .
the rate of preterm birth was reported to be less in the vitrified group ( 7.5% ) as compared to fresh ( 9.2% ) and slow freezing ( 7.8% ) groups , respectively .
number of twin babies born was also less in vitrified group ( 382 ) and higher in fresh and slow freezing group , i.e. , 734 and 1322 , respectively .
the rate of hyper - intensive disorders in vitrified , slow freezing , and fresh groups was 8.9% , 7.6% , and 9.5% , respectively .
another study compared the obstetric and perinatal outcomes in pregnancies with oocyte donation ( od ) and standard ivf .
the study reported an increased risk in pregnancies following od such as first trimester bleeding ( 53% vs. 31% , p < 0.01 ) , pih ( 31% vs. 14% , p < 0.05 ) , and perinatal mortality rate ( 3.3% vs. 0% ) as compared to ivf
. however , there is a lack of data on the incidence of these obstetric and perinatal outcomes following ivf / icsi .
this is the first study to gather the data on the incidence of maternal and perinatal outcome of pregnancy resulting from et following ivf / icsi using own oocytes , donor oocytes , and vitrified - warmed embryos .
the study included all the patients who had a positive pregnancy test after et carried out between january 1 , 2014 , and december 31 , 2014 , following ivf / icsi .
all the patients were provided a format of standard antenatal care ( frequency of monitoring , medications , ultrasound monitoring , etc . ) and were advised delivery at a well - equipped obstetric setup .
all the pregnant subjects were under the obstetric care of an obstetrician of their choice either from the beginning or after 12 weeks as the obstetric care is not provided at the facility .
two approaches were used to collect the data from the study patients :
first , at the time of referral , each obstetrician was provided with a pro forma for pregnancy monitoring and to record the outcome of patient 's pregnancy - both maternal and perinatal .
they were requested to complete the form and send the same to our center within a month of abortion , ectopic pregnancy , or deliveryin cases where obstetrician could not be contacted , the details regarding outcome were obtained from the subjects themselves through a phone call .
first , at the time of referral , each obstetrician was provided with a pro forma for pregnancy monitoring and to record the outcome of patient 's pregnancy - both maternal and perinatal .
they were requested to complete the form and send the same to our center within a month of abortion , ectopic pregnancy , or delivery in cases where obstetrician could not be contacted , the details regarding outcome were obtained from the subjects themselves through a phone call .
the study assessed the pregnancy outcome and frequency of several maternal complications and perinatal outcomes in the study patients .
the pregnancy outcomes included were the cpr , car , epr , lbr , mpr , and twin birth rate .
the maternal complications including pih ; premature rupture of membranes ( prom ) ; gdm ; placental abnormalities , namely , placenta previa and abruption placentae ; liquor abnormalities including oligohydramnios , polyhydramnios , and preterm labor were observed .
the perinatal outcomes including prematurity , birth weight , still births , neonatal deaths , and congenital anomalies were recorded .
chi - squared test was used to assess and compare the frequencies of various maternal and perinatal outcomes of pregnancies following the transfer of self , donor , and vitrified - warmed embryos .
the study included all the patients who had a positive pregnancy test after et carried out between january 1 , 2014 , and december 31 , 2014 , following ivf / icsi .
all the patients were provided a format of standard antenatal care ( frequency of monitoring , medications , ultrasound monitoring , etc . ) and were advised delivery at a well - equipped obstetric setup .
all the pregnant subjects were under the obstetric care of an obstetrician of their choice either from the beginning or after 12 weeks as the obstetric care is not provided at the facility .
two approaches were used to collect the data from the study patients :
first , at the time of referral , each obstetrician was provided with a pro forma for pregnancy monitoring and to record the outcome of patient 's pregnancy - both maternal and perinatal .
they were requested to complete the form and send the same to our center within a month of abortion , ectopic pregnancy , or deliveryin cases where obstetrician could not be contacted , the details regarding outcome were obtained from the subjects themselves through a phone call .
first , at the time of referral , each obstetrician was provided with a pro forma for pregnancy monitoring and to record the outcome of patient 's pregnancy - both maternal and perinatal .
they were requested to complete the form and send the same to our center within a month of abortion , ectopic pregnancy , or delivery in cases where obstetrician could not be contacted , the details regarding outcome were obtained from the subjects themselves through a phone call .
the study assessed the pregnancy outcome and frequency of several maternal complications and perinatal outcomes in the study patients .
the pregnancy outcomes included were the cpr , car , epr , lbr , mpr , and twin birth rate .
the maternal complications including pih ; premature rupture of membranes ( prom ) ; gdm ; placental abnormalities , namely , placenta previa and abruption placentae ; liquor abnormalities including oligohydramnios , polyhydramnios , and preterm labor were observed .
the perinatal outcomes including prematurity , birth weight , still births , neonatal deaths , and congenital anomalies were recorded .
chi - squared test was used to assess and compare the frequencies of various maternal and perinatal outcomes of pregnancies following the transfer of self , donor , and vitrified - warmed embryos .
this prospective observational study included 2092 female patients aged 2150 years who underwent 2112 et ( group a : fresh et using self - oocytes ; 21 - 42 years , n = 691 , group b : fresh et using donor oocytes ; 2250 years , n = 611 , and group c : thaw et using vitrified - warmed embryos : 2150 years , n = 810 ) .
study design and patient disposition table 1 enlists all the pregnancy outcomes assessed in this study .
cpr was reported to be higher ( p = 0.002 ) in group b ( n = 307 ; 50.2% ) , followed by group c ( n = 348 ; 42.9% ) and group a ( n = 282 ; 40.8% ) .
the rate of multiple pregnancies did not differ significantly between the treatment groups : group a ( n = 100 ; 32.5% ) , group c ( n = 109 ; 31.3% ) , and group b ( n = 77 ; 27.3% ) .
the car was higher ( p = 0.017 ) in group c ( n = 88 ; 25.2% ) in comparison to the group b ( n = 67 ; 21.8% ) and group a ( n = 45 ; 15.9% ) .
pregnancy outcomes assessed in the study the rate of ectopic pregnancies did not differ significantly in the three groups ( p = 0.245 ) : group a , n = 8 ( 2.48% ) ; group b , n = 5 ( 1.5% ) ; and group c , n = 4 ( 1.1% ) .
the lbr in the study was higher in group b ( n = 221 ; 36.9% ) in comparison to group a ( n = 221 ; 31.9% ) and group c ( n = 240 ; 29.6% ) ; however , it could not achieve statistical significance .
the rate of singleton and twin birth did not vary significantly among the three treatment groups .
the percentage of singleton births among the three groups was higher in the group a ( n = 167 ; 73.5% ) , followed by group c ( n = 180 ; 72.2% ) and group b ( n = 153 ; 67.1% ) .
the percentage of twin births was higher in the group b ( n = 75 ; 32.8% ) , followed by group c ( n = 69 , 27.7% ) and group a ( n = 60 ; 26.4% ) .
lower segment cesarean section was the mode of delivery in most of the study patients ( n = 660 : group a , n = 203 ; group b , n = 221 ; group c , n = 236 ) .
vaginal delivery was reported in 48 patients ( group a , n = 25 ; group b , n = 7 ; group c , n = 16 ) .
the rate of maternal complications was highest in group b ( 32.0% ) , followed by group c ( 24.9% ) and group a ( 22.0% ) ; however , difference was not statistically significant ( p = 0.3687 ) .
pih was reported to be the most frequent maternal complication in group b ( n = 38 ; 12.38% ) , followed by group c ( n = 26 ; 7.47% ) and group a ( n = 16 ; 5.67% ) .
other frequent complications reported in the women during pregnancy were prom ( n = 50 ; 5.33% ) and oligohydramnios ( n = 32 ; 3.41% ) .
only one patient in the group a had gdm . in the group b and group c ,
gdm was reported in 6 ( 2.7% ) and 6 patients ( 2.2% ) , respectively .
there was one maternal death in group b due to acute renal failure 2 days post - lscs done for severe pih and twin pregnancy .
maternal complications in patients undergoing different treatment types ( p=1.000 ) the incidence of prematurity ( < 36 weeks of pregnancy ) was highest in group b ( 42.58% ) , followed by group c ( 35.74% ) and group a ( 29.52% ) [ table 3 ] .
prematurity rate following in vitro fertilization / intracytoplasmic sperm injection incidence of lbw ( < 2.5 kg ) in group a , group b , and group c was 43.20% , 55.11% , and 46.22% , respectively ; of which 83.75% in group a , 83.83% in group b , and 70.06% in group c belonged to lbw category ( 1.52.499 kg ) [ table 4 ] .
birth weight of infants born with different treatment types ( p=0.005 ) perinatal death rate in the study was higher in group c ( n = 26 ; 81.7/1000 ) in comparison to group a ( n = 16 ; 55.0/1000 ) and group b ( n = 15 ; 49.5/1000 ) ; however , the difference was not statistically significant among the three groups ( p = 0.959 ) .
the rate of stillbirths was 4.1% in group a , 3.3% in group b , and 6.2% in group c [ table 5 ] .
perinatal death rate , stillbirth rate , and neonatal death rate comparison congenital abnormalities [ table 6 ] were reported in 4 ( 1.39% ) infants in group a ( pulmonary cyst , ventriculomegaly , tracheoesophageal fistula ( tof ) , cerebellar hypoplasia , hypertelorism , short femur , and klinefelter 's syndrome ) .
one infant was born with multiple congenital anomalies ( tof , cerebellar hypoplasia , short femur , hypertelorism ) in group a. in group b , 4 ( 1.32% ) infants had congenital abnormalities including transposition of great arteries , total anomalous pulmonary venous connection , anorectal malformation , and cardiac anomaly . in group c , 3 ( 0.94% ) infants had congenital abnormalities ; they were tof , ventriculomegaly , and hypoplastic nasal bone .
this prospective observational study included 2092 female patients aged 2150 years who underwent 2112 et ( group a : fresh et using self - oocytes ; 21 - 42 years , n = 691 , group b : fresh et using donor oocytes ; 2250 years , n = 611 , and group c : thaw et using vitrified - warmed embryos : 2150 years , n = 810 ) .
cpr was reported to be higher ( p = 0.002 ) in group b ( n = 307 ; 50.2% ) , followed by group c ( n = 348 ; 42.9% ) and group a ( n = 282 ; 40.8% ) .
the rate of multiple pregnancies did not differ significantly between the treatment groups : group a ( n = 100 ; 32.5% ) , group c ( n = 109 ; 31.3% ) , and group b ( n = 77 ; 27.3% ) .
the car was higher ( p = 0.017 ) in group c ( n = 88 ; 25.2% ) in comparison to the group b ( n = 67 ; 21.8% ) and group a ( n = 45 ; 15.9% ) .
pregnancy outcomes assessed in the study the rate of ectopic pregnancies did not differ significantly in the three groups ( p = 0.245 ) : group a , n
= 8 ( 2.48% ) ; group b , n = 5 ( 1.5% ) ; and group c , n = 4 ( 1.1% ) .
the lbr in the study was higher in group b ( n = 221 ; 36.9% ) in comparison to group a ( n = 221 ; 31.9% ) and group c ( n = 240 ; 29.6% ) ; however , it could not achieve statistical significance .
the rate of singleton and twin birth did not vary significantly among the three treatment groups .
the percentage of singleton births among the three groups was higher in the group a ( n = 167 ; 73.5% ) , followed by group c ( n = 180 ; 72.2% ) and group b (
the percentage of twin births was higher in the group b ( n = 75 ; 32.8% ) , followed by group c ( n = 69 , 27.7% ) and group a ( n = 60 ; 26.4% ) .
lower segment cesarean section was the mode of delivery in most of the study patients ( n = 660 : group a , n = 203 ; group b , n = 221 ; group c , n = 236 ) .
vaginal delivery was reported in 48 patients ( group a , n = 25 ; group b , n = 7 ; group c , n = 16 ) .
the rate of maternal complications was highest in group b ( 32.0% ) , followed by group c ( 24.9% ) and group a ( 22.0% ) ; however , difference was not statistically significant ( p = 0.3687 ) .
pih was reported to be the most frequent maternal complication in group b ( n = 38 ; 12.38% ) , followed by group c ( n = 26 ; 7.47% ) and group a ( n = 16 ; 5.67% ) .
other frequent complications reported in the women during pregnancy were prom ( n = 50 ; 5.33% ) and oligohydramnios ( n = 32 ; 3.41% ) .
only one patient in the group a had gdm . in the group b and group c ,
gdm was reported in 6 ( 2.7% ) and 6 patients ( 2.2% ) , respectively .
there was one maternal death in group b due to acute renal failure 2 days post - lscs done for severe pih and twin pregnancy .
the incidence of prematurity ( < 36 weeks of pregnancy ) was highest in group b ( 42.58% ) , followed by group c ( 35.74% ) and group a ( 29.52% ) [ table 3 ] .
prematurity rate following in vitro fertilization / intracytoplasmic sperm injection incidence of lbw ( < 2.5 kg ) in group a , group b , and group c was 43.20% , 55.11% , and 46.22% , respectively ; of which 83.75% in group a , 83.83% in group b , and 70.06% in group c belonged to lbw category ( 1.52.499 kg ) [ table 4 ] .
birth weight of infants born with different treatment types ( p=0.005 ) perinatal death rate in the study was higher in group c ( n = 26 ; 81.7/1000 ) in comparison to group a ( n = 16 ; 55.0/1000 ) and group b ( n = 15 ; 49.5/1000 ) ; however , the difference was not statistically significant among the three groups ( p = 0.959 ) .
the rate of stillbirths was 4.1% in group a , 3.3% in group b , and 6.2% in group c [ table 5 ] .
perinatal death rate , stillbirth rate , and neonatal death rate comparison congenital abnormalities [ table 6 ] were reported in 4 ( 1.39% ) infants in group a ( pulmonary cyst , ventriculomegaly , tracheoesophageal fistula ( tof ) , cerebellar hypoplasia , hypertelorism , short femur , and klinefelter 's syndrome ) .
one infant was born with multiple congenital anomalies ( tof , cerebellar hypoplasia , short femur , hypertelorism ) in group a. in group b , 4 ( 1.32% ) infants had congenital abnormalities including transposition of great arteries , total anomalous pulmonary venous connection , anorectal malformation , and cardiac anomaly . in group c , 3 ( 0.94% )
infants had congenital abnormalities ; they were tof , ventriculomegaly , and hypoplastic nasal bone .
this is the first prospective study to assess the pregnancy outcomes as well as incidence of maternal and perinatal outcomes in women undergoing ivf / icsi treatment using self - oocyte , donor oocyte , and vitrified - warmed embryo .
the japanese art registry reports 190,613 art treatment cycles in 2008 approximately 15% increase over 2007 reported treatments .
all women used their own eggs or embryos and approximately 32% of all cycles used frozen thawed embryos .
of the 190,613 treatment cycles , 17.1% resulted in a clinical pregnancy and 10.7% resulted in a live birth delivery .
the european register by the european society of human reproduction and embryology for 2010 reported outcomes of ivf / icsi of more than 5 lakh cycles conducted in 31 countries .
cpr of 33% for fresh et cycles ( both using own oocytes and donor oocytes ) and 20.3% for thaw et cycles were recorded .
. twin birth rate of 20.6% in ivf / icsi and 12.5% in thaw cycles was recorded . in the present study too , cpr was found to be higher in fresh et cycle using own oocytes and donor oocytes of 40.8% and 50.2% , respectively , compared to thaw ets using vitrified - warmed oocytes , i.e. , 42.9% .
overall , mpr was higher , i.e. , 30.5% , being 27.3% , 32.55% , and 31.3% in groups a , b , and c , respectively .
as per sart register in 2013 across 467 clinics in the usa , a total of 160,554 ivf / icsi cycles were performed , resulting in 135,423 ets . among patients undergoing fresh ets using own oocytes , cpr and lbr according to age group were : 54.3% and 47.4% ( < 35 years ) , 47.3% and 39.3% ( 3537 years ) , 38.3% and 28.4% ( 3840 years ) , 27.3% and 16.2% ( 4142 years ) , 15.9% and 8.2% ( 4344 years ) , and 6.9% and 2.9% ( > 44 years ) . in thaw
et cycles using own oocytes , cpr and lbr according to age group were : 54.2% and 44.1% ( < 35 years ) , 50% and 40.1% ( 3537 years ) , 46.9% and 35.7% ( 3840 years ) , 42.1% and 30.3% ( 4142 years ) , 34.2% and 23.5% ( 4344 years ) , and 23.4 and 14.2% ( > 44 years ) . in donor oocyte transfer cycles , the incidence of cpr and lbr in patients undergoing fresh ets and frozen
thawed ets was 66% and 55.9% and 50.1% and 40.2% , respectively . in the present study ,
cpr and lbr in group a were 40.8% and 31.9% , in group b were 50.2% and 36.9% , and in group c were 42.9% and 29.6% , respectively .
the results of the study are comparable to sart data , cpr and lbr being highest in fresh et cycles using donor oocytes .
shen et al . in 2014 reported cpr , mpr , ar , and er of 48.2% , 32.2% , 6.1% , and 2.5% in fresh et cycle ( n = 1150 ) and 36.5% , 29.3% , 19% , and 3% in frozen - thawed et cycles , thereby reporting the higher cpr in fresh et cycles compared to frozen - thawed et cycles , which is in accordance with the present study .
ar in their study too was higher in frozen thawed et cycles compared to fresh et cycles that too in agreement with the current study .
several studies in the past have reported a higher lbr following od . a retrospective study by remoh et al .
reported accumulative pregnancy rate and lbrs to be 94.8% ( confidence interval [ ci ] 90.6%99.0% ) and 88.7% ( ci 88.1%89.3% ) following ovum donation .
the sart ( 2009 ) reported that the transfer of 9485 embryos with od resulted in an lbr of 55.1% .
the study results were also in agreement with the findings of above studies as lbr ( n = 221 ; 36.9% ) was higher in the group b where fresh et was done using donor oocytes .
this is probably because the oocytes are derived from relatively young women with proven fertility .
reported cpr , ar , and mpr in od cycles to be 47% , 19% , and 35% , respectively .
these results are comparable to present study which showed cpr ( 50.2% ) , ar ( 21.8% ) , and mpr ( 32.5% ) . a systematic review by thomopoulos et al .
it concluded that the reduction of multiple gestations by using single et techniques can be a therapeutic option for minimizing the hypertensive complications following assisted pregnancies .
an incidence of gdm is reported to be two times more in women with singleton pregnancies following art as compared with the spontaneous pregnancies .
reported an increased incidence of pih in od cycles ( 15.8% ) compared to self - oocyte cycles ( 9.5% ) . in the current study too , the frequency of pih was reported to be higher in the group b ( n = 38 , 16.6% ) compared to group a ( n = 16 , 7.04% ) .
the exact cause of maternal complications with od is not known ; the possibility is linked with advanced maternal age , primiparity , and multiple pregnancies .
the study also reported an increased risk of pih ( 23% of all deliveries ) similar to the present study .
another study by krieg et al . compared the maternal outcomes of women who conceived through donor oocytes with that of autologous oocytes in ivf .
the study reported similar rates of hypertensive disorders , gdm , and placental abnormalities in both groups .
this study speculated that the use of donor oocytes may not necessarily be associated with an increased risk of obstetric complications .
the complications might be due to advanced maternal age , multiple gestation , or ivf itself .
in the current study , gdm was reported in six patients ( 2.6% ) in group b compared to only one patient ( 0.44% ) in group a. overall , a higher incidence of pih and gdm was observed as compared to other maternal complications .
the international committee monitoring arts world report , 20082010 included data from over 52 countries with 4,461,309 art cycles resulting in 1,144,858 babies born .
delivery rate in fresh cycles per aspiration for ivf / icsi was 19.8% , 19.7% , and 20% for the years 2008 , 2009 , and 2010 , respectively , whereas in frozen - thawed et cycles , they were 18.8% , 19.7% , and 20.7% , respectively .
the risk of preterm birth is reported to be significantly higher in twins born ( 23% ) after ivf as compared to the natural twins .
the risk of lbw is increased due to prematurity resulting from multiple pregnancies , but the risk is even higher in singleton pregnancies and more evident in twins of ivf as compared to natural singletons and twins .
although , previous studies have reported an increased risk of congenital abnormalities in children born after ivf / icsi ( 30%40% ) as compared to natural conception . a recent review by fauser et al .
reported a similar risk of birth defects in ivf and natural conception and a very low risk of genetic disorders in children born following assisted technologies .
the review also concluded that the health of the children is independent of the art and the differences observed might be due to maternal age .
the occurrence of congenital malformations in infants born after art has also been linked to the cause of infertility and its determinants in the couples , medications used for ovulation induction and pregnancy maintenance .
the perinatal mortality rate in fresh ivf / icsi cycles using own oocytes was 22.8/1000 births , 19.2/1000 births , and 21/1000 birth for the years 2008 , 2009 , and 2010 , respectively , whereas in frozen - thawed ets , they were 15.1/1000 , 12.8/1000 , and 14.6/1000 , respectively .
in present study , perinatal death rate was 52.2/1000 births ( n = 16 ) , 46/1000 births ( n = 15 ) , and 78/1000 births ( n = 26 ) in groups a , b , and c , respectively .
however , of the total 16 deaths in the group a , 50% babies were below 1 kg , and among 15 deaths in the group b , 39.8% babies were below 1 kg , and among 26 total deaths in the group c , 69.23% babies were below 1 kg ; this could possibly be a contributing factor . in the current study ,
the incidence of prematurity ( < 36 weeks of pregnancy ) was highest in group b ( 42.58% ) , followed by group c ( 35.74% ) and group a ( 29.52% ) .
the incidence of lbw ( < 2500 g ) was higher in group b ( 46.22% ) , followed by group a ( 36.2% ) and group c ( 32.4% ) . a systematic review ( 2004 ) of the studies comparing perinatal outcomes following assisted and natural conception concluded that singleton pregnancies following the assisted conceptions had adverse perinatal outcomes ( very preterm birth , preterm birth , very lbw , lbw , sga , cesarean section , admission to neonatal intensive care unit , and perinatal mortality ) in comparison to the natural conception .
all these studies have reported varied results on the association of adverse perinatal outcomes and assisted conceptions , but they lack in providing the accurate reasons for the association .
sderstrm - anttila in his review stated that the perinatal complications in oocyte donated pregnancies are usually associated with gdm . in the present study ,
however , we did not observe any perinatal complication in infants born to these patients .
a retrospective study by kato et al . demonstrated higher birth weight ( 3028 465 vs. 2943 470 g , p < 0.0001 ) of infants born following the transfer of vitrified embryos as compared to fresh et .
liu et al . reported birth weight to be higher in babies born from vitrified embryos ( 2587.4 g ) as compared to the fresh ( 2494.4 g ) or slow freezing ( 2538.8 g ) transfer groups .
another recent study by roy et al . also reported improved perinatal outcomes in infants born following vitrified et as compared to fresh et including significantly higher birth weight ( 3296 g vs. 3441 g for fresh and vitrified - warmed groups ) , respectively . mascarenhas et al . in his study reported higher median birth weight in infants born in vitrified group ( 2587.4 g ) as compared to the slow freezing ( 2538.8 g ) or fresh ( 2494.4 g ) transfer groups ( vitrified vs. fresh : p = 0.0015 ; vitrified vs. slow freeze : p = 0.049 ) .
however , in the present study , the birth weight was not reported to be better in group c. early studies on congenital malformations following ivf / icsi reported inconsistent results . however , meta - analysis and systematic reviews done after 2000 and randomized control trials comparing congenital malformations between art and spontaneous conceptions showed some evidence linking the two .
an association of hypospadias with icsi for male factor and imprinting genetic syndromes with ivf and icsi has been well documented .
what remains to be ascertained are the other systemic malformations such as cardiovascular , musculoskeletal , orofacial , and gastrointestinal defects . a case control study conducted by reefhuis et al . in 2009 , which compared 13,586 cases with 5008 controls , found significant associations among singletons for the group of septal heart defects ( odds ratio [ or ] 2.1 , 95% ci 1.14.0 ) , cleft lip with / without cleft palate ( or 2.4 , 95% ci 1.25.1 ) , esophageal atresia ( or 4.5 , 95% ci 1.910.5 ) , anorectal atresia ( or 3.7 , 95% ci 1.59.1 ) , and an elevated or ( 2.1 ) for hypospadias ( 95% ci 0.95.2 ) .
when the patterns among infants with multiple defects were studied , two phenotypes were relatively common among infants conceived using art ; the vertebral defects , anal atresia , cardiac defects , tracheoesophageal fistula , renal malformations and limb defects association and oculoauriculovertebral spectrum .
very little literature is available on the incidence of congenital malformations following oocyte donated pregnancies . in the present study , the incidence of congenital anomalies did not vary significantly between the three groups ( group a [ 1.39% ] , group b [ 1.32% ] , and group c [ 0.94% ] ) . even in the present study ,
the incidence of cardiac malformations , esophageal malformations , and anorectal malformations was reported to be higher .
one infant was born with multiple congenital anomalies ( tof , cerebellar hypoplasia , short femur , hypertelorism ) in group a. however , the current study has only followed children up to a month after the birth .
therefore , the studies with more follow - up periods are needed to be conducted to assess the long - term effects of ivf / icsi involving the transfer of self , donor , and vitrified embryo .
further , a higher number of maternal complications in the group c as compared with group a might be due to the age and health of the donor and the recipient that could have affected the quality of the oocytes .
our study did not make a distinction among donor and self - oocytes in the vitrified embryo group .
it is important that physicians examine a couple of factors before finalizing the type of art treatment such as the cause of infertility , ovarian reserve , and maternal age .
the continuous analysis of the patients with various diagnostic tests during the pregnancy is essential to prevent the occurrence of complications .
pregnancy outcomes and maternal and perinatal complications in pregnancies following ivf / icsi in the present study are similar to developed countries .
this difference can mainly be attributed to the younger age of oocyte donors , which reduces the risk for aneuploidies .
furthermore , the incidence of maternal complications mainly pih , gdm , prematurity , and lbw is higher in od cycles , advanced maternal age possibly contributing as a confounding factor , although a different placentation and immune tolerance may contribute .
furthermore , the incidence of multiple pregnancies was higher in egg donor cycles , which increases the incidence of these complications in group b. no increase in the incidence of congenital malformation compared to the general population was recorded ; however , data are available up to only 1 month after delivery .
the study was funded by merck specialties pvt . ltd . , india , an affiliate of merck kgaa , darmstadt , germany . | background : several global studies have assessed maternal and perinatal outcomes and complications with the type of embryo transfer ( et ) following in vitro fertilization / intracytoplasmic sperm injection ( ivf / icsi ) . the present study assessed the incidence of maternal and perinatal outcomes and complications following ivf / icsi associated with the type of embryo transferred.methodology:a total of 2112 ets were performed in 2092 female patients aged 2150 years between january 1 and december 31 , 2014 ( group a : fresh et using self - oocytes : 691 ; group b : fresh et using donor oocytes : 810 ; and group c : thaw et using vitrified - warmed embryos : 611).results : incidence of clinical pregnancy rate , abortion rate , ectopic pregnancy rate , multiple pregnancy rate , live birth rate , and maternal complications was : group a : 40.8% , 15.9% , 2.8% , 27.3% , 31.9% , and 17.7% ; group b : 50.2% , 21.8% , 1.6% , 32.5% , 36.9% , and 23.7% ; and group c : 42.9% , 25.2% , 1.1% , 31.3% , 29.6% , and 17.8% , respectively .
incidence of prematurity ( < 36 weeks of pregnancy ) , lower birth weight ( < 2500 g ) , perinatal mortality , and congenital abnormalities was as follows : group a ( 29.52% , 36.2% , 5.22% , and 1.39% ) , group b ( 42.58% , 46.2% , 4.6% , and 1.32% ) , and group c ( 35.74% , 32.4% , 7.85% , and 0.94% ) , respectively.conclusion:the higher incidence of the pregnancy outcomes in oocyte donation ( od ) cycles can mainly be attributed to the younger age of oocyte donors .
the higher incidence of complications in od cycles could be due to advanced maternal age , different placentation , and immune tolerance . | INTRODUCTION
METHODOLOGY
Study characteristics
Eligibility criteria
Data collection
Outcomes assessed
Statistical analysis
RESULTS
Patient profile
Outcomes in different groups
Maternal complications
Perinatal outcomes
DISCUSSION
CONCLUSION
Financial support and sponsorship
Conflicts of interest |
hamartomas of the head and neck generally , as well as the sinonasal tract specifically , are very rare .
respiratory epithelial adenomatoid hamartoma ( reah ) and chondro - osseous respiratory epithelial adenomatoid hamartoma ( coreah ) are examples of hamartomas comprising both epithelial and mesenchymal components .
although invariably benign , these lesions may grow to relatively large sizes and pose clinical concerns .
we report herein what represents , to the best of our knowledge , the third case of coreah of the nasal cavity , emphasizing its clinicopathologic features and the importance of recognizing and differentiating it from other , potentially more aggressive lesions of the nasopharynx .
a healthy 38 year - old woman presented to our institution with a left nasal mass that was discovered on a computed tomography ( ct ) scan performed at an outside hospital .
she had complained of mild left nasal obstruction of a few months ' duration ; however , no epistaxis , rhinorrhea , or hyposmia was reported . a punch biopsy obtained at the referring institution
was interpreted as benign respiratory epithelium ( slides not reviewed ) . the ct scan was repeated and confirmed the presence of a 4.0 2.4 1.1-cm soft tissue mass with calcification located in the posterior aspect of the left nasal cavity .
the mass abutted the lateral wall of the cavity , extending into the left sphenopalatine foramen and the left ethmoid air cells , and protruded into the nasopharynx posteriorly ( figure 1 ) .
endoscopic examination revealed a lobulated , well - circumscribed , smooth , tan - white polypoid lesion occupying most of the left nasal cavity .
the lesion was not attached to any structure inside the nasal cavity proper , but its posterior aspect was minimally attached to the lateral nasopharyngeal wall .
axial computed tomography ( ct ) image of a left nasal chondro - osseous respiratory epithelial adenomatoid hamartoma ( coreah ) showing a large ( 4 2.4 1.1 cm ) , iso - intense mass with focal enhancement ( arrowhead ) causing mild deviation of the nasal septum to the right with no erosion of the bone .
the submitted specimen measured 4.0 2.3 1.1 cm , had a tan , smooth outer surface , and was accompanied by multiple small irregular fragments of soft and bony tissue .
microscopic sections exhibited respiratory - type epithelium with underlying submucosal glands , hypocellular fibromyxoid stroma , and mature bone .
the submucosal glands were irregular and exhibited focal mucinous metaplasia , but no significant thickening of the basement membrane was seen .
submucosal glandular proliferation originating from surface respiratory epithelium - lined mucosa , hypocellular fibromyxoid stroma , and mature bone .
the submitted specimen measured 4.0 2.3 1.1 cm , had a tan , smooth outer surface , and was accompanied by multiple small irregular fragments of soft and bony tissue .
microscopic sections exhibited respiratory - type epithelium with underlying submucosal glands , hypocellular fibromyxoid stroma , and mature bone .
the submucosal glands were irregular and exhibited focal mucinous metaplasia , but no significant thickening of the basement membrane was seen .
submucosal glandular proliferation originating from surface respiratory epithelium - lined mucosa , hypocellular fibromyxoid stroma , and mature bone .
hamartoma is defined as a mass - forming aberrant organization of specialized cellular components indigenous to a particular body site1 .
it does not clearly represent a neoplastic or an inflammatory process or have the capacity for continuous unimpeded growth2 .
hamartomas have rarely been reported to arise in the sinonasal region . until the early 1990s , the majority of the sinonasal hamartomas were reported to be mesenchymal , most frequently vascular , in origin3 . however , epithelial hamartomas , namely reahs , have since been more frequently reported2
4
5
6 .
reah was originally described in 1995 by wenig and heffner , who included in their series 1 case containing mixed epithelial and mesenchymal elements with osseous metaplasia2 . in a later abstract presentation , the authors designated this chondro - osseous lesion as coreah4 .
a formal literature review revealed only 2 other reports of coreah5
6 , making ours the third such case published .
two hypotheses have been proposed for the etiology of reah ( and by extrapolation coreah ) .
the first is that reah , similar to other hamartomatous lesions , is congenital in nature and results from an inborn developmental error .
the second explanation is that given the association of such hamartomas with chronic sinusitis , they may represent the effect of the inflammatory process on inflammatory polyps2 .
one study that investigated the molecular genetic changes in reah revealed a higher loss of heterozygosity ( loh ) at loci located on chromosome 9p and 18q than expected for a benign lesion7 .
interestingly , the 9p region is known to code for 2 structurally distant tumor suppressor proteins and is frequently affected in human neoplasms , while loh at 18q has been shown to be common in recurrent or metastatic squamous cell carcinoma of the head and neck and may therefore play a role in tumor progression7 . nevertheless , despite these reported molecular alterations , reah and coreah are completely benign lesions .
clinically , reah has been noted to arise in the posterior nasal cavity in the majority of cases2 .
however , other sites , including the nasopharynx and the ethmoid , maxillary , and frontal sinuses , have been described2
8 .
the presenting symptoms include nasal obstruction and stuffiness , chronic sinusitis , rhinorrhea , hyposmia , and headache8 .
the 2 coreah lesions previously reported in the literature were also located in the nasal cavity . grossly , they were fleshy to firm and polypoid , with white smooth outer surfaces and solid cut surfaces with occasional mucus filled cysts5
6 .
microscopically , they resembled reah , with features including a predominantly glandular submucosal proliferation with round to oval glands varying from small to markedly dilated and lined by ciliated respiratory epithelium originating from the surface mucosa .
these glands were separated by stromal tissue with no evidence of complex growth or cribriform architecture .
other histological features included changes typically seen in association with inflammatory sinonasal polyps , namely stromal edema , polypoid growth , increased numbers of seromucinous glands , vascular and fibroblastic proliferation , and mixed acute and chronic inflammatory cells2
5
6 .
glandular hamartomas , inflammatory polyps , inverted papillomas , and low - grade sinonasal adenocarcinoma are included in the list of clinical differential diagnoses for both reah and coreah2
9 .
glandular ( seromucinous ) hamartoma must be included in the differential diagnosis , as both lesions have similar clinical presentations and may overlap microscopically .
glandular hamartomas consist of an epithelial proliferation of mixed small and large glands with serous acini / tubules growing in clusters or lobules or randomly .
the larger glands are usually lined by ciliated respiratory epithelium or attenuated flat cells , while the lining cells of the small glands are flat to cuboidal and may contain intra - cytoplasmic eosinophilic granules .
although reah / coreah and glandular hamartomas may all fall within the spectrum of sinonasal epithelial hamartomas , they are distinguished histologically by the presence of proliferating serous acini and the absence of chondro - osseous metaplasia9 .
reah and coreah can be distinguished from inflammatory polyps on both clinical and histological grounds .
clinically , most reahs are solitary masses arising in the posterior nasal septum2 , whereas inflammatory polyps are bilateral and arise most commonly in the middle meatus .
the presence of adenomatoid proliferation and stromal hyalinization are distinguishing histological features of reah as opposed to the pauciglandular loose edematous stroma of inflammatory polyps .
their clinical course , unlike that of reah , is characterized by bone destruction , extension along mucosal surfaces , invasion into adjacent structures , local recurrence , and potential for malignant transformation2 .
in addition , inverted papilloma has a known predilection for the lateral nasal wall , and only few arise from the septum10 .
histologically , the endophytically growing stratified squamous epithelium of inflammatory polyps is not seen in reah .
features such as cribriform architecture , absence of ciliated epithelium lining the glands , desmoplastic stroma , and an elevated mitotic rate would strongly favor adenocarcinoma8 .
unlike inverted papilloma and sinonasal adenocarcinoma , reah / coreah is treated by choice by complete local excision11 .
cases followed up for up to 5 years showed no evidence of recurrence2
11 . in conclusion ,
reah / coreah is an interesting although exceedingly rare benign hamartomatous lesion of the sinonasal area that may be clinically mistaken for more common , and potentially more aggressive , tumors of the head and neck .
awareness of this peculiar entity and its radiologic and pathologic characteristics is important to guide the clinician to an appropriately conservative and invariably curative surgical treatment . | summary
introduction : chondro - osseous respiratory epithelial adenomatoid hamartoma ( coreah ) is a benign lesion of the nose and sinuses that is extremely rare , with only 2 cases reported in the literature to date .
case report : we present herein the third reported case of coreah , in a 38-year - old woman who presented with left nasal obstruction and a mass in her left nasal cavity .
the mass was completely resected endoscopically . microscopic examination showed hamartomatous proliferation of respiratory - type glands with mucinous metaplasia admixed with numerous spicules of mature bone , characteristic of coreah .
conclusion : coreah is a benign hamartomatous proliferation of respiratory epithelium , submucosal glands , and chondro - osseous mesenchyme . the clinical differential diagnoses for such lesions include glandular hamartoma , inflammatory polyp , inverted papilloma , and low - grade sinonasal adenocarcinoma .
recognition of this lesion as benign despite its potentially worrisome radiographic appearance is important to avoid an unnecessarily radical surgical procedure . | Introduction
Case Report
Pathology
Discussion |
kidney transplantation is the standard of care for many patients with end stage renal disease ( esrd ) , and has been found to be significantly more effective in improving patient quality of life , physical functioning , and psychosocial functioning ( 1 ) . since 1988 , the prevalence of both dialysis patients and transplant patients with esrd has tripled ( 2 ) .
the cost to treat kidney disease is high , and may be increasing as the population ages and medical care costs escalate .
more than 400 000 americans required dialysis or kidney transplant in 1999 , and the medicare expenditure for kidney disease was $ 11 billion during this year ( 3 ) .
patients in sc who are referred for transplant are required to attend a transplant education class as part of the pre - transplant evaluation process .
these classes are held in different geographic locations ( upstate , midlands , low - country ) and at different time points throughout the month .
in addition to attending the educational session , the patient is required to complete various medical and psychosocial evaluations and tests based on cms regulations and transplant center protocol prior to being placed on the transplant waiting list .
the criteria for being listed for a kidney transplant in sc are provided in figure 1 , along with the number of patients who completed each step in 2010 .
this figure illustrates the number of patients that are lost at each step , and only 29.5% of those referred are eventually listed for transplant .
the process is monitored for each patient , and any lack of patient follow through is communicated to the patient , the dialysis units and to the referring community nephrologist .
the methods of communication include visits to the vascular access clinic , mailings from the transplant center , and phone calls to the patients . despite this well - structured system of communications , a large number of patients
do not progress through the process to fulfill the requirements for wait - listing for a kidney transplant . in sc ,
only 16.89% of the dialysis patients who are younger than 70 years of age are on the waiting list for a transplant relative to the 18.15% in network 6 and 24.23% nationally , indicating that many eligible south carolina patients are either not referred to transplant or are lost to follow up for a kidney transplant .
we define lost to follow up as a patient that does not pursue full evaluation for kidney transplant by not completing required components such as the educational class or medical tests .
the purpose of this paper is to identify barriers to kidney transplant for patients who have been referred by a physician for transplant .
this group of patients receives dialysis and follow - up on referrals to the clinic for vascular access issues , yet they do not complete the required steps to be listed on the kidney transplant waiting list .
one hundred and twenty - seven patients met the criteria for inclusion in the study , and responses were received from 83 eligible patients for a response rate of 65.4% .
those that did not provide responses either declined to participate or did not show up for their appointment in the vascular access clinic . of these 83 patients in the sample , 49 ( 59.0% ) were female , 31 ( 37.3% ) were male , and three ( 3.6% ) did not answer the gender question . for race , 66 ( 79.5% ) were african american , and twelve ( 14.5% ) were white with the remaining being hispanic , other , or did not answer .
fifty - five ( 66.3% ) of the patients were married , while 25 ( 30.1% ) were not , and three ( 3.6% ) did not answer .
the age of the patient sample ranged from 2078 years with the mean being 53.5 years .
the mean number of months on dialysis was 70.4 ( 5.8 years ) with a range of 0216 months .
the average drive time to the transplant center was 68.5 minutes with a range from 5180 .
the majority of the patients reported that they did not live in a rural area ( n=55 or 66.3% ) .
for comparison of characteristics , we used information of about waitlisted patients from internal data and the scientific registry of transplant recipients from the same time period ( srtr 7/1/2010 - 6/3/2011 ) to identify similiarities or differences between those waitlisted and those that were lost to follow up and found that a majority of waitlisted patients were in the same age range as lost to follow up patients ( 5064 years ) , a majority of waitlisted patients were also african american ( 55.6% ) , and a majority of waitlisted patients were also married ( 51.0% ) .
we find that a majority of those waitlisted were males ( 55.6% ) while a majority of those lost to follow - up were females ( 59.0% ) .
a large majority ( n=71 or 85.5% ) reported that a doctor had talked to them about transplantation .
nine patients ( 10.8% ) said a doctor had not talked to them about transplant , two were unsure , and one did not answer .
when asked when the doctor spoke to them about transplant , 43 ( 51.81% ) did not answer or recall .
the majority of respondents who provided an answer said it had been more than five years ( 12 patients , 15.7% ) .
seven patients ( 8.4 % ) said their doctor spoke to them about transplant a year ago , and three ( 3.6% ) said less than a year ago .
only six patients ( 7.2% ) stated that their doctor had talked to them about transplant on more than one occasion . to determine
if the patients had taken any steps in pursuing a kidney transplant , they were asked if they had attended a mandatory transplant education class at one of the transplant center locations . a majority ( 47 patients 56.6% ) had not , while thirty - two patients ( 38.6% ) had attended .
one patient ( 1.2% ) was not sure if he / she had attended , and three ( 3.6% ) did not answer .
respondents were then asked if they had seen a doctor to be evaluated for transplant at our center .
again , the most frequent response was no , ( 39 patients 47.0% ) , following by yes ( 35 patients , 42.2% ) , followed by not sure ( 8 patients , 9.6% ) .
one patient did not answer ( 1.2% ) . when asked why the patients had not pursued transplant ,
since patients were encouraged to select or provide all reasons that applied , there were multiple responses for each individual , thus the percentages reported are greater than 100% .
i did not think i would pass the medical tests , ( 15 patients 18.1% ) .
the second most frequent response was , scared of getting a transplant , ( 13 patients 15.7% ) followed by can not afford transplant or medicines
( 12 patients 14.5% ) , and dialysis is not that bad ( 11 patients 13.3% ) . nine patients ( 10.8% ) were not sure how to proceed , and eight ( 9.6% ) were worried about how long the wait for a kidney would be .
seven patients ( 8.4% ) reported that they , did not believe anyone would serve as a living donor for me , did not have money or transportation to get to transplant center for tests , and did not understand the transplant process .
the least frequent responses with five patients each ( 6.0% ) were that they , do not understand the benefits of transplantation and that the process , did not fit their schedule .
respondent patients were also offered a narrative response category to provide other reasons that they had not pursued transplant .
more than half the respondents ( 43 patients ) provided information in this field . while some of the responses were similar to choices given , others provided new reasons that we had not considered for not pursuing a kidney transplant . several listed specific medical reasons including need for tooth extraction , need to have a catheter put in the chest at that time , having bipolar disorder , being overweight and unwilling to lose weight , being pre - myeloma , or that infection is too bad .
others reported that they did follow up on transplant and did not give further information about where they were in the process .
given the selection criteria , this seems an unlikely response , thus these patients may believe that they followed up , but most likely did not understand the next step in the process that they needed to accomplish .
three patients provided comments that indicated that they believed they were too old for a transplant and preferred that a kidney be offered instead to a younger person . a few respondents blamed physicians either by name or by city of practice ( i.e. georgetown doctor ) or stated that they had not gotten a referral .
a few indicated that they had already had a transplant that failed or that they had been listed but were removed from the list for various reasons ( i.e. amputation ) .
others provided additional details about their fear of transplant including , heard the horror stories of rejection of kidneys and needing multiple transplants , and people tell me that even with a transplant you end up back on dialysis , or scared of transplant failing .
i have thought about it but i do nt know how to get the whole thing started .
others indicated that they were in various stages of the process and that they ,
havent attended the class yet , or that i need three more appointments for completion ( psychiatry , colonoscopy , stress test ) .
some indicated they either forgot about the appointment or that they had dialysis at the time of the class .
one indicated that he / she planned to call to make an appointment , indicating the survey may have served as a reminder .
one patient claimed to have been on the waiting list for 15 years , but not in south carolina .
finally , others seem to blame the system for their lack of knowledge of how to proceed including never received
information about a transplant , never was talked to or introduced about a transplant , and they seem to be making it harder to get transplant . to test for patterns of statistical significance , we used chi - square analysis to determine if respondents who had attended the transplant education class were less likely to report any particular reasons for not pursuing transplant . we did not identify any patterns or relationships of statistical significance , indicating that those who attended the class were not any more or less likely to face certain barriers or misinformation about transplant .
schold and colleagues reported that older age , lower median income , and noncommercial insurance were associated with decreased likelihood for kidney transplant and listing ( 4 ) .
this same study reported that disparities in race and ethnicity are largely explained by the aforementioned factors .
another study found significant differences in the waiting list registration rates , relative transplant rates , and waiting times for transplant patients who were living in rural versus urban locations ( 5 ) .
we sought to identify individual barriers to kidney transplantation not previously identified by surveying patients who were referred for kidney transplant evaluation , but who never followed up on the referral .
as of july 29 , 2011 , there were 312 whites , 600 african americans , eight hispanics , 13 asians , and three american indian / alaska native on the waiting list for a kidney transplant in south carolina ( 6 ) . given these numbers , our study patients who are lost to follow up appears to be approximately representative to the waiting list given that african americans make up the greatest number of esrd patients in south carolina and the greatest number of those on the waiting list for a kidney transplant . without knowing the exact number and characteristics of all eligible patients not on the waiting list , it is difficult to identify if our sample is completely representative , but we have sampled patients given the demographic information we do have about our population .
previous research has shown that there are racial and ethnic disparities in kidney transplant and organ donation , but these factors may be reduced through education ( 7 ) . because of the high percentage of african americans with esrd in south carolina , we sought to oversample this population to identify barriers to kidney transplant .
the main finding of our study is that the most frequent reason that patients are lost to follow - up is that they do not believe they will pass the required medical tests .
while there are medical reasons for not listing patients for a kidney transplant , it appears as though many patients are self - selecting out for perceived medical contraindications to transplant .
given that the criteria for transplant and listing are constantly evolving and vary from center to center , it is essential that physicians be the ones to make the decision as to whether or not patients are medically eligible for transplantation .
it is likely that patients have heard rumors of eligibility from doctors in the community , from peers at their dialysis centers , or from other esrd patients .
dispelling such rumors and providing accurate information is essential , and patients should be told that they are being referred because they might be eligible for transplant and that the only way to find out is to complete the process .
patients have fear of both the surgery and the follow up and believe , in some cases , that transplant is not effective or that it will fail .
while this is a possibility , presenting an accurate picture of life after kidney transplant is necessary and should be the responsibility of the transplant center to ensure accuracy of patients understanding .
although our transplant center conducts small group patient education classes in the community it is likely that the fear of transplant is perpetuated because patients in dialysis units are more likely to see post - transplant patients whose grafts have failed than those who are doing well .
transplant centers or dialysis units may wish to invite healthy post- transplant patients to visit and share an alternative perspective .
a network of support groups in the communities can perhaps address many of the transplant related concerns and address most of the fears of dialysis patients .
third , patients frequently reported that they did not have the money for transportation or evaluation for transplantation .
schold et al reported similar results of lower listings in lower income and non commercial insured group of patients ( 4 ) .
these barriers may be addressed through outreach clinics that allow patients to be seen in their own communities so that significant travel is not required in states where only one transplant center exists . additionally , support that allows these patients to activate and use their medicaid and medicare eligibility to seek care
such support may require more active involvement of social workers or the addition of patient navigator services .
many of the patients indicated that they were uncertain about the process of transplantation , the requirements for listing , their own eligibility , and where they were in the process .
some of the patients that had been referred stated that their physicians had never talked to them about transplant , when in fact they had been referred .
only 6% of patients recalled that the doctor had discussed transplant with them on more than one occasion , and for the vast majority the discussion was almost five years ago .
. this may be the result of communication styles or channels or the health literacy of patients .
furthermore , a lack of understanding of the overall process should be addressed by improved education .
while our transplant center has sought to decrease confusion about the process and requirements for listing , we did not find any significant differences in barriers between those who did and did not attend the education class .
however it is evident that the current education sessions are not meeting patients information needs .
patients may be at different stages of learning and many patients may require a modified program tailored to suit their health literacy levels . additionally , our program has sought to provide patients with multiple reminders ( at least three ) about requirements still pending for their evaluation as well as accessible coordinators to schedule appointments for the clinic
. this may be especially important due to scheduling difficulties that patients may face at large medical centers , and our survey showed that only five ( 6.0% ) patients identified scheduling as an issue in being lost to follow up . of the patients included in the study ,
thirty - five ( 42.2% ) reported that they had been evaluated for transplant by a doctor at the transplant center , and thirty - two ( 38.6% ) reported that they had attended the required educational class .
this group , nearly a majority , represents a group that took some steps in the direction of being listed .
whether they were overwhelmed at the requirements for being listed or more fearful after learning about the process is not clear . again , additional support such as that of a patient navigator may help patients better fulfill the requirements for listing .
various treatments including dialysis and transplantation are available , but the benefits and processes are difficult for patients to understand and navigate .
we find that the most barriers to follow up and listing for patients who have been referred are the result of misunderstanding , misinformation , or fear .
additional outreach and education for these patients at an appropriate health literacy level may reduce these barriers by providing accurate information in ways the patients can understand . given the poor rate of listing in south carolina ( 16.89% of dialysis patients < 70 years ) , steps must be taken to address barriers to follow up for patients who are referred for transplant .
our study provided a unique contribution in that is identified and examined individual barriers to pursuing transplant evaluation in a sample that is likely eligible for kidney transplant . despite this eligibility
, many patients do pursue dialysis access perhaps out of necessity , but do not follow through on the steps to be placed on the kidney transplant wait listing .
we examined only responses from sc patients , thus our findings may not be relevant to other programs , and our generalizability may be limited .
additionally , there is possible selection bias in patients since we collected information from patients at a single center / clinic setting .
however , since we have a unique population , we also have an opportunity to reach these lost to follow - up patients through our affiliated vascular access clinic .
this means that we should be able to measure the effect of any interventions that we will undertake in response to the issues raised by this study .
one challenge of studying those who are lost to follow - up is that they generally can not be located .
our study provides a rare glimpse into the barriers , both real and perceived , that are facing this population .
also , while not explicitly stated , patients at our center have the option of either being added to the national waiting list or pursuing living donation .
therefore , patients who are lost to follow up have not pursued the required tests and steps to pursue either option .
another possible weakness is the recall bias that patients may have about their own care , particularly related to when events occurred such as a doctor talking to them about transplantation . finally ,
while there may be racial differences in the rates and reasons for being lost to follow up , we do not explicitly explore this in our current study .
given the population served at our center and the sample for this study , we do not have a representative sample and statistical power to explore this area .
future studies should consider examining the role of individual patients health literacy level and their stage of learning in the area of transplant .
the transplant process is complex , and the benefits and steps to pursue being added to the waitlist can be confusing and overwhelming .
interventions to individualize the education process rather than the one step that fits all would be of particular value .
future research may also examine the presence of racial disparities in lost to follow up status and whether there are racial differences in reasons for being lost to follow up .
finally , a similar study could be conducted in which individuals who were successfully transplanted can provide information about how they overcame barriers ( e.g. family support , understanding of illness , information about esrd ) .
an expert panel of six clinicians and researchers developed a set of questions to explore issues of barriers to transplantation .
the experts were selected because of their advanced training ( md and/or phd ) in kidney transplant or health services research as well as their experience in the field of kidney transplant surgery , treating esrd patients , or the design of survey questions and qualitative data collection .
the survey questions then were piloted tested in key informant interviews to assure that it was clear , complete , of appropriate health literacy level , and would gather the desired information .
the key informants were vascular access patients who met our selection criteria by not completing an evaluation for transplant ( as described below ) and were asked the questions of the survey to ensure that the questions were being properly understood , that the survey was capturing the desired information , and that the categorical responses were inclusive of all possibilities .
patients qualified for participation in the study if they had been referred for transplant but : 1 ) had not attended the required transplant educational class ; 2 ) if they did not respond after three attempts at contact ; 3 ) if they did not complete a component of the medical or psychological testing ; or 4 ) if they refused a transplant by asking that their case be closed for consideration .
each week , the research team would identify patients scheduled to come into the vascular access clinic who met these criteria .
the nurses in the clinic would then request that these patients complete the survey . surveying the patients in vascular access clinic as opposed to the referrals
was preferred because we wanted to identify if the barriers to evaluation were individual patient barriers or a function of limited referrals from physicians / nephrologists who did not believe individual patients were candidates for transplant . by surveying the vascular access patients
the study was approved by the organization s irb , and patients were given letters explaining the purpose of the study and were asked to participate by completing the survey .
responses to the survey were anonymous , but we tracked the characteristics of the cohort of patients who agreed to participate in the study .
thus , the survey responses were not linked to individual patients , but the researchers know the status in the transplant process of the sample as a whole .
the survey asked patients demographic information such as their age , race , gender , marital status , educational status , and whether they lived in a rural areas .
patients were also asked how long they had been on dialysis , if a health care provider ever spoke to them about a kidney transplant and when this discussion took place , whether they had attended the transplant education class , and had been evaluated for a kidney transplant .
patients were then asked why they did not pursue transplantion and were provided a list of choices including : did nt think i would pass all medical tests , did nt fit my schedule , did not have transportation or money to get to musc for the tests required before transplant , dialysis is nt that bad , scared of getting a transplant , can not afford the transplant and/or medicines , do nt understand the transplant process , do nt understand the benefits of transplant , was nt sure how to proceed , did nt believe anyone would serve as a living donor for me , or worried how long the wait for a kidney would be plus an open narrative response category . | end stage renal disease impacts many americans , however , transplant is the best treatment option increasing life years and offering a higher quality of life than possible with dialysis .
ironically , many who are eligible for transplant do not follow through on the complex work - up protocols required to be placed on the transplant waiting list .
here we surveyed vascular access clinic patients at an academic medical center referred for transplant that did not follow up on the needed work - up to be added to the national transplant waiting list .
the most frequent responses of 83 patients for not pursuing transplantation were that the patients did not think they would pass the medical tests , they were scared of getting a transplant , and they could not afford the medicine or the transplantation .
these impediments may result from unclear provider communication , misinformation received from peers or other sources , misperceptions related to transplant surgery , or limited health literacy / health decision making capacity .
thus , patients with end stage renal disease lost to follow up after referral for kidney transplant faced both real and perceived barriers pursuing transplantation . | Introduction
Results
Discussion
Methods |
each year , 5000 new cases of oropharyngeal cancer are diagnosed in the us , and 8590% of these are confirmed as squamous cell carcinoma ( scc ) .
cervical lymph node status remains the most important prognosticator in head and neck squamous cell carcinoma ( hnscc ) in the absence of distant metastases , reducing 5-year survival by 50% [ 2 , 3 ] . while the choice of management for occult metastases is complex , most clinicians agree that treatment should be chosen over observation when the risk of occult disease is 20% or greater .
the incidence of occult metastases in clinically node - negative necks ( cn0 ) in opscc has been reported to be greater than 30% in some series [ 5 , 6 ] .
the importance of assessing and managing the cervical nodal basin in opscc is therefore of utmost importance and is the focus of the current paper .
prognosis for patients with opscc is closely associated with the involvement of cervical lymph nodes .
therefore , an understanding of the anatomical subsites and lymphatic drainage patterns of each is crucial .
the oropharynx is bounded by the posterior edge of the hard palate superiorly , the pharyngeal wall posteriorly , the tonsillar complexes ( including the anterior and posterior tonsillar pillars , true tonsil , and tonsillar fossa ) laterally , the circumvallate papillae and palatoglossal muscles anteroinferiorly , and the vallecula and hyoid bone inferiorly .
the surgical anatomy of this area is classically divided into four distinct subsites : ( 1 ) base of tongue ( bot ) , ( 2 ) soft palate , ( 3 ) tonsillar complex , and ( 4 ) posterior pharyngeal wall ( ppw ) .
these subsites are independently important , and as lindberg stated in his classic work on lymphatic drainage patterns in the head and neck ,
a thorough understanding of these drainage patterns is a prerequisite to the surgical neck dissection ( nd ) for opscc .
the bot can be defined anteriorly by the circumvallate papillae , laterally by the glossopalatine sulci , and inferiorly by the vallecula .
the lymphatics of the bot drain primarily to the upper two thirds of the jugular lymphatic chain , often bilaterally .
hollinshead stated that the lymphatics posterior to the vallate papillae drained to the nodes of the upper part of the deep cervical chain , with a predilection for the jugulodigastric node .
lindberg associated the midline position of the bot with the frequency of bilateral cervical node involvement . in his report ,
bilateral subdigastric node involvement was more common than midjugular node involvement , posterior cervical nodal disease was uncommon , and low jugular or supraclavicular nodes were rare .
the soft palate is defined anteriorly by the hard palate , laterally by the palatopharyngeal and superior pharyngeal constrictor muscles , and posteriorly by the palatopharyngeal arch and uvula .
the lymphatics of the soft palate have three distinct systems , which drain ( 1 ) medially to the middle third of the jugular chain , ( 2 ) laterally to the retropharyngeal ( rp ) lymphatics , and ( 3 ) anteriorly to the hard palate and subsequently into the submental and submandibular nodal groups .
the lymphatics in the uvula drain primarily into the upper jugular chain , while the vessels draining the upper or posterior surface of the soft palate drain laterally via the pharyngeal lymphatics to end in the rp nodes .
lindberg found that , as a midline structure , the incidence of bilateral metastases in opscc of the soft palate was high , with the jugular nodes the most frequently involved .
the ppw spans the area defined by the soft palate , the epiglottis , the borders of the tonsillar complexes , and the lateral aspects of the piriform sinuses inferiorly .
the lymphatic drainage from the ppw is primarily via the jugular chain bilaterally to the upper jugular nodes in the subdigastric group .
the midjugular group is also frequently involved , as is the posterior cervical triangle , while supraclavicular disease is rare .
the tonsillar complex is composed of the anterior and posterior tonsillar pillars , the true palatine tonsil , and the tonsillar fossa .
primary tumors of the tonsillar complex frequently metastasize to the lateral rp nodes and the upper third of the ipsilateral jugular lymphatic chain , with a smaller proportion draining to the middle third of the jugular lymphatic chain .
lindberg found that the tonsillar node , within the subdigastric group , was always involved first in cervical metastasis .
he also found that both mid and low jugular nodes were frequently involved , and metastases within the posterior cervical triangle were not uncommon . when considering oncology of the oropharynx , it is also important to understand the association of two relevant potential spaces
hasegawa and matsuura reviewed 11 cases of stage iii / iv opscc and concluded that carcinoma of the oropharynx drains directly to the rp nodes , and therefore the evaluation of the rp lymph nodes is critical in the assessment of scc of the pharynx .
the second space , the parapharyngeal space , is important when considering lateral spreading tumors .
this space is often described as an inverted pyramid bounded by the skull base , lateral pharyngeal constrictors , and hyoid cornu .
despite a careful understanding of the anatomy and lymphatic drainage patterns of subsites within the oropharynx , there is a wide variety of individual anatomy and incidence of cervical nodal involvement . a careful understanding of the classification system presented by the memorial - sloan kettering group and further modified by the american head and neck society 's neck dissection committee is therefore warranted .
this classification system contains six levels , with level i , ii , and v divided into two subgroups designated either a or b and is based largely on the biologic significance of positive nodes .
each level has a general name describing the group of lymph nodes within its boundaries and defined borders based on anatomic , radiologic , and surgical landmarks .
the frequency of nodal involvement in opscc based on this classification system is reviewed in table 1 .
the submental lymph nodes make up level ia . they can be found within the submental triangle , which is bounded laterally by the anterior bellies of the digastric muscles , inferiorly by the hyoid , and superiorly by the mandibular symphysis .
the submandibular lymph nodes are found in level ib as defined surgically by the body of the mandible superiorly , the digastric tendon attachment to the hyoid bone inferiorly , the anterior belly of the digastric muscle anteriorly , and by the posterior edge of the submandibular gland posteriorly .
level ii defines the superior jugular lymph nodes and is divided into level iia and iib by the spinal accessory nerve .
level iia is defined superiorly by the skull base , inferiorly by the carotid bifurcation ( or the inferior border of the hyoid bone ) , posterolaterally by a vertical plane defined by the spinal accessory nerve ( san ) , and anteriorly by the posterior border of the submandibular gland .
it is defined superiorly by the skull base , inferiorly by the carotid bifurcation ( or the inferior border of the hyoid bone ) , laterally by the sternocleidomastoid muscle , and anteriorly or medially by the vertical plane defined by the path of the san .
the midjugular lymphatic group , or level iii , is defined superiorly by the carotid bifurcation , inferiorly by the omohyoid muscle , laterally by the sensory branches of the cervical plexus , and medially by the sternohyoid muscle .
level iv is described as the inferior jugular nodes and is defined superiorly by the omohyoid muscle , inferiorly by the clavicle , laterally by the sensory branches of the cervical plexus of nerves or the lateral border of the sternocleidomastoid muscle , and medially by the sternohyoid muscle .
level va is defined superiorly by the junction of the scm and the trapezius muscle , inferiorly by the horizontal plane defined by the inferior border of the cricoid cartilage , laterally by the anterior border of the trapezius muscle , and medially by the sensory branches of the cervical nerve plexus .
level vb is defined superiorly by the horizontal plane of the inferior border of the cricoid cartilage , inferiorly by the clavicle , laterally by the anterior border of the trapezius , and medially by the sensory branches of the cervical plexus .
level vi , known as the anterior or central neck compartment , is important to define for completeness but is rarely involved in opscc .
it is defined superiorly by the hyoid bone , inferiorly by the superior edge of the manubrium of the sternum , and bilaterally by the common carotid arteries .
staging the neck using the nodal levels described above , as well as the tnm system recommended by the american joint commission on cancer ( ajcc ) ( table 2 ) , is a prerequisite for surgical management of the neck in opscc .
the national comprehensive cancer network ( nccn ) includes the following in their 2011 guidelines for the evaluation of the neck in opscc : history and physical , biopsy , hpv testing for prognosis ( suggested ) , chest imaging , computed tomography ( ct ) with contrast and/or magnetic resonance imaging ( mri ) of both the primary site and neck , 18-fluorodeoxyglucose positron emission tomography and computed tomography ( pet - ct ) for stage iii
iv ( consideration ) , dental evaluation as indicated , and examination under anesthesia with endoscopy as clinically indicated . physical examination and palpation of the neck has a relatively low sensitivity and specificity for diagnosing lymphatic metastasis .
the addition of ct scans to clinical findings increases diagnostic detection to 80% with an accuracy of 7080% . according to cohan et al .
, mri offers superior soft tissue contrast , increased resolution of bone marrow involvement , and improved resolution of perineural spread compared to ct .
concluded that the addition of ct , mri , and biopsy to palpation increases the diagnostic value for cervical disease .
this modality has been shown to assist in the diagnosis and detection of regional and distant metastases in hnscc [ 27 , 28 ] .
pet - ct has an average sensitivity of 8790% and specificity of 8093% [ 29 , 30 ] .
this tool can be used to guide dissection of high - risk areas outside the bounds of the routine nd .
however , pet - ct is limited by a relatively low resolution ( 4 - 5 mm ) , high false positive rate , cost , and interobserver variability . despite advances in technology , the gold standard for staging
note that even the most recent techniques of ct , mri , ultrasonography , pet - ct , and ultrasound guided fna have reached a sensitivity of no more than 8085% .
pathology of the neck specimens provides information regarding size of metastases , number of involved nodes , presence of extracapsular spread ( ecs ) , additional tumor deposits , and micrometastases .
however , despite the routine use of pathologic staging and our dependence on it as the gold standard for staging the neck , shah and gil . report the risk of recurrence in the pathologically node - negative ( pn0 ) neck to be as high as 10% .
this is relevant in that the diagnosis of a false negative pn0 is associated with a poor prognosis .
this has spurned investigation into the use of molecular markers which might improve diagnostic accuracy .
using reverse transcriptase polymerase chain reaction ( rt - pcr ) , seethala found that 2030% of pn0 necks by light microscopy and immunohistochemistry ( ihc ) were molecular positive .
this technique is limited by a high false positive rate , the requirement of frozen specimens , the loss of morphologic comparison , and the lack of a defined or consistent threshold for positivity .
some authors hypothesize that further understanding of micrometastases , isolated tumor cells , and molecular characteristics may help to explain a subset of the 10% of regional recurrences in the neck despite a pn0 designation based on light microscopy and ihc .
in addition , further research into the use of additional markers and the use of a multiplex approach to diagnosis could help explain regional failures not explained by surgical failure and nonlymphatic spread of disease [ 2 , 37 ] . the inability of routine pathologic analysis to detect 100% of tumor and the associated morbidity associated with routine nd has led to investigation into the use of sentinel lymph node biopsy ( sln ) for staging the neck in opscc .
suggest that since only 2530% of cn0 necks are upstaged to pn+ necks following nd , the majority of elective surgical management has no therapeutic benefit other than to confirm clinical staging . furthermore , burcia et al .
suggest that while sln sampling allows the pathologist to focus their efforts on a smaller tissue sample , routine staging methods requiring evaluation of large neck specimens leads to a high rate of false negatives and may underestimate the number of invaded lymph nodes per patient .
the second international conference on sentinel node biopsy in mucosal head and neck cancer suggested that sln biopsy can be used in the following settings : ( 1 ) staging of the ipsilateral neck in unilateral ct1/t2 cn0 tumors , ( 2 ) staging of the ipsilateral and contralateral neck in ct1/t2 cn0 midline tumors or tumors crossing the midline , and ( 3 ) staging of the contralateral neck in ct1/t2 cn+ ( ipsilateral neck ) midline tumors or tumors crossing the midline .
regardless of the potential for this staging modality , its routine use in the management of the neck in opscc is still inadequately defined .
a discussion regarding surgical management of the neck in opscc can not be undertaken without first reviewing its history .
the importance of nodal involvement in head and neck cancers was first reported in the medical literature in the 18th century and was considered a sign of incurable disease until the mid-1800s . in 1880 , kocher presented the first description of removing cervical nodes in the submandibular triangle to access a cancer of the tongue .
the first documented nd was performed in 1888 by jawdynski , a polish surgeon , and the first detailed description of the radical neck dissection ( rnd ) was published by crile in 1906 .
interestingly , while 36 of the 132 rnds described by crile were en bloc procedures , 96 demonstrated more selective surgical techniques .
crile recommended preserving the internal jugular vein ( ijv ) and sternocleidomastoid muscle ( scm ) in a cn0 neck and advised dissection of only the lymphatic basin draining the primary tumor if there was no gross disease . despite the forward thinking of crile ,
the en bloc resection remained the mainstay for surgical management of the neck until the mid-1900s . by the early 1950s ,
hayes martin and colleagues had performed over 190 nds , and , as a staunch defendant of the rnd , he disagreed with any suggestion that the rnd be modified .
however , the significant morbidity associated with the rnd , especially related to postoperative shoulder dysfunction , provided an impetus for research into alternate approaches to the neck .
the discovery that lymphatic structures within fascial compartments of the neck could be removed without sacrificing nonlymphatic structures [ 7 , 46 ] prompted investigation into more conservative techniques .
ward and robben reported the first form of a modified radical neck dissection ( mrnd ) by in which they spared the spinal accessory nerve ( san ) .
mrnd was popularized by bocca , who formally defined it as the removal of the lymphatic tissue in levels i v , with preservation of at least one of the nonlymphatic structures classically included in rnd : ijv , san , or scm .
it was not until the 1960s that authors began reporting preservation of select lymph node groups , which marked the first formal introduction of the selective neck dissection ( snd ) .
these advances were supported by the finding that metastases from the head and neck tend to follow fairly constant and predictable pathways , which allows the surgeon to tailor surgical dissection to target the areas most at risk [ 8 , 49 ] .
furthermore , in the 1980s , studies by the brazilian head and neck cancer group found that snd was equivalent to mrnd for the cn0 neck in regards to neck recurrence rates and long - term survival .
as the procedures available for surgical management of the neck evolved , authors produced a myriad of confusing and nonsystematic terminology . in 1988 ,
the committee for head and neck surgery and oncology of the american academy of otolaryngology - head and neck surgery called together a task force in order to simplify terminology , define procedures and surgical structures , and classify cervical metastases based on biology and the principles of surgical oncology .
the outcomes from this meeting with the recent modifications made by the committee for neck dissection classification of the american head and neck society have resulted in the current classification system used to describe nds in the modern era .
the therapeutic nd is performed for a cn+ neck , while an elective nd is described for cn0 necks at high risk for occult metastases .
in addition , a staged nd often refers to a planned nd following primary radiation or chemoradiation therapy while a salvage nd refers to an nd performed to remove persistent ( early salvage nd ) or recurrent ( late salvage nd ) nodal disease following nonoperative therapy .
the american head and neck society committee for neck dissection classification described four major categories of nd currently available based on the anatomic structures resected ( table 3 ) .
the rnd , as first described by crile in 1906 , is the comprehensive standard to which all other dissections are compared . in this procedure , the san , ijv , and scm are resected in addition to all lymphatic tissue in levels i v .
currently , rnd is indicated for patients who have cn+ disease demonstrating ecs with extension to involve the san , ijv , and/or the scm .
the mrnd as described initially by ward and robben and further defined by medina involves en bloc resection of lymphatic tissue contained in level i v with the preservation of one or more nonlymphatic structures ( san , ijv , or scm ) .
the description of a mrnd can be subclassified as type i iii depending on the nonlymphatic structure(s ) removed during resection ( table 3 ) .
this dissection is indicated for cn+ disease with no evidence of extension into the nonlymphatic structures , especially when multilevel disease is present .
the snd has been found to offer an oncologically safe surgery while decreasing overall morbidity and increasing functional and cosmetic outcomes for the appropriately selected patient population . during this dissection ,
this dissection preserves the nonlymphatic structures and allows the surgeon to tailor the dissection to the primary tumor and its lymphatic drainage patterns .
because snd refers to preservation of at least one of the five neck levels included in the classical rnd , there is significant room for variability .
therefore , authors have defined various terms to describe different techniques , such as the supraomohyoid snd ( levels i iii ) , lateral snd ( level i iv ) , posterolateral snd ( level ii
while these terms are descriptive in theory , they do leave room for misinterpretation . therefore , the committee for head and neck surgery and oncology of the american academy of otolaryngology head and neck surgery updated the nd classification in 2002 and recommended that each snd should be listed as snd with each variant depicted with brackets to denote the levels or sublevels removed [ 16 , 53 ] .
finally , the extended nd is employed when there is a high risk or clinical suspicion for metastatic disease outside of the classic lymph node levels and may be applied to any of the previously described nds .
areas targeted by extended nd may include additional lymph node basins such as the periparotid , retropharyngeal , parapharyngeal , superior mediastinal , postauricular , suboccipital , or buccinators .
this type of dissection may also target such nonlymphatic structures as muscle , vasculature , or nerves when at risk or involved by tumor .
the motivation behind developing more selective nd techniques has been driven in part by the desire to decrease associated morbidity without sacrificing oncologic surgical principles and outcomes .
the most significant sequelae associated with nd is shoulder dysfunction and is an important consideration in treatment of the neck for opscc .
. looked at quality of life indicators via the neck dissection impairment score and found that the most important variables included age , weight , radiation treatment , and nd type .
injury of the san can be related to excess traction or elevation and is primarily associated with dissection of levels iib and v. rnd was classically known to cause denervation of the trapezius muscle leding to a syndrome of pain , weakness , and deformity of the shoulder girdle . while leipzig et al
. showed that any form of nd can result in shoulder dysfunction , they reported it to occur more frequently when the san is worked around , skeletonized , or resected .
sobol et al . compared rnd with mrnd and predictably found that patients undergoing rnd had significantly worse shoulder outcomes .
however , mrnd still resulted in associated shoulder morbidity , and the combination of this with the finding that snd offered an oncologically safe outcome in select patients and pushed many surgeons to evaluate the efficacy of this method .
sobol et al . further demonstrated that patients undergoing snd ( level i iii ) had significantly less shoulder dysfunction at 16 weeks postoperatively than mrnd or rnd .
demonstrated a worse constant 's shoulder score for mrnd than snd in 32 nds of each type .
based on these and similar studies , the snd offers the best chance for preserving shoulder function and avoiding pain syndromes when the surgeon is able to avoid dissecting level iib and v. preservation of level iib in opscc is a controversial topic , as the landmark studies on cervical nodal disease patterns for opscc reported a very high incidence of metastatic disease in level ii .
however , these studies often did not evaluate the difference between disease in level iia and iib .
injury to the san during dissection of level iib can be related to traction , elevation , skeletonization , or ischemia due to ligation of the occipital artery .
the data on involvement of iib nodes for all subsites in hnscc ranges from 05.6% for cn0 cases , and 016.7% for cn+ disease .
specifically analyzed level iib involvement in opscc and found that 16.7% of ipsilateral and 8.3% of contralateral level iib nodal basins were pathologically positive in cn+ disease . in the cn0 neck , 0/36 necks ( 21 ipsilateral , 15 contralateral )
demonstrated disease in level iib . based on these results , they recommended preservation of level iib for cn0 opscc .
reviewed 77 nds for opscc and also found that , in the cn0 neck , no patient was found to have occult level iib disease while 25.6% of cn+ patients had disease in this area .
several other authors have reported an increased risk for occult iib disease in patients demonstrating multiple nodal involvement , most commonly associated with level ii and iii disease , as well as level iia involvement , high nodal stage , or ecs [ 18 , 59 , 60 ] .
therefore , while preservation of level iib should be strongly considered , risk factors for occult metastases should be thoroughly evaluated in an effort to maintain oncologic safety .
preservation of level v in cn0 opscc is less controversial , as very few studies have suggested significant involvement in this region . in a study of 51 rnds in 1976 , skolnik et al . found no metastases to the posterior triangle of the neck regardless of primary site ( larynx , pharynx , and oral cavity ) or the status of the jugulodigastric lymph nodes . in one of the largest retrospective reviews on the subject , shah evaluated 1119 rnd specimen and found that primary tumors of the oropharynx predominantly metastasize along the jugular lymphatic chain ( levels ii , iii , and iv ) .
in addition , regardless of subsite , when levels i iv were negative for occult disease , the posterior cervical triangle was never involved .
this supports lindberg 's finding that in the absence of metastases in levels i and ii , involvement of the low jugular and posterior triangle nodes is exceedingly rare .
candela et al . also found that while the jugular chain ( level ii - iii ) was the most commonly involved in opscc , nodal involvement in the posterior cervical triangle nodes was almost always associated with disease at other levels .
they found that only 6% of opscc primaries were associated with posterior cervical triangle disease ( level v ) .
as detailed above , the incidence of metastatic disease in level v for opscc is relatively low , and therefore there is a general consensus that if a patient presents with a cn0 neck or a cn+ neck with no evidence of level v disease and without multilevel involvement , a snd can be safely performed preserving level v and avoiding dissection around the san in this area .
the choice of dissection technique for surgical management of the neck depends on the primary tumor , the clinical status of the neck , and ultimately on the pathologic status of the neck .
while consideration of primary radiation , chemoradiation therapy , or observation is beyond the scope of this review , it is important to remember that management of the neck is often driven by management the primary tumor for early staged tumors while multimodal therapy is advocated for more advanced opscc tumors [ 14 , 22 ] . understanding the predilection for bilateral cervical involvement helps guide both evaluation and choice of nd procedure .
opscc staged t1 or t2 up to 20% present with cn+ disease , 6070% of t3 and t4 palatal disease present with regional metastasis , and up to 50% may present with bilateral nodal disease [ 14 , 64 ] .
opscc tumors of the ppw often cross midline resulting in a relatively high risk for bilateral nodal involvement .
in addition , 6676% of patients with tonsillar opscc present with clinically positive nodal disease , most commonly in the jugulodigastric nodal group [ 1 , 64 , 65 ] . in tumors that involve the true tonsil as well as the posterior tonsillar pillar , up to 22%
have been reported to present with bilateral nodal involvement , whereas primary tumor growth in the anterior pillar alone is associated with a 6% risk of bilateral neck disease [ 1 , 64 , 65 ] .
contralateral necks with evidence of metastatic spread , or at high risk of metastatic spread , must be considered for dissection if the treatment plan is operative .
the national comprehensive cancer network : head and neck cancer guidelines have detailed strategies for the management of opscc . for an n0 - 1 neck associated with a t14 opscc primary
, the surgical treatment arm recommends an ipsilateral or bilateral nd as indicated based on primary tumor risk factors for bilateral involvement and diagnostic workup .
additional adjuvant chemo- or radiation therapy is guided by adverse features identified intraoperatively , which include ecs , positive margins , pt3 or pt4 primary , n2 or n3 nodal disease , or nodal disease in levels iv or v . for a patient with n1 , n2a - b , or n3 disease ,
regardless of t stage , the surgical management arm includes excision of the primary tumor with ipsilateral or bilateral nd as indicated while , for any n2c disease , bilateral nd is mandatory .
again , the presence of adverse risk factors intraoperatively is the key factor in the recommendation for adjuvant therapy in this algorithm .
while the nccn guidelines provide a helpful framework for surgical management of opscc , they do not provide recommendations for extent of resection for either the cn0 versus cn+ neck . for the cn+ neck
, dissection depends primarily on extent of disease . for patients presenting with gross involvement of nonlymphatic structures , including the ijv , san , or scm , or for select cases of bulky , hypomobile nodal disease , a rnd is the procedure of choice [ 7 , 67 ] .
most institutions will offer mrnd for multilevel or cn+ disease without evidence of involvement of these structures . at our institution ,
recently , there has been some research into the use of snd for some cn+ patients .
spiro et al . have advocated snd for cn+ necks and reported a regional failure rate of 5.7% [ 66 , 68 ] , which is consistent with regional failure rates following rnd and mrnd .
in addition , as the risk for disease in level v is relatively low for opscc , many authors recommend preservation of level v , especially for cn1-n2a disease , in order to limit dissection of level v and thus reduce postoperative morbidity associated with shoulder dysfunction . in the cn0 neck , it is important to remember that the consequences of undertreatment are significant , and recurrence or residual disease in an untreated cn0 neck results in a poor prognosis .
weiss et al . performed a computer - assisted mathematical analysis of the decisions and associated outcomes involved in treating the cn0 neck , and concluded that the benefits of prophylactic treatment of the neck outweighed costs only when the risk for occult metastases is greater than 20% .
because 1530% of patients staged cn0 will develop nodal metastases regardless of opscc subsite or t stage , most authors recommend regional nodal therapy for all opscc primaries .
currently , the snd is the procedure of choice for the cn0 neck ; however , the extent of resection is controversial .
recommendations vary from lateral nd ( levels i iv ) to a supraomohyoid nd ( levels i iii ) [ 6870 ] .
reviewed 104 nds to determine both the distributions of cervical lymph node metastases in opscc as well as the therapeutic implications for the n0 neck and recommended that elective nd should include levels ii
they based this recommendation on the finding that of 68 patients , who underwent therapeutic ipsilateral nd , 37% had disease in level iv while only 10% had disease in level i .
shah evaluated 1119 rnd specimen and found that opscc predominantly spreads along the jugular lymphatic chain ( levels ii , iii , and iv ) , which also supports the use of snd ( level ii
the decision to dissect level iib depends on risk of involvement and is controversial as described above . in 2004 , coskun et al .
advocated the use of the susper - selective nd for some cn0 patients with opscc , which avoids injury to the san by preserving level iib nodes . at our institution ,
patients undergoing surgical management for an n0 neck , regardless of t stage , will most often receive a snd ( level ii
iv , including iib ) . the choice to dissect level i depends on several factors , including the risk of involvement ( higher for anterior soft palate lesions ) , as well as the preference of the surgeon . an important consideration when designing an nd for opscc is the status of the retropharyngeal lymph nodes .
this basin is not typically addressed for either the cn0 or cn+ neck , as seen above . however , rp node involvement is not uncommon , especially in posterior pharyngeal wall scc , and can be associated with poor prognosis [ 12 , 72 ] .
byers et al . reported a 4% incidence of rp nodal metastases in 45 patients staged cn0 with pharyngeal wall opscc , while ballantyne reported an incidence as high has 44% for 34 patients with similar primary tumors .
hasegawa and matsuura concluded that since the diagnosis of rp nodes is difficult and opscc , especially that of the posterior pharyngeal wall , drains to the rp nodes , management of these nodes is critical .
therefore , the consideration of an extended nd to include this lymphatic basin should be seriously considered when managing both cn0 and cn+ disease .
while we have discussed the oncologic benefits and morbidity associated with nd for opscc , one can not ignore the acute complications of surgical intervention .
the most dramatic , and often lethal , acute complication is the carotid artery rupture which is often associated with poor coverage of vasculature , malnutrition , diabetes , infection , previous radiation or chemoradiation therapy , and resultant fistula or flap breakdown . chyle leak , as a result of level iv dissection , may occur in treatment of opscc and occurs in up to 2% of patients [ 7 , 74 ] .
additional complications such as facial or cerebral edema associated with synchronous bilateral nds and ijv ligation , blindness associated with embolus or hypoperfusion , air embolus from ijv transection , orocutaneous fistula have all been reported for nd and should be considered when individualizing management options .
these risks increase with a history of radiation , chemoradiation , failed surgical therapy , and the presence of multilevel bulky disease .
in recent years , the use of radiation therapy and chemoradiation ( crt ) therapy has been used with increasing frequency as the primary treatment modality for opscc tumors .
this leads kim et al . to hypothesize that there would be a decrease in the number of nds performed nationally for primary hnscc
however , they found that from 2000 to 2006 there was a slight increase in the point estimates for nd performed for opscc from 2,420 to 2,696 , though this increase was not significant .
this may be due to the decision by many surgeons to perform planned nd either prior to or following crt or by the use of surgical intervention alone for small primary tumors cn+ or high - risk cn0 disease .
based on national trends such as these and the progressive specialization of nd based on primary site , surgical management of the neck remains an important and effective tool and should be considered in the treatment of the neck in opscc . in an effort to target specific high - risk nodal groups and decrease the percentage of patients undergoing nd for pn0 disease , future study into functional and antibody - mediated or tumor - directed imaging will be important .
in addition , advancements must be made in molecular studies which will likely facilitate more effective real time sln - directed neck dissections [ 2 , 37 ] .
finally , surgical techniques which minimize morbidity without compromising oncologic safety , such as endoscopic or robotic techniques , will likely drive even more selective surgical management of the neck in opscc . | the staging and prognosis of oropharyngeal squamous cell carcinoma is intimately tied to the status of the cervical lymph nodes . due to the high risk for occult nodal disease , most clinicians recommend treating the neck for these primary tumors . while there are many modalities available , surgical resection of nodal disease offers both a therapeutic and a diagnostic intervention .
we review the relevant anatomy , nodal drainage patterns , clinical workup , surgical management and common complications associated with neck dissection for oropharyngeal squamous cell carcinoma . | 1. Introduction
2. Anatomy and Lymphatic Drainage of the Oropharynx
3. Nodal Classification
4. Diagnostic Evaluation of the Neck in OPSCC
5. Neck Dissection
6. Complications
7. Future Direction/Conclusions |
in recent years , use of electrical stimulation instead of acoustical stimulation has made much objective electrophysiological evaluation possible , that is useful for management process in young children before and after cochlear implant .
these evaluations have been used for assessment of neuronal survival before cochlear implant and for monitoring of patient and prosthesis function during and after the surgery [ 1 , 2 ] .
one of these evaluations , nowadays in top of research projects , is called electrically evoked compound action potential ( ecap ) which seems a valid and reliable objective evaluation [ 3 , 4 ] . here
, electrical stimulation of peripheral portion of auditory nerve via electrode array , evokes neuronal response in ascending auditory pathway , that can be recorded by using the same techniques in conventional acoustical evoked response audiometry ( era ) [ 1 , 5 ] .
for this , the producers use similar method and technique with different names . this technique in nucleus ci24r ( cs ) and the related software which has been used in this study
the ecap amplitude is so large because of recorder electrode being in the vicinity of neural components is very flexible and efficient facing movement artifacts .
therefore , there is no need to use sedatives in children and this is very suitable for the evaluation in young children [ 1 , 3 ] .
the response consists of a negative peak ( n1 ) with about 0.3ms and a positive peak ( p1 ) with around 0.6ms latencies .
so , the sleep , unconsciousness and sedatives have similar effect on these responses . a normal evoked compound action potential waveform during recent years many studies on ecap have been conducted in adults after surgery .
lai et al evaluated longitudinal behavior of the response and found the relative stability of nrt responses .
cafarelli dees et al evaluated the latency , amplitude and slope of amplitude growth function .
later , other studies ( for example lai et al ) were conducted to assess ecap potential clinical functions .
recently , such studies are accomplished in children before and after the surgery . at present , due to importance of precise setting of speech processor and non accessibility of children 's behavioral response
, most of the studies evaluated the relation between ecap threshold level , behavioral threshold and comfortable levels of the patients , and found considerable results . in this study , we evaluated ecap amplitude changes three months after receiving the speech processor in pediatric cochlear implant .
statistical population consisted of all children less than four years old which were operated for cochlear implant in two cochlear implant centers ( rasoul - e - akram and amir alam hospitals ) in tehran during summer and autumn 2007 .
the study was complete on 36 ( 18 boys and 18 girls ) operated cases .
the remaining 6 were excluded from the study because of being absent in at least one session .
the mean age was 41 months ( sd 5.13 ) . the first session coincided with receipt of processor system ( about 4060 days after surgery ) . in this session
, after voluntary completing of questionnaire by parent , external components ( including speech processor , microphone , coil and related attachments ) were delivered to the parents with the necessity guidance .
in addition , because evaluation of all electrode arrays was time consuming ( which included 22 active and two reference electrodes ) , only four electrodes in base , middle tended to base , the middle tended to apex and apex were evaluated . therefore , according to electrode positions , we can evaluate thorough electrode arrays synoptically . in most of the patients ,
the 1 , 8 , 15 and 20 electrodes ( from base to apex ) were evaluated and only in five cases , the vicinity electrode responses were evaluated due to absence of response in one or some electrodes .
the threshold was determined by ascending presentation of stimulus level in each of the four electrodes .
the thresholds were determined by observational method . in this method , an expert clinician observes the waveforms and determines the smallest acceptable waveform as ecap threshold .
then stimulation 's intensity increased 510 current levels and this response was recorded , too .
after that , the amplitude of these responses were determined and the difference between the amplitudes of these two responses were calculated as amplitude growth .
the evaluations were repeated in 1 , 2 and 3 months later with the same conditions of stimulation parameters and response recording , and all results were recorded again . finally , the amplitude changes in each case were compared in various sessions interelectrodically and intraelectrodically .
the first session coincided with receipt of processor system ( about 4060 days after surgery ) . in this session , after voluntary completing of questionnaire by parent , external components ( including speech processor , microphone , coil and related attachments ) were delivered to the parents with the necessity guidance .
in addition , because evaluation of all electrode arrays was time consuming ( which included 22 active and two reference electrodes ) , only four electrodes in base , middle tended to base , the middle tended to apex and apex were evaluated . therefore , according to electrode positions , we can evaluate thorough electrode arrays synoptically . in most of the patients ,
the 1 , 8 , 15 and 20 electrodes ( from base to apex ) were evaluated and only in five cases , the vicinity electrode responses were evaluated due to absence of response in one or some electrodes .
the threshold was determined by ascending presentation of stimulus level in each of the four electrodes .
the thresholds were determined by observational method . in this method , an expert clinician observes the waveforms and determines the smallest acceptable waveform as ecap threshold .
then stimulation 's intensity increased 510 current levels and this response was recorded , too .
after that , the amplitude of these responses were determined and the difference between the amplitudes of these two responses were calculated as amplitude growth .
the evaluations were repeated in 1 , 2 and 3 months later with the same conditions of stimulation parameters and response recording , and all results were recorded again .
finally , the amplitude changes in each case were compared in various sessions interelectrodically and intraelectrodically .
children 's average age at the surgery was 41 months ( range 26 to 48 months ) ( sd= 5.13 ) .
this was 41 months for boys ( range 26 to 47 months ) ( sd=5.27 ) and 40 months for girls ( range 31 to 48 months ) ( sd=5.11 ) .
the intraelectrodic results showed little increase in amplitude average by time passing in all electrodes , and this was not significant in all electrodes ( p>0.05 ) .
mean ( standard deviation ) amplitude changes in different electrodes in different sessions ( n=36 ) the interelectrodic results showed that the average of amplitude changes in 1 electrode is less than in other electrodes .
determination of normal limit for amplitude changes in this group was impossible due to high variability in intrasubjective and intersubjective results .
high variability of intrasubjective and intersubjective results in different electrodes has been reported in other studies , such as brown et al ( 1996 ) , abbas et al ( 1999 ) , cafarelli dees ( 2005 ) and brown et al ( 1998 ) .
this seems to be due to differences in provocability of neural fibers in different cases .
inter subjective differences between the numbers and properties of the neuronal fibers are probably the reasons of these differences .
the results show that with the time , a little seen , however this is not significant .
formation of a fibrous tissue on electrode array which gradually happens after surgery , can move electrode array and affect the neural current , and so change the amplitude .
gradually changes in na and k around the electrode can affect the current flow from electrodes to neural fibers , and change the ecap amplitude .
this is evident by changes in amplitude response , and consequent need to change the speech processor programming in patients with menier 's disease that received cochlear implant prosthesis .
the general opinion is that the resulted changes in ecap during the time indicate the stimulation path changing or variations related to neural response .
lai et al , and hughes et al already had shown this in ecap threshold .
this incompatibility in their study and present study 's results may be due to different prosthesis , whereas the design of ci24r ( cs ) model is so that it causes closer electrode array to neural terminals ( in comparison with ci2 m model in hughes et al studies ) .
in addition , recent technological improvement which increased surgical accurateness can cause less damage in tissue , which in turn decreases the replacement of fibrous or bony tissues in place . therefore , the interval between stimulator and the fibers does not increase .
interelectrodic results show that the 1 electrode 's amplitude differences are lower than the other electrodes results and this is significant .
this is compatible with the results of the study of cafarelli dees et al ( 2005 ) .
it seems that this phenomenon is due to less neural cells in this region of spiral ganglion . due to the more peripheral region for basal turn of the cochlea , it is more possible to damage this turn , so , less neural density of this region in comparison with apical turn .
this significant difference between neural survival of these regions can explain the difference between our results .
it is not possible to determine the normal range in this group , which is due to high variability of intrasubjective and intersubjective results .
this is the same as the results of other studies[6 , 7 , 10 , 15 ] .
it seems that is due to the difference between the excitability of neural fibers in different patients .
the difference between the density and properties of these fibers can cause this significant difference .
this invariability of results during the time could ensure the clinician that these primary results can be used at least for three months for speech processor setting .
in fact , we can use some electrodes for prosthesis adjustment that increase effectiveness of setting process , although a similar study in adults with postlingual deafness is recommended . | objectiveuse of electrical instead of acoustical stimulation has made much objective electrophysiological evaluation possible .
this is useful for management process of young children before and after the cochlear implant .
these evaluations have been used for assessment of neuronal survival before cochlear implant and for monitoring of prosthesis function during and after the surgery .
electrically evoked compound action potential is one of these tests which makes a valid and reliable objective evaluation possible .
the aim of this study was to evaluate the potential 's amplitude changes three months after receiving the device in pediatric cochlear implant recipients.methodsin this longitudinal study , changes of the potential 's amplitude in four given electrodes in four sessions after receiving the device are evaluated by approximately one month intervals in children implanted in amir alam and hazrat - e - rasoul hospitals , tehran in july to december 2007.findingsthe mean amplitude of the electrodes did not significantly change in different sessions , while there was significant difference between the first and the other electrodes responses in every session ( p<0.05).conclusiondue to high reliability of the responses , the clinician can fit the speech processor for a long time .
better responses in apical electrodes may lead to develop an effective coding strategy . | Introduction
Subjects and Methods
Evaluation process
Findings
Discussion
Conclusion
Conflict of Interest |
the online version of this article ( doi:10.1007/s13555 - 015 - 0068 - 3 ) contains supplementary material , which is available to authorized users .
psoriasis is a chronic , immune - mediated , inflammatory , systemic disease with predominant skin and joint manifestations . as such
, it has significant implications on physical , psychological , and social functioning [ 18 ] .
psoriasis represents one of the most common chronic inflammatory diseases worldwide , affecting approximately 23% of the population [ 4 , 5 , 7 , 911 ] .
about 8090% of patients with psoriasis have the plaque form of the disease [ 3 , 10 ] .
although the majority of psoriatic cases are mild to moderate in severity , approximately 20% of patients suffer from moderate to severe disease as determined by the percentage of body surface area involved or the overall degree of erythema , induration , and desquamation .
the impairment in quality of life due to psoriasis has been found to be equivalent to that from major systemic diseases such as arthritis , type 2 diabetes , chronic lung disease , and myocardial infarction [ 1 , 10 , 12 ] .
currently , topical treatments with corticosteroids and vitamin d analogs represent first - line therapies for psoriasis .
topical treatments may also employ calcineurin inhibitors , dithranol , tazarotene , or tar . in patients with more severe or treatment - resistant disease , second- or
third - line therapies include phototherapy , systemic agents such as methotrexate , and , more recently , biologicals such as tumor necrosis factor inhibitors .
these therapeutic modalities have been proven to be highly effective ; however , the potential for long - term toxicity needs to be considered .
phototherapy includes narrow - band ultraviolet ( uv ) b , broadband uvb , as well as psoralen and uva photochemotherapy [ 15 , 16 ] .
patient surveys have revealed that , at present , patients do not receive optimal treatments and experience insufficient satisfaction with the efficacy of available topical treatments as reflected by a high rate of non - compliance [ 1719 ] . since in a cyclical pattern , treatment outcome influences treatment satisfaction , which in turn affects medication adherence ; the effectiveness of topical treatments
may be improved by increasing patients adherence . therefore , and since psoriasis often requires lifelong therapy , safe , convenient , and effective topical regimens with good cosmetic acceptance can be of great benefit in this large patient population .
current guidelines recommend keratolytics such as topical preparations containing urea and salicylic acid as adjuvant therapy for psoriasis and state that these represent an internationally recognized standard in the treatment of all severity states of psoriasis .
the claimed benefits of these agents are specified in table 1 [ 3 , 4 , 6 , 2123].table 1main objectives of using keratolytics in psoriasismain objectives
softening / hydration of the stratum corneum
penetration enhancement of topically applied anti - psoriatic drugs / ultraviolet radiation during phototherapy
cited according to published reviews [ 3 , 4 , 6 , 2123 ] main objectives of using keratolytics in psoriasis
cited according to published reviews [ 3 , 4 , 6 , 2123 ] however , profound and recent evidence on their efficacy from clinical trials is lacking .
therefore , the aim of this publication is to systematically review the role of currently used emollients and keratolytics in the treatment of psoriasis to answer the following questions : what do authors of recently published reviews / meta - analyses conclude on the role of emollients and keratolytics in the treatment of psoriasis?what is the current evidence from clinical trials on these agents with respect to efficacy and safety that has been published during the last 30 years ?
what do authors of recently published reviews / meta - analyses conclude on the role of emollients and keratolytics in the treatment of psoriasis ? what is the current evidence from clinical trials on these agents with respect to efficacy and safety that has been published during the last 30 years ?
literature searches for relevant articles published within the last 20 years were conducted on december 30 , 2013 in medline via pubmed using the following search term : ( 1993/01/01:2013/11/30[dp ] or 1993/01/01:2013/11/30[edat ] ) and psoriasis and ( keratolysis or keratolytic or salicylic acid or urea ) .
the results were further confined using specific qualifier words regarding efficacy , safety , or type of publication , for example , therapeutic use , efficacy , effectiveness , safety , tolerability , toxicity , review , meta - analysis , practice guideline , clinical trial , or
all hits were reviewed based on abstracts and/or medical subject headings ( mesh ) terms .
articles that did not specifically deal with the safety and efficacy of emollients or keratolytics in the treatment of psoriasis but dealt with other psoriasis treatments such as hydroxyurea or topical retinoids , with other indications or other topics or subjects ( e.g. , methods papers , non - clinical , mechanistic studies ) were excluded .
this applied to the majority of retrieved publications ( approximately 90% ) . because salicylic acid is frequently added to dithranol for the prevention of dithranol oxidation , all publications on the combination of salicylic acid and dithranol were excluded .
the same applies to efficacy trials conducted in healthy volunteers or in patients with disorders other than psoriasis .
whereas clinical studies investigating keratolytics vs. baseline , placebo , no treatment , or other keratolytics and combination therapy vs. the respective monotherapy without penetration enhancement were considered eligible for inclusion , articles that dealt with the safety or efficacy of conventional keratolytics in combination therapies for psoriasis but did not investigate the monosubstances and did thus not allow drawing conclusions about their specific effect were not considered ( approximately 2% of hits ) .
articles that were not written in english or german were excluded ( approximately 2% of hits ) .
since the number of articles providing evidence on the role of conventional keratolytics in the therapy of psoriasis published in the last 20 years was limited , the search period was extended to the last 30 years .
the searches for relevant literature published between 1983 and 1993 were conducted in medline via pubmed using the following search terms : psoriasis and ( keratolytic[majr ] or salicylic acid[majr ] or urea[majr ] ) , psoriasis and ( keratolysis or keratolytic ) and ( rct or randomized controlled trial ) and psoriasis and ( salicylates[majr ] ) . using the above - mentioned selection criteria , a total of 53 guidelines , meta - analyses , reviews , and clinical trials published in german or english language from january 1983 to december 2013 and dealing with topical administration of keratolytics in patients with psoriasis were regarded as potentially relevant and selected for full - text assessment .
after full - text review , seven articles were excluded as they did not refer to emollients or keratolytics ( n = 2 ) or did not compare combination therapy vs. the respective monotherapy without penetration enhancement ( n = 5 ) . since medline may not have revealed all relevant publications ( i.e. , clinical trials ) , additional searches for original literature on psoriasis published in english or german language between 1983 and 2013 were performed in embase using the qualifier clinical trial and the controlled terms keratolytic agent , salicylic acid , and urea .
these searches yielded a total of 41 articles for consideration , of which 3 articles had not previously been identified in medline .
the selection was further complemented by publications that were cited in the articles identified by the systematic literature searches and by including relevant current guidelines on psoriasis treatment as well as references therein ( n = 11 ) .
the results section of this paper consists of four subsections referring to the group of emollients and major keratolytic agents , each starting with a paragraph that contains information on the mechanism of action and evidence of the efficacy and safety as extracted from reviews , meta - analyses , and/or guidelines .
this information is followed by the data on efficacy and safety derived from published clinical trials .
this review is based on previously conducted studies and does not involve any new studies of human or animal subjects performed by any of the authors .
from systematic literature searches conducted in medline via pubmed and embase , a total of 49 publications met the inclusion criteria for this review .
furthermore , the reference lists of included publications were scrutinized for additional studies published in january 1983 or later , adding 11 publications to the selection .
emollients induce an occlusive film that limits evaporation of water from deeper parts of the skin and allows the stratum corneum to rehydrate itself .
the application of natural moisturizing factors induces an increase in the water - binding capacity of the stratum corneum .
regular application of emollients improves comfort and reduces scaling , fissuring , and itching in patients with plaque or scalp psoriasis [ 25 , 26 ] .
additionally , emollients may increase the efficacy of topical corticosteroids by improving the penetration through the skin layers [ 21 , 27 , 28 ] . guidelines of care for the management of psoriasis and psoriatic arthritis state that when used as a control in topical steroid trials , non - medicated topical moisturizers demonstrated a response rate ranging from 15 to 47% [ 21 , 27 ] .
this broad range may reflect the great variability of their composition ; however , in the corresponding guideline dealing with topical therapies , the individual composition of the moisturizers has not been specified .
however , they can cause side effects such as irritant dermatitis , allergic contact dermatitis , fragrance allergy or allergy to other constituents , stinging , cosmetic acne , and pigmentary disorders .
in addition , some reports indicate a potential penetration - enhancing effect of the stratum corneum to irritants after long - term use . in clinical and experimental settings
it has been shown that some emollients , e.g. , oil - in - water emollient enhance the penetration of uva or uvb when used before irradiation , thus increasing the efficacy of phototherapy [ 29 , 30 ] . however , in vitro studies and studies in healthy volunteers also demonstrated a blocking effect of other emollients , such as white petrolatum and the emollient cream eucerin ( beiersdorf inc . , wilton , ct , usa ) , consistent with their thickness .
while 3 small clinical trials including a total of 111 patients provide limited evidence that , compared to baseline , emollients used as a monotherapy may improve skin hydration , barrier function , as well as proliferation and differentiation markers in patients with psoriasis [ 11 , 33 , 34 ] , the clinical response showed only a slight symptomatic improvement of psoriasis .
due to inconsistent results from randomized controlled trials , there is limited evidence of a steroid - sparing effect of emollients when used in combination with corticosteroids . in the evaluated studies ,
only two adverse events of pruritus and folliculitis ( each n = 1 ) were reported ( see table 2 ) [ 11 , 3337].table 2efficacy and safety of emollients in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventsvan duijnhoven et al .
50% cremorlanette i in vaselinum album2 weeks5 patients with psoriasisnon - comparative studynormalization of proliferation and differentiation markers ; slight improvement compared to baselinenone reportedrim et al .
pseudoceramide ( myristyl / palmityloxostearamide / arachamidemonoethanolamine)6 weeks17 patients with psoriasiscontrolled study ( vs. untreated lesions)improved visual assessment of skin dryness , significantly increased electrical capacitance ; decreased tewlmild pruritus in one patientpauporte et al . combination of peanut and mineral oil3 weeks89 patients with moderate to severe scalp psoriasisrandomized , controlled , double - blind study ( vs. 0.01% fluocinoloneacetonide)improvement of all signs of psoriasis compared to baseline ( p < 0.05)treatment - related folliculitis in one patienttanghetti et al
. combination of tazarotene with an emollient ( not further specified)12 weeks1,393 patients with plaque psoriasisobservational studyenhanced efficacy of tazarotene ; increased patients satisfactionnone reportedwatsky et al . combination of 0.05% betamethasone dipropionate and a water - in - oil based moisturizing cream or lotion ( not further specified)4 weeks96 patients with chronic plaque - type psoriasiscontrolled , open label study ( twice daily vs. once daily)once - daily application was equivalent in efficacy to twice - daily application and significantly better than once - daily application of betamethasone alone ( both p = 0.05)none reportedsingh et al . combination of 0.05% betamethasone dipropionate twice daily in propylene glycol9 days36 patients with psoriasisrandomized , controlled , double - blind study ( vs. once - daily betamethasone)no difference compared to once - daily betamethasone regarding erythema , scaling , induration and lpsinone reported
lpsi local psoriasis severity index , tewl transepidermal water loss efficacy and safety of emollients in clinical trials
lpsi local psoriasis severity index , tewl transepidermal water loss urea is known to exert proteolytic , keratolytic , hydrating , hygroscopic , penetration - enhancing , epidermis - thinning , and anti - pruritic effects . the moisturizing action of urea in dry and scaly skin conditions has been widely studied and is well accepted [ 21 , 38 ] .
. suggested that lipid biosynthesis may be increased by topical application of highly concentrated urea . in vitro and in vivo data showed a reduction of dna synthesis in the cells of the basal layers ( by approximately 45% ) , a thinning of the epidermis ( by approximately 20% ) , a reduction of the epidermal cells , and a prolongation of the generation time of postmitotic epidermal cells [ 21 , 39 ] .
therefore , urea has been shown to reduce epidermal hyperproliferation and to induce cell differentiation . as a mechanism of action
it has been hypothesized that urea may break hydrogen bonds and interfere with the quaternary structure of keratin thus dispersing and denaturizing keratin without disrupting the epidermal water barrier .
pre - treatment or concomitant treatment with urea may also enhance the efficacy of other topical therapies . due to its safety
, urea - containing preparations represent the standard in the adjuvant therapy of juvenile psoriasis .
only non - systemic side effects have been reported , with mild irritation being the most common , making urea a safe and well - tolerated topical drug . while a small , older comparative study found no statistical differences on severity parameters such as scaling , erythema , and infiltration compared to the vehicle , in another trial using the same preparation , treatment for 1 week led to a statistically significant improvement of scaling compared to the vehicle ( see table 3 ) [ 38 , 4046 ] .
this is in line with two further studies in which severity parameters of psoriasis such as scaling and/or induration were reduced with urea in monotherapy . of these , in a small randomized , double - blind study , addition of 10% urea to the vehicle was significantly more effective regarding epidermal proliferation , stratum corneum hydration , and epidermal thickness with a 60% reduction of the clinical psoriasis severity score of scaling and a 32% reduction of induration ( see table 3 ) compared to the vehicle alone .
the ointment base also improved psoriasis , but urea was significantly more effective showing a 40% reduction in epidermal proliferation compared to the vehicle .
similar results were demonstrated in a double - blind , placebo - controlled study , in which two urea gel formulations ( 10% plain urea gel or 5% urea niosomal gel ) produced a reduction in erythema , infiltration , and desquamation , as well as in the total psoriasis area and severity index ( pasi ) score , with the 5% urea niosomal gel being more effective regarding desquamation compared to the plain gel and placebo . however , the percentage of affected area was not influenced .
from three small studies , limited evidence is known for an enhanced efficacy of other topical agents such as bifonazole , dithranol or betamethasone dipropionate and calcipotriol leading to a shortened treatment duration ( see table 3 ) [ 4345 ] .
in the evaluated clinical studies , a burning sensation was observed in three patients ( see table 3 ) [ 39 , 42].table 3efficacy and safety of urea in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventsgip et al .
12% urea and 12% sodium chloride3 weeks30 patients with psoriasiscontrolled double - blind study ( vs. vehicle)no statistical differences on severity parameters such as scaling , erythema and infiltration compared to vehicleburning sensation in two patientsfredriksson et al .
12% urea and 12% sodium chloride1 week40 patients with psoriasiscontrolled study ( vs. vehicle)statistically significant improvement in scaling compared to vehiclenone reportedhagemann and proksch 10% urea2 weeks10 patients with psoriasisrandomized , controlled , double - blind study ( vs. vehicle and vs. untreated site)reduction of the clinical psoriasis severity scores of scaling ( 60% ) and induration ( 32% ; p <
0.025 ) compared to the vehicle ; two - fold increase in stratum corneum hydration ( p < 0.01 ) compared to the untreated sitenone reportedlakshimi and bhaskaran 10% plain urea gel or 5% urea niosomal gel12 weeks40 adult patients with stable plaque psoriasis involving <
25% of the body surface area or palmoplantar psoriasisdouble - blind placebo controlled studythe niosomal urea gel produced greater reduction in total score and desquamation score compared to the plain gel and placebo ( p < 0.05 ) .
combination of 40% urea and 1% bifonazole2 weeks52 patients with psoriasis capitis ; 19 patients with scalp seborrheic dermatitisnon - comparative , open - label studyimprovement in 100% of patients with complete healing in 73.2% compared to baselinenone reportedtaube et al .
combination of 1% dithranol and 10% urea ( after 2 days of pre - treatment with 5% salicylic acid)7 weeks57 patients with psoriasis vulgariscontrolled case study ( vs. dithranol alone)significantly shortened mean treatment duration until complete resolution of 3.5 weeks compared to 4.2 weeks in the dithranol only groupnone reportedvena et al .
combination of 2% urea [ betamethasone dipropionate and calcipotriol for 4 weeks followed by calcipotriol alone or with urea ( 2% and 4% ; once daily each)]4 + 8 weeks313 adult patients with psoriasis vulgarismulticenter open studyafter the 8-week maintenance treatment phase , the clinical score for erythema , scaling , infiltration and pruritus improved in both groups , with a tendency towards a greater reduction of infiltration in those treated with urea .
a greater percentage of patients concomitantly treated with urea ( 47% ) than those treated with calcipotriol ( 33% ) judged the efficacy as excellentburning sensation in two patients efficacy and safety of urea in clinical trials alpha - hydroxy acids ( ahas ) , most notably glycolic acid and lactic acid , are used in chemical - peel solutions to exfoliate thickened skin in hyperkeratotic conditions .
however , their use in the treatment of psoriasis has only recently been advocated and , thus , they are not mentioned as keratolytic agents in relevant psoriasis guidelines [ 7 , 17 ] .
ahas penetrate the epidermis , inducing an increase in stratum corneum turnover and cause desquamation of the outermost layer without impairing barrier function .
they reduce intercorneocyte bonds by increasing the distance between corneocytes due to increased stratum corneum water content , by reducing the charges on the surface of cells , by inhibiting enzymes involved in the cohesion between corneocytes , and by breaking desmosomes as they diminish the ph of the medium .
this reduction can also degrade keratinocytes directly , thus promoting cell proliferation . in the dermis
, ahas can stimulate the biosynthesis of glycosaminoglycans , collagen , and other substances , which cause thickening of the skin .
poly - hydroxy acids ( phas ) also aid in dermal expansion and can provide the components for glycosaminoglycans .
phas have anti - oxidant and moisturizing properties and may provide protection of psoriatic skin with a disrupted skin barrier . when used in combination with topical corticosteroids , ahas or phas exert a synergistic effect and reduce steroid - induced skin atrophy . for ahas and phas , results from 3 small clinical studies including 57 patients in total are available .
one of these trials , a small , controlled study , demonstrated that glycolic acid in monotherapy may lead to significant reduction in hyperkeratosis and erythema as compared to baseline , which was comparable to that achieved with 0.05% betamethasone valerate ( see table 4 ) [ 3 , 47 , 48 ] . in a small , short - term study ,
aha / pha and salicylic acid exhibited similar efficacy with regard to the reduction of scaling when compared to baseline ( see table 4 ) .
the third small study found a synergistic effect of 10% glycolic acid in combination with topical corticosteroids leading to reduced treatment duration and an increased healing rate ( see table 4 ) . in the evaluated studies ,
no treatment - related adverse events were reported ( see table 4).table 4efficacy and safety of aha and pha in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventsberardesca et al .
15% glycolic acid15 days12 patients with psoriasiscontrolled study ( vs. 0.05% betamethasone valerate)significantly decreased tewl and laser doppler values ; reduction in hyperkeratosis and erythema compared to baseline being equivalent to that after 0.05% betamethasone valeratenone reportedakamine et al .
15% ahas ( lactic acid , mandelic acid and gycolic acid ) and 5% phas ( gluconolactone and maltobionic acid)2 weeks25 patients with moderate , chronic , plaque psoriasisrandomized , controlled , double - blind study ( vs. 6% salicylic acid)significant improvement in scaling , erythema , induration and , investigator global assessment , compared to baselinemild adverse events assessed as not related in five patientskostarelos et al .
combination of 10% glycolic acid and 0.1% betamethasone8 weeks20 patients with scalp and seborrhoeic psoriasiscontrolled , double - blind study ( vs. betamethasone alone)reduced duration of treatment to approximately half compared to treatment with betamethasone alone , 8 out of 13 of the treated sites healed completely compared to 3 out of 12 with betamethasone onlynone reported
aha alpha - hydroxy acid , pha poly - hydroxy acid , tewl transepidermal water loss efficacy and safety of aha and pha in clinical trials
aha alpha - hydroxy acid , pha poly - hydroxy acid , tewl transepidermal water loss salicylic acid is the most commonly used and most thoroughly studied of the currently known keratolytic compounds . in concentrations of 5% and above , it exerts an increasingly potent , rapid , and deep keratolytic effect on the stratum corneum which leads to descaling . as a mechanism of action
, it is suggested that salicylic acid reduces intercellular cohesion between corneocytes by dissolving the intercellular cement material and reducing the ph of the stratum corneum , thereby increasing hydration and softening [ 3 , 7 , 31 ] .
topical salicylates also reduce pruritus and , at concentrations of 0.3% , they possess bacteriostatic and bactericidal activity against yeast and gram - negative and gram - positive bacteria . in their clinical guide , naldi and rzany state
that there is consensus that salicylic acid is an effective initial and adjunctive treatment in chronic plaque psoriasis .
according to current guidelines , salicylic acid promotes skin availability of other topical therapies including topical corticosteroids due to its keratolytic and penetration - enhancing effect [ 1 , 7 , 14 , 20 , 49 ] .
while salicylic acid is commonly applied and effective when used as a pre - treatment before phototherapy [ 15 , 16 ] , topically administered salicylic acid , in concentrations 0.1% , is photoprotective .
thus , application of salicylic acid before uvb phototherapy is not recommended [ 15 , 16 , 22 , 32 , 50 , 51 ] . according to the evaluated reviews ,
topical use of salicylic acid is limited by the risk of chronic or acute systemic intoxication [ 2 , 7 ] with symptoms such as oral pain , headache , central nervous system symptoms , dizziness , metabolic acidosis , tinnitus , nausea , vomiting , and gastric symptoms , as well as hyperventilation [ 2 , 3 , 52 ] .
these symptoms may occur after prolonged topical treatment of large body surfaces ( i.e. , > 20% ) [ 6 , 7 , 25 ] , especially in children under 12 years of age and in patients with significant renal or hepatic impairment [ 2 , 3 , 7 , 22 , 25 ] . local irritation such as stinging , burning , dry skin , peeling , scaling , or
temporary shedding of telogen hair has been observed when used in the treatment of scalp psoriasis .
concomitant use of other drugs , which may contribute to elevated serum salicylate levels , should be avoided .
there is an increased risk for developing toxicity to other topically applied agents used concurrently , as salicylic acid may increase their skin penetration .
in addition , topical use of salicylic acid can reduce the efficacy of calcipotriol . regarding monotherapy , three studies on salicylic acid including
65 patients were evaluated [ 5456 ] . of these , an open - label , pilot study demonstrated that 6% salicylic acid used as a monotherapy was highly effective , well tolerated , and acceptable in 10 patients with scalp psoriasis .
all psoriasis severity parameters as well as the percentage of affected area were reduced with a significant decrease in psoriasis scalp severity index score from 15.3 to 3.0 after 4 weeks of monotherapy when compared to baseline ( p < 0.001 ) .
a total of 60% of patients were either completely cleared or almost cleared
( see table 5 ) . in a randomized , double - blind study in 25 patients investigating 6% salicylic
acid vs. 20% aha / pha cream ( see also table 4 ) , both topical agents resulted in significant improvement of scaling , erythema , and induration , as well as investigator global assessment , at the end of week 1 and 2 and exhibited similar efficacy in reducing scaling .
however , the extent of affected area was not investigated in this study ( see table 5 ) .
similar results were obtained in an earlier , randomized controlled trial reporting successful treatment of moderate or severe scalp psoriasis with 6% salicylic acid in 30 patients , including 10 in - patients and 20 out - patients . in - patients
were treated for 3 weeks with daily applications of 6% salicylic acid removed with a shampoo 24 h later .
out - patients were treated for 6 weeks with salicylic acid applied once daily and removed 12 h later .
if progress was slow , a shampoo containing 3% coal tar solution was substituted for the shampoo . as a result
, 90% of in - patients and 65% of out - patients improved with salicylic acid regarding scaling and percentage of affected area and in one patient , the scalp cleared completely . scaling scores for out - patients improved from baseline 7.0 to 4.5 at 6 weeks ( n = 20 ; p < 0.01 ) and the scores for in - patients improved from baseline 7.7 to a score of 3.7 at 3 weeks ( n = 10 ; p < 0.001 ) .
eight of the out - patients , but none of the in - patients used the coal tar shampoo . out - patients used less salicylic acid ( 27 g weekly ) than in - patients ( 72 g weekly ; see table 5 ) .table 5efficacy and safety of salicylic acid in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventskircik 6% salicylic acid4 weeks10 patients with scalp psoriasisnon - comparative , open - label , pilot studysignificant decrease in pssi score from 15.3 to 3.0 compared to baseline ( p < 0.001 ) ; 60% of patients were either completely cleared or almost clearednone reportedakamine et al .
6% salicylic acid2 weeks25 patients with moderate , chronic , plaque psoriasisrandomized , controlled , double - blind studysignificant improvement in scaling , erythema , induration and investigator global assessment compared to baselinemild adverse events assessed as not related in five patientsgoing et al .
6% salicylic acid3 and 6 weeks30 patients with moderate or severe scalp psoriasisrandomized , controlled study6590% of patients improved regarding scaling and percentage of affected area compared to baseline ; scaling scores for out - patients improved from 7.0 to 4.5 at 6 weeks ( p < 0.01 ) and for in - patients from 7.7 to 3.7 at 3 weeks ( p < 0.001)dryness and stinging in six patients ; irritation in three patientselie et al .
combination of 2% salicylic acid and 0.05% betamethasone dipropionate lotion21 days40 patients with erythematous squamous dermatoses of the scalp including 22 patients with moderate to severe psoriasisrandomized , controlled studyreduction of mean total disease sign scores for scaling after 14 and 21 days ( p < 0.05 ) , erythema after 14 days ( p < 0.02 ) and after 21 days ( p < 0.01 ) , pruritus after 14 and 21 days ( p < 0.01 ) ; physician s global evaluation showed a better evolution after 14 days ( p < 0.01 ) and after 21 days ( p < 0.02 ) compared to betamethasone dipropionate alonenone reportednolting and hagemeier combination of 2% salicylic acid and 0.05% betamethasone dipropionate solution3 weeks100 patients ( n = 36 with psoriasis vulgaris)randomized , controlled studymore rapid onset of action and a more rapid clearing of scaling , pruritus and inflammation ; decreased pruritus ( 100% vs. 76% ) with betamethasone dipropionate alonenone reportedtiplica and salavastru combination of 5% salicylic acid and 0.1% mometasonefuroate ointment7 days359 patients withrandomized , controlled , open - label studysignificantly greater reduction in pasi score ( p = 0.0017 ) ; better treatment evaluation by patients ( p = 0.003 ) ; significant lower dlqi scores regarding symptoms and feelings ( p = 0.0464 ) and personal relationships ( p = 0.0378 ) compared to mometasonefuroate aloneskin irritation in one patientkatz et al .
combination of 5% salicylic acid and 0.1% mometasonefuroate ointment3 weeks341 patients with moderate - to - severe psoriasisrandomized , controlled studysignificant improvement in total disease sign scores on day 15 ( p = 0.04 ) and on day 22 ( p = 0.01 ) ; improvements in scaling and induration ( each p = 0.01 ) on day 22 compared to mometasonefuroate aloneapplication - site reactions such as burning , pruritus and skin atrophy in 20% of patients vs. 13% with mometasonefuroate alonekoo et al .
combination of 5% salicylic acid and 0.1% mometasonefuroate ointment3 weeks408 patients with moderate - to - severe psoriasis vulgarisrandomized , controlled studysignificant improvement of the investigators global evaluation of overall clinical response at days 15 and 22 ( p < 0.01 ) and individual scores for scaling ( p = 0.01 ) at day 8 , erythema and induration at day 15 ( p = 0.02 and 0.03 , respectively ) compared to mometasonefuroate aloneapplication - site reactions in 9% of patients vs. 8% with mometasonefuroate alone
dlqi dermatology life quality index , pasi psoriasis area severity index , pssi psoriasis scalp severity index efficacy and safety of salicylic acid in clinical trials
dlqi dermatology life quality index , pasi psoriasis area severity index , pssi psoriasis scalp severity index concerning combination therapy with the super - potent or potent corticosteroids betamethasone dipropionate and mometasonefuroate , 5 randomized controlled trials in a total of 1,248 patients were identified .
patients with psoriasis were treated for up to 3 weeks with a combination of 2% salicylic acid and 0.05% betamethasone dipropionate ( 2 studies ; n = 72 ) or 5% salicylic acid and 0.1% mometasonefuroate ( 3 studies ; n = 519 ) .
the respective control groups received the corresponding corticosteroid only . in one study , a more rapid onset of action and a more rapid clearing of scaling , pruritus , and inflammation was demonstrated with the combination ; whereas in another trial , the combination was statistically more effective than the respective corticosteroid alone in terms of mean total disease sign scores beginning at day 8 ( p = 0.05 ) and continuing through days 15 and 22 ( p < 0.01 ) .
this is also reflected in the individual sign scores : the combination was significantly more effective than the corticosteroid alone for scaling starting on day 8 ( p = 0.01 ) , erythema ( p < 0.02 ) , and pruritus on day 14 ( p < 0.01 ) as well as induration on day 15 ( p = 0.03 ) , with p 0.01 for all three signs of psoriasis ( erythema , induration and scaling ) at day 22 [ 46 , 57 ] . according to the investigators global evaluation of overall clinical response , patients treated with the combination showed a better progress than those treated with the corticosteroid alone ( p < 0.01 ) .
after 7 days of treatment , a significantly greater reduction of the psoriasis area severity index score was observed compared to the corticosteroid alone ( p = 0.0017 ) . regarding the items of the dermatology life quality index ( dlqi ) questionnaire ,
data showed significant differences in the symptoms and feelings ( p = 0.0464 ) and the personal relationships items ( p = 0.0378 ) . on the self - assessment questionnaire , patients preferred the combination over the corticosteroid alone for overall improvement of general appearance and overall improvement of psoriasis ( both p = 0.03 ; see table 5 ) . in the evaluated studies ,
no systemic toxicity was observed and absorption of salicylate was negligible after application of 6% to the scalp . yet
application - site reactions such as dryness , irritation , burning , pruritus , and skin atrophy were reported ( see table 5 ) [ 46 , 55 , 58 , 59 ] .
emollients induce an occlusive film that limits evaporation of water from deeper parts of the skin and allows the stratum corneum to rehydrate itself .
the application of natural moisturizing factors induces an increase in the water - binding capacity of the stratum corneum .
regular application of emollients improves comfort and reduces scaling , fissuring , and itching in patients with plaque or scalp psoriasis [ 25 , 26 ] .
additionally , emollients may increase the efficacy of topical corticosteroids by improving the penetration through the skin layers [ 21 , 27 , 28 ] . guidelines of care for the management of psoriasis and psoriatic arthritis state that when used as a control in topical steroid trials , non - medicated topical moisturizers demonstrated a response rate ranging from 15 to 47% [ 21 , 27 ] .
this broad range may reflect the great variability of their composition ; however , in the corresponding guideline dealing with topical therapies , the individual composition of the moisturizers has not been specified .
however , they can cause side effects such as irritant dermatitis , allergic contact dermatitis , fragrance allergy or allergy to other constituents , stinging , cosmetic acne , and pigmentary disorders . in addition
, some reports indicate a potential penetration - enhancing effect of the stratum corneum to irritants after long - term use . in clinical and experimental settings
it has been shown that some emollients , e.g. , oil - in - water emollient enhance the penetration of uva or uvb when used before irradiation , thus increasing the efficacy of phototherapy [ 29 , 30 ] . however , in vitro studies and studies in healthy volunteers also demonstrated a blocking effect of other emollients , such as white petrolatum and the emollient cream eucerin ( beiersdorf inc . , wilton , ct , usa ) , consistent with their thickness .
while 3 small clinical trials including a total of 111 patients provide limited evidence that , compared to baseline , emollients used as a monotherapy may improve skin hydration , barrier function , as well as proliferation and differentiation markers in patients with psoriasis [ 11 , 33 , 34 ] , the clinical response showed only a slight symptomatic improvement of psoriasis . due to inconsistent results from randomized controlled trials , there is limited evidence of a steroid - sparing effect of emollients when used in combination with corticosteroids . in the evaluated studies ,
only two adverse events of pruritus and folliculitis ( each n = 1 ) were reported ( see table 2 ) [ 11 , 3337].table 2efficacy and safety of emollients in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventsvan duijnhoven et al .
50% cremorlanette i in vaselinum album2 weeks5 patients with psoriasisnon - comparative studynormalization of proliferation and differentiation markers ; slight improvement compared to baselinenone reportedrim et al .
pseudoceramide ( myristyl / palmityloxostearamide / arachamidemonoethanolamine)6 weeks17 patients with psoriasiscontrolled study ( vs. untreated lesions)improved visual assessment of skin dryness , significantly increased electrical capacitance ; decreased tewlmild pruritus in one patientpauporte et al . combination of peanut and mineral oil3 weeks89 patients with moderate to severe scalp psoriasisrandomized , controlled , double - blind study ( vs. 0.01% fluocinoloneacetonide)improvement of all signs of psoriasis compared to baseline ( p < 0.05)treatment - related folliculitis in one patienttanghetti et al .
combination of tazarotene with an emollient ( not further specified)12 weeks1,393 patients with plaque psoriasisobservational studyenhanced efficacy of tazarotene ; increased patients satisfactionnone reportedwatsky et al . combination of 0.05% betamethasone dipropionate and a water - in - oil based moisturizing cream or lotion ( not further specified)4
weeks96 patients with chronic plaque - type psoriasiscontrolled , open label study ( twice daily vs. once daily)once - daily application was equivalent in efficacy to twice - daily application and significantly better than once - daily application of betamethasone alone ( both p = 0.05)none reportedsingh et al .
combination of 0.05% betamethasone dipropionate twice daily in propylene glycol9 days36 patients with psoriasisrandomized , controlled , double - blind study ( vs. once - daily betamethasone)no difference compared to once - daily betamethasone regarding erythema , scaling , induration and lpsinone reported
lpsi local psoriasis severity index , tewl transepidermal water loss efficacy and safety of emollients in clinical trials
lpsi local psoriasis severity index , tewl transepidermal water loss
urea is known to exert proteolytic , keratolytic , hydrating , hygroscopic , penetration - enhancing , epidermis - thinning , and anti - pruritic effects .
the moisturizing action of urea in dry and scaly skin conditions has been widely studied and is well accepted [ 21 , 38 ] .
. suggested that lipid biosynthesis may be increased by topical application of highly concentrated urea . in vitro and in vivo data showed a reduction of dna synthesis in the cells of the basal layers ( by approximately 45% ) , a thinning of the epidermis ( by approximately 20% ) , a reduction of the epidermal cells , and a prolongation of the generation time of postmitotic epidermal cells [ 21 , 39 ] .
therefore , urea has been shown to reduce epidermal hyperproliferation and to induce cell differentiation . as a mechanism of action
it has been hypothesized that urea may break hydrogen bonds and interfere with the quaternary structure of keratin thus dispersing and denaturizing keratin without disrupting the epidermal water barrier .
pre - treatment or concomitant treatment with urea may also enhance the efficacy of other topical therapies .
due to its safety , urea - containing preparations represent the standard in the adjuvant therapy of juvenile psoriasis .
only non - systemic side effects have been reported , with mild irritation being the most common , making urea a safe and well - tolerated topical drug . while a small , older comparative study found no statistical differences on severity parameters such as scaling , erythema , and infiltration compared to the vehicle , in another trial using the same preparation , treatment for 1 week led to a statistically significant improvement of scaling compared to the vehicle ( see table 3 ) [ 38 , 4046 ] .
this is in line with two further studies in which severity parameters of psoriasis such as scaling and/or induration were reduced with urea in monotherapy . of these , in a small randomized , double - blind study , addition of 10% urea to the vehicle was significantly more effective regarding epidermal proliferation , stratum corneum hydration , and epidermal thickness with a 60% reduction of the clinical psoriasis severity score of scaling and a 32% reduction of induration ( see table 3 ) compared to the vehicle alone .
the ointment base also improved psoriasis , but urea was significantly more effective showing a 40% reduction in epidermal proliferation compared to the vehicle .
similar results were demonstrated in a double - blind , placebo - controlled study , in which two urea gel formulations ( 10% plain urea gel or 5% urea niosomal gel ) produced a reduction in erythema , infiltration , and desquamation , as well as in the total psoriasis area and severity index ( pasi ) score , with the 5% urea niosomal gel being more effective regarding desquamation compared to the plain gel and placebo .
from three small studies , limited evidence is known for an enhanced efficacy of other topical agents such as bifonazole , dithranol or betamethasone dipropionate and calcipotriol leading to a shortened treatment duration ( see table 3 ) [ 4345 ] . in the evaluated clinical studies ,
a burning sensation was observed in three patients ( see table 3 ) [ 39 , 42].table 3efficacy and safety of urea in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventsgip et al .
12% urea and 12% sodium chloride3 weeks30 patients with psoriasiscontrolled double - blind study ( vs. vehicle)no statistical differences on severity parameters such as scaling , erythema and infiltration compared to vehicleburning sensation in two patientsfredriksson et al .
12% urea and 12% sodium chloride1 week40 patients with psoriasiscontrolled study ( vs. vehicle)statistically significant improvement in scaling compared to vehiclenone reportedhagemann and proksch 10% urea2 weeks10 patients with psoriasisrandomized , controlled , double - blind study ( vs. vehicle and vs. untreated site)reduction of the clinical psoriasis severity scores of scaling ( 60% ) and induration ( 32% ; p <
0.025 ) compared to the vehicle ; two - fold increase in stratum corneum hydration ( p < 0.01 ) compared to the untreated sitenone reportedlakshimi and bhaskaran 10% plain urea gel or 5% urea niosomal gel12 weeks40 adult patients with stable plaque psoriasis involving < 25% of the body surface area or palmoplantar psoriasisdouble - blind placebo controlled studythe niosomal urea gel produced greater reduction in total score and desquamation score compared to the plain gel and placebo ( p < 0.05 ) .
combination of 40% urea and 1% bifonazole2 weeks52 patients with psoriasis capitis ; 19 patients with scalp seborrheic dermatitisnon - comparative , open - label studyimprovement in 100% of patients with complete healing in 73.2% compared to baselinenone reportedtaube et al .
combination of 1% dithranol and 10% urea ( after 2 days of pre - treatment with 5% salicylic acid)7 weeks57 patients with psoriasis vulgariscontrolled case study ( vs. dithranol alone)significantly shortened mean treatment duration until complete resolution of 3.5 weeks compared to 4.2 weeks in the dithranol only groupnone reportedvena et al . combination of 2% urea [ betamethasone dipropionate and calcipotriol for 4 weeks followed by calcipotriol alone or with urea ( 2% and 4% ; once daily each)]4 + 8 weeks313 adult patients with psoriasis vulgarismulticenter open studyafter the 8-week maintenance treatment phase , the clinical score for erythema , scaling , infiltration and pruritus improved in both groups , with a tendency towards a greater reduction of infiltration in those treated with urea .
a greater percentage of patients concomitantly treated with urea ( 47% ) than those treated with calcipotriol ( 33% ) judged the efficacy as excellentburning sensation in two patients efficacy and safety of urea in clinical trials
alpha - hydroxy acids ( ahas ) , most notably glycolic acid and lactic acid , are used in chemical - peel solutions to exfoliate thickened skin in hyperkeratotic conditions . however ,
their use in the treatment of psoriasis has only recently been advocated and , thus , they are not mentioned as keratolytic agents in relevant psoriasis guidelines [ 7 , 17 ] .
ahas penetrate the epidermis , inducing an increase in stratum corneum turnover and cause desquamation of the outermost layer without impairing barrier function .
they reduce intercorneocyte bonds by increasing the distance between corneocytes due to increased stratum corneum water content , by reducing the charges on the surface of cells , by inhibiting enzymes involved in the cohesion between corneocytes , and by breaking desmosomes as they diminish the ph of the medium .
this reduction can also degrade keratinocytes directly , thus promoting cell proliferation . in the dermis
, ahas can stimulate the biosynthesis of glycosaminoglycans , collagen , and other substances , which cause thickening of the skin .
poly - hydroxy acids ( phas ) also aid in dermal expansion and can provide the components for glycosaminoglycans .
phas have anti - oxidant and moisturizing properties and may provide protection of psoriatic skin with a disrupted skin barrier . when used in combination with topical corticosteroids ,
ahas or phas exert a synergistic effect and reduce steroid - induced skin atrophy . for ahas and phas ,
one of these trials , a small , controlled study , demonstrated that glycolic acid in monotherapy may lead to significant reduction in hyperkeratosis and erythema as compared to baseline , which was comparable to that achieved with 0.05% betamethasone valerate ( see table 4 ) [ 3 , 47 , 48 ] . in a small , short - term study , aha / pha and salicylic acid exhibited similar efficacy with regard to the reduction of scaling when compared to baseline ( see table 4 ) .
the third small study found a synergistic effect of 10% glycolic acid in combination with topical corticosteroids leading to reduced treatment duration and an increased healing rate ( see table 4 ) . in the evaluated studies ,
no treatment - related adverse events were reported ( see table 4).table 4efficacy and safety of aha and pha in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventsberardesca et al .
15% glycolic acid15 days12 patients with psoriasiscontrolled study ( vs. 0.05% betamethasone valerate)significantly decreased tewl and laser doppler values ; reduction in hyperkeratosis and erythema compared to baseline being equivalent to that after 0.05% betamethasone valeratenone reportedakamine et al .
15% ahas ( lactic acid , mandelic acid and gycolic acid ) and 5% phas ( gluconolactone and maltobionic acid)2 weeks25 patients with moderate , chronic , plaque psoriasisrandomized , controlled , double - blind study ( vs. 6% salicylic acid)significant improvement in scaling , erythema , induration and , investigator global assessment , compared to baselinemild adverse events assessed as not related in five patientskostarelos et al .
combination of 10% glycolic acid and 0.1% betamethasone8 weeks20 patients with scalp and seborrhoeic psoriasiscontrolled , double - blind study ( vs. betamethasone alone)reduced duration of treatment to approximately half compared to treatment with betamethasone alone , 8 out of 13 of the treated sites healed completely compared to 3 out of 12 with betamethasone onlynone reported
aha alpha - hydroxy acid , pha poly - hydroxy acid , tewl transepidermal water loss efficacy and safety of aha and pha in clinical trials
aha alpha - hydroxy acid , pha poly - hydroxy acid , tewl transepidermal water loss
salicylic acid is the most commonly used and most thoroughly studied of the currently known keratolytic compounds . in concentrations of 5% and above , it exerts an increasingly potent , rapid , and deep keratolytic effect on the stratum corneum which leads to descaling . as a mechanism of action
, it is suggested that salicylic acid reduces intercellular cohesion between corneocytes by dissolving the intercellular cement material and reducing the ph of the stratum corneum , thereby increasing hydration and softening [ 3 , 7 , 31 ] .
topical salicylates also reduce pruritus and , at concentrations of 0.3% , they possess bacteriostatic and bactericidal activity against yeast and gram - negative and gram - positive bacteria . in their clinical guide , naldi and rzany state that there is consensus that salicylic acid is an effective initial and adjunctive treatment in chronic plaque psoriasis .
it is most beneficial in extremely thick or scaly psoriatic plaques . according to current guidelines ,
salicylic acid promotes skin availability of other topical therapies including topical corticosteroids due to its keratolytic and penetration - enhancing effect [ 1 , 7 , 14 , 20 , 49 ] .
while salicylic acid is commonly applied and effective when used as a pre - treatment before phototherapy [ 15 , 16 ] , topically administered salicylic acid , in concentrations 0.1% , is photoprotective .
thus , application of salicylic acid before uvb phototherapy is not recommended [ 15 , 16 , 22 , 32 , 50 , 51 ] . according to the evaluated reviews ,
topical use of salicylic acid is limited by the risk of chronic or acute systemic intoxication [ 2 , 7 ] with symptoms such as oral pain , headache , central nervous system symptoms , dizziness , metabolic acidosis , tinnitus , nausea , vomiting , and gastric symptoms , as well as hyperventilation [ 2 , 3 , 52 ] .
these symptoms may occur after prolonged topical treatment of large body surfaces ( i.e. , > 20% ) [ 6 , 7 , 25 ] , especially in children under 12 years of age and in patients with significant renal or hepatic impairment [ 2 , 3 , 7 , 22 , 25 ] .
local irritation such as stinging , burning , dry skin , peeling , scaling , or contact dermatitis was also reported [ 1 , 9 , 53 ] .
temporary shedding of telogen hair has been observed when used in the treatment of scalp psoriasis .
concomitant use of other drugs , which may contribute to elevated serum salicylate levels , should be avoided .
there is an increased risk for developing toxicity to other topically applied agents used concurrently , as salicylic acid may increase their skin penetration . in addition
regarding monotherapy , three studies on salicylic acid including 65 patients were evaluated [ 5456 ] . of these ,
an open - label , pilot study demonstrated that 6% salicylic acid used as a monotherapy was highly effective , well tolerated , and acceptable in 10 patients with scalp psoriasis .
all psoriasis severity parameters as well as the percentage of affected area were reduced with a significant decrease in psoriasis scalp severity index score from 15.3 to 3.0 after 4 weeks of monotherapy when compared to baseline ( p < 0.001 ) .
a total of 60% of patients were either completely cleared or almost cleared
( see table 5 ) . in a randomized , double - blind study in 25 patients investigating 6% salicylic
acid vs. 20% aha / pha cream ( see also table 4 ) , both topical agents resulted in significant improvement of scaling , erythema , and induration , as well as investigator global assessment , at the end of week 1 and 2 and exhibited similar efficacy in reducing scaling .
however , the extent of affected area was not investigated in this study ( see table 5 ) .
similar results were obtained in an earlier , randomized controlled trial reporting successful treatment of moderate or severe scalp psoriasis with 6% salicylic acid in 30 patients , including 10 in - patients and 20 out - patients . in - patients
were treated for 3 weeks with daily applications of 6% salicylic acid removed with a shampoo 24 h later .
out - patients were treated for 6 weeks with salicylic acid applied once daily and removed 12 h later .
if progress was slow , a shampoo containing 3% coal tar solution was substituted for the shampoo . as a result
, 90% of in - patients and 65% of out - patients improved with salicylic acid regarding scaling and percentage of affected area and in one patient , the scalp cleared completely .
scaling scores for out - patients improved from baseline 7.0 to 4.5 at 6 weeks ( n = 20 ; p < 0.01 ) and the scores for in - patients improved from baseline 7.7 to a score of 3.7 at 3 weeks ( n = 10 ; p < 0.001 ) .
eight of the out - patients , but none of the in - patients used the coal tar shampoo . out - patients used less salicylic acid ( 27 g weekly ) than in - patients ( 72 g weekly ; see table 5 ) .table 5efficacy and safety of salicylic acid in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventskircik 6% salicylic acid4 weeks10 patients with scalp psoriasisnon - comparative , open - label , pilot studysignificant decrease in pssi score from 15.3 to 3.0 compared to baseline ( p < 0.001 ) ; 60% of patients were either completely cleared or
6% salicylic acid2 weeks25 patients with moderate , chronic , plaque psoriasisrandomized , controlled , double - blind studysignificant improvement in scaling , erythema , induration and investigator global assessment compared to baselinemild adverse events assessed as not related in five patientsgoing et al .
6% salicylic acid3 and 6 weeks30 patients with moderate or severe scalp psoriasisrandomized , controlled study6590% of patients improved regarding scaling and percentage of affected area compared to baseline ; scaling scores for out - patients improved from 7.0 to 4.5 at 6 weeks ( p < 0.01 ) and for in - patients from 7.7 to 3.7 at 3 weeks ( p < 0.001)dryness and stinging in six patients ; irritation in three patientselie et al .
combination of 2% salicylic acid and 0.05% betamethasone dipropionate lotion21 days40 patients with erythematous squamous dermatoses of the scalp including 22 patients with moderate to severe psoriasisrandomized , controlled studyreduction of mean total disease sign scores for scaling after 14 and 21 days ( p < 0.05 ) , erythema after 14 days ( p < 0.02 ) and after 21 days ( p < 0.01 ) , pruritus after 14 and 21 days ( p < 0.01 ) ; physician s global evaluation showed a better evolution after 14 days ( p < 0.01 ) and after 21 days ( p < 0.02 ) compared to betamethasone dipropionate alonenone reportednolting and hagemeier combination of 2% salicylic acid and 0.05% betamethasone dipropionate solution3 weeks100 patients ( n = 36 with psoriasis vulgaris)randomized , controlled studymore rapid onset of action and a more rapid clearing of scaling , pruritus and inflammation ; decreased pruritus ( 100% vs. 76% ) with betamethasone dipropionate alonenone reportedtiplica and salavastru combination of 5% salicylic acid and 0.1% mometasonefuroate ointment7 days359 patients withrandomized , controlled , open - label studysignificantly greater reduction in pasi score ( p = 0.0017 ) ; better treatment evaluation by patients ( p = 0.003 ) ; significant lower dlqi scores regarding symptoms and feelings ( p = 0.0464 ) and personal relationships ( p = 0.0378 ) compared to mometasonefuroate aloneskin irritation in one patientkatz et al .
combination of 5% salicylic acid and 0.1% mometasonefuroate ointment3 weeks341 patients with moderate - to - severe psoriasisrandomized , controlled studysignificant improvement in total disease sign scores on day 15 ( p = 0.04 ) and on day 22 ( p = 0.01 ) ; improvements in scaling and induration ( each p = 0.01 ) on day 22 compared to mometasonefuroate aloneapplication - site reactions such as burning , pruritus and skin atrophy in 20% of patients vs. 13% with mometasonefuroate alonekoo et al .
combination of 5% salicylic acid and 0.1% mometasonefuroate ointment3 weeks408 patients with moderate - to - severe psoriasis vulgarisrandomized , controlled studysignificant improvement of the investigators global evaluation of overall clinical response at days 15 and 22 ( p < 0.01 ) and individual scores for scaling ( p = 0.01 ) at day 8 , erythema and induration at day 15 ( p = 0.02 and 0.03 , respectively ) compared to mometasonefuroate aloneapplication - site reactions in 9% of patients vs. 8% with mometasonefuroate alone
dlqi dermatology life quality index , pasi psoriasis area severity index , pssi psoriasis scalp severity index efficacy and safety of salicylic acid in clinical trials
dlqi dermatology life quality index , pasi psoriasis area severity index , pssi psoriasis scalp severity index concerning combination therapy with the super - potent or potent corticosteroids betamethasone dipropionate and mometasonefuroate , 5 randomized controlled trials in a total of 1,248 patients were identified .
patients with psoriasis were treated for up to 3 weeks with a combination of 2% salicylic acid and 0.05% betamethasone dipropionate ( 2 studies ; n = 72 ) or 5% salicylic acid and 0.1% mometasonefuroate ( 3 studies ; n = 519 ) .
the respective control groups received the corresponding corticosteroid only . in one study , a more rapid onset of action and a more rapid clearing of scaling , pruritus , and inflammation was demonstrated with the combination ; whereas in another trial , the combination was statistically more effective than the respective corticosteroid alone in terms of mean total disease sign scores beginning at day 8 ( p = 0.05 ) and continuing through days 15 and 22 ( p < 0.01 ) .
this is also reflected in the individual sign scores : the combination was significantly more effective than the corticosteroid alone for scaling starting on day 8 ( p = 0.01 ) , erythema ( p < 0.02 ) , and pruritus on day 14 ( p < 0.01 ) as well as induration on day 15 ( p = 0.03 ) , with p 0.01 for all three signs of psoriasis ( erythema , induration and scaling ) at day 22 [ 46 , 57 ] . according to the investigators global evaluation of overall clinical response , patients treated with the combination showed a better progress than those treated with the corticosteroid alone ( p < 0.01 ) .
after 7 days of treatment , a significantly greater reduction of the psoriasis area severity index score was observed compared to the corticosteroid alone ( p = 0.0017 ) . regarding the items of the dermatology life quality index ( dlqi ) questionnaire ,
data showed significant differences in the symptoms and feelings ( p = 0.0464 ) and the personal relationships items ( p = 0.0378 ) . on the self - assessment questionnaire , patients preferred the combination over the corticosteroid alone for overall improvement of general appearance and overall improvement of psoriasis ( both p = 0.03 ; see table 5 ) . in the evaluated studies ,
no systemic toxicity was observed and absorption of salicylate was negligible after application of 6% to the scalp . yet
application - site reactions such as dryness , irritation , burning , pruritus , and skin atrophy were reported ( see table 5 ) [ 46 , 55 , 58 , 59 ] .
regarding monotherapy , three studies on salicylic acid including 65 patients were evaluated [ 5456 ] . of these ,
an open - label , pilot study demonstrated that 6% salicylic acid used as a monotherapy was highly effective , well tolerated , and acceptable in 10 patients with scalp psoriasis .
all psoriasis severity parameters as well as the percentage of affected area were reduced with a significant decrease in psoriasis scalp severity index score from 15.3 to 3.0 after 4 weeks of monotherapy when compared to baseline ( p < 0.001 ) .
a total of 60% of patients were either completely cleared or almost cleared
( see table 5 ) . in a randomized , double - blind study in 25 patients investigating 6% salicylic acid vs. 20% aha / pha cream
( see also table 4 ) , both topical agents resulted in significant improvement of scaling , erythema , and induration , as well as investigator global assessment , at the end of week 1 and 2 and exhibited similar efficacy in reducing scaling .
however , the extent of affected area was not investigated in this study ( see table 5 ) .
similar results were obtained in an earlier , randomized controlled trial reporting successful treatment of moderate or severe scalp psoriasis with 6% salicylic acid in 30 patients , including 10 in - patients and 20 out - patients . in - patients
were treated for 3 weeks with daily applications of 6% salicylic acid removed with a shampoo 24 h later .
out - patients were treated for 6 weeks with salicylic acid applied once daily and removed 12 h later .
if progress was slow , a shampoo containing 3% coal tar solution was substituted for the shampoo . as a result
, 90% of in - patients and 65% of out - patients improved with salicylic acid regarding scaling and percentage of affected area and in one patient , the scalp cleared completely . scaling scores for out - patients improved from baseline 7.0 to 4.5 at 6 weeks ( n = 20 ; p < 0.01 ) and the scores for in - patients improved from baseline 7.7 to a score of 3.7 at 3 weeks ( n = 10 ; p < 0.001 ) .
eight of the out - patients , but none of the in - patients used the coal tar shampoo . out - patients used less salicylic acid ( 27 g weekly ) than in - patients ( 72 g weekly ; see table 5 ) .table 5efficacy and safety of salicylic acid in clinical trialsreferencesinterventiontreatment durationpopulationstudy designresultsadverse eventskircik 6% salicylic acid4 weeks10 patients with scalp psoriasisnon - comparative , open - label , pilot studysignificant decrease in pssi score from 15.3 to 3.0 compared to baseline ( p <
6% salicylic acid2 weeks25 patients with moderate , chronic , plaque psoriasisrandomized , controlled , double - blind studysignificant improvement in scaling , erythema , induration and investigator global assessment compared to baselinemild adverse events assessed as not related in five patientsgoing et al .
6% salicylic acid3 and 6 weeks30 patients with moderate or severe scalp psoriasisrandomized , controlled study6590% of patients improved regarding scaling and percentage of affected area compared to baseline ; scaling scores for out - patients improved from 7.0 to 4.5 at 6 weeks ( p < 0.01 ) and for in - patients from 7.7 to 3.7 at 3 weeks ( p < 0.001)dryness and stinging in six patients ; irritation in three patientselie et al .
combination of 2% salicylic acid and 0.05% betamethasone dipropionate lotion21 days40 patients with erythematous squamous dermatoses of the scalp including 22 patients with moderate to severe psoriasisrandomized , controlled studyreduction of mean total disease sign scores for scaling after 14 and 21 days ( p < 0.05 ) , erythema after 14 days ( p < 0.02 ) and after 21 days ( p < 0.01 ) , pruritus after 14 and 21 days ( p < 0.01 ) ; physician s global evaluation showed a better evolution after 14 days ( p < 0.01 ) and after 21 days ( p < 0.02 ) compared to betamethasone dipropionate alonenone reportednolting and hagemeier combination of 2% salicylic acid and 0.05% betamethasone dipropionate solution3 weeks100 patients ( n = 36 with psoriasis vulgaris)randomized , controlled studymore rapid onset of action and a more rapid clearing of scaling , pruritus and inflammation ; decreased pruritus ( 100% vs. 76% ) with betamethasone dipropionate alonenone reportedtiplica and salavastru combination of 5% salicylic acid and 0.1% mometasonefuroate ointment7 days359 patients withrandomized , controlled , open - label studysignificantly greater reduction in pasi score ( p = 0.0017 ) ; better treatment evaluation by patients ( p = 0.003 ) ; significant lower dlqi scores regarding symptoms and feelings ( p = 0.0464 ) and personal relationships ( p = 0.0378 ) compared to mometasonefuroate aloneskin irritation in one patientkatz et al .
combination of 5% salicylic acid and 0.1% mometasonefuroate ointment3 weeks341 patients with moderate - to - severe psoriasisrandomized , controlled studysignificant improvement in total disease sign scores on day 15 ( p = 0.04 ) and on day 22 ( p = 0.01 ) ; improvements in scaling and induration ( each p = 0.01 ) on day 22 compared to mometasonefuroate aloneapplication - site reactions such as burning , pruritus and skin atrophy in 20% of patients vs. 13% with mometasonefuroate alonekoo et al .
combination of 5% salicylic acid and 0.1% mometasonefuroate ointment3 weeks408 patients with moderate - to - severe psoriasis vulgarisrandomized , controlled studysignificant improvement of the investigators global evaluation of overall clinical response at days 15 and 22 ( p < 0.01 ) and individual scores for scaling ( p = 0.01 ) at day 8 , erythema and induration at day 15 ( p = 0.02 and 0.03 , respectively ) compared to mometasonefuroate aloneapplication - site reactions in 9% of patients vs. 8% with mometasonefuroate alone
dlqi dermatology life quality index , pasi psoriasis area severity index , pssi psoriasis scalp severity index efficacy and safety of salicylic acid in clinical trials
dlqi dermatology life quality index , pasi psoriasis area severity index , pssi psoriasis scalp severity index
concerning combination therapy with the super - potent or potent corticosteroids betamethasone dipropionate and mometasonefuroate , 5 randomized controlled trials in a total of 1,248 patients were identified .
patients with psoriasis were treated for up to 3 weeks with a combination of 2% salicylic acid and 0.05% betamethasone dipropionate ( 2 studies ; n = 72 ) or 5% salicylic acid and 0.1% mometasonefuroate ( 3 studies ; n = 519 ) .
the respective control groups received the corresponding corticosteroid only . in one study , a more rapid onset of action and a more rapid clearing of scaling , pruritus , and inflammation was demonstrated with the combination ; whereas in another trial , the combination was statistically more effective than the respective corticosteroid alone in terms of mean total disease sign scores beginning at day 8 ( p = 0.05 ) and continuing through days 15 and 22 ( p < 0.01 ) .
this is also reflected in the individual sign scores : the combination was significantly more effective than the corticosteroid alone for scaling starting on day 8 ( p = 0.01 ) , erythema ( p < 0.02 ) , and pruritus on day 14 ( p < 0.01 ) as well as induration on day 15 ( p = 0.03 ) , with p 0.01 for all three signs of psoriasis ( erythema , induration and scaling ) at day 22 [ 46 , 57 ] .
according to the investigators global evaluation of overall clinical response , patients treated with the combination showed a better progress than those treated with the corticosteroid alone ( p < 0.01 ) .
after 7 days of treatment , a significantly greater reduction of the psoriasis area severity index score was observed compared to the corticosteroid alone ( p = 0.0017 ) . regarding the items of the dermatology life quality index ( dlqi ) questionnaire ,
data showed significant differences in the symptoms and feelings ( p = 0.0464 ) and the personal relationships items ( p = 0.0378 ) . on the self - assessment questionnaire , patients preferred the combination over the corticosteroid alone for overall improvement of general appearance and overall improvement of psoriasis ( both p = 0.03 ; see table 5 ) . in the evaluated studies ,
no systemic toxicity was observed and absorption of salicylate was negligible after application of 6% to the scalp . yet
application - site reactions such as dryness , irritation , burning , pruritus , and skin atrophy were reported ( see table 5 ) [ 46 , 55 , 58 , 59 ] .
this systematic literature review covering articles published from january 1983 to december 2013 identified several reviews , meta - analyses , and guidelines emphasizing that , while topical treatment with corticosteroids and vitamin d analogs currently represent first - line therapies , adjuvant therapy with topical keratolytics and emollients forms part of an integrated therapeutic concept .
this is in line with the evaluated studies demonstrating specific properties of these agents that determine their role within this concept .
regarding emollients , the evaluated studies provided some evidence that these agents play a role as a basic therapy in supporting skin care and improving the altered structure and function of the skin but without a distinct clinical response in psoriasis . study results for urea point to a reduction of induration and/or scaling .
however , the percentage of affected area was not reduced . due to its emollient and keratolytic activity ,
however , to date , there are only a limited number of short - term studies regarding the mentioned substances , which were mostly performed in small populations without control or a clear randomization procedure and mainly using weak outcomes variables .
although salicylic acid used as monotherapy induced a significant improvement of psoriasis , as determined by the percentage of body surface area involved and/or the overall degree of erythema , induration , and desquamation [ 3 , 55 ] , the evidence of its efficacy as monotherapy remains controversial due to the lack of larger , high - quality trials and the absence of a placebo control which is considered a major limitation of most of the identified studies .
only four of the studies included in this review had a placebo control , that is , a comparison with the cream vehicle . in three of these studies ,
treatment with the active substance ( i.e. , urea ) led to a statistically significant improvement of outcome parameters compared to the vehicle . in two studies ,
the ointment base ( which was not further specified ) also improved psoriasis , but to a significantly lesser extent than the pharmacologically active ingredient , urea [ 38 , 42 ] .
this is in line with the studies on emollients , that may represent constituents of an ointment base and that did not show any relevant reduction in the severity of psoriasis . as regards its place in therapy , results of the current literature analysis support the use of salicylic acid as monotherapy in the treatment of scalp psoriasis and as an adjuvant agent in the treatment of other skin areas affected by psoriasis .
yet , patient adherence in scalp psoriasis is often poor due to the longer contact times required and since vehicles tend to be greasy . in combination with the super - potent or potent corticosteroids betamethasone dipropionate and mometasonefuroate , evidence from several randomized controlled trials in a total of 1,248 patients
demonstrates that addition of salicylic acid is beneficial in inducing a more rapid onset of action and a reduction of psoriasis determined by the percentage of body surface area involved and/or the overall degree of erythema , induration , and desquamation .
the addition of salicylic acid led to a better investigators global evaluation of overall clinical response , a more favorable evaluation by patients and significant lower dlqi scores compared to the respective corticosteroid alone . since treatment outcome determines treatment satisfaction , which in turn affects medication adherence , keratolytic agents such as salicylic acid may support overall adherence to the prescribed therapy . while salicylic acid at the applied concentrations was well tolerated in the evaluated studies with no signs of systemic toxicity , concerns of systemic toxicity
are consistently expressed in the literature [ 2 , 3 , 6 , 7 , 22 , 27 ] .
considering that descaling and/or penetration enhancement entails a distinct benefit in patients with psoriasis improving patient satisfaction and treatment adherence , there still is a need for well - designed studies on the currently available keratolytic agents but also on suitable keratolytic alternatives to salicylic acid with less potential for adverse effects .
this review is based on previously conducted studies , and does not involve any new studies of human or animal subjects performed by any of the authors .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited . | introductionpsoriasis is a common chronic disease with significant impairment in quality of life .
as there is no cure , it often requires lifelong disease control to minimize the development of skin lesions and to relieve symptoms .
the aim of this publication is to systematically review the role of currently used emollients and keratolytics in the treatment of psoriasis.methodsa systematic literature search was conducted in medline via pubmed regarding reviews , meta - analyses , and trials published from january 1983 to december 2013 dealing with topical administration of emollients and keratolytics in patients with psoriasis . a subsequent search in embase regarding clinical trials published from 1983 to 2013
was performed to complement the findings.resultsa total of 60 publications met the inclusion criteria for full - text evaluation . while current reviews , meta - analyses , and guidelines state that adjuvant therapy with emollients and keratolytics should be an obligatory part in the therapy of psoriasis to facilitate descaling and/or penetration enhancement , comprehensive trials on these agents are missing , with the exception of combination products containing salicylic acid and corticosteroids .
in the mentioned trials , addition of salicylic acid was beneficial in inducing a more rapid onset of action as well as a reduction of severity parameters and the area affected .
however , its use has substantial limitations in young children , in patients with renal / hepatic impairment , with widespread psoriasis , those undergoing phototherapy , or those concomitantly treated with calcipotriene / systemic salicylates.conclusionin view of these shortcomings , there is a need for well - designed studies on suitable keratolytic alternatives to salicylic acid offering an indisputable positive benefit
risk ratio.electronic supplementary materialthe online version of this article ( doi:10.1007/s13555 - 015 - 0068 - 3 ) contains supplementary material , which is available to authorized users . | Electronic supplementary material
Introduction
Methods
Results
Emollients
Urea
Alpha-Hydroxy Acids and Poly-Hydroxy Acids
Salicylic Acid
Monotherapy
Combination Therapy
Discussion
Conclusion
Electronic supplementary material
Conflict of interest
Compliance with ethics guidelines
Open Access |
fd may occur in one bone ( monostotic ) or multiple bones ( polyostotic ) and may be associated with other conditions like mccune albright syndrome .
clinical presentation may occur at any age , with the majority of lesions being detected by the age of 30 years .
common sites of skeletal involvement are the long bones , ribs , craniofacial bones , and the pelvis .
a 32-year - old female presented with pathological fracture of the shaft of the right femur . radiological evaluation revealed features of fd ( with fracture of the right femoral shaft ) , with similar lesions in the opposite femur .
the right femoral fracture was treated with intramedullary nailing , and intraoperative biopsy confirmed the diagnosis of fd . in order to document the extent of bony involvement in the rest of the skeleton , whole body bone scintigraphy was performed 3 hours after intravenous injection of 99mtc - methylene diphosphonate ( mdp ) .
multiple sites of increased skeletal tracer uptake were detected in the skull , left mandible , multiple ribs , pelvis and both lower limbs [ figure 1 ] .
single - photon emission computed tomography / computerized tomography ( spect / ct ) of the skull was performed for evaluation of the extent of skull bone involvement and showed involvement of the right sphenoid , ethmoid and frontal bones and left mandible , with evidence of bone expansion [ figure 2 ] .
ct component of spect - ct [ figure 3 ] shows bony expansion with ground glass appearance involving right sided ribs .
involvement of the sphenoid wing ( commonly described as the pirate sign ) was also better depicted with spect / ct .
tc-99 m mdp whole body images show multiple sites of increased tracer uptake , including the skull and facial bones , multiple ribs , pelvis and bones of both lower limbs .
the pirate sign indicates involvement of the right sphenoid wing hybrid spect / ct fusion to determine the extent of skull and facial bone involvement shows intense tracer uptake in the sphenoid , ethmoid and frontal bones non - contrast ct scan of the chest shows bony expansion and deformity of the right ribs , where intense osteoblastic activity was detected
fd is postulated to occur as a result of a developmental failure in the remodeling of primitive bone to mature lamellar bone and a failure of the bone to realign in response to mechanical stress .
failure of maturation leaves a mass of immature isolated trabeculae enmeshed in dysplastic fibrous tissue that constantly turns over but never ( or very , very slowly ) completes the remodeling process . the combination of a lack of stress alignment and insufficient mineralization results in substantial loss of mechanical strength , leading to the development of pain , deformity , and pathologic fractures .
the etiology has been linked with a mutation in the gs alpha gene that occurs after fertilization in somatic cells and is located at chromosome 20q13.2 - 13.3 .
the monostotic presentation of fd is more frequent than polyostotic presentation , and lesions enlarge in proportion to skeletal growth .
polyostotic lesions often continue to enlarge after skeletal maturity , with progressive deformity and an increase in pathologic fractures .
patients with polyostotic disease and large , painful lesions in weight - bearing long bones are at the greatest risk for pathologic fracture
. local expansion of fd in the maxilla , zygomatic , or ethmoid bones of the face can produce substantial functional and cosmetic deformity . at the initial presentation ,
radionuclide bone scintigraphy is useful to demonstrate the extent of the disease . actively forming lesions in adolescents
have greatly increased isotope uptake that corresponds closely to the radiographic extent of the lesion .
polyostotic fd has been demonstrated using f18-fluoride positron emission tomography / computed tomography ( pet / ct ) .
the utility of volume rendering has also been demonstrated in evaluation of the bony deformities .
the pirate sign has been previously described on planar bone scintigraphy in fd .
recent studies have described the advantage of performing bone spect in addition to ct to determine the extent of fd in the skull base and of hybrid spect / ct imaging in fd of the lumbar vertebra .
the present case illustrates the utility of hybrid spect / ct in documenting the complete extent of bony involvement of the skull base . | polyostotic fibrous dysplasia is a rare progressive benign disorder of the bone .
bone scintigraphy is extremely useful in the initial evaluation for identifying the extent of disease .
we report a case presenting with pathological fracture of the shaft of the right femur .
after treatment of the fracture , bone scintigraphy revealed involvement of multiple bones including the skull and facial bones .
the utility of single - photon emission computed tomography / computerized tomography in the evaluation of the extent of skull base involvement is highlighted . | INTRODUCTION
CASE REPORT
DISCUSSION |
5-hydroxytryptamine ( 5-ht , serotonin ) is a common biogenic amine found in both vertebrates and invertebrates as well as in plants [ 1 , 2 ] .
the precursor to 5-ht , tryptophan , is likey important in the early evolution of life and perhaps the early presence of tryptophan is a reason for 5-ht to be potentially the first neurotransmitter noted with the development of a nervous system .
5-ht acts as both a neurotransmitter and neurohormone and as a potent modulator of neurons and various tissues in many animal species .
generally 5-ht actions are elicited by transmembrane g protein coupled receptors ( gpcrs ) , which then activate or inhibit different intracellular second messenger cascades .
5-ht receptors from some organisms have been classified based on sequence or pharmacology [ 4 , 5 ] ; for example in the vertebrates , 7 families ( 5-ht1 - 7 ) , 14 subtypes have been identified , whereas in drosophila four 5-ht receptors named 5-ht1adro 5-ht1bdro 5-ht2dro 5-ht7dro [ 5 - 10 ] have been classified .
5-ht receptors appear to be present on invertebrate presynaptic nerve terminals and on muscle membranes ; receptors of a cricket ( gryllus domestica ) mandibular muscle have a similar pharmacological profile as a 5-ht2- like receptor subtype . profiling the 5-ht receptor subtypes directly on skeletal muscle within invertebrates
the 5-ht4 and 5-ht7 receptors are shown to have alternate splice variants which increase the number of receptor subtypes and may alter the selectivity to pharmacological agents .
in addition , 5-ht2 receptors can have different rna - edited isoforms [ 13 , 14 ] . with the use of the genetically modifiable model d. melanogaster
,
a number of studies have examined over - expression and under - expression of receptors subtypes on the effects of development , behavior and physiology as well as the general actions of 5-ht in d. melanogaster [ 7 , 15 - 19 ] .
based on physiological
and pharmacological studies in crustaceans there may be a larger number of 5-ht receptors present than in d. melanogaster [ 20 - 26 ] .
two receptors types have been cloned and characterized in crustaceans [ 9 , 27 , 28 ] and in a pond snail .
a 5-ht receptor 5-ht(apac1 ) has been cloned , sequenced and characterized in aplysia sensory neurons .
5-ht receptors are being cloned in a variety of invertebrates and surely more will be forth coming with the rapid development in genomic sequencing abilities .
there are a plethora of reports on the effects of 5-ht for sensory and central neurons as well as on behaviors in invertebrates which are worthy of multiple reviews .
however , for this brief review we focus on the physiological effects of 5-ht at the skeletal neuromuscular junctions in some of the key model invertebrates .
the invertebrate neuromuscular junctions ( nmjs ) are very diverse across species and within species in structure and function [ 31 - 37 ] .
the recent majority of reports on structure and function of nmjs are of d. melanogaster due to the genetic approaches and manipulations being utilized [ 38 - 41 ] .
the synaptic communication between neurons and target cells depends on the specialized anatomy and physiology of the synapses .
the regulation and modulation of neurotransmitter release is the basis of chemical synaptic transmission . for nervous systems to function properly , the efficacy of synapses are finely regulated and adjustable to respond to changing circumstance and requirement . too high or too low synaptic input
the amount of neurotransmitter released and the sensitivity of the postsynaptic membrane both are important for measuring synaptic strength .
each step in the process of synaptic transmission can be the target of many factors that lead to alteration of synaptic strength .
for example , the phosphorylation state of snare proteins that are involved in vesicle docking , or the density of active zones where transmitter is released , can influence the number of quantal units released per impulse ( presynaptic mechanism ) .
postsynaptically , the number of active receptors , the postsynaptic input resistance , the area and the ultrastructure of subsynaptic reticulum , all can alter the effectiveness of quantum release and thus influence synaptic strength . the ease in accessibility to the synaptic sites at nmjs allows one to record intracellular or very close to synapses by extracellular recordings ( focal macropatch over a varicosity ) in order to minimize cable properties in signal decrement [ 43 - 45 ] .
such signal loss occurs with recordings in a neuron cell body to measure synaptic function in the dendritic trees .
the localized recording over a nmj allows one the ability to measure properties of single and multiple vesicular quanta for very precise quantal analysis ( occurrences , size and shape ) to index synaptic function [ 46 - 49 ] .
in addition , invertebrate nmjs are relatively stable for hours in a minimal saline at room temperature as compared to mammalian nmjs .
since most muscles in invertebrates are innervated by relatively few motor neurons , for the most part , they are identifiable anatomically and physiologically from preparation to preparation [ 50 , 51 ] . since the fine structure and detailed quantal analysis is feasible for many invertebrate nmjs , the acute and chronic actions of modulators on structure and function can be examined for their mechanistic actions [ 52 - 54 ] .
given such a diverse group of animals within the class insecta , it would not be surprising to find a wide range of anatomic and physiologic profiles in the innervation of skeletal nmjs .
for example , the innervation of the genital chamber of the female cricket , acheta domestica , shows 5-ht - immunoreactive nerve terminals that contact the muscle fibers which likely releases 5-ht in a type of volume transmission over the muscle as there are no defined synapses .
such 5-ht containing nerve endings are also present in earthworm skeletal muscles . however , no serotonin is associated with the oviducts or the innervation to the oviducts in the locust .
earlier studies did not elucidate if the effect of 5-ht was directly on the presynaptic terminal or on the muscle but reported overall changes in force of muscle contraction . in a locust leg muscle
, 5-ht produces an overall decrease in force development but the mechanism of action still needs to be determined .
it is suggested that in some of the earlier studies with insects , the high concentrations of 5-ht used may indeed block synaptic transmission by impeding the postsynaptic receptors [ 36 , 58 ] . despite the intense investigations in synaptic structure and plasticity in d. melanogaster related to genetic and mutational manipulations ,
there are few reports on the modulation of synaptic efficacy by peptides or modulators at the skeletal nmj [ 54 , 59 - 64 ] . as for the influence of 5-ht at the nmj ,
the scantiness of studies is likely due to the mild effects observed by using 5-ht itself as well as pharmacological agonists / antagonists of 5-ht receptors .
however , application of 5-ht to the intact larval cns does enhance the drive of motor neurons ( mn ) .
the most commonly studied drosophila neuromuscular junctions are those in the most prominent ventral longitudinal abdominal muscle fiber muscles 6 and 7 , which have the simplest innervation pattern among the drosophila body wall muscles .
both electrophysiological and morphological studies imply that each of these two muscles is innervated by only 2 axons [ 66 , 67 ] .
we are not aware of any attempt to investigate actions of 5-ht on adult skeletal nmjs . however , with the recent advent of designer receptors exclusively activated by designer drugs ( dread ) in motor neurons allows one to examine mechanisms of activating second messenger cascades as if receptors for modulators existed on presynaptic nerve terminals or on the muscles themselves [ 70 , 71 ] .
the nmjs in crustaceans offer many advantages for addressing mechanism of action in modulation of synaptic efficacy at nmjs , but crustaceans do fall short in being able to genetically modify the properties for investigations .
potentially approaches with rnai might be practical to address more species - specific manipulations in synaptic function in a variety of crustaceans [ 72 - 75 ] .
the same physiological and anatomical advantages of the drosophila nmjs apply for the crustaceans , but in addition , the wide range in known diversity in synapses within crustaceans makes them attractable for comparative studies in commonalities of mechanisms in low- and high - output synapses or ones that facilitate or depress rapidly [ 31 , 32 , 76 ] .
the parallels to vertebrate central synaptic physiology of phenomenon described at crustacean nmjs are likely one reason of continual interest to a wide variety of researchers investigating synaptic transmission .
in addition , the historical contribution of crustaceans in synaptic physiology is unsurpassed [ 77 - 80 ] .
the ability to combine direct structure and function in defined labeled synapses offers the ability to unravel synaptic structural complexity with function [ 31 , 32 , 43 - 45 , 81 ] .
it was demonstrated as early as 1954 that 5-ht enhances synaptic transmission at the crustacean nmjs [ 82 , 83 ] and that the effect was likely a presynaptic enhancement of mean quantal content came afterwards .
the 5-ht that modulates most crustacean skeletal nmjs does so through the exposure of hemolymph .
5-ht is released from nerve endings in thoracic roots and from the pericardial organs into the hemolymph .
the excitatory as well as inhibitory nmjs are enhanced in transmission by 5-ht [ 86 , 87 ] .
the quantal effects are explained by increased probability of vesicular fusion during evoked transmission likely caused by an increase in the number of vesicular vesicles being docked and possibility their sensitivity of fusing due to enhanced ca sensitivity or presence of free ca within the terminals . however
, several studies have shown that a presynaptic rise in free ca is not substantial enough to account as a primary mechanism of 5-ht 's action [ 86 , 89 - 91 ] . since there is a steep rise in sensitivity to ca for enhancing synaptic efficacy at crustacean nmjs a low release from internal stores may account well enough for part of the effect .
this notion of an internal release of ca is also supported by experiments conducted by glusman and kravitz in which they showed that a calcium - free bath , along with egta and high mgcl2 , 5-ht could still cause spontaneous release of transmitter for lobster nmjs .
the enhanced spontaneous and evoked fusion events relates to an increase in ' n ' ( number of sites ) and ' p ' ( probability of release ) to explain the enhanced ' m ' ( mean quantal content ; m = np ) after exposure to 5-ht [ 69 , 93 , 94 ] .
an interesting observation , but not yet explained mechanistically , is that 5-ht produced an effect with low or zero extracellular calcium at a crayfish nmj but 5-ht 's effect depended on extracellular sodium concentration .
low- and high - output nmjs in crayfish and crab show differential responses to 5-ht [ 95 - 97 ] .
this could be due to the larger reserve pool of vesicles in tonic ( low - output ) terminals than the phasic ( high - output ) terminals and the fact that higher - output synapses in crustaceans have more complex synapses containing more active zones in close apposition on synapses than lower output synapses [ 45 , 98 - 100 ] .
nmjs investigated in lobster nmjs investigated in lobster and crab revealed similar findings to those of the crayfish .
5-ht also enhances both excitatory and inhibitor nmjs that have been examined in homarus americanus ( lobster ) [ 101 , 102 ] .
5-ht also promotes the force of nerve - evoked contractions of the gastric mill muscle of the crab , cancer borealis .
the differential responses and cellular mechanism of 5-ht 's action at crustacean nmjs is likely accounted for by the density and receptor subtypes on the presynaptic terminals .
vertebrate 5-ht2-like receptors were physiologically identified for procambarus clarkii at nmjs [ 21 - 24 , 69 ] .
since this subtype of receptor has been sequenced in a crab and crayfish these may be the subtypes present at the nmjs ; however the blockers for the vertebrate 5-ht2-like receptors could not block the entire 5-ht enhancement of synaptic enhancement .
also 5-ht2 agonists did not mimic the responses fully at the crayfish nmj , so potential affinity in binding 5-ht and pharmacological agents differ in crustaceans to vertebrate subtype receptor analogs .
the pharmacology of monoamines in the cardiac ganglion of lobsters also does not mimic vertebrate classifications .
care needs to be taken in assuming the pharmacology of mammalian 5-ht receptors applies to invertebrates .
given there is at least some pharmacological and sequence similarity to vertebrate 5-ht2 receptor subtype present in crayfish and that injection of an ip3 analog ( adenophostin - a ) in the presynaptic motor nerve terminals enhances release , a potential mechanism is that 5-ht receptors on the presynaptic membrane mediate activation of g coupled receptors which leads to activation of phospholipase c ( plc ) which in turn produces 1,4,5-trisphosphate ( ip3 ) and diacylglycerol ( dag ) .
the production of ip3 can directly result in ca release from internal stores ( i.e. , er ) through ip3 receptors on the er . since vertebrate 5-ht2 receptor family activates phospholipase c ( plc ) a similar receptor activated cascade is possible at the crayfish nmjs , such mechanisms are established in other systems [ 105 , 107 , 108 ] and given that caffeine and ryanodine actions are in concurrence with ip3 receptors potentially on the er in crayfish presynaptic motor nerve terminals we have to consider this mechanism as a likely possibility . the rise is ca , even a slight rise , could activate calmodulin and in turn activate cam - kinase ( cam - k ) , which can lead to phosphorylation of proteins such as synapsin .
the possibility is that vesicles would then be able to leave the tethers to the cytoskeleton and dock to the presynaptic membrane , which is also a phosphorylation step [ 109 - 111 ] .
the increased docked vesicles could be subjected to the calcium influx and release from internal stores .
this would account for the increase in the occurrence of spontaneous quantal events and enhanced evoked responses with 5-ht exposure . in the invertebrate aplysia , it was shown that exposure of neurons to 5-ht results in phosphorylation of synapsins .
camp was also suggested to be involved in 5-ht action [ 30 , 114 - 116 ] .
camp has been shown to activate protein kinase a ( pka ) which then can lead to phosphorylation of transcriptional factors such as creb .
such action can regulate synthesis of proteins used in synaptic transmission [ 117 - 119 ] .
it has also been suggested that the camp and calmodulin pathways may work together and promote transcription .
when phosphatases are inhibited at the crayfish nmj the effect of 5-ht is enhanced , thus demonstrating the significance of phosphorylation which is known to occur with exposure to 5-ht at crustacean nmjs . in a recent study addressing the potential mechanisms of 5-ht , as well as stimulation of the motor nerve terminal , in recruiting vesicles from a reserve pool ( rp ) to a readily releasable pool ( rrp ) within the presynaptic nerve terminals of crayfish nmjs , we developed a model to account for the observations and previous reports .
in a current study , we inhibited the packaging of glutamate by blocking the vesicular glutamate transporter ( vglut ) with the drug bafilomycin a1 ( ba ) [ 123 - 125 ] . in this way , the rapidly recycling vesicles within the rrp will be empty with repetitive stimulation .
however , if the rp is spared from being recruited by low frequency stimulation and if they are already packaged with transmitter , prior to exposure to ba , then 5-ht should be able to recruit these rp vesicles to the rrp and synaptic transmission restored temporarily .
this is exactly what was observed indicating that the rp and rrp can be physiologically differentiated into distinct functional groups and that 5-ht recruits the rp into action [ 126 , 127 ] . to deplete or use up the packaged rrp vesicles ,
continuous stimulation was provided since the opener nmj preparation is low - output and fatigue resistant .
a high frequency of 40 hz was used for comparative purposes to 20 hz continuous stimulation . as expected , preparations stimulated at 40 hz depressed faster than the ones stimulated at 20 hz and there was a reduced effect for the 40 hz stimulated preparations to exposure of 5-ht .
this suggests that a higher stimulation frequency is able to recruit some of the rp to the rrp .
if plc is an intermediate step within the cascade of events activated by 5-ht mediated responses , we used a plc inhibitor ( u73122 ) and an inactive analog ( u73343 ) to serve as a negative control .
we found that the treatment of u73122 caused a significant decrease of 5-ht effect on synaptic transmission .
this result confirmed the involvement of plc signaling cascade in inducing the enhancement of synaptic transmission by 5-ht at a different physiological condition .
there are observations in other preparations that indicate the presence of two distinct vesicle pools : rrp and rp . in the cat
superior sympathetic ganglion , prado et al . separated the two pools by electrically stimulating the nerve to deplete the rrp of acetylcholine , and then recruit rp vesicles by tityustoxin . using fm 1 - 43 dye ,
the two pools have been identified in a temperature - sensitive mutant drosophila line , shibire , and later in wt [ 130 , 131 ] .
however in our study with the crayfish nmj , a novel approach with bafilomycin a1 was used together with continuous stimulation to deplete the rrp , and then 5-ht was applied to recruit rp vesicles and the recruitment involves a plc signaling cascade .
1 . there does not appear to be a substantial direct effect on crustacean skeletal muscle to account for an increase in epsp or ipsp amplitude due to an increase in input resistance of the fibers [ 82 , 114 , 132 , 133 ] . a small increase in input resistance , by exposure to 5-ht ,
accounts for a slight increase in the epsp amplitude for superficial flexor muscle fibers of crayfish .
more substantial alteration in input resistance can occur in crustacean neurons due to 5-ht exposure so there could be some effect on the presynaptic motor nerve terminals . in comparison to the smooth muscle in the intestine of vertebrates , the muscles of the crayfish hindgut
are striated with gap junctions and generate intrinsic pacemaker activity [ 135 , 136 ] .
application of 5-ht and octopamine to gi tract increases the frequency and strength of contractions .
5-ht and dopamine are highly concentrated in cns and gi tract and they are directly responsible for the peristalsis and muscle contraction [ 137 , 139 ] .
the leech has served as a model organism in neurobiology for many years but few studies have directly focused attention at nmjs in the leech and even fewer on the effects of 5-ht in synaptic transmission at nmjs .
however , studies have examined the effect of 5-ht on the drive of motor neurons and innervation patterns [ 141 - 147 ] .
5-ht exposure has a relaxing effect on skeletal muscle in the leech and enhances muscle force and work production during locomotion and feeding .
this is physiological relevant since retzius neurons do directly innervate skeletal muscle in the leech and these cells do release 5-ht [ 144 , 150 - 152 ] . in the earthworm and polychaete ( sabellastarte magnifica ) muscle contraction is reduced by 5-ht [ 153 , 154 ] which lead to the idea that 5-ht might be acting as inhibitory transmitter in these preparations .
a few studies with gastropods have been approached for the direct effect of 5-ht at the nmj . 5-ht produces facilitation for an evoked response in buccal muscle within aplysia .
like for some of the actions in annelids , 5-ht can also produce muscle relaxation and reduce force in aplysia .
such effects on muscle contraction and force maybe dependent on 5-ht concentration and the species studied , since in aplysia brasiliana 5-ht increases a ca influx that promotes muscle contraction used for swimming .
in a sea urchin ( parechinus ) , 5-ht apparently had no effect at the nmj . however in a sea cucumber ( apostichopus japonicas ) , 5-ht inhibited evoked contractions induced by acetylcholine and there appears to be 5-ht innervation directly to muscles of the body wall .
although headway has been made in describing the various actions of 5-ht at nmjs in invertebrates , the cellular mechanisms of these actions are still lacking .
additional pharmacological and molecular profiling in a variety of invertebrate preparations will increase our knowledge of both the uniqueness and similarities among the invertebrates . as history has taught us in physiology , and in particular neurobiology , what is learned in invertebrate preparations paves the way to new views and mechanistic cellular understanding of complex processes within the vertebrates . | the serotonergic system in vertebrates and invertebrates has been a focus for over 50 years and will likely continue in the future .
recently , genomic analysis and discovery of alternative splicing and differential expression in tissues have increased the knowledge of serotonin ( 5-ht ) receptor types .
comparative studies can provide useful insights to the wide variety of mechanistic actions of 5-ht responsible for behaviors regulated or modified by 5-ht . to determine cellular responses and influences on neural systems as well as the efferent control of behaviors by the motor units , preparations amenable to detailed studies of synapses are beneficial as working models .
the invertebrate neuromuscular junctions ( nmjs ) offer some unique advantages for such investigations ; action of 5-ht at crustacean nmjs has been widely studied , and leech and aplysia continue to be key organisms . however , there are few studies in insects likely due to the focus in modulation within the cns and lack of evidence of substantial action of 5-ht at the drosophila nmjs
. there are only a few reports in gastropods and annelids as well as other invertebrates . in this review
we highlight some of the key findings of 5-ht actions and receptor types associated at nmjs in a variety of invertebrate preparations in hopes that future studies will build on this knowledge base . | GENERAL BACKGROUND OF 5-HYDROXYTRYPTAMINE AND RECEPTORS
WHY FOCUS ON NMJS?
INSECTS
CRUSTACEANS
ANNELIDS
GASTROPODS
OTHER INVERTEBRATES
SUMMARY |
vascular smooth muscle cells ( smcs ) play a vital role in the formation of mature and contractile intracranial vessel walls through smc proliferation , migration , and differentiation , and in the change in the extracellular matrix ( ecm ) components17 ) .
accordingly , an abnormal smc production pathway and altered ecm component can contribute to intracranial vascular diseases such as aneurysm6,11 ) , arteriovenous malformation ( avm ) and cavernous malformation ( cm)19 ) .
kilic et al.11 ) showed differently expressed structural proteins and regulatory growth factors among ruptured aneurysms , unruptured intracranial aneurysms ( uias ) and normal arterial walls . in their study , a drop in collagen iii , collagen iv , -smooth muscle actin ( -sma ) and transforming growth factor- ( tgf- ) was observed in patients with ruptured aneurysm and uia .
however , fibronectin in the ruptured aneurysm , which is abundant in immature vascular wall5,11 ) , was highly expressed compared to the uia or normal control group .
uranishi et al.19 ) reported that smc differentiation in avm was different from that in the cm or normal brain . and
they suspected that such a difference may lead to different contractility responses to hemodynamic stress .
various factors such as retinoic acid , tgf - beta , activin a , and platelet - derived growth factor b regulate smc and ecm proteins .
retinoic acid has an inhibitory effect on smc proliferation , differentiation and neointimal formation7,14 ) .
retinoic acid is regulated by retinoid acid receptors ( rars ) and cellular retinoic acid binding proteins ( crabp - i and ii)9 ) .
the role of crabp - i was suggested as lowering intracellular concentrations of active all - trans - retinoic acid ( atra ) by increasing atra metabolism4 ) .
the association between crabp - i and intimal hyperplasia was shown in an experimental animal model15 ) .
additionally , crabp - i in the cerebrospinal fluid ( csf ) was suggested as a possible candidate for moyamoya disease ( mmd)12 ) .
theoretically , crabp - i also may have the potential to cause disorganized vascular walls by altering the structural and adhesive proteins of the ecm as well as causing the formation of smcs with an immature phenotype which could lead to vulnerable arterial walls with an inadequate response to the hemodynamic stress . in this pilot study
, we hypothesized that high crabp - i level in the csf could be related with presentation of hemorrhage in patients with aneurysm .
in addition , we also extended this hypothesis in patients with vascular malformation according to the presence of hemorrhage .
this study was approved by the institutional review board at the participating hospital ( h-1103 - 097 - 356 ) .
this prospective analysis was conducted on patients who underwent surgery for an aneurysm , avm and cm from april 2011 to march 2012 at a single center . written informed consent
the optical density of crabp - i was estimated according to the presence of hemorrhage in each disease entity .
then , the crabp - i difference between the two groups , with and without hemorrhage presentation , was measured in all enrolled patients with an aneurysm , avm , and cm .
csf samples obtained from a tumor or normal pressure hydrocephalus ( nph ) were regarded as the control group8 ) .
the patients ' medical and radiologic data including sex , age , underlying disease , diagnosis , presenting symptoms , location of lesion and size were reviewed .
csf samples ranging from 5 to 15 ml were collected from the cortical subarachnoid space including the cortex or sylvian fissure and stored at -80. regarding patients with subarachnoid hemorrhage ( sah ) , csf was taken from the cistern of the lamina terminalis ( n=2 ) during the first operation or , the cortical and sylvian fissure during the second operation for concomitant uia ( n=5 ) to avoid blood contamination .
the preparation of csf samples and western blot assay were performed according to previously reported methods8,12 ) .
we carried out protein preparations as follows : 1 ml of the csf mixed with 250 l of 50% trichloroacetic acid ( sigma chemical co. , st .
louis , mo , usa ) was centrifuged at 16000 rpm at 4 for 15 minutes ; the pellet was washed with ethyl ether ( merck co , darmstadt , germany ) after the supernatant was discarded ; then , the protein pellet was dissolved in a solution containing 8 mol / l urea , 4% chaps , 40 mmol / l tris base , and 100 mmol / l dithiothreitol .
determination of the protein concentrations was carried out with the bca protein assay kit ( thermo scientific , waltham , ma , usa ) .
after concentrating the csf samples with trichloroacetic acid precipitation , 50 g of the protein was denatured with buffer at 70 for 10 minutes . then
, the denatured proteins were separated on a novex nupage 4 - 12% bis - tris gel ( novex , san diego , ca , usa ) and transferred onto a polyvinylidene fluoride membrane ( amersham pharmacia biotech , ny , usa ) . after blocking with tris - buffered saline containing 5% nonfat dry milk ,
the membrane was incubated with the primary antibody , goat anti - human crabp - i ( 1 : 500 ) ( santa cruz biotechnology , santa cruz , tx , usa ) in tbs containing 0.1% tween-20 overnight at 4. after it was washed , the blot was incubated with horseradish peroxidase - conjugated mouse anti - goat secondary antibody ( 1 : 1000 ) at room temperature for 1 hour .
horseradish peroxidase - conjugated anti - human albumin antibody ( 1 : 2000 ) ( koma biotech inc , seoul , korea ) was used as a loading control , and an enhanced chemiluminescence system ( invitrogen , carlsbad , ca , usa ) was used for the detection . the image j program
( nih , bethesda , md , usa ) was used to analyze the densitometric intensities .
the optical density of crabp - i is presented as meanstandard error of the measurement .
a comparative analysis of the crabp - i according to the presentation of hemorrhage was carried out by the kruskal - wallis test and mann - whitney u test for all possible pair - wise comparisons .
statistics were performed with statistical package for the social sciences ( spss ) version 19 ( spss inc . , chicago , il , usa ) .
this study was approved by the institutional review board at the participating hospital ( h-1103 - 097 - 356 ) .
this prospective analysis was conducted on patients who underwent surgery for an aneurysm , avm and cm from april 2011 to march 2012 at a single center . written informed consent
the optical density of crabp - i was estimated according to the presence of hemorrhage in each disease entity .
then , the crabp - i difference between the two groups , with and without hemorrhage presentation , was measured in all enrolled patients with an aneurysm , avm , and cm .
csf samples obtained from a tumor or normal pressure hydrocephalus ( nph ) were regarded as the control group8 ) .
the patients ' medical and radiologic data including sex , age , underlying disease , diagnosis , presenting symptoms , location of lesion and size were reviewed .
csf samples ranging from 5 to 15 ml were collected from the cortical subarachnoid space including the cortex or sylvian fissure and stored at -80. regarding patients with subarachnoid hemorrhage ( sah ) , csf was taken from the cistern of the lamina terminalis ( n=2 ) during the first operation or , the cortical and sylvian fissure during the second operation for concomitant uia ( n=5 ) to avoid blood contamination .
the preparation of csf samples and western blot assay were performed according to previously reported methods8,12 ) .
we carried out protein preparations as follows : 1 ml of the csf mixed with 250 l of 50% trichloroacetic acid ( sigma chemical co. , st .
louis , mo , usa ) was centrifuged at 16000 rpm at 4 for 15 minutes ; the pellet was washed with ethyl ether ( merck co , darmstadt , germany ) after the supernatant was discarded ; then , the protein pellet was dissolved in a solution containing 8 mol / l urea , 4% chaps , 40 mmol / l tris base , and 100 mmol / l dithiothreitol .
determination of the protein concentrations was carried out with the bca protein assay kit ( thermo scientific , waltham , ma , usa ) .
after concentrating the csf samples with trichloroacetic acid precipitation , 50 g of the protein was denatured with buffer at 70 for 10 minutes . then
, the denatured proteins were separated on a novex nupage 4 - 12% bis - tris gel ( novex , san diego , ca , usa ) and transferred onto a polyvinylidene fluoride membrane ( amersham pharmacia biotech , ny , usa ) . after blocking with tris - buffered saline containing 5% nonfat dry milk ,
the membrane was incubated with the primary antibody , goat anti - human crabp - i ( 1 : 500 ) ( santa cruz biotechnology , santa cruz , tx , usa ) in tbs containing 0.1% tween-20 overnight at 4. after it was washed , the blot was incubated with horseradish peroxidase - conjugated mouse anti - goat secondary antibody ( 1 : 1000 ) at room temperature for 1 hour .
horseradish peroxidase - conjugated anti - human albumin antibody ( 1 : 2000 ) ( koma biotech inc , seoul , korea ) was used as a loading control , and an enhanced chemiluminescence system ( invitrogen , carlsbad , ca , usa ) was used for the detection . the image j program
( nih , bethesda , md , usa ) was used to analyze the densitometric intensities .
the optical density of crabp - i is presented as meanstandard error of the measurement .
a comparative analysis of the crabp - i according to the presentation of hemorrhage was carried out by the kruskal - wallis test and mann - whitney u test for all possible pair - wise comparisons .
statistics were performed with statistical package for the social sciences ( spss ) version 19 ( spss inc . ,
twenty - six patients were enrolled in this study . this study included aneurysms ( n=14 ) , avm ( n=4 ) , cm ( n=3 ) , and a control group ( n=5 ) .
three cases were placed in the frontal lobe , and one was placed in the cerebellum .
their mean size was measured at 27.4 mm ranging in size from 12.7 to 44.9 mm .
three cases of cm , which were located in the temporal lobe ( n=2 ) and pons ( n=1 ) were enrolled .
their mean size was measured at 19.9 mm ranging in size from 11.0 to 30.6 mm ( table 1 ) .
hemorrhage development was not observed in the control group . crabp - i in sah was highly expressed in the western blot ( fig .
the kruskal - wallis test showed that the optical density of crabp - i was significantly different among the three groups ( sah , 0.330.09 ; uia , 0.120.01 ; control group , 0.100.01 ; p= 0.004 ) .
the mann - whitney u test revealed that the optical density in sah in a ruptured aneurysm was significantly higher than that in uia ( p=0.033 ) or the control group ( p=0.012 ) .
there was no significant crabp - i difference between the uia and control group ( p=0.447 ) ( fig .
2 ) . the hemorrhage presenting avm ( mean 0.45 , range 0.30 - 0.59 ) had a higher crabp - i level than that in avm without hemorrhage presentation ( mean 0.16 , range 0.14 - 0.17 ) .
two cases of cm with and one case without hemorrhage presentation had crabp - i optical densities measured at 0.21 and 0.31 and 0.14 , respectively ( table 1 ) .
we also measured the crabp - i intensity between the two groups based on the presence of hemorrhage presentation in all enrolled patients with an aneurysm , avm and cm .
the hemorrhage presenting group ( n=11 , 0.340.06 ) had a significantly higher crabp - i intensity than that of the non - hemorrhage presenting group ( n=10 , 0.130.01 ) ( p=0.001 ) .
twenty - six patients were enrolled in this study . this study included aneurysms ( n=14 ) , avm ( n=4 ) , cm ( n=3 ) , and a control group ( n=5 ) .
three cases were placed in the frontal lobe , and one was placed in the cerebellum .
their mean size was measured at 27.4 mm ranging in size from 12.7 to 44.9 mm .
three cases of cm , which were located in the temporal lobe ( n=2 ) and pons ( n=1 ) were enrolled .
their mean size was measured at 19.9 mm ranging in size from 11.0 to 30.6 mm ( table 1 ) .
the kruskal - wallis test showed that the optical density of crabp - i was significantly different among the three groups ( sah , 0.330.09 ; uia , 0.120.01 ; control group , 0.100.01 ; p= 0.004 ) .
the mann - whitney u test revealed that the optical density in sah in a ruptured aneurysm was significantly higher than that in uia ( p=0.033 ) or the control group ( p=0.012 ) .
there was no significant crabp - i difference between the uia and control group ( p=0.447 ) ( fig .
2 ) . the hemorrhage presenting avm ( mean 0.45 , range 0.30 - 0.59 ) had a higher crabp - i level than that in avm without hemorrhage presentation ( mean 0.16 , range 0.14 - 0.17 ) .
two cases of cm with and one case without hemorrhage presentation had crabp - i optical densities measured at 0.21 and 0.31 and 0.14 , respectively ( table 1 ) .
we also measured the crabp - i intensity between the two groups based on the presence of hemorrhage presentation in all enrolled patients with an aneurysm , avm and cm .
the hemorrhage presenting group ( n=11 , 0.340.06 ) had a significantly higher crabp - i intensity than that of the non - hemorrhage presenting group ( n=10 , 0.130.01 ) ( p=0.001 ) .
our preliminary results showed that the elevation of crabp - i in the csf could be related to an aneurysmal rupture . although no statistical analysis was done for vascular malformations due to the small number of enrolled cases , vascular malformation with presentation of hemorrhage appears to have a higher crabp - i level than that in vascular malformation without hemorrhage presentation .
overall , the hemorrhage presenting cerebrovascular disease group had a higher crabp - i level than that of the non - hemorrhage group . because vascular smc is not a terminated differentiated phenotype , smc development and differentiation can be modulated by various factors during the process for aneurysm formation and rupture
. a decrease in the number of smcs by apoptosis has been suggested in aneurysm formation in a rat model13 ) .
bygglin et al.6 ) reported on two major proteins of -sma and calponin and expressed prolyl-4-hydroxylase in typical cultured smcs from a human intracranial aneurysm .
they thought that smcs with a synthetic phenotype in response to arterial wall injury could attribute to aneurysm formation .
mmp-2 secreted from migrating smcs can result in elastic degradation , and it could cause an aneurysmal rupture22 ) .
kilic et al.11 ) suspected that aneurysmal rupture could be related to a rise in the ratio of fibronectin to laminin .
they thought that fibronectin , which is abundant in immature vessels , could contribute to the improper contractility of the aneurysm wall , which appeared to be more prone to rupture5,11 ) .
neuville et al.15 ) reported that atra modulates the proliferation and migration of smcs and -sma expression . in that study ,
atra treatment showed an inhibition of dna synthesis in intimal smcs and proliferation of intimal and medial smcs . additionally , increased cell migration of intimal and medial smcs
axel et al.2 ) showed a decrease in mrna - expression of the fibronectin and an increase in -sma and myosin heavy chain formation after atra treatment in human vascular smcs .
in addition , the synthesis of mmp-2 was partially inhibited by a high dose of atra treatment .
these observations suggested that the retinoic acid signaling pathway could be related to the vulnerability of the aneurysm wall through a remodeling pathway of the smc and ecm .
boylan and gudas4 ) reported that a higher crabp - i level facilitates the metabolic rate of retinoic acid by interaction with degradative enzyme cytochrome p450 hydroxylase a1 .
accordingly , retinoic acid which interacts with rars to activate retinoic acid signaling can be deceased in the presence of a higher crabp - i level , which lessens the inhibitory effect of retinoic acid on growth factors and cytokines for vascular smcs .
kim et al.12 ) suggested highly expressed crabp - i as a possible candidate for pediatric mmd through inhibition of retinoic acid . beyond atra 's effect on vascular smcs
accordingly , crabp - i could contribute to disorganized vascular walls through altered structural and adhesive proteins of ecm which could make the arterial walls vulnerable to hemodynamic stress .
axel et al.2 ) thought that atra seems to stimulate structural ecm protein such as collagen and elastin but inhibits adhesive proteins of fibronectin and thrombospondin-1 .
accordingly , long - lasting expression of fibronectin during arterial wall remodeling3 ) could be related with dysmorphic vessel formation secondary to inhibition of retinoic acid by crabp - i ( fig .
uranishi et al.19 ) reported various stages of smc differentiation in avm , cm and normal control brain . -sma and
myosin heavy chain were universally expressed in avm , but the contractile property was less in avm compared with the normal and control brains .
approximately 85% of small cm and 97% of large cm showed -sma expression in the subendothelial layer .
smoothelin , which is a marker of smcs with a contractile phenotype20 ) , was significantly more expressed in the control brain ( 40.9% ) than in avm ( 21.9% ) or cm ( 0% ) .
cm showed more expression of fibronectin and basic fibroblast growth factor in the endothelium than in avm10 ) .
these observations could imply that abnormal smc differentiation and endothelial dysfunction could relate fragile vessel formation vulnerable to hemodynamic stress in vascular malformation .
the association between retinoic acid and pathogenesis and its role in hemorrhage presentation in vascular malformation are not well understood . in our pilot study ,
the mean optical density of crabp - i in avm with hemorrhage presentation was higher than that in avm without hemorrhage presentation .
in addition , cm with hemorrhage presentation had a higher crabp - i optical density than that of cm without hemorrhage presentation .
accordingly , abnormal smc differentiation through an inhibition of retinoic acid by crabp - i could be related to hemorrhage development .
therefore , studies on the relationship between retinoic acid and vascular malformation and the crabp - i difference according to presenting symptoms are needed further .
the possibility of elevated crabp - i as a result of hemorrhage could be a concern .
to the best of our knowledge , an association between crabp - i and intracranial hemorrhage has not been reported .
in addition , we got the csf sample from the cistern of lamina terminalis during first aneurysm surgery or sylvian cistern during second surgery for concomitant unruptured aneurysm to avoid blood contamination . accordingly , concern over the correlation between crabp - i and hemorrhage can be reduced .
, further study will be required to verify the relationship between crabp - i and hemorrhage development in a large number of patients with aneurysm and vascular malformation .
second , we can not suggest a more precise mechanism of crabp - i in hemorrhagic cerebrovascular diseases different from that in mmd .
therefore , a study on the role of crabp - i in the pathogenesis of arterial wall remodeling is required at the molecular level .
this pilot study showed that elevated crabp - i in the csf could be related to the occurrence of an aneurysm rupture .
moreover , a higher crabp - i level in the csf seems to be associated with the presentation of hemorrhage in patients with vascular malformation . | objectiveelevated cellular retinoic acid binding protein - i ( crabp - i ) is thought to be related to the abnormal proliferation and migration of smooth muscle cells ( smcs ) .
accordingly , a higher crabp - i level could cause disorganized vessel walls by causing immature smc phenotypes and altering extracellular matrix proteins which could result in vulnerable arterial walls with inadequate responses to hemodynamic stress .
we hypothesized that elevated crabp - i level in the cerebrospinal fluid ( csf ) could be related to subarachnoid hemorrhage ( sah ) .
moreover , we also extended this hypothesis in patients with vascular malformation according to the presence of hemorrhage.methodswe investigated the csf of 26 patients : sah , n=7 ; unruptured intracranial aneurysm ( uia ) , n=7 ; arteriovenous malformation ( avm ) , n=4 ; cavernous malformation ( cm ) , n=3 ; control group , n=5 .
the optical density of crabp - i was confirmed by western blotting and presented as meanstandard error of the measurement.resultscrabp-i in sah ( 0.330.09 ) was significantly higher than that in the uia ( 0.120.01 , p=0.033 ) or control group ( 0.100.01 , p=0.012 ) .
hemorrhage presenting avm ( mean 0.45 , ranged 0.30 - 0.59 ) had a higher crabp - i level than that in avm without hemorrhage presentation ( mean 0.16 , ranged 0.14 - 0.17 ) .
the crabp - i intensity in cm with hemorrhage was 0.21 and 0.31 , and for cm without hemorrhage 0.14 .
overall , the hemorrhage presenting group ( n=11 , 0.340.06 ) showed a significantly higher crabp - i intensity than that of the non - hemorrhage presenting group ( n=10 , 0.130.01 , p=0.001).conclusionthe results suggest that elevated crabp - i in the csf could be related with aneurysm rupture .
additionally , a higher crabp - i level seems to be associated with hemorrhage development in vascular malformation . | INTRODUCTION
MATERIALS AND METHODS
Patients sample
CSF sample collection and measurement of CRABP-I
Statistical analysis
RESULTS
Enrolled patients
Comparison of CRABP-I according to the presence of hemorrhage
DISCUSSION
CONCLUSION |
the methods of the original study from which these data were acquired have been previously published ( 10 ) .
briefly , 50 nursing homes with > 100 beds in four provinces ( ontario , manitoba , alberta , saskatchewan ) and four states ( minnesota , michigan , north dakota , montana ) were enrolled in the study . during a 12-month period , residents treated with systemic antimicrobial drugs were identified , and antimicrobial prescriptions were recorded , including name , dose , and duration .
infection control practitioners from each facility recorded the name and antimicrobial - susceptibility patterns of all clinical bacterial cultures obtained from study residents .
susceptibility testing was performed by using methods recommended by the national committee for clinical laboratory standards ( nccls ) .
complete information on all clinical bacterial cultures sent for testing from each home was obtained .
these clinical isolates were obtained for diagnostic purposes among residents in the nursing homes . to minimize biased sampling ,
none of the homes at the time of study collected bacterial specimens from residents for surveillance purposes only .
a survey was performed before the study to ensure that laboratories adhered to nccls methods .
infection control practitioners from each facility recorded the name and antimicrobial - susceptibility patterns of all clinical bacterial cultures obtained from study residents .
data recorded for each nursing home included the following : number of resident beds ; staffing levels ( registered and nonregistered nursing staff hours , healthcare aide hours , infection control practitioner hours , physicians hours , and access to an infectious disease specialist ) ; infrastructure for hygiene facilities ( number of showers and tubs per facility and sinks per 100 resident beds ) ; percentage of residents with intravenous catheters , urinary catheters , and gastrostomy tubes ; percentage of residents that were either wheelchair or bed bound ; and information on recent acute - care stay ( new admissions and returns ) .
the study population was drawn from the fixed cohort of nursing home residents used in the original study . only those residents with clinical isolates of enterobacteriaceae resistant or susceptible to third - generation cephalosporins were eligible to be case - residents and controls in this analysis .
case - residents were defined as nursing home residents in whom a clinical enterobacteriaceae isolate resistant to third - generation cephalosporins was detected . for each case - resident
, we randomly selected three control - residents from those residents in whom clinical isolates of enterobacteriaceae sensitive to third - generation cephalosporins were obtained .
since repeat isolates may not represent independent events , we assessed only the first clinical isolate obtained from each resident ( case - residents and control - residents ) .
data were collected at the individual - resident level regarding prior antimicrobial drug use and antimicrobial drug resistance and susceptibility of bacterial isolates .
total antimicrobial drug use , use of any cephalosporins , use of third - generation cephalosporins , use of fluoroquinolone , and use of trimethoprim - sulfamethoxazole were recorded .
covariates were defined as those variables collected at the level of the nursing home , including staffing and patient and facility characteristics .
we sought to compare antimicrobial drug exposures in nursing home residents from whom enterobacteriaceae resistant to third - generation cephalosporins were isolated to antimicrobial drug exposures in nursing home residents from whom susceptible enterobacteriaceae cultures were obtained .
antimicrobial drug exposure was measured in the 10 weeks before resistant bacteria were detected in residents and was compared to antimicrobial drug exposure during a 10-week interval in residents with susceptible organisms . in the absence of any evidence defining an optimal period for assessment of antimicrobial drug exposures ,
10 weeks was selected by consensus opinion of five infectious disease specialists with research expertise in the field of antimicrobial drug resistance .
this strategy was used because all microbial variables , despite log transformation , were highly skewed .
odds ratios were calculated , representing the risk of nursing home residents having antimicrobial drug resistant clinical isolates compared to antimicrobial drug susceptible organisms . to assess for the possible effect of clustering for facility - level variables ,
univariate analyses were also performed with logistic regression with random factors ( logistic - binomial model ) ( egret 2.031 , cytel software corp . , cambridge , ma ) and compared with a logistic regression model in which the factors are fixed ( spss 10.0 , spss inc . , chicago , il ) .
a multivariable model was constructed in which variables with a p value < 0.25 and variables representing the various antimicrobial drugs were selected for inclusion , and the final multivariable model was constructed by using a backwards , stepwise approach . all data entry was performed with sas version 6.0 and 7.0 ( sas institute , cary , nc ) .
the hosmer and lemeshow test was performed to evaluate the overall fit of the model ( 11 ) .
the methods of the original study from which these data were acquired have been previously published ( 10 ) .
briefly , 50 nursing homes with > 100 beds in four provinces ( ontario , manitoba , alberta , saskatchewan ) and four states ( minnesota , michigan , north dakota , montana ) were enrolled in the study . during a 12-month period , residents treated with systemic antimicrobial drugs were identified , and antimicrobial prescriptions were recorded , including name , dose , and duration .
infection control practitioners from each facility recorded the name and antimicrobial - susceptibility patterns of all clinical bacterial cultures obtained from study residents .
susceptibility testing was performed by using methods recommended by the national committee for clinical laboratory standards ( nccls ) .
complete information on all clinical bacterial cultures sent for testing from each home was obtained .
these clinical isolates were obtained for diagnostic purposes among residents in the nursing homes . to minimize biased sampling ,
none of the homes at the time of study collected bacterial specimens from residents for surveillance purposes only .
a survey was performed before the study to ensure that laboratories adhered to nccls methods .
infection control practitioners from each facility recorded the name and antimicrobial - susceptibility patterns of all clinical bacterial cultures obtained from study residents .
data recorded for each nursing home included the following : number of resident beds ; staffing levels ( registered and nonregistered nursing staff hours , healthcare aide hours , infection control practitioner hours , physicians hours , and access to an infectious disease specialist ) ; infrastructure for hygiene facilities ( number of showers and tubs per facility and sinks per 100 resident beds ) ; percentage of residents with intravenous catheters , urinary catheters , and gastrostomy tubes ; percentage of residents that were either wheelchair or bed bound ; and information on recent acute - care stay ( new admissions and returns ) .
the study population was drawn from the fixed cohort of nursing home residents used in the original study . only those residents with clinical isolates of enterobacteriaceae resistant or susceptible to third - generation cephalosporins were eligible to be case - residents and controls in this analysis .
case - residents were defined as nursing home residents in whom a clinical enterobacteriaceae isolate resistant to third - generation cephalosporins was detected . for each case - resident
, we randomly selected three control - residents from those residents in whom clinical isolates of enterobacteriaceae sensitive to third - generation cephalosporins were obtained .
since repeat isolates may not represent independent events , we assessed only the first clinical isolate obtained from each resident ( case - residents and control - residents ) .
data were collected at the individual - resident level regarding prior antimicrobial drug use and antimicrobial drug resistance and susceptibility of bacterial isolates .
total antimicrobial drug use , use of any cephalosporins , use of third - generation cephalosporins , use of fluoroquinolone , and use of trimethoprim - sulfamethoxazole were recorded .
covariates were defined as those variables collected at the level of the nursing home , including staffing and patient and facility characteristics .
we sought to compare antimicrobial drug exposures in nursing home residents from whom enterobacteriaceae resistant to third - generation cephalosporins were isolated to antimicrobial drug exposures in nursing home residents from whom susceptible enterobacteriaceae cultures were obtained .
antimicrobial drug exposure was measured in the 10 weeks before resistant bacteria were detected in residents and was compared to antimicrobial drug exposure during a 10-week interval in residents with susceptible organisms . in the absence of any evidence defining an optimal period for assessment of antimicrobial drug exposures ,
10 weeks was selected by consensus opinion of five infectious disease specialists with research expertise in the field of antimicrobial drug resistance .
this strategy was used because all microbial variables , despite log transformation , were highly skewed .
odds ratios were calculated , representing the risk of nursing home residents having antimicrobial drug resistant clinical isolates compared to antimicrobial drug susceptible organisms . to assess for the possible effect of clustering for facility - level variables ,
univariate analyses were also performed with logistic regression with random factors ( logistic - binomial model ) ( egret 2.031 , cytel software corp . , cambridge , ma ) and compared with a logistic regression model in which the factors are fixed ( spss 10.0 , spss inc .
a multivariable model was constructed in which variables with a p value < 0.25 and variables representing the various antimicrobial drugs were selected for inclusion , and the final multivariable model was constructed by using a backwards , stepwise approach . all data entry was performed with sas version 6.0 and 7.0 ( sas institute , cary , nc ) .
the hosmer and lemeshow test was performed to evaluate the overall fit of the model ( 11 ) .
twenty - nine case - residents were identified , and 87 control - residents were initially selected from 26 nursing homes . because of organizational changes in one nursing home during the course of the study , no covariate data could be obtained . since
such group - level data could not be imputed , all participants selected from this particular home were dropped from the analysis .
this included two case - residents and two control - residents . ignoring the missing group - level variables and including these residents in the analysis on the basis of their individual - level variables made no difference in the estimates
the distribution of types of enterobacteriaceae among case - residents and control - residents is shown in table 1
. a greater proportion of citrobacter and enterobacter species were identified in samples from case - residents compared to samples from control - residents ( p = 0.01 for each ) , and a greater proportion of e. coli isolates were identified in samples from control - residents compared to samples from case - residents ( p = 0.01 ) .
most clinical specimens were isolated from urine samples , and a greater proportion of urine isolates were detected in specimens from control - residents as compared to case - residents ( p = 0.05 ) ( table 2 ) .
univariate analyses of individual - level exposures and facility - level exposures are shown in tables 3 and 4 .
the following variables were considered in the multivariable model : prior exposure to any antimicrobial drug , to a cephalosporin , to a third - generation cephalosporin , to a fluoroquinolone , or to trimethoprim - sulfamethoxazole ; the log number of primary care physician hours per 100 resident beds ; whether an infectious disease physician was on staff ; the number of new admissions from acute care hospitals within the last year per 100 resident beds ; and the log percentage of residents in the nursing home with a gastrostomy tube .
10 weeks before date of confirmed enterobacteriaceae infection . or , odds ratio ; ci , confidence interval . or , odds ratio ; ci , confidence interval ; fte , full - time equivalent ; rn , registered nurse ; na , nursing aide ; icp , infection control practitioner .
the only variables that remained significant after multivariable modeling were prior use of any cephalosporin ( odds ratio [ or ] 4.0 , 95% confidence interval [ ci ] 1.2 to 13.6 , p = 0.029 ) , and log percentage of residents with a gastrostomy tube ( or 3.9 , 95% ci 1.3 to 12.0 , p = 0.016 ) .
the p value obtained for the hosmer and lemeshow test was 0.138 , which suggests that the overall fit of this model is reasonable .
enterobacteriaceae infections resistant to cephalosporins are of concern in long - term care facilities and in the acute - care setting ( 19 ) .
patients with infections resistant to third - generation cephalosporins have been reported to have had longer hospital stays , higher death rates , and greater hospital costs than patients whose infections are susceptible to third - generation cephalosporins ( 4 ) .
a survey of infection control practitioners in ontario showed that no standard approach exists to dealing with esbl - producing e. coli and klebsiella spp . in long - term - care facilities
reservoirs of resistant enterobacteriaceae species will continue to emerge in this setting despite implementation of control measures .
our findings show that recent exposure to any cephalosporin is associated with the isolation of third - generation cephalosporin
few studies have assessed risk factors for enterobacteriaceae resistance to cephalosporins in long - term - care facilities .
weiner et al . described an outbreak of ceftazidime - resistant e. coli infections in chicago nursing homes ( 2 ) .
those researchers conducted a case - control study and found that ciprofloxacin or trimethoprim - sulfamethoxazole exposure was associated with ceftazidime - resistant e. coli in nursing home residents .
cephalosporin treatment may have been given after fluoroquinolone resistance was detected , and this treatment may be linked to cephalosporin resistance found in their study .
muder et al . evaluated modifiable risk factors for antimicrobial drug resistant enterobacteriaceae infection among patients from a long - term veterans affairs facility in pittsburgh ( 13 ) . in this case - control study ,
patient debility , age , coexisting conditions , and prior antimicrobial therapy were examined as risk factors associated with multidrug - resistant enterobacteriaceae infections .
case - patients were identified as having an enterobacteriaceae infection resistant to two of the following groups of antimicrobial drugs : piperacillin , third - generation cephalosporins , or gentamicin .
only a pressure ulcer [ or 12.2 , 95% ci 3.3 to 44.2 ] and prior ampicillin therapy [ or 13.7 , 95% ci 2.2 to 84.0 ] were associated with resistant enterobacteriaceae infection .
no association was found between prior cephalosporin therapy and a multiple - resistant infection , but whether prior cephalosporin therapy and the acquisition of cephalosporin - resistant infections are linked is unknown . a similar study performed previously by this group identified exposure to ciprofloxacin as a risk factor for the acquisition of ciprofloxacin - resistant gram - negative bacteria ( 14 ) .
our findings confirm that patient debility and prior antimicrobial drug therapy are associated with acquisition of resistant bacteria . in the acute - care setting , similar risk factors for the acquisition of broad - spectrum cephalosporin - resistant enterobacteriaceae have been recognized ( 1519 ) .
the risk of acquiring multidrug - resistant bacterial infection has been reported as increasing in hospitalized patients with prior third - generation cephalosporin therapy ( 6,18,19 ) . a hospital - based case - control study performed in argentina examined risk factors for ceftazidime - resistant k. pneumoniae .
prior antimicrobial drug use was associated with acquisition of this type of resistant infection [ adjusted or 6.21 , 95% ci 1.20 to 32.01 ] .
other risk factors found were prior use of ciprofloxacin , nosocomial infection , and hospitalization stay > 6 days ( 15 ) .
bisson et al . also looked at risk factors for acquisition of esbl - producing klebsiella spp . and
e. coli in which patients with this resistance pattern were compared to patients with no culture exhibiting this resistance pattern ( 16 ) .
prior receipt of antimicrobial therapy was not associated with colonization in these patients , but none were exposed to third - generation cephalosporins . since our study was set in long - term - care facilities and because individual measurements were not done , length of stay was not assessed .
lin et al . performed a case - control study evaluating risk factors for esbl producing k. pneumoniae among hospital patients in taiwan ( 17 ) .
prior use of ceftazidime was found to be associated with esbl - producing k. pneumoniae infection compared to non - esbl - producing k. pneumoniae infection . a case - control study by bonomo et al . did not find an association between fecal colonization of cefotaxime - resistant gram - negative bacilli and antimicrobial drug use 4 weeks before admission to the hospital ( 20 ) .
comparison of antimicrobial drug - sensitive organisms to antimicrobial drug - resistant organisms can not infer absolute risk for exposure to that antimicrobial drug ( 21,22 ) .
however , lipsitch has discussed several advantages of calculating conditional or ( orc ) versus simple or ( ors ) when interpreting associations between antimicrobial drug use and resistant organisms ( 23 ) .
ors determines a patient s individual risk of acquiring a resistant infection after receiving treatment compared to not getting an infection after receiving treatment .
orc determines the risk of a resistant infection compared to the risk of a nonresistant infection , which allows for insight into whether a suspect infection in a patient is more likely to be resistant to a particular antimicrobial drug compared to someone who has not been treated ( 23 ) .
widespread treatment with antimicrobial drugs promotes the eradication of antimicrobial - susceptible organisms but also confers a selective advantage for developing antimicrobial - resistant organisms .
measuring orc may even be more useful for clinicians than knowing the absolute risk because it gives information about the community - level risk of having a resistant organism compared to a susceptible organism in persons with a particular recent antimicrobial drug history ( 23 ) .
making this comparison is useful for clinicians who are evaluating the odds of a patient s being infected with a resistant organism .
in addition to antimicrobial drug exposure , the percentage of residents with gastrostomy tubes in the home was also found to predict enterobacteriaceae infection resistant to third - generation cephalosporins . in this analysis ,
percentage of gastrostomy tubes among home residents served as a proxy for generalized debility within each nursing home , and our findings suggest that more debilitated patients may be more predisposed to acquiring resistant organisms .
debilitated patients are most likely to harbor resistant organisms ( 24 ) . since we do not know the strain of resistant bacteria applicable to each patient
, we can not infer with certainty that a gastrostomy tube in a nursing home resident is a risk factor for this type of resistant infection . however , weiner et al .
identified gastrostomy tube use at the patient - level as a risk factor for acquiring resistant enterobacteriaceae ( 2 ) .
infections directly associated with gastrostomy tube contamination , resulting in antimicrobial treatment or hospitalization ( 25,26 ) , have also been reported , . however , since gastrostomy tube sites were not systematically tested in this study , this finding can not be inferred .
strengths of this study are that residents were drawn from a large number of nursing homes in both canada and the united states , exposures at both the individual and aggregate levels were examined , and a wide range of variables were considered , including staffing and infrastructure for hand hygiene .
our study has some limitations , including the following : the date of actual acquisition of resistant bacteria is not known ; we only examined clinical isolates , obtained for diagnostic purposes , which may have led to a sampling bias ; and individual level coexisting conditions were not measured .
given the large size of the original study , measuring coexisting conditions was not feasible .
another limitation is that facilities with higher levels of resistant bacteria among residents may obtain more clinical specimens ( or vice versa ) , which may have led to bias in the sample used .
cross - infection within a facility could not be assessed because of lack of molecular typing of isolates .
admissions and readmissions to acute - care facilities within the last year were not identified as risk factors for infection with enterobacteriaceae resistant to third - generation cephalosporins .
the 12-month period may have been too long , but a significant association may have been identified with a 3-month period . in conclusion ,
prior exposure to cephalosporins and an increased use of gastrostomy tubes among nursing home residents predicts for infection with enterobacteriaceae resistance to third - generation cephalosporins . | limited data identify the risk factors for infection with enterobacteriaceae resistant to third - generation cephalosporins among residents of long - term - care facilities . using a nested case - control study design , nursing home residents with clinical isolates of enterobacteriaceae resistant to third - generation cephalosporins
were compared to residents with isolates of enterobacteriaceae susceptible to third - generation cephalosporins .
data were collected on antimicrobial drug exposure 10 weeks before detection of the isolates , facility - level demographics , hygiene facilities , and staffing levels .
logistic regression models were built to adjust for confounding variables .
twenty - seven case - residents were identified and compared to 85 controls .
exposure to any cephalosporin ( adjusted odds ratio [ or ] 4.0 , 95% confidence interval [ ci ] 1.2 to13.6 ) and log percentage of residents using gastrostomy tubes within the nursing home ( adjusted or 3.9 , 95% ci 1.3 to 12.0 ) were associated with having a clinical isolate resistant to third - generation cephalosporins . | Materials and Methods
Study Design
Case Definition
Statistical Analysis
Results
Discussion |
the group was composed of consecutive patients reporting to the department of endocrinology because of pcos and/or weight excess and of healthy nonhyperandrogenic nonobese volunteers recruited from the staff of hospital universitario ramn y cajal .
women were classified according to their bmi into obese ( bmi 30 kg / m , n = 128 ) and nonobese ( bmi < 30 kg / m , n = 129 ) subgroups .
pcos was diagnosed in 149 women presenting with clinical and/or biochemical hyperandrogenism in addition to oligo - ovulation as reported previously ( 9 ) , thereby fulfilling all of the current definitions of the syndrome ( 1012 ) , whereas 108 women showed no sign of hyperandrogenism , had normal androgen levels , and had regular ovulatory menstrual cycles .
menstrual and ovulatory dysfunction were defined by the presence of oligomenorrhea ( cycles longer than 35 days ) or amenorrhea ( absence of menstrual bleeding for at least three usual cycle lengths ) or , in women presenting with regular menstrual cycles ( cycles between 26 and 35 days ) , by lack of ovulation according to body temperature charts and/or serum progesterone levels
< 12.7 nmol / l during the luteal phase of the menstrual cycle ( 9 ) .
none of the women had a personal history of hypertension , diabetes , or cardiovascular events .
women who took oral contraceptives , antiandrogens , insulin sensitizers , iron supplements , or drugs that might interfere with blood pressure regulation , lipid profile , or carbohydrate metabolism within the previous 6 months or who were referred for any medical reason aside from androgen and/or weight excess were automatically excluded . written informed consent was obtained from all of the participants , and the study was approved by the ethics committee of hospital universitario ramn y cajal .
clinical and anthropometric variables , including the hirsutism score , bmi , waist circumference , and waist - to - hip ratio ( whr ) were determined .
whr was calculated by dividing the minimal waist circumference by the hip circumference at the level of the greater trochanters , using a nonstretchable measuring tape .
whole blood , serum , and plasma samples were obtained between days 5 and 10 of the menstrual cycle , or during amenorrhea after pregnancy was excluded . after a 3-day 300-g carbohydrate diet and 12-h
overnight fasting , samples were obtained early in the morning for the measurement of total testosterone , sex hormone binding globulin , 17-hydroxyprogesterone , androstenedione , dehydroepiandrosterone sulfate , luteinizing hormone , follicle - stimulating hormone , estradiol , thyrotropin , and prolactin .
then , a 75-g oral glucose tolerance test was performed , and samples were obtained for measurement of serum insulin and plasma glucose at 0 , 30 , 60 , 90 , and 120 min .
samples were immediately centrifuged , and serum and plasma were separated and frozen at 20c until assayed .
the assays used for these measurements have been described in detail elsewhere ( 9 ) .
free testosterone concentrations were calculated from total testosterone and sex hormone binding globulin levels ( 9 ) .
serum ferritin and c - reactive protein ( crp ) concentrations were measured by automated immunochemiluminescence ( immulite 2000 ferritin and high sensitivity crp ; diagnostic products corporation , los angeles , ca ) with lower limits of detection of 0.88 pmol / l and 0.1 mg / l , respectively , and intra- and interassay coefficients of variation < 10% .
the circulating concentrations of haptoglobin were assayed by a commercial immunonephelometry method ( dade behring , marburg , germany ) , calibrated against the international crm 470 reference material .
the composite insulin sensitivity index was calculated from circulating glucose and insulin concentrations during the oral glucose tolerance test as described by matsuda and defronzo ( 13 ) .
disorders of glucose tolerance were diagnosed following the recommendations of the american diabetes association ( 14 ) .
genomic dna was obtained from whole blood samples using a nucleon bacc3 dna isolation kit ( amersham , buckinghamshire , u.k . ) and was used to genotype several polymorphisms related to inflammation or oxidative stress that had been previously found to be associated with metabolic disorders such as pcos , obesity , diabetes , and insulin resistance and variants involved in iron metabolism .
genotyping of the dinucleotide ca repeat in intron 8 of the interleukin ( il)-6 receptor- ( il6r ) locus ( rs57636717 ) was performed by pcr using a fluorescently labeled forward primer ( 15 ) .
amplified fragments were resolved by capillary electrophoresis on an abi prism 3100 automated genetic analyzer ( applied biosystems , foster city , ca ) , and their sizes were determined using genemapper 4.0 software .
we detected 13 different alleles with sizes ranging from 143 to 169 bp , of which the 149-bp allele was the most frequent .
for statistical analyses , subjects were genotyped as homozygous for 149-bp alleles , heterozygous for 149-bp alleles , and noncarriers of any 149-bp allele ( 15 ) .
restriction fragment length polymorphism as described previously : variants his63asp ( c.187c > g ) and cys282tyr ( c.845g > a ) in exons 2 and 4 ( rs1799945 and rs1800562 , respectively ) of the hfe gene ( 7 ) ; polymorphism 308g > a ( rs1800629 ) in the promoter of the tumor necrosis factor ( tnf)- ( tnf ) gene ( 16 ) ; variant met196arg ( c.587t > g ; rs1061622 ) in exon 6 of the tnf receptor 2 ( tnfrsf1b ) gene ( 17 ) ; polymorphism 174g > c ( rs1800795 ) in the il-6 gene promoter ( 18 ) ; variant gly148arg ( c.442g > c ; rs2228044 ) in exon 5 of the il-6 signal transducer ( il6st ) gene ( 15 ) ; and polymorphism 108c > t ( rs705379 ) in the paraoxonase ( pon1 ) gene ( 19 ) .
logarithmic or square - root transformations were applied as needed to ensure normal distribution of the variables .
univariate general linear models were used to evaluate the influence of obesity , pcos , and glucose tolerance on clinical and biochemical variables , with introduction of age as a covariate to control for possible age differences among the groups .
a multivariate linear regression analysis was used to determine the influence of clinical , biochemical , metabolic , and genetic variants on the logarithm of serum ferritin concentrations as described below .
depending on the median of the whole population of premenopausal women , serum ferritin levels were categorized into values below , or equal to or above , the median value .
the associations of these two groups with categorical and continuous variables were analyzed by and fisher 's exact tests as appropriate .
genomic dna was obtained from whole blood samples using a nucleon bacc3 dna isolation kit ( amersham , buckinghamshire , u.k . ) and was used to genotype several polymorphisms related to inflammation or oxidative stress that had been previously found to be associated with metabolic disorders such as pcos , obesity , diabetes , and insulin resistance and variants involved in iron metabolism .
genotyping of the dinucleotide ca repeat in intron 8 of the interleukin ( il)-6 receptor- ( il6r ) locus ( rs57636717 ) was performed by pcr using a fluorescently labeled forward primer ( 15 ) .
amplified fragments were resolved by capillary electrophoresis on an abi prism 3100 automated genetic analyzer ( applied biosystems , foster city , ca ) , and their sizes were determined using genemapper 4.0 software .
we detected 13 different alleles with sizes ranging from 143 to 169 bp , of which the 149-bp allele was the most frequent .
for statistical analyses , subjects were genotyped as homozygous for 149-bp alleles , heterozygous for 149-bp alleles , and noncarriers of any 149-bp allele ( 15 ) .
restriction fragment length polymorphism as described previously : variants his63asp ( c.187c > g ) and cys282tyr ( c.845g > a ) in exons 2 and 4 ( rs1799945 and rs1800562 , respectively ) of the hfe gene ( 7 ) ; polymorphism 308g > a ( rs1800629 ) in the promoter of the tumor necrosis factor ( tnf)- ( tnf ) gene ( 16 ) ; variant met196arg ( c.587t > g ; rs1061622 ) in exon 6 of the tnf receptor 2 ( tnfrsf1b ) gene ( 17 ) ; polymorphism 174g > c ( rs1800795 ) in the il-6 gene promoter ( 18 ) ; variant gly148arg ( c.442g > c ; rs2228044 ) in exon 5 of the il-6 signal transducer ( il6st ) gene ( 15 ) ; and polymorphism 108c > t ( rs705379 ) in the paraoxonase ( pon1 ) gene ( 19 ) .
logarithmic or square - root transformations were applied as needed to ensure normal distribution of the variables .
univariate general linear models were used to evaluate the influence of obesity , pcos , and glucose tolerance on clinical and biochemical variables , with introduction of age as a covariate to control for possible age differences among the groups .
a multivariate linear regression analysis was used to determine the influence of clinical , biochemical , metabolic , and genetic variants on the logarithm of serum ferritin concentrations as described below .
depending on the median of the whole population of premenopausal women , serum ferritin levels were categorized into values below , or equal to or above , the median value .
the associations of these two groups with categorical and continuous variables were analyzed by and fisher 's exact tests as appropriate .
the influence of pcos and of obesity on clinical and biochemical variables is summarized in table 1 .
because patients with pcos were younger than nonhyperandrogenic women and obese women were older than nonobese women , the influence of age was controlled by introducing this variable as a covariate in the comparisons described below .
influence of obesity and pcos on clinical and biochemical variables of premenopausal women data are means sd or raw numbers ( % ) .
continuous data were used for univariate general linear models and , because age was different between patients with pcos and nonhyperandrogenic women and between obese and nonobese women , age was introduced as a covariate in the analysis of all the other variables .
patients with pcos had increased serum androgen and luteinizing hormone levels and decreased estradiol concentrations and were insulin resistant and had increased whr compared with their nonhyperandrogenic counterparts irrespective of obesity .
obesity was characterized by increased indexes of insulin resistance , increased frequency of abnormalities in glucose tolerance , and increased serum crp , haptoglobin , and free testosterone levels compared with those in nonobese women , both in patients with pcos and in nonhyperandrogenic women .
patients with pcos presented with increased serum ferritin levels compared with those in nonhyperandrogenic women . when considered as a whole , women presenting with abnormal glucose tolerance had higher serum ferritin concentrations compared with those showing normal glucose values during fasting and after an oral glucose tolerance test . of note , these results occurred both in the nonobese and in the obese subgroups , and obesity did not influence serum ferritin concentrations after controlling for both pcos and glucose tolerance ( fig .
serum ferritin levels depending on the presence or absence of abnormalities of glucose tolerance and pcos in nonobese and obese women .
the box plot includes the median ( horizontal line ) and the interquartile range , and the whiskers indicate the minimum and maximum data values , unless outliers are present , in which case the whiskers extend to a maximum of 1.5 times the interquartile range .
the logarithm of serum ferritin levels was used in a general linear model in which glucose tolerance , pcos , and obesity were introduced as independent variables and age was introduced as a covariate to correct for the difference in age between patients and control subjects and between obese and nonobese women . no interaction was found among independent variables . * p = 0.001 between women presenting with or without abnormalities of glucose tolerance .
p = 0.034 between patients with pcos and nonhyperandrogenic control women . because serum ferritin levels were not distributed normally ,
their logarithm was introduced as a dependent variable in multiple linear regression models using age ; bmi ; glucose tolerance ( codified as normal or abnormal ) ; menstrual cycles ( codified as regular menstruation , oligomenorrhea , or amenorrhea ) ; serum free testosterone , crp , and haptoglobin levels ; the insulin sensitivity index ; and the genomic variants related to iron metabolism , inflammation , and oxidative stress as independent variables .
the model that considered all independent variables explained 22% of the variability in the logarithm of serum ferritin concentrations ( r = 0.22 , p < 0.0001 ) ( fig .
the squares are the standardized regression coefficients ( , the change in terms of sds in the dependent variable that results from a change of 1 sd in an independent variable ) , and the error bars indicate the 95% ci of . menstrual history and genomic variants were coded as dummy variables : regular menstruation was coded 0 , 1 was used for oligomenorrhea , and 2 was used for amenorrhea .
variants in tnf , tnfrsf1b , il6 , il6st , hfe , and pon1 loci were coded as 0 for homozygosity for wild - type alleles , 1 for heterozygosity , and 2 for homozygosity for mutant alleles .
the il6r polymorphism was coded 0 for homozygosity for 149-bp alleles , 1 for subjects carrying only one 149-bp allele , and 2 for subjects carrying two non149-bp alleles .
finally , hfe his63asp / cys282tyr double heterozygotes were coded 1 and subjects without double heterozygosity were coded 0 .
conversely , when the independent variables were introduced using a stepwise method ( probability to enter 0.05 ; probability to remove 0.10 ) , the model ( r = 0.18 , p < 0.0001 ) retained only menstrual dysfunction ( = 0.14 , p = 0.035 ) , serum free testosterone levels ( = 0.14 , p = 0.052 ) , insulin sensitivity index ( = 0.12 , p = 0.012 ) , his63asp variant in hfe ( = 0.16 , p = 0.008 ) , and abnormal glucose tolerance ( = 0.15 , p = 0.015 ) as significant predictors of the logarithm of serum ferritin levels , whereas all the other clinical , biochemical , and genomic variables were excluded ( fig .
, a similar stepwise regression method ( r = 0.17 , p < 0.0001 ) adjusted for age and bmi ( these variables were manually entered into the model ) retained only menstrual dysfunction ( = 0.18 , p = 0.003 ) , abnormal glucose tolerance ( = 0.17 , p = 0.013 ) , his63asp variant in hfe ( = 0.17 , p = 0.004 ) , and insulin sensitivity index ( = 0.15 , p = 0.031 ) as predictors of the logarithm of serum ferritin levels ( fig .
2 ) . when considering the median of the serum ferritin concentrations of the whole population ( 83 pmol / l ) as a cutoff value , premenopausal women presenting with a serum ferritin level above the median had an odds ratio ( or ) for abnormal glucose tolerance of 2.4 ( 95% ci 1.34.4 , = 7.420 , p = 0.009 ) and an or for pcos of 2.2 ( 1.33.7 , = 9.524 , p = 0.002 ) .
the metabolic consequences of iron overload are exemplified by the development of abnormalities of glucose tolerance in primary or secondary hemochromatosis
. however , less severe iron overload also plays an important role in the development of abnormalities in glucose tolerance ( 2 ) , as demonstrated by the improvement in insulin resistance and glucose tolerance in type 2 diabetic patients after the iron depletion achieved by repeated blood letting ( 20 ) or the higher insulin sensitivity associated with reduced iron stores in frequent blood donors from the general population ( 21 ) .
our present results demonstrate that serum ferritin levels , an accurate marker of body iron stores in the absence of acute inflammatory syndromes ( 2 ) , are also related to abnormal glucose tolerance in premenopausal women .
serum ferritin levels above the median were associated with a 2.4-fold or for presenting with abnormal glucose tolerance , and ferritin concentrations were clearly higher in women in whom fasting or postload glucose levels were above the normal range .
furthermore , our present results suggest that the body iron stores of premenopausal women are associated with several factors including menstrual dysfunction , insulin resistance , and the his63asp variant in hfe even after controlling for the difference in age among patients with pcos and nonhyperandrogenic control subjects and between obese and nonobese women .
we have reported previously , in a much smaller series , that body iron stores are increased in premenopausal women presenting with pcos and obesity and that these associations were independent of mutations in hfe and were not influenced by changes in markers of chronic inflammation ( 6,7 ) .
our present findings confirm that serum ferritin levels are increased in patients with pcos and that , accordingly , women presenting with serum ferritin levels above the median have a 2.2 or of having pcos . yet
when controlling for the presence or absence of abnormal glucose tolerance , the previously reported association with obesity disappears , suggesting that it is the increased prevalence of disordered glucose tolerance in obese women and not weight excess by itself that is responsible for increased body iron stores in these women .
according to the regression analyses presented here , menstrual dysfunction , increased androgen levels , and insulin resistance , together with the hfe his63asp variant and abnormal glucose tolerance , are among the strongest predictors of serum ferritin levels . on the contrary ,
these levels are not influenced by indexes of global or abdominal adiposity or by genomic variants related to chronic inflammation and oxidative stress .
therefore , it appears that androgen excess and insulin resistance , which are present in many patients with pcos , collaborate in increasing body iron stores in premenopausal women .
the effects of insulin resistance and hyperinsulinism on body iron stores might depend on a direct insulin stimulation of intestinal iron absorption by upregulating activity of hypoxia - inducible factor-1 and downregulating hepcidin expression ( 22,23 ) and may be counteracted in patients with pcos by administering insulin sensitizers ( 3 ) .
the effect of androgen excess on body iron stores might result from the well - known stimulatory effect of androgens on erythropoiesis , thereby increasing intestinal iron absorption ( 24 ) but may also result from the iron - sparing effect of reduced menstrual losses due to the chronic menstrual dysfunction of pcos .
this iron - sparing mechanism may take years to result in increased iron stores , explaining why regularization of menstrual bleeding in patients with pcos by administering antiandrogenic contraceptive pills for 6 months had no evident impact on serum ferritin levels in our previous report ( 3 ) .
our present results also suggest that the his63asp variant in hfe influences body iron stores in premenopausal women , in conceptual agreement with the partial loss of hfe function induced by this mutation in animal models , leading to a variable degree of hepatic iron loading ( 25 ) .
however , more importantly , the relatively strong association of increased serum ferritin levels with abnormal glucose tolerance raises the possibility that increased iron stores played some pathogenic role in the development of such metabolic derangements , given that progressive iron accumulation in the pancreas contributes to -cell dysfunction and abnormal glucose tolerance in syndromes of iron overload ( 8) . however , because association does not imply causality , this hypothesis is speculative . in summary ,
body iron stores , as reflected by serum ferritin concentrations , are interrelated with androgen excess , insulin resistance , and the his63asp variant in hfe in premenopausal women and are associated with the development of abnormal glucose tolerance in this particular population . | objectiveincreased serum ferritin levels and iron stores may be involved in the development of abnormal glucose tolerance in women presenting with obesity and/or polycystic ovary syndrome ( pcos ) .
we aimed to study the determinants of serum ferritin levels in premenopausal women among indexes of insulin resistance , adiposity , hyperandrogenism , and genotypes pertaining to inflammation , oxidative stress , and iron metabolism.research design and methodsa total of 257 premenopausal women , classified depending on the presence or absence of pcos , obesity , and/or abnormal glucose tolerance , underwent a complete metabolic evaluation , serum ferritin , haptoglobin , and c - reactive protein ( crp ) measurements , and genotyping for proinflammatory and prooxidant variants and mutations in the hfe gene.resultsserum ferritin concentrations were increased in women presenting with pcos and/or abnormal glucose tolerance , independent of obesity . a stepwise multivariate linear regression analysis ( r2 = 0.18 , p < 0.0001 ) retained menstrual dysfunction ( = 0.14 , p = 0.035 ) , free testosterone ( = 0.14 , p = 0.052 ) , insulin sensitivity index ( = 0.12 , p = 0.012 ) , the his63asp variant in hfe ( = 0.16 , p = 0.008 ) , and abnormal glucose tolerance ( = 0.15 , p = 0.015 ) as significant predictors of the logarithm of ferritin levels , whereas crp , haptoglobin , waist - to - hip ratio , or variants in the tnf , tnfrsf1b ,
il6 , il6st , il6r , pon1 , and hfe cys282tyr mutation exerted no influence.conclusionsandrogen excess ( partly because of hyperandrogenemia and partly because of menstrual dysfunction ) , insulin resistance , abnormal glucose tolerance , and the hfe his63asp variant correlate with ferritin levels in premenopausal women . | RESEARCH DESIGN AND METHODS
DNA analysis
Statistical analysis
RESULTS
CONCLUSIONS |
coronary artery disease ( cad ) is one of the most important causes of left ventricular systolic dysfunction ( lvsd ) and it is found in approximately 68% of patients with lvsd.1 ) because left ventricular ( lv ) function and prognosis can be improved with successful revascularization , differentiation of significant cad from other non - ischemic etiologies is important in managing these patients .
however , in advanced heart failure , it is sometimes difficult to delineate the underlying etiology with echocardiography , because of the features of dilated cardiomyopathy .
patients with dilated cardiomyopathy may present with chest pain or ecg change suggestive of cad , whereas some patients with cad and heart failure present without history of angina or electrocardiography ( ecg ) evidence of myocardial ischemia / infaction ( fig .
1 ) . conventional coronary angiography is the gold standard method for the diagnosis of cad .
this has led to the development of non - invasive imaging for the diagnosis of cad , which often involves expensive equipment , radiation exposure , needs medication and contrast administration.2 ) carotid intima - media thickness ( imt ) is efficient , relatively inexpensive , highly reproducible and does not expose patients to contrast dye and radiation .
in addition , carotid imt is a well established surrogate marker of atherosclerosis and is associated with cardiovascular events and asymptomatic myocardial ischemia.3 ) recently , some reports discussed the differentiation of ischemic cardiomyopathy from dilated cardiomyopathy using carotid ultrasonography.4)5 ) as such , the aim of this study was to explore the predictive value of carotid imt and plaque for the diagnosis of cad in severe lvsd patients .
between august 2005 and may 2009 , 181 newly diagnosed heart failure patients were admitted with lv dilatation { left ventricular end - diastolic dimension ( lvedd ) > 55 mm } and severe lvsd { left ventricular ejection fraction ( lvef ) 30% with modified simpson 's method}. we excluded 70 patients with previous history of myocardial infaction ( mi ) , percutaneous coronary intervention ( pci ) , coronary artery bypass graft ( cabg ) , acute coronary syndrome ( acs ) and elevated cardiac enzyme on admission .
in addition , we also excluded 38 patients who did not undergo diagnostic work up for coronary anatomy .
seventy - three ( n=73 ) patients underwent coronary arteriography , conventional coronary angiography ( 64 patients ) and ct coronary angiography ( 9 patients ) were included in this study . decision to perform diagnostic work up for coronary anatomy was at the duty physicians ' discretion , according to the patients ' clinical features at presentation , including visible q wave or poor r wave progression on ecg , presence of cardiovascular risk factors and associated chest pain .
we classified patients into two groups : the cad group and the non - cad group , according to coronary angiographic findings .
lv end systole and end diastolic volumes were calculated by using the modified simpson 's method , and ejection fraction was calculated from the lv end systole and end diastolic volumes .
carotid ultrasound examinations were conducted using commercially available linear array transducer ( 8.0 mhz linear probe , acuson sequoia c 512 , siemens , automated measurement ) . experienced sonographer obtained images of the far wall of both common carotid artery ( cca ) and carotid bulbs according to the mannheim common carotid imt consensus .
plaque was defined as a focal structure encroaching into the arterial lumen of at least 0.5 mm or 50% of the surrounding imt value , or demonstrated a thickness greater than 1.5 mm as measured from the media - adventitia interface to the intima - lumen interface.6 ) each cca segment was measured and these measurements on both sides were averaged to obtain mean cca imt .
coronary angiography was performed via the femoral or radial artery using standard technique , and ct coronary angiography was obtained using 64 channel multi detector ct scanner ( lightspeed vct xt , ge healthcare , usa ) .
we used the duke myocardial jeopardy score to evaluate the severity of cad , categorized as mild ( jeopardy score 2 - 4 points ) , moderate ( 6 - 8 points ) , severe ( 10 - 12 points ) . in this jeopardy scoring system ,
the coronary tree is divided into 6 segments : the left anterior descending artery ( lad ) , diagonal branches , septal perforating branches , circumflex coronary artery , obtuse marginal branches , and the posterior descending coronary artery .
segments distal to stenoses greater than 70% are considered to be ' at risk ' .
the maximum possible number of points is 12.7 ) for example , significant proximal lad stenosis makes 6 jeopardy score points ( septal perforator : 2 points , diagonal branch : 2 points and 2 points for lad ) .
single vessel disease , for example due to right coronary artery ( rca ) stenosis , will be awarded 2 jeopardy score points .
the differences between measurements were tested using t - test for continuous variables and chi - square test for categorical variables . a probability value of p<0.05 was considered statistically significant .
data were analyzed by using statview for windows , version 5.0 ( sas institute , inc .
, cary , nc , usa ) , and medcalc , version 7.0 ( medcalc software , mariakerke , belgium ) .
between august 2005 and may 2009 , 181 newly diagnosed heart failure patients were admitted with lv dilatation { left ventricular end - diastolic dimension ( lvedd ) > 55 mm } and severe lvsd { left ventricular ejection fraction ( lvef ) 30% with modified simpson 's method}. we excluded 70 patients with previous history of myocardial infaction ( mi ) , percutaneous coronary intervention ( pci ) , coronary artery bypass graft ( cabg ) , acute coronary syndrome ( acs ) and elevated cardiac enzyme on admission .
in addition , we also excluded 38 patients who did not undergo diagnostic work up for coronary anatomy .
seventy - three ( n=73 ) patients underwent coronary arteriography , conventional coronary angiography ( 64 patients ) and ct coronary angiography ( 9 patients ) were included in this study . decision to perform diagnostic work up for coronary anatomy was at the duty physicians ' discretion , according to the patients ' clinical features at presentation , including visible q wave or poor r wave progression on ecg , presence of cardiovascular risk factors and associated chest pain .
we classified patients into two groups : the cad group and the non - cad group , according to coronary angiographic findings .
lv end systole and end diastolic volumes were calculated by using the modified simpson 's method , and ejection fraction was calculated from the lv end systole and end diastolic volumes .
carotid ultrasound examinations were conducted using commercially available linear array transducer ( 8.0 mhz linear probe , acuson sequoia c 512 , siemens , automated measurement ) . experienced sonographer obtained images of the far wall of both common carotid artery ( cca ) and carotid bulbs according to the mannheim common carotid imt consensus .
plaque was defined as a focal structure encroaching into the arterial lumen of at least 0.5 mm or 50% of the surrounding imt value , or demonstrated a thickness greater than 1.5 mm as measured from the media - adventitia interface to the intima - lumen interface.6 ) each cca segment was measured and these measurements on both sides were averaged to obtain mean cca imt .
coronary angiography was performed via the femoral or radial artery using standard technique , and ct coronary angiography was obtained using 64 channel multi detector ct scanner ( lightspeed vct xt , ge healthcare , usa ) .
we used the duke myocardial jeopardy score to evaluate the severity of cad , categorized as mild ( jeopardy score 2 - 4 points ) , moderate ( 6 - 8 points ) , severe ( 10 - 12 points ) . in this jeopardy scoring system
, the coronary tree is divided into 6 segments : the left anterior descending artery ( lad ) , diagonal branches , septal perforating branches , circumflex coronary artery , obtuse marginal branches , and the posterior descending coronary artery .
segments distal to stenoses greater than 70% are considered to be ' at risk ' .
the maximum possible number of points is 12.7 ) for example , significant proximal lad stenosis makes 6 jeopardy score points ( septal perforator : 2 points , diagonal branch : 2 points and 2 points for lad ) . single vessel disease , for example due to right coronary artery ( rca ) stenosis , will be awarded 2 jeopardy score points .
the differences between measurements were tested using t - test for continuous variables and chi - square test for categorical variables .
data were analyzed by using statview for windows , version 5.0 ( sas institute , inc . , cary , nc , usa ) , and medcalc , version 7.0 ( medcalc software , mariakerke , belgium ) .
among the study cohort of 73 patients , there was no significant stenosis in 32 patients ( jeopardy score= 0 , non - cad group ) , whereas 41 patients experienced significant stenosis ( jeopardy score 2 , cad group ) .
three patients were awarded 2 points on the jeopardy score , because all of whom experienced significant stenosis in the rca .
there were no significant differences in age ( 68.313.7 years vs. 70.413.1 years ) , male sex ( 40.4% vs. 59.6% ) , diabetes ( 25% vs. 46.3% ) , smoking ( 31% vs. 48.3% ) , lvedd ( 63.46.2 mm vs. 63.17.5 mm ) , lvef ( 22.64.6% vs. 24.04.7% ) .
the prevalence of hypertension ( 34.3% vs. 65.8% , p<0.01 ) and q wave in v1 - 4 ( 6.3% vs. 14.3% , p<0.01 ) was significantly higher in the cad group .
mean cca imt was significantly higher in the cad group than in the non - cad group ( 0.740.05 mm vs. 1.040.04 mm , p<0.01 ) ( figs . 1 and 2a ) .
comparing patients with jeopardy score between 2 and 4 points ( the mild group ) , and patients with jeopardy score between 10 and 12 points ( the severe group ) , the latter demonstrated more increased cca imt ( 0.860.15 mm vs. 1.040.24 mm , p<0.05 ) ( fig .
plaque in cca ( 6.25% vs. 19.5% , p<0.01 ) , and plaque in bulb ( 25.0% vs. 60.9% , p<0.001 ) were more frequently found in the cad group ( table 2 ) .
receiver - operating characteristic curves constructed for different values of mean cca imt versus cad demonstrated the optimal mean cca imt cut off value for ischemic etiology ( fig .
the area under curve was 0.741 and a cut off value of cca imt at 0.9 mm had sensitivity and specificity of respectively 56.1% and 88.2% in detecting cad and that of a cut off value of 1.0 mm was respectively 35.9% and 94.1% ( fig .
the sensitivity and specificity of plaque in cca in detecting cad were respectively 19.5% and 93.7% and that for plaque in bulb was respectively 61% and 75% ( table 3 ) .
multivariate logistic regression analysis showed that hypertension { odds ratio ( or ) 3.0 , 95% confidence interval ( ci ) 1.12 - 11.29 , p<0.05 } , mean cca imt ( or 2.61 , 95% ci 1.134 - 4.469 , p<0.01 ) and plaque in bulb ( or 4.69 , 95% ci 1.702 - 12.965 , p<0.01 ) were significant predictors for cad ( table 4 ) . among 29 patients classified with low probability for cad ( no history of diabetes mellitus , no q wave in ecg ) , 8 patients ( 27.6% )
were shown to have significant cad ( jeopardy score 4 in 3 , 8 in 2 and 10 in 3 patients ) .
the presence of plaque in bulb was a significant predictor for cad ( or 7.08 , 95% ci 1.17 - 42.8 , p<0.05 ) in patients classified as low probability ( table 5 ) .
mean cca imt was significantly higher in the cad group than in the non - cad group ( 0.740.05 mm vs. 1.040.04 mm , p<0.01 ) ( figs . 1 and 2a ) . comparing patients with jeopardy score between 2 and 4 points ( the mild group ) , and patients with jeopardy score between 10 and 12 points ( the severe group ) ,
the latter demonstrated more increased cca imt ( 0.860.15 mm vs. 1.040.24 mm , p<0.05 ) ( fig .
plaque in cca ( 6.25% vs. 19.5% , p<0.01 ) , and plaque in bulb ( 25.0% vs. 60.9% , p<0.001 ) were more frequently found in the cad group ( table 2 ) .
receiver - operating characteristic curves constructed for different values of mean cca imt versus cad demonstrated the optimal mean cca imt cut off value for ischemic etiology ( fig .
the area under curve was 0.741 and a cut off value of cca imt at 0.9 mm had sensitivity and specificity of respectively 56.1% and 88.2% in detecting cad and that of a cut off value of 1.0 mm was respectively 35.9% and 94.1% ( fig .
the sensitivity and specificity of plaque in cca in detecting cad were respectively 19.5% and 93.7% and that for plaque in bulb was respectively 61% and 75% ( table 3 ) .
multivariate logistic regression analysis showed that hypertension { odds ratio ( or ) 3.0 , 95% confidence interval ( ci ) 1.12 - 11.29 , p<0.05 } , mean cca imt ( or 2.61 , 95% ci 1.134 - 4.469 , p<0.01 ) and plaque in bulb ( or 4.69 , 95% ci 1.702 - 12.965 , p<0.01 ) were significant predictors for cad ( table 4 ) .
among 29 patients classified with low probability for cad ( no history of diabetes mellitus , no q wave in ecg ) , 8 patients ( 27.6% ) were shown to have significant cad ( jeopardy score 4 in 3 , 8 in 2 and 10 in 3 patients ) .
the presence of plaque in bulb was a significant predictor for cad ( or 7.08 , 95% ci 1.17 - 42.8 , p<0.05 ) in patients classified as low probability ( table 5 ) .
in daily medical practice , it remains a challenge to distinguish between ischemic and non - ischemic cardiomyopathy .
ischemic etiology has been shown to be independently associated with worse long - term outcome in patients with lvsd.8 ) the etiology of cardiomyopathy also influences the decision to pursue revascularization and the choice of pharmacologic intervention.9 ) dilated cardiomyopathy , defined as lvsd with chamber dilatation , represents a final common pathway for many pathologic processes .
for example , 8% of cad was found in transplantation candidates diagnosed with idiopathic dilated cardiomyopathy.10 ) in patients with definite history of mi , pci , cabg , acs and elevated cardiac marker , there was no uncertainty on the ischemic etiology of cardiomyopathy .
however , in certain patients , determination of etiology may be difficult because patients with heart failure without cad may present with typical angina or regional wall motion abnormalities on echocardiography , whereas patients with severe cad may present without symptom of angina or history of myocardial ischemia / infaction .
carotid imt is a well - established surrogate marker of coronary atherosclerosis,11)12 ) and is associated with cardiovascular events.13 ) it is efficient , relatively inexpensive and highly reproducible and does not expose patients to contrast dye or radiation .
previous studies demonstrated the relationship between carotid imt and the extent and severity of coronary stenosis.14 - 19 ) therefore , it can be postulated that carotid imt and plaque provide diagnostic clue for ischemic etiology in severe lvsd patients .
atherosclerosis is a systemic disease and , as such , increasing carotid imt and plaque are correlated with cad .
however , this association remains debatable.20 ) our study demonstrated that mean cca imt is higher in the cad group ( fig .
2 ) and mean cca imt is increasing according to coronary jeopardy score , which is a simple method for estimating the amount of myocardium at risk on the basis of coronary artery stenosis . even after having excluded patients with known ischemic history , significant cad was found to exist in 41 patients ( 56.1% ) in our study population . among 29 patients classified with low probability of developing cad , cad was found to exist in 8 patients ( 27.6% ) and plaque in bulb remained statistically significant predictor for cad .
we therefore conclude that detection of cad of unknown etiology in severe lvsd patients is important , because they need revascularization that can improve prognosis .
in addition , our study demonstrated showed good specificity of mean cca imt ( 93.7% ) ( fig .
3 ) and the presence of plaque in bulb also exhibited relatively good specificity ( 75% ) and positive predictive value ( 80% ) for the diagnosis of cad ( table 3 ) . therefore , we weighted on mean cca imt or the presence of plaque can be used as tools to support the presence of ischemic etiology in severe lvsd patients and normal cca imt in the absence of plaque support the non - ischemic etiology of severe lvsd patients . in practice , if severe lvsd patients have no history of ischemia with normal imt and without plaque in bulb , we can initially classify them as non - ischemic lvsd . on the contrary , increased imt with plaque in bulb in patients are indications to perform coronary angiography . based on our findings ,
mean cca imt and plaque in bulb can be useful tools for the prediction of cad in severe lvsd patients with unknown etiology .
in addition , there might have been inherent selection bias because we did not include all patients with severe lvsd .
it may not be clinically justified to perform coronary angiography in all patients due to the low probability of atherosclerosis , particularly in young patients .
mean cca imt was higher with cad group in severe lvsd patients . and mean cca imt and plaque in bulb were good predictors for cad .
cca imt and plaque in bulb showed good specificity and positive predictive value for cad . in patients with severe lvsd ,
mean cca imt and plaque in bulb can be useful additional tools for the prediction and/or exclusion for cad .
in addition , there might have been inherent selection bias because we did not include all patients with severe lvsd .
it may not be clinically justified to perform coronary angiography in all patients due to the low probability of atherosclerosis , particularly in young patients .
mean cca imt was higher with cad group in severe lvsd patients . and mean cca imt and plaque in bulb were good predictors for cad .
cca imt and plaque in bulb showed good specificity and positive predictive value for cad . in patients with severe lvsd ,
mean cca imt and plaque in bulb can be useful additional tools for the prediction and/or exclusion for cad . | background and objectivescoronary artery disease ( cad ) is a major cause of heart failure associated with left ventricular systolic dysfunction ( lvsd ) .
the prognosis of lvsd is significantly influenced by the etiology of heart failure and therefore , differentiation of significant cad from other etiologies is important .
carotid intima - media thickness ( imt ) and plaque are useful predictors for cardiovascular events , including stroke and cad .
the purpose of this study was to evaluate the predictive value of carotid imt and plaque for the diagnosis of cad in lvsd patients.subjects and methodsseventy - three ( n= 73 , 47 male , 67.612.4 years ) patients hospitalized for heart failure with severe lvsd were retrospectively enrolled .
the severity of cad was analyzed by the duke jeopardy score system , and carotid imt and plaque were measured according to the mannheim carotid imt consensus.resultssignificant cad was found in 41 patients ( 56.1% , cad group ) on coronary angiography .
mean common carotid artery ( cca ) imt ( 0.740.05 mm vs. 1.040.04 mm , p<0.01 ) was significantly higher in the cad group .
plaque in cca ( 6.25% vs. 19.5% , p<0.01 ) and plaque in bulb ( 25.0% vs. 60.9% , p<0.001 ) were significantly higher in the cad group .
mean cca imt { odds ratio ( or ) 2.61 , 95% confidence interval ( ci ) 1.134 - 4.469 , p<0.01 } and plaque in bulb ( or 4.69 , 95% ci 1.702 - 12.965 , p<0.01 ) were significant predictors for the diagnosis of cad according to multivariate logistic regression analysis.conclusionin patients with severe lvsd , mean cca imt and bulb plaque can be useful additional predictors for the diagnosis of cad . | Introduction
Subjects and Methods
Study population
Two dimensional echocardiography
Carotid intima-media thickness and plaque definition
Coronary angiography and assessment of coronary artery disease severity
Statistical analysis
Results
Carotid ultrasonographic findings and coronary artery disease
Diagnostic accuracy of carotid ultrasonography for the prediction of coronary artery disease
Predictive factors for coronary artery disease
Subgroup analysis for low probable group
Discussion
Limitations
Conclusion |
null | tetrazine
ligations have proven to be a powerful bioorthogonal
technique for the detection of many labeled biomolecules , but the
ligating nature of these reactions can limit reaction turnover in
templated chemistry . we have developed a transfer reaction between
7-azabenzonorbornadiene derivatives and fluorogenic tetrazines that
facilitates turnover amplification of the fluorogenic response in
nucleic acid - templated reactions .
fluorogenic tetrazine - mediated transfer
( tmt ) reaction probes can be used to detect dna and microrna ( mirna )
templates to 0.5 and 5 pm concentrations , respectively .
the endogenous
oncogenic mirna target mir-21 could be detected in crude cell lysates
and detected by imaging in live cells .
remarkably , the technique is
also able to differentiate between mirna templates bearing a single
mismatch with high signal to background .
we imagine that tmt reactions
could find wide application for amplified fluorescent detection of
clinically relevant nucleic acid templates . | Supplementary Material |
venous thromboembolism ( vte ) , which includes both deep vein thrombosis ( dvt ) and pulmonary embolism ( pe ) , is a common complication of critical illness .
critically ill patients harbor many coincident risk factors for dvt , such as the need for surgery , catheters , immobility , and use of sedatives and paralytic agents [ 3 - 5 ] . as in the noncritically ill population
, it is likely that most episodes of dvt are asymptomatic and confined to the deep veins of the calf .
however , with time , 2030% of untreated calf vein thrombi extend proximally into the thigh , where they pose a 4050% risk for pe .
early studies of the natural history of pe suggest that untreated pe has a mortality rate of at least 25% .
one large study found pe at autopsy in 59 out of 404 hospitalized patients ( 14.6% ) ; among the 20 patients who died from pe , this diagnosis was not suspected in 14 ( 70)% . in a 25-year longitudinal study ,
9% of patients had autopsy evidence of pe ; again , the diagnosis of pe was not suspected in 84% of patients before autopsy . in a landmark study highlighting this problem in critical care practice , 13 out of 34 ( 38% ) intensive care unit ( icu ) patients with known dvt who had no symptoms of pe
it is possible that many mechanically ventilated patients with sudden episodes of hypotension , tachycardia , or hypoxia may have undetected pe .
we posit that in critically ill patients with impaired cardiopulmonary reserve , a small pe , which might be of minimal clinical importance in patients who are less ill , might have severe or fatal consequences .
thus , the clinical consequences of dvt have the potential to be particularly serious , but may be unrecognized in the icu .
it is also possible that icu patients undergoing treatment for dvt are more likely than other patients to suffer serious complications from anticoagulant therapy . among ambulatory patients ,
some clinicians may consider clinically important dvt to be proximal ( thigh dvt ) rather than distal ( calf dvt ) , based on the greater propensity of untreated proximal dvt to cause pe .
thus , clinically important episodes of dvt are usually defined as symptomatic events that lead to objective radiologic confirmation and subsequent treatment .
however , critically ill patients can not reliably communicate their symptoms , and intensivists rarely use the reference standard of venography to diagnose dvt . furthermore ,
physical signs such as unilateral leg edema , which are important clinical features of dvt outside the icu , are uncommon in the icu because many critically ill patients are supine and frequently have severe bilateral edema .
these observations suggest that the classic definition of a clinically important dvt is not suitable in the icu setting .
there is no objective reference standard for or definition of clinically important dvt in critically ill patients because , to our knowledge , no studies have systematically correlated clinical or radiographic characteristics of acute venous thrombosis with patient outcomes . despite the lack of such data , the concept of a clinically important dvt in the critically ill is important because such an assessment may be used to determine whether a dvt should be treated ; in addition , a definition of clinically important dvt could be used in future clinical research . therefore , as a first step toward defining a ' clinically important dvt ' , we surveyed critical care physicians to identify those patient factors and radiologic features of lower limb dvt that influence their perceptions about the clinical importance of dvt .
our primary hypothesis was that intensivists will consider the following patient factors more likely to make a dvt clinically important : the dvt is symptomatic , is detected by physical examination , is found in a patient with risk factors , occurs in a patient who has been receiving dvt prophylaxis or therapeutic anticoagulation , and occurs in a patient with either chronic cardiopulmonary comorbidity or acute cardiopulmonary illness that might limit tolerance to a pe .
our secondary hypothesis was that intensivists will consider the following compression ultrasound features more likely to make a dvt clinically important : the dvt is proximal , large , occlusive , and persists 1 week later .
we developed a survey for members of the canadian critical care trials group who care for critically ill adults .
we generated items for this instrument based on a review of the literature , our prior work , and discussion among the investigators .
we reduced items for this instrument by interviews with five intensivists who did not participate in the survey . in the survey we provided the rationale for the questionnaire , defined the concept of clinically important dvt , and requested basic demographic information about respondents and their icu settings .
we then surveyed respondents about the extent to which various factors influence their assessment of the clinical importance of dvt in critically ill patients .
a self - administered rather than interviewer - administered format was used to maximize the validity of self - reported information .
we used the following conceptual definition of clinically important dvt : a dvt that , if untreated , would will lead to increased short - term morbidity ( e.g. cardiopulmonary consequences that may delay weaning from mechanical ventilation ) , long - term morbidity ( e.g. patient - centered consequences such as chronic venous insufficiency ) , or mortality .
we listed potential characteristics of clinically important dvts in two domains : patient factors and ultrasonographic features . for an icu patient with a dvt we asked respondents to indicate , using a likert scale , whether each of these characteristics was more or less likely to make a dvt clinically important ( 1 = much less likely to make the dvt clinically important , 2 = somewhat less likely to make the dvt clinically important , 3 = neither more nor less likely to make the dvt clinically important , 4 = somewhat more likely to make the dvt clinically important , and 5 = much more likely to make the dvt clinically important ; see appendix 1 ) .
demographic questions included year of graduation from medical school and clinical discipline ( internal medicine or its subspecialities , surgery , or anesthesia ) .
we also requested information about the number of icu beds in which the respondent works , the type of icu ( medical , surgical or mixed medical
we used closed - ended questions for the icu demographic data to maximize the accuracy and completeness of responses .
we administered the survey instrument by e - mail to all members of the canadian critical care trial group who care for critically ill adults .
we contacted nonrespondents by facsimile with a second copy of the questionnaire , and then by e - mail or telephone contact .
participation was voluntary , individual responses were kept confidential , and data were anonymized upon receipt .
the study was approved by the research ethics board of st joseph 's healthcare in hamilton , ontario .
descriptive statistics were used , including proportions with associated confidence intervals , as well as measures of central tendency and dispersion ( mean and standard deviation [ sd ] ) . within each domain ( patient factors and ultrasonographic features )
, we ranked the characteristics according to which were most likely to make the dvt clinically important .
we developed a survey for members of the canadian critical care trials group who care for critically ill adults .
we generated items for this instrument based on a review of the literature , our prior work , and discussion among the investigators .
we reduced items for this instrument by interviews with five intensivists who did not participate in the survey .
in the survey we provided the rationale for the questionnaire , defined the concept of clinically important dvt , and requested basic demographic information about respondents and their icu settings .
we then surveyed respondents about the extent to which various factors influence their assessment of the clinical importance of dvt in critically ill patients .
a self - administered rather than interviewer - administered format was used to maximize the validity of self - reported information .
we used the following conceptual definition of clinically important dvt : a dvt that , if untreated , would will lead to increased short - term morbidity ( e.g. cardiopulmonary consequences that may delay weaning from mechanical ventilation ) , long - term morbidity ( e.g. patient - centered consequences such as chronic venous insufficiency ) , or mortality .
we listed potential characteristics of clinically important dvts in two domains : patient factors and ultrasonographic features . for an icu patient with a dvt we asked respondents to indicate , using a likert scale , whether each of these characteristics was more or less likely to make a dvt clinically important ( 1 = much less likely to make the dvt clinically important , 2 = somewhat less likely to make the dvt clinically important , 3 = neither more nor less likely to make the dvt clinically important , 4 = somewhat more likely to make the dvt clinically important , and 5 = much more likely to make the dvt clinically important ; see appendix 1 ) .
demographic questions included year of graduation from medical school and clinical discipline ( internal medicine or its subspecialities , surgery , or anesthesia ) .
we also requested information about the number of icu beds in which the respondent works , the type of icu ( medical , surgical or mixed medical surgical ) , and the presence of a thrombosis consult service .
we used closed - ended questions for the icu demographic data to maximize the accuracy and completeness of responses .
we administered the survey instrument by e - mail to all members of the canadian critical care trial group who care for critically ill adults .
we contacted nonrespondents by facsimile with a second copy of the questionnaire , and then by e - mail or telephone contact .
participation was voluntary , individual responses were kept confidential , and data were anonymized upon receipt .
the study was approved by the research ethics board of st joseph 's healthcare in hamilton , ontario .
descriptive statistics were used , including proportions with associated confidence intervals , as well as measures of central tendency and dispersion ( mean and standard deviation [ sd ] ) . within each domain ( patient factors and ultrasonographic features )
, we ranked the characteristics according to which were most likely to make the dvt clinically important .
sixty - six ( 93% ) of the surveys were returned without a reminder e - mail ; five ( 7% ) required a reminder .
clinical discipline backgrounds were internal medicine in 52 ( 75% ) , anesthesia in eight ( 12% ) , surgery in six ( 9% ) , and other in three ( 4% ) .
respondents had 16.2 ( sd 8.2 ) years of icu experience , and worked in icus with a mean of 21.5 ( sd 8.0 ) beds .
icus represented were from 31 hospitals in 16 cities in canada ; 67 ( 94% ) of respondents were university affiliated .
patient factors considered to increase the clinical importance of a dvt , ranked according to the mean score , are shown in table 1 . a clinical suspicion of pe ( mean score 4.6 [ sd 0.7 ] ) , acute or chronic cardiopulmonary morbidity that might limit a patient 's ability to tolerate pe ( score 4.5 [ 0.7 ] ) , and the presence of leg symptoms ( score 4.2 [ 0.8 ] ) were most likely to make a dvt clinically important . in fig .
1 we present the distribution of responses from 1 to 5 for patient factors associated with clinically important dvt .
the absence of risk factors , symptoms , or physical signs of dvt , dvt associated with central venous catheterization , and dvt in the absence of prophylaxis were all considered to be less important than the other factors in determining the clinical relevance of an icu - acquired dvt . in table 2
we present the ultrasonographic features considered likely to make a dvt clinically important , ranked according to the mean score .
proximal location of the dvt was rated as most likely to make a dvt clinically important ( score 4.7 [ sd 0.5 ] ) . of the other ultrasound features , large ( score 4.2 [ 0.6 ] ) and totally occlusive ( score 3.9 [ 0.8 ] ) thrombi
2 we present the distribution of responses from 1 to 5 for ultrasonographic features associated with clinically important dvt . a dvt that is small , partially occlusive , or has flow around it did not make the dvt unlikely to be considered clinically important .
this occurs despite the high likelihood that pe is clinically more important in the critically ill , who often have impaired cardiopulmonary reserve .
we conducted the present survey to determine which characteristics of dvt are considered to be clinically important by intensivists . determining which characteristics impart clinical significance is important because the thrombi that are considered to be clinically important are likely to be treated , and these treatments have adverse effects such as bleeding , inconvenience , and cost .
outside the icu setting , many clinicians consider dvt clinically significant primarily when patients have referable symptoms and evidence of occlusive thrombosis on ultrasonography .
however , critically ill patients are generally unable to report symptoms and uncommonly have unilateral leg edema because they are recumbent . therefore , ' typical ' clinical symptoms and signs
can not be used to establish the clinical significance of a dvt in the icu .
our survey confirmed that intensivists use some different criteria to assign clinical significance than are used by nonintensivists , particularly thrombosis experts [ 24 - 26 ] .
for example , asymptomatic dvt detected on screening ultrasonography in critically ill patients with severely impaired cardiorespiratory reserve are accorded substantial clinical importance in the icu , whereas the significance of these thrombi may be debated by clinicians working outside the icu setting .
strengths of the survey include comprehensive lists of both patient factors and ultrasonographic features that may influence clinicians ' interpretation of the importance of a dvt in the icu setting .
ideally , empiric data would inform us about which dvt characteristics are most likely to be associated with short - term and long - term morbidity and mortality in critically ill patients . in the absence of such data
, we defined clinically important dvt as a dvt that is likely , in the opinion of the intensivists , to result in short - term or long - term morbidity or mortality if left untreated , as opposed to a dvt that will probably not have important consequences .
we used evidence from three randomized trials to conduct this survey ; these suggested that a self - administered format yields more valid self - reports than interviewer - administered questionnaires , that closed - ended formats yield more complete and valid demographic data about the respondents than do open - ended formats , and that appending second questionnaires to reminders maximizes response rates .
our respondents represented largely university affiliated icus from coast to coast in canada , and our response rate was 99% .
we believe that our results are generalizable to similar multidisciplinary secondary and tertiary care settings in which the majority of mechanically ventilated , critically ill patients are cared for .
however , in focusing on the short - term consequences of vte , there are three major limitations of the survey .
the first is that we did not evaluate thresholds for dvt treatment in the icu setting , which is a more complex phenomenon .
treatment thresholds are also influenced by other factors such as the natural history of the icu patient 's underlying illness , the type of therapeutic options available and suitable for each patient , intensivists ' knowledge about the realistic magnitude of therapeutic benefits and harms , patient - specific and dynamic balance between bleeding and thrombosis risks , and alternative options such as surveillance monitoring .
evaluating treatment thresholds is also interesting , although it is a more complex issue and would require different survey questions ( or an alternative study design altogether ) .
second , we did not elicit views on the risks , costs , and consequences of investigating and managing treatment complications such as bleeding .
third , we did not consider the long - term consequences of dvt such as postphlebitic syndrome , which may be associated with disabling symptoms and/or ulceration among survivors .
experts express varying views on the appropriate end - points for studies of thromboprophylaxis [ 27 - 31 ] . over the years
, the majority of thromboprophylaxis trials have used dvt detected by sensitive screening methods such as venography as the primary efficacy outcome .
only one of two randomized trials in the icu has employed ultrasonographic followed by venographic screening for dvt , and venograms are rarely performed in critical care practice today .
two lines of evidence support the hypothesis that dvt detected by screening tests is clinically unimportant .
the first line of evidence is the fact that even with use of appropriate vte prophylaxis , 1530% of patients undergoing major orthopedic surgery will be discharged from the hospital with venographically detectable calf or more proximal dvt ; fewer ( about 3% of such patients ) ultimately return with a symptomatic dvt .
the second line of evidence is that , even when clinicians perform screening ultrasonography at the time of hospital discharge and then treat patients who have dvt with antithrombotic therapy , there is no evidence that the subsequent risk for thrombosis is decreased .
for example , robinson and colleagues randomized patients after orthopedic surgery to undergo screening ultrasonography or sham ultrasonography . after hospital discharge
the risk for patients returning with clinical symptoms of venous thrombosis was the same , irrespective of whether patients underwent ultrasonography , suggesting that thrombi identified by screening ultrasonography in hospitalized patients are not necessarily destined to produce clinical symptoms . as a result of these observations , routine screening of such patients for dvt at the time of hospital discharge has effectively been abandoned .
caution is needed , however , in extrapolating this practice pattern to critically ill patients .
therefore , they may be unable to tolerate a small pe that an otherwise healthy outpatient might tolerate easily .
better quality evidence on the clinical impact of dvt diagnosed by screening ultrasound in the critically ill is needed .
meanwhile , most such patients with lower limb dvt diagnosed by screening ultrasonography appear to be treated , based on recent studies .
interpreting studies about vte in the icu requires consideration of the clinical importance of the dvt end - points . in future randomized trials testing the efficacy of thromboprophylaxis interventions , we recommend that validated and feasible screening tests , such as doppler ultrasonography or serial doppler ultrasonography , be used .
large , simple randomized trials that use clinically important vte end - points should follow , consisting of events such as symptomatic or fatal pe , and ultrasonographically diagnosed proximal dvt [ 28 - 31 ] .
the results of this survey can inform our research program on vte in the icu .
we conclude that most forms of vte are considered to be clinically serious , perhaps more so than in patients outside the critical care setting , supporting the need for ongoing research in this area . from this survey we generated new information showing how the critical care context is important to intensivists caring for patients with dvt .
development of dvt in the critically ill patient may have unique consequences , particularly in patients requiring mechanical ventilation , vasopressors , or inotropes , because intensivists report that cardiopulmonary reserve is crucial in interpreting the features of a dvt that make it clinically important .
our results also suggest that treatment thresholds used by intensivists may be lower than the treatment thresholds employed by other clinicians , although this hypothesis can be formally tested .
on the other hand , the treatment threshold may be higher for intensivists who take into account other complications of critical illness .
for example , dynamic bleeding and thrombotic risks in icu patients must be traded off when considering whether to treat a dvt , and with what to treat it .
such factors will influence the associated morbidity and mortality of vte in the icu setting , which need to be more rigorously evaluated .
we demonstrated that intensivists define clinically important dvt using criteria that are relevant to critical care patients in addition to those suitable for general dvt patients .
pending the availability of data that correlate clinical outcomes with the criteria we studied in this survey , these concepts could be used in future studies of the prevention and treatment of dvt in the critically ill .
mm received grants for investigator initiated studies from pharmica , aventis and leo pharmaceuticals ( latter for this survey ) .
jg as a co - investigator , indirectly received funding from pharmacia and leo pharmaceuticals for the dvt study .
gg received grants for investigator initiated studies from pharmica , aventis and leo pharmaceuticals ( latter for this survey ) .
mc received honoraria and research grants from pfizer , pharmica , aventis , leo pharmaceuticals and novo nordisk .
dc has received a grant for this survey from leo pharmaceuticals , and additional grants for investigator initiated research from pharmacia and aventis .
dvt = deep vein thrombosis ; icu = intensive care unit ; pe = pulmonary embolism ; sd = standard deviation ; vte = venous thromboembolism .
1 . determining which dvt characteristics impart clinical significance to intensivists is important because dvt considered to be clinically important are likely to be treated , and treatments have adverse effects such as bleeding , inconvenience and cost .
2 .
in this survey of intensivists , we defined a clinically important dvt as one that , if untreated , would will lead to increased short term morbidity , long term morbidity , or mortality .
3 .
the 3 patient factors reported as most likely to make a dvt clinically important were clinical suspicion of pe , acute or chronic cardiopulmonary morbidity which might limit the tolerability of a pe , and leg symptoms .
the 3 ultrasound features reported as most likely to make a dvt clinically important were proximal location , large size , and total vessel occlusion .
the clinical importance of dvt according to intensivists is influenced by unique icu factors such as cardiopulmonary reserve among mechanically ventilated patients .
we are grateful to the canadian critical care trials group for their support of the present study .
the authors contributions were as follows : conception : d cook , g guyatt , and m meade ; design : d cook , m crowther , m meade , g guyatt , w geerts , and l griffith ; data collection : d cook ; analysis : l griffith ; interpretation : d cook , m crowther , m meade , g guyatt , j granton , and w geerts ; drafting of manuscript : d cook , m crowther , and l griffith ; and critical revision of manuscript : m meade , g guyatt , j granton , and w geerts .
patient factors considered by respondents to make a deep venous thrombosis ( dvt ) clinically important in the intensive care unit setting .
the scale used was as follows : 1 = much less likely to make the dvt clinically important ; 2 = somewhat less likely to make the dvt clinically important ; 3 = neither more nor less likely to make the dvt clinically important ; 4 = somewhat more likely to make the dvt clinically important ; and 5 = much more likely to make the dvt clinically important .
ultrasonographic factors considered by respondents to make a deep venous thrombosis ( dvt ) clinically important in the intensive care unit setting .
the scale used was as follows : 1 = much less likely to make the dvt clinically important ; 2 = somewhat less likely to make the dvt clinically important ; 3 = neither more nor less likely to make the dvt clinically important ; 4 = somewhat more likely to make the dvt clinically important ; and 5 = much more likely to make the dvt clinically important .
patient factors affecting the clinical importance of deep venous thrombosis in intensive care unit patients according to mean scores we ranked the patient factors considered by intensivists as likely to make a deep venous thrombosis clinically important .
sd , standard deviation ultrasonographic features affecting the clinical importance of deep venous thrombosis in intensive care unit patients according to mean scores we ranked the ultrasonographic features considered by intensivists as likely to make a deep venous thrombosis ( dvt ) clinically important . | introductionoutside the intensive care unit ( icu ) , clinically important deep vein thrombosis ( dvt ) is usually defined as a symptomatic event that leads to objective radiologic confirmation and subsequent treatment .
the objective of the present survey is to identify the patient factors and radiologic features of lower limb dvt that intensivists consider more or less likely to make a dvt clinically important in icu patients.methodsour definition of clinically important dvt was a dvt likely to result in short - term or long - term morbidity or mortality if left untreated , as opposed to a dvt that is unlikely to have important consequences .
we asked respondents to indicate the likelihood that patient factors and ultrasonographic features make a dvt clinically important using a five - point scale ( from 1 = much less likely to 5 = much more likely).resultsof the 71 canadian intensivists who responded , 70 ( 99% ) rated three patient factors as most likely to make a dvt clinically important : clinical suspicion of pulmonary embolism ( mean score 4.6 ) , acute or chronic cardiopulmonary morbidity that might limit a patient 's ability to tolerate pulmonary embolism ( score 4.5 ) , and leg symptoms ( score 4.2 ) .
of the ultrasound features , proximal ( score 4.7 ) , large ( score 4.2 ) , and totally occlusive ( score 3.9 ) thrombi were considered the three most important.conclusionwhen labeling a dvt as clinically important , intensivists rely on different patient specific factors and thrombus characteristics than are used to assess the clinical importance of dvt outside the icu . the clinical importance of dvt is influenced by unique factors such as cardiopulmonary reserve among mechanically ventilated patients . | Introduction
Methods
Instrument development
Instrument formatting
Instrument administration
Research ethics
Analysis
Results
Discussion
Conclusion
Competing interests
Abbreviations
Key messages
Supplementary Material
Acknowledgements
Figures and Tables |
one of the most interesting properties of the brain is its ability to change in response to experience .
this property has been termed plasticity and is involved in the reorganization of cortical maps during development , and in learning and memory processes in the adult animal ( for review , see malenka and bear , 2004 ) .
synaptic plasticity can be short - term ( lasting from milliseconds to several minutes ) or long - term ( lasting from hours to months ; see citri and malenka , 2008 for review ) .
the most extensively studied forms of synaptic plasticity are long - term potentiation ( ltp ) and long - term depression ( ltd ) .
spike timing - dependent plasticity ( stdp ) is a hebbian form of long - term plasticity ( caporale and dan , 2008 ) and is a strong candidate for a synaptic plasticity mechanism involved in cortical development ( song and abbott , 2001 ; feldman and brecht , 2005 ; dan and poo , 2006 ; caporale and dan , 2008 ) . in stdp
, the temporal order and relative timing of pre- and postsynaptic action potentials ( spikes ) , with millisecond precision , determine the direction and magnitude of synaptic change .
thus , timing - dependent ( t- ) ltp occurs when a presynaptic spike is followed by a postsynaptic spike , whereas t - ltd is induced when this order is reversed ( markram et al .
; for a detailed review of stdp , see caporale and dan , 2008 ) . both t - ltp and t - ltd depend on a specific type of ionotropic glutamate receptor , the n - methyl - d - aspartate ( nmda ) receptor , for their induction ( bi and poo , 1998 ; debanne et al . , 1998 ;
the ionotropic family of glutamate receptors comprises amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid ( ampa ) , kainate and nmda receptors , which are widely distributed in the central nervous system ( dingledine et al . , 1999 ) .
nmda receptors are ligand - gated ion channels permeable to ca , na and k ions .
these receptors are hetero - tetramers composed of two essential glun1 and two modulatory glun2 subunits ( using the subunit nomenclature recommended by the iuphar ; collingridge et al . , 2009 ) , which confer different functional , kinetic , pharmacological and signaling properties to the nmda receptor ( for review , see cull - candy et al . , 2001 ) .
nmda receptors participate in normal synaptic transmission , synaptic development and synaptic plasticity , and are involved in the pathogenesis of some neurological states and diseases including stroke , epilepsy , schizophrenia and neuropathic pain ( cull - candy et al . , 2001 ) .
these receptors have been localized in the postsynaptic membrane where they are activated by the co - agonists glutamate and glycine ( or d - serine ) and contribute to excitatory postsynaptic responses together with ampa and kainate receptors .
t - ltp depends on postsynaptic nmda receptors acting as classical coincidence detectors where presynaptic spikes trigger the release of glutamate necessary to activate these receptors , and back - propagating action potentials produce postsynaptic depolarization which relieves the nmda receptors of their voltage - dependent mg block leading to influx of ca ions .
surprisingly , in some cortical areas , postsynaptic loading of the nmda receptor channel blocker mk-801 blocked t - ltp but not t - ltd , suggesting that nmda receptors involved in t - ltd are not postsynaptic .
this finding raises the possibility that nmda receptors involved in t - ltd might have a presynaptic location .
the existence of presynaptic nmda receptors was first proposed following the finding that nmda receptor agonists facilitated noradrenaline release in synaptosome preparations from the hippocampus ( pittaluga and raiteri , 1990 , 1992 ; wang et al . , 1992 ) and cerebral cortex ( fink et al . , 1990 ; wang et al . , 1992 ) , and dopamine release in the striatum ( johnson and jeng , 1991 ; krebs et al . ,
recently , more evidence has appeared for presynaptic nmda receptors involved in dopamine release in synaptosomes and synaptoneurosomes in the striatum ( whittaker et al . , 2008 ) .
evidence for presynaptic nmda receptors was also found at neuromuscular synapses from xenopus in culture where nmda enhances transmitter release ( fu et al . , 1995 ) .
the existence of presynaptic nmda receptors has also been supported by anatomical evidence . anatomical support for presynaptic nmda receptors
has come from immuno - electron microscopy experiments which have identified nmda receptor immunolabeling in presynaptic elements of the neocortex ( aoki et al .
, 1994 ; debiasi et al . , 1996 ; charton et al . , 1999 ; corlew et al . , 2007 ) , the hippocampus ( siegel et al . , 1994 ; charton et al . , 1999
; jourdain et al . , 2007 ) , the spinal cord ( liu et al . ,
1994 ) , the amygdala ( farb et al . , 1995 ; pickel et al . ,
2006 ) and the cerebellum ( petralia et al . , 1994 ; bidoret et al . , 2009 ) .
functionally , presynaptic nmda receptors have been proposed to exist on both excitatory and inhibitory boutons , where they could modulate transmitter release . at cortical glutamatergic synapses
they have generally been suggested to serve as facilitatory autoreceptors , reversibly enhancing glutamate release .
a transient decrease of miniature excitatory postsynaptic current ( mepsc ) frequency was seen following the application of the nmda receptor antagonist d - ap5 when postsynaptic nmda receptors were previously blocked by intracellular loading of mk-801 or by hyperpolarization .
this was first demonstrated in the entorhinal cortex ( berretta and jones , 1996 ; woodhall et al . , 2001 ) and subsequently in the visual cortex ( sjstrm et al . , 2003 ;
, 2007 ; li and han , 2007 ; li et al . , 2008 ) , somatosensory cortex ( bender et al . , 2006 ; brasier and feldman , 2008 ) and hippocampus ( mameli et al . , 2005 ; jourdain et al . , 2007 ; see corlew et al . , 2008 for review ) .
apart from the cerebral cortex , there is also evidence for physiologically active presynaptic nmda receptors in the cerebellum ( glitsch and marty , 1999 ; casado et al . , 2000 ;
duguid and smart , 2004 ; fiszman et al . , 2005 ) , amygdala ( humeau et al . , 2003 ) and spinal cord ( liu et al . , 1997 ; bardoni et al . ,
( 1999 ) , engelman and macdermott ( 2004 ) and pinheiro and mulle ( 2008 ) .
presynaptic nmda receptors have been implicated in plasticity at both excitatory and inhibitory synapses , including heterosynaptic associative ltp at thalamic and cortical afferent synapses in the amygdala ( humeau et al . ,
2003 ) , depolarization - induced potentiation ( duguid and smart , 2004 ) and ltd ( casado et al . , 2002 ) in the cerebellum , ltd at gabaergic synapses in the tadpole optic tectum ( lien et al . , 2006 ) and t - ltd in different cortical areas as discussed by duguid and sjstrm ( 2006 ) and corlew et al .
while these putative functional nmda receptors are generally assumed to be at axonal locations , the existence of presynaptic , axonal nmda receptors has been challenged by the discovery that somatodendritic nmda receptor activation can affect axonal ca levels through voltage - dependent calcium channel activation , at least in cerebellar stellate cells ( christie and jahr , 2008 ) .
a further challenge has come from the apparent lack of direct effect of nmda application on axonal ca levels and axon excitability in cortical layer ( l ) 5 pyramidal neurons ( christie and jahr , 2009 )
. to summarize , experiments in synaptosomes are suggestive of nmda receptors being present in presynaptic boutons ; immuno - electron microscopy experiments are also consistent with axonal nmda receptors since immunolabeling has been found in axons in different regions . in slices ,
the existence of axonal presynaptic nmda receptors has been proposed based on the observation that the addition of an nmda receptor antagonist affects spontaneous , miniature and evoked neurotransmitter release , even after intracellular blockade of postsynaptic nmda receptors ( see corlew et al . , 2008 for review ) .
the recent experiments by christie and jahr ( 2008 , 2009 ) question the interpretation of these results , suggesting that the observed effects could be mediated by nmda receptors located in the somatodendritic compartment of the presynaptic neuron . to unequivocally demonstrate the existence of functional presynaptic axonal nmda receptors a combination of different approaches will be required ( see corlew et al . , 2008 for review ) : ( 1 ) immunogold electron microscopy ( farb et al . ,
1995 ) ; ( 2 ) direct monitoring of presynaptic function by calcium imaging whilst adding agonists or antagonists at nmda receptors ( shin and linden , 2005 ) ; ( 3 ) direct electrophysiological recording from presynaptic boutons ( fiszman et al .
, 2005 ) ; ( 4 ) direct loading of nmda receptor antagonists into the presynaptic neuron ( rodrguez - moreno and paulsen , 2008 ) ; and ( 5 ) compartment - specific interference with nmda receptor function using molecular or genetic tools ( lynch , 2004 ; safo and regehr , 2005 ) .
the first evidence for a role of presynaptic nmda receptors in stdp came from experiments at l5-l5 synapses of visual cortex where an nmda receptor - dependent presynaptic form of t - ltd was described ( sjstrm et al . ,
this t - ltd requires activation of postsynaptic group i mglurs and postsynaptic ca elevation .
results indicate that this form of t - ltd is expressed as a reduction in the probability of neurotransmitter release , thus implicating a retrograde signal from the postsynaptic to the presynaptic compartment ( sjstrm et al . , 2003 ) . this retrograde messenger has been suggested to be endocannabinoids , which mediate many forms of short - term ( wilson et al . , 2001 ;
thus , it has been proposed that the coincidence detector for t - ltd at this synapse is presynaptic and involves both presynaptic nmda receptors and cannabinoid receptor type 1 ( cb1 receptors ) ( sjstrm et al . , 2003 ) ( figure 1 ) .
model 1 : presynaptic nmda receptors and cb1 receptors drive t - ltd . in this model , during post - before - pre pairing , presynaptically released glutamate activates mglurs and postsynaptic action potentials enhance ca influx .
co - activation of presynaptic cb1 receptors and presynaptic nmda receptors causes synaptic depression . in this model ,
astrocytic release of gliotransmitters ( glutamate as agonist and/or d - serine or glycine as co - agonist ) may contribute to activating neuronal nmda receptors .
model 2 : in a second model , ecb - dependent retrograde signaling is not necessary for induction of t - ltd ( dashed crosses ) , and activation of presynaptic nmda receptors alone appears to be sufficient to drive presynaptic t - ltd .
direct evidence for presynaptic nmda receptor involvement in t - ltd has recently been obtained at l4-l2/3 synapses of somatosensory cortex using dual whole - cell recordings of synaptically - connected l4 and l2/3 neurons by loading the nmda receptor channel blocker mk-801 intracellularly via a patch pipette into pre- or postsynaptic neurons .
induction of t - ltd was unaffected by postsynaptic loading of mk-801 but completely blocked by presynaptic mk-801 , indicating that t - ltd requires presynaptic , but not postsynaptic nmda receptors ( rodrguez - moreno and paulsen , 2008 ) .
the subunit composition of these presynaptic receptors has been analyzed ( banerjee et al . , 2009 ) .
for this purpose , two glun2c / d subunit - preferring nmda receptor antagonists , ppda and ubp141 were used .
these compounds selectively blocked t - ltd at l4-l2/3 synapses with no effect on t - ltp at the same synapses , which was instead blocked by the glun2a subunit - preferring antagonist nvp - aam077 .
they also had no blocking effect on t - ltd at l2/3-l2/3 synapses , which was , however , blocked by a glun2b subunit - selective antagonist ( ro 25 - 6981 ; banerjee et al . , 2009 ) .
compounds currently available are not highly selective for glun2c / d - containing nmda receptors and , moreover , are competitive antagonists .
thus , the inhibition produced depends on the effective glutamate concentration ( neyton and paoletti , 2006 ) , precluding strong conclusions to be drawn . nevertheless , the double dissociation found , and the fact that these glun2c / d subunit - preferring antagonists did not block t - ltd at a different synapse , suggest that l4-l2/3 presynaptic nmda receptors contain glun2c / d subunits
when available , experiments with glun2c / d non - competitive antagonists should confirm whether results are due to different subunit composition of the receptors at pre- and postsynaptic sites or to different kinetics of glutamate transients at different locations .
the current lack of selective compounds that can distinguish between glun2c and glun2d subunits precludes an investigation into whether it is glun2c or glun2d that is the important subunit for the induction of t - ltd .
the possible involvement of presynaptic glun2c / d subunits in t - ltd at layer 4-to - layer 2/3 synapses is particularly interesting because the deactivation time constant of glun2c / d subunit - containing receptors is very slow ( momiyama et al . , 1996 ;
this might be relevant for the particularly broad time window for induction of t - ltd at this synapse ( feldman , 2000 ) .
several lines of evidence indicate that this form of t - ltd is presynaptic : ( i ) t - ltd is blocked when presynaptic nmda receptors are blocked by internal mk-801 in recordings from pairs of synaptically - connected l4 and l2/3 cells ( rodrguez - moreno and paulsen , 2008 ) , ( ii ) an increase in paired - pulse ratio is observed after a t - ltd protocol ( bender et al . ,
2006 ) , and ( iii ) coefficient of variation ( cv ) analysis is consistent with presynaptic expression ( rodrguez - moreno and paulsen , 2008 ) .
although previous studies have implicated endocannabinoid signaling through cb1 receptors in this form of t - ltd at rat l4-l2/3 synapses ( bender et al . ,
2006 ) , it was recently reported that t - ltd does not need cb1 receptor activation at the mouse l4-l2/3 synapse ( hardingham et al . , 2008 ; banerjee et al . , 2009 ) , suggesting a possible species and/or age difference .
in contrast , cb1 receptors are necessary for induction of t - ltd at horizontal synapses ( l2/3-l2/3 ) , supporting the idea that different excitatory synapses onto the same postsynaptic neurons can have different requirements for the induction of synaptic plasticity ( banerjee et al . , 2009 ) .
it is clear from these results that endocannabinoids are not obligatory for all forms of timing - dependent synaptic depression .
the results also suggest that at least two distinct forms of presynaptic nmda receptor - dependent ltd can be dissociated , one dependent on endocannabinoid signaling and the glun2b subunit ( sjstrm et al .
, 2003 ; banerjee et al . , 2009 ) ( figure 1 ) , and another , independent of endocannabinoids but dependent on presynaptic nmda receptors containing glun2c / d subunits ( rodrguez - moreno and paulsen , 2008 ; banerjee et al . , 2009 ) ( figure 1 ) .
notably , both of these forms of t - ltd have in common a dependence on presynaptic nmda receptors , suggesting that nmda receptors mediate t - ltd while cb1 receptors may have a permissive role .
the results described above suggest that , at l4-l2/3 synapses , t - ltd is mediated by presynaptic nmda receptors that contain glun2c / d subunits . since there is no evidence that other presynaptic receptors are implicated , we suggest that presynaptic nmda receptors are effectively mediating this form of t - ltd . in this model ,
postsynaptic spikes allow the activation of presynaptic nmda receptors when followed by a presynaptic spike .
it is , however , unknown whether the depolarization requirement often observed for unblocking nmda receptors is necessary for activation of presynaptic nmda receptors , since glun2c / d and glun3a - containing nmda receptors show less voltage sensitivity than other nmda receptor types ( cull - candy et al . , 2001 ; clarke and johnson , 2006 ) .
the presence of nmda receptors with low conductance and reduced susceptibility to mg block in the presynaptic layer 4 spiny stellate cells was reported earlier using transgenic mice ( binshtok et al . , 2006 ) .
another interesting aspect to consider is the relationship with frequency in the induction of this form of t - ltd .
t - ltd has been observed in neocortical slices using different stimulation frequencies from 0.1 to 20 hz , indicating that this form of plasticity can be elicited at low frequencies of stimulation ( feldman , 2000 ; sjstrm et al . , 2001 , 2003 ;
bender et al . , 2006 ; nevian and sakmann , 2006 ; rodrguez - moreno and paulsen , 2008 ; banerjee et al . ,
however , at 40 hz and above , only t - ltp was observed , irrespective of the timing between pre- and postsynaptic action potentials ( sjstrm et al . , 2001 ) .
timing - dependent ltd at l4-l2/3 synapses in synaptically - connected cells during paired recordings can be induced by pairing single presynaptic and postsynaptic action potentials at 0.2 hz ( rodrguez - moreno and paulsen , 2008 ) , constraining the possible mechanisms involved in this form of t - ltd .
the requirement of presynaptic nmda receptors for t - ltd raises several interesting questions : ( i ) what is the source of the transmitter that activates presynaptic nmda receptors ? in principle , there are several possible different sources of transmitter mediating the activation of presynaptic nmda receptors .
glutamate could also be released by the postsynaptic neuron , as retrograde release of glutamate has been suggested ( harkany et al . , 2004 ) .
glial cells have also been shown to release glutamate and modulate synaptic transmission and plasticity ( see perea et al .
co - agonists at nmda receptors , such as d - serine , are also released by astrocytes and have recently been shown to be involved in plasticity ( henneberger et al . , 2010 ) .
glutamate ( and/or co - agonists at nmda receptors ) of glial origin could reach presynaptic nmda receptors and activate them ( jourdain et al . , 2007 ) .
spillover of transmitter appears less likely , however , since t - ltd can be induced at very low frequency in pairs of synaptically - connected cells , leaving the postsynaptic neuron and glial cells as the most likely sources .
( ii ) is the activation of these presynaptic nmda receptors tonic or phasic in nature ?
rodrguez - moreno and paulsen ( 2008 ) showed that the application of the nmda receptor antagonist d - ap5 did not alter the epsp slope at the l4-l2/3 synapse , suggesting that these receptors are not tonically active .
brasier and feldman ( 2008 ) found that addition of d - ap5 caused a reduction of ampa currents at the l4-l2/3 synapse , suggesting that , in principle , these receptors could be tonically activated , though these results were obtained in the presence of glutamate transporter blockers .
( iii ) what is the role of the postsynaptic action potential in the pairing protocol ?
induction of t - ltd at this synapse requires pairing of postsynaptic action potentials with presynaptic activity .
previous experiments have shown that this form of ltd requires a rise in postsynaptic ca , as it is blocked by the presence of bapta in the postsynaptic cell ( bender et al . , 2006 ; nevian and sakmann , 2006 ) .
the postsynaptic action potential could mediate ca entry through voltage - dependent calcium channels and/or induce release of ca from internal stores .
this implies that a ca dependent signal from the postsynaptic neuron is most probably necessary , but the nature of this signal remains to be determined .
( iv ) why do t - ltp protocols not also produce ltd ? if a slow ca
dependent postsynaptic process is involved in the induction of t - ltd , one might expect that the postsynaptic condition for induction of t - ltd would also be satisfied during a pre - before - post paradigm .
postsynaptic action potentials might trigger the release of a retrograde messenger that acts on the presynaptic element during the presynaptic action potential . because the time window for post - before - pre pairing is relatively narrow
, it would suggest that this retrograde signal has to act in a similarly short time window ( 10 ms ) to operate as a presynaptic coincidence signal .
this time scale would appear to make postsynaptic enzyme - dependent mechanisms less likely candidates to provide the presynaptic coincidence signal during induction of t - ltd .
there is clearly more work to be done before we understand the detailed mechanisms of induction of presynaptic nmda receptor - dependent t - ltd .
in conclusion , spike timing - dependent ltd requires presynaptic nmda receptors at some cortical synapses .
two basic models are emerging to explain the mechanism of these presynaptic forms of t - ltd . in one model , presynaptic nmda receptors and cb1 receptors
a second model , suggests that presynaptic nmda receptors mediate a form of t - ltd that is independent of cb1 receptor activation ( rodrguez - moreno and paulsen , 2008 ; banerjee et al . , 2009 ) .
notably , both forms of t - ltd have in common a dependence of presynaptic nmda receptors , suggesting that nmda receptors , might be essential to mediate t - ltd , while cb1 receptors have a permissive role when involved .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | it has recently been discovered that some forms of timing - dependent long - term depression ( t - ltd ) require presynaptic n - methyl - d - aspartate ( nmda ) receptors . in this review ,
we discuss the evidence for the presence of presynaptic nmda receptors at cortical synapses and their possible role in the induction of t - ltd .
two basic models emerge for the induction of t - ltd at cortical synapses . in one model , coincident activation of presynaptic nmda receptors and cb1 receptors mediates t - ltd . in a second model ,
cb1 receptors are not necessary , and the activation of presynaptic nmda receptors alone appears to be sufficient for the induction of t - ltd . | Synaptic Plasticity and NMDA Receptors
Evidence for Presynaptic NMDA Receptors
Role of Presynaptic NMDA Receptors in Spike Timing-Dependent LTD
Mechanism of Presynaptic t-LTD
Conclusion
Conflict of Interest Statement |
drug - resistant tuberculosis and multidrug - resistant tuberculosis ( mdr - tb ) in particular represent a major threat to the fight against tuberculosis globally .
mdr - tb is defined as disease caused by strains of mycobacterium tuberculosis resistant to at least isoniazid and rifampicin , the two most powerful first - line antituberculosis drugs . among the world 's 12 million ( range 1113 million )
prevalent cases of tuberculosis estimated by the world health organization ( who ) in 2011 , the best estimate was that 630 000 ( 5.3% ) had mdr - tb . globally ,
most cases of mdr - tb remain undetected and untreated because of limited laboratory capacity to conduct tests for drug resistance and limited access to second - line treatment , which is very long ( 20 months is recommended for most cases according to current who guidelines ) as well as toxic and expensive [ 13 ] . as with other forms of tuberculosis , mdr - tb can affect people of all age groups , including children ( aged 014 years ) .
the diagnosis of mdr - tb is bacteriological by definition , based on the isolation of strains resistant to medicines . while isolating m. tuberculosis in adults with pulmonary tuberculosis is generally an easy procedure ( the exception is patients who are immunocompromised ) , children mainly have paucibacillary disease , which means that specimens for culture and drug susceptibility testing are often difficult to obtain , particularly from the youngest who can not expectorate sputum . in most cases
adults represent the source of infection for children but household contact investigations are rarely performed as part of routine surveillance activities in resource - limited settings with a high burden of tuberculosis and tend to be confined to special research projects [ 6 , 7 ] .
therefore , the results of drug susceptibility testing from adult source cases are not systematically used to investigate drug resistance in children . for these reasons published reports of drug - resistant tuberculosis in children
are largely from hospital settings [ 811 ] where more efforts can be made to obtain respiratory specimens by gastric aspirates , induced sputum and/or nasopharyngeal aspirates , and bronchoalveolar lavage .
the objectives of the analyses presented in this manuscript are to describe all the available data on drug - resistant tuberculosis among children collected by the who global project on anti - tuberculosis drug resistance surveillance between 1994 and 2011 , and to assess the evidence whether children ( aged < 15 years ) are more or less likely than adults ( aged 15 years ) to have mdr - tb in each country for which data are available .
since 1994 aggregated drug resistance surveillance data have been reported on an annual basis to who , which ascertains the quality and representativeness of the data , performs analyses and disseminates the findings on regular basis [ 1 , 12 , 13 ] .
three main principles are used to ensure data quality : 1 ) data should be representative of the patients with tuberculosis in the country / geographical setting under study ; 2 ) patients ' treatment histories should be carefully obtained and available medical records reviewed to clearly determine whether patients have or have not previously received antituberculosis drugs ; and 3 ) laboratory methods for antituberculosis drug susceptibility testing should be selected from among those recommended by who , and all laboratory processes should be quality - assured in cooperation with a partner supranational reference laboratory [ 14 , 15 ] .
drug resistance surveillance data can be collected via special surveys of a representative sample of patients or continuous surveillance based on routine diagnostic drug susceptibility testing . in both cases ,
all consecutive patients with bacteriologically confirmed ( smear and/or culture positive ) pulmonary tuberculosis are included .
those with extrapulmonary disease and those who are already on treatment for tuberculosis are excluded . in special surveys , in order to select a sample of patients representative of all patients in a geographic setting , either of the following sampling techniques is used : 100% sampling of all diagnostic centres or probability - proportional - to - size cluster sampling . in routine surveillance , in order to ensure representativeness of the data , the coverage of culture and drug susceptibility testing should be high . a detailed description of the criteria used by who to ascertain whether survey and continuous surveillance data meet quality and representativeness standards is provided elsewhere [ 1 , 16 ] .
surveillance data used in this analysis were reported to who disaggregated by history of treatment ( new or previously treated ) , sex ( male or female ) and age ( < 15 or 15 years ) .
the full database of the global project on anti - tuberculosis drug resistance surveillance was investigated for this study .
subnational level data that were not representative of the entire country were excluded from the analysis .
data on susceptibility to isoniazid and rifampicin were reviewed and proportions of mdr - tb in children aged < 15 years and adults aged 15 years were compared . to assess the relationship between mdr - tb and age group , odds ratios with 95% confidence intervals were calculated using logistic regression models run separately for each country . for countries with data from multiple years
, robust standard errors were calculated to account for within - country time dependencies and the longitudinal facet of the data .
stata ( version 12 ; statacorp , college sta , tx , usa ) was used for all analyses .
since 1994 data on susceptibility to isoniazid and rifampicin disaggregated by age group have been reported to who from continuous surveillance or special surveys from a total of 85 countries . among them , 35 countries reported at least one case of mdr - tb in children < 15 years old during the period 20002011 .
figure 1 shows the 85 countries that reported drug resistance surveillance data by age group as well as the 35 countries that had at least one case of mdr - tb in children .
a total of 323 046 patients with tuberculosis who received drug susceptibility testing for isoniazid and rifampicin in these 35 countries , including 6070 children aged < 15 years ( 2% of all those tested ) , were included in the analysis .
for most countries ( 28 ( 80% ) out of 35 ) , data were generated from continuous surveillance systems and for two - thirds ( 23 ( 66% ) out of 35 ) , data were available for more than 1 year .
coverage of drug susceptibility testing in culture - positive cases was 86100% in all age groups except for bulgaria , georgia , hungary and south africa ( range 3672% ) .
countries that reported drug resistance survey / surveillance data disaggregated by age group , 20002011 .
mdr - tb : multidrug - resistant tuberculosis ; tb : tuberculosis ; na : not available . :
new and previously treated tb cases ; : estimates refer to the year of reporting , where multiple years are shown , estimates refer to the latest year of reporting . data from .
odds ratios ( 95% ci ) for mdr - tb in children aged < 15 years compared to adults aged 15 years varied widely among countries , from 0.25 ( 0.023.34 ) to 5.76 ( 0.7643.98 ) . in five countries children
aged < 15 years with tuberculosis had significantly higher odds of harbouring mdr - tb strains compared to adult patients aged 15 years ( germany : 1.58 ( 1.032.44 ) ; namibia : 3.44 ( 1.1310.51 ) ; south africa : 1.52 ( 1.331.74 ) ; uk : 2.36 ( 1.603.49 ) ; usa : 2.35 ( 1.433.85 ) . in australia ,
a weak positive association between mdr - tb and age < 15 years was documented ( 1.86 ( 0.983.53 ) ) . in the remaining 29 countries , no association between mdr - tb and age
forest plot depicting the association between multidrug - resistant tuberculosis ( mdr - tb ) in children ( aged < 15 years ) versus adults ( aged 15 years ) in countries reporting at least one mdr - tb case in children .
data among all ( new and retreated ) cases are presented . among the 36 countries included in our analysis , 10 ( austria , belgium , germany , latvia , namibia , norway , republic of moldova , sweden , uk and usa ) reported at least one case of mdr - tb in children aged
the odds of harbouring mdr - tb was not significantly different between these two groups of children .
this study is the first analysis of levels of mdr - tb among children using a very large dataset that has been developed over 10 years by the who global project on anti - tuberculosis drug resistance surveillance .
the results suggest that , in a given setting , the proportion of mdr - tb in children and adults with bacteriologically confirmed tuberculosis is broadly similar , a finding consistent with reports from a few small - scale surveys conducted in the central african republic , india , south africa and the usa [ 11 , 1820 ] . in none of the countries in our study was the risk of mdr - tb in children significantly lower than in adults . at the same time , levels of mdr - tb in children are highly variable among countries , but insufficient data on potential risk factors mean that further research is needed to understand this heterogeneity .
the global dataset that we analysed illustrates that drug resistance in children is reported mainly by high - income countries with continuous surveillance systems based on routine diagnostic drug susceptibility testing of all bacteriologically confirmed tuberculosis cases .
continuous surveillance represents the most appropriate approach to monitoring of drug resistance , but it requires good laboratory infrastructure that is generally not available in resource - limited settings . since the countries included in our analysis are a convenient sample and not representative of global regions , pooled estimates of the burden of mdr - tb in children have not been calculated .
only seven countries were able to identify mdr - tb in children through special surveys conducted among representative samples of patients with tuberculosis .
surveys are generally not designed to accurately measure mdr - tb in a selected group of patients , such as children , as this would require very large sample sizes . in addition , obtaining ethical clearance for surveys involving children is very complex in some settings and this is sometimes used as a justification for excluding children from enrolment in surveys .
novel survey approaches in screening , sampling and diagnosis that would allow the measurement of drug resistance in children in countries with limited laboratory capacity need to be explored .
a new molecular technology has been recently introduced for the rapid diagnosis of tuberculosis and tuberculosis resistant to rifampicin .
the tool , named xpert mtb / rif assay ( cepheid , sunnyvale , ca , usa ) , has the potential to facilitate the diagnosis of drug resistance in smear - negative patients , including in children .
two studies have suggested that the xpert mtb / rif assay can facilitate the diagnosis of drug resistance in children [ 22 , 23 ] , but more work should be done to improve the sensitivity of the test in patients with paucibacillary disease . among the countries included in our analysis , a particular concern is the elevated risk of mdr - tb in children documented in namibia and south africa , two southern african countries with a high prevalence of hiv .
if confirmed by further data , this finding has important implications for tuberculosis and mdr - tb control . as it is rare for children to develop drug resistance during their treatment , detection of mdr - tb in this age group
is usually a sensitive indicator of recent transmission of drug - resistant strains from contacts present in the environment in which they live .
the fact that in germany , the uk and usa children appear to have a significantly higher risk of mdr - tb compared to adults also requires further evaluation .
contact investigations that are routinely performed in these countries could have played a role in this finding . in these countries
the epidemic of tuberculosis is largely driven by migration [ 2427 ] and foreign - born patients with tuberculosis are known to have higher levels of drug resistance compared to those born in the country . in western european countries
this is a strong indication of household transmission and highlights the need for better prevention and diagnosis of tuberculosis and mdr - tb in children and in particular among the youngest .
research on effective chemoprophylaxis regimens for children exposed to patients with mdr - tb is important .
the fact that in our analysis children aged < 15 years represented 2% of all cases who received drug susceptibility testing is in line with the proportion of children among all cases notified with tuberculosis in 2011 ( 2% ) .
our analysis has two main limitations that are intrinsic to the use of programmatic surveillance data .
first , in a few countries , data on the age of tuberculosis patients were missing ( 8% of patients who were tested for drug susceptibility in south africa and 23% in namibia and italy ) .
second , the inherent challenges involved in diagnosing tuberculosis and mdr - tb in children , described above , are likely to affect the validity of surveillance data . although survey and surveillance data used for this analysis met the representativeness and quality criteria defined by who , it is not possible to completely rule out selection bias introduced by the difficulties in diagnosing tuberculosis in children and by contact investigations in countries where those are routinely performed .
our analysis from a subset of 10 countries showed no significant difference in levels of resistance between children aged < 5 years and children aged 514 years .
this reinforces the hypothesis that , although obtaining specimens for culture from the youngest children is often difficult and drug - resistant tuberculosis is more likely to be underdiagnosed , younger children have a similar likelihood of harbouring drug resistant strains than older children . given the limited availability of data for this analysis this finding should be confirmed by larger studies . in conclusion , this analysis suggests that while the problem of mdr - tb in children is largely unknown and often unreported [ 4 , 5 , 11 , 28 ] , a child with tuberculosis is as likely as an adult with tuberculosis to have mdr - tb . to improve the identification of mdr - tb in children for treatment and for surveillance purposes , household contact investigation of all patients with mdr - tb
in addition , children should be systematically included in all surveillance activities , including drug resistance surveys when routine surveillance is not in place .
more broadly , the data illustrate the need for intensified efforts to develop better tests for the diagnosis of tuberculosis and mdr - tb in children and to improve the availability of paediatric drug formulations for the treatment of children with tuberculosis and mdr - tb . | multidrug - resistant tuberculosis ( mdr - tb ) can affect persons of any age , but it remains unknown whether children are more or less likely than adults to have mdr-tb.representative drug resistance surveillance data reported to the world health organization between 1994 and 2011 were analysed to test the association between mdr - tb and age group ( children aged < 15 years versus adults aged 15 years ) , using odds ratios derived by logistic regression with robust standard errors.of 85 countries with data from nationwide surveys or surveillance systems , 35 reported at least one paediatric mdr - tb case .
aggregated data on age and drug susceptibility testing for 323 046 tuberculosis cases notified in these 35 countries were analysed .
odds ratios for mdr - tb in children compared to adults varied widely between countries . in germany , namibia , south africa , the uk and the usa , mdr - tb was positively associated with age < 15 years . in the remaining countries no association was established.despite the limitations intrinsic to the use of surveillance data and to the challenges of diagnosing childhood tuberculosis , our analysis suggests that proportions of mdr - tb in children and adults are similar in many settings .
of particular concern is the association found between age < 15 years and mdr - tb in southern african countries with high hiv prevalence . | Introduction
Methods
Results
Discussion |
interface fluid syndrome ( ifs ) can develop after laser in situ keratomileusis ( lasik ) . if ifs occurs , intraocular pressure ( iop ) measurements become unreliable . as a result ,
glaucomatous optic neuropathy progresses , followed by a detectable increase in iop and a rapid decline in visual function .
reports have described ifs cases resulting from increased iop secondary to postoperative steroid administration or to corneal endothelial dysfunction triggered by scleral buckling surgery for retinal detachment , a shallow anterior chamber after trabeculectomy , or uveitis . to our knowledge
, no reports have described the development of ifs because of uncontrolled iop after lasik during glaucoma management in the absence of these triggering factors . in this study
, we report on a patient who underwent lasik after iop had been controlled using topical antiglaucoma medications .
two years later , despite the absence of triggers such as steroid use or a history of previous ocular surgery , ifs developed in association with iop elevation and marked loss of visual function .
a 23-year - old man was diagnosed with glaucoma at an eye clinic in january 2009 based on elevated iop in the right eye , and treatment with an unspecified topical antiglaucoma medication was initiated .
one month later , the patient was informed that the iop had normalized , and he spontaneously terminated the use of antiglaucoma eye drops .
approximately 6 months later , the patient underwent lasik for myopia at a lasik center .
he underwent several medical examinations after lasik , but he did not report glaucoma at that center .
therefore , he had not used any antiglaucoma medication after lasik . in september 2010 , an eye doctor at another clinic measured an iop of 29 mm hg in the right eye and 16 mm hg in the left eye using noncontact tonometer ( nct ) .
topical latanoprost 0.005% ( pfizer inc , new york , ny ) once daily and topical timolol maleate 0.5% twice daily in the right eye were initiated , and the patient was referred to kitasato university hospital for further management .
at the hospital , goldmann applanation tonometry ( gat ) revealed iops of 13 and 14 mm hg , and nct revealed iops of 13.9and 15.2 mm hg in the right and the left eye , respectively .
no opacity or edema was observed in the flap or the interface , and there was no inflammation in the anterior chamber .
funduscopy revealed cup - to - disc ratios of approximately 0.9 in the right eye , along with superior and inferior rim thinning , and 0.7 in the left eye .
an attached referral form indicated that the humphrey field analyzer ( hfa ; carl zeiss meditec inc , dublin , ca ) mean deviations ( mds ) were 25.28 db in the right eye and 1.85 db in the left eye using the swedish interactive threshold algorithm standard 30 - 2 program .
the patient 's medical history revealed that before undergoing lasik , the patient had worn contact lenses to correct 8 diopters ( d ) of myopia , with the assumption that the measured iop of 4 to 5 mm hg was underestimated . on follow - up , the iop in the right eye decreased to 9 to 11 mm hg ( gat ) until december 2010 . on june 6 , 2011 ,
the visual acuity ( va ) of the right eye was hand motion , and gat measurement was impossible because the inner edges of the 2 fluorescein semicircles in the prism head were blurred and irresolvable .
the iop was presumed to be high ( at least 30 mm hg ) based on digital palpation and the positioning of the outer edges of the fluorescein semicircles .
an intravenous mannitol drip was immediately administered , and the iop decreased to 24.0 mm hg , as measured using an nct .
oral acetazolamide ( 500 mg / d and 2 types of antiglaucoma eye drops were prescribed .
pachymetry measurements indicated that the central corneal thickness was 540 m in the right eye and 490 m in the left eye .
the corneal endothelial cell densities were 2414/mm in the right eye and 2521/mm in the left eye .
minimal opacity was detected in the flap interface , and no substantial water gap was observed based on slit - lamp examination ( figure 1 ) ; however , an optically empty space corresponding to an interface fluid pocket was detected using axsun anterior optical coherence tomography ( kitasato university , kanagawa , japan ) .
anterior segment findings for the right eye on july 4 , 2011 . an anterior segment optical coherence tomography image of the right eye .
the arrow indicates a small empty space corresponding to an interface fluid pocket visualized using axsun anterior optical coherence tomography ..
on july 13 , 2011 , a trabeculectomy with mitomycin c ( mmc ) was performed on the patient 's right eye .
this pressure remained stable at 2 mm hg for 1 month ; subsequently , an average iop of 5 mm hg was maintained during the first postoperative year .
after surgery , va improved slightly from the preoperative level of light projection to hand motion .
a temporal island of the visual field , as measured by goldmann kinetic perimetry , remained unchanged after surgery . on july 23 , 2012 , iop was stable at 5 mm hg in the right eye , but was increased to 37 mm hg ( as measured by gat ) in the left eye , accompanied by minimal corneal edema .
systemic acetazolamide ( 750 mg / d ) was prescribed , but was insufficiently effective .
no symptoms of ifs were observed in the right eye ; however , a trabeculectomy with mmc was performed on the patient 's left eye on august 1 , 2012 .
in july 2013 , the iops were 6 mm hg in the right eye and 7 mm hg in the left eye ( as measured by gat ) . at this time point , the right eye va was hand motion , whereas the uncorrected va of the left eye was 1.2 ( 20/16 ) .
a fold was observed on the corneal flap interface in the right eye 2 years postoperatively ; this fold diminished over time , but did not completely resolve .
there were no significant differences between the preoperative and 6-month postoperative hfa md values ( 2.23 db and 2.20 db , respectively ) .
ifs , which is associated with inaccurately low measurements of central iop because of cushioning of the fluid - filled pocket , can result from increased iop secondary to postoperative steroid use or corneal endothelial dysfunction after vitreous surgery or trabeculectomy .
a study of human eye bank corneas reported 2 mechanisms of ifs : increased iop ( the high - iop form of ifs ) and corneal endothelial dysfunction ( the endothelial cell damage form of ifs ) . in the current case ,
no steroid treatment was administered before the onset of ifs , and specular microscopy produced unremarkable findings .
this case was classified as the high - iop form of ifs despite a minimal increase in corneal thickness and opacity under the flap because there was no opacity or edema in the flap itself .
both hamilton et al and kang et al reported that ifs is associated with glaucoma , but the mechanisms underlying ifs differed between these 2 studies .
the former report indicated that iop increased with steroid use , whereas the latter report cited corneal endothelial dysfunction resulting from aggressive surgery and 5-fluorouracil intervention as the possible cause of increased iop .
the case described here may be the first reported instance in which ifs developed because of uncontrolled iop during glaucoma management in the absence of triggering factors such as steroid - induced iop elevation or corneal endothelial dysfunction .
dawson et al classified ifs into stages ranging from 0 to 3 based on the degree of fluid retention in the flap interface . using this staging system ,
the right eye in the current case would be classified as stage 2 ; the left eye would be categorized as stage 1 , which is often referred to as pressure - induced interlamellar stromal keratitis .
owing to this delay , the corneal flap might have been stretched by the interface fluid that had accumulated under the flap . as a result ,
even after the interface fluid was absorbed and the space under the flap decreased , the stretched flap did not recover , leading to shriveling of the flap and the sustained presence of a fold at 2 years after surgery . because the central visual field was lost in the right eye , it was impossible to determine how the corneal fold affected the vision of this patient ; however , if a corneal fold had developed in the left eye , we would predict a delay in visual recovery ( figure 2 ) .
we must investigate the reason why the vision in his right eye was nearly lost .
one reason could be the fact that he stopped seeing a doctor and terminated his use of antiglaucoma medication because he was informed that the iop had normalized . once patients are diagnosed with glaucoma , they must continue to be followed by doctors throughout their lives .
it is possible that the explanation provided by the doctor at the first clinic regarding the disease of glaucoma was insufficient .
another reason could be that lasik was performed on the eye without sufficient information about the probability of glaucoma progression and the difficulty of glaucoma management after lasik .
it is well known that the iop is often underestimated after lasik . in this case , on the first visit to our hospital , iop measurements of 13 mm hg in the right eye and 14 mm hg in the left eye were obtained via gat . given the power of the contact lenses ( 8 d ) before lasik surgery , underestimation by approximately 4 mm hg is thought to occur .
this result suggests that the corrected iop might be approximately 17 to 18 mm hg .
according to the target iop used in the advanced glaucoma intervention study , the iop in this patient first reached the targeted iop .
however , to predict the appropriate iop to be maintained for the management of glaucoma in this case , iop and the visual field should be monitored for a prolonged period .
even if there had been no elevation of iop , reducing the iop might have been necessary in the current case . the determination of whether or not treatment is required should be based on frequent medical evaluation and examination . however , one must consider the possibility of an increase in iop because it is not easy to control iop based on underestimated iop measurements using gat
. cases with normal tension glaucoma are unlikely to develop ifs as occurred in this case because the increase in iop in this case is unusual .
alternatively , in glaucoma cases involving a prior increase in iop , iop can continue to increase during the disease course even if temporary control of iop has been achieved .
if lasik is performed in such cases , the treatment may be insufficient because of underestimation of the typical iop .
in fact , the measurement of iop can become difficult at high - iop levels .
thus , lasik should not be performed on eyes with glaucoma because of the high risk of elevated iop . | abstractthis study sought to describe a glaucoma patient with interface fluid syndrome ( ifs ) induced by uncontrolled intraocular pressure ( iop ) without triggering factors after laser in situ keratomileusis ( lasik).case report and review of the literature.a 23-year - old man with open - angle glaucoma underwent bilateral lasik for myopia in 2009 .
two years later , the patient reported sudden vision loss .
the iop in the right eye was not measurable using goldmann applanation tonometry ( gat ) , but was determined to be 33.7 mm hg using a noncontact tonometer .
ifs was diagnosed based on the presence of space - occupying interface fluid on anterior segment optical coherence tomography images . after a trabeculectomy was performed , the iop decreased to 10 mm hg , and gat measurement became possible .
however , the corneal fold remained visible in the flap interface .
six months later , the iop in the left eye increased , and a trabeculectomy was performed during the early stages of this increase in iop . following this procedure ,
the iop decreased , and visual acuity remained stable.in glaucoma cases that involve a prior increase in iop , iop can continue to increase during the disease course even if temporary control of iop has been achieved .
if lasik is performed in such cases , the treatment of glaucoma becomes insufficient because of underestimation of the typical iop .
in fact , the measurement of iop can become difficult because of high - iop levels .
therefore , lasik should not be performed on patients with glaucoma who are at high risk of elevated iop . | INTRODUCTION
PRESENTING CONCERNS
CLINICAL FINDINGS
DIAGNOSTIC FOCUS AND ASSESSMENT
THERAPEUTIC FOCUS AND ASSESSMENT
FOLLOW-UP AND OUTCOMES
DISCUSSION |
the human genome project had made the scientific community and public believe that all biology and medicine would become understandable after the sequencing of the dna . as biology is much more complicated than the structure and function of nucleic acids ,
the study of living systems has now expanded past genomics based on the rationale that it is the protein products of the gene and not simply gene expression that have effects and cause disturbances at the cellular level .
its advent has provided the hope of discovering novel biological markers for use in the screening , early diagnosis and prediction of response to therapy .
mass spectrometers ( mss ) like matrix - assisted laser desorption / ionization time of flight ( maldi - tof ) ms , surface - enhanced laser desorption / ionization time of flight ( seldi - tof ) ms , electro spray ionization ms and fourier transform ion cyclotron resonance ms have enabled the study of molecular mechanisms of cancer with complex fluids and tissue samples with a good sensitivity and resolution .
proteomic technologies like two - dimensional ( 2d ) polyacrylamide gel electrophoresis ( page ) , isotope - coded affinity tags , seldi - tof , multidimensional protein identification technology , protein arrays and protein chips promise application at the bedside for discovering protein patterns that distinguish disease from disease - free states with a high sensitivity and specificity .
cervical cancer is one of the leading causes of cancer morbidity and mortality in women worldwide .
more than 98% of the cases are related to a human papilloma virus ( hpv ) infection .
researchers are working on the identification and functional verification of host proteins associated with hpv e6 and e7 oncoproteins .
this may provide useful information for understanding cervical carcinogenesis and development of cancer - specific markers .
in addition , proteomic profiling of altered proteins by anticancer drugs on cervical cancer may contribute to providing the fundamental resources for investigation of disease - specific target proteins , elucidation of novel mechanisms of action and development of new drugs . to date , the quest to develop a non - invasive diagnostic test for endometriosis has mostly concentrated on the levels of cytokines and growth factors that are involved in inflammation , angiogenesis and tissue remodeling present in serum , peritoneal fluid , endometrium and endometriotic lesions . as this has not yet translated into the development of such a diagnostic test ,
proteomic techniques are now being employed to identify proteins that are potential biomarkers of the disease .
the urgent need of biomarkers accurately detecting early - stage epithelial ovarian cancer has prompted many research groups to enter in a search for specific peptide signatures that may discriminate transformed cells from those of the normal ovarian microenvironment .
ca-125 , the most widely used biomarker for ovarian cancer , does not have a high positive predictive value , and it is only effective when used in combination with other diagnostic tests [ table 1 ] .
a combination of mass spectra generated by new proteomic techniques such as seldi - tof- and artificial intelligence - based informatic algorithms have been used to discover a small set of key proteins in order to discriminate between normal and patients with ovarian cancer .
serum protein pattern analysis might be applied ultimately in medical screening clinics as a supplement to thediagnostic work up and evaluation.[69 ] breast cancer is one of the most frequent and deadly cancers worldwide . although survival of patients has increased over the last decade in relation to screening programs and post - operative adjuvant therapies ( hormone therapy , chemotherapy ) , many patients die from metastatic relapse .
research studies of molecular alterations have successfully elucidated mechanisms of mammary oncogenesis and identified key genes such as erbp-2 , tps3 , ccnd1 , brca1 and brca2 .
it has now allowed considerable therapeutic progress by targeting hormone receptors as well as erbb2 and her2 receptors . a proteomic - based approach utilizing 2d - page and newer technologies such as laser capture microdissection and highly sensitive mass spectrometry methods
are currently being used together to identify lower abundance proteins that are differentially expressed between defined cell populations .
high - density protein arrays , antibody arrays and lysate arrays are novel technologies still in development phases , which will enable identification of validated targets in small biopsy specimens .
seldi - tof analysis enables the high - throughput characterization of lysates from few tumor cells , and may be best suited for clinical biomarker studies .
breast cancer studies have used tumor tissue and also biological fluids including serum , plasma , nipple aspirate or ductal lavage material .
breast cancer proteomics has already identified the markers of potential clinical interest ( such as the molecular chaperone 14 - 3 - 3 sigma ) . with examples of fibroblast growth factor and h19 , an oncogenic , non - coding mrna ,
proteomics have become a powerful approach for deciphering the complex signaling circuitry involved in tumor growth .
found hsp27 upregulated while 14 - 3 - 3 sigma downregulated in serum of breast cancer patients .
these two biomarkers can also be used for further study in drug design and breast cancer therapy .
recently , liu et al . supported that the analysis of ca binding protein s100a11 expression in breast cancer may be an effective tool that helps in the detection of early - stage breast cancer , and it is a novel diagnostic marker in breast carcinoma .
pre - eclampsia is a pregnancy - specific syndrome and a major cause of maternal mortality .
watanabe et al . sought to identify proteins associated with pre - eclampsia using 2d electrophoresis on sera of six patients with pre - eclampsia and six normal pregnant women , followed by comparison of the profiles .
clusterin was identified by maldi - tof - ms followed by peptide mass fingerprinting , a protein database search and western blot analysis .
mine and colleagues found dynactin , a protein related to cell turnover in placental proteome maps , by novel 2d - immunoblotting analysis .
myers et al . carried out a pilot study to use protein chip technology to determine differences in protein profiles in plasma taken at 26 weeks from women at risk of developing pre - eclampsia .
they found five proteins upregulated significantly in samples from women who subsequently developed pre - eclampsia compared with women who remained normotensive .
recent evidence suggests that a major cause of prematurity - associated neonatal pathology is the fetal and neonatal response to inflammation or infection rather than respiratory distress syndrome , intraventricular hemorrhage , necrotizing enterocolitis and bronchopulmonary dysplasia as the primary causes of pre - term delivery .
proteomic profiling of amniotic fluid provides a precise means for detection of inflammation by revealing the presence of four biomarkers ( defensins-2 and 1 , calgranulin c and a ) that are highly predictive of intrauterine inflammation ( mr score ) .
mr score presents a gradient of disease activity progressing from absent , mild to severe inflammation .
thus , it provides the ability to identify patients who might benefit from interventions in utero in a modern diagnostic therapeutic framework .
proteomic tools are being applied in varied fields related with reproductive function , such as the study of oocyte maturation , spermatogenesis and fertilization in mammals.[2023 ] the identification of specific genes in oocytes and embryos is now possible with the use of powerful tools such as library analysis or subtractions , dna array , comparative analysis of databanks from other mammals and 2d - gel electrophoresis analysis .
finally , rna interference is a useful tool for studying gene function by knocking out the activity of specific genes , and will be used in oocytes and embryos .
amniotic fluid is a potential source of biomarkers for many disorders that may occur during pregnancy or for embryonic abnormalities .
proteomics have already been applied in the analysis of tissues from fetuses with down 's syndrome .
the proteomic analysis of follicular fluid by angelucci et al . revealed identification of a large number of acute phase proteins , including transferrin , ceruloplasmin , afamin , hemopexin , haptoglobin and plasma amyloid protein , suggesting the hypothesis that mammalian ovulation can be compared with an inflammatory event .
several important antioxidant enzymes , i.e. catalase , superoxide dismutase , glutathione transferase , peroxisonase , heat shock protein 27 and protein disulfide isomerase , were also identified .
this indicates that , during maturation , the human follicle is well protected against toxic injury due to oxidative stress .
proteomic tools are being applied in varied fields related with reproductive function , such as the study of oocyte maturation , spermatogenesis and fertilization in mammals.[2023 ] the identification of specific genes in oocytes and embryos is now possible with the use of powerful tools such as library analysis or subtractions , dna array , comparative analysis of databanks from other mammals and 2d - gel electrophoresis analysis .
finally , rna interference is a useful tool for studying gene function by knocking out the activity of specific genes , and will be used in oocytes and embryos .
amniotic fluid is a potential source of biomarkers for many disorders that may occur during pregnancy or for embryonic abnormalities .
proteomics have already been applied in the analysis of tissues from fetuses with down 's syndrome .
the proteomic analysis of follicular fluid by angelucci et al . revealed identification of a large number of acute phase proteins , including transferrin , ceruloplasmin , afamin , hemopexin , haptoglobin and plasma amyloid protein , suggesting the hypothesis that mammalian ovulation can be compared with an inflammatory event .
several important antioxidant enzymes , i.e. catalase , superoxide dismutase , glutathione transferase , peroxisonase , heat shock protein 27 and protein disulfide isomerase , were also identified .
this indicates that , during maturation , the human follicle is well protected against toxic injury due to oxidative stress .
proteomic tools are being applied in varied fields related with reproductive function , such as the study of oocyte maturation , spermatogenesis and fertilization in mammals.[2023 ] the identification of specific genes in oocytes and embryos is now possible with the use of powerful tools such as library analysis or subtractions , dna array , comparative analysis of databanks from other mammals and 2d - gel electrophoresis analysis .
finally , rna interference is a useful tool for studying gene function by knocking out the activity of specific genes , and will be used in oocytes and embryos .
amniotic fluid is a potential source of biomarkers for many disorders that may occur during pregnancy or for embryonic abnormalities .
proteomics have already been applied in the analysis of tissues from fetuses with down 's syndrome .
the proteomic analysis of follicular fluid by angelucci et al . revealed identification of a large number of acute phase proteins , including transferrin , ceruloplasmin , afamin , hemopexin , haptoglobin and plasma amyloid protein , suggesting the hypothesis that mammalian ovulation can be compared with an inflammatory event .
several important antioxidant enzymes , i.e. catalase , superoxide dismutase , glutathione transferase , peroxisonase , heat shock protein 27 and protein disulfide isomerase , were also identified .
this indicates that , during maturation , the human follicle is well protected against toxic injury due to oxidative stress .
looking back , it seems that the major outcome of human genome sequencing has finally been to open the way to exploration of the proteome .
perhaps the most promising outcome of the work reported by scientists is the interface between proteomic technology and bioinformatics .
the rapid explosion in the amount of data being generated by current genomic and proteomic technology already exceeds the analytical capacity of the human mind .
the need for increasing sophistication in data management and statistical interpretation and attention to this aspect of research is critical to its successful translation into clinical practice . | proteomics helps to understand the basic biological processes critical to normal cellular functions as well as the development of diseases .
it identifies the essential components of these processes and exploits these components as targets in the development of new methods to prevent or treat diseases .
proteomics , although in an infancy stage in india , has the potential to complement and further enlarge the wealth of information in medicine , especially in the field of cancer .
this article reviews the recent progress in proteomic techniques and their applications in the field of obstetrics and gynecology . | Introduction
Proteomics in Gynecology
Proteomics in Obstetrics
None
Others
Conclusion |
learning disorder is one of the issues that attract a great deal of attention . the term was primarily suggested by samuel kerck in 1963 to describe a group of children who had problems in developing language , speech , reading , and communicative skills .
students suffering from these disorders , without some special helps , have weak performance in such skills ; their friends and families consider them as incapable ; and as a result , they have a low self - esteem and motivation .
on the other hand , children suffering from learning disorders form a group of exceptional children with a normal appearance and normal or even higher iq .
most of the time we can not identify them before school age , but with entering into school , particularly at their 1 and 2 grade , their problems will gradually appear in reading , writing , calculating , and spelling .
these children may have problems in learning one or several academic skills , but merely poor educational performance in one area or even in several areas is not enough to identify children suffering from learning disorder , because poor educational performance may result from factors other than learning disorders ( 1 ) . in dsm-5 ( diagnostic and statistic manual of mental disorder ) learning disorder
is renamed as specific learning disorder ; and reading , writing and mathematical disorders that were considered as independent disorders are now considered as specifier of specific learning disorder , meaning that after this psychiatrists or clinical psychologists will never say that a child suffers from reading disorder , but instead they will suggest that the child suffers from specific learning disorder with the specifier of reading ( 2 ) .
one of the factors that students may be involved with and has not been given enough attention is emotion failures or alexithymia .
inability in cognitive processing of emotional information and regulation of emotions is called alexithymia ( 3 ) .
sifneos defines people suffering from alexithymia as people with physical - mental symptoms who can not identify and express emotions .
emotion failures have three characteristics : difficulty in identifying feelings , difficulty in describing feelings and externally - oriented thinking styles ; difficulty in identifying feelings occurs when an individual is in distress trying to make a distinction among his / her feelings ; difficulty in describing feelings occurs when an individual can not express what he / she has felt emotionally ; and externally oriented thinking occurs when an individual tends to think about affairs externally , which is in direct contradiction with internally oriented thinking .
people suffering from alexithymia or emotion failures exaggerate normal bodily incitements , misinterpret bodily signs of emotional provocation , show their emotional distress through bodily complaints and in measures taken for treatment try to find physical signs ( 3 ) .
recent researches indicate that emotion failures have a negative impact on psychological and emotional welfare and a dangerous factor in causing emotional distress , psychological problems and lack of mental health .
there is a relationship between emotion failures and pain , arthritis , overweighting , blood pressure , irritable bowel syndrome , depression ( 5 ) , self - injurious behaviors ( 6 ) , nervous lack of appetite , overeating , and job exhaustion ( 7 ) .
self - harms or self - injurious behavior has previously been used in the field of education services related to learning disability , and the term self - injury had been used a lot in the case of mental health ( 8) . self - harm behavior is defined as a deliberate act to destroy or change body tissues that damage tissues ( 9,10 ) .
this term includes behaviors like self - injury ( self - beating ) and many other indirect forms of body injury ( 11,12 ) .
whatever their culture is , youths ( teenagers ) show self - harm behaviors ( 13 ) .
moreover , self - harm behavior is defined as behaviors resulting from an individual s damage , bodily or psychic harm and violent behavior towards himself .
some researchers have reported that a high percent of students with learning disability have had self - harm behavior .
the degree of self - injury in students suffering from learning disability varies from 1.7% to 24% ( 15 ) , but it is reported 41% in some official studies ( 16 ) . fifty two systematic researches on self - harm behaviors were published from 2005 to 2011 worldwide ; in these studies , the frequency of self - harm behavior among students was 16.1 , whereas that of clinical samples varied from 40% to 80% ( 17 ) .
emotion regulation training is one of the effective factors in decreasing emotion failures and self - harm behaviors in students suffering from specific learning disorder .
regulation of emotion includes all conscious and unconscious strategies used to increase , preserve and decrease emotional , behavioral and cognitive parameters of an emotional response and it is referred to the ability to regulate experience , and understanding and expressing emotions ( 18 ) .
the study of psychological texts and studies show that regulation of emotion is a very important factor in assessing the health status and having successful social interactions ( 19,20 ) ; and deficiency in regulating emotion is related to some internal disorders such as depression , anxiety and social isolation , and external disorders such a criminality and aggressive behaviors .
emotion regulation training decreases and controls negative emotions and use them in a positive manner . studying the role of emotion regulation in temperament , affection and self - injurious behaviors
indicate that negative emotion regulation strategies predict negative temperament , low satisfaction , low positive affection , and high self - injurious behaviors ; and positive emotion regulation strategies predict low negative affection ( 21 ) .
moreover , there is a relationship between emotion regulation strategies and the decrease in negative emotions and affective events .
furthermore , concentrating on positive strategies of emotion regulation promotes understanding of emotion management ( 22 ) . with respect to the interventions based on regulation of emotions
, previous studies have found the efficacy of such a treatment . in one study , it was revealed that cognitive - emotion interventions are effective in perceiving emotional - social behaviors and in modifying complicated behaviors of children suffering from learning disability ; they believed that such interventions increase students thinking ability with regards to hypothesizing and understanding witty remarks in social relations ( 23,24 ) . in another study , it was found that recognition and regulation of emotions and training the manner of solving social problems with cognitive method had a significant effect in improving the performance of students suffering from learning disability in the case of solving social problems , decreasing unsuitable behaviors of aggression , seclusion and emotion failures .
moreover , the results showed an improvement in students judgment and an increase in their social self - efficacy in compatibility and increasing friendly behaviors ( 25 - 27 ) .
with respect to the role of emotion regulation problems in retention of emotional disorders and self - harm behaviors , it seems that training and applying emotion regulation skills can help improve this area of treatment .
hence , the aim of this study was to answer this question : is emotionregulation training effective in decreasing emotion failures and self - injurious behaviors of students suffering from specific learning disorder(sld ) ?
this research was conducted experimentally through pre - test , post - test and a control group .
research population included all 5 grade male students suffering from specific learning disorder ( case study : 5 grade male students in ardabil in 2015 ) . for sample selection ,
first we selected 294 students from five schools ( 2 classes from each school ) through multi - step cluster sampling ; all students of the selected classes were evaluated through academic achievement test , kay math mathematic test , diagnostic test of reading disorder and test of writing disorder
. then cases who were suspicious of having specific learning disorder underwent a clinical interview . finally , revan intelligence test was usedto identify the lack of any mental disability in the selected students ; and those students with iq score of lower than 90 were omitted from the sample . at the end
although the minimum number of the sample in experimental studies must be 15 ( 28 ) , in this research we selected 40 individuals ( suffering from specific learning disorder ) to increase external validity .
structured clinical interview on the basis of symptoms in dsm-5:in this research , to identify symptoms of specific learning disorder and their specifiers , we used structured clinical interview on the basis of symptoms described for this disorder in dsm-5 .
test of reading disorder : this test was developed by shafiei et al . ( 29 ) in a study titled designing and constructing a screening test to diagnose reading disorder among 1 to 5 grade primary school students in isfahan .
the main part of this test for every grade includes a 100-word reading comprehension text which has been confirmed by the experts and authorities of this field .
this test was conducted on 200 male and female 1 to 5 grade primary school students who were selected randomly from among 1000 students from five different regions of esfahan .
the research was conducted on two groups : one group with reading disorder and a control group .
findings revealed a high correlation between scores of rate and accuracy of reading and the total test score .
the reported test reliability on the basis of cronbach s alpha was 0.77 and difference between the averages of the two groups was significant ( p > 0.01 ) .
with respect to the obtained results , this test can be used as a useful screening test for rapid diagnosis of reading disorder among 1 to 5 grade primary schools students .
kay - math mathematic test : kay - math mathematic test was normalized by kenoli .
it is used to identify advantages and disadvantages of students in different mathematical areas . on the basis of cronbach s alpha ,
test of writing expression : in this research , we used dictation tests developed and validated by falahchay .
validity of these tests was confirmed by experienced applicants and teachers ; and on the basis of researchers method its reliability was estimated to be 0.91 to 0.95 ( 31 ) .
revan intelligence test : this test was developed by revan ( 32 ) in england to measure intelligence among 9 to 18 age groups ; it contains 60 items ( five 12-item series ) . in this test
, the average of internal validity coefficient is 0.90 and the average of retest reliability coefficient is 0.82 .
the obtained test correlation through intelligence test of wechsler , stanford - binet , labyrinth proteus and goodenough ranged from 0.40 to 0.75
.
scale of emotion failures ( tas-20):torento emotion failures ( alexithymia ) scale of children and teenagers is taken from the original version of a questionnaire related to adult alexithymia ( 33 ) .
this 20-item questionnaire is graded on the basis of a 3-point scale ( totally , somewhat and not at all ) , and three factors of difficulty in identifying feelings ( 7 items ) , difficulty in describing feelings ( 5 items ) and objective thinking style ( 8 items ) are measured on the basis of a 5-point likert scale ranging from point one totally disagree to point five totally agree ( 34 ) . in this scale ,
questions 4 , 5 , 10 , 18 , and 19 are graded inversely ; questions 2 , 4 , 7 , 12 , and 17 , questions 1 , 3 , 6 , 9 , 11 , 13 , and 14 and questions 5 , 8 , 10 , 15 , 16 , 18 , 19 , and 20 evaluate difficulty in describing feelings , difficulty in identifying feelings and concentration on external experiences , respectively .
the obtained reliability for dependent variable and independent variables has been proven to be high with cronbach s alpha coefficients of well over 0.75 .
the reported correlation coefficients of micro - scales of this test with psychic symptom checklists range from 0.17 to 48 ( 34 ) . in the persian version of the scale of alexithymia , the coefficients of cronbach s alpha for the total alexithymia , and the three sub - scales of difficulty in identifying feelings , difficulty in describing feelings and objective thinking are 0.85 , 0.82 , 0.75 , and 0.72 , respectively .
questionnaire of self - injurious behaviors : this questionnaire is a self - report questionnaire , whose reliability and validity has obtained by gratz ( 35 ) . the items in this questionnaire are collected through clinical observations , self - reporting by people with self - injurious behaviors , and other self - injurious behaviors reported in other texts .
the finished form of this questionnaire was changed by lundh , karim and quilisch from 17 to 16 items ( 36 ) .
method of conducting research : after acquiring permission and referring to schools and collecting samples , we randomly selected 20 students as the experimental group and 20 as control the group from all students identified with specific learning disorder .
when briefing the participants about the aim of the study , we asked them to participate in a course to treat this disorder . before starting the training methods , we tested both groups with a pretest and asked them to fill the questionnaires .
treatment sessions included eight 90-minute group sessions once a week , which was held in a place determined by ardabil ( a city in northwest of iran ) education office . at the end of this course , we tested both groups through a posttest .
the obtained data were analyzed using spss software and multivariate analysis of variance ; p<0.05 was considered as significant .
a summary of functional instructions of the of emotion regulation training is presented in table 1 .
structured clinical interview on the basis of symptoms in dsm-5:in this research , to identify symptoms of specific learning disorder and their specifiers , we used structured clinical interview on the basis of symptoms described for this disorder in dsm-5 .
test of reading disorder : this test was developed by shafiei et al . ( 29 ) in a study titled designing and constructing a screening test to diagnose reading disorder among 1 to 5 grade primary school students in isfahan . the main part of this test for every grade includes a 100-word reading comprehension text which has been confirmed by the experts and authorities of this field .
this test was conducted on 200 male and female 1 to 5 grade primary school students who were selected randomly from among 1000 students from five different regions of esfahan .
the research was conducted on two groups : one group with reading disorder and a control group .
findings revealed a high correlation between scores of rate and accuracy of reading and the total test score .
the reported test reliability on the basis of cronbach s alpha was 0.77 and difference between the averages of the two groups was significant ( p > 0.01 ) .
with respect to the obtained results , this test can be used as a useful screening test for rapid diagnosis of reading disorder among 1 to 5 grade primary schools students .
kay - math mathematic test : kay - math mathematic test was normalized by kenoli . it is used to identify advantages and disadvantages of students in different mathematical areas .
on the basis of cronbach s alpha , the coefficient of reliability in this test is 0.80 ( 30 ) .
test of writing expression : in this research , we used dictation tests developed and validated by falahchay .
validity of these tests was confirmed by experienced applicants and teachers ; and on the basis of researchers method its reliability was estimated to be 0.91 to 0.95 ( 31 ) .
revan intelligence test : this test was developed by revan ( 32 ) in england to measure intelligence among 9 to 18 age groups ; it contains 60 items ( five 12-item series ) . in this test
, the average of internal validity coefficient is 0.90 and the average of retest reliability coefficient is 0.82 .
the obtained test correlation through intelligence test of wechsler , stanford - binet , labyrinth proteus and goodenough ranged from 0.40 to 0.75
.
scale of emotion failures ( tas-20):torento emotion failures ( alexithymia ) scale of children and teenagers is taken from the original version of a questionnaire related to adult alexithymia ( 33 ) .
this 20-item questionnaire is graded on the basis of a 3-point scale ( totally , somewhat and not at all ) , and three factors of difficulty in identifying feelings ( 7 items ) , difficulty in describing feelings ( 5 items ) and objective thinking style ( 8 items ) are measured on the basis of a 5-point likert scale ranging from point one totally disagree to point five totally agree
questions 4 , 5 , 10 , 18 , and 19 are graded inversely ; questions 2 , 4 , 7 , 12 , and 17 , questions 1 , 3 , 6 , 9 , 11 , 13 , and 14 and questions 5 , 8 , 10 , 15 , 16 , 18 , 19 , and 20 evaluate difficulty in describing feelings , difficulty in identifying feelings and concentration on external experiences , respectively .
the obtained reliability for dependent variable and independent variables has been proven to be high with cronbach s alpha coefficients of well over 0.75 .
the reported correlation coefficients of micro - scales of this test with psychic symptom checklists range from 0.17 to 48 ( 34 ) . in the persian version of the scale of alexithymia , the coefficients of cronbach s alpha for the total alexithymia , and the three sub - scales of difficulty in identifying feelings , difficulty in describing feelings and objective thinking are 0.85 , 0.82 , 0.75 , and 0.72 , respectively .
questionnaire of self - injurious behaviors : this questionnaire is a self - report questionnaire , whose reliability and validity has obtained by gratz ( 35 ) . the items in this questionnaire are collected through clinical observations , self - reporting by people with self - injurious behaviors , and other self - injurious behaviors reported in other texts .
the finished form of this questionnaire was changed by lundh , karim and quilisch from 17 to 16 items ( 36 ) .
method of conducting research : after acquiring permission and referring to schools and collecting samples , we randomly selected 20 students as the experimental group and 20 as control the group from all students identified with specific learning disorder .
when briefing the participants about the aim of the study , we asked them to participate in a course to treat this disorder . before starting the training methods , we tested both groups with a pretest and asked them to fill the questionnaires .
treatment sessions included eight 90-minute group sessions once a week , which was held in a place determined by ardabil ( a city in northwest of iran ) education office .
the obtained data were analyzed using spss software and multivariate analysis of variance ; p<0.05 was considered as significant .
a summary of functional instructions of the of emotion regulation training is presented in table 1 .
the meansd age of the experimental group is 10.20.44 yr , and those of control group are 10.30.39 yr . ( age ranges : 10 - 11yr ) .
as demonstrated in table 2 , the mean ( sd ) of the pretest total score in the experiment groupwas 71.4 ( 7.39 ) for emotion failures and it was 40.6 ( 5 ) for the posttest in this group .
moreover , the mean ( sd ) of the pretest total score for emotion failures was 63.6 ( 6.63 ) in the control group and the posttest was 65.0 ( 7.79 ) in this group . according to this table , the mean ( sd ) of the pretest total score for self - injurious behaviors of the experiment group was 38.8 ( 2.32 ) and that of the posttest was 24.9 ( 2.82 ) for this group .
moreover , the mean ( sd ) of the pretest total score for self - injurious behaviors of the control group was 37.6 ( 2.30 ) and it was 38.1 ( 2.14 ) for that of the posttest this group .
before using multivariate analysis of variance for observing the hypotheses , we used tests of box and leven . on the basis of box s test , which was not significant for any variable ,
the equality condition of variance / covariance was observed correctly ( p=0.152 ) . on the basis of leven test , which was not significant for any variable , the equality condition of intergroup variances was observed .
the results of wilkes lambda test indicated that group effect was significant on the variables of emotion failures and self - injurious behaviors [ p 0.001 ] .
the obtained results revealed a significant difference between one of the variables of the studied groups .
as indicated in table 3 , the results of multivariate analysis of variance showed a significant difference between the average scores of emotion failures with ( f = 134.91 ) and self - injurious behaviors with ( f = 276.34 ) between the experiment and the control groups ( p<0.001 ) .
hence , it can be concluded that at the posttest level , emotion regulation training will decreaseemotion failures and self - injurious behaviors among students suffering from specific learning disorder compared to the control group
ss= sum of squares , ms= mean square
the aim of this study was to examine the effect of emotion regulation training in decreasing emotion failures and self - injurious behaviors among students suffering from specific learning disorder .
the results indicated that emotion regulation training decreased emotion failures significantly in students suffering from specific learning disorder compared to the control group .
our finding is in line with previous findings ( 5,7,27 ) with regards to the efficacy of emotion regulation group intervention in decreasing symptoms of anxiety and stress , and regulation of emotions .
hence , it is obvious that emotions play an important role in one s life and there is a relationship between emotion regulation as a treatment in modifying emotions and self - esteem and positive social interactions .
emotion regulation will lead to an effective counteraction with stress - making situations ( 22 ) and will increase activity in response to social situations ( 23 ) .
therefore , emotion regulation training can play an important role in improving psychological health and decreasing emotion failures among students suffering from specific learning disorder through making them aware of positive and negative emotions . in justifying this finding ,
it can be noted that positive strategies of emotion regulation have predicted the increase in positive temperament and consequently the decrease in emotion failures .
moreover , the finding supports that of gross and thompson ( 18,19 ) , which revealed a positive relationship between psychological welfare and experiencing positive emotions , and a negative relationship between psychological welfare and experiencing negative emotions . also , it can be stated that since emotion regulation will lead to modification and management of emotions , positive skills of emotion regulation will lead to positive compatibility ; hence
, emotion regulation can play an important role in one s life and increase their psychological welfare and positive emotions .
moreover , we may refer to the point that students suffering from specific learning disorder most likely can not use positive emotions practically in different life situations ; in contrast , they experience high levels of negative emotions which will cause other problems such as negative self - perception , worrying about interaction with other people and unsuitable social performance .
furthermore , the results of multivariate of variance analysis indicated that emotion regulation training had been effective on decreasing self - injurious behaviors among students suffering from specific learning disorder .
this supports ( 6,14,26 ) several studies which showed that emotion regulation training had been effective in prevention and treatment of mental disorders and decreasing self - injurious behaviors .
moreover , it can be noted that self - injurious behaviors of students suffering from specific learning disorder result from negative emotion regulation strategies , which is the outcome of the lack of emotional sufficiency , unsuitable emotional skills , and having a low ability to resolve contradictions .
it seems that these students are not competent in managing theiremotions , controlling theirs and others affections , and developing the necessary social skills to eliminate such obstacles and prevent self - injurious behaviors .
hence , insufficient affective growth , difficulty in organizing behaviors and emotions and having negative emotions are characteristics of those who commit self - injurious behaviors ( 21 ) .
emotion regulation may be another reason for justifying this finding , and in particular the positive strategy of emotion cognitive re - evaluation will decrease negative feelings and will increase positive feelings and adjustable behaviors ( 21 ) .
therefore , emotion regulation training for students suffering from specific learning disorder will lead to a situation in which they can decrease negative feelings as well as self - injurious behaviors through the correct use of emotions , awareness of emotions and accepting them , and expressing emotions especially positive ones in real life situations .
moreover , emotion regulation training will lead to a condition in which the students in the experiment group become aware of negative emotions and their negative effect , and try to keep their emotional life healthy through the re - evaluation of emotions in different situations ; taking this approach , they may decrease their physical and psychological problems in particular self - injurious behaviors ( 24 ) .
based on the results of this study , we can infer that using emotion regulation training can be effective in decreasing emotion failures and self - injurious behaviors among students suffering from learning disorder through decreasing negative emotions and increasing the positive ones .
this study was conducted in ardabil , and the studied sample included male elementary school students .
lack of follow - up , and time restriction for providing education were among the other limitations of this study ; and these issues should be taken into account in future studies .
|
background : a great deal of attention has been given to the study of learning disorders .
hence , the
aim of this research was to study the effect of emotion regulation training in decreasing emotion failures
and self - injurious behaviors among students suffering from specific learning disorder .
methods : this was an experimental study with the pre - test , post - test and a control group .
research
population included all 5th grade male students suffering from specific learning disorder ( case study :
5th grade students in ardabil in 2015 ) .
research sample included 40 male students suffering from
specific learning disorder ( sld ) who were selected through multi - step cluster sampling and classified
into two groups : experimental group ( n= 20 ) and control group ( n= 20 ) .
the following tools
were used for data collection : kay math mathematic test , raven intelligence test , reading test of
shafiei et al , falahchay writing expression , emotion failures scale , self - injurious behavior questionnaire
and diagnostic interview based on dsm-5 .
data were analyzed by multivariate of variance
analysis ( manova ) model in the spss software version 22 .
results : the results of manova revealed that emotion regulation training was effective in decreasing
emotion failures in all parameters ( difficulty in describing feelings , difficulty in identifying
feelings , and externally oriented thinking style ) and self - injurious behaviors in students suffering
from specific learning disorder ( p < 0.001 ) .
conclusion : in this study , it was found that since emotion regulation training can have a remarkable
effect on reducing negative emotions and increasing the positive ones ; this treatment can play an
eminent role in decreasing emotion failures and self - injurious behaviors in such students .
| Introduction
Methods
Research Tools
Results
Discussion
Conclusion
Acknowledgements |
the scientific community may view recovery as an outcome defined by its emphasis on symptoms amelioration and ability to function independently .
however for the consumer - focused activists and proponents , recovery is a process toward achieving , among other things , empowerment , hope , and respect .
in contrast to clinical remission , functional recovery requires that a person be able to perform the daily activities that are required for self - maintenance .
harvey and bellack in this context reviewed extensive literature that suggests that an improvement / remission of symptoms of psychotic illnesses is not necessarily linked to improved functioning , nor does there appear to be any close links between either of these factors and well - being .
the task of judging an individual 's functional recovery is not an easy one for health - care professionals .
using clinical judgment alone may not be enough , given the fact that the clinicians are not embedded into the natural environment of those they work with , thereby making it difficult to know how an individual functions in the real world . in psychiatric disorders ,
mental illnesses account for 12.3% of the global burden of diseases , and this is forecasted to rise to 15% by 2020 . as per the version 2
estimates for global burden of a disease study , schizophrenia is the sixth leading cause of years lived with disability . in an australian study , it was reported that as high as 93% of the patients with schizophrenia have some sort of activity restriction . despite having a high level of disability associated with high economic burden on the caregivers and the society due to these disorders ,
their rehabilitation has not gained adequate attention . in india , persons with disabilities ( equal opportunities , protection of rights and full participation )
the government notified the act on january 5 , 1996 , and it has been in effect since february 7 , 1996 .
nearly one - third of the persons with psychotic disorders have significant disability . in the study on determinants of outcome of severe mental disorder initiated by world health organization
, it was found that nearly 50% had only one psychotic episode while 15% had continuous unremitting illness .
thirty - three percent had two or more episodes followed by remission . in the developing countries ,
a complete clinical remission rate was significantly higher as compared with that of the developed countries ( 37% vs 15.5% ) .
the researcher commented that sobering experience of high rates of chronic disability and dependency associated with schizophrenia in high income countries , despite access to costly biomedical treatment , suggests that something essential to recovery is missing in the social fabric. hence the rehabilitation measures need to be molded as per the sociocultural need of the society . in a study done in chennai , india ,
it was reported that 75% of the male patients were found employed at the end of 20 years of follow - up .
the authors commented that the lack of social security benefits and pressure to find work as primary wage earners may have contributed to the high rate of employment besides most patients belonging to the low or middle class with jobs in the unorganized sector as street vendor , sales staff , or domestic help .
again in a multicenter study done in india , it was found that patients with disability due to mental illness suffered more discrimination as compared with their counterparts with physical disability .
they also found that there was very less awareness regarding existing law and social programs .
so , large - scale awareness programs on mental health - related issues are also needed .
this will hasten treatment , improve functioning , and reduce disability . a proper tool for the measurement of disability will help to plan services , programs , and welfare benefits for them .
a positive correlation between duration of untreated psychosis and negative treatment outcome has been replicated in many studies .
long - term hospitalization has been recognized as a contributory factor to disability associated with schizophrenia . in mental hospitals we frequently encounter patients with long duration of hospitalization leading to institutionalization .
so a proper coordination between different agencies of the society is needed for proper handling of these issues .
mental health care has improved over the last century due to advancements in many fields .
the progress in scientific knowledge , development of psychotropicdrugs , replacement of the hospital - centered model by community care aiming at patients comprehensive care , and their social reinsertion are factors that shouldbe stressed . among the numerous fallouts of this
revolution , the most striking were the changes in patients profiles and goals and length of hospitalization .
consequently , old psychiatric hospitals have become general hospitals or , inversely , psychiatric wards were created inside general hospitals .
there have been legal provisions in indiathat provide guidelines for the treatment of mentally ill persons in a hospital setup . the indian lunacy act 1912 considered the mentally ill persons as noncriminal lunatic. after that , there was a change and the mental health act ( mha ) 1987 rephrased the term and made it more humane by replacing the term with mentally ill person. but this act is applicable only to mental hospitals and psychiatric nursing homes .
there is sufficient provision through which a mentally ill person can enter into a treatment facility either voluntarily or involuntarily .
but there is no proper provision for the rehabilitation of the needy persons in the said act .
again due to some orders passed by the legal authorities , it becomes problematic for the treating team to send the mentally ill person back to the community at the earliest possible time which may help in the rehabilitation process .
consequently , we see many patients staying in mental hospitals as long - stay patients .
moreover , many homeless mentally ill persons are brought for the treatment to mental hospitals with reception order under provision of mha 1987 . due to various reasons at times , it becomes difficult for the treating team to reintegrate the person with the family concerned .
there has been no specific measure for dealing with such persons available under the provision of mha 1987 .
this leads to lack of admission facilities for the actively ill patients for unnecessary prolonged hospitalization of this group of chronic patients .
again it bears enormous cost on the health system . in a 3-year follow - up study of 321 discharged state hospital patients ,
the cost of community care was found to be less than half of the estimated cost of state hospitalization .
similar finding is reported by hallam et al . in 1994 and salize et al . in 1996 .
so we need to develop a proper chain of level of treatment for them as per the need of the society in accordance with the cultural norms . in the present study we tried to find out the level of psychopathology and disability in a group of patients with schizophrenia without having proper caregivers staying in a mental health institution for more than 5 years and tried to figure out the possibilities of rehabilitation for them .
the present study was conducted at lokopriya gopinath bordoloi regional institute of mental health , tezpur , assam .
it was established in 1876 as a lunatic asylum . as per the directives of the supreme court
, it has been converted into a postgraduate teaching institute for the mental health disciplines .
the mental health act is followed in the hospital in the treatment of the patients . in the hospital , currently there are 40 patients who are staying in the hospital for more than 5 years .
the inclusion criteria are as follows :
mentally ill persons having stayed in the hospital for more than 5 yearspatients whose family is untraceablepatients who do not have proper family support .
mentally ill persons having stayed in the hospital for more than 5 years patients whose family is untraceable patients who do not have proper family support .
patients having mental retardation . of these 40 patients , 6 women and 5 men have mental retardation and a female patient is dumb .
proper family support we meant patients who do not have their parents alive or were rejected by other first - degree family relatives due to various reasons .
the tools utilized are as follows :
a semistructuredproforma for collecting information regarding sociodemographic variables , circumstances of admission to the hospital , duration of hospital stay , availability of the family of the personsicd-10 criteria for clinical description and diagnosis guidelines : international classification of diseases and related health problems , tenth revision ( icd-10 ) is the current diagnostic guideline for diagnosing the health problems across the globe adopted by the world health organization , whose chapter v ( f ) is related to the behavioral problemsbrief psychiatric rating scale ( bprs ) : it was developed by overall and gorham in 1962 .
it is an 18-item scale that measures major psychotic and nonpsychotic symptoms in individuals with major psychiatric disorders , particularly schizophrenia .
it assesses the symptoms on an 8-point scale ( where 0=not assessed and 7=extremely severe)world health organization disability assessment schedule ii ( whodas ii ) : it is an instrument based on the international classification of functioning , disability and health developed by world health organization for standardized cross - cultural measurement of health status .
it has various forms from self - administered to clinician administered . in the current study we utilized the 6-item clinician proxy version that assesses disability in six domains , namely , understanding and communication , getting around , self - care , getting along with people , householdwork / school activities , and participation in the society .
a semistructuredproforma for collecting information regarding sociodemographic variables , circumstances of admission to the hospital , duration of hospital stay , availability of the family of the persons icd-10 criteria for clinical description and diagnosis guidelines : international classification of diseases and related health problems , tenth revision ( icd-10 ) is the current diagnostic guideline for diagnosing the health problems across the globe adopted by the world health organization , whose chapter v ( f ) is related to the behavioral problems brief psychiatric rating scale ( bprs ) : it was developed by overall and gorham in 1962 .
it is an 18-item scale that measures major psychotic and nonpsychotic symptoms in individuals with major psychiatric disorders , particularly schizophrenia .
it assesses the symptoms on an 8-point scale ( where 0=not assessed and 7=extremely severe ) world health organization disability assessment schedule ii ( whodas ii ) : it is an instrument based on the international classification of functioning , disability and health developed by world health organization for standardized cross - cultural measurement of health status .
it has various forms from self - administered to clinician administered . in the current study we utilized the 6-item clinician proxy version that assesses disability in six domains , namely , understanding and communication , getting around , self - care , getting along with people , householdwork / school activities , and participation in the society .
sixteen ( 57.14% ) of them are illiterate ; 12 of these patients have some of their family members alive and are traceable but refused to take responsibility of these patients .
families could not be traced for the rest of the patients due to various reasons despite taking help from the different agencies both governmental and nongovernmental .
four ( 14.29% ) of these 28 patients were admitted after the implementation of the mha 1987 on voluntary basis , and all of them were women .
she was refused by her father 's side also . in the case of one such patient
, there is no one to look after her , as her sons also suffer from the same disorder .
other patients were admitted under provision of indian lunacy act 1912 . table 1 shows the difference of age among men and women along with their duration of stay in the hospital .
although the total mean score on the bprs is more forwomen , a significant difference was not observed with that of men .
the mean score on item cs1 differed significantly with that of the rest items . cs5 and
cs6 were not assessed as the patients were staying in hospital for a prolonged period , which is self - explanatory .
in the present study we found that of the 28 patients , 19 ( 67.86% ) were men ; 84.21% of the men were single , while 66.67% of the women were single .
the average age of the patients matches with that of the findings of fleck et al .
the higher mean age for men may be due to increased rates of hospitalization . in earlier days
, the male patients were brought to mental hospitals for their increased severity of the symptomatologies .
again , it is seen that the seeking of treatment in the case of female patients are less , and even if the treatment is sought it is usually at a later stage .
the mean duration of hospital stay is significantly higher for men as compared with that forwomen , which is self - explanatory .
the highest period of hospital stay formen is 55 years and for women it is 19 years .
these findings are in line with those of the brazilian study : 42.86% of the cohort had some relative alive , but they refused to take responsibility of the patients .
it has been observed that since the inception of mha 1987 , only four patients turned out to be for long - term hospitalization .
all of them were women , and they were either on voluntary basis or with reception order .
many patients suffer from inhuman treatment in the society , and they prefer to stay in a protected environment as found in hospitals . to counter this prejudice against the ill - treatment of the mentally ill persons , proper awareness programs need to be designed .
the institute has seen a major change in its facilities in the last 10 years .
initially it was neglected and the appointed doctors did not have qualification in psychiatry . after the order was passed by the supreme court , appropriate manpower were recruited and it is being converted in to a center of excellence in manpower development . hence the quality of care for the patients improved and there has been sufficient effort done by treating team for reintegration of the patient back to the community .
but the difference between the two groups did not have significant difference . in a study done in italy
, the bprs scores were grouped into three categories for the analysis : < 35 ( absent or mild symptoms ) , 3565 ( moderate symptoms ) , and > 65 ( severe symptoms ) .
if we follow that classification , then we have 11 patients who scores < 35 .
again in the same study , scores on the das sections were collapsed into the categories of < 1 ( no or mild disability ) , 1 to < 2 ( moderate disability ) , and 2 ( severe disability ) . in our study
, we found that the scores in the area of understanding and communication are significantly more as compared to the scores in the other areas assessed .
thus from the above classification it can be said that in our group of cohort , severe disability is present in the area of cs1 in the whodas ii ; whereas in cs2 , cs3 , and cs4 , moderate disability is seen . again
this can be attributed to the relatively older age of the cohort . in a study done in kuwait
, it was reported that two - thirds of the long - stay patients can be successfully treated in the community and they have suggested building up of community homes accommodating 810 patients per home .
the mha 1987 is silent on the issues relating to the rehabilitation of the psychiatric patients .
setting up of proper rehabilitation centers including community shelter homes , sheltered workshop , and foster homes at various levels will be an appropriate step for their integration into the society .
moreover , for community level rehabilitation some indigenous modes can be applied as per the capability of the patient .
they can be employed in those centers , for example , as helpers in temples , chowkidars in markets , and helpers in cultivation .
again proper implementation of the disability act is desirable along with awareness about it among the public .
certification and setting up of appropriate centers for rehabilitation as mentioned above is the need of the hour .
families with mentally ill person should receive certain facilities for proper assistance of the patients .
. the mental health institutes should take appropriate measures in bringing awareness among pubic along with proper research in this area .
they should be able to attract the nongovernmental organizations to work in this field and also offer help in their activities .
the strength of this article is that it looks into the problems associated with long stay in the case of patients with schizophrenia .
it also looked into the mater of destitution for the patients who were not reintegrated with the family after the abolition of the indian lunacy act and implementation of the mha 1987 .
the limitation of the study is that a proper evaluation of the psychopathology and disability along with quality of life at various time intervals was not done .
moreover , a study in similar group of persons after their reintegration in the community at various levels will be very informative . | background : recovery from schizophrenia is a complex concept . remission of symptoms of psychotic illnesses is not necessarily linked to better functioning . among various causes of disability , mental illnesses account for 12.3% of the global burden of diseases .
long - term hospitalization has been recognized as counterproductive and a contributory factor of disability associated with schizophrenia . under various circumstances ,
many persons with mental illness are brought to mental hospitals but the measures taken for their rehabilitation and follow - up care is insufficient.aim:in the present study we tried to find out the level of psychopathology and the associated disability in a group of patients with schizophrenia who have been staying in a mental health institution for more than 5 years due to lack of proper caregivers in the society or in their home.materials and methods : the study is conducted in a mental hospital of northeast india . of the 40 patients staying for more than 5 years in the hospital , 28 fulfilled the criteria for inclusion .
the brief psychiatric rating scale and world health organization disability assessment schedule ii ( who dasii ) were used for those patients .
analytical statistical methods were used subsequently.results:male patients were significantly older and had prolonged duration of stay .
but the level of psychopathology did not differ significantly between male and female patients . under whodasii , understanding and
communication problems are more prominent in both the groups .
of late , there are very few cases that required prolonged stay in the hospital .
many patients are fairly functional and are considered suitable for care outside hospital premises.conclusion:prolonged hospital stay is associated with more disability . shorter hospital stays with proper family support is an ideal way to counteract this issue . however , due to the inadequate mandate in the mental health act ( mha ) 1987 and lack of other supportive facilities , patientsoften tend to languish in the hospital for longer duration , causing harm to the patients and draining scarce state resources .
it is therefore necessary to revisit the mha 1987 and provide adequate rehabilitative measures for the needy patients . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION |
estimate body composition of children is not an easy task , since the relationships between body components during growth are not constant as in adults .
anthropometric - based equations remain an adequate alternative for determining the body composition of pediatric populations in field settings .
however , the advent of new technologies has enabled new ways for body composition assessment , thus , rendering the traditional anthropometry inaccuracy as a representative standard .
there are some methodological concerns when using the current anthropometric models : several equations have been developed using a two - compartment model ( 2c model ) either using hydrostatic weighing [ 2 , 3 ] or other densitometric techniques ; however , this approach relies on assumptions , specifically concerning the fat - free mass ( ffm ) density ( 1.1 g / cc ) and hydration ( 73.2% of total - body water within the ffm ) that , although stable for adults , may vary substantially during growth .
in fact , from childhood through adolescence , total - body water ( tbw ) decreases whereas bone mass increases which means that ffm density is lower than 1.1 g / cc , at younger ages , approaching that value when chemical maturity is reached .
therefore , 2c models tend to overestimate fm and underestimate ffm in children , and their use as a criterion method for developing anthropometric - based models is inaccurate . for that reason , the use of 3c and 4c compartment models are preferred for determining the body composition in children , since fewer assumptions are used as more ffm components are measured .
the advent of dual - energy x - ray absorptiometry ( dxa ) , measures of fm , bone mineral content ( bmc ) , and lean soft tissue ( lst ) are obtained .
hence , dxa can be considered as a 3c model since the estimates of three components are obtained as follows : first by separating pixels into those with soft tissue only ( fm plus lst ) and those with soft tissue plus bmc , based on two different photon energies ( lower and higher energies , resp . ) .
the dxa provides precise [ 6 , 7 ] and accurate [ 811 ] measures of fm and ffm ( as lst plus bmc ) when compared to multicompartment models .
in addition , given its low risk and quick assessment , the dxa use has been implemented in large multicenter studies , including the national health and nutrition examination survey .
however , the availability of dxa in the clinical and fields settings is limited given its cost .
therefore , simple solutions are required for estimating body composition in children and anthropometric parameters , such as skinfolds and circumferences , which have been widely used as bedside techniques in different contexts .
thus , the aim of this study was to develop and cross - validate multicomponent - anthropometric - based equations to simultaneously estimate fm , bmc , and lst in a male pediatric population , using dxa as the criterion method .
the study followed a cross - sectional design , consisting of a sample of 408 young males between 8 and 18 years of age .
the subjects were recruited voluntarily from a population of students that could be engaged in systematic programs of sports , or not , considered as athletes and nonathletes , respectively .
the athletes came from sports centers ( n = 177 ) and nonathletes from schools ( n = 231 ) .
children with a regular sports practice were engaged in soccer field ( n = 143 ) , athletics ( n = 11 ) , football court ( n = 20 ) , and judo ( n = 3 ) .
the nonathletes came from public ( n = 142 ) and private ( n = 89 ) school .
medical examinations were conducted to assure that children were healthy and not taking medications that could affect metabolism , appetite , or growth .
the number of white participants was relatively higher ( n = 270 ) compared to blacks ( n = 79 ) , hispanics ( n = 50 ) , and asians ( n = 9 ) , classified by race self - declared .
this sample comes from a large ethnic mixture and previous analysis that showed no statistical differences in interracial body composition ( data not shown ) , so , the final samples ( n = 408 ) were considered as uniform . to determine the sample size
, we followed the bolfarine and bussab recommendation , and based on a pilot analysis with subjects presenting a large variance in the dependent variable ( fm ) , the estimation of the desired error ( 1.25% ) and confidence interval ( 95% ) determined that at least 300 subjects would be required .
the study followed the guidelines and regulations of directing human research , and agreements were obtained from the parents or guardians to all procedures .
the approval was granted by the ethics in research department of the school of physical education and sport , university of so paulo ( cep332007/eefe/04.04.2007 - 2006/32 ) , which also adhere to the helsinki declaration .
each subject was evaluated in the laboratory , in the morning after an overnight fast , in a single session , and always by the same examiner , and all measurements , were performed during a period of three months . before the measurements the subjects were asked to empty their bladders .
dressed in shorts and shirt , the total - body dxa examination was applied using the system for total - body scan , according to manufacturer 's guidelines .
the anthropometric measures were performed according to the literature recommendations [ 14 , 15 ] , summarized below .
whole and regional body composition was estimated with a dxa scanner lunar dpx - nt ( ge medical , software lunar dpx encore 2007 version 11.40.004 , madison , wi ) .
the software identified the physical characteristics of ethnicity , gender , and age and automatically adjusted the scan mode , speed , and images resolution . body weight was determined from dxa , and the dependent variables of interest were fat mass ( fm , kg ) , bone mineral content ( bmc , kg ) , and lean soft tissue ( lst , kg ) .
the subject body mass , height , and seating height were measured with a digital scale ( filizola , pl 200 , campo grande , ms ) and a fixed wall stadiometer ( sanny professional - es2020 , so paulo , sp ) , respectively . the skinfolds ( biceps , triceps , subscapular , chest , midaxillary , suprailiac , vertical abdominal , horizontal abdominal , mid - thigh , and medial calf ) , circumferences ( chest , relaxed arm , contracted arm , forearm , wrist , waist , abdominal , hip , proximal thigh , and calf ) , and breadths ( biacromial , biiliac , chest , elbow , bitrochanteric , wrist , knee , and bimalleolar ) were measured by conventional procedures stated in the literature [ 15 , 16 ] using sanny scientific equipment .
the maturity offset was predicted by gender - specific regression equations based upon noninvasive techniques , using chronological age , height , body mass , sitting height , and leg length measurements .
the method predicts years from peak height velocity ( phv ) according to the mirwald et al .
equation for boys :
( 1)phv=9.236 + 0.0002708(lhsh)0.001663(alh)+0.007216(ash)+0.02292(wt / ht100 ) ,
where lh stands for legs height ( cm ) , sh for seating height ( cm ) , a for age ( years ) , wt for body weight ( kg ) , and ht for height ( cm ) .
chronological ages were based on birth year and grouped in decimal values adjusted to the nearest integer . to ensure the precision of the results , intra evaluator technical errors of measurement absolute ( tem ) and relative ( tem% ) were calculated ( table 1 ) . in subsequent days , duplicates for all measures were applied in thirteen subjects , when the results were always within the expected tolerance limits .
, chicago , il ) was used to analyze the data of descriptive statistics ( mean , standard deviation , range , technical error of measure relative , absolute , and the confidence interval
ci 95% ) were used to describe the sample , and correlation coefficient was applied to verify the basic assumption of the relations between dependent and independent variables . for developing the multicomponent anthropometric equation ,
a multivariate regression model ( nym = nx(r+1)(r+1)m + nm ) was utilized as diagonal mutual analysis , parameter estimation , and the least squares errors method by r - free software . when the choice of remaining variables the following criteria were used ( a ) maintenance of a high correlation between independent and dependent variables , ( b ) uniformity of the data , ( c ) centralized distribution of the residuals , ( e ) reducing the number of independent variables while maintaining the highest levels of significance after stepwise , with adjustments by the pillai approach to test the f values , ( f ) multicollinearity tolerated , ( g ) determining the values in a multivariate model , and ( h ) remaining of the high precision and validity of the final model .
for performing the validation of the models we used thepress statistic . from the deletion of an observation , proposed equations with the remaining sample are conducted , and the process is repeated .
the press statistic is defined as the sum of squares of residuals ( press ) in :
( 2 )
press
= i=1n[yiy^(i)]2 .
thus , a model with a high degree of predictability for excluded observations gives the value of the rpress ( close to 1 ) and a standard estimated error ( seepress ) near zero . in summary ,
the validation procedure that uses press is similar to the application of the equation to an independent sample .
characteristics of the total sample are shown in table 1 , including range ( minimum maximum ) , tem , tem% , and confidence interval ( 95% ) .
table 2 presents the correlation matrix within some of the 32 independents , including size measures , skinfolds , circumferences , breadths , and maturation by phv with and the dependent variables . a centered distribution of the residuals ( differences )
was observed for the response components ( figure 1 ) . from all 32 initial variables used as predictors of the dependent variables ,
a stepwise regression was performed individually for fm , bmc , and lst in order to select the common variables for all three components , with the higher significance level .
the number of predictor variables was reduced after 27 eliminations , and a final model was obtained with five independent variables and high precision ( r ) , meaning that the models largely explained the variance of the dependent variables ( table 3 ) . here
the estimated parameters vector ( ) of the model was obtained for each variable , resulting in a single model for all dependent variables ( table 3 ) . from the multivariate parameters , it was possible to predict simultaneously each body component ( fm , bmc , and lst ) , considering the interrelationship of dependent variables , unlike the traditional methods ( one - dimensional analysis ) .
multicollinearity within the final independent variables was tested , and cases were found in which the variables were highly collinear . in those cases , an independent variable in the model was eliminated and performed the ratio between the largest and the lowest eigenvalues , until resulting in a final product with only moderate multicollinearity ( = 167.0637 ) .
table 4 summarizes mean values and standard deviations for the descriptive characteristics obtained from the dxa scan by age group .
the fm showed increases up to the age of 13 , which tend to stabilize .
all other significant differences for subsequent ages in bmc were found from 11- to 12-year - old age group ( p = 0.021 ) , from 13- to 14-year - old age group ( p = 0.001 ) , and from 14- to 15-year - old age group ( p = 0.001 ) ; for lst , the differences were found from 11- to 12-year - old age group ( p = 0.001 ) , from 13- to 14-year - old age group ( p = 0.001 ) , and from 14- to 15-year - old age group ( p = 0.001 ) .
the correlations between the predicted values ( of the model ) and those observed ( by dxa ) in fm , bmc , and lst ( figure 2 ) showed an increased dispersion at higher scores of body composition . the press related statistics ( r ) ,
adjusted coefficients of determination ( adj r ) , and standard error of estimate ( seeresidual ) for residual analysis are showed in table 3 . in this study , the error was determined by the outcome of y - observed minus y - estimated .
parameters of internal validation included rpress statistic and seepress , as observed in table 3 .
the model is valid according to the assumptions defined in the methodology , where rpress should be close to 1 and seepress near 0 .
then , the final model for each dependent variable could be expressed as
( 3)fm= 0.0857 height+0.3139 weight + 0.1970 sksi+0.2350 skhab0.6571 phv , bmc=0.0032 height+0.0392 weight 0.0095 sksi0.0105 skhab+0.0525 phv , lst=0.0820 height+0.6419 weight 0.1964 sksi0.2321 skhab+0.7047 phv ,
where sksi stands for suprailiac skinfold ( mm ) , skhab for horizontal abdominal skinfold ( mm ) , and phv for peak height velocity ( years ) .
the multicomponent model approach presented in this study showed a high correlation in most comparisons between independent and dependent variables ( table 2 ) , suggesting the possibility of using these variables as an alternative method .
the multicomponent determination of body composition during growth finds application in field and clinical settings allowing specific definition for the component of interest . in sports , for example ,
monitoring the training process to reduce fm or increase lean mass may be of interest to technicians , aiming to improve sports performance .
for most cases , the uncertainty of which component has contributed to an increase in body weight may compromise an adequate decision for exercise prescription , since the true relationships between fm and ffm are not known .
therefore , an accurate and precise body composition estimation is required using simple methods . in the present study ,
the greater associations of fm were observed with skinfolds , bmc , with growth components ( height , weight , breadth , and pvc ) and lst with growth components and circumferences ( table 2 ) , expressing the real expected relationships between the types of measurements and the components measured in a combined prediction .
this is so because the combined estimation of the parameters produces zero restrictions on coefficients of other equations .
the relationship between the predictors and the response variables must be strong . however , the robustness of the model can be compromised if there is multicollinearity between independent variables .
therefore , the elimination of independent variables was required , and those who are not commonly used in the literature or without a high predictive significance were removed . apart from being a practical model , the least number of possible variables should be considered . in this case , the estimates of regression coefficients become very sensitive to small changes in the planning matrix .
the variations of the estimators are high , making testing of h0 : j = 0 versus ha : j 0 diff = 0 ; therefore , important independent variables could mistakenly be removed .
one of the assumptions of the linear model is that the rank of the matrix ( xx ) is equal to k + 1 .
thus , in addition to moderate multicollinearity ( = 167.0637 ) and near the bottom of this classification ( from 100 to 1000 ) and the determinant away from zero , the rank axis of xx matrix is complete . then , there is its classical inverse ( xx ) [ det ( xx ) 0 ] , multiplied by the right side of the normal equation system , allowing the obtaining the least squares estimator .
the classical inverse matrix procedure was calculated , resulting in the root close to the efficiency characteristic , once the issue of moderate multicollinearity was observed , near to lower limit .
the gain in predictive efficiency in the use of multivariate analysis in relation to various regressions is well proven . basically , this is true because the efficiency jointly estimates the parameters and produces zero restrictions on coefficients of other equations , with the same error as vectors of estimated betas , enhancing the prediction .
so far , only the fm has been predicted by pediatric anthropometric models , determined by anthropometric - based models which have been developed against densitometric techniques in children [ 2 , 3 , 2426 ] showing relatively low ability in predicting the variability of the reference method ( r < 0.80 ) when compared to those developed from the present study ( table 3 ) .
however , investigations can be controversial when very young or very obese children are involved in the observations , and the literature expresses caution in the estimation of body composition when bmi is high [ 1 , 28 , 29 ] .
the model proposed in this study was able to predict the body composition also of overweight subjects according to the cole et al .
cutoff points ( 11 cases ) . even if these cases were removed , the accuracy of the model remained similar , confirming a possible generalization of the predictive equations for assessing overweight children .
the method of internal validity adopted confirmed the effectiveness of the model to predict the components of body composition with a high internal validity ( rpress = 0.94 to 0.98 ) and low proportional errors of estimation ( seepress = 0.01 to 0.09 ) , that is , a score rpress = 0.9490 for fm ( table 3 ) may explain about 94.90% of the variability in predicting new observations in independent samples , compared with about 98.08% of variability in the original data , explained by the least squares ( r ) method .
also , the high independent rpress ( 94.02% and 98.04% ) , respectively , for bmc and lst indicates the strength of the model in predicting the lean body composition of young males between 8 and 18 years of age .
these results provide the generalizability of the model , even when the variance of body composition is high .
the low dispersion of the measured and predicted values for the body components ( figure 2 ) seems to confirm this hypothesis . to facilitate a better understanding of the practical utility of the model ,
we show the following example for predicting fm , bmc , and lst in a 13-year old boy ( table 5 ) . after obtaining , the measures ( independent variables ) of height , weight , maturation ( phv ) , and skinfolds ( suprailiac and horizontal abdominal )
the products of each measure , multiplied by its coefficient regression , result in absolute values ( kg ) for fm , bmc , and lst .
a limitation of this study is that although dxa was used as a reference method to develop our model , this technique is not considered the gold standard for pediatric populations . a four - compartment model ( 4c model )
is actually the most strong model for accurately assesses body composition in children as it accounts for the variability of the main ffm components . though its use is recommended as criterion , this method is time - consuming and requires sophisticated equipment , specialized technicians , and high costs which make it difficult for use in large samples .
in addition , the 4c model is not free of errors , considering the number of required techniques necessary for determining the main ffm constituents ( water and mineral )
. therefore , the use of dxa is an alternative chosen by several investigators to develop predictive equations for children and adolescents [ 25 , 3338 ] .
in fact , a recent study revealed dxa as a precise and valid method for body composition assessment .
another limitation that needs to be addressed is the ethnical differences of this sample , who could limit the generalization of the equations to other populations .
therefore , further studies are recommended that examine the accuracy of the models before its application .
concluding , new anthropometric - based model for assessing body composition of children and adolescent males was proposed . considering the unavailability of sophisticated instruments in field and clinical settings , these models proved to be a valid and alternative solution to estimate body composition in a male pediatric population . | the aim of this study was to propose and cross - validate an anthropometric model for the simultaneous estimation of fat mass ( fm ) , bone mineral content ( bmc ) , and lean soft tissue ( lst ) using dxa as the reference method .
a total of 408 boys ( 818 years ) were included in this sample .
whole - body fm , bmc , and lst were measured by dxa and considered as dependent variables .
independent variables included thirty - two anthropometrics measurements and maturity offset determined by the mirwald equation . from a multivariate regression model ( ymn = x(r + 1)(r + 1)nm + nm ) , a matrix analysis was performed resulting in a multicomponent anthropometric model .
the cross - validation was executed through the sum of squares of residuals ( press ) method .
five anthropometric variables predicted simultaneously fm , bmc , and lst .
cross - validation parameters indicated that the new model is accurate with high rpress2 values ranging from 0.94 to 0.98 and standard error of estimate ranging from 0.01 to 0.09 .
the newly proposed model represents an alternative to accurately assess the body composition in male pediatric ages . | 1. Introduction
2. Methods
3. Results
4. Discussion |
tobacco is consumed in two forms : the smoked tobacco products , like cigarettes and shisha ( water pipe ) and the smokeless tobacco ( st ) .
also known as moist snuff or spit tobacco , is held in the mouth between the cheeks and gums instead of being smoked .
the dip rests on the inside lining of the mouth usually for a period depending on the user 's preference , between few minutes to an hour .
the st is primarily used in central asia , iran , afghanistan , pakistan , tajikistan , india , and in europe , like sweden .
the prevalence of st use in india is 20% , and significantly higher in males . in the united states ,
5.2% of young adults , between the ages of 18 and 25 , and 3.2% adults over the age of 26 , used st in 2006 . in sweden , around 20% of the adults used st .
there are no precise figures available on the exact prevalence of st usage in the gulf region , but most observers agree that is widely used by workers coming from asia , and it has been recently noticed that these products have gained popularity among adult and adolescent citizens .
proliferation of restrictions on the smoking area is the main reason behind many people using st , especially for the young , below 18 years of age .
other reasons are that it is presumed to be a less harmful alternative for those having difficulty quitting smoking and its easy affordability .
we report the case of a young man who presented with acute myocardial infarction . a thorough review of the risk factors
a previously healthy 21-year - old man presented with central chest pain that awakened him from sleep two hours before , associated with nausea , vomiting , dizziness , and shortness of breath .
he had used dipping st in the form of niswar ( sweka ) five to ten times per day [ figure 1 ] continuously for one year , which was preceded by the habitual use of both types of smoking for another year .
there was no past history of cardiac disease , diabetes , hypertension , hyperlipidemia , drug abuse or family history of coronary artery disease .
dipping smokeless tobacco in the form of niswar ( sweka ) on physical examination the heart rate was 100 beats / minute , regular , and the blood pressure was 100/70 mmhg .
a 12-lead electrocardiogram ( ecg ) showed st elevation in leads v2-v5 , i , avl with reciprocal st - segment depression in leads ii , iii , and avf [ figure 2a ] .
in the first few minutes of presentation , the patient developed cardiac arrest due to ventricular tachycardia ( vt ) , which rapidly disintegrated to ventricular fibrillation .
v5 , i , and avl , with reciprocal st - segment depression in leads ii , iii , and avf .
( b ) patient 's electrocardiogram after successful fibrinolyitic therapy fibrinolyitic therapy was given at presentation as well as intravenous nitrate and heparin .
the chest pain subsided and st elevation was markedly reduced after 30 minutes [ figure 2b ] . apart from short runs of nun - sustained vt , he remained asymptomatic until the third hospital day , when the chest pain reappeared and a coronary angiogram was performed which revealed a 70% proximal left anterior descending artery ( lad ) lesion , 40% left circumflex artery ( lcx ) lesion , and a normal right coronary artery [ figure 3a ] .
even though the patient was on continuous intravenous nitrate , further intra - coronary nitrate failed to relieve a presumed coronary spasm .
angioplasty was performed and followed by a bare metal stent implantation for the culprit lesion in the lad [ figures 3b and c ] .
the laboratory tests showed a peak in the troponin - t level , of 5.056 ng / ml ( normal < 0.1 ng / ml ) , and creatine kinase mb of 350.6 u / l ( normal < 24 u /
the drug screen for cocaine , amphetamine , ethanol , barbiturates , benzodiazepines , methadone , opiates , phencyclidine , propoxyphene , and tetrahydrocannabinol was negative .
the thrombophilia screen for factor v leiden mutation , antiphospholipid antibodies , proteins c and s , and antithrombin levels was negative .
transthoracic echocardiography during admission revealed left ventricular segmental wall motion abnormalities and an ejection fraction of 28% .
( a ) coronary angiogram reveals a 70% proximal left anterior descending artery ( lad ) lesion and lcx : left circumflex artery ; ( b ) angioplasty shows the waist ; ( c ) lad after stent implantation .
many studies have shown contradictory results with regard to the cardiovascular effects of st . some have reported an association between st and cardiovascular complications.[57 ] some studies showed lower risk in comparison to those who smoked tobacco , while some studies failed to find such an association.[1012 ] bolinder et al . , reported an increased prevalence of circulatory disorders as well as cardiovascular mortality among snuz users in 1994 , but in this study the tobacco - specific nitrosamine content of the swedish snus was substantially reduced through changes in the manufacturing process . while , more recently hergens et al . , found no increased risk of mi from swedish snus ( rr 0.99 ; 95% ci 0.90 1.10 ) , the risk of fatal mi was higher among heavy users ( 50 g per day ) ( rr 1.96 ; 95% ci1.08 3.58 ) . the cardiovascular short - term effect of st use have been documented .
the effects produced by nicotine were an increase in blood pressure and heart rate , plus an increase in cardiac stroke volume and coronary blood flow , as well as vasoconstriction .
nicotine is the main component of tobacco and is found to reach a higher concentration in st users in comparison to smokers .
furthermore , the endothelial dysfunction , which is a risk factor for mi , was found to be caused by st use .
hergens , hypothesized that the direct cardiovascular effect of nicotine could be the cause behind the severity of mi , and oral moist snuff contained substances such as fatty acids and flavonoids that could have a protective effect for mi , while , carbon monoxide , oxidant gases , and polycyclic aromatic hydrocarbons were substances present in cigarettes .
these substances and not nicotine could be the cause of an increase in the risk of mi among smokers . although it has not been reported before with st use , coronary artery spasm caused by smoking is well - recognized specially in young patients .
a presentation we thought the patient had coronary spasm and he was kept on nitrate infusion .
the failure to respond to intracoronary nitrate during angiography and the clear balloon waist during dilatation of the lad lesion raised the possibility of atherosclerotic plaque rupture behind the mi .
coronary spasm due to illicit drug abuse was excluded angiographically , as well as by negative history and an unrevealing drug screen .
the absence of clear risk factors for cad in this patient , except for st use , draw attention to the likelihood of rapid acceleration and / or enhanced vulnerability of atherosclerosis attributable to st use . due to the lack of information about the constituents of different types of st in different countries , the previous impression that st is less harmful should be handled carefully and abandoned until further studies are conducted .
its alternative use to quit smoking needs to be handled carefully . a prompt call for restriction and prohibition is advised . | dipping smokeless tobacco ( st ) is used worldwide .
we report a case of acute myocardial infarction in a young patient , who consumed smokeless tobacco ( sweka ) for over one year .
st may be as harmful as smoking and carries adverse cardiac complications .
a prompt call for restriction and prohibition is advised and its alternative use to quit smoking must be abandoned . | INTRODUCTION
CASE REPORT
DISCUSSION
CONCLUSION |
anastomotic leakage and protective urinary diversion in pediatric pyeloplasty continue to be a controversial issue among pediatric urologists ( 1 , 2 ) .
some surgeons prefer a tubeless repair , while others use some varied combination of instruments , including an internal ureteral stent , nephrostomy tube , or a nephron - ureteral stent ( 1 ) along with a perinephric drain and/or urethral bladder catheter ( 3 , 4 ) .
the pediatric literature reports a complication rate of 12% for the stented group and 14% for the un - stented group ( 4 ) .
in this article , we attempt to demonstrate that a single percutaneous externalized nephroureteral ( nu ) 5-fr catheter as the sole instrument of drainage provides sufficient protective measure in pediatric pyeloplasty and also prevents leakage .
in a prospective clinical trial study , we performed 148 open pyeloplasties on 142 infants and children at the bahrami pediatric hospital ( tehran university of medical sciences ) over a seven - year period from 2005 - 2012 .
all cases in this study involved primary repair , although some were recurrent cases , and others had malrotated and/or horseshoe kidneys .
we excluded patients with a single kidney ( three cases ) and some difficult recurrent cases ( seven cases ) from our study population .
the exclusion was intended to provide more protective measures to prevent leakage and its consequences . in these excluded cases
all patients underwent preoperative renal ultrasound , nuclear diuretic renography ( dtpa ) , and a dmsa renal scan with the measurement of differential renal function ( drf ) and vcug .
the degree of hydronephrosis in our patients was classified in accordance with the society of fetal urology ( usa ) scheme .
open pyeloplasty was performed via a 2.5 - 3.5 cm transverse posterior lumbotomy incision using a modified anderson - hynes technique .
the modification involved the creation of a triangular flap from the lowest portion of the renal pelvis for performing an anastomosis to the laterally spatulated healthy proximal ureter with a length of 15 - 18 mm .
the abnormal stenotic segment of the ureter was then removed . here , our intention was to create a funnel - shaped ureteropelvic junction ( upj ) .
we then made multiple side holes 10 mm apart in the 6 - 7 cm terminal portion of the 5-fr catheter .
the posterior layer of the pelvis flap was anastomosed to the spatulated ureter in the first step using 6 - 0 polyglactin sutures in a separate fashion .
the catheter was then pulled through from the 2-mm skin stab wound with a right angle clamp into the gerota fascia .
the fine right angle clamp was placed into a lower calyx and then passed out through the parenchyma to grasp the catheter and pull it through into the pelvis .
then the catheter was sutured to the renal capsule with 4 - 0 chromic in a purse - string fashion to prevent postoperative dislodgement , and the catheter was placed across the anastomosis and down to the mid ureter .
we emphasize the proper and careful placement of this catheter to ensure that at least two holes stay within the pelvis to allow the largest volume of urine to drain externally as well as the easy passage of urine down to the ureter .
the catheter was further secured to the skin at two points with nylon sutures , looped under the dressing , and then set to gravity drainage ( figure 1 ) .
postoperatively , the catheter was flushed every two hours with 2 ml of normal saline for 48 hours in the hospital in order to prevent blockage by blood clots . in addition
all patients were discharged two days postoperatively and were instructed to uncap the catheter and leave it to drain for 10 days at home under closed and sterile conditions . at the time of discharge from the hospital , 3 mg / kg trimethoprim - sulfamethoxazole
was administered as a prophylactic agent for children and 10 mg / kg cephalosporin for infants and then continued for six weeks in each case .
a contrast study was performed 12 days postoperatively , and the radiographic appearance was recorded .
if no leak were identified , the catheter was removed in the clinic , which was the case for all patients .
we routinely sampled the urine from both the catheter and the urethra for analysis and culture before the contrast study .
any complications that arose , such as poor catheter functioning , premature catheter dislodgement , urinary tract infection , blockage , and leakage around the catheter , were recorded .
the study was approved by the research committee of the hospital affiliated with the tehran university of medical sciences .
the study was approved by the research committee of the hospital affiliated with the tehran university of medical sciences .
we performed 148 open pyeloplasties on 142 infants and children , including 6 with bilateral upj obstruction ( upjo ) and 10 recurrent cases .
our study included 122 boys and 20 girls between the ages of 2 months and 11 years , and 76% of these patients were less than three years of age .
we found that 118 ( 83% ) of our patients had grade-4 hydronephrosis , while 24 ( 17% ) were diagnosed with grade-3 hydronephrosis . in almost all of the patients ,
we encountered no significant difficulties during the intraoperative placement of this externalized nu 5-fr catheter .
unintentional removal of the catheter did not occur in any of the patients when the catheter was in place and the patient was resting at home .
in addition , no blockage or dislodgement of the catheter was noted . a contrast study conducted through the catheter did not reveal any leakage across the repair 12 days postoperatively . through this study
, we were able to examine the whole length of the ureter all the way through to the bladder ( figure 2 ) .
the catheter was removed on the day of the contrast study without requiring further anesthesia during an office visit .
we did not encounter a symptomatic and/or febrile uti during the 12 days while the catheter was still in place .
the parents did not report encountering any difficulties at home , even with small children .
the contrast study administered through a catheter in 148 pyeloplasty procedures identified 5 cases of uvjo , which were then individually and appropriately treated . in this study , symptomatic uti and transient obstructive symptoms occurred in about 10% of participants ( 15 cases ) after stent removal during the following 1 - 3 days .
this was the only significant complication in our study , and it was managed medically without any invasive procedures .
all patients under 3 years of age were admitted to the hospital and were treated with intravenous antibiotics and hydration .
patients who developed febrile uti after the stent removal had no unique findings during the postoperative contrast study . in all of these patients , symptoms of febrile uti and
transient obstructive symptoms subsided after 2 - 3 days , and all except two remained unobstructed on long - term follow - up .
a renal ultrasound scan was obtained six weeks after the pyeloplasty to ensure that the hydronephrosis ( pyelocaliectasis ) was improving .
the diuretic renal scintigraphy ( drs ) and dmsa scanning for measurement of the drf was performed six months after the operation to provide a relative assessment of the overall renal function and washout time .
the t1/2 returned to the non - obstructed range in the first six months postoperatively . in others ,
of course , the renal function remained stable during this interval , and there was no need for concern . a nuclear study conducted one year postoperatively revealed normalization of t1/2 in 146 pyeloplasties ( 8 - 13 minutes ) .
long - term imaging at three years was obtained to look for the delayed cicatrization and re - stenosis of the upj .
success was defined as improvement in hydronephrosis and stabilization or improvement in drf function on dmsa renal scanning along with the normalization of the washout time on the dtpa diuretic renal scan ( drs ) . in two patients (
one bilateral , the other with unilateral upjo associated with a giant abdominal mass and seizure disorder ) , cutaneous pyelostomy was performed as a primary procedure .
the first pyeloplasty was performed six months later ; after catheter removal , uti occurred within two days , took a longer amount of time to resolve , and was managed only with considerable difficulty . in the follow - up evaluation , both patients demonstrated increased washout times .
intraoperatively , the upj seemed to be patent but was associated with a large , thick - walled pelvis .
we assumed that in these two patients , the post - stent removal uti had led to scarring of the anastomosis , although the large , thick - walled pelvis could have interfered with the washout across the anastomosis .
the success rate of open pyeloplasty reported in the published pediatric literature is well in excess of 95% ( 5 ) . the original description of dismembered pyeloplasty advocates for non - stented repair , but as techniques have improved and as more postoperative complications were reported , drainage with stents and nephrostomy tubes have been used more liberally .
however , postoperative drainage has not been uniformly reported in many published articles ( 6 ) .
some authors have recommended a nephrostomy tube either with or without a stent to divert the urine and to keep the anastomosis dry ( 1 ) .
there is general agreement that the upper urinary tract should be drained after pyeloplasty in high - risk patients , such as those with poor renal function , extreme pyelocaliectasis , a single kidney , an inflamed renal pelvis , or a revision pyeloplasty ( 7 ) .
in addition , perinephric drains and urinary bladder catheters are used in a considerable number of cases .
the three most common reasons to use a stent and a nephrostomy tube are to ensure urinary diversion , to retain the ureteral caliber , and to maintain anastomotic patency and alignment .
the main objective of draining the pelvis after pyeloplasty is to prevent urine leakage through the anastomosis .
in addition , postoperative edema and undesirable kinking at the anastomosis site may cause ureteral occlusion that could lead to immediate and prolonged complications and hospitalization .
these complications are worrisome to the surgeon as well as to parents ( 1 , 9 ) ; stenting prevents these complications . as reported in the literature
, urologic complications may occur in both stented and non - stented patients , although they are slightly more frequent in non - stented groups ( 14% vs. 12% , respectively ) ( 4 , 10 - 12 ) .
the nu catheter used in this study allows for maximal drainage of the pelvis , preventing any hydronephrosis secondary to edema of the anastomosis and also any early trans - anastomotic leakage and subsequent peri - anastomotic scarring .
this nu catheter also provides for better alignment of the renal pelvis and ureter and facilitates external access to visualize the reconstructed area radiologically .
this catheter remains in the renal collecting system for only 12 days postoperatively , whereas according to the published literature , routine operations involve a combination of devices , including a nephrostomy tube and a double pigtail ureteral stent , while a penrose drain foley catheter is used as a protective mechanism for 14 days , 2 - 6 weeks , 7 - 10 days , and 24 - 48 hours , respectively ( 13 ) .
dj stenting may be difficult or impossible in infants because of the small size of the uvj ( 14 ) .
in contrast , the nu catheter diverts the upper tract only and does not cross the uvj .
the only notable complication in our series was the occurrence of uti in 15 of our 142 patients ( 148 pyeloplasties ) . in our opinion , the signs and symptoms of uti and transient obstructive symptoms after removal of the stent may indicate anastomotic edema and malfunction , which can take several weeks to resolve , or as a complication of a foreign body ( nu catheter ) in the urinary tract ( debris ) .
we believe that the existence of debris in the stented urinary tract and its associated transient obstructive effects in the ureter may play a role in this complication . in most of these cases
, we found that the urine samples obtained through the external catheter before its removal usually contained a number of white blood cells , red blood cells , and bacteria .
although the fever and positive urine culture seen in patients with dj can be due to reflux ( 14 ) , we have been unable to determine why some patients develop utis after catheter removal while others do not .
two of the most important concerns of an externalized drainage tube are its poor functioning and dislodgement before its intended removal .
when this technique was implemented in our clinical trial , we did not observe any premature dislodgment or unintentional removal .
as previously mentioned , this catheter was the sole method of drainage in our patients .
we emphasize proper placement and securing of the catheter intraoperatively with the aim of keeping it in a fixed position within the renal pelvis for the desired length of time .
many reports in the literature indicate that external drainage techniques are unequivocally associated with longer hospital stays . in our study , all patients were discharged 48 hours postoperatively .
however , in a comparative study , although there was a longer stay for patients with a nephrostomy tube , it had lower overall costs ( 14 ) .
the 48-hour hospital stay was intended to provide acute care management , primarily due to the need for intravenous hydration , antibiotic therapy , parenteral pain control , flushing of the catheter to prevent blockage , and educating parents in caring for the external drainage catheter .
another problem is the inconvenience of having an external drainage device for the child and his or her parents .
of course , the problem is varied in different cultural and social environments . in the opinion of some authors with whom we have had personal communication , performing a contrast study through the tube that crosses
the upj is not very useful in demonstrating leaks in the suture line , nor does it demonstrate patency of the anastomosis that is being stented by the tube .
one other drawback to an externalized ureteral stent as reported in the literature is the increased risk of uti ( as seen in 15 of our patients ) , a prolonged hospital stay , and restricted mobility of the patient postoperatively ( 12 ) .
the creation of local ischemia , pressure necrosis , and subsequent stricture formation , particularly in the small caliber ureters , has also been attributed to the presence of a ureteral stent ( 12 ) .
one clear and main limitation of this study is the lack of a comparative control group .
although a historical control group is not sufficient , in the past we would have applied some additional measures to better ensure appropriate drainage , including a nephrostomy tube in addition to the ureteral stent , perinephric drains , and a foley catheter . with experience
, we decided that a single nu 5-fr catheter as the sole method of drainage without any additional catheter or drain usually addresses the required protection for pyeloplasty . therefore , we set up this descriptive case series using only a nu 5-fr catheter for the pyeloplasty .
this method has not been widely used and also carries the message that in children , a single 5-fr catheter is sufficient for the prevention of postoperative leakage .
there is no fear of dislodgement and migration or mechanical irritation of the bladder trigone , which are often seen with dj catheters .
while these conditions might also occur with nu catheters that have been used for quite some time , they are often associated with the concurrent use of some other protective measures , such as a foley catheter or perinephric drain . in pediatric pyeloplasty for the correction of congenital upjo , radiologic exploration of
, we performed this task with antegrade contrast study through the catheter and found five cases of uvjo .
we treated this second anomaly individually . the use of a percutaneous externalized 5-fr nu ( feeding tube ) with multiple side holes as the sole instrument for diversion after open pyeloplasty was sufficient to prevent anastomotic leakage .
patent anastomosis was achieved in 98.7% of the cases according to long - term follow - up , and there were only a few notable complications .
the catheter was well tolerated and offered the combined advantages of a nephrostomy tube and an internal stent and also allowed for radiologic study of the anastomosis and the distal ureter while obviating the need for a second anesthetic for its removal .
therefore , it can be a good option during pyeloplasty , especially in developing countries with low economies and poor medical facilities .
further research is required to identify ways to prevent the risk of symptomatic uti associated with an externalized nu catheter after its removal .
the use of a percutaneous externalized 5-fr nu ( feeding tube ) with multiple side holes as the sole instrument for diversion after open pyeloplasty was sufficient to prevent anastomotic leakage .
patent anastomosis was achieved in 98.7% of the cases according to long - term follow - up , and there were only a few notable complications .
the catheter was well tolerated and offered the combined advantages of a nephrostomy tube and an internal stent and also allowed for radiologic study of the anastomosis and the distal ureter while obviating the need for a second anesthetic for its removal .
therefore , it can be a good option during pyeloplasty , especially in developing countries with low economies and poor medical facilities .
further research is required to identify ways to prevent the risk of symptomatic uti associated with an externalized nu catheter after its removal . | backgroundpyeloplasty for ureteropelvic junction obstruction correction is a common procedure , but the optimal method for protective diversion after pyeloplasty is still a matter of debate.objectiveshere , we present our clinical trial experience using a single percutaneous externalized nephroureteral ( nu ) 5-fr catheter ( infant feeding tube ) with multiple side holes as the sole instrument of drainage to provide a protective mechanism.materials and methodsin this prospective study , we analyzed the charts of 142 patients who underwent pyeloplasty from august 2001 through october 2008 .
we used a single externalized nu 5-fr catheter with multiple side holes for postoperative upper tract diversion .
the catheter was removed in the office after 10 - 14 days .
complications from the use of this catheter , including poor catheter function , premature dislodgement , urinary tract infection , leakage , urinoma , and anastomotic stenosis , were evaluated .
the operations were performed by two surgeons at two separate centers.resultsin all , 148 pyeloplasty procedures were performed on 142 patients .
the mean hospital stay length was 2 ( 1 - 3 ) days .
a contrast study through a catheter demonstrated excellent drainage with no leakage in all patients . immediately after catheter removal
, febrile urinary tract infection and transient obstructive symptoms and signs occurred in 15 patients.conclusionsusing a percutaneous externalized nu 5-fr catheter was sufficient as a protective measure after open pyeloplasty .
it costs less than other diverting systems , such as dj , and can be removed in the office .
therefore , it can be a safe and cost effective procedure , especially in developing countries where cystoscopic set ups are not readily available .
there were only a few notable complications . | 1. Background
2. Objectives
3. Materials and Methods
3.1. Ethics
4. Results
5. Discussion
5.1. Conclusions |
injection drug use is the second leading cause of hiv and the leading cause of hepatitis c virus ( hcv ) infection in california.1 according to california hiv / aids surveillance data , injection drug use accounts for 10.4% of all newly reported aids cases and 19.1% of cases when male injection drug users ( idus ) who also report having sex with men are included.2 similarly , injection drug use is the primary risk factor for hcv infection , likely accounting for more than 60% of prevalent cases and most incident cases in the usa.3 an estimated 600,000 californians , or 2% of the state s population , are infected with hcv , of which 475,000 californians are currently living with chronic hepatitis c in california.4 in san francisco , 45% of idus under 30 years of age have hcv antibody,5 and among idus who injected longer than 6 years , 71% are anti - hcv positive.6 young idus in san francisco are at high risk for hcv infection with an annual incidence of 26.7%.7 transmission of these and other blood - borne infections occurs through sharing syringes and other injection paraphernalia that are contaminated with hcv or hiv - infected blood.8,9 while cessation of injection drug use is the ideal prevention strategy , this is not always achievable , and studies indicate that making sterile syringes readily available to idus decreases the prevalence of blood - borne viral infections10,11 ; thus , the us public health service recommends one - time use of sterile syringes for idus who continue to inject.12 other studies found lower hiv infection rates and risky injection practices among idus in us cities without laws requiring a prescription compared to cities with prescription laws.11,13 efforts to increase syringe access include syringe exchange programs ( seps ) ; however , reported barriers to accessing seps include fear of being labeled as an idu , police harassment , inadequate syringe supply , limited operating hours , limited privacy , and long travel distance.14 nonprescription syringe sales ( npss ) provide an important adjunct to seps as a source of sterile syringes.15 senate bill 1159 ( sb 1159 ) ( chapter 608 , statutes of 2004)16 was signed into legislation and enacted on january 1 , 2005 . according to the legislation , the disease prevention demonstration project ( dpdp ) is authorized for the purpose of evaluating the long - term desirability of allowing licensed pharmacists to furnish or sell nonprescription hypodermic needles or syringes to prevent the spread of blood - borne pathogens , including hiv and hepatitis c. participation in the program is voluntary , and a two - step opt - in process was required before syringes can be legally sold without a prescription .
the first step permits local health jurisdictions ( lhjs ) to establish dpdps after approval by a local governing body .
the second step requires pharmacies in lhjs with a dpdp to register with the local health department ( lhd ) before they may legally sell 10 syringes to customers 18 years old without a prescription .
california s two - step opt - in process offers a unique contrast to other states that have legalized npss on a statewide basis , without requiring additional local approval .
sb 1159 also decriminalized possession of 10 syringes obtained from an authorized source such as a pharmacy . under the dpdp
, registered pharmacies must provide customers a mechanism for safe disposal of used syringes and information about hiv prevention and drug treatment .
lhds must maintain lists of registered pharmacies and provide pharmacies with printed educational materials for their customers . without new legislation , sb 1159 provisions will sunset on december 31 , 2010 . to monitor the approval and implementation status of dpdps statewide , we surveyed california lhjs annually between 2005 and 2007 .
california is divided in to 61 lhjs served by 58 county and three city health departments ( pasadena , berkeley , and long beach ) .
results from the 2005 survey were published previously.17 data from the past three surveys were used to describe the current state of the dpdps 3 years after sb 1159 passed and to elucidate trends in dpdp approval and implementation .
between 2005 and 2007 , three annual surveys were conducted among health departments in california s 61 lhjs .
questionnaires were initially sent to health officers in each lhj and support garnered during meetings of the california conference of local health officers , the california conference of local aids directors , and the county health executives association of california .
alternate respondents were requested when someone other than the health officer was primarily responsible for dpdp activities .
questionnaires also requested contact information for the person who would be most appropriate for future surveys . through this process , we were able to identify individuals most knowledgeable about sb 1159 .
methods for the 2006 and 2007 surveys were similar to the 2005 survey , reported elsewhere.17 surveys were mailed and e - mailed to health officials with ca office of aids endorsement .
nonresponders received reminder letters followed by phone calls when needed to assure high response rates .
responses could be returned by mail , fax , e - mail , internet , or telephone .
the questionnaire was developed in consultation with an advisory board founded in 2004 and comprised of state and local public health officials , academic researchers , pharmacists , law enforcement , waste management representatives , and idu advocates .
questionnaire topics included dpdp approval and implementation status , program characteristics , facilitators , and barriers to approval and implementation , pharmacy registration status , syringe disposal , and technical assistance needs .
we used 2007 data to describe the current status of sb 1159 , while data from all 3 years were used to describe trends in approval and implementation of dpdps over time . to assess whether dpdps were approved in communities needing hiv prevention , we compared dpdp coverage to 2007 california population estimates ( california department of finance)18 and cumulative hiv statistics.2
overall , 57 ( 93.4% ) lhjs responded in 2005 , 55 ( 90.2% ) responded in 2006 , and 60 ( 98.4% ) responded in 2007 .
one lhj ( city of pasadena ) did not respond in 2007 but participated in los angeles county s dpdp .
respondents in 2007 consisted of health department staff ( 33% ) , health officers and deputy health officers ( 30% ) , public health executives ( 15% ) , hiv / aids program coordinators / directors ( 12% ) , and public health nurses ( 10% ) .
by december 2007 , dpdps were approved in 17 ( 27.9% ) lhjs , reflecting an 89% increase from 2005 and a 21% increase from 2006 ( table 1 ) .
the number of lhjs in the process of seeking local government approval for a dpdp declined in 2007 compared to 2006 and 2005 ( one , two , and eight lhjs , respectively ) .
additionally , the number of lhjs planning , though not actively proceeding , to approve a dpdp also declined in 2007 compared to 2006 and 2005 ( seven , nine , and 17 lhjs , respectively ) . given that the number of lhjs without plans to approve a dpdp increased in 2007 compared to 2006 and 2005 ( 35 , 25 , and 18 lhjs , respectively ) , it appears that by 2007 , most lhjs considering dpdps had either already received local government approval or abandoned plans to do so .
examining pharmacy registration by year revealed that by 2007 , 14 ( 82% ) of the 17 approved dpdps had registered pharmacies into the program ; however , the proportion of pharmacies that were registered within each lhj varied from 0% to 61% ( table 2 ) . of note , the santa cruz county board of supervisors approved a dpdp in 2005 for cities within the unincorporated areas of the county , but the cities were held responsible by the county for also authorizing the program . as of 2007
table 1disease prevention demonstration project ( dpdp ) status by year among california s 61 local health jurisdictionsdpdp status200520062007approved91417 in process of approving821plan to approve1797approval process on hold200no plans to approve182535status unknown350survey not completed461table 2pharmacies registered by year among 17 local health jurisdictions with approved disease prevention demonstration projectslhjapproval daten ( % ) pharmacies registered200520062007contra costadec .
200535 ( 26)64 ( 49)71 ( 55)yolomay 200510 ( 42)19 ( 76)17 ( 61)los angeles ( city)jun . 2005183 ( 11)santa barbarasept .
200610 ( 5)total133 ( 23.6)263 ( 28.2)532 ( 17.8)percentages were calculated by dividing the number of registered pharmacies by the number of commercial , non - clinic - based , pharmacies licensed by the california board of pharmacy in the county during the year of the surveyalameda and berkeley are classified as independent lhjs , but total pharmacy data are aggregated between the two disease prevention demonstration project ( dpdp ) status by year among california s 61 local health jurisdictions pharmacies registered by year among 17 local health jurisdictions with approved disease prevention demonstration projects percentages were calculated by dividing the number of registered pharmacies by the number of commercial , non - clinic - based , pharmacies licensed by the california board of pharmacy in the county during the year of the survey alameda and berkeley are classified as independent lhjs , but total pharmacy data are aggregated between the two a comparison of survey data to california population and hiv case reporting data revealed that approximately 52% of california s population resided in the 17 lhjs with dpdps ( table 3 ) .
these lhjs included 62% of reported persons living with hiv and 59% of idu - related hiv cases .
lhjs with no plans to approve a dpdp represent approximately 43% of california s population , 32% of reported persons living with hiv , and 35% of idu - related hiv cases .
although california s most populous lhj ( los angeles ) has a dpdp , the next four most populous lhjs ( orange , riverside , san diego , and san bernardino counties ) , including over 10 million residents , do not .
table 3disease prevention demonstration project authorization status by population , reported living hiv cases and reported living cases attributed to idu exposure among california s 61 local health jurisdictions as of december , 2007 california populationliving with hivhiv cases attributed to idu exposuren(%)n(%)n(%)authorized already19,680,200(51.7)15,160(62.0)2,099(59.4)in process of obtaining approval492,642(1.3)1,163(4.8)142(4.0)not in process but plan to1,388,209(3.6)228(0.9)47(1.3)no plans to obtain approval16,340,285(42.9)7,846(32.1)1,239(35.0)did not complete survey148,126(0.4)69(0.3)8(0.2)total38,049,462(100)24,466(100)3,535(100)source : california department of public health , office of aids , hiv / aids case registry section ; and state of california , department of finance disease prevention demonstration project authorization status by population , reported living hiv cases and reported living cases attributed to idu exposure among california s 61 local health jurisdictions as of december , 2007 source : california department of public health , office of aids , hiv / aids case registry section ; and state of california , department of finance of the 35 lhjs without plans to approve dpdps in 2007 , 40% cited competing priorities - limited time as a reason for not approving a dpdp
. additionally , competing priorities - limited interest ( 34% ) , lack of pharmacy interest ( 31% ) , and law enforcement opposition ( 26% ) were other major reasons for not approving dpdps .
( 24% ) , enlisting pharmacy participation ( 24% ) , and securing dpdp approval ( 24% ) . similarly , the eight lhjs planning or in the process of approving a dpdp cited time management
( 13% ) ; educating stakeholders such as police , pharmacists , policy makers , and community members ( 13% ) ; and enlisting pharmacy participation ( 13% ) as barriers to approval .
syringe disposal costs and sep presence were also examined because these factors may be considered by governing boards deciding on dpdp approval . in 2007 , respondents estimated that dpdp costs for syringe disposal ranged from $ 0 to $ 850 per month .
( 21% ) , and surcharges added to syringe price ( 7% ) ; 21% reported that
syringe disposal posed no additional cost . as of july 2007 , california had 39 seps operating in 17 lhjs,19 13 ( 76.5% ) of which overlapped with the 17 lhjs with dpdps versus five ( 11.6% ) seps in the 43 lhjs surveyed without a dpdp .
evaluating technical assistance needs and coalition status across all 60 lhjs in 2007 revealed that only 15 ( 25% ) received technical assistance for sb 1159 during the previous year from : oa ( 80% ) , peers in other lhjs ( 53% ) , website developed by oa20 ( 40% ) , and other sources ( 20% ) .
eight ( 47% ) of the 17 lhjs with a dpdp had established coalitions to assist with dpdp approval and implementation , while only five ( 11.6% ) out of 44 lhjs without dpdps formed coalitions .
annual surveys conducted during the first 3 years since sb 1159 passage revealed that by december 2007 , only 17 of california s 61 lhjs had approved dpdps , in which less than one fifth of the pharmacies had registered to sell nonprescription syringes .
most dpdps were authorized shortly after sb 1159 passed and few additional lhjs still considered implementing dpdps 3 years after passage . while only a quarter of the california s lhjs approved dpdps , over 52% of the state s population and 62% of persons living with hiv were represented in this pilot , giving credence to the generalizability of findings from additional studies assessing the impact of sb 1159 . since lack of time , resources , and interest were reported by several health departments as reasons for not approving dpdps , future legislation void of the two - step opt - in process required during the pilot might permit a greater number of pharmacies statewide to sell syringes without a prescription as a way to reduce the risk of hiv and hcv transmission among idus .
local governing bodies , informed by their health officials , may be better suited than the state government to understand the need for npss depending on factors such as prevalence of injection drug use or hiv infection , availability of alternate interventions , and public approval . hence , sb 1159 allowed lhjs autonomy to decide whether or not npss would best serve the needs of individual communities within the country s most populous state .
as the only state in the usa that requires local government approval before pharmacists can sell nonprescription syringes , california provides unique insights into npss legislation .
results from this study suggest that while the opt - in process allowed some lhjs to exercise their authority to keep npss illegal , some lhjs may have opted out simply because they lacked the time or resources to pursue the approval process .
in addition , anecdotal reports from health officials indicated that that the opt - in process led to program inconsistency across lhjs , making it difficult for health departments to help one another to implement the law and avoid redundancy .
this same pattern of inconsistent implementation was observed for sep implementation in california ; a process that also required local governing bodies to opt into approving seps.21 it is too early to determine the impact of npss on pharmacies and consumers in the 14 lhjs with registered pharmacies .
however , cooper and colleagues22 found through a survey of pharmacists in san francisco and los angeles counties that there have been few problems related to npss and that pharmacists were more likely to sell syringes without a prescription if they considered it an important hiv prevention intervention .
there is also evidence from other states that npss decreases syringe sharing and acquisition from unsafe sources.2326 conversely , despite having pharmacies registered to sell nonprescription syringes ,
pharmacists beliefs and attitudes may hinder idus from actually purchasing them as one study found pharmacists unwilling to sell syringes to certain customers discriminating by race or other factors.27 in other studies , pharmacists opinion s toward syringe sale varied according to their perceptions of whether npss prevents hiv or increases drug use , and their concerns about how selling syringes to idus will affect their business and the community.2830 riley and colleagues31 found that 2 years after legalizing npss in san francisco , pharmacies effectively augmented seps as a source of clean syringes for idus .
however , it is unknown whether idus at highest risk for blood - borne infections are aware of the law or are able to afford syringes from pharmacies . among idus enrolled in a treatment facility in new york where npss was legalized in 2001 ,
less than 50% of the sample was aware that they could obtain syringes from pharmacies and even fewer actually did so.32 additional pharmacy and consumer - level assessments of sb 1159 are needed to determine the impact of the dpdps in california . since sb 1159 required an evaluation without a provision for state funding , such research will depend on alternate state or federal funding . in 2005 , strong community opposition , competing priorities , law enforcement opposition , and little or no interest among pharmacies were identified as the major barriers to sb 1159 approval.17 in 2007 , the most commonly reported barriers were limited time or interest due to competing priorities , suggesting some overlap with the earlier study , but perhaps also some decrease in opposition . personal conversations and open - ended responses to the survey revealed a common emphasis by health officials on the lack of time and resources to develop dpdps . of note , lhjs with seps
future public health legislation should consider the need for balance between allowing lhjs autonomy to implement locally suitable policy and overburdening lhjs with an approval process that could preclude only the most committed communities from adopting it .
this study was limited by potential differences in response quality across lhjs . despite the use of a structured questionnaire and thorough follow - up of respondents in all but one lhj ,
respondents attention to their answers may vary depending on whether idu health issues were significant concerns in the respondent s lhj .
another limitation was that we only assessed knowledge possessed by health department officials or staff and not idus , pharmacists , or community members .
in 2007 , an online survey option was added to mailed , faxed , and telephone surveys .
although this method was believed to make responding easier for some health officials , leading to the highest response rate of the 3 years , we found no evidence that the online - survey option introduced bias .
npss is intended to increase idus access to sterile syringes and subsequently decrease their need to share syringes contaminated with hiv , hcv , or other bloodborne pathogens .
sb 1159 made it legal for california counties and cities to decide individually whether or not to remove restrictions on npss .
this process was similar to california s legalization of seps and provides an important contrast to other states that legalized syringe sale or exchange on a statewide basis.21 while sb 1159 gave localities the choice of legalizing these programs , consequences of this approach include preventing the willing pharmacies in non - approved lhjs from selling syringes , complicating technical assistance to lhjs because dpdps lack uniformity and possible confusion among consumers about where they can and can not legally purchase syringes . while sb 1159 permitted some lhjs to implement npss , a measured response was observed that appears to be due to a mixture of willingness and resources across the state s 61 lhjs .
further research is needed to identify what conditions , if any , would have made it possible for additional jurisdictions to legalize nonprescription syringe sales in california . | in january 2005 , passage of california senate bill 1159 enabled california s county or city governments to establish disease prevention demonstration projects ( dpdps ) through which pharmacies could subsequently register to legally sell up to 10 syringes to adults without a prescription .
california s 61 local health jurisdictions ( lhjs ) were surveyed annually in 20052007 to monitor the progress of dpdp implementation and assess program coverage , facilitators , and barriers .
completed surveys were returned by mail , fax , e - mail , phone , or internet .
we analyzed 2007 survey data to describe current dpdp status ; data from all years were analyzed for trends in approval and implementation status . by 2007 , 17 ( 27.9% ) lhjs approved dpdps , of which 14 ( 82.4% ) had registered 532 ( 17.8% ) of the 2,987 pharmacies in these 14 lhjs .
although only three lhjs added dpdps since 2006 , the number of registered pharmacies increased 102% from 263 previously reported . among
the lhjs without approved dpdps in 2007 , one ( 2.3% ) was in the approval process , seven ( 16.3% ) planned to seek approval , and 35 ( 81.4% ) reported no plans to seek approval .
of 35 lhjs not planning to seek approval , the top four reasons were : limited health department time ( 40% ) or interest ( 34% ) , pharmacy disinterest ( 31% ) , and law enforcement opposition ( 26% ) . among eight lhjs pursuing approval , the main barriers were time management ( 13% ) , educating stakeholders ( 13% ) , and enlisting pharmacy participation ( 13% ) .
the17 lhjs with dpdp represent 52% of california s residents ; they included 62% of persons living with hiv and 59% of idu - related hiv cases , suggesting that many lhjs with significant numbers of hiv cases have approved dpdps .
outcome studies are needed to determine whether sb 1159 had the desired impact on increasing syringe access and reducing blood - borne viral infection risk among california idus . | Introduction
Methods
Results
Discussion |
the aim of therapy is recuperation or increasing life expectancy in patients with cancer . yet in order to destroy cancerous cells , various treatments including chemotherapy , radiotherapy , immunotherapy and surgery have been used .
however , a common feature of malignancy is resistance to radiation and chemotherapy which is called multi - resistancy . the resistance of cancer cells to current therapies led to designing new strategies .
viruses are rays of hope for curing a number of cancers ( 2 ) . during 90s ,
oncolytic viruses were used in order to treat solid tumors because they simply spread in tumorous cells and leave the least side effect in normal tissues ( 3 , 4 ) . by direct injection into the tumorous cells ,
, the failure to maintain antiviral mechanism in tumorous cells makes them sensitive to viruses while protecting normal cells from virus attack . on the other hand
, autophagy is an important hypothesis for carcinogenesis and sensitivity of tumor cells to curative viruses .
autophagy is a cellular process for reducing damaged proteins and disabled parts of cells , which helps the survival of cells in high - pressure conditions ( pathogen infection , lack of energy ) by controlling cell hemostasis .
thus autophagy , in contrast to apoptosis , is part of the cell survival process .
irregularity in autophagy relates with different diseases , such as heart disease , nerve damage and cancer .
the involved genes in autophagy also affect innate and adaptive immunity in response to viral infection ( 5 - 8 ) .
this molecule interferes with ambra1 , bif1 , uvrag proteins for increasing and with bcl2 , and rubicon for decreasing the autophagy .
it also reacts with vps34 ( pi3kiii ) for forming the two - layer membrane of autophagosome ( 9 ) . in cancerous cells ,
autophagy is stimulated due to cells search for energy sources , suggesting that the control of autophagy path increases the sensitivity of cancer cells to viruses .
the high - risk subgroups of papilloma , a human virus that causes cancer , are related with carcinoma of squamous cells in cervix .
when the virus enters the cell , genomic instability caused by protein expression of e6 and e7 leads to transformation of cell . in these cells ,
one of the innate immune mechanisms is the path of autophagy . the persistence of human papilloma virus ( hpv ) infection makes the expression of 3a domain in atpase family ( an anti - autophagy factor ) stable and reduces the control of autophagy .
there is a negative relationship between beclin1 and high risk hpv which reveals the fact that in absence of autophagy in hrhpv infection , the cervix squamous cell carcinoma increases ( 10 - 12 ) .
in this study the degree of beclin1 gene expression in hela cell ( that has been transformed by e6 and e7 genes ) and a549 cell ( that is resistant to virotherapy in comparison with many other tumorous cells ) was measured .
then the sensitivity of hela and a549 cells to the oncolytic vsv was evaluated by mtt assay .
cells from hela ( cancer cells from cervical tumor ) , and a549 ( human lung alveolar basal carcinoma epithelial cell line ) cell lines were used to study autophagy and vero cells ( african green monkey kidney cells ) were applied to propagate vsv virus , new jersey strain .
the cells were first cultured in dmem ( dulbeccos modified eagles medium , gibco ) environment containing 10% fetal bovine serum ( gibco ) , and 1% penicillin - streptomycin 100x ( gibco ) , in an incubator containing 5% co2 at temperature of 37c .
next , in order to determine the virus titer using tcid50 method , the virus was inoculated on two hela and a549 cells in a 96-well culture plate with the logarithmic dilutions of 10 - 1 to 10 - 8 .
after 72 hour the microplate were checked for cpe and the virus titer was calculated using the karber formula .
the hela and a549 cells were cultured in 6-well plates . after reaching the proper density ( 90% ) ,
the cells were inoculated with 0.1 and 0.001 multiplicity of infections ( mols ) of virus , leaving one row as control .
twelve hours after the incubation in the incubator containing 5% co2 and the temperature of 37c , the cells were harvested , and the supernatant was discarded after centrifugation .
the resultant sediment was kept in qiazol solution ( qiazol lysis reagent , qiagen ) for the extraction of cellular rna according to the manufactor s protocol .
cdna synthesis was carried out by random hexamer at 42c for 1 hour ( united states , thermo scientific kit ) .
the beclin1 human gene sequence was extracted from ncbi and the primers were designed in the form of exon junction using allele i d software . the primers forward : 5 ' 3 ' cgtgtcaccatccaggaactc .
the relative amount of the expression of beclin1 gene in two hela and a549 cells in comparison with gapdh internal control was carried out using corbet device . in this method ,
the percentage of the vital cells in hela and a549 was determined based on the restoration and break down of the yellow crystals of tetrazolium using the succinate dehydrogenase enzyme and the formation of blue crystals .
hela and a549 cells were cultured in a 6-well plate and inoculated with 1 , 0.1 , 0.01 and 0.001 mols of the virus after reaching proper density .
after 24 hours , the mtt solution ( recombinant life idea , tehran ) was added and 2 to 3 hours later the supernatant was discarded and dmso was added .
fifteen minutes later , the optical density was read at a wavelength of 570 nm .
cells from hela ( cancer cells from cervical tumor ) , and a549 ( human lung alveolar basal carcinoma epithelial cell line ) cell lines were used to study autophagy and vero cells ( african green monkey kidney cells ) were applied to propagate vsv virus , new jersey strain .
the cells were first cultured in dmem ( dulbeccos modified eagles medium , gibco ) environment containing 10% fetal bovine serum ( gibco ) , and 1% penicillin - streptomycin 100x ( gibco ) , in an incubator containing 5% co2 at temperature of 37c .
next , in order to determine the virus titer using tcid50 method , the virus was inoculated on two hela and a549 cells in a 96-well culture plate with the logarithmic dilutions of 10 - 1 to 10 - 8 .
after 72 hour the microplate were checked for cpe and the virus titer was calculated using the karber formula .
the hela and a549 cells were cultured in 6-well plates . after reaching the proper density ( 90% ) ,
the cells were inoculated with 0.1 and 0.001 multiplicity of infections ( mols ) of virus , leaving one row as control .
twelve hours after the incubation in the incubator containing 5% co2 and the temperature of 37c , the cells were harvested , and the supernatant was discarded after centrifugation . the resultant sediment was kept in qiazol solution ( qiazol lysis reagent , qiagen ) for the extraction of cellular rna according to the manufactor s protocol .
cdna synthesis was carried out by random hexamer at 42c for 1 hour ( united states , thermo scientific kit ) .
the beclin1 human gene sequence was extracted from ncbi and the primers were designed in the form of exon junction using allele i d software . the primers forward : 5 ' 3 ' cgtgtcaccatccaggaactc .
the relative amount of the expression of beclin1 gene in two hela and a549 cells in comparison with gapdh internal control was carried out using corbet device .
in this method , the percentage of the vital cells in hela and a549 was determined based on the restoration and break down of the yellow crystals of tetrazolium using the succinate dehydrogenase enzyme and the formation of blue crystals .
hela and a549 cells were cultured in a 6-well plate and inoculated with 1 , 0.1 , 0.01 and 0.001 mols of the virus after reaching proper density .
after 24 hours , the mtt solution ( recombinant life idea , tehran ) was added and 2 to 3 hours later the supernatant was discarded and dmso was added .
fifteen minutes later , the optical density was read at a wavelength of 570 nm .
the tcid50 titer of vsv was calculated for the hela and a549 cells , 72 hours after virus inoculation using the karber formula in which the virus titer was obtained to be 10 and 10 tcid50/ml for hela and a549 , respectively . in order to study the quantitative level of gene expression ,
then the amount of ct was determined using the amplification diagram . based on the results of rest program , from the statistical point of view , the level of beclin1 gene expression in hela cell significantly declined ( p 0.05 ) compared to a549 ( figure 1 ) .
the percentage of vital cells 24 hours after virus infection at different mois was evaluated .
based on the results of the mtt test for the two hela and a549 cells , the percentage of the vital cells in a549 was higher compared to that of hela ( figure 2 ) .
the tcid50 titer of vsv was calculated for the hela and a549 cells , 72 hours after virus inoculation using the karber formula in which the virus titer was obtained to be 10 and 10 tcid50/ml for hela and a549 , respectively .
in order to study the quantitative level of gene expression , first the technical accuracy was evaluated using the melting curve
based on the results of rest program , from the statistical point of view , the level of beclin1 gene expression in hela cell significantly declined ( p 0.05 ) compared to a549 ( figure 1 ) .
the percentage of vital cells 24 hours after virus infection at different mois was evaluated .
based on the results of the mtt test for the two hela and a549 cells , the percentage of the vital cells in a549 was higher compared to that of hela ( figure 2 ) .
autophagy plays a complicated role in the production of tumor and response to treatment . in the early stages of tumorgenesis
, autophagy can serve as a suppressor and reduction of autophagy has been observed with the transformation of tumor cells ( 13 ) . in this case , inducing autophagy seems useful for the prevention of cancer , although at the stage of tumor creation , autophagy contributes to tumor development and cancer cells are reinforced by autophagy to survive under treatment and metabolic stress . on the other hand , autophagy is considered as an innate antivirus mechanism against viral infection .
data suggest that autophagy is directly activated by vsv infection , most likely via the surface glycoprotein vsv g , and thus activation does not require viral replication .
shelly et al . showed that vsv rna is not the sensor for autophagy in flies ( 5 ) .
malilas et al . in 2013 showed that a549-cug2 cells , which harbor a novel oncogene mediating stat1 activation causing resistance to infection of vesicular stomatitis virus became susceptible to vsv infection upon treatment with beclin1 sirna ( 14 ) .
most cancer cells , including hela , are sensitive to virus therapy due to defects in the innate immune system ( including autophagy ) while the activity of the autophagy mechanism can be interpreted as a contributing factor to the resistance or lack of proper response from some cancer cells to virus treatment . in a number of studies on various cancers , inhibition of autophagy by drugs including 3ma ( inhibition pi3kiii ) ,
cancer cells have sensitized to a wide range of treatment models , including radiation theraphy , hormonal therapy etc . by inhibiting autophagy ,
viruses are protected from the xenophagy phenomenon which helps the viruses to destroy cancer cells ( 5 - 7 , 13 , 15 - 17 ) . among the most important evidence of the role of autophagy in tumor suppression
anti - apoptotic bcl-2 interacts with the bh3 domain of beclin1 , which results in autophagy reduction and tumor progression .
elimination of beclin1 is frequently detected in breast , ovarian , prostate cancer in humans and mice ( 9 ) . in the present study
, a comparison was made between the activity level of beclin1 gene , as the most important factor for the commencement of the autophagy process , in two hela and a549 cells .
the reduced expression of beclin1 was expected for hela due to the activity of e6 and e7 genes in the autophagy process .
a549 cell is reported to be resistant to virus treatment compared to many other tumor cells .
the results showed that autophagy was reduced in hela cells compared to a549 and perhaps the heightened sensitivity of hela cells to the death due the vsv virus can be attributed to the reduction of autophagy in these cells , although further investigation is needed to fully evaluate this connection ( 6 ) . in conclusion , it can be proposed that for the development of successful autophagy strategies against cancer , there is a need for a better understanding of cell mechanisms in connection with the stages of tumor , cell type and genetic factors .
in addition , we must be assured about the special autophagy pathways activated or inhibited in various anti - cancer treatments .
it seems possible to increase the sensitivity of tumor cells to virus treatment or other treatments by finding ways to reduce autophagy ( 7 , 13 ) . | background : beclin1 is an important , primary molecule for autophagy.objectives:it is suggested that the control of the autophagy path increases the sensitivity of tumor cells to vsv.materials and methods : in this study , the degree of beclin1 gene expression in two cell lines , hela and a549 , has been examined and the percentage of living cells subsequent infection with virus has been evaluated by mtt assay method.results:the results showed that the degree of beclin1 gene expression in hela cells in comparison with a549 cells has reduced , and the sensitivity of these cells to vesicular stomatits virus ( vsv ) oncolysis is more than a549.conclusions:it seems that by using some methods for reducing autophagy , it is possible to make tumor cells more sensitive to virotherapy and even other treatments . | 1. Background
2. Objectives
3. Materials and Methods
3.1. HeLa, A549 Cell Culture and Virus Titer Determination Through TCID50
3.2. Cell Culture in 6-Well Plate for the Extraction of the Cellular RNA
3.3. Beclin1 Primer Design
3.4. Real Time PCR
3.5. MTT Assay
4. Results
4.1. Titration in HeLa and A549 Cells
4.2. Real Time PCR
4.3. MTT Asay
5. Discussion |
dental caries in primary dentition has been mentioned as an important matter in the recent years because it may be predictive of later caries and also special attention is necessary to overcome this problem .
the relative influence of each factor differs noticably in individuals and is not completely recognized .
aberrant anatomic and morphologic configurations , such as deep pits and grooves and broad flat proximal contact areas will greatly increase its susceptibility .
the pattern of caries occurrence in primary dentition seems to be initially more on the occlusal surface than the proximal surface .
interproximal caries in both the anterior and buccal segments of the primary dentition usually does not occur until proximal contact develops .it has been suggested that if the proximal surfaces of the primary teeth do not become carious by the age of 68 years , the risk of developing dental disease is very low for the remaining mixed dentition period .
this statement suggests that the role of different tooth sites in the natural history of caries is important to understand .
absence of interdental spaces leads to a greater extent of decay in the primary dentition .
crowding is said to decrease the accessibility to hygiene measures ; thereby , increasing plaque accumulation and promoting caries .
if this is the case , one could hypothesize that open contacts would be less prone to caries than closed contact points as they are less likely to accumulate plaque and this hypothesis has to be eminently testable in the primary dentition where gaps between the teeth are very common and even normal .
not many studies have assessed the relationship between the presence / absence of interdental spacing and dental caries in the primary dentition .
therefore , the purpose of the present study was to assess the relationship between interdental spacing and dental caries in the primary dentition .
this study was conducted on 4 to 6-year - old healthy , cooperative children from 21 kindergartens and play schools in bangalore city , india .
the city of bangalore was divided into four zones , and play schools and kindergartens from each zone were randomly selected .
prior to the study , ethical clearance was obtained from the institutional review board as well as written consent was obtained from parents / guardians and concerned school authorities .
children with permanent teeth , missing primary teeth due to exfoliation or extraction , presence of intraoral / extraoral swelling and uncooperative children were not included . children with supernumerary teeth ,
five hundred and fifty children with primary dentition and all 20 primary teeth erupted were included for the study .
parental consent could not be obtained for 50 of the children ; thus , 500 children formed the study group . visual examination of the teeth was done under natural daylight using a mouth mirror with a good reflecting surface .
an explorer was used at times only to remove the debris present on the tooth surfaces and to confirm presence of cavitations in cases of questionable pits .
when necessary , a magnification lens was used to help decide whether or not there was cavitation .
surface - specific dental caries data ( dfs ) was recorded by a single examiner using the criteria given by warren et al . .
criteria includes lesions with evidence of demineralization , but no loss of enamel structure ( d1 ) ; lesions with loss of enamel structure that are confined to the enamel layer only ( d2 ) ; and lesions with loss of enamel structure that penetrate into dentin ( d3 ) .
those teeth with clinical pulp involvement ( d4 ) were also considered under cavitated lesions . in the present study , caries in the enamel ( d2 ) and dentin ( d3 )
were considered as single entity ( d23 ) . following examination and recording of caries , upper and lower alginate impressions
were made for every child . to avoid any error , the dental casts were poured immediately using dental stone .
interdental spaces on upper and lower casts were measured using the digital vernier calliper ( reading to the nearest of 0.1 mm was taken ) .
absence of spacing was confirmed by passing silk ligature wire or by blowing air from chip blower .
evaluation of tooth spacing was performed by the same examiner on a space - by - space basis , using the criteria given by warren et al .
( 2003 ) . from the stone casts , each interdental area was categorized as : ( 1 ) space > 1 mm , ( 2 ) space < 1 mm , ( 3 ) no space , teeth in contact , or ( 4 ) no space , teeth overlapped .
these categories were collapsed into presence or absence of space for each interdental site and counted for each individual .
analyses assessed the relationships between interdental spacing and caries experience with separate analyses for anterior spacing , posterior spacing and total spacing . to minimize intra - examiner variability , 5% of the casts
the data obtained were tabulated and subjected to statistical analysis using pearson correlation coefficient and chi - square test .
nearly 90% of children had interdental spacing and more children had anterior interdental spacing in both arches ( table 1 ) .
the number of sites with interdental spaces was higher in the maxillary arch in comparison to the mandibular arch and the highest number of interdental spaces was observed between the maxillary anteriors ( table 1 ) .
eighty percent of the children had dental caries and the mean dfs score was 6.35 ( table 2 ) .
forty - five percent of the children had interproximal caries in both arches ; 178 children showed interproximal caries only in the maxillary arch and 125 children had interproximal caries only in the mandibular arch .
the proximal surfaces of the maxillary teeth showed the highest number of cavitated tooth surfaces ( d23 ) ( table 3 ) .
a significant correlation was found between dental caries and interdental spacing in the posterior segment of the mandibular arch ( table 4 ) .
an inverse relation was also found between interproximal caries and interdental spacing ( table 5 ) .
one of the risk factors in the complex etiology of dental caries is interdental spacing .
, two consistent morphologic arch forms of the primary dentition are found : either spaces between the teeth were present at all stages ( type i ) or the teeth were in proximal contact at all stages ( type ii ) .
spacing in the primary dentition is apparently congenital rather than developmental . spaced arches frequently exhibit two distinct diastemas : one between the mandibular canine and the first primary molar and the other between the maxillary lateral and the canine .
primate spaces .a secondary spacing of the maxillary primary incisors occasionally occurs when the still underdeveloped maxillary arch is widened somewhat by the eruption of the mandibular permanent central incisors .
hence , in our study children with only primary dentition were selected . in the primary dentition ,
the occlusal surface is the most susceptible to carious attack , attributable to its anatomy of pits and fissures .
however , with the eruption of the permanent first molars , the normal developmental spaces of the primary dentition begin to close . with space closure and formation of the contact areas ,
the incidence of proximal caries greatly increases .thus , children aged between 4 and 6 years with no permanent tooth erupted were selected .
almost 90% of the children in the present study had interdental spaces in at least one site and 10.4% of the children had absolutely no interdental spaces .
this was in accordance with studies who reported a prevalence of 8499% [ 912].a study on 3-year - old danish children showed higher spacing in the maxillary than the mandibular arch .
, the anterior segments in both arches showed a higher prevalence of spacing than the posterior segments .
the initial arrangement of tooth germs in the maxilla as well as the mandible is an important determinant of interdental spaces . during postnatal development ,
intensified lateral growth of the alveolar processes was found to occur during the formation of deciduous arches following the period of lactation .
both lateral and frontal growth of the alveolar processes during the formation of deciduous arches manifest in spaced deciduous anteriors .
apparent spacing of the primary incisors may also occur as a result of occlusal attrition .
the wider incisor part of the teeth worn away to leave apparently larger spaces between the narrower remaining parts .
there have been discussions in dental literature which have emphasized the need for including what are termed
non - cavitated lesions in caries evaluation / assessment criteria leading to development of more sensitive criteria .
these criteria were originally developed by the world health organization and have been subsequently modified .
most studies have used the dmf / def index to detect caries [ 2125 ] . although this method is simple and
can be modified to suit special circumstances , it does not evaluate initial caries , such as the white spot lesion .
a mean dfs of 6.35 was observed which was in contrast to warren et al . who reported a lower mean dfs of 2.02 in the primary dentition .
both studies used the same criteria for caries recording and included the non - cavitated lesions in their evaluation .
the occurrence of both non - cavitated and cavitated tooth surfaces in the maxillary anterior segment reiterates the rapidity and pattern of caries spread in these teeth .
although a high number of interdental spaces are seen in the anterior region , these teeth are more susceptible to caries because they are exposed to a highly cariogenic environment resulting from improper feeding practices .
the protective action of the tongue and opening of salivary gland ducts in the floor of the mouth could be mainly responsible for the comparatively lower number of non - cavitated and cavitated tooth surfaces in the mandibular anterior segment .
when the distribution of dental caries was analyzed , posterior tooth surfaces of the mandibular arch showed more caries when compared to the anterior tooth surfaces .
the complex fissure topography of posterior teeth compounded by gravitational forces could make these teeth more prone to dental caries .
other contributing factors include absence of interdental spacing , inaccessibility to maintain oral hygiene in these areas and genetic pattern [ 2 , 21 , 25 ] .
this explains the significant association between dental caries and interdental spacing in the mandibular posterior region .
however , it should not be inferred that susceptibility to occlusal caries mandates the prevalence on proximal surfaces or vice versa , because these lesions are similar but independent of each other in development . when the relative susceptibility of proximal surfaces in the primary dentition is analysed , a general trend of increased caries incidence in a distal direction occurs .
the equal frequency of proximal caries on adjacent sites in primary molars requires time to develop , but generally the lesions do not appear simultaneously because of differences in eruption sequence . keeping in mind the concerns of exposing children to radiation strictly for research purposes , the costs involved and risk of bias from the refusal of some study participants to undergo radiography ; bitewing radiographs were not utilized for diagnosis of proximal caries in our study .
this could have resulted in the diagnosis of a higher number of cavitated proximal surfaces when compared to the non - cavitated proximal surfaces .
the present study supports the belief that absence of interdental spaces in the primary dentition may increase the risk of dental caries . | objective : there are various risk factors which play an essential role in the multifactorial disease dental caries . although absence of interdental spaces in the primary dentition may increase the risk of dental caries , not many studies have been carried out to assess this correlation .
this study was performed to assess the relationship between interdental spacing and dental caries in primary dentition.materials and methods : five hundred 46 year - old children were enrolled into this study .
dental caries was recorded using the criteria given by warren et al . following this ,
impressions were made for the upper and lower arches and dental casts were poured .
interdental spaces were measured on the dental casts using a digital verniercaliper .
the data obtained were subjected to statistical analysis.results:the number of sites with interdental spaces was higher in the maxillary arch in comparison to the mandibular arch .
the highest number of interdental spaces was observed between the maxillary anteriors . the number of demineralized , but non - cavitated tooth surfaces ( d1)were higher than the number of cavitated tooth surfaces .
this difference was significant in the mandibular anterior segment .
dental caries showed a negative correlation with interdental spacing .
a significant correlation was found between dental caries and interdental spacing in the posterior segment of the mandibular arch.conclusion:this study showed that children with no interdental spacing in the primary dentition are at higher risk for dental caries . | INTRODUCTION
MATERIALS AND METHODS
RESULT
DISCUSSION
CONCLUSION |
chronic myeloproliferative diseases include essential thrombocythemia ( et ) , polycythemia vera , chronic myelocytic leukemia and myelofibrosis , and cause hemorrhagic and thrombotic symptoms in many organs of the body .
purpura , subcutaneous hemorrhage , ulcer , acral gangrene , livedo symptoms , and erythromelalgia can occur in the skin .
we encountered a patient in whom an et - associated ulcer of the toe was markedly improved by treatment with hydroxyurea .
the patient was a 47-year - old woman in whom an ulcer had developed on the toe two weeks before she visited the outpatient clinic of our department because of pain .
polycythemia and hypertension had been found during a health check - up 4 years earlier , but had been left untreated .
a purple - reddish macula accompanied by coldness and pain had appeared on the toe tip 3 years before and the region had repeatedly swelled for 2 years . on the first examination , a swelled , cyanotic discoloration of the skin was present on the right 5th toe .
an ulcer 5 mm in diameter , covered with a crust and accompanied by pain and numbness was noted at the toe tip ( fig.1a , b ) .
pulsation of the dorsal artery of the foot was good on both sides and intermittent claudication was absent .
histopathological examination of the ulcerated skin showed that the epidermis was partially defective , platelet thrombi were present in dilated small blood vessels in the upper to middle dermis , and inflammatory cells had infiltrated around the small vessels ( fig.2a ) .
the inner wall was destroyed in some blood vessels and the structure was unclear with complete obstruction of the lumen ( fig.2b ) .
blood tests showed wbc , 19,900/l ; rbc , 628 10/l ; hb , 12.9 g / dl ; ht , 43.7% ; platelets , 99.4 10/l ; igg , 1,458 mg / dl ; iga , 418 mg / dl ; igm , 135 mg / dl ; ferritin , 6.3 ng / ml ; pr3-anca , negative ; mpo - anca , negative ; anticardiolipin antibody , negative ; cryoglobulin , negative ; and vitamin b12 , 812 ng / ml ( normal value : 200800 ) . in a bone marrow test
, the number of irregular - sized megakaryocytes with atypical nuclei was markedly increased , and the numbers of granulocyte system cells and erythrocyte precursors were also increased , but no myelofibrosis was noted .
abdominal echography detected a 67 44-mm splenomegaly , but there were no findings suggesting infection , inflammatory disease , or malignant tumor .
administration of oral hydroxyurea at 500 mg / day was initiated and the patient 's platelet count was reduced to 42 10/l and wbc to 9,700/l after several months .
the ulcer on the right 5th toe was mostly epithelialized about one month after initiation of hydroxyurea , and only mild livedo and pigmentation were present thereafter .
et is one of several chronic myeloproliferative diseases and has a pathology believed to involve hyperplasia of platelets without normal function due to abnormal autonomous proliferation of megakaryocyte - lineage cells in the bone marrow .
et is diagnosed based on a platelet count of 60 10/l or higher and ht of 40% or lower , normal rbcs , normal serum ferritin , a philadelphia chromosome- or bcr / abl fusion gene - negative status , the exclusion of chronic myelocytic leukemia , the absence of marked myelofibrosis , and the exclusion of reactive thrombocythemia . the incidence is high in persons aged 60 years and older , and the condition may be accompanied by deep or superficial venous thrombosis , nasal hemorrhage , intracranial hemorrhage , transient ischemic attack , and cerebral and myocardial infarction , although many cases are asymptomatic .
regarding skin symptoms , purpura is most frequent , followed by erythromelalgia , skin ulcer , and livedo reticularis .
skin symptoms in et such as ulcer and gangrene are thought to develop due to an increased production of platelet - activating substances such as thromboxane a2 and prostaglandins g2 and h2 .
this process is induced by an increased adhesion , release and aggregation due to an increased platelet count , elevated sensitivity of platelets to these substances , decreased production of prostacyclin , which is a platelet - function inhibitor , and increased platelet aggregation due to decreased sensitivity of platelets to prostaglandins i2 and d2 . to our knowledge ,
25 patients with et - associated skin ulcer / necrosis of the toe have been reported since 1970 [ 2 , 5,6,7,8 ] .
two patients were treated with hydroxyurea and the ulcer markedly improved [ 7 , 8 ] , whereas 7 patients were treated with antiplatelet drugs such as aspirin , but gangrene progressed and amputation of the toe was required .
hydroxyurea is a metabolic antagonist that inhibits dna synthesis , and it is frequently used in the treatment of myeloproliferative diseases such as chronic myelocytic leukemia .
hydroxyurea has been used to treat et in many cases since the 1990s [ 1 , 8 , 8 ] , with the goal of reducing the platelet count .
the patient in the current case was treated with hydroxyurea from the early phase , and the platelet count decreased and skin symptoms were improved .
hydroxyurea treatment at 500 mg / day is ongoing and her platelet count has stabilized at about 5070 10/l without recurrence of skin symptoms .
it sometimes use treated for skin ulcer with antiplatelet drugs such as aspirin or cilostazol , cyclophosphamide for reducing the number of platelet .
our case suggests that et should be kept in mind as a possible cause of refractory ulcer in the crura and toes , even though the condition is rare . in such cases ,
early diagnosis and rapid treatment may prevent aggravation , and hydroxyurea is the treatment of choice . | the patient was a 47-year - old woman with a painful ulcer that had appeared on the right 5th toe two weeks before she visited our hospital .
histopathological examination showed that thrombi were present in small blood vessels in the dermis and pancytosis was detected in a blood test , suggesting polycythemia - associated ulceration of the toe .
essential thrombocythemia was diagnosed based on bone marrow puncture and chromosomal test findings .
platelet count and the ulcer were improved by oral hydroxyurea . | Introduction
Case Report
Discussion |
the public has wondered why the humidifier disinfectant disaster ( hdd ) only occurred in south korea ( here after korea ) .
the issue of how a demand for humidifier disinfectant ( hd ) formed in korea , how the product was released , and how it was distributed for over 20 years needs specialized analysis .
this study intends to seek answers on issues that must be addressed regarding the hdd from the perspective of a chemical substance expert .
the first question that comes to mind is , why were nt we able to foresee the hd issue , figure it out in time , and properly handle the case ?
then it is natural to wonder , can we prevent the toxic hd or a similar product from entering the market under the current system ? through analysis of the two questions above , this study ponders the answer to the question , what must be done in order to prevent another hd incident ?
what were manufacturers , authorities , and relevant experts doing for the past 20 years when more than 1000 victims ( 100 of which were casualties ) resulted from the release and distribution of the hd ? why were nt they able to identify defects in the product beforehand and deal with the issue in advance ?
we must clearly distinguish the causes of the accident whether it was simply a lack of inhalation toxicity data , a systemic problem such as a blind area in management , an issue regarding policy intentions of the authorities , or an issue of professional capacity .
future forecast and prescription will differ depending on the cause . regarding the cause of the disaster ,
the following three potential causes are mentioned the most : ( 1 ) since the hd issue was caused by a lack of information such as inhalation toxicity data , it was impossible to predict such an accident with the level of technology at the time ; ( 2 ) because the authorities did not have the legal right to prevent the release of a company s product or the use of chemical substances for certain purposes , it was impossible to prevent the market release of the hd ; ( 3 ) it was possible to predict the inhalation toxicity of the hd to some extent ; therefore , although it was not subject to management , if the manufacturers and authorities had the will to do so , the market release of the product could have been prevented in many ways , even without any legal reform .
to explain point three further , when the hd was released into the market , there was no obligation to submit toxicity data during the process of product certification under the act on quality management and safety control of industrial products . because the hd was not subject to management , the product was able to enter the market without any restrictions even though there was no inhalation toxicity data about it .
however , even if the hd would have been subject to management , it could have been sold in the market with a korea certification ( kc ) mark attached if it had just met product safety standards and had obtained certification . even though the possibility of inhalation exposure was clearly stated in the hazard review data , in the case of poly(oxyalkylene guanidine ) hydrochloride ( pgh ) , a toxic hd , the chemical registration review group did not request submission of additional inhalation toxicity data in 2003 ; subsequently , pgh was classified as a common chemical substance , not a hazardous substance . in this case , a general regulation , which requires inhalation toxicity data when there is a possibility of inhalation exposure , was ignored .
eventually , the chemical registration assessment team of the national institute of environmental research reversed the decision , designated pgh as a hazardous substance , and announced it in august of 2013 .
therefore , we can not assign the blame to manufacturers for failing to put together toxicity data regarding the hds . at the time
, no one had requested toxicity data from manufacturers and no one had assessed the danger of inhalation toxicity of the products before market release .
it is regretful that the severe danger of the hd could have been identified if the inhalation toxicity data of phmb ( a similar substance to polyhexamethylene guanide phosphate ( phmg)another hd ) would have been used .
is it possible to prevent the release of a product with a serious defect like that of the toxic hds ? in cases
where a product is subject to the list of product under the management according to the act on quality management and safety control of industrial products , it can still be released without any obstacles if the product safety standards are met through the autonomous safety certification system and a
the same goes for hazardous products list of concern according to the act on the registration and evaluation , etc . of chemical substances ( arecs ) .
unless current product safety standards are exceeded , products can be freely released in the market without any product registration procedure . unlike the act on quality management and safety control of industrial products
, arecs does not even have a product registration system that can track the products released in the market .
if a product is not subject to management , there is nt really a way to take measures beforehand . in terms of managing the usage of chemical substance
, it is possible to take some advance measures since the arecs system stipulates that the safety of chemical substances which exceed 10 tons of usage annually must be reviewed beforehand through a risk assessment of their specific uses .
however , chemical substances used in most consumer products are excluded from the risk assessment , except for substances that are coincidentally also used for industrial purposes .
therefore , just as in the past , even if inhalation toxicity data is produced , there is almost no possibility of preventing the release of products that may cause health damage ( such as that of the hd ) due to the inadequacy of the present system for chemical management .
while the hd was not regulated at the product level because it was nt subject to management , an argument has been raised asserting that there would have been a big difference if a safety review were carried out on its chemical substances after receiving relevant toxicity data during the review process , and it could have been declared a hazardous substance and managed .
if the hd had been classified as a hazardous substance due to inhalation toxicity data , would the relevant chemical substances still have been used as components of the hd ?
products both subject to and not subject to management do not face any restriction for using hazardous substances if they meet product safety standards . and even if a chemical is classified as a hazardous substance , there are no legal means to restrict manufacturers from using the substances for the hd .
, arecs stipulates that manufacturers must declare hazardous chemical substances used in a household chemical product if the annual usage amount exceeds one ton for a product or the content of the substance exceeds 0.1% of a product .
however , it is estimated that chemical substances used in most household chemical products are not subject to declaration .
therefore , under arecs , there is no other way to limit the use of hazardous chemical substances in household chemical products than to set product safety standards .
then , is it possible for the government to identify the substances used in products subject to management before market release , and to manage those products by setting product safety standards ?
it is realistically not possible because there are no means to identify which chemical substances are used in which products and to what degree , and no means to assess the risk of the products . because the toxicity of the biocide was evident , the risk of inhaling the substance was logically predictable even if there was no inhalation toxicity data .
, the hd , which used disinfectant components without any restriction in a product with a possibility of inhalation exposure , was released into the market .
the korean agency for technology and standards , which was responsible for the safety management of the product at the time , initially refused requests from manufacturers to authorize kc mark since it deemed the product a disinfectant , not a cleaning product as subject to management , but did not take any measures toward ensuring the safety of the product and neglected the situation .
finally , the korean agency for technology and standards awarded the kc mark to costco s humidifier clean up product , which contained phmg .
the agency should nt have awarded it a kc mark , and instead should have designated the product as subject to management and prepared product safety standards .
it were possible to apply those measures within the legal system at the time , if only the authorities had the will to carry them out .
therefore , the primary responsibility of the government for the hd incident lies in the hands of the korean agency for technology and standards , which was the principal agency responsible for the management of chemical substances in industrial products at the time and which directly received product certification requests from manufacturers .
the current policies of the ministry of trade , industry and energy and the korean agency for technology and standards have not drastically changed since the hd incident ; only the problematic household chemical products were transferred over to the ministry of environment .
it is difficult to simultaneously expect professionalism and responsibility regarding the safety management of products from departments that are responsible for supporting and promoting manufacturers under the name of industrial revitalization .
it is no longer admissible to leave the lives and safety of citizens in the hands of agencies that are neither responsible nor professional . in order to prevent another hd incident ,
the entire workload of safety management of chemical substances must be fully transferred over to the ministry of environment and the ministry of food and drug safety .
similar to the case of household chemical products , it is also worrisome that the korean agency for technology and standards a ministry of trade , industry and energy - affiliated organization is in charge of safety management of chemical substances for industrial products ( especially children s products ) .
this is because the korean agency for technology and standards usually considers the safety management work as taking international regulation standards , and many cases have been reported in which manufacturers modify such standards to meet the level acceptable by manufacturers .
for instance , international standards limit the use of six phthalates in products for children 3-years - old or younger , but a special act on children s product safety in korea allows the use of three phthalates without any limit on the content on the condition that the substances are declared .
this example illustrates that the true intention of the special act on children s product safety is not to specifically protect children , but to specifically protect korean manufacturers from international competitors .
currently , hd is considered a substance used as an additive to water within the humidifier for preventive purposes against microbe propagation and limescale , and is managed through a prior authorization method after being designated as a quasidrug .
the hd was designated as an item that needs prior authorization and must be subject to management after taking into account the form of the product ( substance used as an additive to water within the humidifier ) and its functional uses ( prevention of microbe propagation and limescale ) .
the functional use of the product ( prevention of microbe propagation and limescale ) provides indirect information on the kinds of functional materials that can be used .
the form of the product ( substance used as an additive to water within the humidifier ) is a preliminary factor of product management in terms of determining the route and level of exposure .
however , under the current management method , it is difficult to identify beforehand the release of products that add chemical substances to humidifier water for purposes other than to prevent limescale and microbe propagation .
moreover , such products could be excluded from being subject to quasi - drug authorization because of their different usage , and could be released without any restriction . for chemical substances used as an additive to the water within the humidifier ,
whatever its use , prior authorization must be received after reviewing the safety of the chemical substances used .
therefore , it is hard to say that other kinds of chemicals used as an additive to water within the humidifier is currently being properly managed through its designation as a quasi - drug . for many of the same reasons , similar issues arise when designating consumer products ( e.g. , household chemical products or children s products ) as subjects of management .
there is a need to identify the actual safety of the product type and to manage the product type by designating it as an item subject to management .
for instance , aerosol - generating products such as humidifiers , sprays , and manual and mechanical injectors , must be managed as items subject to prior authorization , regardless of their different uses .
prior authorization is also needed for products used by children ( a susceptible group ) , such as products children bite and suck on , powder / clay - type products , accessories , and children s cosmetics , all of which have a high level of exposure intensity and exposure time , and have a high frequency of use .
this is because of a fundamental limitation in the current regulation system , which allows substances to be used without restriction , save for a few designated substances that are used in quantities less than the standard value .
the current regulation system is a kind of negative regulation method in which the government , instead of the manufacturer , essentially takes responsibility for the proactive management of product defects .
while the government prescribes product safety standards by law , the problem is how well such a regulation system will actually work . for this kind of regulation system to function properly ,
information about what substances and how much are being used , but the government does nt have that information , and manufacturers do not reflect such information in their safety designs even if they have it . if the manufacturers can not make their own decisions , they should entrust authorities to make decisions for them , but they are currently ignoring things , under the excuse that they are trade secrets . ultimately , since the authorities do not possess information about substances and their quantity used in the products , the opportunity to identify product safety before market release disappears . in other words , it is a system in which no one can take responsibility for product safety before market release .
basic information for chemical substance management through registration of the uses of chemical substances
( providing the necessary information needed to prepare an exposure scenario for a preliminary risk assessment of the product ) and product registration ( including the substances used , the amount of substances used , and the product uses , etc . )
must be secured by authorities in order to manage the chemical substance uses and the safety of the products .
however , the current system does not ensure the minimum requirements for safety management of chemical substances and products due to various constraints .
agencies carry out safety management of chemical substances by self - assessing the uses verified for safety and registering them with the authorities .
this is the fundamental background for the advancement of the european union s reach and korea s arecs . in the case of arecs ,
such a registration process is applied to chemical substances in which more than one ton is used per manufacturer annually , and only to chemical products , excluding the articles ( consumer products except for chemical products ) . however
, most manufacturers do not use more than one ton of chemical substances annually for household chemical products or children s products . properly identifying the kinds of substances used in products that may cause
substances that have not been tested for inhalation toxicity are still being used in spray products .
ultimately , it is difficult to properly carry out management of chemical substance use for most consumer products . under the current management system , consumer products manufacturers determine whether chemical substances are used in consumer products , but authorities do not have enough legal power or means to identify the usage beforehand and to prevent the release of products when there is concern for harm .
therefore , the national assembly must amend laws in order to create legal authority for the government to take responsibility on its own .
it is realistic conditions for the government to carry out administrative responsibility that manufacturers must be given the legal duty to provide lists of chemical substances used in products and their content and other relevant information that may be needed regarding product functions , and the authorities must be given the power and means to recall products if there is a violation of regulations .
it is no solution that the public just criticizes the rights and wrongs of the authorities . in particular
, the special act on safety of product for children comprehensively stipulates safety management work regarding chemical substances used in children s products , which is essentially the same management system defined by the act on quality management and safety control of industrial products .
if products satisfy the safety requirements presented by the korean agency for technology and standards , they can use any chemical substance and be released without any restrictions . in particular , for children s products as with biocide products , a registration and prior authorization system for children s products is needed , which would allow only products whose safety is verified beforehand containing substances whose safety is identified .
however , the korean agency for technology and standards does nt seem to have the expertise to deal with the management responsibility for children s products .
the korean agency for technology and standards is currently completely dependent on the ministry of environment for preliminary risk assessments regarding actual children s products it only determines whether the safety standards are met , through follow - up monitoring called a product safety investigation . therefore , administrative responsibility for safety management of chemical substances in consumer products can only be made possible if the responsibility for safety management of chemical substances used in all consumer products including children s products is fully transferred over to the ministry of environment . for consumer products that are known for their dangerousness ( e.g. ,
biocide products and spray products ) , a prior authorization system must be adopted immediately .
for this , arecs must be amended ( adopting the consumer products registration system and imposing the responsibility of product risk assessment to consumer products manufacturers ) and a separate legislation for biocide products must be advanced .
the hd incident needs to be understood as having two aspects : an accident due to a biocide ( the disinfectant ) and a safety issue of a consumer product ( the humidifier ) .
therefore , in order to prevent another hd incident , we need answers to questions such as , how can we make safety management possible for biocides ( e.g. , the disinfectant ) and biocide products ? and how can we guarantee safety of chemical substances for consumer products that require special management , like that of the humidifier ? in addition , we need to tackle the issue of preventing the reckless use of chemical substances without inhalation toxicity data in products that require special care due to the possibility of inhalation exposure .
in conclusion , the only solution is to adopt a product registration and prior authorization system for consumer products subject to special management , such as that of the humidifier , and for biocide products that contain biocides .
parts of the plan have already been implemented within the arecs system . a separate legislation that can play the role of the european union s biocidal product regulation is the most realistic plan .
to prevent blind spots in the chemical management , the essence is to adopt a certification for all biocides by use , except for biocide products already managed by different laws , and to adopt a prior authorization system for biocide products . for this , it is important to identify the actual distribution of biocides that have been pre - approved , which is only possible through the adoption of a prior authorization system with legal force .
manufacturers were asked to take countless surveys and provide material aid , but they only submitted questionable data from unknown sources . unless there is a device to expel products from the market if , through a later survey , unregistered substances are detected in products subject to management , it is realistically impossible to understand the actual state of affairs . a realistic plan is to identify the usage of active biocide components through a product registration system .
trying to identify the actual condition of biocides without such a registration system is impossible .
if the registration system does not immediately demonstrate its full functions , there is a need to temporarily report biocides whose domestic and foreign usages are identified , and to self - declare that other unreported substances are not used .
this is a necessary measure so that manufacturers are held responsible from the registration of the product to its entry into the market .
the remaining issue is safety management of chemical substances used in household products that manufacturers claim are not biocides ( active ingredients ) .
there are substances that could cause harm when used in consumer products , even if they are not active ingredients , whose functional purposes ( or uses ) are disinfection , sterilization , and preservation .
the most representative is waterproof coating material used on clothes and shoes for hiking , which is not a biocide in terms of its function , but could cause serious lung disease if used indoors without ventilation as a spray , since the substance can be inhaled .
besides biocides , assessment of product safety through pre - registration is needed for products and chemical substances that may cause harm .
however , it is over - regulation to designate all consumer products as products that need certification .
there is a need to review a plan to adopt a registration system only for products identified as having the possibility to cause harm ( e.g. , humidifiers , spray products , and children s products that have a high exposure intensity ) and designating products that could generate aerosol or products that need special management ( e.g. , children s products ) as products that need prior authorization . the only method to resolve the blind spots of management is to create a system to comprehensively manage chemical substances and consumer products , not to expand the number of products subject to management , which is a
mend the barn after the horse is stolen kind of approach . by separating the management of chemicals in products from the management of chemical substances ,
neither the chemical substance use management nor the safety of consumer products can be guaranteed .
the following are the only ways to prevent another hd ( product ) , another oxy reckitt benckiser ( product manufacturer , downstream user ) , and another sk chemical ( chemical substance manufacturer , upstream supplier ) : safety assessments of chemical substance use , governmental certification of chemical substance safety for consumer products , imposition of the burden of proof on manufacturers , and a disciplinary compensation system .
first , the principal agent of safety management for chemical substances must be completely transferred over to the ministry of environment and the ministry of food and drug safety , out of the current dichotomized system of products in either the ministry of trade , industry and energy and the ministry of environment or the ministry of food and drug safety .
the safety management agent for chemical substances used in consumer products must be clearly stipulated as the ministry of environment and the ministry of food and drug safety . in particular , a massive system reform is needed for the establishment of a comprehensive management system for chemical substances and products regarding children s products . in order to achieve this
, the physical safety management work must be left as is under the jurisdiction of the special act on children s product safety , and the chemical substance safety management work must be excluded . instead , the chemical substance safety management of children s products must be expanded and reorganized within the framework of the environmental health act , which supervises all children s environmental health issues .
the adoption of a pre - registration and assessment system for the chemical substance use management of children s products must also be advanced . for the safety evaluation of each usage type in the chemical substance management system
, the downstream user is responsible for delivering information on usage , quantity , and exposure conditions .
that way , if chemical substances are used for unidentified purposes , the upstream supplier ( the agent responsible for registering chemical substances ) can be held accountable and tangible registration and assessment of chemical substances can be made possible . however
, this regulation could exist in name only if the downstream user has the upper hand .
if a substance is registered once , the downstream user has the full responsibility to determine whether the substance is used in a safety - certified way or used in a different way from its registered exposure conditions .
along with considering a change in registration for changes in exposure condition as well as usage , an effective penalty must be made clear in case there is a violation of a change in registration .
cases where chemical substances are used in the final products such as articles were excluded from registration and assessment under arecs , due to trade secrets and other reasons . however , at least for consumer products , new regulations must be created in order to make registration assessment possible , with upstream suppliers and article manufacturers responsible for usage safety .
arecs must be transformed into an act that contains comprehensive regulations that manage the safety of chemical substances in consumer products , except for products that are managed under other individual laws . if it is realistically impossible to demand disclosure of information from downstream users , regulations must be amended so that instead of the current system of conducting a risk assessment by representative upstream suppliers , a risk assessment can be conducted after an exposure scenario is prepared through a self - evaluation by the downstream user . in other words , the choice must be made between a risk assessment carried out by upstream suppliers after collecting information about exposure scenario and exposure condition , or a risk assessment carried out by downstream users so that they can wield control over secretive information regarding their businesses .
a few korean conglomerates and associations are already disclosing whether or not they use harmful chemical substances in order to respond to the regulation systems of foreign countries ( eu reach , california proposition 65 ) .
such information should be disclosed in a suitable way and utilized for safety management of chemical substances in korea .
just as the registration and assessment of chemical substances is compulsory in principle , the registration and assessment of consumer products must also be fixed as a rule .
plans for a proactive management system and follow - up management and supervision must be proposed after properly classifying the scope in which the prior authorization system will be applied ( biocide products , children s products , spray products , recycled products ) and the scope in which self - certification will be applied ( other household chemical products ) . just like the act on the registration and evaluation , etc . of chemical substances , methods for the registration and assessment of existing and new consumer products
priorities must be set by considering product characteristics , such as usage ( intensity of use , duration , and frequency ) , material , and form , for consumer products that may cause harm ( e.g. household chemical products , children s products , aerosol generators , indoor construction material and flooring material , plate lumber / furniture ) .
the hd incident shows that a chemical substance with a toxicity so low that it was deemed safe to eat can cause tremendous consequences if inhaled .
therefore , using chemical substances whose inhalation toxicity is unidentified must be restricted or prohibited for consumer products with a strong possibility of inhalation exposure .
priorities for management must be set by evaluating the relative degree of inhalation exposure regarding the usage / material / form of all consumer products currently in use .
the priority for spray products used as air fresheners , deodorants , disinfectants , sterilizers , insecticides , and anti - rust additives is a safety check regarding inhalation toxicity . for products that generate aerosol ,
a list of usable substances should be suggested after taking exposure intensity into account , and must be strictly managed so that the substances are only used after receiving prior authorization .
currently , a total inspection is needed for identifying the usage of chemical substances that do not have inhalation toxicity data in products with a strong possibility of inhalation exposure .
since there is a realistic possibility that manufacturers will not know the quantity and types of substances used by manufacturers , measures must be taken regarding this issue . in the future , a list of usable substances should be suggested so that safety - certified products will be produced and distributed . through an investigation of the functions of individual chemical substances ,
if the function is essential , usage of alternative material should be induced through the support of alternative material assessment .
parts of the plan have already been implemented within the arecs system . a separate legislation that can play the role of the european union s biocidal product regulation is the most realistic plan .
to prevent blind spots in the chemical management , the essence is to adopt a certification for all biocides by use , except for biocide products already managed by different laws , and to adopt a prior authorization system for biocide products . for this , it is important to identify the actual distribution of biocides that have been pre - approved , which is only possible through the adoption of a prior authorization system with legal force .
manufacturers were asked to take countless surveys and provide material aid , but they only submitted questionable data from unknown sources . unless there is a device to expel products from the market if , through a later survey , unregistered substances are detected in products subject to management , it is realistically impossible to understand the actual state of affairs .
a realistic plan is to identify the usage of active biocide components through a product registration system .
trying to identify the actual condition of biocides without such a registration system is impossible .
if the registration system does not immediately demonstrate its full functions , there is a need to temporarily report biocides whose domestic and foreign usages are identified , and to self - declare that other unreported substances are not used .
this is a necessary measure so that manufacturers are held responsible from the registration of the product to its entry into the market .
the remaining issue is safety management of chemical substances used in household products that manufacturers claim are not biocides ( active ingredients ) .
there are substances that could cause harm when used in consumer products , even if they are not active ingredients , whose functional purposes ( or uses ) are disinfection , sterilization , and preservation .
the most representative is waterproof coating material used on clothes and shoes for hiking , which is not a biocide in terms of its function , but could cause serious lung disease if used indoors without ventilation as a spray , since the substance can be inhaled .
besides biocides , assessment of product safety through pre - registration is needed for products and chemical substances that may cause harm .
however , it is over - regulation to designate all consumer products as products that need certification . there is a need to review a plan to adopt a registration system only for products identified as having the possibility to cause harm ( e.g. , humidifiers , spray products , and children s products that have a high exposure intensity ) and designating products that could generate aerosol or products that need special management ( e.g. , children s products ) as products that need prior authorization .
the only method to resolve the blind spots of management is to create a system to comprehensively manage chemical substances and consumer products , not to expand the number of products subject to management , which is a
mend the barn after the horse is stolen kind of approach . by separating the management of chemicals in products from the management of chemical substances ,
neither the chemical substance use management nor the safety of consumer products can be guaranteed .
the following are the only ways to prevent another hd ( product ) , another oxy reckitt benckiser ( product manufacturer , downstream user ) , and another sk chemical ( chemical substance manufacturer , upstream supplier ) : safety assessments of chemical substance use , governmental certification of chemical substance safety for consumer products , imposition of the burden of proof on manufacturers , and a disciplinary compensation system .
first , the principal agent of safety management for chemical substances must be completely transferred over to the ministry of environment and the ministry of food and drug safety , out of the current dichotomized system of products in either the ministry of trade , industry and energy and the ministry of environment or the ministry of food and drug safety .
the safety management agent for chemical substances used in consumer products must be clearly stipulated as the ministry of environment and the ministry of food and drug safety . in particular , a massive system reform is needed for the establishment of a comprehensive management system for chemical substances and products regarding children s products . in order to achieve this ,
the physical safety management work must be left as is under the jurisdiction of the special act on children s product safety , and the chemical substance safety management work must be excluded . instead , the chemical substance safety management of children s products must be expanded and reorganized within the framework of the environmental health act , which supervises all children s environmental health issues .
the adoption of a pre - registration and assessment system for the chemical substance use management of children s products must also be advanced . for the safety evaluation of each usage type in the chemical substance management system ,
the downstream user is responsible for delivering information on usage , quantity , and exposure conditions .
if this responsibility is violated , a realistic penalty must be prescribed . that way , if chemical substances are used for unidentified purposes , the upstream supplier ( the agent responsible for registering chemical substances ) can be held accountable and tangible registration and assessment of chemical substances can be made possible
. however , this regulation could exist in name only if the downstream user has the upper hand .
if a substance is registered once , the downstream user has the full responsibility to determine whether the substance is used in a safety - certified way or used in a different way from its registered exposure conditions .
along with considering a change in registration for changes in exposure condition as well as usage , an effective penalty must be made clear in case there is a violation of a change in registration .
cases where chemical substances are used in the final products such as articles were excluded from registration and assessment under arecs , due to trade secrets and other reasons .
however , at least for consumer products , new regulations must be created in order to make registration assessment possible , with upstream suppliers and article manufacturers responsible for usage safety .
arecs must be transformed into an act that contains comprehensive regulations that manage the safety of chemical substances in consumer products , except for products that are managed under other individual laws . if it is realistically impossible to demand disclosure of information from downstream users , regulations must be amended so that instead of the current system of conducting a risk assessment by representative upstream suppliers , a risk assessment can be conducted after an exposure scenario is prepared through a self - evaluation by the downstream user . in other words , the choice must be made between a risk assessment carried out by upstream suppliers after collecting information about exposure scenario and exposure condition , or a risk assessment carried out by downstream users so that they can wield control over secretive information regarding their businesses .
a few korean conglomerates and associations are already disclosing whether or not they use harmful chemical substances in order to respond to the regulation systems of foreign countries ( eu reach , california proposition 65 ) .
such information should be disclosed in a suitable way and utilized for safety management of chemical substances in korea .
just as the registration and assessment of chemical substances is compulsory in principle , the registration and assessment of consumer products must also be fixed as a rule .
plans for a proactive management system and follow - up management and supervision must be proposed after properly classifying the scope in which the prior authorization system will be applied ( biocide products , children s products , spray products , recycled products ) and the scope in which self - certification will be applied ( other household chemical products ) . just like the act on the registration and evaluation , etc . of chemical substances , methods for the registration and assessment of existing and new consumer products
priorities must be set by considering product characteristics , such as usage ( intensity of use , duration , and frequency ) , material , and form , for consumer products that may cause harm ( e.g. household chemical products , children s products , aerosol generators , indoor construction material and flooring material , plate lumber / furniture ) .
the hd incident shows that a chemical substance with a toxicity so low that it was deemed safe to eat can cause tremendous consequences if inhaled .
therefore , using chemical substances whose inhalation toxicity is unidentified must be restricted or prohibited for consumer products with a strong possibility of inhalation exposure .
priorities for management must be set by evaluating the relative degree of inhalation exposure regarding the usage / material / form of all consumer products currently in use .
the priority for spray products used as air fresheners , deodorants , disinfectants , sterilizers , insecticides , and anti - rust additives is a safety check regarding inhalation toxicity . for products that generate aerosol ,
a list of usable substances should be suggested after taking exposure intensity into account , and must be strictly managed so that the substances are only used after receiving prior authorization .
currently , a total inspection is needed for identifying the usage of chemical substances that do not have inhalation toxicity data in products with a strong possibility of inhalation exposure .
since there is a realistic possibility that manufacturers will not know the quantity and types of substances used by manufacturers , measures must be taken regarding this issue . in the future , a list of usable substances should be suggested so that safety - certified products will be produced and distributed . through an investigation of the functions of individual chemical substances ,
if the function is essential , usage of alternative material should be induced through the support of alternative material assessment . | the humidifier disinfectant disaster ( hdd ) was not a simple poisoning accident by biocides , but a singular disaster in history created by chemicals in household products .
this disaster was a result of the failure of a system for the management of chemical and product safety .
since the management authority for chemical usage safety is different from those for chemical safety in products , many blind areas for chemical safety management in products still remain .
the act on the registration and evaluation , etc . of chemical substances ( arecs) or the new
biocidal product act must not only address the blind areas in the management system for chemical and product safety , but also prevent a second hdd . to prevent another hdd ,
an integrated registration , evaluation , and management system for chemicals and consumer products must be incorporated into the arecs as an essential part for chemical safety in consumer products . | Introduction
Diagnosis of the Causes of the Humidifier Disinfectant Incident
The Absence of Prevention Measures From the Governments Response to the Humidifier Disinfectant Disaster
Measures to Prevent the Recurrence of a Humidifier Disinfectant Incident
Conclusion
Adopting a Product Registration and Prior Authorization System for Biocides and Biocide Products
Preparing a Resolution for Management Blind Spots Regarding Consumer Products
Prohibition of Substances of Unknown Inhalation Toxicity in Consumer Products That May Be Subject to Inhalation Exposure |
biliary atresia is the most common neonatal cholestatic disorder with a varying incidence of 1:8000 - 1:18000 .
the disease is characterized by obliteration or discontinuity of the extrahepatic bile ducts with persistent jaundice in an infant who usually looks well .
most patients with extrahepatic biliary atresia ( ehba ) ( 70 - 95% ) have no associated extrahepatic congenital abnormality and are classified as having classical biliary atresia .
the remaining cases present in association with one or more extrahepatic congenital anomalies , including polysplenia , portal vein abnormalities , intestinal malrotation , abdominal situs inversus , absence of inferior vena cava , intrapulmonary shunting , asplenia , pancreatic anomalies , and congenital heart disease .
these anomalies might be the result of a late intrauterine or early neonatal insult associated with a presumed inflammatory process whereas cases of ehba with major unrelated congenital anomalies could arise through malformations , disruptions or chromosomal abnormalities .
the liver damage may progress despite re - establishment of biliary drainage after corrective surgery .
the medical records of 137 patients with ehba treated by the senior author ( vb ) in the department of pediatric surgery , aiims , new delhi during the past 12 years were reviewed .
retrospective data were collected from each record including the patient 's age at the time of surgery , sex , duration of onset of jaundice , liver function tests , imaging studies , presence of any associated anomalies ( polysplenia , hepatic vasculature and portal vein anomalies , intestinal malrotation , situs inversus or congenital heart disease ) , date of kasai procedure ( kp ) , liver histology , and postoperative outcome .
imaging evaluation was done with ultrasonography , magnetic resonance cholangiopancreatography , post - primingtc iminodiacetic acid hepatic scan , and peroperative cholangiography .
the mean age was 81 33 days ( range = 20 - 150 days ) .
these anomalies were divided into four groups hepatobiliary , gastrointestinal , cardiovascular , and others [ table 1 ] .
of these 40 patients , 26 patients had hepatobiliary anomalies which included hepatic vascular inflow anomalies in 22 patients , choledochal cyst in 4 patients , and 2 patients had spleniculi .
the right hepatic artery arose from the superior mesenteric artery in 7 patients , 10 patients showed early branching of right hepatic artery outside liver parenchyma , in 2 patients right hepatic artery gave a small branch to the left lobe , cystic artery was found to be arising from the left hepatic artery in 2 patients , in 2 patients two cystic arteries were supplying the gall bladder , accessory right hepatic artery was seen in 4 patients , early division of portal vein was seen in 5 patients .
gastrointestinal anomalies were seen in 13 patients ( 22.4% ) and these included intestinal malrotation in 7 patients ( 12% ) , jejunoileal atresias ( jejunal-2 , ileal-1 ) in 3 patients ( 5% ) , 2 patients ( 3.4% ) had esophageal atresia and tracheoesophageal fistula , 1 patient ( 1.7% ) had meckel 's diverticulum .
cardiac anomalies included an atrial septal defect in 2 patients and two had situs inversus .
others included umbilical hernias ( n = 10 ) and inguinal hernia ( n = 3 ) .
congenital anomalies associated with biliary atresia the esophageal atresia and jejunoileal atresia patients had undergone corrective surgeries in the 1 week of life and none of them had received parenteral nutrition .
all the patients ( n = 7 ) with malrotation underwent ladd 's procedure simultaneously with kp .
furthermore , patients who had hernias ( umbilical / inguinal ) underwent hernia repair simultaneously .
all infants ( n = 4 ) of ehba with choledochal cyst had type iii biliary atresia and were treated surgically with bilioenteric bypass procedures .
it occurs slightly more often in females than in males ( 1.4:1 ) , and affects children of all races .
the coexistence of ehba with other congenital anomalies has been widely reported , with an incidence ranging from 10% to 15% . in our study , ehba occurred as an isolated defect in 70.8% patients and was associated with other anomalies in 29.2% of infants . in larger series of ehba , either an equal gender distribution or only a slight female predominance was observed . in our study , not only a higher prevalence of ehba but also a higher incidence of associated anomalies was seen in boys .
various anomalies including malrotation , liver asymmetry , situs inversus , absent inferior vena cava , preduodenal portal vein , and polysplenia have been reported in association with biliary atresia ; teratogenesis during the critical period of fetal embryogenesis of the foregut might be responsible for these anomalies . in our series , vascular anomalies at porta hepatis
the anatomy of the hepatic artery and its variants has been described adequately in literature , but new emphasis was given to this anatomy with the introduction of liver transplantation .
four patients with atresia of the distal common bile duct had a proximal choledochal cyst and were treated surgically with bilioenteric bypass procedures .
the occurrence of associated anomalies in infants with ehba might support the hypothesis that the disease represents more than one clinical entity with different causes . in literature , among congenital structural anomalies associated with ehba , splenic malformations such as polysplenia or asplenia have been known to be very common .
polysplenia syndrome has been reported in 25% of all biliary atresia cases ; this might be due to the insult to the bile duct early in gestation at a time coinciding with the development of the spleen and gut rotation .
however , it was seen in only two infants ( 3.4% ) in our series .
malrotation of the intestinal tract is the result of a well - defined aberrant sequence of embryological events . in
the present series , among gastrointestinal anomalies , malrotation of the intestine was the most frequent anomaly and it was incidentally detected during kp .
none of these patients had manifested any symptoms related to intestinal malrotation . in all these patients ,
technical difficulties were , however , encountered while constructing the roux en y loop in the derotated bowel for kp .
the most frequent form of intestinal atresia associated with ehba has been reported to be duodenal atresia .
the association of biliary atresia and duodenal malformation might be presupposed from their common points of embryonic development .
the incidence of ehba in cases of jejunoileal atresia ranges from 0% to 0.5% . in our study , there were 2 jejunal atresia and 1 ileal atresia patients .
the postulation for the coexistence of biliary atresia and jejunoileal atresia might be bacterial or viral infection in the peri or postnatal period .
furthermore , the coexistence of esophageal and biliary atresia was seen in two patients ; the literature has reported this association rarely .
biliary atresia is reported to occur in 28% of infants born with situs inversus as compared to the 0.01% of the general population and genetic factors were suggested for this coexistence . in our series ,
reviews conducted by silveira et al . on 237 biliary atresia patients reported associated structural lesions in 47 patients ( 19.8% ) this finding was confirmed by carmi et al . in a multicenter study of 251 biliary atresia cases in which 51 children ( 20.3% ) had associated anomalies .
reported that 25 infants ( 45% ) showed several forms of congenital heart disease and nine infants ( 16% ) required cardiac surgery ; of these , the initial operation predated the biliary exploration in 7 . in the present series ,
only two patients showed structural cardiac anomalies ; however , echocardiography was not a part of the routine work - up of the patients with biliary atresia and these anomalies might get unnoticed unless looked for specifically .
the existence of anomalies in distantly developing anatomic regions in patients with ehba supports the possibility of a generalized insult during embryogenesis rather than a localized defect . the distant anomalies , unless life threatening on their own part
however , anomalies of gut rotation and those in and around the porta hepatis can adversely affect the performance of kp and hence the outcome of treatment .
in the present study , the incidence of vascular anomalies at the porta hepatis , abdominal wall hernias , malrotation of intestine , and digestive anomalies was much more common as compared to splenic and cardiac anomalies as reported in other studies .
in addition , male infants were observed to have a higher incidence of associated anomalies as compared with the female infants in contrast to other reported studies .
the presence of anomalies did not affect the timing of the surgery which is important for favorable results . | background / purpose : this study aims to analyze the incidence and type of various associated anomalies among infants with extrahepatic biliary atresia ( ehba ) , compare their frequency with those quoted in the existing literature and assess their role in the overall management.materials and methods : a retrospective study was performed on 137 infants who underwent the kasai procedure for ehba during the past 12 years .
the medical records were reviewed for the incidence and type of associated anomalies in addition to the details of the management of the ehba.results:of the137 infants , 40 ( 29.2% ) were diagnosed as having 58 anomalies .
the majority of patients had presented in the 3rd month of life ; mean age was 81 33 days ( range = 20 - 150 days ) .
there were 32 males and 8 females ; boys with ehba had a higher incidence of associated anomalies .
of these 40 patients , 22 ( 37.9% ) had vascular anomalies , 13 patients ( 22.4% ) had hernias ( umbilical-10 , inguinal-3 ) , 7 patients ( 12.1% ) had intestinal malrotation , 4 patients ( 6.8% ) had choledochal cyst , 1 patient ( 1.7% ) had meckel 's diverticulum , 3 patients ( 5% ) had undergone prior treatment for jejunoileal atresias ( jejunal-2 , ileal-1 ) , 2 patients ( 3.4% ) had undergone prior treatment for esophageal atresia and tracheoesophageal fistula , 2 patients ( 3.4% ) had spleniculi , and 2 patients ( 3.4% ) were diagnosed as having situs inversus.conclusions:the most common associated anomalies in our study were related to the vascular variation at the porta hepatis and the digestive system .
the existence of anomalies in distantly developing anatomic regions in patients with ehba supports the possibility of a
generalized insult during embryogenesis rather than a localized defect .
in addition , male infants were observed to have significantly more associated anomalies as compared with the female infants in contrast to earlier reports . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUSION |
dna repair processes are indispensable for maintaining the integrity of genetic information in all organisms .
environmental agents such as chemicals , uv light , and ionizing radiation , as well as endogenous metabolic processes involving dna constantly challenge the chemical structure and stability of the genome .
dna lesions can interfere with processes such as dna replication or transcription and may lead to mutations and cancer [ 1 , 2 ] . to prevent the erosion of the chemical structure of dna ,
living systems have evolved various different biochemical systems for dna repair [ 37 ] .
dna damage from endogenous sources gives rise to 20,000 lesions per mammalian cell per day . amongst these lesions ,
the most common are base deamination , spontaneous hydrolysis of the n - glycosidic bond , alkylation , and damage by reactive oxygen or nitrogen species and lipid peroxidation products [ 812 ] .
other lesions such as the formation of single- and double - strand breaks , the collapse of replication forks , and the introduction of modified nucleic acid bases during dna replication are caused by errors in dna metabolic processes . in total , there are 1010 dna repair events that occur daily in a healthy adult man ( 10 cells ) .
lesions that are not repaired often lead to mutations , aging and various diseases , including carcinogenesis and neurodegeneration [ 1418 ] .
some pathological disorders directly related to defects in the dna repair machinery are xeroderma pigmentosum , different types of cancer ( breast cancer , colorectal cancer , endometrial cancer , gastric cancer , or prostate cancer ) , fancomi anemia , muir - torre syndrome , tay syndrome , and werner syndrome . on the other hand ,
unrepaired lesions that occur in germline cells become the main source of genetic variability and therefore a driving force for the evolution . for this reason ,
the dna repair system needs not only to be regulated to maintain an individual genome 's integrity , but also to increase the genetic variability in the context of populations .
many mechanisms are known that regulate the amount of dna repair as a response to environmental conditions .
given its many duties in different contexts , it is not surprising that dna repair is a very complicated process , involving many factors .
for instance to date , 168 genes encoding proteins involved in dna repair have been identified in the human genome [ 17 , 18 , 20 ] ( 20 january 2011 , date last accessed ) . over all organisms ,
there are many more ; for base excision repair alone , kegg lists 41 groups of orthologous genes encoding for hundreds of proteins in total .
the key players in dna repair are enzymes that catalyze reactions leading from the dna with damage to a repaired molecule .
they are assisted by proteins that detect damage and mediate signals that coordinate the repair process with other cellular processes . from the point of view of the dna substrate ,
the biochemical pathways of dna repair can be divided into eight categories : dna damage signaling ( dds ) : also known as the dna damage checkpoint ; it is a group of responses to dna damage caused by some endogenous and environmental agents ; activation of these pathways may be triggered by the effect the dna lesions have on replication , transcription , or chromatin topology ; base - excision repair ( ber ) : initiated by excision of a modified base from the dna .
depending on the length of dna resynthesis , the pathway is subdivided into two subpathways : short path ( sp - ber ) or long path ( lp - ber ) ; dna damage response ( ddr ) : directly restores the native nucleotide residue by removing the nonnative chemical modification ; homologous recombination repair ( hrr ) : repair of dna double - strand breaks using the homologous dna strand as a template for resynthesis ; mismatch repair ( mmr ) : postreplicational dna repair that removes errors introduced during the replication ( misinserted nucleotides , small loops , insertions , deletions ) ; nonhomologous end - joining repair ( nhej ) : ligation of ends resulting from dna double - strand breaks ( including the more error - prone microhomology - mediated end - joining ( mmej ) mechanism ; nucleotide excision repair ( ner ) : removes bulky damage from the dna .
the damage from the active strand of transcribed genes is removed by transcription coupled repair ( tcr)-ner , while global genome repair ( ggr)-ner removes damage present elsewhere in the genome ; translesion synthesis ( tls ) : damage - tolerance pathway that employs specialized polymerases to replicate across lesions in order to finish replication despite dna damage .
each of these pathways can be represented as a series of enzymatic transformations between different dna structures , catalyzed by a dedicated system of proteins .
it must be emphasized that dna repair pathways are connected to each other , that is , they can share some steps and/or proteins involved . as a consequence
, dna repair proteins rarely work in isolation in the cell , and their activity is dependent on other components of dna repair systems .
dna repair itself is not an isolated process , and it is strongly connected to other pathways of nucleic acid metabolism , including ( but not limited to ) dna replication , dna epigenetic modification , transcription , cell cycle regulation , and induced cell death as well as processes that are specific to different domains of life , such as telomere maintenance in eukaryotes and dna restriction in prokaryotes .
the knowledge of dna repair systems and their components is critical to our understanding of how cells control the integrity of their genomes .
a large body of data on this topic has been published mostly in the literature and in a few electronic resources .
today , systematizing this knowledge and presenting it in a clear and easily accessible way is mostly done by biological databases .
the collection , curation , and availability of data are necessary to answer questions about subsystems of dna repair , for example , which proteins participate in mmr in humans and in plants ? , what immediate cellular response is triggered by damage caused by uv light ? , or how does hrr differ between plants and vertebrates ?
however , there are few databases dedicated to dna repair , and most of the data is scattered over various general databases . in table 1 , we have listed some of the available web resources relevant to dna repair , and in the following section we discuss their content .
repairtoire is a database for systems biology of dna damage and repair developed by the authors of this paper and their coworkers .
the purpose of this database is to gather information about all dna repair systems and proteins from model organisms and to facilitate the access to knowledge about correlation of human diseases with mutations in genes responsible for dna integrity and stability as well as information about toxic and mutagenic agents causing dna damage .
repairtoire is available online at http://repairtoire.genesilico.pl/. it organizes data into the following categories : ( i ) the chemical structures of dna lesions ( as of april 2011 : 85 different types of damage in the dna ) linked to their causative mutagenic and cytotoxic agents , ( ii ) pathways comprising individual processes and enzymatic reactions involved in the removal of damage , ( iii ) proteins participating in dna repair , in particular enzymes involved in the transformation between different chemical structures of the dna substrate , and ( iv ) diseases correlated with mutations in genes encoding dna repair proteins ( 40 diseases caused by the mutations in 32 genes linked to defects in dna repair proteins ) .
repairtoire covers all eight main dna damage checkpoint , repair , and tolerance pathways ( see above ) .
the pathway / protein dataset is currently limited to three model organisms : escherichia coli , saccharomyces cerevisiae , and homo sapiens .
dna repair and tolerance pathways are represented as graphs and in tabular form with descriptions of each repair step as well as corresponding proteins .
the individual entries in the database ( proteins , diseases , pathway steps , damage , etc . ) are cross - referenced to the supporting literature and their respective primary databases .
repairtoire can be queried by the names of pathway , protein , enzymatic complex , damage and disease .
the query tool returns a structured list of entries in the database that contain the query ( e.g. , cancer , dna polymerase
, crosslink , adenine , etc . , or a name of the author ) .
these features have been provided for collaborators and superusers who are interested not only in viewing , but also curating the content of the database .
creating an account and logging into the database grants access to the administrative site of the database to a user . by entering the administration site
, it is possible to add new data , delete information , edit , and correct mistakes .
editing information about proteins , genes , diseases , and types of damage is also available via wiki - like pages for particular database entries .
repairtoire is unique in that it focuses on dna repair and provides reciprocal annotation between damage entities and the proteins that can detect and remove them .
it also contains more connections between dna lesions and the respective proteins that can detect and remove them than can be found in general - purpose databases .
the repairtoire website which also provides an online tool for drawing images of dna - protein complexes ( accessible via the
this tool has been developed to illustrate all steps of dna repair pathways as protein - dna complexes , in which proteins are displayed in the textbook - like format of potato models ( ellipsoids ) .
however , it can be also used outside the dna repair context to create images of any protein - protein or protein - dna complexes
. the drawing engine uses the svg format provided by the w3c consortium and enables exporting the image in the jpeg format .
images created in the svg vector format can be scaled without losing quality and can be modified with external tools for vector graphics processing , for example , inkscape or other free or commercially available software .
the repairgenes database ( http://www.repairgenes.org/ ) collects information about genes encoding proteins involved in dna repair and connects information taken from sequence and ontology databases . at the moment
the database can be browsed by organisms and by biological processes defined by the gene ontology ( go ) standard .
the species are organized in a taxonomy tree . for processes , 17 subcategories of the go term dna repair
( go:0006281 ) and their respective subterms are distinguished . for each process , the organisms and genes that refer to this term can be listed . also , it is possible to highlight the processes for a given organism .
the major advantage of using go terms is that they are being used ubiquitously for annotating sequence data .
the raw data about dna repair genes is extracted from the swiss - prot database .
the repairgenes database also gives an overview of dna repair processes and genes in five selected organisms ( archaeoglobus fulgidus , drosophila melanogaster , e. coli , homo sapiens , and s. cerevisiae ) , in total listing 452 genes . human dna repair genes
is an online supplement to a review published by wood et al . in 2005 and updated regularly ( http://sciencepark.mdanderson.org/labs/wood/dna_repair_genes.html ) .
it provides a table with gene name ( synonyms ) linked to the genecards human gene database at cancer research uk ( http://bioinformatics.cancerresearchuk.org/genecards/ ) , activity linked to the omim database , chromosome location linked to the ncbi mapview , and an accession number linked to the ncbi entrez server .
the repair - funmap database used to provide information about the network of interactions between proteins involved in dna repair and other proteins , but to our best knowledge it is no longer available . kegg ( kyoto encyclopedia of genes and genomes , available at http://www.genome.jp/kegg/ ) is a collection of separate cross - linked databases including kegg pathway , kegg disease ( human diseases ) , kegg genes ( genes and proteins ) , and kegg organisms .
of particular relevance to dna repair are kegg genes ( a catalog of genes for sequenced genomes obtained from publicly available resources , mostly ncbi refseq and kegg pathway ( a collection of manually drawn pathway maps representing knowledge on the molecular interaction and reaction networks for : global map of pathways , metabolism , genetic information processing , environmental information processing , cellular processes , organismal systems , human diseases , and interaction of these systems with drugs ) ) .
dna repair pathways annotated in kegg include ber , ner , nhej , mmr , and hrr but not dds , ddr , or tls .
a schematic graphical representation of protein - dna complexes in the reaction steps of each pathway is available for eukaryotes and prokaryotes separately .
kegg brite is another component of kegg that is important for analyzing dna repair systems .
it is a collection of hierarchical classifications representing knowledge on various aspects of biological systems .
in contrast to kegg pathway , which is limited to molecular interactions and reactions , kegg brite incorporates many different types of relationships .
the most relevant and interesting part is a section devoted to dna repair ( identifier ko03400dna repair and recombination proteins ) , where all dna repair proteins available in kegg are classified according to their functions in this process .
reactome ( http://www.reactome.org/reactomegwt/entrypoint.html ) is a resource developed in collaboration among different groups as an open source curated bioinformatics database of human pathways and reactions .
the site provides bioinformatics tools for pathway analysis such as : the pathway browser , the pathway and expression analysis tools , or the species comparison tool .
in contrast to kegg , reactome includes graphical representations of dna repair pathways generated for each organism explicitly instead of a generalized view like in kegg
. moreover , reactome divides pathways into subpathways , for example , gg - ner ( global genomic ner ) in human is divided into four subpathways ( dna damage recognition , formation of the incision complex , dual incision reaction , and gap - filling dna repair synthesis and ligation ) .
each subpathway contains individual reactions visualized in the context of the entire cellular metabolic map .
the pathway analysis tool facilitates analysis of different pathways , for example , finding connections between rna transcription and dna repair , facilitating interdisciplinary studies .
the genesnps database ( http://www.genome.utah.edu/genesnps/ ) is dedicated to known human polymorphisms and has a section devoted to dna repair .
it can be accessed from the main page by selecting dna repair in the gene lists menu on top of the home page .
the snp loci are presented as a table of 119 human genes involved in dna repair and connected to phenotypes described in the omim database .
an exemplary usage of this resource is the study of polymorphisms in the dna repair gene xrcc , where all the snp data were collected from the genesnps database .
more phenotypes of dna repair defects can be found in the mouse mutation database ( a database of mouse strains carrying targeted mutations in genes affecting cellular responses to dna damage available at http://pathcuric1.swmed.edu/research/research.htm ) . biocyc ( http://biocyc.org/ ) is a collection of 1004 ( as of february 2011 ) pathway / genome databases .
each database in the biocyc collection describes the genome and metabolic pathways of a single organism .
this is not only a collection of databases but of tools for bioinformatics analysis , including the following : a genome browser , a display of individual metabolic pathways and of full metabolic maps , visual analysis of user - supplied omics datasets by painting onto metabolic , regulatory , and genome maps , and comparative analysis tools .
tier 1 databases have received person - decades of literature - based curation and are the most accurate .
these include for example , ecocyc ( http://ecocyc.org/ ) , a comprehensive database of escherichia coli k-12 mg1655 biology or metacyc ( http://metacyc.org/ ) , a database of nonredundant , experimentally elucidated metabolic pathways .
data included in these databases undergo a curation procedure involving external experts , who work on particular cellular systems to provide a comprehensive literature overview and up - to - date coverage of the field .
recently , this type of curation has been applied to the process of dna repair ; both direct repair mechanisms , such as photolyase , as well as indirect repair mechanisms , such as nucleotide excision repair , base excision repair and homologous recombination have been annotated .
tier 2 and tier 3 databases of biocyc contain computationally predicted metabolic pathways , predictions as to which genes code for missing enzymes in metabolic pathways , and predicted operons .
biocyc does not include a dedicated dna repair section , but information on dna repair pathways can be found in other database sections .
data available in biocyc can be used in in - depth analyses of biological systems relevant to different fields of research .
this approach has been demonstrated in the study of differential network expression during drug and stress response by cabusora et al . , where the expression data of known stress responders and dna repair genes in mycobacterium tuberculosis from biocyc collection were used .
brenda ( braunschweig enzyme database , http://www.brenda-enzymes.org/ ) is a comprehensive database on enzymes that collects manually annotated information on properties of enzymes , including mutants and engineered variants .
enzyme records contain data taken from the primary literature , such as classification , nomenclature , reaction type , substrate specificity , functional parameters , species , protein sequence and structure , practical application , information on mutants and engineered variants , stability , disease , isolation , and preparation .
an essential part of brenda consists of information on metabolites and small molecules , which interact with enzymes as substrates and products , inhibitors , activating compounds , cofactors , or bound metals .
brenda provides also enzyme disease - related information obtained from pubmed entries by text - mining procedures .
brenda is currently the largest continuously maintained and publicly available enzyme database and covers a large number of experimentally characterized dna repair enzymes .
pathway commons ( http://www.pathwaycommons.org/pc/ ) is a comprehensive collection of publicly available pathway data from multiple organisms , which includes biochemical reactions , complex assembly , transport , catalysis events , and physical interactions involving proteins , dna , rna , small molecules , and complexes
. this meta - database collects information from other databases such as reactome or biogrid , thereby facilitating analyses of system - level datasets across several species .
it allows users to browse and search pathways across multiple valuable public pathway databases and download an integrated set of pathways in the biopax format for global analysis .
it also provides an interface for software developers to create software for more advanced analyses and hence may be a very useful resource for programmatic linking of data on dna repair systems with other cellular systems and pathways .
examples include dna replication ( oridb , replicationdomain ) , apoptosis ( deathbase ) , telomere maintenance ( telomerase database ) , dna restriction and modification ( rebase ) , and epigenetics / chromatin modification ( dancer ) .
these processes are relevant to dna repair as they may contribute to dna damage ( replication ) or regulation of other enzymatic processes ( dna methylation , cell cycle control , and apoptosis ) .
in addition to databases that store and disseminate the data , there are also bioinformatics tools that can be particularly useful for data analyses .
we would like to emphasize three groups of predictive tools that can be particularly useful for analyzing dna repair enzymes : methods for predicting and modeling protein structures , predicting protein - dna interactions and complexes , predicting the effect of amino acid substitutions on protein stability and function , and their phenotypic effect , as well as predicting cancer outcome .
there is a large number of tools , with which to predict the structure of a protein when only its sequence is known .
there , a protein with known 3d structure is used as a template to construct a model for another , evolutionarily - related protein ( a target ) .
this approach requires not only an experimentally solved structure of the template protein , but also a pairwise sequence alignment between the target and the template . among the numerous methods , the swiss - model
server ( http://swissmodel.expasy.org/ ) supports not only the fully automatic construction of homology models via its web interface , it also helps finding a suitable template and alignment .
it is particularly useful for building models of proteins that are closely related to the experimentally determined structures , so the relationship can be detected by methods such as blast .
if no such closely related templates are available , advanced template search and alignment tools such as hhsearch can be used to identify remote evolutionary relationships .
there are also specialized meta - servers such as the genesilico metaserver developed in the laboratory of the authors of this paper .
these tools use several third - party methods and infer a consensus prediction . as an example of protein modeling application to the analysis of dna repair
, we may refer to an analysis carried out in our laboratory : missense alterations of the mismatch repair gene mlh1 have been identified in a significant proportion of individuals suspected of having lynch syndrome , a hereditary syndrome that predisposes for cancer of colon and endometrium .
a number of mlh1 alterations are located in the c - terminal domain ( ctd ) of mlh1 , which is responsible for constitutive dimerization with another protein pms2 .
we used the aforementioned genesilico metaserver to identified structurally characterized homologs of mlh1 and align their sequences , thereby enabling the construction of a homology model for mlh1 using the
frankenstein 's monster approach [ 56 , 57 ] . that structural model was used to analyze 19 alterations connected to lynch syndrome and to identify three alterations that decrease the efficiency of mmr in human by interfering with the mlh1-pms2 dimerization , confirming that they are pathogenic , and suggesting that defective dimerization underlies their deleterious effect .
when analyzing enzymes acting on dna , it is often important to know which parts of them interact with the substrate .
prediction of dna - binding residues is facilitated by the knowledge of protein structure , either from experiment or from prediction ( see above ) .
an example of a bioinformatics online tool for structure - based prediction of dna - binding residues is displar ( http://pipe.scs.fsu.edu/displar.html ) , which uses a machine learning approach .
there are also methods , available as web services , enabling prediction of dna - binding from protein sequence alone .
examples include bindn+ ( http://bioinfo.ggc.org/bindn+/ ) , disis ( http://www.predictprotein.org/ ) , and dnabindr ( http://turing.cs.iastate.edu/preddna/predict.html ) . if 3d structures of the components are known , it is also possible to obtain a three - dimensional model of protein - dna complexes .
server ( http://haddock.chem.uu.nl/ ) uses a flexible docking approach to build a complex from two or more separate protein and dna structures .
it takes into account additional information such as distances between interacting residues and includes them as
this allows to use results from experimental analyses like mutation , crosslinking , and footprinting experiments or computational predictions made , for example , by the above - mentioned bioinformatics methods .
it is important to note that haddock generates a complex structure for all given components , but it does not evaluate whether the given components really interact and does not enable the modeling of large conformational changes . also , identifying the correct interaction region is the most error - prone step , which is why accurate experimental knowledge is essential to obtain reliable structures .
the haddock developers also provide an extensive dataset of protein - dna complexes that can be used for benchmarking purposes .
an alternative approach is to build models with other methods , without the use of experimental data , and then use the filtrest3d method developed in the laboratory of the authors to rank them according to the extent of agreement with the restraints .
as illustrated by the example of the mlh1 protein , prediction of mutation / substitution effects on protein structure and function , and linking them to the relevant phenotype can be very useful in the study of dna repair proteins .
snps3d ( http://www.snps3d.org/ ) is an online tool that returns predictions of functional effects of nonsynonymous snps stored in the ncbi dbsnp database ; currently it does not make predictions for altered sequences submitted by the users .
there are a few predictive online methods that use protein structure ( solved experimentally or modeled ) to infer the effect of user - defined amino acid substitutions .
cupsat ( http://cupsat.tu-bs.de/ ) ( cologne university protein stability analysis tool ) predicts gibbs - free energy changes associated with amino acid substitutions , based on analyzing of residue interactions with its 3d environment .
popmusic ( http://babylone.ulb.ac.be/popmusic/ ) evaluates the changes of protein stability resulting from single - residue or multiple substitutions .
it can be used both as a classifier for predicting the sign of the protein stability change upon mutation and as a regression estimator for predicting the related gibbs - free energy changes .
mupro ( http://www.ics.uci.edu/~baldig/mutation.html ) is a set of machine learning programs to predict how single - site amino acid substitutions affect protein stability .
the server accepts single protein sequences or sequences with a predicted tertiary structure of the protein as an input .
there are also methods that predict mutation / substitution effects based on sequence information alone .
polyphen ( polymorphism phenotyping ) ( http://genetics.bwh.harvard.edu/pph/ ) predicts the possible impact of an amino acid substitution on the structure and function of human proteins , based on straightforward empirical rules .
( http://sift.jcvi.org/ ) predicts whether an amino acid substitution ( aas ) affects protein function based on analysis of sequence profiles .
it can be applied to study naturally occurring nonsynonymous polymorphisms as well as laboratory - induced missense mutations .
( http://mutpred.mutdb.org/ ) is a web application that predicts the gain / loss of 14 different structural and functional properties ( for instance , gain of helical propensity or loss of a phosphorylation site ) .
it also classifies an amino acid substitution as disease - associated or neutral in human .
phd - snp ( http://snps.uib.es/phd-snp/phd-snp.html ) is another machine - learning method for predicting whether a phenotype derived from a nonsynonymous snp could be related to a genetic disease in humans .
it is optimized to predict if a given point mutation can be classified as a disease - related or a neutral polymorphism . a tool which facilitates the analyses of cancer - related proteins , genes and pathways is caerus a tool for predicting cancer outcomes using relationships between protein structural information , protein networks , gene expression data , and mutation data ( http://www.oicr.on.ca/research/ouellette/caerus/ ) .
this tool was developed in order to identify a list of gene signatures and to better predict cancer by investigating the changes in gene expression profiles caused by disruptions between protein - protein interactions and domain - domain interactions in the human interactome .
as the authors of caerus indicate , it was tested on a set of well - documented breast cancer patients , which suggests that the disrupted interactome is important to determine patient prognosis .
they also declare that this approach is robust if tested on other independent data sets and therefore offers a promising prognostic tool to classify different cancer outcomes .
as dna repair is closely connected to cancer , this service can be used in the analysis of proteins and genes related to oncogenesis .
dna repair is currently covered by a few dedicated databases . while repairtoire and repairgenes focus on this topic , information is also available via general - purpose pathway databases .
for instance , there is no specialized , universal ontology and no standards to describe entities and processes involved in dna repair .
connecting the known parts such as enzymes , to pathways and processes in a formalized way that at the same time provides more insight into dna repair processes , is probably the biggest challenge for the bioinformatics of dna repair in the nearest future .
it may be necessary to extend the currently established go ontology by a vocabulary that will allow for describing repair processes on the protein complex and reaction level .
a particular challenge is to find a consistent and appealing way to represent repair processes visually , and to include not only 3d descriptions , but also the dimension of time .
the development and application of new computer programs for simulating and visualizing molecular processes involving multiple components will certainly contribute to our understanding of the complex process of dna repair .
in particular , it may help in the identification of new biomarkers , in predicting the possible side - effects of drugs based on personal genome information , and in the development of new therapeutic agents to restore the proper function of dna repair proteins affected by disease - causing mutations . | dna is continuously exposed to many different damaging agents such as environmental chemicals , uv light , ionizing radiation , and reactive cellular metabolites .
dna lesions can result in different phenotypical consequences ranging from a number of diseases , including cancer , to cellular malfunction , cell death , or aging . to counteract the deleterious effects of dna damage ,
cells have developed various repair systems , including biochemical pathways responsible for the removal of single - strand lesions such as base excision repair ( ber ) and nucleotide excision repair ( ner ) or specialized polymerases temporarily taking over lesion - arrested dna polymerases during the s phase in translesion synthesis ( tls ) .
there are also other mechanisms of dna repair such as homologous recombination repair ( hrr ) , nonhomologous end - joining repair ( nhej ) , or dna damage response system ( ddr ) .
this paper reviews bioinformatics resources specialized in disseminating information about dna repair pathways , proteins involved in repair mechanisms , damaging agents , and dna lesions . | 1. Introduction
2. DNA Repair Data and Databases
3. Bioinformatics Tools for the Study of DNA Repair Proteins
4. Summary |
integration of iii v semiconductor devices on silicon substrates would allow the fabrication of high efficiency optoelectronic and photonic devices using the well - established complementary metal oxide semiconductor ( cmos ) technology .
although of the great technological interest , results in this field are far from being optimized . some issues like lattice mismatch between gaas and si and formation of anti - phase domain in gaas are not yet fully solved .
one attractive approach to minimize these issues is the fabrication of local artificial substrates ( las ) .
the concept of las lies in the possibility to prepare a suitable surface for a subsequent epitaxial growth not on the whole surface of the sample , but locally , using as base some structures fabricated , for example , by a nano - patterning technique .
we propose a self - assembling growth procedure based on droplet epitaxy [ 4 - 6 ] for the fabrication of gaas islands on si substrate with high uniformity , selectable size , and density .
these islands should act as las for the integration of iii v high quality nanostructures on si . in our experiments , we used si(001 ) substrates cleaned with standard rca treatment and finally dipped into hf solution to get an h - terminated surface .
substrates were loaded in a conventional gen ii molecular beam epitaxy ( mbe ) system equipped with an arsenic valved cell .
substrate temperature was raised to 780c to desorb hydrogen , as confirmed with the change in surface reconstruction observed with reflection high energy electron diffraction ( rheed ) from ( 1 1 ) to a mixed ( 2 1 ) ( 1 2 ) .
the substrate temperature was decreased to the value reported in table 1 for the ga deposition .
a ga molecular beam flux was supplied with a deposition rate of 0.075 ml / s .
ga droplets were finally crystallized at 150c by exposure to an as flux of 5 10 torr for 5 min . during the arsenic irradiation ,
the surface morphology of the five samples was investigated ex situ with a transmission electron microscope ( tem ) and an atomic force microscope ( afm ) .
ga deposition temperature , ga coverage , average diameter and density of the islands island density was estimated by large area tem and afm scan ( 2 2 m or more ) . left panel of fig .
1 shows a tem image of the surface of sample e , right panel shows the surface of sample a. the value of island density reported in table 1 evidences a dependence on the substrate temperature during ga deposition .
it is thus possible to use these values to finely tune island density through a proper choice of the ga deposition temperature .
varying the amount of deposited ga thus makes possible to control the mean island volume .
large area tem scans on surface of sample e ( left panel ) and a ( right panel ) by means of afm measurements , it is also possible to calculate the base diameter , the height , and the size dispersion of the islands .
afm measurements also make possible to calculate the aspect ratio ( ratio between height and base diameter ) .
this value increases with island size and reaches 0.5 for the larger islands , i.e. when height and radius have the same value .
the calculated standard deviation on base size distribution is less than 10% for all the samples .
this value is similar to the best values reported for sige islands grown on si patterned substrate .
transmission electron microscope measurements confirmed the values obtained by afm for the island mean base size .
diffraction pattern obtained from tem measurements allows also to estimate the crystalline quality of the gaas islands .
images from a single island ( right panel in fig . 2 for sample a )
show two different clear bragg spots for si and gaas , demonstrating the formation of single crystal gaas islands .
diffraction images obtained with diffraction vector ( left panel in fig . 2 for sample e ) evidence moir fringes .
the spacing between fringes gives a good estimation for distances between planes in si and gaas , and the values we obtained are in agreement with the ones expected for bulk material , thus demonstrating fully relaxation of gaas islands .
left panel : tem image of a single island on sample e obtained with diffraction vector .
right panel : ( 220 ) bragg spot on diffraction pattern from a single island on sample a figure 3 reports the typical profile of randomly chosen islands on samples b ( left panels ) , d ( central panels , magnified by a factor of 2 ) , and e ( right panels magnified by a factor of 3 ) along ( upper panels ) and [ 110 ] ( lower panels ) .
the slope exposed by the islands is mostly compatible with the plane { 111 } near the si surface and with the plane { 113 } in the upper part of the islands . a similar behavior with the presence of these planes
however , by using the droplet , epitaxy technique is possible to achieve a clear improvement in size distribution . from the profiles
obtained , we could correlate the increment in the aspect ratio from 0.3 up to 0.5 with the exposed planes on the profiles .
the bigger islands expose more portions of surface with { 111 } slope and reduce { 113}. the formation of different surface planes plays an important role for the subsequent fabrication of small quantum dots on the top of local substrates .
a stronger affinity for the nucleation of inas small quantum dots on high index surface like { 113 } or { 115 } than on { 111 } is reported .
we expect that the control on exposed surfaces could allow the selection of a particular area of the las as a preferential nucleation site for inas quantum dots .
afm profiles along ( upper panels ) and [ 110 ] ( lower panels ) for islands on samples b ( two left panels ) , d ( two center panels ) and c ( two right panels ) we have presented a fabrication procedure for the self - assembly of gaas islands on si substrate via droplet epitaxy to be used as las .
the islands are made by a single relaxed crystal and are tunable in size and density changing substrate temperature and amount of supplied ga .
the islands expose large portions of surface with a slope compatible with { 111 } and { 113 } , and the aspect ratio reaches 0.5 for larger islands .
the control on size , density , and exposed surfaces , the well - defined shape and the low thermal budget requirements make these islands good candidates for the fabrication of las and the integration of iii v nanostructures on si substrate .
this work was supported by the cariplo foundation under the project quadis2 ( contract no .
2008 - 3186 ) and by the italian prin - miur under the project goccia ( contract no .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited . | we propose a self - assembling procedure for the fabrication of gaas islands by droplet epitaxy on silicon substrate .
controlling substrate temperature and amount of supplied gallium is possible to tune the base size of the islands from 70 up to 250 nm and the density from 107 to 109 cm2 .
the islands show a standard deviation of base size distribution below 10% and their shape evolves changing the aspect ratio from 0.3 to 0.5 as size increases . due to their characteristics , these islands are suitable to be used as local artificial substrates for the integration of iii v quantum nanostructures directly on silicon substrate . | None
Acknowledgments
Open Access |
globally , chronic illnesses are the leading cause of mortality ( 60% ) , and this is no different in developing countries , particularly in the caribbean[26 ] .
statistics indicate that 79% of all mortalities are attributable to chronic diseases , and that they are occurring in developing countries such as those in the caribbean . using data for 1989 and 1990 ,
holder & lewis showed that hypertension and diabetes mellitus were among the 5 leading causes of mortality in the english - speaking caribbean and suriname .
the findings from holder and lewis indicated that mortality resulting from hypertension was highest in dominica ( over 90 per 100,000 of the population ) and diabetes crude death rates per 100,000 of the population were the greatest in trinidad and tobago ( over 85 per 100,000 ) .
the 20 century has brought with it massive changes in the typology of diseases , where deaths have shifted from infectious diseases such as tuberculosis , pneumonia , yellow fever , black death ( i.e. bubonic plague ) , smallpox and diphtheria to diseases such as cancer , heart complaints and diabetes .
although diseases have moved from infectious to degenerate , chronic non - communicable illnesses have arisen and are still lingering in spite of all the advances in science , medicine and technology .
morrison titled an article diabetes and hypertension : twin trouble in which he established that diabetes mellitus and hypertension have now become two problems for jamaicans and people in the wider caribbean .
this situation was corroborated by callender and steingo at the 6 international diabetes and hypertension conference , which was held in jamaica in march 2000 .
they found that there is a positive association between diabetic and hypertensive patients - 50% of individuals with diabetes had a history of hypertension .
prior to those scholars work , eldemire found that 34.8% of new cases of diabetes and 39.6% of hypertension were associated with senior citizens ( i.e. ages 60 and over ) . in an article published by caribbean food and nutrition institute , the prevalence rate of diabetes mellitus affecting jamaicans
is noted to be higher than in north american and many european countries .
chronic illnesses have been on the rise in the caribbean . in a 1996 study conducted by morrison and colleagues in trinidad and tobago
, they noted that there is an alarming rise in the prevalence rate of diabetes mellitus ( 15 - 18% ) .
a study in barbados found that between 1988 and 1992 the prevalence rate of diabetes mellitus for the population was 17.5% ; 12.5% in mixed population ( black / white ) , 6.0% in white / other and 0.3% in the younger population .
another research , in europe , found that the prevalence among newly diagnosed diabetics in europeans was 20% ; african - caribbeans , 22% ; and in pakistanis , 33% .
van agt et al . went further when they found that poverty was greater among the chronically ill , with which a later study by the world health organization concurred .
the who stated that 80% of chronic illnesses were in low and middle income countries , emphasizing the association between not only diabetes and poverty , but chronic conditions and poverty . the relationship between poverty and chronic conditions extends to premature mortality .
findings from the who showed that 60% of global mortality is caused by chronic illness , which offers an explanation of the face for those with these particular conditions . within the context of a strong association between poverty and chronic illness , the high prevalence of diabetes mellitus ,
further opined that the global figure for diabetes is projected to move from 171 million ( 2.8% ) in 2000 to 366 million ( 6.5% ) in 2030 .
of this figure 298 million of these persons will be in developing countries , which reinforces the poverty - illness relationship .
chronic diseases can be likened to a tsunami in developing nations[2022 ] , and it seems to be spiralling because of the unhealthy lifestyle of people .
the tsunami of chronic illnesses in the developing countries is equally reflected in the americas , and particularly jamaica .
the face of chronic illness in developing nations is therefore for ( 1 ) lower socioeconomic strata , ( 2 ) rural residents , ( 3 ) adults , ( 4 ) gender differences , ( 5 ) lower educational level , and ( 6 ) married people .
a great deal of research exists on the management of chronic illnesses , and rightfully so , as these go to the health status and mortality of a population .
the profiles of those with chronic diseases have never been examined in latin america and the caribbean , and studies outside of this region have used a piecemeal approach to the investigation of chronic conditions .
hence information is available on one or a few of the aforementioned faces of chronic illness , and some research has examined diabetes mellitus and hypertension but not arthritis . the present gap in the literature will be lowered by this study examining the faces of chronic illness from half a decade of data . using data for 2002 and 2007
the study will utilize three chronic diseases ( i.e. diabetes mellitus , hypertension , and arthritis ) , and analyze health status , health insurance status , health care utilization , chronic illness and other sociodemographic characteristics in order to ascertain the transition occurring in the population .
we hypothesized that there are changing faces of those with diabetes , hypertension and arthritis over the last half a decade ( 2000 - 2007 ) .
the current study extracted a sample of 592 respondents from the 2002 and 2007 jamaica survey of living conditions ( jslc ) .
only respondents who indicated that they were diagnosed with particular chronic conditions were used for this analysis ( i.e. diabetes mellitus , hypertension , and arthritis ) .
the present subsample represents 0.8% of the 2002 national sample ( 25,018 ) and 5.7% of the 2007 sample ( 6,783 ) .
the jslc is an annual and nationally representative cross - sectional survey that collects information on consumption , education , health status , health conditions , health care utilization , health insurance coverage , non - food consumption expenditure , housing conditions , inventory of durable goods , social assistance , demographic characteristics and other issues .
it is a modification of the world bank 's living standards measurement study ( lsms ) household survey .
overall , the response rate for the 2007 jslc was 73.8% and 72.3% for 2002 .
over 1,994 households of individuals nationwide are included in the entire database of all ages .
the residents of a total of 620 households were interviewed from urban areas , 439 from other towns and 935 from rural areas .
this sample represents 6,783 non - institutionalized civilians living in jamaica at the time of the survey .
the jslc used complex sampling design , and it is also weighted to reflect the population of jamaica .
statistical analyses were performed using the statistical packages for the social sciences for windows 16.0 ( spss inc ; chicago , il , usa ) .
descriptive statistics such as mean , standard deviation , frequency and percentage were used to analyze the socio - demographic characteristics of the sample .
chi - square was used to examine the association between non - metric variables , and an analysis of variance was used to test the equality of means among non - dichotomous categorical variables .
means and frequency distribution were considered significant at p < 0.05 using chi - square , independent sample t - test , and analysis of variance f test .
table 1 presents the operational definitions of some of the variables used in this study .
the current study extracted a sample of 592 respondents from the 2002 and 2007 jamaica survey of living conditions ( jslc ) .
only respondents who indicated that they were diagnosed with particular chronic conditions were used for this analysis ( i.e. diabetes mellitus , hypertension , and arthritis ) .
the present subsample represents 0.8% of the 2002 national sample ( 25,018 ) and 5.7% of the 2007 sample ( 6,783 ) .
the jslc is an annual and nationally representative cross - sectional survey that collects information on consumption , education , health status , health conditions , health care utilization , health insurance coverage , non - food consumption expenditure , housing conditions , inventory of durable goods , social assistance , demographic characteristics and other issues .
it is a modification of the world bank 's living standards measurement study ( lsms ) household survey .
overall , the response rate for the 2007 jslc was 73.8% and 72.3% for 2002 .
over 1,994 households of individuals nationwide are included in the entire database of all ages .
the residents of a total of 620 households were interviewed from urban areas , 439 from other towns and 935 from rural areas .
this sample represents 6,783 non - institutionalized civilians living in jamaica at the time of the survey .
the jslc used complex sampling design , and it is also weighted to reflect the population of jamaica .
statistical analyses were performed using the statistical packages for the social sciences for windows 16.0 ( spss inc ; chicago , il , usa ) .
descriptive statistics such as mean , standard deviation , frequency and percentage were used to analyze the socio - demographic characteristics of the sample .
chi - square was used to examine the association between non - metric variables , and an analysis of variance was used to test the equality of means among non - dichotomous categorical variables .
means and frequency distribution were considered significant at p < 0.05 using chi - square , independent sample t - test , and analysis of variance f test .
table 1 presents the operational definitions of some of the variables used in this study .
the current study extracted a sample of 592 respondents from the 2002 and 2007 jamaica survey of living conditions ( jslc ) .
only respondents who indicated that they were diagnosed with particular chronic conditions were used for this analysis ( i.e. diabetes mellitus , hypertension , and arthritis ) .
the present subsample represents 0.8% of the 2002 national sample ( 25,018 ) and 5.7% of the 2007 sample ( 6,783 ) .
the jslc is an annual and nationally representative cross - sectional survey that collects information on consumption , education , health status , health conditions , health care utilization , health insurance coverage , non - food consumption expenditure , housing conditions , inventory of durable goods , social assistance , demographic characteristics and other issues .
it is a modification of the world bank 's living standards measurement study ( lsms ) household survey .
overall , the response rate for the 2007 jslc was 73.8% and 72.3% for 2002 .
over 1,994 households of individuals nationwide are included in the entire database of all ages .
the residents of a total of 620 households were interviewed from urban areas , 439 from other towns and 935 from rural areas .
this sample represents 6,783 non - institutionalized civilians living in jamaica at the time of the survey .
the jslc used complex sampling design , and it is also weighted to reflect the population of jamaica .
statistical analyses were performed using the statistical packages for the social sciences for windows 16.0 ( spss inc ; chicago , il , usa ) .
descriptive statistics such as mean , standard deviation , frequency and percentage were used to analyze the socio - demographic characteristics of the sample .
chi - square was used to examine the association between non - metric variables , and an analysis of variance was used to test the equality of means among non - dichotomous categorical variables .
means and frequency distribution were considered significant at p < 0.05 using chi - square , independent sample t - test , and analysis of variance f test .
table 1 presents the operational definitions of some of the variables used in this study .
health care utilization , health insurance status , particular chronic illness ( i.e. diabetes mellitus , hypertension and arthritis ) , and sociodemographic characteristics are presented in table 2 .
the findings in table 2 showed that the average annual increase in the particular chronic illness was 17.2% between 2002 and 2007 .
arthritis showed an average annual reduction of 3.8% , hypertension , + 12.7% and diabetes mellitus , + 185.0% .
furthermore , the average annual increase in health care utilization ( visits to health care institutions ) was 11.9% ( public hospital , + 8.2% ; private hospital , + 10.7% ; public health care centre , + 8.4% ; private health care centre , + 17.1% ) .
on average the annual increase in health insurance coverage was + 148% ; while the health care utilization ( health seekers ) increased by 11.7% .
the particular chronic illnesses have shifted mostly from urban ( 67.6% ) to rural residents ( 55.1% ) .
this shift could be attributed to cultural factors affecting how and what individuals eat in rural versus urban areas .
the sedentary lifestyles of urban areas also added to the overall dramatic increase in chronic illnesses .
demographic characteristic of sample , 2002 and 2007 table 3 presents information on self - reported diagnosed particular chronic illness by sex of respondents for 2002 and 2007 . on average , the annual increase in particular chronic illness in males
diabetes mellitus showed the highest annual percentage increase ( males 186.7% and females 184.4% ) , while arthritis fell in females ( average annual 7.9% ) compared to an increase in males ( average annual 10.0% ) . hypertension increased more in females ( average annual 14.0% ) compared to 9.7% in males . this could be attributed to the increasing absorption of females into the upper echelons of management in stressful occupations such as banking and finance , law , and the police force .
self - reported diagnosed chronic illness by sex of respondents , 2002 and 2007 table 4 examines information on health coverage , health status , health care utilization and some sociodemographic characteristics by self - reported diagnosed particular chronic illnesses for 2002 and 2007 . based on table 4 , although particular chronic illnesses have decreased in rural respondents , rural dwellers continue to be the face of chronic conditions as well as married , primary , uninsured , private health centers and those in the lower class .
the average annual increase in particular chronic illnesses increased by 22.9% for those in the lower strata compared to 11.0% for those in the middle class and 16.0% for those in the wealthy socioeconomic strata . however , the greatest increase occurred in diabetics belonging to the upper class ( average annual + 200% ) compared to those lower class ( 116.7% ) . on the other hand , the highest average annual increase in hypertension occurred in the lower socioeconomic group ( 26.9% ) as compared to those in the middle class ( 7.4% ) and upper socioeconomic strata ( 7.1% ) .
the massive increase in cases of diabetes within the upper class is clearly not due to the lack of resources for seeking health care . a more detailed analysis of their diet and lifestyle is needed to ascertain the real causes for the drastic increase relative to other socioeconomic groups .
particular demographic and health variable by diagnosed chronic illness , 2002 and 2007 table 5 presents information on the age of respondents and particular self - reported chronic conditions for 2002 and 2007 . based on this information
the face is changing to reflect the inclusion of those less than 30 years of age ( including children ) as distinct from the elderly population .
the present study revealed that the prevalence of particular chronic diseases ( i.e. diabetes mellitus , hypertension and arthritis ) increased from 8 per 1,000 in 2002 to 56 per 1,000 in 2007 .
diabetes mellitus showed an exponential average annual increase of 185% compared to hypertension ( + 12.7% ) and arthritis ( - 3.8% ) .
while hypertension remained the most prevalent of the particular chronic diseases in this study , diabetes mellitus showed the greatest annual increase .
the transitions of particular chronic conditions are accounted for by ( 1 ) urban - to - rural shift , ( 2 ) female - to - male , ( 3 ) aged - to - young people , and ( 4 ) lower socioeconomic strata to upper class .
the average annual increase in particular chronic diseases was greatest among those in the lower socioeconomic groups .
however when the particular chronic ailments were disaggregated , the findings indicated that those in the wealthy socioeconomic group had the largest prevalence increase in diabetes mellitus , hypertension was greatest among those in the lower class and those in the upper class had the greatest reduction in arthritic cases . particularly of note
is the switching from public health care utilization by particular chronically ill respondents to private health care utilization .
similarly , the prevalence of health insurance coverage on average saw an exponential annual increase of 148% , while health care seeking behavior over the same period showed a marginal increase of 12% .
there is an emerging body of literature to support the changing face of people with particular chronic diseases from old ages ( 30 + years ) to younger people including children[2832 ] .
this reality supports the large reservoir of literature on elderly diabetic , hypertensive and arthritic patients . with the emergence of epidemiological and population transition ,
much attention was placed on diseases in middle and later ages as well as those conditions that accounted for most of the mortality and morbidity in a population .
because lifestyle practices were mostly responsible for chronic illness , many researchers limited their investigation to people 30 + years old[811233334 ] .
the present paper supports the literature that particular self - reported chronic diseases ( such as diabetes , hypertension and arthritis ) are found mostly among the elderly ( 60 + years ) .
the findings revealed that the mean ages of those with the specific self - reported chronic ailments have fallen marginally in jamaica over the period ( 2002 - 2007 ) .
this is somewhat deceptive as 41% of those with diabetes were less than 60 years of age , compared to 40% of those with hypertension and 31% of arthritic respondents .
two percent of diabetic respondents were less than 15 years of age , but no children had hypertension or arthritis .
similarly , increases were observed in diabetes and arthritis for the young adult ( diabetics aged 15 - 30 years ) for the period .
this is evidence that self - reported particular chronic diseases are changing face as almost 5% of diabetics were less than 31 years old in 2007 compared to 0% in 2002 .
another emerging face of particular self - reported chronic illness is that of those with arthritis , as almost 2% of cases were among people ages 15 - 30 years of age .
the young face of those with diabetes and other chronic diseases can be accounted for by ( 1 ) maternal nutrition during pregnancy , ( 2 ) diet and the environment .
the sedentary lifestyles of the youth in the population are further entrenched by the modern electronic games which have removed the young person from the playing field and see him spending longer periods on the couch in front of the television .
this hooked - on - game syndrome has also resulted in the increased consumption of sweet snacks and other so - called junk food .
the new face of those with particular chronic diseases is changing , and this reality is therefore a cause for public health concern .
this means that policy makers , health care practitioners , educators and the wider community need to recognize that chronic conditions such as diabetes , hypertension and arthritis have begun manifesting in young people as well as children .
there is an urgent rationale for an intervention campaign that will sensitize educators , medical practitioners , parents , and children about the current reality of children and young adults being diagnosed with particular chronic illnesses .
the intervention program that should be formulated must include signs of ailments , place of reference , chronic disease management , nutrition , and medical practitioners understanding that testing for diabetes , hypertension and arthritis must be a rudimentary part of medical examinations , even of children , and further , even if their parents are not experiencing those conditions .
the emerging young face of diabetics , and hypertensive and arthritis patients requires a new thrust in the study of mortality and morbidity data for health planning .
although diabetes , hypertension and arthritis may not be among the 10 leading causes of mortality in jamaica or the developing society , the emergence of those conditions requires researchers , demographers , epidemiologists and policy makers to embark on the inclusion of data on those conditions in publications in order that they can be examined . in a recently conducted study by wilks et al . , they used teens of 15 + years to present information on those with particular diseases , but neglected to mention the new reality of children of younger ages with particular chronic illnesses .
the new reality means that researchers , policy makers and the general society need to be cognizant of these facts .
this will be accommodated by researchers , and in particular the statistical agency , publishing findings on the new reality in order to commence the discourse and intervention campaign . with the absence of information on the matter ,
however , the new findings are reflecting the early onset of diabetes ( < 15 years ) and the provision of data beginning at 15 years omits 0.8% of infected children or 2.4% of diabetics .
the present paper unearths more information on the new faces of those with particular chronic conditions at younger ages .
fifty - four out of every 100 persons with particular chronic diseases ( i.e. diabetes , hypertension and arthritis ) had hypertension , 32 out of every 100 had diabetes and 15 out of every 100 had arthritis .
despite the majority of those with particular chronic illnesses having hypertension , the prevalence rate for those with diabetes increased exponentially more than the other conditions .
many studies have established a relationship between poverty and illness[1216 and 22 ] , and particularly poverty and chronic illness .
's work revealed that chronic diseases were greater among those in the lower socioeconomic strata than the other social classes , but this study found that more people in the wealthy class had diabetes , while more hypertensive and arthritic respondents were in the lower socioeconomic group .
although the prevalence rate of particular chronic illnesses was greater among the wealthy strata for 2002 and 2007 , those in the lower socioeconomic group recorded the greatest average annual percentage change .
on disaggregating the particular chronic diseases , the present paper showed that the prevalence of diabetes was greater among the upper than the lower class , and the opposite was noted for hypertension and arthritis .
's research , but provides pertinent information on the unhealthy lifestyle practices among the wealthy , and reinforces the role of material deprivation on health , health conditions and mortality .
two scholars opined that money can buy health , implying that health is a transferable commodity , and that unhealthy lifestyle practices by the wealthy can be reversed with money .
clearly smith and kington 's claim can be refuted as 42 out of every 100 chronically ill respondents were in the upper class , and more than half of those with diabetes were part of the wealthy income group . for any postulation to hold true about money purchasing health ,
one of the key axioms that needs to be looked at is the health conditions being lower among the wealthy than those in the lower class .
the wealthy will continue to live by their desires , and at the onset of chronic ailments , may be able to reverse this by medical expenditure .
it is well established that income is positively correlated with health , as money affords a particular diet , nutrition , medical facilities , safe drinking water , proper sanitation , leisure and good physical milieu , but the reality is that whenever unhealthy lifestyle practices become the choice of an individual , his / her money will not be able to eradicate the onset of diabetes , hypertension , heart disease , or other chronic diseases .
therefore , money enhances the scope of better health , but it can not buy good health as this is not transferable from one person to the next .
the very reason that health is non - transferable is the rationale behind the mortality of the wealthy elderly , and morbidity among the upper class .
socioeconomic status was found to be the strongest determinant of variations in health , as wealth allows for particular choices , opportunities , access , resources and privileges that are not available to the poor .
while those matters provide a virtual door leading to better health , money or wealth does not reduce the risk of ill - health arising from poor choices . a study by wilks et al .
found that most ( 71% ) of those in the upper socioeconomic strata currently use alcohol which is more than those in the lower class ( 59% ) and the middle class ( 64% ) .
twice as many people in the upper class ( 14% ) had heart attacks compared to those in the middle class ( 7% ) and 6% in the lower class .
the evidence is in that concretizes and refutes the proposition that money can buy health , and although the association between income and health is well established , unhealthy lifestyle choices can not be reversed with money .
the carbonated soft drink industry is experiencing a boom in the usa and the caribbean .
recently , research conducted by ha et al . found that carbonated soft drinks and milk were the two most popular non - alcoholic beverages in the usa .
this explosion in carbonated soft drinks means that added sugar is infesting the dietary intake of young people and children more than in previous decades .
another study showed that among children aged 6 to 19 years there was a positive significant statistical association with soft drink consumption and a negative one with milk intake . a sedentary lifestyle along with the consumption of sugar , salted food and fast food are accounting for the overweight and obesity in the world . according to bostrom and eliasson , over 50% of men and
33.3% of women between the ages of 16 and 74 years in sweden are overweight and obese .
wilks et al . found that 73% of jamaicans aged 15 to 74 years practice a sedentary lifestyle , and obesity was the third most popular disease ( 5.6% of the population , 8.5% of females and 2.7% of males ) behind hypertension ( 20.2% ) and diabetes mellitus ( 7.6% ) .
the growing global tsunami of chronic diseases in developing countries , and in particular jamaica , requires urgent policy and public health intervention . the carbonated soft drink industry has infiltrated the consumption intake of young adults and children .
sugar in the form of sweets ( lollipops , candies , et cetera ) is sold in every shop and supermarket , and at school gates in jamaica .
children and young adults are fed a diet of more sugar than vegetables , beans , legumes , nuts , protein , dairy products , fruits and fiber .
embedded in the increase in diabetes in children and young adults in jamaica are parents and children 's nutritional intake ( or lack thereof ) , as the dietary habits of jamaicans have changed to include more fast foods and less nutrient dense diets .
this extends beyond jamaica to barbados and the usa . with the exponential increase in diabetes over the last 5 years in jamaica , and the increase in unhealthy lifestyle practices of the people , coupled with the sales explosion of the carbonated soft drink industry and the increase in fast food outlets
, jamaica is experiencing a diabetes epidemic which can not be resolved without government and policy interventions .
as is clear from the literature , with the increase in carbonated soft drinks , reduction in milk intake and influx of fast food entities in the americas , the diabetes epidemic of jamaica may become a reality across the americas .
this is not just affecting countries in the americas , as studies have shown that type 2 diabetes has become a global public health problem .
the who contextualized the global public health type 2 diabetes epidemic when it stated that during 1999 - 2025 the prevalence of this ailment will be 40% in the developed nations and 170% in the developing countries .
clearly this paper is showing that diabetes has now reached an epidemic state in jamaica , and may no longer be an epidemic but a pandemic disease .
type 2 diabetes is no longer an adult or later life disease , as was the case a generation ago , as it is now being diagnosed in children in jamaica and other countries .
this study highlights the changing image of those with particular chronic diseases ( i.e. diabetes , hypertension and arthritis ) in jamaica . with 2 out of every 100 diabetics being children ( < 15 years ) and the new image of hypertensive and arthritic patients being 15 - 30 years , plus the exponential increase in diabetes in the wealthy class , the present research highlights significant public health problems . in the last half a decade ( 2002 - 2007 ) ,
the average annual increase in diabetes mellitus has risen by 185% indicating the unhealthy lifestyle practices of pregnant women , children and other young adults .
the image of particular chronic illness in jamaica continues to be lower class female and rural residents , but the average annual increase in diabetes mellitus was 200% for those in the wealthy class , compared to 117% of those in the lower socioeconomic class .
forty - seven out of every 100 chronically ill people in jamaica utilize public health care facilities , which denotes that the matter is a public one and not solely individual .
the cost of public health care in the next 5 - 10 years will increase phenomenally , as greater proportions of the population who rely on the public health care system will be afflicted with these chronic diseases .
this has serious implications for the sustainable development of developing countries as well as their future achievements regarding the united nations millennium developments goals . to act now
will not only save lives but will also save the various developing countries billions of dollars that can be spent on other development programs .
the demographic transition , in particular chronic conditions , now demands that data collection on those illnesses be lowered to < 15 years .
apart from the lowering of the ages in the data collection process , public health specialists need to address the massive changes in new diabetic cases .
this is an obvious problem , which requires public health intervention as well as lifestyle management of diabetes .
this sensitization and lifestyle management campaign must extend to include educators , parents , children , vendors ( especially those at schools ) , and the government .
governments need to regulate the sugar content of products in jamaica ( carbonated soft drinks , confectionary and fast food ) as this is contributing to a public health problem which will cost the government and people in the medium to long - term .
diabetes can be likened to a tsunami in jamaica and one that demands government intervention .
currently , there is a lifestyle campaign dealing with sexual behavior , condom usage , and cancer in jamaica ; this research highlights the urgent need for a diabetes campaign that extends beyond parents to include vendors , confectionaries , soft drink manufacturers and government , in order to sensitize the public about this new public health problem .
the gravity of the situation is that such a program can not be delayed for some time in the future as the opportunity costs of delay are ( 1 ) higher public expenditure , ( 2 ) increasing cost of diabetic care and management , ( 3 ) lower production cost , ( 4 ) increased unemployment benefits , ( 5 ) the imputed cost of ignorance , and ( 6 ) an increased mortality rate .
in summary , the theoretical position that underlines testing for diabetes among other chronic diseases should be abandoned , as the findings show the need to begin rudimentary health examinations of all ages .
the new thrust of governments , public health specialists and researchers is to commence a mandate that addresses confectionary products ingredients , and institution guidelines about the sugar and salt components of manufactured commodities .
the wider confectionary and food industry can not be left unregulated as the chronic diseases tsunami is upon us , and it will require a concerted effort from everyone to combat this public health problem as the nation addresses the diabetes epidemic .
diabetes has risen to such epidemic proportions that it now requires a policy initiative aimed at reducing the level of increases in a managed way . | background : globally , chronic illnesses are the leading cause of mortality , and this is no different in developing countries , particularly in the caribbean .
little information emerged in the literature on the changing faces of particular self - reported chronic diseases.aims:this study examines the transitions in the demographic characteristics of those with diabetes , hypertension and arthritis , as we hypothesized that there are changing faces of those with these illnesses.materials and methods : a sample of 592 respondents from the 2002 and 2007 jamaica survey of living conditions .
only respondents who indicated that they were diagnosed with these particular chronic conditions were used for the analysis.results:the prevalence of particular chronic diseases increased from 8 per 1,000 in 2002 to 56 per 1,000 in 2007 .
the average annual increase in particular chronic diseases was 17.2% .
diabetes mellitus showed an exponential average annual increase of 185% compared to hypertension ( + 12.7% ) and arthritis ( - 3.8% ) . almost 5 percent of diabetics were less than 30 years of age ( 2.4% less than 15 years ) , and 41% less than 59 years .
three percent of hypertensive respondents were 30 years and under as well as 2% of arthritics.conclusion:the demographic transition in particular chronic conditions now demands that data collection on those illnesses be lowered to < 15 years .
this research highlights the urgent need for a diabetes campaign that extends beyond parents to include vendors , confectionary manufacturers and government , in order to address the tsunami of chronic diseases facing the nation . | Introduction
Materials and Methods
None
Data
Statistical analysis
Measures
Results
Discussion
Conclusion |
mohan s diabetes specialities center in chennai city ( formerly madras ) , in southern india , called diabetes electronic medical records , was established at the time of inception of the center in 1991 and has data of > 200,000 diabetic patients registered between 1991 and 2011 .
a preliminary analysis of the diabetes electronic medical records was published recently ( 18 ) .
we have a unique identifying number so that any given patient can have only one record with multiple follow - up visits documented in that record . because ours is a tertiary diabetes center
, we get patients from different parts of the country . because it is a private center
, our patients mostly belong to the middle or upper socioeconomic sections of society ; however , through our charitable free clinics , several poor patients also attend the clinic .
the period of follow - up of the patients varies ; some have long periods of follow - up and others have much shorter periods . many have died or have been lost to follow - up .
accurate classification of patients is performed wherever possible using a battery of clinical and biochemical investigations including c - peptide and gad antibodies .
approximately 94% of our patients are hindus , 3% are muslims , 2% are christians , and 1% practice other religions .
we usually prescribe a diet with complex carbohydrates ( 60% ) , protein ( 15% ) , and fat ( 25% ) .
however , it is difficult to ensure dietary compliance and physical activity over prolonged periods of time .
t2 dm is diagnosed based on absence of ketosis , good -cell reserve as shown by fasting c - peptide assay ( 0.6 pmol / ml ) , absence of pancreatic calculi ( on abdominal radiograph ) , and response to oral hypoglycemic agents for > 2 years . from our database , we identified 238 patients with t2 dm who had survived with > 40 years of documented duration of diabetes ( survivors ) .
we then obtained data on 307 t2 dm subjects who were matched for age at onset of t2 dm and for gender with the survivor cohort but who had died of various causes before 40 years of duration ( nonsurvivors ) to compare the clinical profile of the survivors and nonsurvivors .
medical records of both groups of patients were reviewed and the biochemical and clinical data were recorded .
patient demographics , including age at last visit , age at diagnosis , and duration of diabetes among the survivors , and the age and duration of diabetes at time of death among nonsurvivors , were noted along with family and smoking history and the details of medications . for the nonsurvivors ,
the cause of death was ascertained by examining medical records , death certificates , discharge summaries from hospitals , and , wherever possible , a verbal autopsy .
hypertension was diagnosed based on drug treatment for hypertension or if blood pressure was > 140/90 mmhg ( 19 ) .
height and weight measured from the most recent clinic visit were obtained to calculate bmi in kg / m . based on criteria of the world health organization
asia pacific guidelines ( 20 ) , patients of either gender were classified as overweight if they had bmi between 23 kg / m and 24.9 kg / m and as obese if they had bmi 25 kg / m .
biochemical profile , including fasting plasma glucose , lipids , and liver function tests , was obtained from the medical records .
because this is a retrospective study going back > 20 years , the methods used for biochemical parameters varied slightly over the years . until 1998 , plasma glucose estimations were performed by glucose oxidase method , serum cholesterol was measured by cholesterol oxidase phenol plus aminophenazone method , triglycerides were measured by glycerol-3 phosphate oxidase phenol plus aminophenazone method , and serum creatinine was measured by modified kinetic method of jaffe using ciba corning express plus auto analyzer ( corning ) . since 1999 , plasma glucose estimations were performed by hexokinase method .
total cholesterol , triglycerides , hdl cholesterol , and serum creatinine measurements were performed by the same methods , but on a hitachi 912 autoanalyser ( mannheim , germany ) using the same commercial kits . since 1993 , glycated hemoglobin ( hba1c ) has been estimated by high - performance liquid chromatography method using the variant machine ( bio - rad , hercules , ca ) .
our center participates in external quality - control programs and is certified by the college of american pathologists as well as the national accreditation board for testing and calibration of laboratories of the government of india .
the intra - assay and interassay coefficients of variation for the biochemical assays ranged between 3.1 and 7.6% .
institutional ethics committee approval was obtained , and written informed consent to use their anonymized medical data was obtained from all study subjects .
mmol / l ( 200 mg / dl ) and hypertriglyceridemia was diagnosed if triglyceride levels were 1.69 mmol / l ( 150 mg / dl ) or if the subject was using drug treatment for dyslipidemia .
mmol / l ( 100 mg / dl ) , and low hdl cholesterol was diagnosed if the value was < 1.0 mmol / l ( 40 mg / dl ) in males and < 1.3
assessments of diabetes complications , including retinopathy , microalbuminuria , macroalbuminuria , neuropathy , peripheral vascular disease ( pvd ) , and coronary artery disease ( cad ) , were performed as described .
a comprehensive ocular examination was performed and visual acuity was recorded using an illuminated snellen chart .
a detailed retinal ( fundus ) examination was performed by direct and indirect ophthalmoscope by a retinal specialist trained in grading of retinal lesions .
retinal ( fundus ) photography was performed using four - field stereo color retinal photography ( model ff 450 plus camera ; carl zeiss , jena , switzerland ) whenever possible .
an early treatment diabetic retinopathy study grading system that has been modified and standardized in other population - based studies was used for the diagnosis of diabetic retinopathy ( 22,23 ) .
urinary albumin concentration was measured in a fasting urine sample using a immunoturbidometric assay ( hitachi 902 autoanalyzer ; roche diagnostics ) .
microalbuminuria was diagnosed if the albumin excretion was between 30 and 299 g / mg creatinine .
macroalbuminuria was diagnosed if albumin excretion was 300 g / mg creatinine ( 24).the modification of diet in renal disease study equation is as follows : glomerular filtration rate = 186 ( serum creatinine ) 1.154 age 0.203 ( 0.742 if female ) ( 1.210 if african american [ not applicable to our population ] ) ; it was used to calculate the estimated glomerular filtration rate ( 25 ) .
vibratory perception threshold of the great toes was measured in a standardized manner by a single observer , and neuropathy was diagnosed if the mean vibratory perception threshold was 20 v ( 26 ) .
similar recordings were made of the dorsalis pedis and posterior tibial pulses in the lower limb by inflating the cuff proximal to the ankle , and the mean of these two readings was taken as the ankle pressure .
ankle - brachial index < 0.9 was used for the diagnosis of pvd ( 27 ) .
coronary artery disease ( cad ) was diagnosed based on a history of documented myocardial infarction , coronary revascularization , electrocardiogram changes , or , if using drug treatment , drug treatment for cad ( aspirin plus nitrates ) .
descriptive analysis was used for continuous variables and test was used for categorical variables .
multiple logistic regression analyses were performed using survivors and nonsurvivors as dependent variables and hba1c , diastolic blood pressure , total serum cholesterol , serum triglycerides , and ldl cholesterol as independent variables .
kaplan - meier curves were plotted for cumulative survival in relation to the duration of diabetes among the nonsurvivor group .
a comprehensive ocular examination was performed and visual acuity was recorded using an illuminated snellen chart .
a detailed retinal ( fundus ) examination was performed by direct and indirect ophthalmoscope by a retinal specialist trained in grading of retinal lesions .
retinal ( fundus ) photography was performed using four - field stereo color retinal photography ( model ff 450 plus camera ; carl zeiss , jena , switzerland ) whenever possible .
an early treatment diabetic retinopathy study grading system that has been modified and standardized in other population - based studies was used for the diagnosis of diabetic retinopathy ( 22,23 ) .
urinary albumin concentration was measured in a fasting urine sample using a immunoturbidometric assay ( hitachi 902 autoanalyzer ; roche diagnostics ) .
microalbuminuria was diagnosed if the albumin excretion was between 30 and 299 g / mg creatinine .
macroalbuminuria was diagnosed if albumin excretion was 300 g / mg creatinine ( 24).the modification of diet in renal disease study equation is as follows : glomerular filtration rate = 186 ( serum creatinine ) 1.154 age 0.203 ( 0.742 if female ) ( 1.210 if african american [ not applicable to our population ] ) ; it was used to calculate the estimated glomerular filtration rate ( 25 ) .
vibratory perception threshold of the great toes was measured in a standardized manner by a single observer , and neuropathy was diagnosed if the mean vibratory perception threshold was 20 v ( 26 ) .
similar recordings were made of the dorsalis pedis and posterior tibial pulses in the lower limb by inflating the cuff proximal to the ankle , and the mean of these two readings was taken as the ankle pressure .
ankle - brachial index < 0.9 was used for the diagnosis of pvd ( 27 ) .
coronary artery disease ( cad ) was diagnosed based on a history of documented myocardial infarction , coronary revascularization , electrocardiogram changes , or , if using drug treatment , drug treatment for cad ( aspirin plus nitrates ) .
descriptive analysis was used for continuous variables and test was used for categorical variables .
multiple logistic regression analyses were performed using survivors and nonsurvivors as dependent variables and hba1c , diastolic blood pressure , total serum cholesterol , serum triglycerides , and ldl cholesterol as independent variables .
kaplan - meier curves were plotted for cumulative survival in relation to the duration of diabetes among the nonsurvivor group .
all 238 t2 dm survivors had duration of diabetes > 40 years , whereas 21 ( 8.8% ) had survived at least 50 years with diabetes .
table 1 shows the clinical and biochemical parameters of the 238 survivors and 307 nonsurvivors with t2 dm . the mean ages at diagnosis of the survivors and nonsurvivors were 33.5 6.9 and 34 5.5 years , respectively ( p = 0.379 ) .
the mean age of the survivors was 76.7 6.9 years , whereas the mean age at the time of death of the nonsurvivors was 56.3 11.7 years ( p < 0.001).the mean duration of diabetes of survivors was 43.7 3.9 years , and that of the nonsurvivors , at time of death , was 22.4 11.0 years ( p < 0.001 ) .
the nonsurvivors had significantly higher systolic and diastolic blood pressures , blood glucose , hba1c , serum cholesterol , ldl cholesterol , and triglycerides and lower hdl cholesterol compared with long - term survivors ( p < 0.001 for all parameters except systolic blood pressure , which was p = 0.027 ) . clinical and biochemical characteristics of t2 dm survivors and nonsurvivors fifty - three percent of survivors reported a family history of diabetes in a parent compared with 31.5% of the nonsurvivors ( p < 0.001 ) .
the details of the drug treatment in the two groups are shown in table 1 , and it shows higher use of insulin ( p < 0.001 ) and statins ( p < 0.001 ) among the survivors . the distribution of survivors and nonsurvivors according to quartiles of hba1c is presented in fig .
1 . there was a significant increase in percentage of the nonsurvivors in the higher quartiles of hba1c compared with the survivors ( trend = 70.5 ; p < 0.001 ) .
the ldl cholesterol distributions are presented in fig . 2 , and this again shows that more nonsurvivors were in the higher quartiles of ldl cholesterol ( trend = 59.6 ; p < 0.001 ) .
distribution of t2 dm survivors and t2 dm nonsurvivors according to quartiles of ldl cholesterol .
retinopathy screening could be performed in 171 of 238 survivors ( 71.8% ) , whereas among the remaining 67 individuals it could not be performed because of either cataracts ( n = 43 ) or refusals ( n = 24 ) .
out of 171 subjects screened , 130 subjects had retinopathy ( 76% ) , of whom 125 had nonproliferative diabetic retinopathy and 5 had proliferative diabetic retinopathy .
the hba1c of those who had retinopathy was 8.6% compared with 7.9% in those without retinopathy . among the nonsurvivors , 62% ( n = 150/242 screened ) had retinopathy , of whom 131 ( 87.3% ) had nonproliferative diabetic retinopathy and 19 ( 12.7% ) , had proliferative diabetic retinopathy .
prevalence of complications among the t2 dm of survivors and nonsurvivors the prevalence of renal failure , defined as estimated glomerular filtration rate < 15 , was higher among nonsurvivors compared with survivors ( 16.9 vs. 0.8% ; p < 0.001 ) .
the prevalence of pvd among survivors and among nonsurvivors was 23.1 and 11.4% , respectively .
table 3 presents the logistic regression of various independent protective factors for survivors compared with nonsurvivors , taken as reference .
serum cholesterol ( odds ratio [ or ] 0.182 [ 95% ci 0.1160.284 ] ; p < 0.001 ) , ldl cholesterol ( 0.265 [ 0.1800.391 ] ; p < 0.001 ) , serum triglycerides ( 0.471 [ 0.3200.692 ] ; p < 0.001 ) , hba1c ( 0.658 [ 0.5920.732 ] ; p < 0.001 ) , and diastolic blood pressure ( 0.957 [ 0.9370.976 ] ; p <
logistic regression for long - term t2 dm survivors compared with t2 dm nonsurvivors fig .
3 shows the cumulative survival for the nonsurvivors with respect to duration of diabetes and shows that within 10 years 14.3% had died , by 20 years 43.6% had died , by 30 years 81.1% had died , and by 40 years 100% of the nonsurvivors had died .
analysis of causes of death among nonsurvivors showed that myocardial infarction ( 46.4% ) and renal insufficiency ( 16.6% ) were the leading causes of death , followed by respiratory diseases ( 9.7% ) , septicemia ( 7.8% ) , cancer ( 5.8% ) , hepatic failure ( 5.2% ) , stroke ( 3.2% ) , and others such as accident or unnatural causes ( 4.9% ) .
all 238 t2 dm survivors had duration of diabetes > 40 years , whereas 21 ( 8.8% ) had survived at least 50 years with diabetes .
table 1 shows the clinical and biochemical parameters of the 238 survivors and 307 nonsurvivors with t2 dm . the mean ages at diagnosis of the survivors and nonsurvivors were 33.5 6.9 and 34 5.5 years , respectively ( p = 0.379 ) .
the mean age of the survivors was 76.7 6.9 years , whereas the mean age at the time of death of the nonsurvivors was 56.3 11.7 years ( p < 0.001).the mean duration of diabetes of survivors was 43.7 3.9 years , and that of the nonsurvivors , at time of death , was 22.4 11.0 years ( p < 0.001 ) .
the nonsurvivors had significantly higher systolic and diastolic blood pressures , blood glucose , hba1c , serum cholesterol , ldl cholesterol , and triglycerides and lower hdl cholesterol compared with long - term survivors ( p < 0.001 for all parameters except systolic blood pressure , which was p = 0.027 ) . clinical and biochemical characteristics of t2 dm survivors and nonsurvivors fifty - three percent of survivors reported a family history of diabetes in a parent compared with 31.5% of the nonsurvivors ( p < 0.001 ) .
the details of the drug treatment in the two groups are shown in table 1 , and it shows higher use of insulin ( p < 0.001 ) and statins ( p < 0.001 ) among the survivors . the distribution of survivors and nonsurvivors according to quartiles of hba1c is presented in fig .
1 . there was a significant increase in percentage of the nonsurvivors in the higher quartiles of hba1c compared with the survivors ( trend = 70.5 ; p < 0.001 ) .
the ldl cholesterol distributions are presented in fig . 2 , and this again shows that more nonsurvivors were in the higher quartiles of ldl cholesterol ( trend = 59.6 ; p < 0.001 ) .
distribution of t2 dm survivors and t2 dm nonsurvivors according to quartiles of ldl cholesterol .
retinopathy screening could be performed in 171 of 238 survivors ( 71.8% ) , whereas among the remaining 67 individuals it could not be performed because of either cataracts ( n = 43 ) or refusals ( n = 24 ) .
out of 171 subjects screened , 130 subjects had retinopathy ( 76% ) , of whom 125 had nonproliferative diabetic retinopathy and 5 had proliferative diabetic retinopathy .
the hba1c of those who had retinopathy was 8.6% compared with 7.9% in those without retinopathy . among the nonsurvivors , 62% ( n = 150/242 screened ) had retinopathy , of whom 131 ( 87.3% ) had nonproliferative diabetic retinopathy and 19 ( 12.7% ) , had proliferative diabetic retinopathy .
prevalence of complications among the t2 dm of survivors and nonsurvivors the prevalence of renal failure , defined as estimated glomerular filtration rate < 15 , was higher among nonsurvivors compared with survivors ( 16.9 vs. 0.8% ; p < 0.001 ) .
the prevalence of pvd among survivors and among nonsurvivors was 23.1 and 11.4% , respectively .
table 3 presents the logistic regression of various independent protective factors for survivors compared with nonsurvivors , taken as reference .
serum cholesterol ( odds ratio [ or ] 0.182 [ 95% ci 0.1160.284 ] ; p < 0.001 ) , ldl cholesterol ( 0.265 [ 0.1800.391 ] ; p < 0.001 ) , serum triglycerides ( 0.471 [ 0.3200.692 ] ; p < 0.001 ) , hba1c ( 0.658 [ 0.5920.732 ] ; p < 0.001 ) , and diastolic blood pressure ( 0.957 [ 0.9370.976 ] ; p <
logistic regression for long - term t2 dm survivors compared with t2 dm nonsurvivors fig .
3 shows the cumulative survival for the nonsurvivors with respect to duration of diabetes and shows that within 10 years 14.3% had died , by 20 years 43.6% had died , by 30 years 81.1% had died , and by 40 years 100% of the nonsurvivors had died .
analysis of causes of death among nonsurvivors showed that myocardial infarction ( 46.4% ) and renal insufficiency ( 16.6% ) were the leading causes of death , followed by respiratory diseases ( 9.7% ) , septicemia ( 7.8% ) , cancer ( 5.8% ) , hepatic failure ( 5.2% ) , stroke ( 3.2% ) , and others such as accident or unnatural causes ( 4.9% ) .
there have been several studies describing the long - term survival of t1 dm patients ( 16,17 ) . here
, we compare the clinical profile of a group of long - term survivors with t2 dm and a matched group of nonsurvivors selected from the electronic database of a tertiary diabetes center in south india .
the study shows that the long - term survivors had better control of glycemia and a better lipid profile , with lower total cholesterol , ldl cholesterol , and higher hdl cholesterol , and they also had lower systolic and diastolic blood pressures .
obesity was present in 37% of the nonsurvivors compared with 33.6% of long - term survivors , which is significantly lower than the prevalence of 8090% commonly reported in european t2 dm patients ( 28 ) .
the mean bmi for all t2 dm patients at our center is 25.8 4.2 kg / m ( 18 ) , whereas it was 23.6 4.1 kg / m among the survivors .
thus , overall , the survivors were leaner than the average t2 dm patients attending our center .
diabetes affects 1025% of elderly people ( older than 65 years ) worldwide , with particularly high rates in populations such as pima indians , mexican - americans , south asians , and , more specifically , indians .
elderly persons with diabetes mellitus , being a dependent population , impose considerable economic , social , and health burdens ( 29 ) . in urban india ,
the prevalence of diabetes in those older than 65 years of age was 28.1% according to the chennai urban rural epidemiology study ( cures ) ( 8) . in the national india council of medial research
india diabetes study ( icmr - indiab ) study , 168 of 1,087 ( 15.5% ) had diabetes at an age older than 65 years ( 2 ) . according to india s 2011 census , the mean life expectancy in india is 67.3 years for males and 69.6 years for females ( http://www.censusindia.gov.in/2011-prov-results/data_files/india/final_ppt_2011_chapter8.pdf ) .
thus , this group of t2 dm survivors has lived much longer than the average indian despite the long duration of t2 dm . the chennai urban population study ( 30 ) reported that the overall deaths were higher among diabetic subjects ( 11.9% ) compared with nondiabetic subjects ( 3.3% ) . in that study , among nondiabetic subjects a large proportion of deaths
were attributable to gastrointestinal ( 12.1% ) , respiratory ( 9.1% ) , lifestyle - related ( 6.1% ) , and unnatural causes ( 18.2% ) ; however , among those with diabetes , cardiovascular disease contributed to 52.9% of deaths , renal disease contributed to 23.5% of deaths , and infections and age - related causes contributed to the remaining deaths ( 30 ) . in the current study , myocardial infarction and renal disease were the most common causes of death , whereas infective and other causes , including cancer , contributed the rest .
zhang et al . ( 31 ) have reported that patients with t2 dm have an increased risk of development of cancer .
thus , it appears reasonable to conclude that if t2 dm patients do not die of cad or nephropathy within the first 2030 years of t2 dm , then they tend to live longer and die of other causes , including cancer .
the mean hba1c of 8.4% of t2 dm survivors is above the recommended target of 7% , and only 48 patients ( 20.3% ) had hba1c 7% among the long - term survivors .
the recent american diabetes association and european association for the study of diabetes guidelines , however , recommend less stringent control in some groups of patients ( 32 ) , and the patients in this series would fit into that category because they were older and had long duration of diabetes .
moreover , the hba1c levels were considerably better than in the nonsurvivor group ( mean hba1c , 9.9% ; p < 0.001 )
. among the long - term survivors , 37.8% were using statins compared with 23% of the nonsurvivors . the more favorable lipid profiles and the use of statin treatment may be one of the factors contributing to the long - term survival of the survivors . in previous studies , statin therapy has been associated with a 1955% reduction in cardiovascular disease events in patients with diabetes ( 33 ) .
statins also are known to reduce the rate of progression of microvascular complications , including diabetic retinopathy , nephropathy , and neuropathy ( 3436 ) .
comparison of the complication rates between survivors and nonsurvivors is not meaningful because the survivors were much older than the nonsurvivors ( 76.7 6.9 vs. 56.3 11.7 years ) and the mean duration of diabetes was also much greater ( 43.7 3.9 vs. 22.4 11 years at time of death of the nonsurvivors ) .
however , data on the prevalence of complications among survivors are of interest because this has not been reported in t2 dm with such a long duration of diabetes .
a previous study reported a prevalence of 71.9% among all t2 dm patients with duration of at least 15 years ( 37 ) .
the cures reports the prevalence of diabetic retinopathy to be 20.8% among known t2 dm patients with a mean duration of diabetes of 5.9 5.3 years ( 23 ) .
thus , the increased prevalence of retinopathy in our study can be attributed to the longer duration of diabetes .
however , it is of interest that approximately one - quarter of t2 dm patients did not have development of retinopathy even after 40 years duration of diabetes , pointing to the role of protective factors ( possibly genetic factors ) in some t2 dm subjects .
microabluminuria was present in 39.1% of patients , which is greater than the reported prevalence of 19% among south asian t2 dm patients in the united kingdom ( 38 ) and in our earlier population - based study , in which the prevalence was 26.9% ( 23 ) .
the prevalence of macroalbuminuria in the current study was 8.4% , which was similar to the prevalence of 8.0% in a north indian clinic report ( 39 ) .
thus , progression to end - stage renal disease appears to be uncommon once t2 dm subjects survive for > 30 years .
the most common complication among survivors was neuropathy , which was reported in 86.5% of our patients .
neuropathy was also the most common complication among t1 dm patients in the joslin 50-year medialist study , but the prevalence was 60.6% ( 17 ) .
age , long duration , and poor control could contribute to the higher prevalence of neuropathy in our study .
moreover , t2 dm long - term survivors tend to be significantly older than t1 dm survivors as well as the nonsurvivors in this study , which also might explain the higher prevalence of neuropathy noted in this study among the survivors .
pvd was diagnosed in 23.1% of the survivors , which is significantly higher than the 7.8% reported in the chennai urban population study ( cups ) ( 22 ) and 8.69.8% reported in earlier clinic - based studies ( 40,41 ) .
however , it should be noted that the mean age of patients in cups was 46 15 years compared with the 76.7 6.9 years in this study .
the prevalence of pvd is usually low in our t2 dm population , probably because of younger age at onset of t2 dm .
it is known that in older t2 dm population , the prevalence is much higher ( 22 ) .
thus , the higher prevalence of pvd in this study may be attributed to the older age of our survivors .
this is significantly higher than the 21.4% prevalence reported in our population - based study , cups ( 42 ) , which is , again , likely a reflection of the older age of our present cohort .
although the overall prevalence of cad was not different between survivors and nonsurvivors , it is significant that the majority of the nonsurvivors died of cad , suggesting that the severity of cad was likely greater among nonsurvivors .
use of statins and worse glucose and lipid profile and higher blood pressure may be some of the factors contributing to the mortality of the nonsurvivors . among the survivors ,
one patient ( 0.4% ) had all of the five complications , namely , retinopathy , nephropathy , neuropathy , pvd , and cad .
four complications were found in 69 ( 29% ) patients , 3 complications were found in 49 ( 20.6% ) , 2 complications were found in 71 ( 29.8% ) , 1 complication was found in 38 ( 16% ) , and 4.2% ( n = 10 ) of patients did not have any of diabetes - related complications . among the nonsurvivors , 25(8.1% ) had all the 5 complications , 4 complications were found in 97 ( 31.6% ) , 3 complications were found in 85 ( 27.7% ) , 2 complications were found in 68 ( 22.1% ) , and 1 complication was found in 32 ( 10.4% ) .
one of the limitations is that because this was a retrospective study , we were not able to present longitudinal data for lipids and a1c or complications for all subjects , but we have provided whatever data were available .
second , some of the laboratory methods had changed , although it is unlikely that this could have affected the results because of constant laboratory standardization and participation in international laboratory quality - control programs .
third , because autopsies are not usually performed in india , the causes of death were ascertained by perusal of medical records and , whenever possible , by verbal autopsy .
hence , the actual cause of death could have been different , although the similarity to the causes of death noted in our earlier population - based study is reassuring . in summary , we report on the clinical profile of survivors and nonsurvivors with t2 dm . the survivors had more favorable glycemic control and lipid profiles and lower blood pressures and greater use of statins , which probably contributed to their longer survival .
further studies , including genetic analysis , possibly could help to identify the factors responsible for long - term survival and the relative protection from end - stage complications of this group of long - term t2 dm survivors . | objectiveto compare clinical profile of long - term survivors and nonsurvivors with type 2 diabetes ( t2dm).research design and methodsafter conducting a retrospective survey of > 200,000 case records , we identified t2 dm survivors ( > 40 years of duration ) and age at diagnosis and sex - matched t2 dm nonsurvivors .
prevalence of complications and causes of death were analyzed .
retinopathy was diagnosed by retinal photography .
microalbuminuria and macroalbuminuria , peripheral vascular disease based on ankle - brachial index < 0.9 , coronary artery disease based on history of myocardial infarction or coronary revascularization , and neuropathy based on vibration perception threshold > 20 v were compared in both groups.resultsthe mean duration of diabetes of survivors ( n = 238 ) was 43.7 3.9 years , and that of the nonsurvivors ( n = 307 ) , at time of death , was 22.4 11.0 years ( p < 0.001 ) .
nonsurvivors had significantly higher systolic and diastolic blood pressures , plasma glucose , hba1c , serum cholesterol , ldl cholesterol , and triglycerides and lower hdl cholesterol compared with long - term survivors ( p < 0.001 for all parameters except systolic blood pressure , which was p = 0.027 ) .
myocardial infarction ( 46.4% ) and renal failure ( 16.6% ) were the most common causes of death .
prevalence of most complications was higher among survivors because of longer duration and older age , as follows , for survivors versus nonsurvivors : retinopathy , 76 vs. 62% ; microalbuminuria , 39.1 vs. 27.3% ; macroalbuminuria , 8.4 vs. 23.7% ; neuropathy , 86.5 vs. 63.5% ; peripheral vascular disease , 23.1 vs. 11.4% ; and coronary artery disease , 44.5 vs. 40.7%.conclusionslong - term survivors with t2 dm had better glycemic and blood pressure control and more favorable lipid profiles . | RESEARCH DESIGN AND METHODS
Retinopathy
Nephropathy
Neuropathy
PVD
Coronary artery disease
Statistical analysis
RESULTS
Clinical characteristics
CONCLUSIONS |
severe aplastic anemia ( saa ) is a fatal disease characterized by pancytopenia and hypocellular bone marrow .
bone marrow transplantation is the treatment of choice for young patients who have a human leukocyte antigen ( hla ) matched sibling donor .
immunosuppressive treatment ( ist ) with antithymocyte globulin ( atg ) and cyclosporine is an effective therapy for patients who have no suitable donor .
atg exerts its action by depleting clonal suppressor t cells implicated in the pathogenesis of saa123 ) .
the depletion of suppressor t cells by atg could change the b - cell activation12 ) .
there have been rare reports on the association between atg treatment for saa and the development of autoimmune hyperthyroidism4567 ) . because horse atg ( hatg ) is no longer available for the treatment of saa in most countries , rabbit atg ( ratg )
moreover , as ratg has more potent and prolonged suppression of t cells than hatg8 ) , more frequent encounters of autoimmune hyperthyroidism can be anticipated .
we report the rare case of graves disease following ratg treatment for saa in a korean child .
a 12-year - old boy visited chonnam national university hwasun hospital because of petechiae , easy bruising and knee joint pain in december 2007 .
a complete blood count showed white blood cell 1,600/l , hemoglobin 11.7 g / dl , platelets 4,000/l , absolute neutrophil count 940/l , and corrected reticulocyte count 0.89% .
the patient was diagnosed as a saa . as he had no hla - matched sibling , he was treated with ist using ratg ( thymoglobuline , genzyme , cambridge , ma , usa ; 3.5 mg / kg / day for 5 days ) and cyclosporine ( 5 mg / kg / day ) and methylprednisolone ( 2 mg / kg / day for 5 days , then tapered over 30 days ) . while being treated with ist , he developed peripheral neuropathy with pain and tingling sensation in both extremities , requiring a sympathetic nerve block , which relieved symptoms .
twenty - three months after ist with ratg , he complained of mild hand tremors , sweating , weight loss , palpitations and goiter .
subsequent thyroid function tests showed the hyperthyroidism ( free thyroxine , 3.42 ng / dl ; tsh , < 0.01 niu / ml ; triiodothyronine , 3.99 ng / ml ; thyroxine , 17.3 g / dl ) .
autoantibody results were as follows : antimicrosome antibody ( + ) , tsh - binding inhibitory immunoglobulin ( + ) , antithyroglobulin antibody ( - ) , and antinuclear antibody ( - ) .
a tc-99 m pertechnetate thyroid scan showed enlarged thyroid gland with diffuse uptake ( fig .
the patient has been disease free 39 months after ist and 9 months after methimazole treatment
. currently , his blood counts and thyroid function tests are normal , and he has no discomfort from graves disease .
graves disease is an autoimmune disorder characterized by hyperthyroidism , diffuse goiter , ophthalmopathy , and occasionally a dermopathy referred to as pretibial or localized myxedema9 ) . in immune pathogenesis of graves disease ,
b and t cells have a major role in the production of tsh receptor antibodies ( tshr - ab ) that are responsible for the thyroid stimulation and growth .
these activated t cells in turn increase the secretion of tshr - ab from b cells .
the hyperthyroidism and goiter of graves disease are caused by stimulation of the thyroid by tshr - ab9 ) .
it has been suggested that a genetic clonal lack of suppressor t cells may be responsible for the unregulated production of tshr - ab in in vitro studies10 ) .
the pathogenesis of aplastic anemia is thought to be t - cell - mediated destruction of hematopoietic progenitors and stem cells .
a variety of in vitro and in vivo research supported the implication of immune effector cells and cytokines , such as interferon- or tumor necrosis factor-1 ) .
the mechanism action of atg therapy for aplastic anemia is likely complex and multifactorial , but its main mechanism is thought to have immunosuppressive effect by depleting peripheral t cells from the circulation through complement - dependent lysis or activation associated apoptosis11 ) .
atg is manufactured through the immunization of horses or rabbits with thymocytes or t - cell lines , followed by the purification of the igg fraction of the sera from these animals . between hatg and ratg preparations ,
thus , they are dissimilar in inducing activation of t cells , as exemplified in the case of expansion of regulatory t cells11 ) . also , gene expression profiling was markedly different between cells treated with both preparations11 ) .
as a consequence , hatg and ratg would provide different mechanisms of action through multiple modes of immunomodulation . despite the differences mentioned above , hatg and ratg
have generally been used interchangeably in the clinic . however , in a recent randomized , prospective trial , ratg plus cyclosporine compared unfavorably with hatg plus cyclosporine when used as a first - line treatment .
the use of ratg led to a more profound depletion of cd4 + t cells , whereas both preparations resulted in a similar depletion of cd8 + t cells8 ) .
the depletion of suppressor t cells by atg was thought to have a role in the development of many autoimmune disorders3 ) .
interferon- is vital for cell - mediated immunity , inhibition of inappropriate b - cell proliferation and antibody production .
it is secreted by a subset of suppressor t cells to inhibit th2-cells which in turn activate b cells13 ) .
thus , depletion of suppressor t cells and resultant decreased production of interferon- by atg could also allow b - cell activation , which increases the risk of autoimmune disorder .
this was supported by studies showing that interferon- down - regulates tshr - ab production14 ) .
it also attenuated tsh receptor ( the tshr - ab target ) synthesis in graves disease15 ) .
thus , impaired interferon- production can cause derestricted tshr - ab production and increased tsh receptor production , resulting in immune hyperthyroidism .
there are a few reports of graves disease after treatment with atg for saa4567 ) .
three cases have been described occurring 26 , 42 , and 106 months after treatment with antilymphocyte globulin or atg in patients aged 25 , 30 , and 35 years , respectively4 ) . a 62-year - old man developed graves disease and fibrosing alveolitis 15 days after the administration of atg for saa5 ) .
the first case in children was described 6 years after atg in a 10-year - old boy7 ) .
this case represents the first case of possible implication of ratg in the pathogenesis of autoimmune hyperthyroidism .
recently , hatg is no longer available for the treatment of saa in europe , japan , latin america , and korea .
moreover , ratg has more potent and prolonged suppression of t cells than hatg8 ) , and the development of autoimmune hyperthyroidism may be encountered more frequently .
therefore , thyroid function tests should be incorporated in the routine follow - up of saa following ratg treatment . | antithymocyte globulin ( atg ) is used as an immunosuppressive treatment ( ist ) to deplete clonal suppressor t cells in patients with severe aplastic anemia ( saa ) .
the depletion of suppressor t cells by atg may affect the activation of b cells , which results in an increased risk for autoimmune conditions .
a 12-year - old boy was diagnosed with idiopathic saa .
as he did not have an human leukocyte antigen - matched sibling , he was treated with rabbit atg ( 3.5 mg / kg / day for 5 days ) and cyclosporine .
five months later , he became transfusion independent .
however , 23 months after ist , he complained of mild hand tremors , sweating , weight loss , palpitations , and goiter .
results of thyroid function tests revealed hyperthyroidism ( free thyroxine , 3.42 ng / dl ; thyroid stimulating hormone [ tsh ] ,
< 0.01 niu / ml ; triiodothyronine , 3.99 ng / ml ) . results of tests for autoantibodies were positive for the antimicrosome antibody and tsh - binding inhibitory immunoglobulin , but negative for the antithyroglobulin antibody and antinuclear antibody .
he was treated with methimazole , and his symptoms improved .
the patient has been disease free for 39 months after ist and 9 months after methimazole treatment .
this case report suggests that although rare , rabbit atg may have implications in the pathogenesis of autoimmune hyperthyroidism .
our findings suggest that thyroid function tests should be incorporated in the routine follow - up of saa patients treated with atg . | Introduction
Case report
Discussion |
the manual determination of cellular differentials in blood , bone marrow , and body fluids ( including urine and pleural , peritoneal , and pericardial fluids ) is a well - established diagnostic method useful in the evaluation of hematopoiesis , hematopoietic disorders , and infectious diseases .
similar methods are also employed in establishing the grade of various solid tumors in tissue samples , a feature that often has a significant impact on prognosis . for decades
in fact , despite the development of automated cell counters based on flow cytometric methods , image recognition software , and other approaches , manual cell counting remains the gold standard for many of these applications . despite the importance of manual cell counting methods within the clinical laboratory ,
analog cell counters have remained essentially devoid of any significant improvement since their inception . as a result , these devices suffer from a number of substantial deficiencies .
not only are tabletop cell counters relatively expensive ( often more than five hundred dollars for a single device ) , but this expense is compounded by the need to purchase units in sufficient quantities to accommodate each microscope used for cellular differentials .
furthermore , only 8 and 12 button configurations are widely available , frequently resulting in either a dearth or an excess of buttons than is required for a particular task .
the buttons themselves are often closely spaced , and they can not be distinguished without visual confirmation , increasing the risk for operational error .
importantly , analog counters also commonly lack editing capabilities , making error correction highly cumbersome .
the inability to directly transfer these results to laboratory information systems increases the time needed to generate reports and introduces the possibility of typographical errors during data entry .
clearly , any erroneous results have the potential to jeopardize patient safety . with the recent advent of tablet computers , digital cell counters in the form of mobile applications ( apps ) have become an alternative to analog devices , having the potential to address many of their shortcomings .
relative to analog units , digital cell counters and their associated hardware are less expensive ( at the time this article was written , android - based tablets ranged in price from one to three hundred dollars , and cell counter apps were either free to download or , at most , five dollars per user ) and offer customizable user - interface configurations for optimal performance of a particular task .
as digital counters can be installed on any tablet computer or smartphone , they are significantly more portable than their tabletop counterparts .
importantly , data generated by digital counters can be edited during collection , and the final results are easily exported and/or digitally transferred without the need for manual entry of individual values . despite their reduced cost and broad availability , app - based cell counters have not been widely adopted by clinical laboratories . although many factors likely impede the acceptance of digital cell counters within the laboratory setting , the most substantive concern particularly in terms of its potential impact on patient care is a perceived decrease in count accuracy , potentially owing to the lack of tactile feedback inherent to a touchscreen interface . such concerns may have previously been understandable as validation data establishing the equivalency of digital cell counters to analog devices have not been reported . to address this deficiency
, we herein provide the first systematic evidence that digital / app - based cell counters function equivalently to standard tabletop devices .
our cell counter app was programmed using java by computer science students at san jose state university ( san jose , california : amir eibagi , minh dang , and jake karnes , under the supervision of dr .
following initial troubleshooting by our group , the app was distributed to faculty and staff at the university of california , san francisco ( ucsf ) medical center for additional testing .
further improvements ( incorporating end - user feedback from ucsf faculty and staff ) were implemented through a similarly iterative process .
after preliminary data had suggested that no systematic differences existed between digital and analog device - generated data , the app was made publicly available at : https://play.google.com/store/apps/details?id=edu.sjsu.hemepathcounter .
additional images are available at https://play.google.com/store/apps/details?id=edu.sjsu.hemepathcounter 188 peripheral blood smears and 62 bone marrow aspirate smears ( 250 total samples ) were selected , each for paired analysis using both the app - based counter and the tabletop unit . to ensure that a wide range of differential values for each cellular subset would be available for analysis , peripheral blood and bone marrow aspirate smears were selected from both the ucsf hematopathology teaching archives and from among de - identified patient samples .
all cases were selected randomly , and the reviewer was blinded to the final diagnosis as well as the reported differential count .
four authors ( at , bb , jd , and mj ) performed paired 100-cell differentials on a subset of the selected peripheral blood and/or bone marrow aspirate smears , once using our app - based cell counter ( cell counter for android , installed on one of three mobile devices : samsung galaxy s3 , samsung galaxy tab 4 7.0 , or samsung galaxy note 10.1 ; samsung electronics ) , and once with a with a standard tabletop unit ( modulus data systems diffcount ) . to streamline data acquisition and presentation ,
a total of six cell categories were quantified for each sample type : neutrophils ( including band forms ) , immature granulocytes , lymphocytes , monocytes , eosinophils , and basophils for peripheral blood smears ; mature granulocytes ( including band forms ) , immature granulocytes , lymphocytes , monocytes , erythroid precursors , and blasts for bone marrow aspirate smears .
differences between paired data sets were evaluated using the correlation coefficient , student 's t - test for paired samples , and bland
altman plots , according to the well - established method described by bland and altman for establishing agreement .
primary data were aggregated across users [ figures 13 ] with individual user data analyzed separate [ tables 1 and 2 ] .
altman plots ( lower ) generated following paired counts of one hundred and 88 peripheral blood smears .
the relative proportions of neutrophils , ( a ) immature granulocytes , ( b ) lymphocytes , ( c ) monocytes , ( d ) eosinophils and ( e ) basophils , ( f ) were measured .
correlation coefficients ( r - values ) and results of paired t - tests ( p values ) are shown for each data set scatterplots with lines of linear regression ( upper ) and bland - altman plots ( lower ) generated following paired counts of 62 bone marrow aspirate smears .
the relative proportions of mature granulocytes ( a ) , immature granulocytes ( b ) , lymphocytes ( c ) , monocytes ( d ) , erythroid precursors ( e ) , and blasts ( f ) were measured .
correlation coefficients ( r - values ) and results of paired t - tests ( p values ) are shown for each data set individualized correlation coefficients ( r - values ) and results of paired t - tests ( p values ) for all six peripheral blood cell categories individualized correlation coefficients ( r - values ) and results of paired t - tests ( p values ) for all six bone marrow aspirate cell categories
our cell counter app was programmed using java by computer science students at san jose state university ( san jose , california : amir eibagi , minh dang , and jake karnes , under the supervision of dr .
following initial troubleshooting by our group , the app was distributed to faculty and staff at the university of california , san francisco ( ucsf ) medical center for additional testing .
further improvements ( incorporating end - user feedback from ucsf faculty and staff ) were implemented through a similarly iterative process .
after preliminary data had suggested that no systematic differences existed between digital and analog device - generated data , the app was made publicly available at : https://play.google.com/store/apps/details?id=edu.sjsu.hemepathcounter .
188 peripheral blood smears and 62 bone marrow aspirate smears ( 250 total samples ) were selected , each for paired analysis using both the app - based counter and the tabletop unit . to ensure that a wide range of differential values for each cellular subset would be available for analysis ,
peripheral blood and bone marrow aspirate smears were selected from both the ucsf hematopathology teaching archives and from among de - identified patient samples .
all cases were selected randomly , and the reviewer was blinded to the final diagnosis as well as the reported differential count .
four authors ( at , bb , jd , and mj ) performed paired 100-cell differentials on a subset of the selected peripheral blood and/or bone marrow aspirate smears , once using our app - based cell counter ( cell counter for android , installed on one of three mobile devices : samsung galaxy s3 , samsung galaxy tab 4 7.0 , or samsung galaxy note 10.1 ; samsung electronics ) , and once with a with a standard tabletop unit ( modulus data systems diffcount ) . to streamline data acquisition and presentation ,
a total of six cell categories were quantified for each sample type : neutrophils ( including band forms ) , immature granulocytes , lymphocytes , monocytes , eosinophils , and basophils for peripheral blood smears ; mature granulocytes ( including band forms ) , immature granulocytes , lymphocytes , monocytes , erythroid precursors , and blasts for bone marrow aspirate smears .
differences between paired data sets were evaluated using the correlation coefficient , student 's t - test for paired samples , and bland
altman plots , according to the well - established method described by bland and altman for establishing agreement .
primary data were aggregated across users [ figures 13 ] with individual user data analyzed separate [ tables 1 and 2 ] .
altman plots ( lower ) generated following paired counts of one hundred and 88 peripheral blood smears .
the relative proportions of neutrophils , ( a ) immature granulocytes , ( b ) lymphocytes , ( c ) monocytes , ( d ) eosinophils and ( e ) basophils , ( f ) were measured .
correlation coefficients ( r - values ) and results of paired t - tests ( p values ) are shown for each data set scatterplots with lines of linear regression ( upper ) and bland - altman plots ( lower ) generated following paired counts of 62 bone marrow aspirate smears .
the relative proportions of mature granulocytes ( a ) , immature granulocytes ( b ) , lymphocytes ( c ) , monocytes ( d ) , erythroid precursors ( e ) , and blasts ( f ) were measured .
correlation coefficients ( r - values ) and results of paired t - tests ( p values ) are shown for each data set individualized correlation coefficients ( r - values ) and results of paired t - tests ( p values ) for all six peripheral blood cell categories individualized correlation coefficients ( r - values ) and results of paired t - tests ( p values ) for all six bone marrow aspirate cell categories
inspection of the differential results generated by the tabletop unit confirmed that the selected material encompassed a wide range of cellular differentials associated with a variety of neoplastic and nonneoplastic disorders .
these findings were considered to be representative of the range of differential results typically encountered in the clinical laboratories at ucsf medical center , an academic tertiary care hospital . as expected , a significant proportion of the patient samples taken from the hematopathology service were , upon unblinding , found to have no significant pathologic abnormalities ; these smears exhibited differential counts within established age - matched references ranges by both the standard and app - based methods .
having established that our selected cases spanned a wide range of values for each cellular subset under investigation , we turned our attention to the evaluation of similarity between the paired analog- and app - based counts of peripheral blood smears . with the exception of basophils ( r = 0.684 ) ,
peripheral blood differential cell counts were found to be highly correlated within each cell category ( mean r = 0.956 ; figure 2 , upper panels ) . despite their relatively low correlation coefficient , basophils showed a high level of agreement between values generated by the two methods , and the values from the analog- and app - based methods never differed by an absolute value > 3% .
altman plots uniformly exhibited a narrow spread about the mean difference without evidence of significant outliers [ figure 2 , lower panels ] .
paired t - tests demonstrated p values which did not reach statistical significance for any cell type ( all p > 0.05 , including basophils ) , arguing against the presence of any systematic deviation from the tabletop unit by the app - based counter . to assess for inter - user variability in count accuracy , we also calculated r and p values separately for each user [ table 1 ] . among 24 comparisons ,
only a single nominally statistically significant result was observed ( user mj , lymphocytes , p = 0.028 ) .
given the consistent similarity of differentials generated by the two methods in peripheral blood , we proceeded with the same analysis in bone marrow aspirate smears .
comparable results were obtained for bone marrow aspirate differential cell counts : the two data sets were highly correlated ( mean r = 0.990 ; figure 3 , upper panels ) ; showed a tight , random dispersion about the mean difference on bland
altman plots [ figure 3 , lower panels ] ; and were not found to significantly differ by paired t - tests ( all p > 0.05 ) .
inspection of the differential results generated by the tabletop unit confirmed that the selected material encompassed a wide range of cellular differentials associated with a variety of neoplastic and nonneoplastic disorders .
these findings were considered to be representative of the range of differential results typically encountered in the clinical laboratories at ucsf medical center , an academic tertiary care hospital . as expected , a significant proportion of the patient samples taken from the hematopathology service were , upon unblinding , found to have no significant pathologic abnormalities ; these smears exhibited differential counts within established age - matched references ranges by both the standard and app - based methods .
having established that our selected cases spanned a wide range of values for each cellular subset under investigation , we turned our attention to the evaluation of similarity between the paired analog- and app - based counts of peripheral blood smears . with the exception of basophils ( r = 0.684 ) ,
peripheral blood differential cell counts were found to be highly correlated within each cell category ( mean r = 0.956 ; figure 2 , upper panels ) . despite their relatively low correlation coefficient , basophils showed a high level of agreement between values generated by the two methods , and the values from the analog- and app - based methods never differed by an absolute value > 3% .
altman plots uniformly exhibited a narrow spread about the mean difference without evidence of significant outliers [ figure 2 , lower panels ] .
paired t - tests demonstrated p values which did not reach statistical significance for any cell type ( all p > 0.05 , including basophils ) , arguing against the presence of any systematic deviation from the tabletop unit by the app - based counter . to assess for inter - user variability in count accuracy , we also calculated r and p values separately for each user [ table 1 ] . among 24 comparisons ,
only a single nominally statistically significant result was observed ( user mj , lymphocytes , p = 0.028 ) .
given the consistent similarity of differentials generated by the two methods in peripheral blood , we proceeded with the same analysis in bone marrow aspirate smears .
comparable results were obtained for bone marrow aspirate differential cell counts : the two data sets were highly correlated ( mean r = 0.990 ; figure 3 , upper panels ) ; showed a tight , random dispersion about the mean difference on bland
altman plots [ figure 3 , lower panels ] ; and were not found to significantly differ by paired t - tests ( all p > 0.05 ) .
to our knowledge , a formal evaluation of the concordance between digital / app - based cell counters and analog tabletop units considered to be the gold standard instrument for use in the determination of manual cellular differentials has never been performed .
our work addresses this deficiency by providing the first evidence that cellular differentials generated by an app - based cell counter do not significantly differ from those of an analog device .
this conclusion is supported by the tight correlation ( r 0.899 for all measured cell categories , excluding peripheral blood basophils ) and lack of statistically significant differences observed between paired data sets ( aggregated p > 0.05 for all measured cell categories ) as well as by bland
altman analysis , which demonstrated a narrow spread of the difference about the mean without evidence of systematic bias between paired results .
analysis of individual user - device pairs showed similar results , save for a single nominally significant difference observed for one user ( mj ) within one cell category ( peripheral blood lymphocytes ) .
however , as this value was not corrected for multiple comparisons ( according to the method of bonferroni ) , we do not consider it to be a contradictory datum .
although statistical measures of difference ( such as the chi - squared test , student 's t - test , etc . )
are familiar to pathologists and laboratorians alike , the approach to demonstrating similarity between data sets is often less well - defined .
some studies rely exclusively on the correlation coefficient to establish statistical similarity ; however , the combination of the correlation coefficient with bland
altman analysis is a more stringent approach to demonstrating functional equivalence between a novel and an established method and is subject to fewer sources of error .
the superiority of a combined approach is evidenced by our results for peripheral blood basophils : although only moderate correlation was observed for this cell category ( r = 0.684 ; figure 2f , upper panel ) , the accompanying bland altman analysis [ figure 2f , lower panel ] demonstrated that this lack of correlation does not represent a systematic discrepancy between the two methods . the nonsignificant difference demonstrated by
we therefore hypothesize that this finding is attributable to the enhanced effect of background variance on this low - frequency event . taken together
, the findings suggest that our app - based cell counter is functionally similar to an analog tabletop unit for the purpose of generating manual cellular differentials a conclusion which is based on data generated by four different users on three separate touchscreen devices .
accordingly , our findings do not support the hypothesis that the loss of tactile feedback inherent to a digital / app - based cell counter leads to a decrease in count accuracy .
our app provides alternative modes of user feedback through differential coloring and distinctive sound effects for each button , which may compensate for the lack of button tactility ( future versions of our app may also include haptic / vibrational feedback with each keystroke ) . additionally , the screen sizes of the devices used in our study ranged from 4.8 inches ( samsung galaxy s3 ) to 10.1 inches ( samsung galaxy note 10.1 ) , suggesting that touchscreen dimensions do not significantly impact count accuracy
nevertheless , future studies to formally examine the effect of screen size , resolution , and/or orientation ( horizontal versus vertical ) are warranted to confirm this impression .
although our results can not be directly extrapolated to all cell counting apps and/or touchscreen devices , our study provides a framework for the validation of other software / hardware combinations . unlike digital counters , tabletop devices are ubiquitous , durable , require little technical support , and are unlikely to be stolen .
thus , it seems doubtful that app - based counters will entirely supplant analog devices , at least in the immediate future .
however , given the low total cost of app - based counters ( 100 dollars at minimum , including hardware ) and their ease of validation ( as laid out in this work ) , digital cell counters may represent an appealing alternative for small - sized and/or newly established clinical laboratories .
although not formally investigated in this study , subjectively , none of the users noted an increase in the time required to perform cellular differentials when using our app - based counter .
nonetheless , the potential impact of digital cell counters on laboratory workflow is a topic in need of further study . in summary
, we have presented here the first statistical evidence that digital / app - based cell counters are functionally similar to analog tabletop devices in the generation of manual cellular differentials . | introduction : for decades cellular differentials have been generated exclusively on analog tabletop cell counters . with the advent of tablet computers , digital cell counters in the form of mobile applications ( apps ) now represent an alternative to analog devices .
however , app - based counters have not been widely adopted by clinical laboratories , perhaps owing to a presumed decrease in count accuracy related to the lack of tactile feedback inherent in a touchscreen interface .
we herein provide the first systematic evidence that digital cell counters function similarly to standard tabletop units.methods:we developed an app - based cell counter optimized for use in the clinical laboratory setting .
paired counts of 188 peripheral blood smears and 62 bone marrow aspirate smears were performed using our app - based counter and a standard analog device .
differences between paired data sets were analyzed using the correlation coefficient , student 's t - test for paired samples and bland
altman plots.results:all counts showed excellent agreement across all users and touch screen devices . with the exception of peripheral blood basophils ( r = 0.684 ) , differentials generated for the measured cell categories within the paired data sets were highly correlated ( all r 0.899 ) .
results of paired t - tests did not reach statistical significance for any cell type ( all p > 0.05 ) , and bland
altman plots showed a narrow spread of the difference about the mean without evidence of significant outliers.conclusions:our analysis suggests that no systematic differences exist between cellular differentials obtained via app - based or tabletop counters and that agreement between these two methods is excellent . | INTRODUCTION
METHODS
App Design and Development
Case Selection
Cell Counting
Statistical Analysis
RESULTS
Cases Selected for Analysis Span a Wide Range of Cellular Differentials
Manual Differentials Generated on Peripheral Blood Smears Using Tabletop Versus App-Based Cell Counters Show No Statistically Significant Differences
Manual Differentials Generated on Bone Marrow Aspirate Smears Using Tabletop Versus App-Based Cell Counters Show No Statistically Significant Differences
CONCLUSIONS |
hepatitis b virus- ( hbv- ) related end stage liver diseases ( esld ) account for over 80% of orthotopic liver transplantations ( olts ) in china , and active hbv replicative status prior to olt is present in over 50% of patients .
although hbv graft reinfection and hepatitis b ( hb ) recurrence have been controlled to an acceptable level after the adoption of antiviral drugs such as the nucleoside analogue lamivudine ( lam ) combined with hepatitis b immunoglobulin ( hbig ) [ 13 ] , drug resistance requiring the lifelong use of antiviral agents and virus escape under long - term use of hbig may increase the risk of graft reinfection and hb recurrence [ 36 ] .
additionally , lifelong use of these drugs is associated with significant financial burden and inconvenience .
induction of active immunity against hbv has become a potential alternative in posttransplant patients who have undergone olt for hbv - related liver diseases .
to date , a few pilot studies have confirmed the feasibility of this method [ 711 ] .
however , its effectiveness and response rate require further improvement [ 1215 ] . based on basic and clinical research of the induction of active immunity against hbv after olt during the past decade
, we have conducted this prospective clinical study regarding active immunization against hepatitis b virus graft reinfection in our center .
this study was a prospective clinical study and was approved by the ethics committee of beijing you - an hospital ( on january 4 , 2006 ) and was performed according to the ethical guidelines of the 1975 declaration of helsinki .
study subjects were posttransplant patients who underwent olt for hbv - related esld from 1999 to 2010 .
all organ donations or transplants were approved by the institutional review board of beijing you - an hospital , capital medical university , under the guidelines of the ethics committee of the hospital , the current regulations of the chinese government , and the declaration of helsinki .
specific inclusion criteria were as follows : ( 1 ) at least 18 months following transplantation ; ( 2 ) receiving a combined prevention regimen using nucleoside analogues and hbig ; and ( 3 ) liver function being normal or near normal .
the study was clearly explained to all participants , and they all provided written signed informed consent .
the two vaccines , twinrix and engerix - b , are officially approved for clinical use and are commercially available worldwide and in china .
the participant recruitment period was from january 1 , 2005 , to january 1 , 2012 .
follow - up period ranges from june 10 , 2006 ( from the first successful vaccination ) , to december 31 , 2013 .
the vaccines used were a recombinant hepatitis b surface antigen ( hbsag ) vaccine containing hbsag 20 g per vial ( engerix - b ; gsk ) and a bivalent vaccine which contained inactivated hepatitis a virus antigen and recombinant hbsag 20 g per vial ( twinrix , gsk ) .
one round of inoculation consisted of intramuscular injections of the vaccine ( 20 g for each inoculation ) in the region of the triceps muscle at 0 , 1 , 2 , and 6 months .
all participants received at least one round of inoculation and were given multiple rounds of inoculation according to response status and anti - hbs level .
serum hbv markers including anti - hbs were detected quantitatively with an electrochemiluminescence immunoassay ( roche diagnostics gmbh , mannheim , germany ) using a cobas e 601 ( roche diagnostics gmbh , mannheim , germany ) immunoassay analyzer .
hbv dna was detected with a real - time quantitative pcr diagnostic kit for quantification of hepatitis b virus dna ( shanghai kehua bio - engineering co. , ltd . ,
china ) using an abi 7500 pcr instrument ( applied biosystems , usa ) .
the detection limit was 1010 copies / ml . the combined regimen using nucleoside analogues and hbig was maintained during the inoculation period .
participants received intramuscular injections of hbig ( 400 iu / injection ) regularly in order to maintain a stable baseline level of hbig .
each vaccine inoculation was carried out 14 days after scheduled hbig , and serum anti - hbs concentrations were measured on the day prior to the inoculation .
the patient was defined as a responder if the sera anti - hbs titer increased more than 100% above the baseline value during any vaccination course lasting more than 3 months or the elevated serum hbsab titer remained high although it is less than 100% of baseline level .
as soon as a patient was defined as a responder , exogenous hbig administration was discontinued .
another 3-month observation after exogenous hbig was withdrawn , nucleoside analogues were then withdrawn subsequently if the patients were willing to stop nucleoside analogues . to maintain sustainable and spontaneous high anti - hbs production after discontinuation of hbig ,
a booster vaccination was administered ( usually every 3 to 6 months ) in the early phase for successful responders .
regular surveillance of sera hbv dna and hbv antigens was performed every 3 months . if it was found that the hbsag turned to be positive during the follow - up period , nucleoside analogues were reused and/or intravenous injection of hbig ( 2000 iu ) was performed .
intergroup variations were analyzed with t - test or analysis of variance ( anova ) , and the percentage variation was analyzed with test .
until december 31 , 2013 , two hundred olt recipients who met the inclusion criteria were enrolled in this study , and all received at least one round of inoculation .
fifty patients , including 41 males ( 82% ) and 9 females ( 18% ) , achieved successful reestablishment of active immunity against hbv and were classified as responders . among the 50 recipients , with a mean postoperative time of 35.8 19.12 months ( median : 27 months ;
range : 12 to 85 months ) , 19 cases were hbv active replicative ( sera hbv dna 10 copies / ml ) and 31 cases were hbv nonactive replicative ( sera hbv dna < 10 copies / ml ) before olt . among the 50 successful cases , 20 received the engerix - b vaccine and 30 received the twinrix vaccine .
the baseline anti - hbs titer of the 50 patients was 87.71 38.82 iu / l ( median : 83.61
the mean anti - hbs titer was 264.91 197.66 iu / l ( median : 198.64
the average number of doses administered at the time of establishment of immunity was 5.06 2.39 ( median : 5 ; range : 1 to 11 ) , with 22 cases requiring one round of inoculations , 22 requiring two rounds , and six requiring three rounds .
the highest anti - hbs titer in the follow - up period was 488.07 322.52
iu / l , which was higher than that at the time of successful response ( 264.91 197.66
the lowest anti - hbs titer in the follow - up period was 111.82 74.53
iu / l , which was higher than the baseline anti - hbs titer ( 87.71 38.82
the mean number of booster vaccinations administered was 1.61 0.79 ( median : 1 ; range : 1 to 4 ) , and the anti - hbs titer increased to 438.09 296.96
iu / l in these patients , which was similar to the highest sera anti - hbs titer ( 488.07 322.52
iu / l , t = 0.751 , and p = 0.455 ) in the follow - up period .
the interval of time between successful establishment of immunity and withdrawal of hbig was 3.53 4.00 months ( median : 2 months ; range : 1 to 22 months ) , and the interval of time between withdrawal of hbig and withdrawal of both hbig and antiviral agent was 5.57 3.93 months ( median : 3 months ; range : 3 to 17 months ) .
when hbig was withdrawn , the mean anti - hbs titer was 257.72 160.22 iu / l ( median : 194.50
iu / l ) , which was higher than the mean baseline anti - hbs titer of 87.71 38.82 iu / l ( median : 83.61
iu / l ) ( t = 7.273 , p = 0.000 ) but lower than the highest mean anti - hbs titer of mean 488.07 322.52 iu / l ( median : 388.15
there was no hbv graft reinfection or hb recurrence in the 24 cases who discontinued hbig during the follow - up period of 26.13 7.05 months ( median : 24.5 months ; range : 19 to 52 months ) , and 21 cases discontinued both hbig and nucleoside analogues during the follow - up period of 39.86 15.47 months ( median : 34 months ; range : 20 to 87 months ) .
the mean anti - hbs titer of the 45 cases at the end of the followup was 341.36 262.56 iu / l ( median : 286.55
iu / l ) , which was higher than that when hbig was withdrawn ( t = 1.829 , p = 0.071 ) , although the difference was not significant . there were 20 cases in engerix - b group and 30 cases in twinrix group in which active immunity against hbv was established .
there was no difference between the two groups in baseline titers , titer at success of immunization , the highest titer , the lowest titer before booster vaccination , the highest titer after booster vaccinations , titer when hbig was withdrawn , and the titer at the end of followup ( figure 2 ) .
the number of inoculation cycles required for success ( 1.75 0.64 versus 1.63 0.72 , t = 0.587 , and p = 0.560 ) , dosage number ( 4.95 2.14 versus 5.13 2.57 , t = 0.264 , and p = 0.793 ) , and number of booster vaccinations ( 1.86 1.03 versus 1.46 0.59 , t = 1.528 , and p = 0.135 ) were similar between the two groups .
the number of cases requiring booster vaccinations ( 15 cases in the engerix - b group and 24 cases in the twinrix group ) was also similar ( = 0.175 , p = 0.467 ) .
however , the drug withdrawal rate of the twinrix group was greater than that of engerix - b group ( = 13.923 , t = 0.001 ; table 3 ) . in the 50 patients that had a successful response ,
there were no differences in those who had liver failure , hepatocellular carcinoma ( hcc ) , liver cirrhosis ( lc ) , and hcc combined with lc in success rate , titer at successful response , the highest titer , the lowest titer before booster vaccination , the highest titer after booster vaccination , titer when hbig was withdrawn , and the titer at the end of followup ( figure 3 ) .
the influence of the donor anti - hbs status ( positive or negative ) on the response of the recipients to vaccination is shown in figure 4 .
there were no differences between the positive and negative groups in titer at successful response , the highest titer , the lowest titer before booster vaccination , the highest titer after booster vaccination , titer when hbig was withdrawn , and titer at the end of followup .
in addition , the round of inoculation when successful immunization occurred , the number of doses , the number of booster vaccinations , and the booster vaccination rate of the two groups were similar ( data not shown ) . recipients ' preoperative sera hbv dna level ( 10 copies / ml or < 10 copies / ml ) did not influence the response to vaccination . there were no differences between the 10 copies / ml group and < 10 copies / ml group in baseline titer , titer at successful immunization , the highest titer , the lowest titer before booster vaccination , the highest titer after booster vaccination , titer when hbig was withdrawn , and the titer at the end of followup ( figure 5 ) .
in addition , the round of inoculation when successful immunization occurred , the number of doses , the number of booster vaccinations , and the booster vaccination rate of the two groups were similar ( data not shown ) . in the 21 patients who discontinued hbig and nucleoside analogues , 4 patients appeared hbsag positive .
the interval of time between withdrawal of nucleoside analogues and hepatitis b virus reinfection was 14.25 months ( 6 to 23 months ) .
the four patients reused nucleoside analogues and one patient whose hbsag and hbv dna were negative was treated with hbig ( 2000 iu ) .
the gene mutations of hbv were detected by nested pcr assay and gene sequence analysis and the clinical characteristics of these 4 patients were reviewed ( table 4 ) .
additionally , we notified other patients withdrawn from hbig and nucleoside analogues regimen that they had the risk of hbv reinfection , although the risk was unclear .
whether hbig and nucleoside analogues administered for the prevention of hbv graft reinfection and hb recurrence after olt for hbv - related esld can be withdrawn or not has yet to be determined . based on the latest findings and the results from our previous studies [ 1719 ] ,
long - term or lifelong use of these drugs raises a series of issues , including resistance to antiviral drugs , hbig - induced hbv immune escape , and high monetary costs .
thus , an alternative protocol which is more rational , economical , and effective is needed . since active immunization is the gold standard for preventing hbv infection among the general population , induction of active immunity against hbv after olt appeared to be an effective alternative to hbig and nucleoside analogues . while there are multiple clinical reports on the induction of active immunity against hbv in patients undergoing olt for hbv - related esld [ 715 ]
, most studies only included a small number of cases , and all were nonactive hbv replicative .
in addition , participants stopped or did not use exogenous hbig in order to facilitate a response to the vaccine [ 7 , 8 , 1113 ] .
our study included 200 patients who had completed at least one vaccination round , and our results showed that establishment of active immunity against hbv after olt caused by hbv - related esld is feasible , especially including recipients with hbv active replication before surgery . according to literature reports , adoptive immunity is helpful for the reestablishment of active immunity against hbv after olt .
the primed lymphocytes from hbsab - positive donor 's liver graft are beneficial to the induction of positive immunity against hbv .
memory t lymphocytes and memory b lymphocytes play the most important role in this process ; they are activated by hbv antigens such as hbsag in the donors .
after olt , they are stimulated by the hbv vaccine in the recipients and lymphocyte proliferation occurs , which consequently leads to the active immunity against hbv .
unfortunately , reports showed that the adoptive immunity is generally ineffective , and the response intensity to hbv vaccination is relatively weak and short - term .
similarly , we did not find significant adoptive immunity in the present study as there was no significant difference when comparing hbsab - positive donors and hbsab - negative donors .
we also observed that the response intensity of the hcc group was greater than that of the other disease groups , especially after booster vaccinations were performed , though the differences were not significant ( figure 2 ) . to prevent hcc recurrence , immunosuppressive agents such as tacrolimus
were reduced to the possible lowest dosage , which was the reason why the response intensity was greater for the hcc group than other groups .
previous study has indicated that the hbv vaccine type could affect the final immune response outcome .
the vaccination efficiency of recombinant hbsag is only 7.7% , but vaccination efficiency is increased to 47% when the sci - b - vac complex vaccine containing pre - s antigen is used .
these results indicate that improvements in vaccines can enhance the immune response and suggest that a combination vaccine has the potential to improve the vaccination response rate . however , the adjuvant vaccine mentioned above is still not commercially available , and its safety requires clarification . in our study ,
the twinrix group exhibited a greater response intensity than the engerix - b group , and the drug withdrawal rate of the twinrix group was greater than that of the engerix - b group .
the reason for these differences may be that twinrix is a bivalent vaccine which contains inactivated hepatitis a virus antigen and recombinant hbsag , while engerix - b is a monovalent vaccine which only contains recombinant hbsag .
this difference could result in a bystander effect caused by hepatitis a virus antigen , which facilitates the immune response for hbv vaccination .
it is possible that the presence of the hbsag - hbig complex further enhanced the effectiveness of the vaccines . in this study , most patients with successful vaccination had a successful reaction after 5 to 11 doses .
this is because all of the transplant recipients were immunocompromised , whose immune systems had different levels of native / innate tolerance or acquired tolerance to hbsag .
their immune responses could only be restored through long - term and continuous antigenic stimulation .
this is another example illustrating that the immune response can be improved along with the improvement of general conditions after liver transplantation .
this suggests that inoculations should be continued until successful vaccination is achieved among immunocompromised subjects . in this study ,
long - term and repetitive vaccine stimulation was an important method to create and cultivate an enhanced immune response in the immunocompromised individuals .
intermittent vaccination reinforcement ( booster vaccination ) was also an important means to maintain a spontaneous anti - hbs production .
the average length of time after transplantation was 35.80 19.12 months in the patients with successful vaccinations in this study .
our previous study confirmed that the general condition of olt recipients and the antigen - presenting ability of the primary immune cells ( dendritic cells ) exhibited a tendency towards improvement with elongation of the postoperative time and minimization of the immunosuppression , which was essentially the immunological basis of this phenomenon .
therefore , from an immunological perspective the longer the postoperative time and the better the recovery of immune function , the higher the success rate of vaccination .
however , the risk of viral resistance to drugs and immune escape are higher with the elongation of the postoperative prevention regimen .
we believe that patients should be vaccinated before the occurrence of those aforementioned phenomena . we have named this time period the opportunity window to reconstruct active immunity . therefore , timely vaccination is the wisest choice .
our results also suggest that it is reasonable to initiate reconstruction of active immunity 18 months after transplantation .
similarly , the reaction intensity was different in patients with responses . as discussed above , responses were defined based on the reaction intensity . in immunocompromised individuals with responses ,
antibody production was characterized by low intensity , short duration , and the need of regular vaccination reinforcement .
we observed that , during the process of hbig and antiviral drug withdrawal , it was necessary to give one reinforcing inoculation regularly in the early stage in order to maintain a sustainable and spontaneous anti - hbs production over baseline level , which was especially important after entering the withdrawal protocol .
the reasons for hbv reinfection in patients who withdrew hbig and nucleoside analogues were complex .
first , it was shown that mutation for hbsag escape under immune pressure or drug resistance mutations have occurred before liver transplantation .
second , traces of hepatitis b virus still existed in liver , myeloid element , or other tissues .
third , the antibodies , by which the patients reestablished active immunity against hbv generated , could not cover all subtypes of hepatitis b virus .
we will evaluate the status of immunization and hepatitis b virus before and after vaccination in future research . in conclusion ,
induction of active immunity against hbv in patients who have undergone olt for hbv - related esld is feasible . for long - term posttransplant survivors ,
withdrawal of hbig with induction of active immunity against hepatitis b is reasonable , effective , dependable , and economical ; however , discontinuation nucleoside analogues should be cautious .
but because of the complexity of the immune response and the molecules involved in hbv immunology further study is needed ; moreover , the indication for withdrawal of nucleoside analogues needs further exploration . |
background .
the aim of this study was to establish a hepatitis b virus ( hbv ) vaccination protocol among orthotopic liver transplantation ( olt ) recipients under the coverage of a low - dose hepatitis b immunoglobulin ( hbig ) combined with an antiviral agent prophylaxis protocol .
method .
two hundred olt recipients were included in this study .
the vaccine was injected at months 0 , 1 , 2 , and 6 .
low - dose hbig combined with antiviral agent prophylaxis protocol was continued before reestablishment of active immunity against hbv in order to maintain a steady anti - hbs titer .
results . active immunity against hbv was reestablished in 50 patients , for an overall response rate of 25% .
of the 50 patients , 24 discontinued hbig without any hbv graft reinfection during a follow - up period of 26.13 7.05 months .
21 patients discontinued both hbig and antiviral agents during a follow - up period of 39.86 15.47 months , and 4 patients among them appeared to be hbsag positive .
there was no recipient death or graft loss because of hbv reinfection . conclusions .
vaccination preventing hbv reinfection for olt recipients is feasible .
the strategy withdrawal of hbig with induction of active immunity against hepatitis b is reasonable for long - term survivors of olt ; however , discontinuation nucleoside analogues should be cautious . | 1. Introduction
2. Patients and Methods
3. Results
4. Discussion |
among the neonatal seizure syndromes , benign familial neonatal convulsions ( bfnc ) , a rare autosomal dominant epilepsy characterized by unprovoked , generalized convulsions occurring in the first days of life , must be differentiated from non - epileptic paroxysmal events of the newborn and from other etiologies of neonatal seizures .
the seizures are characterized by generalized hypertonia with apnea and cyanosis , followed by head movement and/or clonic or tonicclonic limb jerks ( 1 ) .
most patients are seizure - free by 6 months of age , and psychomotor development in affected children is usually normal ( 2 ) .
although bfnc represent a benign epilepsy syndrome , between 10% and 16% of patients experience seizure recurrence at a later time ( 1 ) .
the idiopathic epilepsies , among which bfnc was listed , have been regarded as genetic in origin .
this presumption was confirmed by the identification of mutations in kcnq2 and kcnq3 in families with bfnc .
five individuals in 3 generations were affected , and molecular analysis disclosed a kcnq2 mutation .
a female infant weighing 2.8 kg was born at 39 weeks , 2 days gestation to a 28-yr - old mother after an uncomplicated pregnancy . on the 3rd day of life , she presented with three brief generalized tonic seizures with upward deviation of the eyes and cyanosis of the lips which lasted approximately one minute .
electrolytes , calcium , glucose , cerebrospinal fluid examination , brain magnetic resonance imaging and electroencephalography ( eeg ) were all normal .
she was discharged after 3 days without further seizures on phenobarbital . in follow - up , her phenobarbital was weaned at 3 months of age , but her seizures recurred 1 month later .
her eeg showed several spike discharges originating from the left and right central - temporal areas at that time .
phenobarbital was restarted and tapered off successfully without any seizure recurrence at 7 months of age .
detailed review of her family history revealed five affected family members , in three separate generations , who experienced similar neonatal convulsions , including the patient 's grandfather , father , paternal uncle , and cousin ( fig .
ia ( grandfather ) : patient ia had 3 convulsions within the 1st month of life , but no further seizures after those initial episodes .
iic ( paternal uncle ) : this patient experienced 5 convulsions within the first 3 months of his life .
iie ( father ) : he experienced a single convulsion on the 2nd day of life .
iiic ( a cousin ) : eight months - old at the time of this writing .
although he experienced 6 convulsions within the 6 months of life , he has shown normal development . in sum , despite multiple infantile seizures , no epilepsy or psychomotor dysfunction occurred in any affected family members even without the use of antiepileptic drugs . to search for mutations in kcnq2 in the pedigree , 16 exons and adjacent short intronic sequences of the gene were amplified by polymerase chain reaction ( pcr ) with dna obtained from the affected individuals .
sixteen exons of the kcnq2 gene and their intronic flanking sequences were amplified by pcr using a total of 19 sets of primers with exon 1 split into two and exon 6 into three primer pairs .
genetic study revealed an r448x mutation located in the c - terminal segment of kcnq2 in the family members with neonatal seizures ( ia , iie , iiid , fig .
a female infant weighing 2.8 kg was born at 39 weeks , 2 days gestation to a 28-yr - old mother after an uncomplicated pregnancy . on the 3rd day of life , she presented with three brief generalized tonic seizures with upward deviation of the eyes and cyanosis of the lips which lasted approximately one minute .
electrolytes , calcium , glucose , cerebrospinal fluid examination , brain magnetic resonance imaging and electroencephalography ( eeg ) were all normal .
she was discharged after 3 days without further seizures on phenobarbital . in follow - up , her phenobarbital was weaned at 3 months of age , but her seizures recurred 1 month later .
her eeg showed several spike discharges originating from the left and right central - temporal areas at that time .
phenobarbital was restarted and tapered off successfully without any seizure recurrence at 7 months of age .
detailed review of her family history revealed five affected family members , in three separate generations , who experienced similar neonatal convulsions , including the patient 's grandfather , father , paternal uncle , and cousin ( fig .
ia ( grandfather ) : patient ia had 3 convulsions within the 1st month of life , but no further seizures after those initial episodes .
iic ( paternal uncle ) : this patient experienced 5 convulsions within the first 3 months of his life .
iie ( father ) : he experienced a single convulsion on the 2nd day of life .
iiic ( a cousin ) : eight months - old at the time of this writing .
although he experienced 6 convulsions within the 6 months of life , he has shown normal development . in sum , despite multiple infantile seizures , no epilepsy or psychomotor dysfunction occurred in any affected family members even without the use of antiepileptic drugs . to search for mutations in kcnq2 in the pedigree , 16 exons and adjacent short intronic sequences of the gene were amplified by polymerase chain reaction ( pcr ) with dna obtained from the affected individuals .
sixteen exons of the kcnq2 gene and their intronic flanking sequences were amplified by pcr using a total of 19 sets of primers with exon 1 split into two and exon 6 into three primer pairs .
genetic study revealed an r448x mutation located in the c - terminal segment of kcnq2 in the family members with neonatal seizures ( ia , iie , iiid , fig .
bfnc remains a diagnosis of exclusion , since many neonates present with cryptogenic convulsions associated with uncertain outcomes .
symptomatic neonatal seizures , secondary to hypoxic - ischemic - encephalopathy , metabolic disturbances or to an infectious process should be ruled out .
subsequently , the finding of self - limited neonatal seizures in multiple affected family members can clinch the diagnosis .
the kcnq2 and kcnq3 genes encode the heteromeric assembly of subunits through which muscarinic - regulated potassium current ( m - current ) , a primary regulator of neuronal excitability , is established ( 3 ) .
the functional analysis of mutations thus far has indicated that a partial loss of activity of the k+ current is sufficient to produce epilepsy , and dominant negative mutations in kcnq2 or kcnq3 can result in a more severe phenotype ( 4 ) . in our case , the family history given by the grandmother of the proband was key to the diagnosis , and further genetic study identified a putative causative mutation in kcnq2 , the r448x ( 5 , 6 ) . consistent with prior cases of r448x ( 5 ) , none of our patients have experienced seizures outside of infancy .
interestingly , the kcnq2 c - terminal truncation mutant r448x has been shown to reduce the potassium current by < 50% and to cause no changes in the ion channel 's biophysical properties ( 6 ) . given recent findings that ion channels may regulate diverse cellular functions in addition to their current conduction properties , this finding may suggest that another property of the kcnq2 may be involved in its epileptogenic properties .
( 7 ) have demonstrated simultaneous high expression of kcnq2 and kcnq3 in human brain from late fetal life through infancy , coinciding with the time that bfnc occurs .
such developmental changes in potassium channel activity in the developing brain may explain the age - dependent expression of bfnc . however , inter - familial differences in susceptibility to subsequent febrile or afebrile seizures ( 1 , 8) have been observed , and further genotype - phenotype correlations may facilitate our understanding of this condition . due to the immaturity of neonatal brain structures ,
analyzing the ictal phenomenology and eeg and definitive classification of bfnc is still difficult . on the other hand ,
bfnc shares features with benign rolandic epilepsy , the most common idiopathic localization - related epilepsy , including its age - dependency and presence of centrotemporal spikes ( 9 , 10 ) . in our study , the index case showed intermittent right or left centrotemporal sharp wave discharges , and the seizures observed were generalized tonic seizures .
it is thought that as data accumulates , the electroclinical features of the ictal , interictal and follow - up eeg may yield insight into the mechanism of seizure generation . in conclusion , | neonatal seizures represent a heterogeneous group of disorders with vastly different etiologies and outcomes .
benign familial neonatal convulsions ( bfnc ) are a distinctive epileptic syndrome of autosomal dominant inheritance with a favorable prognosis , characterized by the occurrence of unprovoked partial or generalized clonic seizures in the neonatal period or early infancy .
recently , mutations in two potassium channel genes , kcnq2 and kcnq3 , have been described in this disorder . in this report
, we describe a family with bfnc due to a kcnq2 mutation , the first such family to be described in the korean population . the diagnosis of bfnc can be made based on clinical suspicion and careful history taking with special emphasis on the familial nature of the disorder .
kcnq2 mutations may be associated with bfnc in a number of different races , as has been reported in other ethnic groups . | INTRODUCTION
CASE REPORT
Index case (IIId)
Patients
DISCUSSION |
a recent report in critical care demonstrates the types of steps hospitals are taking to address the growing problem of icu capacity constraints . these steps are often necessary , as icu strain leads to serious , real - world problems .
for example , both admission delays from the emergency department to the icu and premature discharges from the icu to the ward are associated with increased mortality . moreover , although the data are mixed , new evidence suggests that when icus are strained , patients in the icu experience a greater risk of death .
cancelling high - risk elective surgeries due to a lack of appropriate postoperative care means less revenue at a time when many hospitals are struggling financially .
clearly the stakes are high . when faced with icu capacity constraints , however , hospitals have a limited number of options . the first , and perhaps most obvious , option is to simply add more icu beds .
hospitals are taking this approach in the united states , where the number of icu beds is increasing over time .
however this approach is misguided at best and harmful at worst - hospitals vary in the degree to which they use intensive care without much variation in outcome , suggesting that many icu patients do not really benefit from icu - level care . additionally , increasing the number of icu beds increases the hospitals fixed costs while at the same time creating waste in the system during times when the icu is not full .
another option is to create alternative levels of care within the hospital for moderate - risk patients who may not need the icu .
these alternatives can take the form of step - down units for patients in recovery or , as demonstrated by kastrup and colleagues , expanded post - anesthesia care units ( pacus ) that can care for intermediate risk , short - stay patients .
the benefits of these approaches are that they increase icu capacity more efficiently than simply adding icu beds , since these types of beds are cheaper to maintain . as a case in point , in kastrup and colleagues ' study
the hospital case mix index - a measure of hospital efficiency related to the average cost per case - increased from 0.286 to 0.309 , indicating a lower cost per case and , presumably , higher operating margins . at the same time ,
length of stay in the icu increased - probably due to both removal of short - stay postoperative patients from the denominator and a lack of bed pressure to discharge patients earlier in their treatment course .
although at first glance this move appears to have been a good one for the hospital , it is worth noting several caveats that could cause efforts like these to backfire .
first , increasing icu capacity by shuttling some postoperative patients through the pacu could just result in more low - risk patients being admitted from the ward .
this effect would increase the cost of care for these patients , negating other cost savings .
second , this move presupposes that an intensivist and trained icu nurses are available to staff the pacu . in many health systems ,
in addition to these caveats , kastrup and colleagues ' study has some noteworthy limitations .
the case mix index is a crude measure of hospital efficiency , and actual costs , charges and margins are not reported . also , this was a single - center , before - after study that did not control for severity of illness .
at least some of these changes are probably due to differences in severity of illness on admission and routine temporal trends , rather than due to the staffing change itself . despite these limitations , kastrup and
colleagues ' study provides important lessons about the risks and rewards of expanding icu capacity .
providing high - quality critical care in the era of capacity constraints requires creative solutions . adding more icu beds is conceptually easy but is also costly and inefficient .
developing new service lines that can care for intermediate - risk patients is more efficient , but is only of value in some circumstances .
for example , the high - intensity pacu approach of kastrup and colleagues will not work for icus with low numbers of postoperative patients or for icus that only care for extremely high - risk surgery patients that almost always require icu admission .
finally , we must remember that much of icu utilization is overuse - many patients , especially those at very high risk of death , would not want intensive care at their end of life .
addressing capacity constraints purely by adding capacity , rather than working to prevent overuse , may be a missed opportunity to better align care with patient preferences .
otherwise we risk making changes that are purely about improving the bottom line , rather than about improving care for our patients . | icu capacity strain is associated with increased morbidity and lost hospital revenue , leading many hospitals to increase the number of icu beds . however
, this approach can lead to inefficiency and waste .
a recent report in critical care highlights a different approach : creating new service lines for low - risk patients . in this case , the authors started a post - anesthesia care unit with an intensivist - led care team , resulting in lower hospital costs with no changes in icu mortality .
although this type of change carries some risks , and will not work for every hospital , it is an example of the creative solutions hospitals must sometimes undertake to maintain the supply of critical care in response to a rising demand . | None
Abbreviations
Competing interests |
the nematode abbreviata hastaspicula ( spirurida : physalopteridae ) occurs predominantly in varanus gouldii lizards , principally in the arid interior of australia .
it requires an arthropod intermediate host to complete its life - cycle ( mnnig , 1934 , alicata , 1937 ) .
distribution of the nematode genus abbreviata is worldwide ( bain et al . , 2015 ) , in australia
they are most common in the lizard fauna ( jones , 2014 ) , and physalopterid nematodes also occur in birds ( berger , 2010 ) .
the arid australian landscapes support the richest and the most diverse lizard fauna in the world , due to the dry hot climate and the dominant , hummock grasslands ( triodia spp . ) , which provide various habitat niches for several species of lizard ( pianka , 1986 ) .
in addition , a range of shrubs and sparse trees provide niches for a great variety of both diurnal and nocturnal lizards ( rich and talent , 2008 ) .
the varanidae contain the world s largest lizards , with at least 25 endemic described species in australia ( bush et al . , 2000 ) .
the species of lizard in this study , varanus gouldii is found in all areas of western australia except the coolest and wettest parts .
factors affecting the geographical pattern of abbreviata are probably firstly , the distribution of suitable arthropod intermediate hosts ; secondly , the ability of the eggs to survive and remain viable outside the final hosts ( jones , 2014 ) ; thirdly , the availability of prey for the hosts e.g. small lizards . a fuller understanding of the biology of species of physalopterinae would clarify the relative importance of these factors .
the life - cycle of spirurid nematodes consists of six stages involving an egg , four larval stages ( or juvenile stages ) and lastly , adult . for parasitic nematodes found in vertebrates , the infective stage is always the third larval stage , l3 ( anderson , 2006 ) .
however , in paratenic hosts , the infective stage of a parasite persists without essential development and usually lack of growth ( anderson , 2006 , anderson et al . , 2009 ) .
its lifecycle can only be completed by the final host ( larger lizards ) feeding on insects ( intermediate hosts ) or paratenic hosts ( smaller lizards ) containing infective third stage larvae ( anderson , 2006 , preston and johnson , 2010 ) .
larvae ingested by possible paratenic hosts generally encyst in the abdominal tissues , where they can persist until they are eaten by a predaceous final host .
the ingested larvae then attach to the stomach wall and , depending on the amount of food in the stomach , grow to adult ( lee , 1955 ) .
abbreviata requires the tropical cricket , teleogryllus oceanicus to act as its intermediate host is the only partial life cycle of abbreviata spp .
this study was undertaken to elucidate the life - cycle of abbreviata hastaspicula in australia by infecting wild caughtvaranus gouldii ( final host ) and christinus marmoratus ( paratenic host ) with live arthropods that had been infected with the larvae of abbreviata hastaspicula .
eight varanus gouldii were caught from arid paynes find ( latitude:29 43 21.5436 , longitude : 117 10 24.3912 ) and the two christinus marmoratus were caught at wooroloo ( latitude:31 48 7.3218 , longitude : 116 18 51.6384 ) , western australia with the permission of department of environment and conservation australia ( licence no .
the average weight of the varanids was 4.15 0.52 kg and that of the geckos was 17.1 3.20 g. the varnaus were marked from no .
the faeces of the wild - caught v. gouldii were collected from the floor of their individual housing cage and were checked weekly for eggs of the nematode abbreviata hastapicula two v. gouldii ( no . 1 and 2 )
were used as controls and were euthanized by sodium pentobarbital injection ( dose : 100 mg / kg ) as soon as embryonated eggs were found in the faeces to ascertain that nematodes in the experimental lizards were the same as the species of nematodes that occurred in these lizards in the wild .
the remaining lizards ( six v. gouldii and two c. marmoratus ) were treated with panacur 25 ( 0.4 ml/100 g body weight orally once and repeat in 14 days ) .
one week after the two doses of panacur 25 were administered to all the lizards directly with an oral syringe , no eggs were found in the v. gouldii ( no .
38 ) , thus ascertaining that all six v. gouldii and the two geckoes were free of parasites . after ascertaining that all the six v. gouldii were free from nematodes , two varanus ( no . 3 and 4 )
were kept uninfected and parasite free , they were fed the two c. marmoratus three months later in this experiment .
5 , 6 , 7 and 8) and two c. marmoratus were fed with infected live teleogryllus oceanicus ( orthoptera : ensifera : gryllidae ) crickets that ingested the embryonated eggs of a. hastaspicula 28 days earlier following the methodology previously described ( king et al . , 2013 )
each varanus consumed 19 t. oceanicus crickets that had contained third stage larvae of abbreviata hastaspicula , and five t. oceanicus were given to each c. marmoratus .
the v. gouldii had ingested all the t. oceanicus crickets as soon as they were given to them .
the two c. marmoratus had broken apart and ingested some shattered parts of the crickets , but it was not certain whether they had ingested the infected cysts .
faeces of varanus were examined microscopically every week to determine whether the third stage larvae had developed into adults .
two months later , in order to confirm that abbreviata hastaspicula larvae can only develop into adults in a final host , the four infected v. gouldii ( no .
5 , 6 , 7 and 8) were euthanized by sodium pentobarbital injection , when the eggs of a. hastaspicula were found in their faeces.the two c. marmoratus ( possible paratenic host ) were euthanized by carbon dioxide inhalation and thier stomachs and gastrointestinal tracts were opened to check whether they contained larval cysts of a. hastaspicula .
after another month , the two v. gouldii ( no . 3 and 4 ) that had consumed the two c. marmoratus were euthanized by injection of sodium pentobarbital and were dissected ( uwa animal ethics ref .
ra/3/100/1248 ) . the lizard was laid on its back , and a vertical ventral incision was made from the sternum to the pubis .
the connective tissue was peeled from skin and turned back so that viscera were exposed .
the lower oesophagus , stomach and intestine were released from connective tissues and examined for adult nematodes and larvae .
stomach , gastrointestinal tracts , cysts and worms were removed with forceps and fixed in formalin and preserved in 70% alcohol .
5 , 6 , 7 and 8) were observed under light microscopy under x4 , x10 and x20 objectives after clearing in chlorolactophenol , and lengths of the larvae and adult nematodes ( in mm ) were measured .
their stage of development was assessed by the differentiation of their sexual organs ( cawthorn and anderson , 1977 ) .
nematodes and small segments of stomach and gastrointestinal tracts of infected varanus were dehydrated , embedded in paraffin , and serially sectioned at 5 m .
tissue samples from animals were stained with hematoxylin and eosin ( gabe and blackith , 1976 ) .
embryonated eggs of a. hastaspicula were present in the faeces of all wild - caught v. gouldii , indicating that all the v. gouldii were infected with this nematode in the wild .
embryonated eggs of a. hastaspicula and a. antarctica were found in one of the controls v. gouldii .
for the c. marmoratus , because this species of gekkonidae could be a possible paratenic host that might contain infective third stage larvae but not adult a. hastaspicula , and eggs could only be produced by adult a. hasataspicula , we therefore were not able to tell whether the c. marmoratus have infection as we could not observe this in the faeces .
two months after the lizards had ingested infected t. oceanicus , eggs of a. hastaspicula were being passed in the faeces of the experimentally infected v. gouldii ( no . 5 , 6 , 7 and 8) .
5 , 6 , 7 and 8 were 5 , 3 , 8 and 14 respectively .
no larva or adult nematodes of a. hastapicula were found in c. marmoratus .
five hundred and eight and 834 nematodes were recovered respectively from the two controls v. gouldii ( fig . 1 ) .
females were longer and stouter than males ; the average width of males ( 0.57 mm ) was about half of that of females ( 1.10 mm ) .
the spearhead - like tip of the male right spicule was diagnostic , fig .
diagnostic morphological features in the female include the thin - walled eggs compared with those of potential concurrent species ( a. antarctica and a. bancrofti ) and the tubular extension to the vulva ( fig . 2 , fig . 4 ) .
histological sections showed little inflammatory cells and there was no evidence that a. hastaspicula affects the health of their final host , v. gouldi ( fig .
no difference of host response to infection across the species was noted in any lizards .
adult abbreviata are widespread in the stomachs of large lizards in the genus varanus in australia , with an infection prevalence close to 100% ( jones , 1995a , jones , 2005 ) . in the present study ,
adults or immature adults of a. hastaspicula were present in all the four experimental varanus gouldii ( no . 5 , 6 , 7 and 8) that had ingested the infected tropical crickets , confirming that this lizard is a definitive host of a. hastaspicula ( fig .
previous studies by jones ( 1983 ) have shown a positive correlation between the numbers of abbreviata sp .
lee ( 1957 ) elucidated the lifecycle of skrjabinoptera phrynosoma by infecting 27 horned toads with larvae from intermediate host texas agricultural ants .
five out of the 27 infected toads carried the exact number of adult nematodes they were fed . compared with our study ,
although all 19 t.oceanicus crickets were ingested by the v. gouldii , we only found 5 , 3 , 8 and 14 a. hastaspicula in v. gouldii no.58 respectively during dissection .
no eggs were found in the faeces of v. gouldii after the first dosage of anthelmintic panacur , but to ascertain the varanus were fully clear of parasites , a second dose of drug was administered to them 14 days later .
in addition , no larvae or adult a. hastaspicula was observed in no . 3 and 4 v. gouldii .
it is therefore concluded that the a. hastaspicula recovered from v. gouldii no .
the same species of parasites are more likely to infect the host species that are taxonomically related ( freeland , 1983 ) . in the case of abbreviata spp . ,
consistent with jones , 2005 , jones , 2007 , jones , 2014 which indicated that a. hastaspicula predominates in varanidae , all of the eight wild caught v. gouldii in our experiment were naturally infected with a. hastaspicula . although a. antarctica was recovered at highest prevalence and intensity in v. rosenbergi ( jones , 2005 , jones , 2007 , jones , 2014 ) , concurrent infection of both a. hastaspicula and a. antarctica occurred in one of our controls v. gouldii . in the dry inland of the continent with an annual precipitation below 400 mm ,
a. hastaspicula replaces a. antarctica though the two coexist over wide areas ( jones , 1983 ) , which might explain why seven out of the eight wild captured varanids in our study were only naturally infected by a. hastaspicula .
the morphologically primitive physalopteran nematode kreisiella chrysocampa occurs as adults in several species of smaller skinks lizards , in which physalopterid cysts occur but no adult abbreviata suggest that abbreviata spp.may have arisen in smaller lizards , and that their ancestor may have been species related to of kreisiella ( jones , 1995a ) .
hence , it is possible that the definitive host of a. hastaspicula may have been smaller lizards and which , on being ingested by larger lizards , developed in them .
environmental changes could theoretically expose lizards to different suites of parasites over time ( poulin , 2007 , poulin and keeney , 2008 ) .
findings from the australian lizard fauna show that host - specificity in the subfamily physalopterinae is usually at the family rather than species level ( jones , 2004 , jones , 2007 , jones , 2014 ) .
gecko c. marmoratus was used in the present study to ascertain whether it is a potential paratenic host for v. gouldii ; this was the only species of gecko we caught in the wild .
we could not confirm the two c. marmoratus were uninfected before they were fed with the infected t. oceanicus as only adult a. hastaspicula is able to pass its eggs in the faeces of the lizards .
as the anthelmintic drug has dewormed the varanids , we therefore expected that the geckos were free of parasites .
however , further experimentations could perhaps use x - ray to confirm the infection status of the c. marmoratus or other potential paratenic gekkonidae .
the two c. marmoratus that had ingested the crickets and the two v. gouldii that had consumed the c. marmoratus were not infected with adult abbreviata species ; however , we were unable to ascertain that the geckoes had ingested nematodes from the offered crickets , and thus we can not confirm that c. marmoratus are potential paratenic hosts for a.hastaspicula .
many species of smaller lizards , mainly skinks and geckoes , are paratenic hosts for physalopterid larvae ( jones , 1995a ) , in which there is a lack of inflammatory response ( jones , 1995b ) .
no further development in these paratenic hosts occurs unless they are consumed by a larger species of lizard ( jones , 1995a ) .
more studies are required to ascertain the postulated life cycle in paratenic hosts ( dashed arrows in fig .
6 ) and we recommend the inoculation of third stage infective larvae to the geckos to be performed using a stomach tube or oral syringe .
infection is probably the result of a long evolutionary association between this species of nematode and their reptile final host .
varanus gouldii can live for at least seven years in captivity ( king and green , 1999 ) .
the lifespan of a. hastaspicula within the host is unknown , but the reptile hosts outlive the third - stage physalopterid larvae ( jones , 1995b ) . to conclude , our study has elucidated the complete life - cycle of a. hastaspicula in its definite v. gouldii .
the findings of the present study may have relevance for human contact and hence possible infection . as early as 1902 , there are records of physalopterinae nematodes infecting humans in caucasus , central africa , south america ( ortlepp , 1926 , morgan , 1945 ) , panama ( faust and martinez , 1935 ) , india ( singh and rao , 1954 ) and congo ( vandepitte et al . , 1964 ) . in australia ,
physalopteran larvae have caused life - threatening eosinophilic granulomata in an 11-month - old male infant , but the species causing the infection could not be identified ( nicolaides et al . , 1977 ) .
this subfamily of nematodes may perhaps be underreported in man because they are insufficiently known .
further studies of nematodes in the genus of abbreviata in australian lizards should provide considerably more information for the understanding of their biology , and thus the risk of humans acquiring physalopterid infection . | this study elucidates the life - cycle of the reptile inhabiting nematode abbreviata hastaspicula ( spirurida : physalopteridae : physalopterinae ) in australia .
eight varanus gouldii ( lacertilia : varanidae ) , and two christinus marmoratus ( reptilia : gekkonidae ) lizards were captured in the wild .
two v. gouldii were used as controls and no experimental procedures were carried out on them .
another six v. gouldii ( final host ) and the two c. marmoratus ( paratenic host ) were treated with oral anthelmintics to remove all parasitic worms and were fed with infected live arthropods containing third stage larvae of abbreviata hastaspicula .
faeces of v. gouldii were examined under the microscope weekly to determine whether the third stage larvae had developed into adults .
two months later , a total of 30 larvae and adults of a. hastaspicula were found in the stomachs of four experimentally - infected v. gouldii lizards .
no cysts or larva were found in the c. marmoratus .
this is the first study to demonstrate the life - cycle of this genus of nematode in their definitive reptile hosts . | Introduction
Materials and methods
Results
Discussion |
as a common head and neck cancer , nasopharyngeal carcinomas are generally either keratinizing or nonkeratinizing squamous cell carcinomas .
primary nasopharyngeal adenocarcinomas ( npacs ) are rare neoplasms , constituting only 0.38% to 0.48% of all malignant nasopharyngeal neoplasms .
thyroid - like low - grade nasopharyngeal papillary adenocarcinoma ( tl - lgnppa ) is a small minority of conventional nasopharyngeal adenocarcinoma that exhibits papillary growth and abnormal expression of thyroid transcription factor 1 ( ttf-1 ) . to the best of our knowledge ,
only thirteen cases have been reported in the english - language literature and eleven in the chinese - language literature to date ( table 1 ) . in this article , we present a case of primary tl - lgnppa and an analysis of its clinicopathological features .
a 15-year - old chinese girl presented with a complaint of rhinorrhoea and nasal congestion with a duration of 1 month . on clinical examination , no thyroid tumor or other physical abnormalities were found .
nasal endoscopy identified a pedunculated polypoid mass with smooth surface that measured approximately 2.52 cm arising from the posterior nasal septum ( fig .
follow - up data showed no signs of local recurrence at up to 2 years after complete surgical removal .
the tissue was fixed in formalin and embedded in paraffin , after which 4-m thin sections were cut and stained with hematoxylin and eosin .
immunohistochemical staining was performed using commercially available antibodies to the following antigens : pan - cytokeratin ( ckpan ) , epithelial membrane antigen ( ema ) , vimentin , cytokeratin ( ck ) 7 , cd15 , thyroid transcription factor 1 ( ttf-1 ) , ki-67 , p40 , s100 , glial fibrillary acidic protein ( gfap ) , ck20 , cdx-2 , and thyroglobulin . at the same time , in situ hybridization for the presence of small epstein - barr virus ( ebv)encoded rna was performed to identify the association between this tumor and ebv .
histological examination of the biopsy specimen revealed a tumor that showed papillary configuration with hyalinized fibrovascular cores , similar to thyroid papillary carcinoma ( fig .
the papillae were complex and tightly packed , and most were lined with cuboidal or columnar epithelia containing overlapping round to ovoid nuclei that displayed fine chromatin and mildly eosinophilic cytoplasm ( fig . 2c ) .
small intra - nuclear cytoplasmic inclusions were present focally , although neither nuclear grooving nor ground glass nuclei were found . in small parts of the tumor ,
no necrosis or mitotic activity was discerned and no continuity between the tumor epithelia and normal nasopharyngeal mucosa or mucous glands was identified .
immunoperoxidase studies showed that neoplastic cells were positive for ck7 , vimentin , ttf-1 , ckpan , and ema ( fig .
there was no immunoreactivity for thyroglobulin , cd15 , s100 , p40 , ck20 , cdx-2 , and gfap . in the most concentrated spot ,
npac contains two subtypes : conventional / surface origin - type and salivary gland - type .
the latter includes polymorphous low - grade adenocarcinoma , mucoepidermoid adenocarcinoma , and adenoid cystic carcinoma . in 1988 , wenig et al .
first described thyroid - like papillary adenocarcinoma of the nasopharynx and proposed that these papillary adenocarcinomas should been regarded as a distinct entity from conventional adenocarcinomas in this region based on their indolent clinical behavior and low - grade histological features .
nasopharyngeal papillary adenocarcinoma ( nppa ) was enrolled in the world health organization classification system of malignant epithelial tumors of the nasopharynx in 2005 .
papillary configuration and aberrant ttf-1 expression are the distinguishing features of tl - lgnppa , mimicking papillary thyroid carcinoma ( ptc ) .
tl - lgnppa is an extremely rare neoplasm . to the best of our knowledge ,
the median age is 35 years in patients , ranging from 9 to 68 years .
instances of tl - lgnppa were usually localized in the roof of the nasopharynx and posterior edge of the nasal septum .
the excellent prognosis was obvious , with local excision being performed in all reported cases , and no local recurrence or metastasis reported .
histologically , these neoplasms frequently exhibit papillary architecture lined by moderately pleomorphic columnar epithelial cells with fibrovascular cores , overlapping nuclei with clear optically chromatin , and psammoma bodies .
however , the biphasic pattern of low - grade nppa with a spindle cell component has been described in three case reports . in this case , no obvious spindle cell component was observed .
the biphasic pattern of tl - lgnppa should be further investigated if a large number of cases can be collected .
immunohistochemically , the positive expression of ttf-1 was the most characteristic feature of tl - lgnppa .
as a homeodomain containing transcription factor coded by nkx2 - 1 , ttf-1 is usually found in lung , thyroid , and central nervous system tissue .
nevertheless , the positive expression of ttf-1 was also observed in other organs , including endometrium , colon , and breast .
although the etiology of ttf-1 positive staining in tl - lgnppa is still not clear , three mechanisms to explain this phenomenon were proposed in a recent case report .
second , a gene rearrangement that affects ttf-1/nkx2 - 1 may result in abnormal expression of ttf-1 . finally , genetic instability and reprogramming of the cancer cells can cause dis - differentiation and lead to deregulation of ttf-1/nkx2 - 1 . however , these presumptions are poorly evidenced owing to the extreme rarity of this tumor at the present time .
there are limited options available for differential diagnosis of papillary lesions in the nasopharynx . because tl - lgnppa display a striking resemblance to ptc , it is important to exclude nasopharyngeal metastasis from papillary adenocarcinoma of the thyroid gland for accurate diagnosis , treatment , and prognosis of the patient .
immunostaining for thyroglobulin and cd15 are critical and highly recommended to distinguish these two entities .
however , a case of tl - lgnppa with focal expression of thyroglobulin was recently reported .
polymorphous low - grade papillary adenocarcinoma ( plga ) is more aggressive and positive for vimentin and s100-protein . to date , positivity for ttf-1 has never been reported in plga .
papillary variants of the intestinal type of adenocarcinoma ( itac ) show more nuclear atypia and commonly display mucinous differentiation .
acinic cell carcinomas ( acc ) with a papillary component are frequently cystic and variably positive for s100-protein and vimentin according to the range of differentiation ( acinar to intercalated ducts ) .
extraventricular choroid plexus papillomas ( cpp ) at unusual localization must be taken into consideration , most of them was positive for s100 and negative for ema , part of them was positive for gfap .
in our report , negative staining for thyroglobulin , cd15 , s100 , gfap , ck20 , and cdx-2 was revealed ; therefore , ptc , plga , itac , acc , and cpp should not be considered for accurate diagnosis .
it has been well documented that tumors originating from the nasopharyngeal epithelium were associated with the ebv
. investigation of in situ hybridization for ebv revealed negative results , which is concordant with reports by wu et al .
a close relationship between tl - lgnppa and ebv was not confirmed ; however , further investigation is needed because of the rarity of this neoplasm . to date ,
no case of lymphatic metastasis or recurrence has been reported , indicating excellent prognosis for patients with thyroid - like papillary adenocarcinoma .
generally , surgical excision is adequate for the treatment of tl - lgnppa . when surgical excision is not feasible or positive surgical margins have been observed , radiotherapy can be employed as an adjuvant treatment .
in conclusion , we present here a novel case of tl - lgnppa with a review of its main clinicopathological features . due to the rarity of this neoplasm and favorable clinical outcome
, clinicians should pay more attention to accurate diagnosis of this entity , as well as its treatment and clinical prognosis . | purposeprimary low - grade thyroid - like papillary adenocarcinomas are extremely rare neoplasms that generally originate in the nasopharynx . here
, we describe a novel case of a 15-year - old chinese girl who was diagnosed with low - grade thyroid - like papillary adenocarcinoma , including a brief review of the literature to reveal the clinicopathological features of low - grade thyroid - like nasopharyngeal papillary adenocarcinoma.materials and methodsimmunohistochemistry was used to evaluate the expression of pan - cytokeratin ( ckpan ) , cytokeratin ( ck ) 7 , thyroid transcription factor 1 ( ttf-1 ) , vimentin , epithelial membrane antigen ( ema ) , thyroglobulin , cd15 , s100 , p40 , ck20 , cdx-2 , glial fibrillary acidic protein ( gfap ) , and ki-67 .
additionally , in situ hybridization investigation was utilized to identify the presence of small epstein - barr virus ( ebv)encoded rna.resultshistopathological analysis revealed florid proliferation of papillary structures lined by columnar epithelial cells with fibrovascular cores .
immunohistochemically , the neoplastic cells were positive for ckpan , ck7 , ttf-1 , vimentin , and ema , but negative for thyroglobulin , cd15 , s100 , p40 , ck20 , cdx-2 , and gfap .
the ki-67labeling index reached 5% in the most concentrated spot .
in situ hybridization for ebv was negative.conclusiondue to the distinct rarity of low - grade thyroid - like papillary adenocarcinomaswith a favorable clinical outcome , a nationwide effort to raise public awareness of this neoplasm is required . | Introduction
Materials and Methods
Results
Discussion
Conclusion |
a 6-year - old girl presented with unilateral hearing loss . at the physical examination , the otologic status and head and neck status were normal .
pure tone audiometry and speech testing showed total deafness of the right side , but normal hearing thresholds in the left side .
an examination with brain stem electric response audiometry ( bera ) showed no response from the right ear .
for further evaluation of the seventh and eighth cranial nerves , high - resolution mr imaging was performed using the 3.0-t achieva system ( philips medical systems , best , the netherlands ) .
mr imaging protocols included the following : a three - dimensional driven equilibrium radio frequency pulse ( 3d drive ) sequence ( tr / te 2000/200 , 1.2 mm slice thickness , matrix 336 336 , field of view 200 200 mm , number of acquisitions 1 ) and a t2-weighted fast spin - echo ( fse ) sequence ( tr / te 2555/80 , 2 mm slice thickness , matrix 400 313 , field of view 130 130 , number of acquisitions 2 ) on axial and parasagittal planes .
parasagittal mr imaging was obtained perpendicular to the course of the acoustic nerve for the iac . as seen on temporal bone hrct , there were two narrow bony canals in the iac of the right temporal bone .
the iac was divided by a bony septum into a relatively large anterosuperior portion ( 1.6 mm ) and a stenotic inferoposterior portion ( 0.8 mm ) ( figs .
the anterosuperior portion ended in a wide connection in the facial canal and a narrow connection to the vestibule . the inferoposterior portion ended in narrow connections to the cochlea and vestibule .
the facial nerve canal was intact along its course , except for a slightly widened labyrinthine segment .
there were no abnormalities in the cochlea , vestibule , and semicircular canals as seen on hrct .
as seen on mr imaging , the inner ear structures were normal , and the vestibulocochlear and facial nerves in the iac were clearly identified on the left side . on the right side , the cochlea , the vestibule , and the semicircular canals were normal .
however , there was no identifiable neural structure in the inferoposterior compartment of the right duplicated iac .
there was only one nerve structure , assumed to be the facial nerve , on the anterosuperior compartment of the duplicated iac ( figs .
a narrow iac is a rare congenital malformation of the temporal bone and it usually exists along with several other abnormalities of the temporal bone and various systemic developmental anomalies , including cardiac , renal , skeletal , and intestinal malformations ( 1 ) .
this malformation comprises only 12% of congenital temporal bone anomalies , and it is usually unilateral ( 3 , 4 , 9 ) .
congenital isolated narrowing of the iac implies that there are no associated abnormalities in the inner ear , middle or external ear structures , and the absence of any acquired osseous condition predisposing to stenosis of the iac ( 10 ) . in this case , the iac was unilateral and there was no evidence of other temporal bone or systemic developmental anomalies .
there are two widely accepted hypotheses that explain the association of a narrow iac with sensorineural hearing loss .
one hypothesis is that the embryonic cochlear and vestibule induce the growth of the vestibulocochlear nerve and the bony canal develops around the nerve together with the facial nerve by chondrification and ossification of the mesoderm in the eighth week of gestation . when the vestibulocochlear nerve is aplastic or hypoplastic , the iac fails to develop and becomes stenotic ( 1 , 4 ) .
the other hypothesis is that the primary defect is bony stenosis that inhibits the growth of the vestibulocochlear nerve and causes impaired transmission of an induction signal from the intact cochlea and vestibule .
however , given the fact that the facial nerve function is usually preserved and it has a normal gross morphology in most cases of narrow iac , this hypothesis is less likely ( 1 ) .
the facial nerve develops separately and it is later surrounded as the canal forms around the vestibulocochlear nerve .
this may cause the duplication of the iac in some cases of a narrow iac with the aplastic or hypoplastic vestibulocochlear nerve . in this case , the right iac was duplicated with a bony septum that separated the canal into a relatively large anterosuperior portion containing an intact facial nerve and empty stenotic inferoposterior portion . to date , only five cases of a narrow iac with duplication have been reported .
these investigators described a case of narrow iac with duplicated canals that joined at the fundus of the iac .
cho et al . ( 5 ) reported a third case in 2000 and it was a case of narrow iac with duplication .
however , two separate canaliculi of the iac showed similar diameters and did not join at the fundus of iac .
these investigators described a similar case of narrow iac which was associated with bilateral enlargement of the vestibule and the lateral semicircular canal and bilateral dysplastic cochleae .
this was a case of a narrow iac that was separated into two narrow bony canals .
our case was an isolated unilateral narrow iac that was not associated with any other labyrinthine abnormality . in this case , the iac was divided by a bony septum into two bony canals that were joined at the fundus of iac .
the normal range of the iac is 2 - 8 mm , with an average of 4 mm , and a narrow iac is defined when a canal is smaller than 2 mm in vertical diameter as seen on hrct ( 9 ) .
the hrct scan is the diagnostic modality of choice as it provides excellent bony detail and high sensitivity and specificity in demonstrating the congenital inner ear and temporal bone abnormalities ( 1 ) .
however , a ct scan has a limited role in assessing the neural components of the iac .
( 6 ) described seven cases with congenital or unexplained sensorineural hearing loss and five of those cases with a normal iac showed aplasia or hypoplasia of the vestibulocochlear nerve or of only the cochlear branch on mr imaging . in patients with a narrow iac , assessment of the cochlear nerve is crucial for selecting patients for cochlear implantation ( 4 ) .
patients with aplastic cochlear nerves may not respond to the electric stimulation of the cochlear implantation .
these reports emphasized that an hrct scan alone is not sufficient to rule out the risk of aplasia or hypoplasia of the vestibulocochlear nerve and that mr imaging should be performed to look for the defect of neural structures in the iac of patients with sensorineural hearing loss .
mr imaging has become the modality of choice along with hrct for the assessment of abnormalities in patients with sensorineural hearing loss .
especially , the use of high - resolution gradient - echo imaging provides detailed anatomical images of the vestibulocochlear and facial nerves of an iac and is essential for cochlear implant candidates ( 6 ) .
there are several newly developed high - resolution gradient - echo mr imaging sequences which include 3d magnetization prepared rapid gradient echo ( mp - rage ) , 3d balanced fast field echo ( b - ffe ) , 3d fourier transformation - constructive interference in the steady state ( 3d ft - ciss ) , and 3d drive sequences ( 5 , 7 ) .
these sequences are all three - dimensional for data acquisition and submillimetric in spatial resolution , which are optimal to evaluate the neural structures less than 1 mm in diameter , such as the auditory and facial nerves . in this case
, we used a 3d drive sequence with a high field 3-tesla mri scanner to obtain detailed images for the neural structures of the iac .
cho et al . ( 5 ) reported a case of narrow iac syndrome with aplasia of the vestibulocochlear nerve and intact facial nerve that were successfully demonstrated by using parasagittal reconstruction mr imaging .
in this case , the iac was narrow and was composed of two separate canaliculi as seen on hrct .
on 3-t mr images using 3d drive and a t2-weighted fse sequence with axial and parasagittal planes perpendicular to the course of the iac , there were a relatively larger anterosuperior portion containing the intact facial nerve and a stenotic inferoposterior portion without any neural contents . in conclusion , an isolated narrow iac with duplication associated with congenital sensorineural hearing loss and normal facial nerve function
is extremely rare , and to the best of our knowledge , this is the sixth case reported for this malformation .
an examination of this anomaly should include a past medical history and physical examination , auditometry including auditory brainstem response , a high - resolution ct scan , and high - resolution mr imaging .
it is of great importance to make a diagnosis of aplasia or hypoplasia of the vestibulocochlear nerve in the iac for cochlear implant candidates . for this purpose , high - resolution
submillimetric gradient - echo mr images , such as 3d - ciss and 3d drive , or t2-weighted fse sequences should be obtained in the parasagittal plane perpendicular to the course of the vestibulocochlear and facial nerves . | a narrow internal auditory canal ( iac ) with duplication is a rare anomaly of the temporal bone .
it is associated with congenital sensorineural hearing loss .
aplasia or hypoplasia of the vestibulocochlear nerve may cause the hearing loss .
we present an unusual case of an isolated narrow iac with duplication that was detected by a ct scan . in this case , the iac was divided by a bony septum into an empty stenotic inferoposterior portion and a large anterosuperior portion containing the facial nerve that was clearly delineated on mri . | CASE REPORT
DISCUSSION |
tumor of the follicular infundibulum ( tfi ) is a rare benign neoplasm providing two distinctive clinical patterns : the solitary and the eruptive form .
the clinical presentations resemble many other dermatologic conditions and require histopathological study to make a definite diagnosis .
although the tumor is called a tfi , it is not a neoplasm with infundibular differentiation .
we herein report the case of a tfi patient who presented with multiple asymptomatic hypopigmented macules resistant to the treatments .
a 50-year - old man presented with a clinical history of multiple asymptomatic lesions of the face , neck , upper chest and back spanning more than 20 years .
the size of the lesions ranged from approximately 3 to 20 mm in diameter ( fig .
administration of 5% liquor carbonis detergens for many years resulted in only minimal improvement.fig .
1hypopigmented angulated macules on face , neck ( a ) and upper chest ( b ) hypopigmented angulated macules on face , neck ( a ) and upper chest ( b ) a biopsy was performed and histopathologic examination revealed a plate - like fenestrated subepidermal tumor extending horizontally under the epidermis with multiple cord - like connections to the overlying epidermis .
this patient was treated with carbon dioxide laser ablation.fig . 2
a plate - like fenestrated subepidermal tumor extending horizontally under the epidermis with multiple cord - like connections to the overlying epidermis ( h&e 20 ) .
b peripheral palisading of the basaloid cells ( h&e 40 )
a plate - like fenestrated subepidermal tumor extending horizontally under the epidermis with multiple cord - like connections to the overlying epidermis ( h&e 20 ) .
b peripheral palisading of the basaloid cells ( h&e 40 ) all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1975 , as revised in 2000 and 2008 .
all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1975 , as revised in 2000 and 2008 .
tumor of the follicular infundibulum is considered as a rare benign neoplasm , first described by mehregan and butler in 1961 .
however , the estimated frequency is 310 per 100,000 biopsies and the tumor develops predominantly in women .
usually , solitary tumor presents as scaly papule or nodule up to 1.5 cm in diameter and distributed on the head and neck or trunk of middle - aged and elderly patients [ 24 ] .
abbas and mahalingam reported 3 cases of multiple tfi ( 6% ) from 50 cases in 2009 and alomari et al . reported 13 cases ( 7.7% ) from total 168 cases in their study [ 3 , 4 ] .
the eruptive form has been described in most reports as symmetrically distributed tumors of variable scaling , hypopigmented macules and papules with irregular or angulated borders confined to the face , neck and upper trunk .
rarely , the tumors occur on the extremities and buttocks [ 5 , 6 ] .
the number of tumors varies from fewer than twenty to more than a hundred , and they are usually asymptomatic .
the differential diagnosis of tfi is one of the most challenging issues because the tumor also resembles many other dermatologic conditions .
differential diagnosis of hypopigmented macular lesions includes tinea versicolor , pityriasis alba , vitiligo , tuberculoid leprosy and idiopathic guttate hypomelanosis [ 3 , 5 ] .
for the depressed lesions , differential diagnosis includes acne scars , atrophic lichen planus , lichen sclerosus et atrophicus , disseminated superficial actinic porokeratosis and discoid lupus erythematosus [ 3 , 6 ] .
finally , differential diagnosis of papular lesions includes basal cell carcinoma , melanocytic nevi , seborrheic keratosis , actinic keratosis , prurigo nodularis , warts and trichoblastoma [ 3 , 6 , 7 ] . because of the variety of clinical presentations , the histopathological study is the most important method for providing a definite diagnosis .
histopathological findings in both forms of tfi consist of the plate - like growth of epithelial cells in the upper part of the dermis , expanding parallel to the epidermis , and showing peripheral nuclear palisading of the individual nest [ 2 , 5 , 8 ] .
some articles report an increase in elastic fibers surrounding the tumor [ 2 , 4 ] .
the histopathological difference between the solitary and eruptive form is the decrease of epidermal melanin , particularly in the tumor area , which can be correlated with the clinical form of hypopigmentation presented in the eruptive variant [ 2 , 3 ] .
histologically , tfi should be differentiated from basal cell carcinoma , superficial fibroepithelial tumor of pinkus , trichilemmoma , inverted follicular keratosis and pilar sheath acanthoma [ 4 , 5 ] .
most articles propose that the origin of the tumor is the follicular infundibulum , regarding the topography of the tumor proliferation and glycogen in the tumor cells [ 1 , 2 ] .
others hypothesize that the origin of the tumor is the isthmus part of the follicle , regarding tumor cells showing trichilemmal differentiation and the reports of sebaceous differentiation [ 9 , 10 ] .
the eruptive form has been reported in association with cowden s disease , nevus sebaceous , actinic keratosis , junctional melanocytic nevus , desmoplastic malignant melanoma , trichilemmoma , epidermal inclusion cysts and transformation to basal cell carcinoma .
however , the associations are not strong and should be considered only in additional cases which raise clinical concerns .
treatments reported for tfi include topical steroids , topical retinoic acid , topical keratolytics , topical imiquimod , etretinate , cryotherapy , curettage , excision and ablative laser , all with unpleasant results .
our patient was treated with carbon dioxide laser ablation and the short - term result was satisfactory .
although only a single reported case of transformation to basal cell carcinoma exists , the possibility of this outcome should be considered [ 11 , 12 ] .
long - term follow - up , especially in the case of eruptive form , should be performed since complete treatment is not practicable .
in conclusion , we report the case of tfi to remind physicians of the clinical presentation of this rare tumor . moreover , hypopigmented macules are one of the more common clinical presentations in dermatological practices .
tfi should be included in the differential diagnosis when a patient with hypopigmented lesions , particularly on the head and neck area , does not respond to the treatment based on the clinical diagnosis .
all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional and national ) and with the helsinki declaration of 1975 , as revised in 2000 and 2008 .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited . | backgroundtumor of the follicular infundibulum ( tfi ) is considered as a rare benign neoplasm providing two distinctive clinical patterns : the solitary and the eruptive form .
the clinical presentations resemble many other dermatologic conditions and require histopathological study to make a definite diagnosis.objectiveto inform physicians of a clinical presentation of tfi.case reportwe report on a 50-year - old man who presented with multiple asymptomatic hypopigmented macules resistant to the treatments .
the histopathological study was consistent with tumors of the follicular infundibulum.conclusionhypopigmented macules are one of the more common clinical presentations in dermatological practices .
it is important to include tfi in the differential diagnosis when a patient with hypopigmented lesions does not respond to the treatment based on the clinical diagnosis.electronic supplementary materialthe online version of this article ( doi:10.1007/s13555 - 015 - 0079 - 0 ) contains supplementary material , which is available to authorized users . | Electronic supplementary material
Introduction
Case Report
Compliance with Ethics
Discussion
Conclusion
Electronic supplementary material
Conflict of interest
Compliance with ethics guidelines
Open Access |
obturator hernias ( ohs ) are rare ; they represent only 0.051.4% of all abdominal wall hernias . the typical patient with an
women are affected nine times more frequently than men , because of broader pelvis with a larger triangular obturator canal opening with a greater transverse diameter , and a history of pregnancy .
additional contributing factors are multiparity , chronic illness , malnutrition and conditions associated with increased intra - abdominal pressure .
a 88-year - old woman presented to the ed with abdominal pain , vomiting , right hip pain and diarrhoea .
medical co - morbidities include ischaemic heart disease , hypertension and bilateral osteoarthritis of the hip .
her surgical history includes three caesarean sections , open cholecystectomy , umbilical hernia repair and left mastectomy for breast cancer . a computed tomography ( ct ) abdomen revealed small bowel obstruction due to the right oh ( fig . 1 ) and
a trial of conservative management was made for patient due to her age , multiple co - morbidities and patient 's wishes .
the patient re - presented 1 month later with small bowel obstruction and pain radiating down medial left leg .
abdominal x - ray was consistent with small bowel obstruction ( fig . 2 ) and
intra - operatively , there was a large right oh containing a small bowel , which was reduced , and a bard polypropylene mesh plug inserted into the defect and fixed with prolene interrupted sutures .
the patient made an unremarkable recovery , and she was discharged 3 days after the operation .
figure 1:(a and b ) small bowel obstruction secondary to a right oh . ( a ) coronal and ( b ) axial .
figure 2:abdominal x - ray showing dilated small bowel loops and severe osteoarthritis changes in both hips .
figure 3:(a and b ) small bowel obstruction secondary to a left oh . ( a ) coronal and ( b ) axial .
( a and b ) small bowel obstruction secondary to a right oh . ( a ) coronal and ( b ) axial . abdominal x - ray showing dilated small bowel loops and severe osteoarthritis changes in both hips .
( a and b ) small bowel obstruction secondary to a left oh . ( a ) coronal and ( b ) axial .
it occurs when viscera herniates through the obturator canal , through which the obturator vessels and nerve pass to reach the hip .
three stages of oh formative have been described : ( 1 ) pre - peritoneal connective tissue and fat enter the obturator canal ; ( 2 ) a dimple is formed in the peritoneum over the internal orifice of the obturator canal and progresses to the invagination of a peritoneal sac and ( 3 ) viscera , typically ileum , enters the sac . in an emaciated patient ,
the loss of protective pre - peritoneal fat over the obturator canal increases the risk of herniation .
according to a case series of 30 patients by mayo clinic , the most common presenting signs and symptoms were bowel obstruction ( 63% ) , abdominal / groin pain ( 57% ) and a palpable lump in medial aspect of thigh ( 10% ) .
romberg sign , which is pain along the distribution of the obturator nerve , is present in 37% of patients .
high morbidity in oh is directly related to the advanced age of the patients , diagnostic delay , gangrene and bowel perforation , deterioration and disability of the patients , and associated chronic diseases [ 7 , 8 ] . as such , conservative management has little or no place in the management of oh , as is proved in our case where conservative management did eventually fail .
the early diagnosis is challenging when the symptoms and signs are non - specific . among the various radiologic diagnostic modalities ,
ct scan has superior sensitivity and accuracy , as it allows definitive diagnosis of oh before laparotomy , and it can also show incarcerated bowel in the obturator foramen , with contrast scans having the ability to demonstrate any ischaemia or infarction . in a setting where ct is not available , plain abdominal radiographs can show signs of bowel obstruction , and ultrasound examination may reveal a hypoechoiec mass reflecting a dilated oedematous bowel segment .
oh repair is usually accomplished by a midline laparotomy and primary repair . however , with the advent of laparoscopy , additional choices of mesh , and the possibility of a pre - operative diagnosis , other options for repair now exist .
laparoscopic repair is only suitable for elective repairs , mostly when oh presents as an incidental intraoperative diagnosis during a laparoscopic hernia repair or other pelvic operation .
a midline laparatomy was applied in this case because it has the advantages of better exposure and facilitation of bowel resection when necessary .
we used a prosthetic plug to reinforce the obturator foramen in one side and a simple primary closure for the other side , and the outcome was satisfying .
after reduction of the contents , it is necessary to check the viability of the bowel and perform segmental resection of ischaemic or gangrenous areas . in conclusion ,
they should always be suspected when a thin elderly woman presents with symptoms of bowel obstruction or non - specific pain over the thigh and hip . | obturator hernia ( oh ) is a rare type of pelvic hernia
. it can cause significant morbidity and mortality , especially in the elderly age group .
delayed treatment is associated with high rates of strangulation ( 25100% ) .
we present an 88-year - old woman who presented with symptoms of bowel obstruction and right hip pain .
computed tomography ( ct ) abdomen revealed bilateral ohs and bowel obstruction secondary to the right oh . she was managed conservatively due to her age and co - morbidities and her bowel obstruction subsequently resolved .
she was discharged , only to re - present 1 month later with similar complaints .
a repeat ct scan revealed bilateral ohs and bowel obstruction due to the left oh . she underwent midline laparatomy and both ohs were reduced .
the right oh was fixed with polypropylene mesh plug and the left oh was fixed with primary closure .
the patient recovered and no recurrence was noted during follow - up . | INTRODUCTION
CASE REPORT
DISCUSSION |
humeral head resurfacing was proposed as a treatment for glenohumeral arthrosis in an attempt to preserve the original anatomy and avoid humeral head resection .
preservation of humeral head maintained the native inclination , offset , head shaft angle , and version of humerus [ 13 ] .
other advantages include a shorter operating time , reduced blood loss , and fewer complications .
another advantage is that , unlike stemmed implant , there is no need for a straight humeral canal to accommodate a long stem .
this allows easier later revision to a conventional total shoulder arthroplasty , if required [ 1 , 2 ] .
it is an attractive option in both the old and the young patients [ 4 , 5 ] .
the disadvantage of resurfacing is the limited exposure to glenoid when wanting to perform a total shoulder resurfacing arthroplasty , but this does not affect when resurfacing the humeral head alone . the primary aim of our study was to report the results of humeral resurfacing arthroplasty in a consecutive series of patients at a district general hospital practice
twenty - one consecutive patients underwent shoulder resurfacing ( aequalis , tornier , usa ) between october 2007 and november 2009 for symptomatic end - stage glenohumeral arthrosis . clinical examination and radiographic evidence
patient demographics , duration of surgery , intraoperative findings , and complications were prospectively recorded .
of the 21 patients , one patient had worsening of symptoms and underwent revision to a stemmed total shoulder replacement in less than 2 years , one patient died of unrelated cause , and in one patient the humeral head collapsed at the time of impaction of the definitive component and therefore was converted to a stemmed hemiarthroplasty intraoperatively .
therefore 18 patients with a mean followup of 36.3 months ( range 2454 months ) were included in the study .
there were 6 men and 12 women with a mean age of 75.1 years ( range 5891 years , 95% ci of the sd was 70.8 to 79.4 ) , and there were 7 right and 11 left shoulders ( table 1 ) .
the mean duration of preoperative symptoms was 33.6 months ( range 6120 months , 95% ci of the sd was 22.6 to 45.2 ) .
all patients were operated on in the beach chair position under general anaesthesia and an interscalene nerve block .
the shoulder was exposed by a deltopectoral approach with the upper third of subscapularis and the joint capsule reflected in one layer .
the cartilage of humeral head and glenoid were inspected for wear , and osteophytes were excised from the head of the humerus .
the rotator cuff was inspected for its integrity , and either a normal appearance or partial tear was recorded .
any inflammatory pathology of the rotator interval , integrity of the labrum and the long tendon of the biceps brachii and loose bodies in the inferior recess were recorded .
a guide wire was then introduced in the centre of the humeral head which was reamed to the measured size , and trial component inserted after a cruciate keel made a foot anchor in the cancellous bone of the humeral head .
soft tissue releases were undertaken , and stability and range of movement of the shoulder were assessed with trial implant in situ .
subscapularis tendon and joint capsule were repaired using the tendon - to - tendon technique .
the operation was performed by the senior author or by an orthopaedic trainee under direct supervision of the senior author .
the mean duration of anaesthesia that included surgical time was 112 minutes ( range 75150 minutes , median 120 minutes ) .
this included monitoring of postoperative pain and neurovascular status , two further doses of iv cefuroxime 1.5 gm each at 8 and 16 hours , a check x - ray of the shoulder 's anteroposterior and lateral views , a sling to be worn for comfort , no external rotation beyond neutral for 3 weeks and no active external rotation for 6 weeks , physiotherapy advice at discharge , and a physiotherapy followup at 3 weeks postoperatively .
clinical outcome of the operation was assessed by patients ' self - reported oxford shoulder score ( oss ) for pain .
it has a best possible score of 48 and the worst score of 0 [ 6 , 7 ] .
paired two - tailed p value was calculated to assess improvement in the outcome of the procedure , and a value of < 0.05 was considered statistically significant .
oss is a patient - reported outcome measure , and its reliability has been validated against constant shoulder score , sf36 [ 6 , 8 , 9 ] , western ontario rotator cuff index ( worc ) , and shoulder pain and disability index ( spadi ) .
the median duration of hospital stay was one day ( mean 2 days , range 18 days ) .
one patient complained of chest pain postoperatively and stayed for 8 days in the hospital .
she was diagnosed to have a triple vessel coronary disease , which delayed her discharge due to investigative procedures .
she later underwent a coronary artery angioplasty . the pre - operative mean oss of 15 ( range 329 , 95% ci of the sd was 10.6 to 19.4 ) improved by 19.5 points to a final mean oss of 34.5 ( range 647 , 95% ci of the sd was 29.3 to 39.7 ) .
the improvement of oss was highly significant with a two - tailed p value less than 0.0001 and 95% confidence interval of this difference from 14.2 to 24.7 .
15 patients ( 83.3% ) had greater than 11-point improvement of oss ( table 2 ) .
one patient developed adhesive capsulitis and his pre - operative oss of 18 declined to 15 at 54 months followup .
this patient then underwent arthroscopic capsular release ; however , he did not respond to further oss questionnaires .
two patients each had 3 and 4 points improvement of oss ( table 2 ) .
one of them had radiating pain from cervical spondylosis and was referred to pain clinic for management of her symptoms .
no identifiable cause for the lack of greater than 4 points improvement of oss was found in the other patient .
apart from one patient , the remaining 17 patients were very or fairly pleased with the operation and , if they could go back in time , they still would choose to have the same operation . of the excluded patients
, one had an intraoperative collapse of the humeral head while impaction of the definitive implant and therefore was converted to a stemmed hemiarthroplasty .
one patient had poor initial result from the resurfacing procedure and was revised to total shoulder replacement within the first two years .
he made a significant improvement to a final oss of 30 at one year after total shoulder replacement .
there were no wound healing problems , infection , deep vein thrombosis , pulmonary embolism , and neurovascular deficits .
over the past twenty years , shoulder resurfacing arthroplasty has gained popularity as an alternative to conventional shoulder arthroplasty for the treatment of glenohumeral arthropathy .
the potential advantages of humeral resurfacing , as compared with conventional shoulder arthroplasty , that include minimal bone resection , a short operative time , low prevalence of humeral periprosthetic fractures , maintenance of head shaft angle , and an ease of revision to a conventional total shoulder replacement , if needed , are well documented [ 1 , 2 , 11 ] .
outcomes of various surface replacement arthroplasty designs have been comparable with those of arthroplasties with a stemmed prosthesis in numerous short and mid - term follow - up studies [ 1 , 2 , 11 ] .
these include the copeland surface replacement prosthesis ( biomet ) , the durom cup ( zimmer ) , total articular replacement arthroplasty prosthesis ( depuy orthopaedics [ warsaw , in , usa ] , and howmedica [ rutherford , nj , usa ] ) [ 1 , 2 , 12 , 13 ] ; however , our study presents results of the aequalis shoulder resurfacing implant ( tornier ) which have not been published in the literature .
our consecutive series of 18 patients with end - stage glenohumeral arthritis showed a mean 19.5 points ( range 3 to 36 ) improvement in oss at a mean followup of 36.3 months .
these results are comparable to change in the oxford shoulder score of a mean 25 points ( range 42 to 17 ) with tess anatomic prosthesis ; however , this study used the older version of oss [ 8 , 9 ] with best possible score of 12 points and worst score of 60 points .
most patients ( 94.5% ) were very or fairly pleased with the operation similar to the 90% satisfaction rate reported by huguet et al . .
our overall complication rate was 14.3% ; however , this can partly be attributed to the initial learning curve rather that to the design or performance of the implant .
the reasons for failure include poor selection of a patient where the humeral head collapsed intraoperatively at the time of impaction of the definitive prosthesis .
and one patient who developed adhesive capsulitis , unrelated to the surgical procedure , presented with a fall in oss score by three points and underwent arthroscopic capsular release .
our consecutive series of patients shows the good results through historical analysis of the prospectively collected data with no loss to followup .
our study of this implant is from a nonoriginating center of design and production , and to date the results of this implant have not been reported in the literature .
the results show that it is comparable with previously published studies on other resurfacing implants [ 1 , 2 , 14 ] .
the limitations of our study are due to smaller number of patients and early followup .
however , given the available data , our study shows very good results with aequalis shoulder resurfacing prosthesis .
it was not the purpose of this study to compare shoulder resurfacing with stemmed shoulder replacements , and no overall consensus was reached favoring one over the other .
this may need a prospective , randomized , long - term study in the future . |
aim . to evaluate results of aequalis humeral head resurfacing in patients with end - stage glenohumeral arthritis at a minimum followup of two years .
patients and methods .
twenty - one consecutive patients underwent humeral head resurfacing hemiarthroplasty between 2007 and 2009 .
three patients did not fulfill the inclusion criteria .
18 patients with mean age of 75.1 years ( range 5891 years ) and a mean duration of preoperative symptoms of 33.6 months ( range 6120 months ) were analyzed .
patients ' self - reported oxford shoulder score ( oss ) was collected prospectively and was used as an assessment tool to measure final outcome .
results .
the mean initial oss was 15 ( range 329 ) .
the score improved by an average of 19.5 points at a mean followup of 36.3 months ( range 2454 months ) to reach a mean final oss of 34.5 ( range 647 ) .
the improvement of oss was highly significant with a two - tailed p value less than 0.0001 .
the overall patient satisfaction was 94% .
conclusion .
this study demonstrates aequalis shoulder resurfacing hemiarthroplasty as a reliable procedure , away from its originating center , for improvement of shoulder function as shown by the patients ' self - reported outcome score ( oss ) in end - stage glenohumeral arthritis at a minimum followup of 2 years . | 1. Introduction
2. Patients and Methods
3. Results
4. Discussion |
topiramate is a sulfa - derivative antiepileptic drug which is also used for other indications such as migraine , personality disorders , weight loss , neuropathic pain and , recently , essential tremor [ 1 , 2 ] .
the pharmacodynamic picture of this drug generally reflects the modulation of voltage - gated sodium and calcium channels , increase of gabaergic inhibition , blockage of glutamate receptors and mild carbonic anhydrase inhibition . to date , several side effects of this drug are reported , of which ophthalmic manifestations are of special importance .
the most clinically significant ophthalmic side effects are angle - closure glaucoma , myopic shift , diplopia and nystagmus
. the precise mechanisms responsible for such adverse effects are , however , not completely understood .
serous choroidal detachment ( transudation of fluid into the suprachoroidal space ) may be due to globe hypotony of any etiology or exudation of serum caused by inflammation or other causes .
moreover , there are some instances in which the occurrence of choroidal detachment is not explainable by common mechanisms . to our knowledge ,
massive choroidal detachment following the administration of topiramate has never been described in previous case reports .
the purpose of this report was to illustrate the clinical and paraclinical features of a patient who experienced the above - mentioned adverse event .
we also aimed to discuss the possible pathogenic links of topiramate by comparing the features of our case with those of cases previously reported in the literature .
a 79-year - old male was admitted to our center for further evaluation of acute bilateral painless decline of vision .
the patient 's past clinical history included 80 mg / day aspirin intake due to unstable angina for 11 years .
the patient had no significant neurological disorder until 1 month before admission , when he experienced essential tremor .
as a result , treatment with topiramate 50 mg / day and propranolol 40 mg / day was started 2 weeks before his admission due to ophthalmic symptoms .
he underwent uncomplicated cataract surgery 11 years ago for the right eye and 9 years ago for the left eye , and both eyes had intraocular lenses .
on ophthalmologic examination , best - corrected visual acuity was 20/800 od and 20/600 os .
pupillary reactions to light and near stimuli were normal , and no pupillary afferent defect was present .
intraocular pressure was 10 mm hg in the right and 11 mm hg in the left eye .
retinal examination revealed posterior pole drusen compatible with mild dry age - related macular degeneration and notable choroidal detachments in all quadrants of the periphery ( fig .
1 ) , which were confirmed by ultrasonography ( fig .
2 ) .
the administration of topiramate was discontinued as a potential causative agent for this condition ; however , we did not reduce the dosage of propranolol .
this improvement continued until day 7 , when visual acuity gradually exceeded to 20/25 od and 20/30 os . by the end of day 7 , choroidal detachment resolved as well .
however , it is worth noting that in a study by the national registry of drug - induced ocular side effects , 9 cases of suprachoroidal effusion were concisely mentioned regardless of the severity of their complication .
the data on these subjects were extracted from the records of the world health organization or other related / similar organizations . nevertheless , to the best of our knowledge ,
neither precise features of these cases , e.g. the severity of effusion , were published elsewhere , nor any of them were specified to present massive choroidal detachment .
a review of the ophthalmology literature reveals that , to date , there are several reports describing bilateral angle closure following topiramate intake [ 4 , 7 , 8 , 9 ] .
our patient did not exhibit myopic changes or a shallow anterior chamber , although such side effects have been frequently observed with the use of this drug .
the term ciliochoroidal effusion syndrome was first proposed by ikeda et al . to describe the phenomena induced by topiramate and other sulfa derivatives .
this syndrome represents a category of symptoms including ciliochoroidal effusion , forward displacement of the lens - iris diaphragm and , consequently , angle narrowing and myopic shift .
accordingly , in our case choroidal effusion without development of angle closure or myopic shift could be due to lack of crystalline lens .
as mentioned previously , the main cause of choroidal detachment is generally believed to be ocular hypotony following surgical procedures . in our literature review
, we could identify an interesting case by doherty et al . that shares decisive common features with ours .
taking together , four main similarities are worth noting : ( 1 ) both patients had a past history of uncomplicated cataract surgery ; ( 2 ) intraocular pressure was within normal limits in both patients ; ( 3 ) dorzolamide and topiramate are both sulfa - derivative drugs , and ( 4 ) similar to dorzolamide which is a carbonic anhydrase antagonist , topiramate is also suggested to be a mild carbonic anhydrase inhibitor .
accordingly , the authors concluded that the cause of choroidal detachment is not always hypotony and postulated that it may also be due to hypersensitivity to dorzolamide .
our case provides further evidence in favor of this hypothesis , and this raises the question whether the cause of choroidal detachment in our case was hypersensitivity to topiramate as this is a sulfa - derivative drug as well . from another point of view
, it is well known that carbonic anhydrase antagonists can cause choroidal detachment , and this may explain why the administration of dorzolamide and topiramate results in this adverse effect . as a conclusion ,
we propose that the administration of topiramate and perhaps other sulfa - derivative drugs might be eligible to be added as a differential diagnosis of choroidal detachment . | topiramate is a sulfa - derivative antiepileptic drug which is also used for other indications such as essential tremor . a 79-year - old male was admitted to our center due to acute bilateral painless decline of vision .
one month before admission , he had experienced essential tremor and treatment with topiramate 50 mg / day and propranolol 40 mg / day .
best - corrected visual acuity was 20/800 od and 20/600 os .
both eyes had normal anterior chamber depths and irides .
intraocular pressure was 10 mm hg in the right eye and 11 mm hg in the left eye .
retinal examination showed notable choroidal detachments in all quadrants of the periphery , which were confirmed by ultrasonography .
refraction showed no myopic shift .
the administration of topiramate was discontinued as a potential causative agent for this condition . during follow - up , choroidal detachment and visual acuity
gradually resolved . in this study
, we described the first case of isolated massive choroidal detachment induced by topiramate . | Introduction
Case Report
Discussion
Disclosure Statement |
over the past two decades , the single most common cause of withdrawal or restriction of a medication that has already entered the market has been prolongation of the qt interval associated with polymorphic ventricular tachycardia or torsades de pointes.1 nine structurally unrelated drugs marketed in the united states for a wide range of noncardiovascular indications have since been removed or had their availability severely restricted due to this form of toxicity.1,2 in the hospital setting , numerous risk factors for drug - induced qt interval prolongation potentially leading to torsades de pointes exist , including hypokalemia , hypomagnesemia , bradycardia , genetic predisposition , associated heart disease , female gender , and use of drugs that either prolong the qt interval or disrupt the metabolism or distribution of qt - prolonging drugs.3 in the class of qt - prolonging drugs , intravenous administration of medications can also be associated with higher drug concentrations and greater cardiac exposure compared with oral dosing.3 in the postoperative setting , droperidol , as well as the 5-hydroxytryptamine type 3 receptor antagonists , or setrons ( eg , ondansetron ) , have been found to be very effective antiemetics for prevention or treatment of nausea and vomiting.4 however , in 2001 , the us food and drug administration added a black box warning to the package labeling for droperidol regarding its potential proarrhythmic properties leading to qt prolongation.2 as a response to this warning , providers in the united states began to prescribe the setrons more widely due to patient safety issues .
furthermore , in 2006 , generic ondansetron entered the us market , making the drug more widely available to providers and their patients . however , like droperidol , the setrons also possess the ability to block the myocardial kcnh2-encoded herg ( human ether - - go - go related gene ) potassium channel which , in theory , gives droperidol its proarrhythmic properties.5,6 the herg channel mediates the ikr ( rapid component of the delayed rectifier potassium current ) which is essential for phase 3 of repolarization of the cardiac action potential
. inhibition of this current results in prolongation of the duration of the action potential and a prolonged qt interval.5,6 in addition , the setrons block sodium channels , resulting in lengthening of both depolarization and repolarization of the action potential.5 while case reports have been published documenting the proarrhythmic potential of setrons in both adults and children , overall electrocardiographic data have been conflicting.711 presently , only two prospective studies , conducted by the same investigators , have evaluated the effect of ondansetron , droperidol , and a combination of these agents on prolongation of the qt interval corrected for heart rate ( qtc ) at various time points following administration.12,13 in both studies , ondansetron was associated with a statistically significant increase in mean maximal qtc lengthening of about 1720 msec ( p < 0.0001 ) . however , these findings were documented in patients who were either healthy volunteers or postoperative patients without additional risk factors for qtc prolongation .
while these studies meet the criteria for assessing the effect of a drug on ventricular repolarization in humans established by the international conference on harmonization , their results do not always reflect a real world setting where the drug would be used in a patient with cardiovascular disease who may be at greater risk for qtc prolongation.14 regarding patient safety , data generated in this patient population might assist health systems in their decisions to monitor the qtc interval more closely in those receiving setrons .
the aim of this prospective observational study was to assess the effects of ondansetron on the mean qtc interval following the first dose in patients admitted to a coronary intensive care unit or step down unit with cardiovascular disease ( eg , heart failure or acute coronary syndromes plus one additional risk factor for torsades de pointes ) .
study inclusion criteria consisted of admission with a principal diagnosis of either heart failure ( ejection fraction < 40% ) or acute coronary syndromes to the university of colorado hospital , being a patient in the coronary intensive care unit or step down unit between december 21 , 2010 and july 1 , 2011 , having a new medication order for 4 mg intravenous ondansetron , and one of the following risk factors for torsades de pointes in the hospital setting : hypomagnesemia ( < 1.0 meq / l ) for > 24 hours ; hypokalemia ( < 3.2 meq / l ) for > 24 hours ; congenital long qt syndrome ; baseline qtc > 500 msec ; female gender ; heart failure ( ejection fraction < 40% ) ; acute coronary syndromes ; old myocardial infarction ; bradycardia ( 50 beats per minute ) ; or receiving more than one scheduled ( not as needed ) medication with an accepted or possible risk for torsades de pointes as per the education and research at the university of arizona.1,3,15 patients were excluded if they were not placed on telemetry , had used ondansetron as a chronic medication or within the past four months , had already received a dose of ondansetron during their current hospitalization , or required a cardiac pacemaker .
this study was reviewed and granted exempt status by the colorado multiple investigation review board .
patients were prospectively identified by a clinical pharmacist each morning by electronic pharmacy and medical admissions records . as part of hospital procedure ,
each patient admitted to the coronary intensive care unit or step down unit with a primary cardiovascular diagnosis had a baseline 12-lead electrocardiogram on admission conducted on the ward or in the emergency department .
one hundred and twenty minutes after the first dose of slow push intravenous ondansetron , the patient s nurse obtained another 12-lead electrocardiogram .
if the patient was also receiving a qtc - prolonging medication , then the medication could not be given during this 120-minute time period .
this 120-minute measurement interval was chosen because it was the middle of the dosing interval for ondansetron .
the electrocardiographic readings were analyzed and the qtc calculated by a cardiologist who was also blinded to the intent of the study .
qtc prolongation was defined as > 450 msec for men and > 470 msec for women.3 the qt interval was measured by the following protocol .
the anterior electrocardiogram lead in which the t wave had the largest amplitude was selected for qt interval measurement in each subject.3 the qt interval was measured from the onset of the qrs complex to the end of the t wave , which was defined according to the criteria of lepeschkin and surawicz.16 because a notched t wave could represent t - u fusion , according to lepeschkin and surawicz , the intersection of the tangent to the downslope of the major repolarization wave with the isoelectric line was used in the presence of a t - u wave.16 the qt interval was corrected for heart rate according to the formula of bazett ( qtc = qt/r r ) .
results are expressed as the mean standard deviation . to detect a qtc change from baseline greater than 10 msec with and risks of 0.05 and 0.20 , respectively , and assuming a standard deviation of qtc change of 10 msec , a minimum of 10 subjects was needed .
comparison of qtc before and after ondansetron exposure was analyzed using the student s paired t - test .
all analyses were conducted using sas version 9.2 ( sas institute inc , cary , nc ) .
study inclusion criteria consisted of admission with a principal diagnosis of either heart failure ( ejection fraction < 40% ) or acute coronary syndromes to the university of colorado hospital , being a patient in the coronary intensive care unit or step down unit between december 21 , 2010 and july 1 , 2011 , having a new medication order for 4 mg intravenous ondansetron , and one of the following risk factors for torsades de pointes in the hospital setting : hypomagnesemia ( < 1.0 meq / l ) for > 24 hours ; hypokalemia ( < 3.2 meq / l ) for > 24 hours ; congenital long qt syndrome ; baseline qtc > 500 msec ; female gender ; heart failure ( ejection fraction < 40% ) ; acute coronary syndromes ; old myocardial infarction ; bradycardia ( 50 beats per minute ) ; or receiving more than one scheduled ( not as needed ) medication with an accepted or possible risk for torsades de pointes as per the education and research at the university of arizona.1,3,15 patients were excluded if they were not placed on telemetry , had used ondansetron as a chronic medication or within the past four months , had already received a dose of ondansetron during their current hospitalization , or required a cardiac pacemaker .
this study was reviewed and granted exempt status by the colorado multiple investigation review board .
patients were prospectively identified by a clinical pharmacist each morning by electronic pharmacy and medical admissions records . as part of hospital procedure , each patient admitted to the coronary intensive care unit or step down unit with a primary cardiovascular diagnosis had a baseline 12-lead electrocardiogram on admission conducted on the ward or in the emergency department .
one hundred and twenty minutes after the first dose of slow push intravenous ondansetron , the patient s nurse obtained another 12-lead electrocardiogram .
if the patient was also receiving a qtc - prolonging medication , then the medication could not be given during this 120-minute time period .
this 120-minute measurement interval was chosen because it was the middle of the dosing interval for ondansetron .
the electrocardiographic readings were analyzed and the qtc calculated by a cardiologist who was also blinded to the intent of the study .
qtc prolongation was defined as > 450 msec for men and > 470 msec for women.3 the qt interval was measured by the following protocol . the anterior electrocardiogram lead in which the t wave had the largest amplitude
was selected for qt interval measurement in each subject.3 the qt interval was measured from the onset of the qrs complex to the end of the t wave , which was defined according to the criteria of lepeschkin and surawicz.16 because a notched t wave could represent t - u fusion , according to lepeschkin and surawicz , the intersection of the tangent to the downslope of the major repolarization wave with the isoelectric line was used in the presence of a t - u wave.16 the qt interval was corrected for heart rate according to the formula of bazett ( qtc = qt/r r ) .
results are expressed as the mean standard deviation . to detect a qtc change from baseline greater than 10 msec with and risks of 0.05 and 0.20 , respectively , and assuming a standard deviation of qtc change of 10 msec , a minimum of 10 subjects was needed .
comparison of qtc before and after ondansetron exposure was analyzed using the student s paired t - test .
all analyses were conducted using sas version 9.2 ( sas institute inc , cary , nc ) .
data were collected and analyzed for 40 patients ( 16 with a principal diagnosis of heart failure and 24 with a principal diagnosis of acute coronary syndromes ) .
the mean age was 55 years in both the heart failure and acute coronary syndromes groups , with 50% of patients being women . in patients with heart failure , three patients had a baseline qtc that was already prolonged ( range 0.520.57 msec ) as did five patients in the acute coronary syndromes group ( range 0.500.57 msec ) .
the majority of risk factors for qtc prolongation in both groups consisted of receiving at least one medication that could potentially prolong qtc , female gender , and hypokalemia . not including the principal diagnosis as a risk factor
, 56% of patients with heart failure had only one risk factor for qtc prolongation , compared with 33% of patients with acute coronary syndromes .
table 2 lists the concomitant qtc - prolonging medications , their risk for torsades de pointes as per the center for education and research at the university of arizona , the length of time the patient had been receiving the medication prior to ondansetron exposure , and the half - life of the drug .
all qtc - prolonging medications had been initiated prior to hospital admission ( range 3 days to 5 years ) , were scheduled medications and not given as needed , and were at steady - state as per their half - half . as seen in table 3 ,
the mean and median baseline qtc for patients with heart failure were 443 53 msec and 435 msec , respectively , and 444 45 msec and 430 msec , respectively , for patients with acute coronary syndromes .
one hundred and twenty minutes after ondansetron administration , the mean and median baseline qtc for patients with heart failure increased to 466 60 msec and 450 msec , respectively , and to 463 45 msec and 450 msec , respectively , for patients with acute coronary syndromes . the mean difference in time interval between obtaining the baseline electrocardiogram and the second electrocardiogram following ondansetron administration was 3.5 2.14 ( range 0.58 ) hours . compared with baseline ,
the mean change in qtc increased significantly by 20.6 20 msec ( p < 0.0012 ) , 18.3 20 msec ( p < 0.0001 ) , and 19.30 18 msec ( p < 0.0001 ) 120 minutes after ondansetron administration in patients with heart failure , acute coronary syndromes , and the total population , respectively . according to gender - related thresholds ,
five patients ( 31% ) in the heart failure group and 11 patients ( 46% ) in the acute coronary syndromes group met the criteria for prolonged qtc following ondansetron administration .
our data are consistent with those of two previously published studies evaluating the qtc prolongation effect of ondansetron.12,13 in a prospective single - blind study , charbit et al evaluated 85 patients with postoperative nausea and vomiting who were allocated to receive either 0.75 mg droperidol or 4 mg ondansetron intravenously.12 electrocardiographic recordings were obtained before administration and then again at minutes 1 , 2 , 3 , 5 , 10 , and 15 afterwards . according to gender - related thresholds , the incidence of qtc prolongation was 20% and 23% in the ondansetron and droperidol groups , respectively .
the investigators found a significant increase in mean qtc interval during the 15 minutes after antiemetic drug administration in both groups .
the maximal mean qtc interval lengthening was observed at 3 minutes after ondansetron administration , with a mean maximal lengthening of 20 13 msec ( p <
when using the fridericia correction formula , the qtc interval changes were similar to those found by bazett s correction formula . in a subset of eight patients ,
electrocardiograms were repeated up to 3 hours following drug exposure . in both groups , there was a statistically significant reduction in qtc interval when compared with baseline qtc ( p < 0.05 ) . in their second study , charbit et al randomized 16 healthy volunteers to receive either placebo , 1 mg of intravenous droperidol ,
4 mg of intravenous ondansetron , or 1 mg of intravenous droperidol plus 4 mg of intravenous ondansetron in a double - blind crossover design.13 at intervals of one minute for the first 15 minutes and then at minutes 20 , 30 , 45 , 60 , 90 , 120 , 240 , and 600 after the beginning of drug administration , 10-second digital electrocardiograms were recorded . compared with placebo , the mean maximal difference in change in qtc values using the fridericia correction formula
were 25 8 msec and 17 10 msec , and 42 21 msec and 24 12 msec using bazett s qt correction formula after droperidol and ondansetron administration , respectively . when evaluating time , volunteers receiving intravenous ondansetron had qt interval prolongation until minute 4 , and then again at minutes 7 , 8 , and 11 .
in both studies , the investigators concluded that , under controlled conditions , ondansetron induced significantly marked prolongation of the qtc interval.12,13 in our study , using bazett s formula for qt correction , we found that patients with heart failure or acute coronary syndromes with additional risk factors for qt prolongation had significant prolonging of their qtc interval by 20.6 20 msec ( p < 0.0012 ) and 18.3 20 msec ( p < 0.0001 ) , respectively , which was similar to the mean maximal changes in qtc seen in the other two studies.12,13 .
however , in our study , this prolongation was only seen at 120 minutes after administration of ondansetron because we did not measure qtc before or beyond this time period .
we hypothesize that this may be due to the fact that all our patients had underlying heart disease , which is considered to be one of most important nonmodifiable risk factors for qtc prolongation.1,2 cardiac dilatation from long - standing heart failure can result in abnormal automaticity .
anaerobic metabolism in ischemic myocardial tissue following myocardial infarction can raise the resting membrane potential and ultimately lead to an abnormal impulse condition.1,2 additionally , the half - life of ondansetron in healthy volunteers is 5.7 hours , so adequate drug was still available within the central compartment to have a potential impact on myocardial tissue.17 our study has several of the limitations associated with observational data .
however , patients were identified consecutively and enrolled into the study according to inclusion criteria in the order that they were admitted .
secondly , a mean period of 3.5 2.14 hours existed between obtaining a baseline electrocardiogram to the second electrocardiogram following intravenous ondansetron administration , during which patient s symptoms could deteriorate or improve , thereby impacting the qtc interval during that window of time .
third , based on animal models , rapid infusion of qtc - prolonging medications may be more likely to cause arrhythmias than slower infusions.3 however , at our institution , it is hospital policy that ondansetron be administered via slow intravenous push ( eg , over five or more minutes ) .
fourth , we were not able to obtain multiple consecutive electrocardiographic measures because this was considered a patient safety / quality control initiative and could impede nursing work flow in the coronary intensive care unit and step down settings .
fifth , we used bazett s formula for correcting the qtc for varying heart rate . while this is the most commonly used method in clinical practice , it has been shown to overcorrect at short rr intervals and to undercorrect at long rr intervals.1 finally , our data are reflective only of the intravenous formulation of ondansetron , and can not be generalized to oral dosing.3
despite these limitations , the results of our study add to the literature showing that intravenous ondansetron in doses approved by the food and drug administration can significantly prolong the qtc interval . as per the center for education and research at the university of arizona
, ondansetron is a member of the risk category of possible drugs that could prolong the qtc interval , leading to torsades de pointes.15 in patients admitted for either heart failure or acute coronary syndromes with at least one additional risk factor for torsades de pointes , we found that this effect could be seen at least 120 minutes following drug exposure . when considering using ondansetron for long - term administration in the inpatient setting , patients with cardiovascular disease who are at high risk for drug - induced torsades de pointes should at least be monitored via telemetry . from a patient safety perspective
, ondansetron should be added to the clinician s list of drugs that can possibly prolong the qtc interval . | background : the 5-hydroxytryptamine type 3 antagonists , or setrons ( eg , ondansetron ) , are commonly used for nausea and vomiting in the hospital setting . in 2001
, droperidol was given a black box warning because it was found to prolong the qt interval and induce arrhythmias .
the setrons share with droperidol the same potential proarrhythmic mechanisms , but limited data exist concerning their effects on the qt interval in individuals at high risk for torsades de pointes.methods:forty hospitalized patients admitted for heart failure or acute coronary syndromes with one or more risk factors for torsades de pointes and an order for intravenous ondansetron 4 mg were enrolled in this prospective , observational study .
the qt interval corrected for heart rate ( qtc ) was obtained via a 12-lead electrocardiogram on admission and again 120 minutes after the first dose of ondansetron in order to determine the mean change in qtc following ondansetron exposure.results:the mean time interval between obtaining the baseline electrocardiogram and the second electrocardiogram following ondansetron administration was 3.5 2.14 hours . in the total population , the qtc interval was prolonged by 19.3 18 msec ( p < 0.0001 ) 120 minutes after ondansetron administration . for patients with an acute coronary syndrome and those with heart failure , qtc
was prolonged by 18.3 20 msec ( p < 0.0001 ) and 20.6 20 msec ( p < 0.0012 ) , respectively .
following ondansetron exposure , 31% and 46% in the heart failure and acute coronary syndromes groups , respectively , met gender - related thresholds for a prolonged qtc.conclusion:our study found qtc prolongation due to ondansetron administration similar to that found in previous studies . when used in patients with cardiovascular disease ( eg , heart failure or acute coronary syndromes ) with one or more risk factors for torsades de pointes , ondansetron may significantly increase the qtc interval for up to 120 minutes after administration .
from a patient safety perspective , patients who are at high risk for torsades de pointes and receiving ondansetron should be followed via telemetry when admitted to hospital . | Introduction
Methods
Subjects
Study design
Statistical analysis
Results
Discussion
Conclusion |
to successfully generate organotypic cerebellar cultures use mice between p0-p3 or p8-p12 . for our experiment we used mice in the p8-p12 range because this developmental stage was more appropriate for our study .
prepare the dissection and the culture medium : brain dissection and slice preparation are carried out in low sodium artificial cerebrospinal fluid ( acsf ) containing 1 mm calcium chloride , 10 mm d - glucose , 4 mm potassium chloride , 5 mm magnesium chloride , 26 mm sodium bicarbonate , 246 mm sucrose and phenol red solution ( 1:1000 ) , ph 7.3 . to sterilize the solution ,
filter it through a .22 m filter and store at 4 c.cerebellar slices are cultured in 75% minimum essential medium eagle ( mem ) , 25% heat - inactivated horse serum , 25 mm hepes , 1 mm glutamine , 5mg/ ml glucose , penicillin ( 100 u/ ml ) and streptomycin ( 100 u/ ml ) .
filter the medium through a 0.22 m filter and store at 4 c for a maximum of two weeks .
brain dissection and slice preparation are carried out in low sodium artificial cerebrospinal fluid ( acsf ) containing 1 mm calcium chloride , 10 mm d - glucose , 4 mm potassium chloride , 5 mm magnesium chloride , 26 mm sodium bicarbonate , 246 mm sucrose and phenol red solution ( 1:1000 ) , ph 7.3 . to sterilize the solution ,
cerebellar slices are cultured in 75% minimum essential medium eagle ( mem ) , 25% heat - inactivated horse serum , 25 mm hepes , 1 mm glutamine , 5mg/ ml glucose , penicillin ( 100 u/ ml ) and streptomycin ( 100 u/ ml ) .
filter the medium through a 0.22 m filter and store at 4 c for a maximum of two weeks .
dissect brain in ice - cold acsf medium previously bubbled with carbogen ( 95% oxygen and 5% carbon dioxide ) note , that saturation with carbogen will change the ph of the solution so it will shift from red to orange . the dissection should be performed in the minimum amount of time possible being careful not to damage the brain structure .
make a sagittal cut with a razor blade in one hemisphere , trying to cut as little as possible of the cerebellum ; this will provide a flat surface for slicing .
the cortex is used only for support to make the slicing easier but since time is an important issue it is more convenient to cut out the rostral half of the cortex with a razor blade.use cyanoacrylate ( superglue ) to fix the position of the brain on the metal vibratome plate .
it is important to chill the plate on ice before adding the glue and to spread it well using the tip of the tube to form a thin adhesive layer .
if there is an excess of superglue , it will detach from the plate when it comes in contact with the acsf and the sample will be lost.once the brain is attached to the vibratome plate , add enough acsf media to cover the brain and put ice below the plate to keep it cold.cut 400 m slices and transfer them with a plastic pasteur pipette ( cut the tip to widen it and avoid damage to the slices ) to a 6-well cell culture plate containing acsf on ice.separate the cerebellum from the rest of the brain with the help of two insulin syringes ( syringes with small diameter 28-gauge needles ) under the dissecting microscope . some slices will have superglue attached to the edges : this is the moment to try to remove it as it can affect the viability of the slice .
make a sagittal cut with a razor blade in one hemisphere , trying to cut as little as possible of the cerebellum ; this will provide a flat surface for slicing .
the cortex is used only for support to make the slicing easier but since time is an important issue it is more convenient to cut out the rostral half of the cortex with a razor blade .
use cyanoacrylate ( superglue ) to fix the position of the brain on the metal vibratome plate .
it is important to chill the plate on ice before adding the glue and to spread it well using the tip of the tube to form a thin adhesive layer .
if there is an excess of superglue , it will detach from the plate when it comes in contact with the acsf and the sample will be lost .
once the brain is attached to the vibratome plate , add enough acsf media to cover the brain and put ice below the plate to keep it cold .
cut 400 m slices and transfer them with a plastic pasteur pipette ( cut the tip to widen it and avoid damage to the slices ) to a 6-well cell culture plate containing acsf on ice .
separate the cerebellum from the rest of the brain with the help of two insulin syringes ( syringes with small diameter 28-gauge needles ) under the dissecting microscope .
some slices will have superglue attached to the edges : this is the moment to try to remove it as it can affect the viability of the slice .
transfer the cerebellar slices to 6-well plates containing 30 mm culture plate inserts with 0.4 m pores . add 1 ml of culture media per well , that was pre - conditioned by incubation for at least 2 hours at 37c and 5% co2 ( in the cell culture incubator ) .
place the inserts on top of the media making sure there are no air bubbles trapped underneath and then place the cerebellar slices ( 1 - 3 per insert ) on top of the inserts making sure they are fully extended and that no liquid is covering them .
incubate at 37c and 5% co2 changing the culture media every 2 or 3 days .
it is best to replace only a portion of the medium ( e.g. volume ) at once , since used medium contains slice - derived trophic factors that are important for cell survival . for the apoptotic challenge experiment , we first culture the slices for 5 days changing media on day in vitro 3 ( div3 ) .
on div5 cultures are treated with 0.5 g/ ml of the fas agonist antibody jo2 by adding it directly to the media in order to have a clean background of cell death since the changes of media can induce some mortality in the cultures .
to fix the slices , add 1 ml of ice cold 4% pfa beneath and 1 ml above the insert .
next remove the pbs and add 1 ml beneath and 1 ml above the insert of 20% ice - cold methanol in pbs and incubate for 5 minutes at room temperature .
wash again with pbs and add 1 ml beneath and 1 ml above the insert of 0.5% triton - x-100 in pbs for permeabilization .
after permeabilization , block with 20% bsa in pbs for a minimum of 4 hours at room temperature or overnight at 4c . at this stage
the slices can be kept in blocking solution for at least 3 days at 4c . in order to stain the slices
carefully cut the piece of the membrane insert attached to the cerebellar slice and transfer it to 24-well plates containing pbs .
the immunostaining is done sequentially , first with tunel reagent for one hour and then with calbidin antibody overnight .
aspirate the pbs and add 250 l off tunel reagent into each well making sure it covers the entire surface of the slice .
incubate at 37c for one hour in the dark.after one hour remove the tunel mix and wash with pbs three times for 10 minutes.after the last wash , remove the pbs and add 250 l of a 1/1000 dilution of the calbindin antibody in pbs and incubate overnight at 4c in the dark.remove the primary antibody solution and wash with pbs three times for 10 minutes.add 250 l of secondary antibody diluted 1/500 in pbs and incubate for at least three hours at room temperature in the dark .
the tunel kit we used is labeled with tmr red , therefore our secondary antibody for calbindin is conjugated to alexa-488.wash three times for 10 minutes with pbs and mount the slices onto a glass microscope slide using a mounting media that contains dapi.image the slices with a confocal microscope using the 488 nm and 561 nm excitation wavelenght for calbindin and tunel respectively .
aspirate the pbs and add 250 l off tunel reagent into each well making sure it covers the entire surface of the slice .
after one hour remove the tunel mix and wash with pbs three times for 10 minutes .
after the last wash , remove the pbs and add 250 l of a 1/1000 dilution of the calbindin antibody in pbs and incubate overnight at 4c in the dark .
add 250 l of secondary antibody diluted 1/500 in pbs and incubate for at least three hours at room temperature in the dark .
the tunel kit we used is labeled with tmr red , therefore our secondary antibody for calbindin is conjugated to alexa-488 .
wash three times for 10 minutes with pbs and mount the slices onto a glass microscope slide using a mounting media that contains dapi .
image the slices with a confocal microscope using the 488 nm and 561 nm excitation wavelenght for calbindin and tunel respectively
. the main challenge of this protocol is to be able to generate healthy cerebellar slice cultures , especially since our final readout will be cell death .
a healthy culture appears as one where the cell body layer is translucent and allows you to see the foliated structure of the cerebellum under the microscope ( figure 1 ) .
after few days in culture the slices start to thin and non - neuronal cells can be observed migrating away from the margins of the slice .
the dark round cells ( most likely macrophages ) that cover the slices after few days in culture , will eventually decrease in number after 10 - 14 days in vitro ( figure 2 ) .
the ultimate proof for the viability of the slices is to stain for different cellular markers , such as calbindin for the purkinje cells .
figure 3 shows a representative confocal microscope image of the purkinje cell layer with several tunel positive nuclei .
it is important to consider that even if some slices received an apoptotic stimulus , they were only exposed for 24 hours . this allowed sufficient time to observe dna fragmentation in the dying cells with the tunel staining , but a defined purkinje cell layer was still present .
this image shows the translucent cell body layer and the foliated cerebellar structure in a healthy slice .
we can still observe the foliated structure of the cerebellum and the appearance of dark cell bodies .
this confocal image shows the purkinje cells stained with calbindin ( green ) and the apoptotic cells positive for tunel staining ( red ) .
purkinje cells do not appear in a single row but are clustered forming a folium - like structure .
to successfully generate organotypic cerebellar cultures use mice between p0-p3 or p8-p12 . for our experiment we used mice in the p8-p12 range because this developmental stage was more appropriate for our study .
prepare the dissection and the culture medium : brain dissection and slice preparation are carried out in low sodium artificial cerebrospinal fluid ( acsf ) containing 1 mm calcium chloride , 10 mm d - glucose , 4 mm potassium chloride , 5 mm magnesium chloride , 26 mm sodium bicarbonate , 246 mm sucrose and phenol red solution ( 1:1000 ) , ph 7.3 . to sterilize the solution ,
filter it through a .22 m filter and store at 4 c.cerebellar slices are cultured in 75% minimum essential medium eagle ( mem ) , 25% heat - inactivated horse serum , 25 mm hepes , 1 mm glutamine , 5mg/ ml glucose , penicillin ( 100 u/ ml ) and streptomycin ( 100 u/ ml ) .
filter the medium through a 0.22 m filter and store at 4 c for a maximum of two weeks .
brain dissection and slice preparation are carried out in low sodium artificial cerebrospinal fluid ( acsf ) containing 1 mm calcium chloride , 10 mm d - glucose , 4 mm potassium chloride , 5 mm magnesium chloride , 26 mm sodium bicarbonate , 246 mm sucrose and phenol red solution ( 1:1000 ) , ph 7.3 . to sterilize the solution ,
cerebellar slices are cultured in 75% minimum essential medium eagle ( mem ) , 25% heat - inactivated horse serum , 25 mm hepes , 1 mm glutamine , 5mg/ ml glucose , penicillin ( 100 u/ ml ) and streptomycin ( 100 u/ ml ) .
filter the medium through a 0.22 m filter and store at 4 c for a maximum of two weeks .
dissect brain in ice - cold acsf medium previously bubbled with carbogen ( 95% oxygen and 5% carbon dioxide ) note , that saturation with carbogen will change the ph of the solution so it will shift from red to orange . the dissection should be performed in the minimum amount of time possible being careful not to damage the brain structure .
make a sagittal cut with a razor blade in one hemisphere , trying to cut as little as possible of the cerebellum ; this will provide a flat surface for slicing .
the cortex is used only for support to make the slicing easier but since time is an important issue it is more convenient to cut out the rostral half of the cortex with a razor blade.use cyanoacrylate ( superglue ) to fix the position of the brain on the metal vibratome plate .
it is important to chill the plate on ice before adding the glue and to spread it well using the tip of the tube to form a thin adhesive layer .
if there is an excess of superglue , it will detach from the plate when it comes in contact with the acsf and the sample will be lost.once the brain is attached to the vibratome plate , add enough acsf media to cover the brain and put ice below the plate to keep it cold.cut 400 m slices and transfer them with a plastic pasteur pipette ( cut the tip to widen it and avoid damage to the slices ) to a 6-well cell culture plate containing acsf on ice.separate the cerebellum from the rest of the brain with the help of two insulin syringes ( syringes with small diameter 28-gauge needles ) under the dissecting microscope . some slices will have superglue attached to the edges : this is the moment to try to remove it as it can affect the viability of the slice .
make a sagittal cut with a razor blade in one hemisphere , trying to cut as little as possible of the cerebellum ; this will provide a flat surface for slicing .
the cortex is used only for support to make the slicing easier but since time is an important issue it is more convenient to cut out the rostral half of the cortex with a razor blade .
use cyanoacrylate ( superglue ) to fix the position of the brain on the metal vibratome plate .
it is important to chill the plate on ice before adding the glue and to spread it well using the tip of the tube to form a thin adhesive layer .
if there is an excess of superglue , it will detach from the plate when it comes in contact with the acsf and the sample will be lost .
once the brain is attached to the vibratome plate , add enough acsf media to cover the brain and put ice below the plate to keep it cold .
cut 400 m slices and transfer them with a plastic pasteur pipette ( cut the tip to widen it and avoid damage to the slices ) to a 6-well cell culture plate containing acsf on ice .
separate the cerebellum from the rest of the brain with the help of two insulin syringes ( syringes with small diameter 28-gauge needles ) under the dissecting microscope .
some slices will have superglue attached to the edges : this is the moment to try to remove it as it can affect the viability of the slice .
transfer the cerebellar slices to 6-well plates containing 30 mm culture plate inserts with 0.4 m pores . add 1 ml of culture media per well , that was pre - conditioned by incubation for at least 2 hours at 37c and 5% co2 ( in the cell culture incubator ) .
place the inserts on top of the media making sure there are no air bubbles trapped underneath and then place the cerebellar slices ( 1 - 3 per insert ) on top of the inserts making sure they are fully extended and that no liquid is covering them .
incubate at 37c and 5% co2 changing the culture media every 2 or 3 days .
it is best to replace only a portion of the medium ( e.g. volume ) at once , since used medium contains slice - derived trophic factors that are important for cell survival .
for the apoptotic challenge experiment , we first culture the slices for 5 days changing media on day in vitro 3 ( div3 ) . on div5 cultures are treated with 0.5 g/ ml of the fas agonist antibody jo2 by adding it directly to the media in order to have a clean background of cell death since the changes of media can induce some mortality in the cultures .
to fix the slices , add 1 ml of ice cold 4% pfa beneath and 1 ml above the insert .
next remove the pbs and add 1 ml beneath and 1 ml above the insert of 20% ice - cold methanol in pbs and incubate for 5 minutes at room temperature .
wash again with pbs and add 1 ml beneath and 1 ml above the insert of 0.5% triton - x-100 in pbs for permeabilization .
after permeabilization , block with 20% bsa in pbs for a minimum of 4 hours at room temperature or overnight at 4c . at this stage
the slices can be kept in blocking solution for at least 3 days at 4c . in order to stain the slices
carefully cut the piece of the membrane insert attached to the cerebellar slice and transfer it to 24-well plates containing pbs .
the immunostaining is done sequentially , first with tunel reagent for one hour and then with calbidin antibody overnight .
aspirate the pbs and add 250 l off tunel reagent into each well making sure it covers the entire surface of the slice .
incubate at 37c for one hour in the dark.after one hour remove the tunel mix and wash with pbs three times for 10 minutes.after the last wash , remove the pbs and add 250 l of a 1/1000 dilution of the calbindin antibody in pbs and incubate overnight at 4c in the dark.remove the primary antibody solution and wash with pbs three times for 10 minutes.add 250 l of secondary antibody diluted 1/500 in pbs and incubate for at least three hours at room temperature in the dark .
the tunel kit we used is labeled with tmr red , therefore our secondary antibody for calbindin is conjugated to alexa-488.wash three times for 10 minutes with pbs and mount the slices onto a glass microscope slide using a mounting media that contains dapi.image the slices with a confocal microscope using the 488 nm and 561 nm excitation wavelenght for calbindin and tunel respectively .
aspirate the pbs and add 250 l off tunel reagent into each well making sure it covers the entire surface of the slice .
after one hour remove the tunel mix and wash with pbs three times for 10 minutes .
after the last wash , remove the pbs and add 250 l of a 1/1000 dilution of the calbindin antibody in pbs and incubate overnight at 4c in the dark .
add 250 l of secondary antibody diluted 1/500 in pbs and incubate for at least three hours at room temperature in the dark .
the tunel kit we used is labeled with tmr red , therefore our secondary antibody for calbindin is conjugated to alexa-488 .
wash three times for 10 minutes with pbs and mount the slices onto a glass microscope slide using a mounting media that contains dapi .
image the slices with a confocal microscope using the 488 nm and 561 nm excitation wavelenght for calbindin and tunel respectively .
the main challenge of this protocol is to be able to generate healthy cerebellar slice cultures , especially since our final readout will be cell death .
a healthy culture appears as one where the cell body layer is translucent and allows you to see the foliated structure of the cerebellum under the microscope ( figure 1 ) .
after few days in culture the slices start to thin and non - neuronal cells can be observed migrating away from the margins of the slice .
the dark round cells ( most likely macrophages ) that cover the slices after few days in culture , will eventually decrease in number after 10 - 14 days in vitro ( figure 2 ) .
the ultimate proof for the viability of the slices is to stain for different cellular markers , such as calbindin for the purkinje cells .
figure 3 shows a representative confocal microscope image of the purkinje cell layer with several tunel positive nuclei .
it is important to consider that even if some slices received an apoptotic stimulus , they were only exposed for 24 hours . this allowed sufficient time to observe dna fragmentation in the dying cells with the tunel staining , but a defined purkinje cell layer was still present .
this image shows the translucent cell body layer and the foliated cerebellar structure in a healthy slice .
we can still observe the foliated structure of the cerebellum and the appearance of dark cell bodies .
this confocal image shows the purkinje cells stained with calbindin ( green ) and the apoptotic cells positive for tunel staining ( red ) .
purkinje cells do not appear in a single row but are clustered forming a folium - like structure .
this method describes one of the many possible applications of neuronal organotypic cultures and it has allowed us to study the effect of apoptotic stimuli in wild type and mutant cerebellar slices .
the most critical part of this experiment is to be able to consistently generate healthy cerebellar slice cultures .
the key factors are dissection and slicing technique and the ability to perform the protocol in the least time possible , but at the same time being careful not to damage the slices .
another crucial factor is the preparation and composition of the culture media , these cultures are very sensitive , so we had to test several recipes and brands of media .
even different batches of serum or any other components of the media could affect the viability of the slices .
once the cerebellar slices are generated one can study cerebellar development , electrophysiology , cell survival alone or in response to apoptotic stimuli , excitotoxicity or oxygen deprivation .
comparative studies using wild type and mutant cerebellar slices have been very insightful in many aspects of cerebellar function and development . | organotypic cultures of neuronal tissue were first introduced by hogue in 1947 1,2 and have constituted a major breakthrough in the field of neuroscience . since then , the technique was developed further and currently there are many different ways to prepare organotypic cultures .
the method presented here was adapted from the one described by stoppini et al . for the preparation of the slices and from gogolla et al . for the staining procedure 3,4.a unique feature of this technique
is that it allows you to study different parts of the brain such as hippocampus or cerebellum in their original structure , providing a big advantage over dissociated cultures in which all the cellular organization and neuronal networks are disrupted . in the case of the cerebellum
it is even more advantageous because it allows the study of purkinje cells , extremely difficult to obtain as dissociated primary culture .
this method can be used to study certain developmental features of the cerebellum in vitro , as well as for electrophysiological and pharmacological experiments in both wild type and mutant mice.the method described here was designed to study the effect of apoptotic stimuli such as fas ligand in the developing cerebellum , using tunel staining to measure apoptotic cell death .
if tunel staining is combined with cell type specific markers , such as calbindin for purkinje cells , it is possible to evaluate cell death in a cell population specific manner .
the calbindin staining also serves the purpose of evaluating the quality of the cerebellar cultures . | Protocol
1. Organotypic Cerebellar Cultures:
2. Fas Treatment and Staining of Cerebellar Slices:
3. Representative Results:
Discussion
Disclosures |
the development of new agents targeting important cellular pathways involved in cancer progression , although promising , has so far resulted in relatively short - term benefits for the majority of patients with advanced malignancy .
cell therapy can be numbered among the novel biologic therapeutics that will increase our ability to cure human disease in the years to come . despite the great potential ,
t cell therapy for cancer still has a marginal role in the management of patients with neoplasia .
this is due to limitations inherent to the technologies and products employed , and , more importantly , to the financial and structural requirements that are associated with cell therapy 1 - 3 .
clinical application was first attempted by rosenberg and colleagues in 1985 by using lak cells , infused with il-2 into patients with different advanced malignancies 4 : response was observed in four kinds of solid tumors , thus paving the way to further investigations . afterwards , several experimental and clinical studies were conducted : cell types tested included cik cells 5 , tumor infiltrating lymphocytes ( tils ) 6,7,8 and other t - cells variously manipulated 1,3,9 - 11 , which were used in different settings , from solid cancers to the transplantation field . among the factors that so far limited a wider use of t cell therapy for human tumors
may be the very low frequency of tumor - specific lymphocytes circulating in patients with cancer , or the limited ability to induce t cell lines with protective antitumor activity with current knowledge and available technology . with the exception of til therapy in melanoma ,
the only other human solid cancer setting in which tumor - specific t cells have been employed with success is virus - related tumors . indeed ,
when the frequency of circulating t cells against the target antigen on a tumour is high , as is the case for viral antigens , t cell therapy can be very effective in destroying large tumours in humans . in this context
, ebv - positive malignancies provide an optimal model system to test and ameliorate cellular therapies : the first very encouraging results were reached with prophylaxis and treatment of posttransplant lymphoproliferative disease 9 - 11 ; the success of this approach has fostered research in other , more complex areas , such as ebv - related solid tumors .
nasopharyngeal carcinoma ( npc ) is a rare cancer in the western hemisphere where its incidence is approximately 1 case per 100,000 individuals ; conversely there are some areas , such as southern china , southeast asia , the mediterranean basin and alaska , where it reaches 80 per 100,000 individuals : moreover in the western hemisphere the tumor histology differs from the endemic form 12 .
all these differences suggest that an important role in the pathogenesis is played by genetic and environmental factors .
the current who classification defines nasopharyngeal cancer a carcinoma that shows light microscopic or ultrastructural evidence of squamous differentiation .
it encompasses squamous cell carcinoma , associated with behavioural risk factors such as alcohol and tobacco use , non keratinizing carcinoma ( differentiated and undifferentiated ) and basaloid squamous cell carcinoma 13 .
the most common pediatric nasopharyngeal carcinoma is the non - keratinizing undifferentiated carcinoma 14 and is associated with ebv in practically 100% of cases 13 . although npc is serologically and biologically associated with epstein - barr virus , npc cells express only a limited pattern of ebv genes ( the so - called latency ii pattern ) which comprises non - coding rnas ( ebers , barts ) , the nuclear antigen ebna1 and surface antigens lmp1 and lmp2 15 , immunogens that are weak , albeit capable of inducing a t - lymphocyte response . in most cases
the tumor presents as a painless mass in the upper neck , with possible cervical lymphadenopathy .
the most common pattern of tumor diffusion is local infiltration which , given the limitrophe structures , may cause serous otitis , hearing difficulties , nasal obstruction , epistaxis , dysphasia , dysphonia and dysphagia .
npc can metastatize to lung , bone , mediastinum , bone marrow and visceral organs 13,16,17 .
paraneoplastic syndromes may also be present , in most cases related to tumor dissemination or relapse , such as hypertrophic osteoarthropathy , leukemoid reaction , fuo , dermatomyositis , and inappropriate adh secretion syndrome 18 .
the extent of the tumor at diagnosis is described by the tnm classification of the american joint committee on cancer ; in children , as in adults , the tnm stage at the time of diagnosis correlates with outcome 19 .
however , with more advanced and improved treatments , while the presence of metastases continues to be associated with poor outcome , t and n staging are losing prognostic significance 20 , 21 .
radiotherapy is a cornerstone of first line therapy and it is the standard treatment for early - stage npc ( t1 - 2a ; n0 ; m0 ) : patients with local disease can be adequately treated with radiation alone , with a 5-years control ranging from 80 to 95% of cases 22 - 25 .
treatment strategies for locally advanced npc consists mainly of platinum based chemotherapy in conjunction with radiotherapy , and yields an overall response rate of about 90% , with complete response ranging from 20 to 50% 26 - 28 .
induction treatment is able to improve local regional control , which translates into long - term specific survival benefits . in local - regional recurrent nasopharyngeal cancer
not amenable for reirradiation , combination cisplatin - based chemotherapy is a standard first line treatment , with response rates of 40 - 80% , mainly depending on the site of lesions , previous treatment , disease free interval 28,29 .
no standard second - line chemotherapy has been defined , but a recent study reported an 11% response rate in recurrent and metastatic disease by combining target therapy ( cetuximab ) to carboplatin 30 .
second line therapies in refractory / relapsing patients usually have little effect on the natural history of the disease , and there is therefore a need to develop additional forms of treatment , particularly ones that lack overlapping toxicities with radiochemotherapy 31,32 .
in the last 15 years , a number of reports demonstrated the effectiveness of atct directed against ebv antigens for the treatment of ebv - related hematological malignancies in the immunocompromised host 3,9 - 11,33 .
ebv - related posttransplant lymphoproliferative disease ( ptld ) constitutes a highly immunogenic lymphoproliferation whose onset is greatly favoured by the host immunodeficiency status .
thus , t cell therapy in this setting is expected to have a great chance of success .
adoptive transfer of polyclonal ctls specific for viral latency antigens in the context of ebv - associated malignancies arising in the immunocompetent host , such as nasopharyngeal carcinoma ( npc ) , is hampered by a number of factors 34 .
ebv - specific ctls are dominated by reactivity against viral proteins not expressed by these tumors .
moreover , the transferred ctls have to compete with endogenous lymphocytes for cytokines and biological niches , and , once ctls reach the tumor site , they have to overcome the inhibitory barriers exerted by the tumor environment .
notwithstanding these limitations , the results of the clinical cell therapy trials conducted so far in npc patients demonstrate that administration of an avid anti - tumour t cell targeting a highly expressed antigen can result in cancer regression 35,36 . to date , a total of 57 patients with npc were treated within phase i - ii clinical trials 35 - 41 . in a phase i study , comoli et al .
35 enrolled 10 patients with stage iv npc in progression after conventional radiotherapy and chemotherapy .
patients underwent multiple ( from 2 to 23 ) infusions of autologous ebv - specific ctls with a dose ranging from 2 to 8x10 cells /m , accompanied by administration of low - dose ( 1x10u ) recombinant il-2 with the purpose of prolonging t - lymphocyte life - span .
there were no major adverse events , although two patients suffered from moderate inflammatory reactions at the tumor site .
control of disease progression was obtained in six of ten patients ( two with partial response and four with stable disease ) .
more importantly , it was demonstrated that tumor control related to cell therapy did occur , and was associated to the emergence or increase in lmp2-specific responses in the peripheral blood . in the same year , straathof and colleagues 36 published data from 10 patients with advanced npc . in a recent update 37
louis added 13 new patients to the previous 10 ( whose follow - up was extended ) , for a total of 23 patients treated . of these patients ( all but one with stage iii - iv npc ) eight were in disease remission at the time of the first infusion and 15 had active disease
they were treated with a mean of 2 infusions with a dose ranging from 2x10 cells / m to 2x10 cells /m
the therapy was well tolerated : only one patient experienced marked swelling at the tumor site requiring a tracheostomy .
of the eight patients treated in remission five remained disease - free for 25 to 82 months and three suffered from disease relapse . of the other 15 patients treated with active disease ten showed control of the disease ( 5 with complete response , 2 with partial response , 3 with stable disease ) , while the other five progressed .
prior to these two studies , one pilot study in china showed that the adoptive transfer of autologous ebv - targeted ctls induced antiviral responses but no clinical responses in 4 npc patients 40 , while adoptive transfer of allogeneic ebv - specific ctl induced a clinical response in a patient with advanced - stage npc , likely associated to a boost in endogenous lmp2-specific response 41 .
the data obtained with these early studies prompted further efforts aimed at enhancing the expansion potential of infused t - cells , by means of a lymphodepleting treatment prior to ctl infusion , as demonstrated in the context of t - cell therapy for melanoma 42,43 . in a pilot study , 8 patients with loco - regional or metastatic refractory / recurrent npc were given anti - cd45 monoclonal antibody treatment , followed by escalating doses of polyclonal ebv - specific ctl .
after transitory lymphodepletion , and increase in the circulating levels of il-15 , 3 objective responses were seen , in the patients who showed higher increase in their peripheral blood frequency of ebv - specific t cells after ctl infusion 38 .
secondino and colleagues 39 enrolled 11 heavily pre - treated patients with active stage iv npc , who received non - myeloablative lymphodepleting chemotherapy consisting of cyclophosphamide and fludarabine : two doses of autologous ebv - specific ctls ( median dose of 3.7x10cells ) were subsequently infused , two weeks apart , supported by low - dose il-2 .
control of disease was obtained in six of eleven patients ( 3 with stable disease , 2 with partial response and one with minor response ) .
two patients experienced mild to moderate swelling at the disease site . notwithstanding the encouraging preliminary results ,
the use of lymphodepleting preparative regimens as a mean to overcome the inhibitory checkpoints devised by the tumor cells is a strategy that needs further optimization .
to summarize , data collected from a total of 57 patients receiving polyclonal , ebv - polyspecific ctl were as follows : of 30 patients with advanced , active npc , treated with autologous or allogeneic , polyclonal ebv - specific ctl infusions , 17 ( 56% ) achieved control of the disease ( defined as either tumor regression or disease stabilization)of 19 patients with advanced , active npc , treated with autologous , polyclonal ebv - specific ctl infusions preceded by a lymphodepleting regimen 9 ( 47% ) achieved control of the diseaseof 8 patients treated in disease remission , although at great risk of relapse , at the time of the first infusion , 5 ( 62% ) remained disease - free for 25 to 82 months and 3 suffered from relapsing disease of 30 patients with advanced , active npc , treated with autologous or allogeneic , polyclonal ebv - specific ctl infusions , 17 ( 56% ) achieved control of the disease ( defined as either tumor regression or disease stabilization ) of 19 patients with advanced , active npc , treated with autologous , polyclonal ebv - specific ctl infusions preceded by a lymphodepleting regimen 9 ( 47% ) achieved control of the disease of 8 patients treated in disease remission , although at great risk of relapse , at the time of the first infusion , 5 ( 62% ) remained disease - free for 25 to 82 months and 3 suffered from relapsing disease t cell therapy , although now frequently used in the hematopoietic transplantation setting , has not yet been widely introduced in the clinical oncologic field and is currently limited to research protocols in highly - specialized centres . for solid tumors , the majority of the literature available nowadays refers to treatment of melanoma 42 .
the phase i - ii studies of ebv - targeted t cell therapy for npc , taken together , provide one of the larger series for non - melanoma solid malignancies .
these studies provide new perspectives on the optimal treatment for metastatic or recurrent disease ; indeed , to date , cisplatin - based chemotherapy is considered the preferred regimen for such patients : response rates are above 50% and median survival is approximately 12 months 26 .
however , the choice for second - line regimens in patients with unsatisfactory responses to a platinum - based treatment remains unclear 32 .
in the cell therapy trials described , the patients enrolled were a heavily pre - treated cohort with a very poor prognosis .
in these patients , further conventional treatment would likely lead to a very high risk of toxicity , ranging from 26% after re - irradiation with high dose radiotherapy 44 to 89% after conventional cytotoxic protocols 45 . in the cohort treated with ctls , there were only five out of 52 patients ( less than 10% ) who suffered from swelling at the tumor site ; of these , four had mild to moderate inflammatory reactions 35 , 39 and only one had a major complication 36 .
in particular this patient , who presented bulky disease and pre - existing facial swelling , two days after the first infusion , developed marked worsening of the tumefaction requiring a tracheostomy : the authors performed a needle biopsy which showed tumor cells , but not inflammatory cells , suggesting tumor progression rather than an inflammatory reaction .
thus the safety and the feasibility of this approach , even at the highest doses reached , is more than a supposition . the second point to take into consideration
is the efficacy of this therapy : taken grossly together all these data show a response rate ranging from 47 to 64% , thus perfectly in line with other types of second- , third- or more advanced therapy 32 . for the patients treated in remission ,
given the small size of the cohort , the role of infused ctls remains unclear .
but , more importantly , these data raise a number of questions , which remains , to date , unresolved .
first of all , what is the role and the best timing of adoptive t - cell therapy in npc ?
the studies published to date indicate that ctls could possibly be administered earlier the course of treatment and in combination with conventional therapies ( for example as consolidation treatment after achieving response to second line therapy ) 39 .
furthermore , immune escape can occur even in instances when polyclonal antigen - specific t cells are infused 46 : gottschalk et al reported a patient with ebv - positive lymphoproliferative disease , who failed ebv - specific t - cell therapy , in which the tumor virus had deleted immunodominant ebv epitopes 47 .
a strategy to overcome this phenomenon , and to increase clinical efficacy through better targeting , could be to ameliorate the quality of the cell product .
in this perspective , efforts are being made towards augmenting the pool of t - cells specific for the subdominant antigens expressed on ebv latency ii tumor cells within the infused product , with the aim of increasing t cell therapy efficacy . in detail , the subdominant component of the ebv - specific immune response directed towards latent membrane proteins lmp1 and lmp2 has been shown to expand , by stimulation with dendritic cells or ebv - lcl genetically modified to express the antigens 48 - 50 . in a pilot study enrolling ebv - positive hodgkin or non - hodgkin lymphoma , 5 of 6 patients with active relapsed disease showed a tumor response after infusion of autologous lmp2-specific ctl 51 .
a barrier to the function of infused ebv - specific ctls in immunocompetent hosts is the display of tumor - mediated immune evasion strategies 52 . to improve the resistance of ctls to tumor - derived inhibitory cytokines , bollard et al .
have shown that ebv - specific ctl made transgenic for a dominant - negative tgf- receptor , in which the intracellular signaling domain is truncated , are rendered resistant to the devastating effects of tgf- , secreted by hodgkin tumor cells 53 .
likewise , treatment failure due to lack or loss of ebv antigen expression by neoplastic cell subpopulations may be avoided through redirecting ebv - specific ctls to target other tumor antigens .
it has been shown that ebv - specific ctls expressing a chimeric antigen receptor ( car ) specific for cd30 , a molecule highly and consistently expressed on malignant hodgkin reed - sternberg cells , while retaining their original specificity , are also able to target cd30 + neoplastic cells , and mediate activity against ebv-/cd30 + tumors in a xenograft model 54 .
in the last 15 years , a number of reports demonstrated the effectiveness of atct directed against ebv antigens for the treatment of ebv - related hematological malignancies in the immunocompromised host 3,9 - 11,33 .
ebv - related posttransplant lymphoproliferative disease ( ptld ) constitutes a highly immunogenic lymphoproliferation whose onset is greatly favoured by the host immunodeficiency status .
thus , t cell therapy in this setting is expected to have a great chance of success .
adoptive transfer of polyclonal ctls specific for viral latency antigens in the context of ebv - associated malignancies arising in the immunocompetent host , such as nasopharyngeal carcinoma ( npc ) , is hampered by a number of factors 34 .
ebv - specific ctls are dominated by reactivity against viral proteins not expressed by these tumors .
moreover , the transferred ctls have to compete with endogenous lymphocytes for cytokines and biological niches , and , once ctls reach the tumor site , they have to overcome the inhibitory barriers exerted by the tumor environment .
notwithstanding these limitations , the results of the clinical cell therapy trials conducted so far in npc patients demonstrate that administration of an avid anti - tumour t cell targeting a highly expressed antigen can result in cancer regression 35,36 . to date , a total of 57 patients with npc were treated within phase i - ii clinical trials 35 - 41 . in a phase i study , comoli et al .
35 enrolled 10 patients with stage iv npc in progression after conventional radiotherapy and chemotherapy .
patients underwent multiple ( from 2 to 23 ) infusions of autologous ebv - specific ctls with a dose ranging from 2 to 8x10 cells /m , accompanied by administration of low - dose ( 1x10u ) recombinant il-2 with the purpose of prolonging t - lymphocyte life - span .
there were no major adverse events , although two patients suffered from moderate inflammatory reactions at the tumor site .
control of disease progression was obtained in six of ten patients ( two with partial response and four with stable disease ) .
more importantly , it was demonstrated that tumor control related to cell therapy did occur , and was associated to the emergence or increase in lmp2-specific responses in the peripheral blood . in the same year , straathof and colleagues 36 published data from 10 patients with advanced npc . in a recent update 37
louis added 13 new patients to the previous 10 ( whose follow - up was extended ) , for a total of 23 patients treated . of these patients ( all but one with stage iii - iv npc ) eight were in disease remission at the time of the first infusion and 15 had active disease
they were treated with a mean of 2 infusions with a dose ranging from 2x10 cells / m to 2x10 cells /m
the therapy was well tolerated : only one patient experienced marked swelling at the tumor site requiring a tracheostomy .
of the eight patients treated in remission five remained disease - free for 25 to 82 months and three suffered from disease relapse . of the other 15 patients treated with active disease ten showed control of the disease ( 5 with complete response , 2 with partial response , 3 with stable disease ) , while the other five progressed .
prior to these two studies , one pilot study in china showed that the adoptive transfer of autologous ebv - targeted ctls induced antiviral responses but no clinical responses in 4 npc patients 40 , while adoptive transfer of allogeneic ebv - specific ctl induced a clinical response in a patient with advanced - stage npc , likely associated to a boost in endogenous lmp2-specific response 41 .
the data obtained with these early studies prompted further efforts aimed at enhancing the expansion potential of infused t - cells , by means of a lymphodepleting treatment prior to ctl infusion , as demonstrated in the context of t - cell therapy for melanoma 42,43 . in a pilot study , 8 patients with loco - regional or metastatic refractory / recurrent npc were given anti - cd45 monoclonal antibody treatment , followed by escalating doses of polyclonal ebv - specific ctl .
after transitory lymphodepletion , and increase in the circulating levels of il-15 , 3 objective responses were seen , in the patients who showed higher increase in their peripheral blood frequency of ebv - specific t cells after ctl infusion 38 .
secondino and colleagues 39 enrolled 11 heavily pre - treated patients with active stage iv npc , who received non - myeloablative lymphodepleting chemotherapy consisting of cyclophosphamide and fludarabine : two doses of autologous ebv - specific ctls ( median dose of 3.7x10cells ) were subsequently infused , two weeks apart , supported by low - dose il-2 .
control of disease was obtained in six of eleven patients ( 3 with stable disease , 2 with partial response and one with minor response ) .
two patients experienced mild to moderate swelling at the disease site . notwithstanding the encouraging preliminary results ,
the use of lymphodepleting preparative regimens as a mean to overcome the inhibitory checkpoints devised by the tumor cells is a strategy that needs further optimization .
to summarize , data collected from a total of 57 patients receiving polyclonal , ebv - polyspecific ctl were as follows : of 30 patients with advanced , active npc , treated with autologous or allogeneic , polyclonal ebv - specific ctl infusions , 17 ( 56% ) achieved control of the disease ( defined as either tumor regression or disease stabilization)of 19 patients with advanced , active npc , treated with autologous , polyclonal ebv - specific ctl infusions preceded by a lymphodepleting regimen 9 ( 47% ) achieved control of the diseaseof 8 patients treated in disease remission , although at great risk of relapse , at the time of the first infusion , 5 ( 62% ) remained disease - free for 25 to 82 months and 3 suffered from relapsing disease of 30 patients with advanced , active npc , treated with autologous or allogeneic , polyclonal ebv - specific ctl infusions , 17 ( 56% ) achieved control of the disease ( defined as either tumor regression or disease stabilization ) of 19 patients with advanced , active npc , treated with autologous , polyclonal ebv - specific ctl infusions preceded by a lymphodepleting regimen 9 ( 47% ) achieved control of the disease of 8 patients treated in disease remission , although at great risk of relapse , at the time of the first infusion , 5 ( 62% ) remained disease - free for 25 to 82 months and 3 suffered from relapsing disease
t cell therapy , although now frequently used in the hematopoietic transplantation setting , has not yet been widely introduced in the clinical oncologic field and is currently limited to research protocols in highly - specialized centres . for solid tumors , the majority of the literature available nowadays refers to treatment of melanoma 42 .
the phase i - ii studies of ebv - targeted t cell therapy for npc , taken together , provide one of the larger series for non - melanoma solid malignancies .
these studies provide new perspectives on the optimal treatment for metastatic or recurrent disease ; indeed , to date , cisplatin - based chemotherapy is considered the preferred regimen for such patients : response rates are above 50% and median survival is approximately 12 months 26 .
however , the choice for second - line regimens in patients with unsatisfactory responses to a platinum - based treatment remains unclear 32 .
in the cell therapy trials described , the patients enrolled were a heavily pre - treated cohort with a very poor prognosis . in these patients , further conventional treatment would likely lead to a very high risk of toxicity , ranging from 26% after re - irradiation with high dose radiotherapy 44 to 89% after conventional cytotoxic protocols 45 . in the cohort treated with ctls
, there were only five out of 52 patients ( less than 10% ) who suffered from swelling at the tumor site ; of these , four had mild to moderate inflammatory reactions 35 , 39 and only one had a major complication 36 .
in particular this patient , who presented bulky disease and pre - existing facial swelling , two days after the first infusion , developed marked worsening of the tumefaction requiring a tracheostomy : the authors performed a needle biopsy which showed tumor cells , but not inflammatory cells , suggesting tumor progression rather than an inflammatory reaction .
thus the safety and the feasibility of this approach , even at the highest doses reached , is more than a supposition . the second point to take into consideration is the efficacy of this therapy : taken grossly together all these data show a response rate ranging from 47 to 64% , thus perfectly in line with other types of second- , third- or more advanced therapy 32 . for the patients treated in remission ,
given the small size of the cohort , the role of infused ctls remains unclear .
but , more importantly , these data raise a number of questions , which remains , to date , unresolved .
first of all , what is the role and the best timing of adoptive t - cell therapy in npc ? the studies published to date indicate that ctls could possibly be administered earlier the course of treatment and in combination with conventional therapies ( for example as consolidation treatment after achieving response to second line therapy ) 39 .
furthermore , immune escape can occur even in instances when polyclonal antigen - specific t cells are infused 46 : gottschalk et al reported a patient with ebv - positive lymphoproliferative disease , who failed ebv - specific t - cell therapy , in which the tumor virus had deleted immunodominant ebv epitopes 47 . in the setting of npc immune escape
a strategy to overcome this phenomenon , and to increase clinical efficacy through better targeting , could be to ameliorate the quality of the cell product . in this perspective
, efforts are being made towards augmenting the pool of t - cells specific for the subdominant antigens expressed on ebv latency ii tumor cells within the infused product , with the aim of increasing t cell therapy efficacy . in detail , the subdominant component of the ebv - specific immune response directed towards latent membrane proteins lmp1 and lmp2 has been shown to expand , by stimulation with dendritic cells or ebv - lcl genetically modified to express the antigens 48 - 50 . in a pilot study enrolling ebv - positive hodgkin or non - hodgkin lymphoma , 5 of 6 patients with active relapsed disease showed a tumor response after infusion of autologous lmp2-specific ctl 51 .
a barrier to the function of infused ebv - specific ctls in immunocompetent hosts is the display of tumor - mediated immune evasion strategies 52 . to improve the resistance of ctls to tumor - derived inhibitory cytokines , bollard et al .
have shown that ebv - specific ctl made transgenic for a dominant - negative tgf- receptor , in which the intracellular signaling domain is truncated , are rendered resistant to the devastating effects of tgf- , secreted by hodgkin tumor cells 53 .
likewise , treatment failure due to lack or loss of ebv antigen expression by neoplastic cell subpopulations may be avoided through redirecting ebv - specific ctls to target other tumor antigens .
it has been shown that ebv - specific ctls expressing a chimeric antigen receptor ( car ) specific for cd30 , a molecule highly and consistently expressed on malignant hodgkin reed - sternberg cells , while retaining their original specificity , are also able to target cd30 + neoplastic cells , and mediate activity against ebv-/cd30 + tumors in a xenograft model 54 .
the management of human cancer with radio - chemotherapy is still suboptimal , due to persistence of refractory / relapsing disease , and the increased toxicity observed with increased efficacy of therapeutic regimens .
targeted therapies may offer equal or increased efficacy , coupled with a considerable decrease in overall toxicity . among these novel approaches ,
cell therapy offers a unique opportunity to restore antitumor immune surveillance , and it is therefore conceivable that application of this strategy will increase in the next few years 55 . in particular , for patients with relapsed or refractory npc which express ebv antigens , autologous , polyclonal , ebv - specific ctl therapy is safe , feasible , with low complication rates and a significant clinical response . | among the novel biologic therapeutics that will increase our ability to cure human cancer in the years to come , t cell therapy is one of the most promising approaches .
however , with the possible exception of tumor - infiltrating lymphocytes therapy for melanoma , clinical trials of adoptive t - cell therapy for solid tumors have so far provided only clear proofs - of - principle to build on with further development .
epstein - barr virus ( ebv)-associated malignancies offer a unique model to develop t cell - based immune therapies , targeting viral antigens expressed on tumor cells . in the last two decades , ebv - specific cytotoxic t - lymphocytes ( ctl )
have been successfully employed for the prophylaxis and treatment of ebv - related lymphoproliferative disorders in immunocompromised hosts .
more recently , this therapeutic approach has been applied to the setting of ebv - related solid tumors , such as nasopharyngeal carcinoma .
the results are encouraging , although further improvements to the clinical protocols are clearly necessary to increase anti - tumor activity .
promising implementations are underway , including harnessing the therapeutic potential of ctls specific for subdominant ebv latent cycle epitopes , and delineating strategies aimed at targeting immune evasion mechanisms exerted by tumor cells . | Introduction
Nasopharyngeal carcinoma
Cell therapy for NPC
Clinical results
Considerations on clinical data and on future strategies to ameliorate outcome
Conclusions |
this study evaluated variables already in the literature , but the breakdown and comparison among different ethnic groups is new and important to understand and be able to address the specific needs of older adults from these groups .
we evaluated a convenience sample of ethnically diverse community - dwelling older adults residing in south florida who volunteered to participate in the study .
the participants were recruited using adds and by word of mouth at health fairs , senior centers , housing developments , and by referrals from other participants from 2012 to 2014 .
the inclusion criteria were : age 60 years , walking independently or using an assistive device , age / education - adjusted mini mental state examination score 23 , and self - reported to belong to one of the four ethnic groups studied ( african - americans , afro - caribbeans , hispanic americans , and european americans ) .
the sample included 550 community - dwelling south floridians with mean ( standard deviation [ sd ] ) age of 75 ( 9 ) years .
all instruments were translated into spanish and creole , and administered by bilingual speakers of english
haitian creole , or english spanish at the participants home or at a community center . given the inclusion criteria ( age / education - adjusted mini mental state examination score 23 ) , the participants had good cognitive status ; therefore , they responded to the questions themselves .
the questions were read for the participants and the research assistants filled in all answers .
falls were assessed using the question : have you fallen down in the last two years ?
characteristics previously found to be associated with falls in community - dwelling older adults were tabulated , including : age , sex , ethnicity , physical activity , feet swelling , difficulty remembering , difficulty shopping , ambulatory devices , fatigue , medications , shortness of breath , dizziness , back pain , and urinary incontinence.14 we used a limited dataset of questions and information on participant characteristics to minimize the effects of multiple testing when comparing between groups .
the variables were selected based on the previous literature in this area and physiological plausibility for a relationship with falls .
univariable and multivariable analyses of association between falls and the characteristics were conducted , and generalized linear models were used to derive risk ratios ( rrs ) and 95% confidence intervals.15 multiple imputations were used to create 20 imputed datasets to address missing covariate data points.16 to analyze the association between falls and age , we dichotomized those above and below the mean age of the sample ( 75 years ) to compare their risk of falls . a multivariable analysis stratified by ethnicity
all p - values are two - sided and the analyses were conducted using stata ( stata statistical software 2013 : release 13 .
we evaluated a convenience sample of ethnically diverse community - dwelling older adults residing in south florida who volunteered to participate in the study .
the participants were recruited using adds and by word of mouth at health fairs , senior centers , housing developments , and by referrals from other participants from 2012 to 2014 .
the inclusion criteria were : age 60 years , walking independently or using an assistive device , age / education - adjusted mini mental state examination score 23 , and self - reported to belong to one of the four ethnic groups studied ( african - americans , afro - caribbeans , hispanic americans , and european americans ) .
the sample included 550 community - dwelling south floridians with mean ( standard deviation [ sd ] ) age of 75 ( 9 ) years .
all instruments were translated into spanish and creole , and administered by bilingual speakers of english
haitian creole , or english spanish at the participants home or at a community center . given the inclusion criteria ( age / education - adjusted mini mental state examination score 23 ) , the participants had good cognitive status
the questions were read for the participants and the research assistants filled in all answers .
falls were assessed using the question : have you fallen down in the last two years ?
characteristics previously found to be associated with falls in community - dwelling older adults were tabulated , including : age , sex , ethnicity , physical activity , feet swelling , difficulty remembering , difficulty shopping , ambulatory devices , fatigue , medications , shortness of breath , dizziness , back pain , and urinary incontinence.14 we used a limited dataset of questions and information on participant characteristics to minimize the effects of multiple testing when comparing between groups .
the variables were selected based on the previous literature in this area and physiological plausibility for a relationship with falls .
univariable and multivariable analyses of association between falls and the characteristics were conducted , and generalized linear models were used to derive risk ratios ( rrs ) and 95% confidence intervals.15 multiple imputations were used to create 20 imputed datasets to address missing covariate data points.16 to analyze the association between falls and age , we dichotomized those above and below the mean age of the sample ( 75 years ) to compare their risk of falls . a multivariable analysis stratified by ethnicity
all p - values are two - sided and the analyses were conducted using stata ( stata statistical software 2013 : release 13 .
univariable and multivariable analyses of association between falls and the characteristics were conducted , and generalized linear models were used to derive risk ratios ( rrs ) and 95% confidence intervals.15 multiple imputations were used to create 20 imputed datasets to address missing covariate data points.16 to analyze the association between falls and age , we dichotomized those above and below the mean age of the sample ( 75 years ) to compare their risk of falls . a multivariable analysis stratified by ethnicity
all p - values are two - sided and the analyses were conducted using stata ( stata statistical software 2013 : release 13 .
the mean ( sd ) age of the participants was 75 ( 9 ) years ; 40% ( n=222 ) were european americans , 21% ( n=113 ) were hispanics , 20% ( n=109 ) were afro - caribbeans , and 19% ( n=106 ) were african - americans .
ninety - four percent of the african - americans , 78% of the european americans , 6% of the hispanics , and 19% of the afro - caribbeans were born in the usa .
moderate physical activity was performed at least once a week by 63% of the participants ; fatigue - related dysfunction was reported by 59% and back pain by 45% ( table 1 ) .
being male and practicing moderate physical activity at least once a week were the only characteristics not significantly associated with falls in the univariable analysis .
afro - caribbeans were approximately 40% less likely to have fallen than the other groups ( p0.022 ) .
participants were 1.51.9 times more likely to have fallen if they used anxiety medication , were incontinent , had back pain , fatigue - related dysfunction , feet swelling , or difficulty remembering ( p0.004 ) .
age 75 years , taking anxiety medication , feet swelling , back pain , and incontinence were significantly associated with falls in the multivariable analysis .
table 3 shows the adjusted rrs stratified by ethnicity for these covariates ; the trends were similar across ethnic groups , but the rrs were 5% to 12% higher for the afro - caribbeans than for the other groups .
one potential explanation is that foreign - born immigrants tend to have lower rates of falls.12,17 while 78% of the european americans and 94% of the african - americans were born in the usa , only 19% of the afro - caribbeans and 6% of the hispanics were born in the usa .
however , the lower rate of falls among afro - caribbeans compared to hispanics still can not be explained by the reason of being born abroad .
the factors contributing to lower prevalence of falls among afro - caribbeans need further investigation .
this finding indicates that using the falls prevalence data among the general population is not appropriate to assess how afro - caribbeans are doing in relation to falls .
taking anxiety medication , incontinence , back pain , feet swelling , and age 75 years were associated with falls in the multivariable model .
age is a nonmodifiable risk factor , but addressing the underling health issues may help reduce falls risk .
the relationship between taking anxiety medication and falls may be explained by the medication side effects and/or by anxiety itself.18 community - dwelling older adults taking psychotropic medications were found to have 1.53.7 higher odds of falls than those not taking it.19,20 medication review and reconciliation may help reduce the risk of falls among these patients .
also , anxious subjects are likely to present more fear of falls , which increase the risk due to activity restriction and deconditioning.8 as in this study , urinary incontinence among racially diverse cohort of older adults has been found to be related to falls.21 this relationship is likely related to the need to rush to the toilet possibly resulting in inattention to environmental hazards ( eg , carpet edges , cords , wet floors ) .
the increased risk associated with urinary incontinence may be reduced by treating the symptoms as well as by making sure that the path between the person with incontinence bed and bathroom is clear of clutter , furniture , and cords ; that the floors are not wet ; that the person wears proper anti - slip footwear or socks ; and that bathroom night - lights are installed .
back pain may increase the risk of falls because it affects balance and mobility.22 low back pain has been found to be independently associated with falls , and a back exercise program reduced falls in older women.23,24 therefore , interventions to reduce back pain , such as physical therapy , exercises , and weight loss , may also reduce falls risk .
the relationship between feet swelling and falls is likely to be due to decreased proprioception as a result of the compression of the neurovascular structures .
proprioception is the ability to detect joint motion and position , and it depends on mechano - sensory receptors on the joints , ligaments , tendons , and muscles . vision and proprioception interact with the vestibular system and provide the central nervous system with information on the position of body allowing for postural control and balance maintenance.25 when the information sent from the sensory systems is unpredictable , insufficient , or conflicting there is loss of balance and inability to recover from disturbances.26 similarly to back pain and incontinence , addressing the causes and consequences of feet swelling may reduce the risk of falls .
however , older age may be related to falls due to aging - related physiological and functional decline .
gait impairments in older adults are related to declines in balance , muscle strength , and range of motion.27 however , practicing moderate physical activity at least once a week was not associated with falls .
the health benefits of physical activity are well established.28 what may help explain our finding is that the physical activity intensity and frequency is important and practicing moderate physical activity at least once a week may be insufficient to reduce the risk of falls .
one of the limitations of the current study is that we did not include physical measures .
another limitation of our study is that the sample was not randomly selected and therefore it may not represent the general population . this is a common limitation of studies conducted in the community where randomization is rarely feasible .
taking anxiety medication , incontinence , back pain , persistent swelling of the feet , and age 75 years were significantly associated with falls after adjusting for confounders .
the strength of association was higher for afro - caribbeans , but this group presented lower prevalence of falls than african - americans , hispanics , and european americans . | purposeto evaluate rates and factors associated with older adult falls in different ethnic groups.participants and methodsinformation on demographics , medical and falls history , and pain and physical activity levels was collected from 550 community - dwelling older adults ( 759 years old , 222 european americans , 109 afro - caribbeans , 106 african - americans , and 113 hispanics).resultstaking medications for anxiety ( risk ratio [ rr ] = 1.4 , 95% confidence interval [ ci ] = 1.12.0 ) , having incontinence ( rr = 1.4 , 95% ci = 1.11.8 , p=0.013 ) , back pain ( rr = 1.4 , 95% ci = 1.01.8 ) , feet swelling ( rr = 1.3 , 95% ci = 1.11.7 ) , and age 75 years ( rr = 1.3 , 95% ci = 1.01.6 ) were associated with falls .
the associations were stronger for afro - caribbeans , but they presented approximately 40% lower prevalence of falls than the other groups.conclusiontaking anxiety medication , incontinence , back pain , feet swelling , and age 75 years were associated with falls , and afro - caribbeans presented lower prevalence of falls . these findings need to be taken into consideration in clinical interventions in aging . | Introduction
Materials and methods
Subjects
Data collection
Statistical analysis
Results
Discussion
Conclusion |
a traumatic right diaphragmatic rupture as the result of blunt trauma is a rare condition .
the overall incidence of diaphragmatic rupture after blunt trauma is 0.8 - 3.6% ( 1 ) .
most injuries are due to vehicular - related incidents ( 79.5% ) and falling from a height ( 15.9% ) ( 2 ) .
right - sided tears are significantly less likely than left - sided tears , 27.3% and 68.2% respectively ( 3 ) . the correct diagnosis of diaphragmatic injury is initially missed in 12%-66% ( 1 )
delayed diagnosis and treatment of diaphragm rupture is associated with increased rates of morbidity and mortality . in our case
on our outpatient clinic , a 37-year - old man was presented with 31 years before a fall from a wall of 3 meters on his right side .
next to this major event the man was involved in a moped -car accident with only his face wounded , 18 years ago . during his life
the patient presented to us with primary complaints of progressive , stabbing pain in the upper right abdomen and right lower thorax with simultaneous periods of dyspnoea .
the symptoms worsened over a year , eventually leading to shortness of breath during rest . beside this presentation
the patient had right upper abdominal pain while eating spicy food . on admission , his vital signs were stable and colour was fair .
pulmonary examination revealed diminished breath sounds at the basal right hemithorax and the diaphragm was determined to be higher on the right by percussion .
the diagnosis was confirmed by thoracic - abdominal x - rays and computerised tomography ( ct ) imaging , which revealed intra - thoracic displacement of the liver and also the gallbladder ( figure 1 ) .
an elective thoracotomy in the sixth intercostal space was performed with repairing the diaphragmatic hernia ( figure 2 ) .
the liver with gallbladder was replaced in the abdominal cavity , after adhesiolysis of the lung from pleura and diaphragm , whereupon the diaphragm was closed tensionless by running technique with non - absorbable sutures .
two drains were left behind , one near the diaphragm and one in the right upper thorax .
right sided diaphragmatic rupture with consequently hepatothorax is a rare condition . blunt traumatic diaphragm rupture
a delay could result in increased rates of morbidity and mortality ( 5 ) . in case of hepatothorax , hypovolemic
shock can occur , because of possible kinking of the inferior vena cava with obstruction of the blood . in this case
there was a lateral impact on the chest , which distorted the chest wall and sheared the diaphragm .
there remains doubt about the cause of delayed diagnosis and treatment of this diaphragm injury , since it could occur as the result of either delayed rupture or delayed detection .
even if the herniation did not take place initially it would result in herniation eventually , because of the significant discrepancy between the intra - thoracic pressures and higher intra - abdominal pressure .
most of the diaphragmatic ruptures occur on the left side , because the right diaphragm is congenitally stronger than the left .
moreover the liver partially protects the right side as the impact can be spread over a large area .
pain in the upper abdomen and lower thorax , dyspnoea , cyanosis and hypotension are typical symptoms of diaphragmatic injury , but if the rupture is small the patient can remain symptom free for a long time .
the true incidence of traumatic diaphragm rupture is unknown because in 12 - 66% ( 1 ) of major trauma victims , the diagnosis is missed .
there is no consensus yet , on the gold standard of imaging technologies to diagnose diaphragm rupture .
based on the literature , diagnosis of diaphragmatic injury requires a high index of suspicion regardless whether you make an x - ray or ct .
the choice of surgical approach includes thoracotomy , laparotomy , or both if it is necessary .
the decision to repair the diaphragm either way is dictated by the stability of the patient and the presence of other associated organ injuries . | a traumatic right diaphragmatic rupture is an uncommon condition , as it occurs in 0.8 - 3.6% after blunt trauma .
it is challenging to find the diagnosis immediately and is illustrated by the incidence of 12 - 66% initially missed diagnosis ( 1).most blunt traumatic diaphragm ruptures are an indication for early aggressive surgical intervention by way of thoracotomy , laparotomy , or both if it is necessary .
delayed diagnosis and treatment of diaphragm rupture is associated with increased rates of morbidity and mortality .
therefore , diagnosis of diaphragmatic injury requires a high index of suspicion .
we report a case of a 37-year - old man with right diaphragmatic rupture after blunt injury 31 years prior to admission . | INTRODUCTION
CASE REPORT
DISCUSSION |
kaposi 's varicelliform eruption ( kve ) , also known as eczema herpeticum , is a rare and potentially fatal viral infection , caused mainly by reactivation of herpes simplex virus ( hsv ) , predominantly type i. other viruses such as coxsackie a 16 , vaccinia , and varicella zoster have also been implicated in its pathogenesis .
it concomitantly occurs with preexisting skin conditions , mostly atopic dermatitis ( ad ) , with a higher prevalence in childhood , although it can occur at any age .
it is characterized by widespread clusters of umbilicated vesicopustules and eroded vesicles , alternating with punched - out ulcers covered by hematic crusts usually located over the head , neck , and trunk .
antiviral treatment proved to be effective and should be instituted with no delay to prevent significant morbidity and mortality .
we conducted a retrospective observational study that included 19 patients [ table 1 ] between 0 and 55 years who were diagnosed with kve between 01 march 2008 and 01 march 2014 .
fifteen were children and only four were adults , with a similar distribution in both sexes ( 9 females and 10 males ) .
clinical features of patients with kaposi 's varicelliform eruption fourteen patients had a history of ad , one had psoriasis , one pemphigus foliaceus , one szary syndrome , and two previously healthy patients developed their debut of ad immediately before kve .
fifteen cases were sporadic , whereas four were familial ( two cousins on one side and two siblings on the other ) .
the most severe forms of kve were seen in patients with ad ( three of them had widespread lesions ) .
widespread clusters of vesicles and erosions covered by hemorrhagic crusts clinical diagnosis was performed in all cases , supported by the positivity of cytodiagnosis of tzanck in all patients in whom it was performed . in five patients a skin biopsy
two patients showed oral involvement with feeding difficulties , two had significant scarring on their face [ figure 2 ] , whereas two patients had severe involvement of conjunctival and genital [ figure 3 ] mucosa .
all patients were treated with oral or parenteral acyclovir ( with a dose ranging from 800 to 1600 mg per day until complete resolution ) , whereas in 10 patients , systemic antibiotic was added .
five patients required acyclovir suppressive therapy due to relapses ( acyclovir 800 mg per day for 612 months ) .
( b ) significant scars after the acute period kaposi 's varicelliform eruption affecting conjunctival mucosa and periocular area
kve was first described by moritz kaposi in the 19 century , who assumed it was a fungal infection , whereas juliysber argued that it was caused by bacterias . in
it has also been reported in association with psoriasis , pityriasis rubra pilaris , darier s , grover s , and hailey
hailey diseases , and contact dermatitis ( both irritant and allergic ) , among others . of note ,
one of our patients developed kve while being treated with prednisone 60 mg per day and cyclophosphamide 150 mg per day for pemphigus foliaceus [ figure 4 ] .
kaposi 's varicelliform eruption over pemphigus foliaceus . in a clockwise direction : erosions covered by hematic crusts on ( a ) right ear , ( b ) abdomen , and ( c ) face ; ( d ) clusters of vesicles on right index finger although the pathogenesis of kve is not completely elucidated , it is well recognized that the patients with diseases with underlying skin barrier damage and those with immune deficiencies are the most susceptible .
it is believed to be due to humoral and cellular immunity dysfunction . in a study that assessed the growth of hsv
i in cultured skin of patients with atopic dermatitis and psoriasis , faster replication than in normal skin was observed .
decreased production of some cytokines , such as interferon or cxcl 10/ip b 10 , or elevated levels of serum ige have also been associated with a higher risk of developing kve .
atopic patients would have an impaired immunity against the virus mediated by t cells , a defect in the specific antibody to the virus and a decrease in nk cells and il-2 receptors .
they would also show inhibition of the th1 response due to increased level of il4 , decreased levels of cathelicidins and plasmacytoid dendritic cells producing interferon - gamma , a cytokine with known antiviral effects .
the source of kve would be hsv i infection in family members or close contacts and/or endogenous recurrent infection .
it has been speculated that hsv may enter due to the overexpression of adhesion molecules in the affected skin of kve .
it is more common in children , mainly because of its relationship with ad , although cases in healthy adults have also been reported .
most cases are sporadic , although an outbreak in a dermatology ward has been recently described . in our study
we included four contemporary cases within two families : two were siblings with severe ad , both under treatment with cyclosporine and two were previously healthy cousins who made their debut of ad immediately before their kve . there has been a significant increase in the communications of kve cases since 1980 due to the drastic increase in hsv infection in the world .
this phenomenon took particular effect in japan in 2007 , with yet no known cause .
some authors relate this increase to the use of corticosteroids and topical tacrolimus in ad . lately
, kve has been related to the use of methotrexate and retinoids in patients with psoriasis , darier , and hailey hailey .
our series included a 15 year old girl with a previous diagnosis of psoriasis with lesions located only on the buttocks .
recently , mathes et al . proposed the term eczema coxsackium to refer to a kve caused by coxsackie virus a 16 .
kve is characterized by vesicopustules , some umbilicated and other eroded , and extended in clusters .
the lesions are painful and they are often associated with fever , malaise , and regional lymphadenopathy .
the average disease duration is 16 days and most of the lesions heal without scarring within 26 weeks .
the tzanck smear allows a diagnostic approach , that is rapid and economical , though not specific .
it is and its positivity rules out smallpox and its vacccine , booming because of bioterrorism .
detection of viral dna by pcr , electron microscopy , and immunofluorescence as well as sampling of vesicular fluid for culture and viral serology and histopathological biopsy could also be performed .
differential diagnoses are chickenpox , impetigo , contact dermatitis , and smallpox vaccine could also be done .
the most common complications are both bacterial infection that can lead to sepsis and viremia , with involvement of other organs . therefore , prophylactic antibiotic therapy is recommended .
viremia could affect lungs , liver , brain , gastrointestinal tract , and adrenal glands .
the bacterial agent most commonly found in secondary infected erosions is staphylococcus aureus , although beta - hemolytic streptococci and pseudomonas may also be isolated .
disseminated cutaneous herpes simplex in childhood , often seen in association with ad may be associated with bone marrow suppression and disseminated intravascular coagulation , presumably caused by viremia .
when general health is affected , a complete laboratory study including blood count , metabolic profile , and liver function studies should be made to rule out systemic involvement . at the present time , there is no standard therapeutic regimen for kve .
patients treated with acyclovir ( 1015 mg / kg / day ) , intravenous or oral , resolved the lesions faster than patients treated with placebo . for outpatients
this treatment is very effective and should be instituted without delay to prevent significant morbidity and mortality .
some authors add vidarabine ointment to the oral acyclovir therapy . in recalcitrant cases , foscarnet is the agent of choice . after healing , suppressive antiherpes treatment is recommended .
the highlights of our case series is the low frequency of the disease and the unusual presentation of cases in the same family .
we believe it is important to recognize this entity and to establish early treatment in order to avoid complications .
the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .
the authors declare that there are no conflicts of interest , that the manuscript has been read and approved by all the authors , that the requirements for authorship have been met , and that each author believes that the manuscript represents honest work .
the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .
the authors declare that there are no conflicts of interest , that the manuscript has been read and approved by all the authors , that the requirements for authorship have been met , and that each author believes that the manuscript represents honest work . | kaposi 's varicelliform eruption is a rare and potentially fatal viral infection caused mainly by reactivation of herpes simplex virus .
it concomitantly occurs with pre - existing skin conditions , mostly atopic dermatitis , so it is predominately found in children .
we present a case series that includes four adults , familial cases , and previously healthy patients .
we also highlight clinical features , associations and therapeutic options . | INTRODUCTION
CASE REPORTS
DISCUSSION
Declaration of patient consent
Financial support and sponsorship
Conflicts of interest |
within 4 days , 5 patients with skin lesions suggestive of an opv infection were reported to the infectious disease task force at the bavarian health and food safety authority .
infected patients were from 2 unrelated families living in 2 different counties in the greater munich area , germany .
the families had bought 1 and 2 rats , respectively , from the same pet shop on december 15 and december 17 , 2008 .
source tracing showed that the pet shop owner had sold a litter of 8 rats to 7 different households in the greater munich area .
the pet shop owner had purchased the litter from a bavarian rat breeder 7 days before the last rat in the litter was sold .
no symptoms of opv infection were reported in the rats or any another animal in the pet shop .
the pet shop owner denied purchasing any animals from abroad that could have been related to the 2003 us monkeypox outbreak ( 7 ) , although he did acknowledge owning another breeding facility in the czech republic .
inspection of the breeding facility in bavaria found 4 rats with crusts suspicious for opv infection .
mice , hamsters , rabbits , and degus ( octodon degus ) were also bred in the facility , but none had clinical signs of opv .
a total of 31 rats from the facility were tested for opv infection by oral swabs and serology .
according to their owners , all pet rats were asymptomatic when purchased , but 2 rats ( 1 in each family with a human opv infection ) died after 9 and 14 days , respectively .
one rat had distinct skin lesions on its extremities , mouth , and nose ( figure 1 , panel a ) ; the other had only 2 very small lesions on its front leg and nose .
two additional rats from the litter in 2 other households were euthanized due to clinical suspicion of opv infection ; 3 rats were assessed as healthy by their owners .
a ) rat named shiva ( strain named after this rat ) with lesions on the right hind limb ; it died 1 day later .
b ) neck lesions of a girl without previous vaccinia virus ( vv ) vaccination .
c ) neck lesion of the girl s grandmother with a history of vv vaccination .
2 . in households 1 and 2 ( table ) with human cases of infection , 2 and 3 persons , respectively , reported only direct skin contact with their pet rats since the first day of purchase .
notably , the onset and severity of symptoms were apparently associated with a patient s vv vaccination status : 2 girls ( patients 2 and 5 , each 16 years of age with no history of vv vaccination ) had multiple lesions on the neck , chest , and abdomen ( figure 1 , panel b ) accompanied by fever and local lymphadenopathy .
in contrast , the incubation period for 2 vv - vaccinated mothers ( patients 1 and 3 , 42 and 40 years of age , respectively ) and for the vv - vaccinated grandmother of 1 of the girls ( patient 4 , 60 years of age ) was > 7 days .
all showed less severe symptoms ( figure 1 , panel c ) without fever or lymphadenopathy and only 1 small skin lesion on the neck or chest . *
all obtained hemagglutinin open reading frames were 924 bp , and the respective sequences were 100% identical to each other ( genbank accession no .
rat 8 from the outbreak litter belonging to household 7 is missing because the rat owner could not be identified .
em , electron microscopy ; nd , not done ; na , materials not available . for orthopoxvirus spp . in household 3
after 35 days , skin lesions developed in all of her rats , including the initially asymptomatic index rat .
, the kidney transplant patient without previous vv vaccination did not develop signs or symptoms suggestive of cpxv infection . nevertheless , we collected a blood sample and swabs from her throat and a recent rat - bite finger wound .
various specimens ( skin biopsies , crusts , oral swabs , serum , and whole blood ) obtained from 5 patients and from rats from 3 households and 31 other rats ( 939 ) from the local breeding facility in bavaria were sent to the bavarian health and food safety authority ( table ) .
skin biopsy and crust specimens were homogenized and inspected for typical opv - like particles by using by electron microscopy .
dna from all samples was extracted using the qiaamp dna mini kit ( qiagen , hilden , germany ) according to the manufacturer s instructions .
for opv dna detection , the realart orthopoxvirus lc kit ( qiagen ) was used . for species identification
, the products of a second pcr , spanning the entire open reading frame of the hemagglutinin gene ( 8,9 ) , were sequenced .
datasets were edited and aligned using bioedit ( 10 ) . blast search ( www.ncbi.nlm.nih.gov/blast/blast.cgi ) was performed to confirm species identification of the isolated strain as well as similarity with published cpxv strains .
a phylogenetic tree was constructed using the maximum parsimony method with the phylogeny inference package version 3.68 ( http://evolution.genetics.washington.edu/phylip.html ) with 100 bootstraps ; the tree was drawn with treeview version 1.6.6 ( http://taxonomy.zoology.gla.ac.uk/rod/treeview.html ) ( figure 2 ) .
opv - specific serum antibody titers were determined using an immunfluorescence test based on vv - infected cells and either an antihuman or an antirat immunoglobulin g fluorescein - labeled conjugate ( dako , hamburg , germany ) .
phylogenetic tree of the isolated cowpox virus ( cpxv ) shiva strain ( in boldface ; named after pet rat shown in figure 1 , panel a ; genbank accession no .
fj654467 ) , constructed by the maximum - parsimony method based on the partial sequences method based on the hemagglutinin ( ha ) gene , unrooted . blast search ( www.ncbi.nlm.nih.gov/blast/blast.cgi ) confirmed the identification of this strain as a cpxv strain with a unique ha gene sequence .
additional unique cpxv strains shown for comparison , by accession number : ay902307 ( cowha35e ) , ay902301 ( cowha82 ) , ay902299 ( cowha70 ) , ay902298 ( cowha68 ) , ay902297 ( cowha52 ) , ay902296 ( cowha51 ) , ay902295 ( cowha48 ) , ay902294 ( cowha46 ) , ay902289 ( cowha47 ) , ay902288 ( cowha41 ) , ay902287 ( cowha40 ) , ay902286 ( cowha37 ) , ay902279 ( cowha76 ) , ay902276 ( cowha23 ) , ay902308 ( cowha38 ) , ay902275 ( cowha22 ) , ay902274 ( cowha21 ) , ay902273 ( cowha81 ) , ay902271 ( cowha19 ) , ay902270 ( cowha18 ) , ay902269 ( cowha17 ) , ay902268 ( cowha16 ) , ay902263 ( cowha15 ) , ay902262 ( cowha34 ) , ay902260 ( cowha13 ) , ay902257 ( cowha09 ) , ay902256 ( cowha07 ) , ay902255 ( cowha63 ) , ay902252 ( cowha73 ) , ay944029 ( cpv90_ger2 ) , ay944028 ( cpv91_ger3 ) , af377886 ( cowpox virus ) , af377885 ( cpv-922 - 99 ) , af377884 ( cpv-867 - 99b ) , af377883 ( cpv-667 - 94b ) , af377877 ( cpv-1218 - 00 ) , af375090 ( cpx - ep-2 ) , af375089 ( cpx - brt ) , af375088 ( cpx-90 - 5 ) , af375087 ( cpx-90 - 1 ) , af375086 ( cpx-89 - 5 ) , af375085 ( cpx-89 - 4 ) , and af375084 ( cpx-89 - 1 ) .
besides molecularly proven wild rat - to - human cpxv transmission ( 6 ) an additional cpxv infection probably transmitted from a pet rat was reported ( 11 ) .
recently , 4 human infections acquired from pet rats were reported to the reference laboratory for poxviruses at the robert koch institute ( 12 ) .
we describe a cpxv outbreak among 5 patients caused by infected pet rats from the same litter .
cpxv infections seem to be increasing ( 13 ) , but because cpxv infections in humans and in most animals ( e.g. , cats and rats ) are not notifiable , this increase remains an assumption .
one obvious reason for an increase might be the fading cross - protective immunity to opv after the cessation of vv vaccination ( 14 ) . in our small cluster ,
the onset and severity of symptoms seemed to be correlated with vv vaccination status ; however , although patients reported similar contact with pet rats , patient age and manner of infection might confound this hypothesis ( 15 ) .
the rising popularity of pet rats might also be a point of concern in a population with decreasing cross - protection to opv and an increasing number of immunocompromised persons .
our findings emphasize the necessity to monitor opv infections in humans and all animals ( e.g. , notification requirement ) and to improve public awareness .
our outbreak investigation underlines the importance of close cooperation between human health and veterinary authorities in the management of zoonotic diseases . | we describe a cluster of cowpox virus ( cpxv ) infections in humans that occurred near munich , germany , around the beginning of 2009 .
previously , only sporadic reports of cpxv infections in humans after direct contact with various animals had been published . this outbreak involved pet rats from the same litter . | The Study
Conclusions |
melanoma diagnosis presents important unmet clinical challenges . on the one hand , the ramatic mismatch between increases in detection and mortality rates ( report , 2010 ) may suggest significant overcalling ( glusac , 2011 ; swerlick and chen , 1996 ) . on the other hand , nearly one in ten patients with thin melanomas ( < 1 mm ) and no initial evidence of metastases develops recurrences ( kalady , white et al .
melanin chemistry is a natural biomarker of melanocyte activity , and is a promising marker to differentiate benign , dysplastic , and malignant pigmented lesions ( sealy et al , 1982 ; lazova and pawelek , 2009 ; marchesini et al , 2009 ; biesemeier et al , 2011 ) .
for example , a key metric for pathologists is melanocyte density and melanocyte - to - keratinocyte ratio ( herlyn and shih , 1994 ) , so it is important to differentiate cell type ( melanocyte , keratinocyte , melanophage , etc . ) .
also , melanocytes in the dermis are very concerning ( clark et al , 1969 ) , while macrophages are less concerning , even though both can be pigmented hence the need for immunohistochemistry .
electron microscopy ( vinther et al , 2008 ; jimbow et al , 1983 ) provides spatial information , but it is not quantitative , provides no molecular contrast , and is prone to mistaking melanosome shapes for other objects if the melanosomes are not purified . in this paper , we extend our recently demonstrated pump - probe technique for quantitative imaging of eumelanin and pheomelanin ( matthews et al , 2011 ) to extract subcellular resolution and morphological information not attainable by any other method .
pump - probe imaging using the near - infrared spectrum is ideal for biological applications due to the enhanced penetration depth of near - infrared compared to ultra - violet or visible light , inherent sectioning capabilities , and low sample damage from heating ( comparable to methods using very low power continuous wave lasers ) .
we have previously shown that this method gives intrinsic contrast in a variety of biological applications , including differentiating oxy- and deoxyhemoglobin ( fu et al , 2007 ) and melanin distributions on a variety of scales , from skin cross sections ( matthews et al , 2011a ) to entire pigmented lesions in vivo ( matthews et al , 2011b ) .
eumelanin and pheomelanin have broad , featureless linear absorption spectra ; however they can be easily differentiated because their pump - probe spectra reflect many competing nonlinear processes ( including excited state absorption , stimulated emission , and ground state depletion ) .
thus the technique is effective even when highly absorbing fluorophores are present ( such as hematoxylin and eosin in previously stained slides ) ( matthews et al , 2011a ) .
specifically , we investigate a number of pigmented lesions with high spatial resolution and more spectroscopic detail , examining differences in pigment chemistry down to the level of individual melanosomes .
we refine our distinction of melanins to not just eumelanin versus pheomelanin , but also sub - classes of eumelanin .
our multi - modality microscope ( described in the materials and methods section ) shows cell structure including melanocytic dendrites and melanosomes , cell nuclei , cell membranes , and presence of collagen .
we observe melanin in macrophages that is spectroscopically different from melanin in epidermal cells , the random spatial distribution of melanin in melanocytic nests , supranuclear caps pointing perpendicular to the basal layer , and individual melanocytes and keratinocytes containing both eumelanin and pheomelanin .
melanin standards in figure 1 show that pump - probe microscopy differentiates skin phantoms containing eumelanin and pheomelanin . in fixed ,
thin tissue slices , macrophages were identified by their location in the collagen and by their coarse pigment ( massi and leboit , 2004 ) .
note that the melanin tends to be homogeneous , with mostly a uniform melanin type and that is spatially not changing rapidly .
further , we find that melanin contained in macrophages in the dermis has a slightly different spectrum than epidermal melanin . to demonstrate this we use a convenient method to capture the heterogeneity of pump - probe signatures called phasor analysis ( redford and clegg , 2005 ; robles et al , 2012 ) , which highlights differences in the spectra of individual or ensembles of spatial pixels .
this approach was previously used to differentiate components of complex fluorescence lifetime images ( redford and clegg , 2005 ) and was recently applied to spectrally separate pump - probe signals of biological and historically significant art pigments ( robles et al , 2012 ) .
phasor analysis also separates the spectra of eumelanin in the epidermis from eumelanin in the macrophages , as shown in figure 3 .
a thin skin slice is shown , along with the spectra of dermal and epidermal cells .
because they have differentiable spectra , they can be separated with phasor analysis because the pixels for each type of cell have separate locations on the phasor plot .
a high - magnification image of a single melanocyte in a melanocytic nest is shown in figure 4a , with the melanocytic nest identified by its location near the basal layer and nest - like in shape .
this is made visible by the second - harmonic generation / fluorescence channel ( shown in gray scale ) . in the nests
, the melanin tends to be spatially disorganized , containing both eumelanin and pheomelanin very close to one another . while the majority of macrophages observed in this study contained mostly eumelanin , there were exceptions to this trend .
our sample set also shows supranuclear melanin caps , which serve to protect nuclei from the damaging radiation of the sun ( kobayashi , 1998 ) .
figure 5 shows examples of supranuclear melanin caps , both cross sections of caps ( figure 5a ) and an en face cap ( figure 5b ) .
in particular , a z - stack of an en face cap shows the contour of the cap , which is rendered in three - dimensions in figure 5c .
most of the macrophages observed in this study appeared to contain eumelanin , even in cases where the epidermal melanin is composed mainly of pheomelanin .
this is consistent with previous findings that melanosomes are broken down in phagocytes but melanin is not , and that pheomelanin is likely broken down more readily due to its increased solubility ( borovansk and elleder , 2003 ) .
the exceptions to this finding were pheomelanic macrophages , found only in malignant regions of melanomas .
if a melanoma is rapidly forming melanin , then the melanin could be building up in the macrophages and allowing observation of not yet degraded pheomelanin .
additionally , melanin in macrophages tends to lack a negative signal at zero delay , possibly due to thermal effects caused by concentrated melanin absorbing the laser light and dissipating it as heat or due to effects of oxidative degradation .
this spectral difference is used to separate populations of melanin in the epidermis and in the macrophages using phasor analysis .
both eumelanin and pheomelanin can be seen in the single melanocyte ( figure 4b ) , supporting the previous finding that individual melanocytes can exhibit mixed melanogenesis ( jimbow et al , 1983 ; ito and wakamatsu , 2008 ) .
similarly , both types of melanin were observed in single keratinocytes , which is consistent with previous findings using electron microscopy ( jimbow et al , 1983 ) . in keratinocytes , the most efficient approach for
the supranuclear caps to protect nuclei would be for the caps to point toward the source of the radiation ( the skin surface ) , but cell signaling is directed from living cells , not the dead stratum corneum .
imaging cells at high magnification shows that melanin caps point perpendicular to the basal layer and not necessarily toward the skin surface ( figure 5d ) .
this supports the previous report of melanin caps covering the apical pole of a cell s nucleus and not necessarily the top of the skin ( corcuff , 2001 ) . in summary
, pump - probe microscopy has allowed the discrimination of eumelanin and pheomelanin non - destructively in individual cells .
this method can be applied to answer questions regarding the subcellular distribution of melanins in fixed samples or in vivo and identify different cell types . in this work
, it has been used to differentiate melanin in epidermal cells from melanin in macrophages , even when both melanin populations are eumelanin .
this could help differentiate macrophages from pigmented dermal melanocytes in stained or unstained biopsy slides or even in vivo .
this work also confirms previous findings that single keratinocytes and melanocytes can contain both eumelanin and pheomelanin .
the two - color pump - probe microscope used in this study is similar to the previously reported microscope in ref ( matthews et al , 2011a ) . in brief , a 720 nm pump beam is modulated at 2 mhz , and a 810 nm probe beam is un - modulated . to characterize a sample s nonlinear dynamic behavior ,
images are taken at a variety of interpulse delays including the following : time points with the probe preceding the pump ( negative delay ) for long lived signals on the order of nanoseconds , points when the pump and probe overlap for instantaneous signals , and points with the pump preceding the probe for measuring the dynamics of the excited state on the order of picoseconds .
the light that passes through the sample filters out the pump beam , such that any modulation transferred from the pump beam to the probe beam is detected using a lock - in amplifier .
the phase of the modulation is set to have positive signal for an absorptive event and negative for a transmissive event .
in addition to the pump - probe system , other microscopy modalities are incorporated : a dichroic filter separates the combined fluorescence and second harmonic generated light that returns through the objective , and is detected using a photomultiplier tube .
most images were acquired using a 60x , 0.9 na objective and a half milliwatt average power of pump and probe beam .
melanin imaging standards were prepared by embedding separately sepia melanin ( sigma - aldrich , saint louis , mi , usa ) and in - house prepared synthetic pheomelanin ( ito , 1989 ) in 1% agarose .
this preparation was molded into blocks and sliced to about 1 mm thickness , then mounted on a slide and cover - slipped .
unstained 5 m slices of formalin - fixed , paraffin - embedded skin biopsies from pigmented lesions were obtained through an institutional review board - exempted protocol .
a dermatopathologist identified the clinically concerning regions of melanoma samples to ensure the fields of view included in the study were properly categorized . for processing of the data ,
every pixel of each image was fit to spectra from melanin standards and then recolored to represent the fractional content of eumelanin ( red ) and pheomelanin ( green ) , determined by the coefficients required for the fitting .
the precision of the melanin fraction calculation depends on the exact concentration of the melanin solutions used to calculate the coefficients , which is approximate because eumelanin is insoluble in water . | pump - probe microscopy non - destructively differentiates eumelanin and pheomelanin and can be used to quantify melanin distributions in thin biopsy slices . here
we have extended that work for imaging eumelanin and pheomelanin distributions on a sub - cellular scale , allowing elucidation of characteristics of different cell types .
the results show that melanin heterogeneity , previously found to be characteristic of melanomas , persists on the sub - cellular scale .
we have also found spectral changes associated with melanin located in melanophages , which could potentially differentiate invasive pigmented melanocytes from melanophages without immunohistochemical staining . | Introduction
Results
Discussion
Materials and Methods |
recently , the european hernia society ( ehs ) has systematised and introduced classifications of inguinal and ventral ( primary and incisional ) hernias [ 1 , 2 ] . both classifications are based on the stipulation that a good classification must be simple ; these classifications should mention the most appropriate and practicable criteria .
the classification of ventral hernia is used in another ehs project the european registry of abdominal wall hernias ( eurahs ) .
this database covers the registry of parastomal hernias ( ph ) ; the founders of this project stated that a classification of ph is still missing .
previously published classifications of ph are not practicable and have not been used in any publication other than the original publication .
most of the previous proposals did not mention concomitant incisional hernias ( cih ) and included subgroups that did not qualify as hernias , according to the definition of abdominal wall hernias as proposed by the ehs [ 48 ] . during the ehs board meeting in madonna di campilio ( february 2011 )
the aim was to introduce an ehs classification for ph based on the same template and rules of previously published ehs classifications for inguinal and ventral hernias to improve the ability to compare different studies and their results .
the conference was held on behalf of the secretary for scientific research in toru , poland , on april 2021 , 2012 .
several members of the ehs board and invited experts on ph met for 2 days to discuss currently existing classifications and the possibility of developing a new or modified system ( fig . 1 ) .
participants were chosen based on a literature review of publications on ph from leading recognised centres ; the participants were approved by the ehs board ( fig .
1the ehs classification for parastomal hernias is a proposal formulated during a consensus meeting in torun , poland , on april 2021 , 2012fig .
2examples of the different subgroups of parastomal hernias as defined by the ehs classification the ehs classification for parastomal hernias is a proposal formulated during a consensus meeting in torun , poland , on april 2021 , 2012 examples of the different subgroups of parastomal hernias as defined by the ehs classification the participants agreed on the general rules of classification before their meeting . according to the ontology , unambiguous interpretation of the classes and strict hierarchical subclass relationship were needed . to make this classification useful
, we decided that the level of granulation ( measurements needed to classify ) should be low , and natural language should be used . by mentioning the natural language
abandonment of abstract abbreviations , we targeted sharp classification of meaning of terms and the challenge of pluralism of the cultures .
these rules are usually useful in the methodology of taxonomy ; they are used to validate various classifications . creating a successful classification in the medical community
implies that surgeons must be convinced of the value of the proposal ; additionally , they must accept the information required and uniformly complete the data sets .
it is important to create a proposal that uses clearly defined criteria from which we can anticipate a positive effect of the treatment strategy and prognosis .
currently existing classifications were reviewed with respect to the number of different subgroups , relevance , missing subgroups , accuracy and simplicity .
previously published classifications on ph are based on three different examination methods : physical examination , intraoperative findings or radiological description ( ct scans or us ) . according to the type of hernia and hernia content , we isolated four to five subgroups of hernias .
these subgroups describe various pathological findings of the stoma : from the real hernias ( with the presence of the hernia sac and its content ) to the prolapse of the stoma or stoma loop protrusion under the skin [ 47 ] .
only the classification by gil and szczepkowski includes coexisting midline incisional hernias in the classification .
table 2 summarises the subgroup definitions of different classifications.table 1description of previous parastomal hernia classification proposalsauthor ( year)classification typeclassification based onnumber of subclassesclinical validationdevlin intraoperativeintraoperative findings4yesrubin intraoperativeintraoperative findings4nomoreno - matias radiologicalct5yesgil , szczepkowski [ bielanski hospital ] clinicalphysical examination4yestable 2subgroups of parastomal hernias in various classification proposalsdevlin rubin et al .
type i : interstitial hernia type ii : subcutaneous hernia type iii : intrastomal hernia type iv : peristomal hernia ( stoma prolapse ) type i : true parastomal hernia ia : interstitial ib : subcutaneous type ii : intrastomal hernia type iii : subcutaneous prolapse type iv : pseudohernia ( connected with flank insufficiency or denervation)moreno - matias gil and szcepkowski type 0 : peritoneum follows the wall of the bowel forming the stoma , with no formation of a sac type ia : bowel forming the colostomy with a sac < 5 cm type ib : bowel forming the colostomy with a sac > 5 cm type ii : sac containing omentum type iii : intestinalloop other than the bowel forming the stoma type i : isolated small parastomal hernia type ii : small parastomal hernia with coexisting midline incisional hernia ( without any significant front abdominal wall deformity ) type iii : isolated large parastomal hernia ( with significant front abdominal wall deformity ) type iv : large parastomal hernia with coexisting midline incisional hernia ( with significant front abdominal wall deformity ) description of previous parastomal hernia classification proposals subgroups of parastomal hernias in various classification proposals existing classifications are of low clinical value , except for the one described by gil and szczepkowski .
they have not been used in any clinical trial or cohort group description ; it seems that the subgroup allocation of patients will not influence the treatment options or the prognosis .
the classifications proposed by devlin and rubin include subgroups that do not fulfil the definition of hernia [ 4 , 5 ] .
the allocation of a patient to the appropriate type or subgroup is impossible on clinical examination alone , except for the gil and szczepkowski classification .
the classification by moreno - matias was evaluated according to the presence of symptoms reported by the patient . in type 0 , over 70 percent of hernias were asymptomatic , whereas in type iii , all of the hernias manifested clinical symptoms .
the classification proposed by gil et al . described the clinical symptoms in different subclasses .
the most frequent indications for treatment in type i were strangulation and ileus . in type ii , local complications dominated among the patients . in types
iii and iv , the size of the hernia and the deformity of the front abdominal wall or flank were considered as indications .
nevertheless , in this classification , the cut - offs of subclasses were not precisely defined ( small vs. large ) , which can lead to mistakes and can make comparative studies impossible . a pure classification does not include the type of operative technique used .
however , it seems that the complexity of the operation will increase with the described subgroups .
the primary purpose of the work was to improve the ability to compare different studies and their results .
the secondary purpose was to use the classification in various databases , such as the eurahs database , to collect the data .
we believe that if the proposed classification is widely accepted and used , the possibility of developing evidence - based therapeutic guidelines will increase in the future .
in 2007 , the ehs published the classification of inguinal hernias ; in 2009 , based on a similar template , a ventral hernia classification was proposed [ 1 , 2 ] .
we agreed that ph classification should have a similar format and that a grid format should be proposed , even if it restricts the number of variables that can be used for the classification . following the ehs definition of ventral hernia ( any abdominal wall gap with or without a bulge in the area of a postoperative scar perceptible or palpable by clinical examination or imaging )
, ph is an abnormal protrusion of the contents of the abdominal cavity through the abdominal wall defect created during placement of a colostomy , ileostomy or ileal conduit stoma .
it should be distinguished from local stoma problems without a hernia sac , such as a mucosal prolapse or a siphon loop , which is a subcutaneous folding of the excess bowel length at the stoma . when proposing a classification , it is important to determine the most suitable variables that should be included .
we have considered many potential criteria that influence the symptomatology of the hernia , the choice of treatment and treatment prognosis ( table 3 ) .
it is impossible to consider all of these variables because it would make the proposed classification too extensive and complicated .
therefore , a consensus decision on the exclusion or inclusion of variables was made.table 3variables discussed to be included in the final classificationvariable proposed for classification ( description)includedexcludedpatients medical history ( cancer , bowel inflammatory disease , etc.)xrisk factorsxtype of stomy ( colostomy , ileostomy , urostomy , ileal conduit)xlocalisation ( according to the ehs ventral hernia classification)xhernia symptoms ( ileus , bowel obstruction , pain , etc.)xlocal stoma problems ( fistula , skin lesion or necrosis , etc.)xdefect size ( largest diameter)xsize of the hernia sacxhernia content ( stoma loop , other bowel , omentum , etc.)xcoexisting incisional hernia ( previous scar in the middle line)xdistance between parastomal hernia and midline ( ev . midline hernia border)xrecurrencex variables discussed to be included in the final classification
previously published classifications on ph are based on three different examination methods : physical examination , intraoperative findings or radiological description ( ct scans or us ) . according to the type of hernia and hernia content , we isolated four to five subgroups of hernias .
these subgroups describe various pathological findings of the stoma : from the real hernias ( with the presence of the hernia sac and its content ) to the prolapse of the stoma or stoma loop protrusion under the skin [ 47 ] .
only the classification by gil and szczepkowski includes coexisting midline incisional hernias in the classification .
table 2 summarises the subgroup definitions of different classifications.table 1description of previous parastomal hernia classification proposalsauthor ( year)classification typeclassification based onnumber of subclassesclinical validationdevlin intraoperativeintraoperative findings4yesrubin intraoperativeintraoperative findings4nomoreno - matias radiologicalct5yesgil , szczepkowski [ bielanski hospital ] clinicalphysical examination4yestable 2subgroups of parastomal hernias in various classification proposalsdevlin rubin et al .
type i : interstitial hernia type ii : subcutaneous hernia type iii : intrastomal hernia type iv : peristomal hernia ( stoma prolapse ) type i : true parastomal hernia ia : interstitial ib : subcutaneous type ii : intrastomal hernia type iii : subcutaneous prolapse type iv : pseudohernia ( connected with flank insufficiency or denervation)moreno - matias gil and szcepkowski type 0 : peritoneum follows the wall of the bowel forming the stoma , with no formation of a sac type ia : bowel forming the colostomy with a sac < 5 cm type ib : bowel forming the colostomy with a sac > 5 cm type ii : sac containing omentum type iii : intestinalloop other than the bowel forming the stoma type i : isolated small parastomal hernia type ii : small parastomal hernia with coexisting midline incisional hernia ( without any significant front abdominal wall deformity ) type iii : isolated large parastomal hernia ( with significant front abdominal wall deformity ) type iv : large parastomal hernia with coexisting midline incisional hernia ( with significant front abdominal wall deformity ) description of previous parastomal hernia classification proposals subgroups of parastomal hernias in various classification proposals existing classifications are of low clinical value , except for the one described by gil and szczepkowski .
they have not been used in any clinical trial or cohort group description ; it seems that the subgroup allocation of patients will not influence the treatment options or the prognosis .
the classifications proposed by devlin and rubin include subgroups that do not fulfil the definition of hernia [ 4 , 5 ] .
the allocation of a patient to the appropriate type or subgroup is impossible on clinical examination alone , except for the gil and szczepkowski classification .
the classification by moreno - matias was evaluated according to the presence of symptoms reported by the patient . in type 0 , over 70 percent of hernias were asymptomatic , whereas in type iii , all of the hernias manifested clinical symptoms .
the classification proposed by gil et al . described the clinical symptoms in different subclasses .
the most frequent indications for treatment in type i were strangulation and ileus . in type ii , local complications dominated among the patients . in types
iii and iv , the size of the hernia and the deformity of the front abdominal wall or flank were considered as indications .
nevertheless , in this classification , the cut - offs of subclasses were not precisely defined ( small vs. large ) , which can lead to mistakes and can make comparative studies impossible . a pure classification does not include the type of operative technique used .
however , it seems that the complexity of the operation will increase with the described subgroups .
the primary purpose of the work was to improve the ability to compare different studies and their results .
the secondary purpose was to use the classification in various databases , such as the eurahs database , to collect the data .
we believe that if the proposed classification is widely accepted and used , the possibility of developing evidence - based therapeutic guidelines will increase in the future .
in 2007 , the ehs published the classification of inguinal hernias ; in 2009 , based on a similar template , a ventral hernia classification was proposed [ 1 , 2 ] .
we agreed that ph classification should have a similar format and that a grid format should be proposed , even if it restricts the number of variables that can be used for the classification .
following the ehs definition of ventral hernia ( any abdominal wall gap with or without a bulge in the area of a postoperative scar perceptible or palpable by clinical examination or imaging ) , ph is an abnormal protrusion of the contents of the abdominal cavity through the abdominal wall defect created during placement of a colostomy , ileostomy or ileal conduit stoma .
it should be distinguished from local stoma problems without a hernia sac , such as a mucosal prolapse or a siphon loop , which is a subcutaneous folding of the excess bowel length at the stoma .
when proposing a classification , it is important to determine the most suitable variables that should be included .
we have considered many potential criteria that influence the symptomatology of the hernia , the choice of treatment and treatment prognosis ( table 3 ) .
it is impossible to consider all of these variables because it would make the proposed classification too extensive and complicated .
therefore , a consensus decision on the exclusion or inclusion of variables was made.table 3variables discussed to be included in the final classificationvariable proposed for classification ( description)includedexcludedpatients medical history ( cancer , bowel inflammatory disease , etc.)xrisk factorsxtype of stomy ( colostomy , ileostomy , urostomy , ileal conduit)xlocalisation ( according to the ehs ventral hernia classification)xhernia symptoms ( ileus , bowel obstruction , pain , etc.)xlocal stoma problems ( fistula , skin lesion or necrosis , etc.)xdefect size ( largest diameter)xsize of the hernia sacxhernia content ( stoma loop , other bowel , omentum , etc.)xcoexisting incisional hernia ( previous scar in the middle line)xdistance between parastomal hernia and midline ( ev . midline hernia border)xrecurrencex variables discussed to be included in the final classification
the task of developing a good classification of ph is similar to the classification of incisional hernias .
there is great variability in the morphology of ph ; additionally , we agreed that coexistence of another incisional hernia in the previous scar will change treatment and may influence the outcome .
there was consensus that the presence of a cih and the size of the ph defect play a crucial role in the proposed treatment .
we added the cut - off value of 5 cm to distinguish a small ph from a large ph .
the size of the hernia defect is defined as the largest diameter of the hernia orifice in any direction , the width , the length or a diagonal measurement .
it was mentioned that almost half ( 41 % ) of patients has cih , and in almost 50 % the size of parastomal defect was larger than 5 cm .
this leads to the conclusion that choosing this variables as cut - off value will divide the patients population in four almost equal subgroups , what can help in future treatment strategy choice .
in addition , the descriptions of the deformation of the front abdominal wall have been removed from the classification because they are difficult to define and might lead to decreased reproducibility ( table 2 ) . to make the new classification similar to previously published inguinal and incisional hernia classifications
, a separate box was added to the grid describing primary or recurrent hernia ( as in other classifications , p indicates primary and r indicates recurrent ) .
although they could be important for the treatment choice and prognosis , all of them are included in the eurahs database , so that they could be analysed in the future if more clinical cases are reported in the registry .
we also believe that some variables such as medical history and risk factors are of minor importance for the choice of surgical approach and technique .
these variables can be important for the general clinical outcome of the patient ( e.g. , an existing malignancy ) . in most circumstances , local stoma problems , localisation , symptoms of the hernia , size of the sac and its content do not influence the operative technique itself .
2):type i : ph 5 cm without cih.type ii : ph 5 cm with cih.type iii : ph > 5 cm without cih.type iv : ph > 5 cm with cih.p : primary ph.r : recurrence after previous ph treatment .
, we propose a format for the classification of ph.table 4ehs grid for classification of parastomal hernias ehs grid for classification of parastomal hernias as in previously published inguinal and ventral hernia and parastomal classifications , the measurements of the hernia orifice and cih are performed intraoperatively .
the measure of the hernia orifice should follow the general roles of previously published ehs classification of incisional hernias ( aggregate length and width of all defects on previous scar , but the size of the parastomal defect separately ) .
we agree that although ct scans could be performed preoperatively and could help determine the subgroup of the defect , intraoperative measurement is the recommended procedure .
the task of developing a good classification of ph is similar to the classification of incisional hernias .
there is great variability in the morphology of ph ; additionally , we agreed that coexistence of another incisional hernia in the previous scar will change treatment and may influence the outcome .
there was consensus that the presence of a cih and the size of the ph defect play a crucial role in the proposed treatment .
we added the cut - off value of 5 cm to distinguish a small ph from a large ph .
the size of the hernia defect is defined as the largest diameter of the hernia orifice in any direction , the width , the length or a diagonal measurement .
it was mentioned that almost half ( 41 % ) of patients has cih , and in almost 50 % the size of parastomal defect was larger than 5 cm .
this leads to the conclusion that choosing this variables as cut - off value will divide the patients population in four almost equal subgroups , what can help in future treatment strategy choice .
in addition , the descriptions of the deformation of the front abdominal wall have been removed from the classification because they are difficult to define and might lead to decreased reproducibility ( table 2 ) . to make the new classification similar to previously published inguinal and incisional hernia classifications
, a separate box was added to the grid describing primary or recurrent hernia ( as in other classifications , p indicates primary and r indicates recurrent ) .
although they could be important for the treatment choice and prognosis , all of them are included in the eurahs database , so that they could be analysed in the future if more clinical cases are reported in the registry .
we also believe that some variables such as medical history and risk factors are of minor importance for the choice of surgical approach and technique .
these variables can be important for the general clinical outcome of the patient ( e.g. , an existing malignancy ) . in most circumstances , local stoma problems , localisation , symptoms of the hernia , size of the sac and its content do not influence the operative technique itself .
2):type i : ph 5 cm without cih.type ii : ph 5 cm with cih.type iii : ph > 5 cm without cih.type iv : ph > 5 cm with cih.p : primary ph.r : recurrence after previous ph treatment .
in table 4 , we propose a format for the classification of ph.table 4ehs grid for classification of parastomal hernias ehs grid for classification of parastomal hernias
as in previously published inguinal and ventral hernia and parastomal classifications , the measurements of the hernia orifice and cih are performed intraoperatively .
the measure of the hernia orifice should follow the general roles of previously published ehs classification of incisional hernias ( aggregate length and width of all defects on previous scar , but the size of the parastomal defect separately ) .
we agree that although ct scans could be performed preoperatively and could help determine the subgroup of the defect , intraoperative measurement is the recommended procedure .
it was possible to create a group of experts on behalf of the ehs to propose a new classification of ph .
we believe that due to its simplicity and the sharp edges of the subgroup definition , it will help surgeons to formulate a precise description of the pathology .
the proposed classification is also the missing link in the ehs classifications of abdominal wall hernias .
although many variables were not included in the classification , we believe that , together with the data collected in the registers ( including eurahs ) , this work will bring us more information about ph treatment in the future . similar to the inguinal and ventral hernia classification
, we believe that the proposed classification must be tested and validated in clinical practice . the validation process might provide new information to allow us to consider future modifications of the classifications . | purpose
a classification of parastomal hernias ( ph ) is needed to compare different populations described in various trials and cohort studies , complete the previous inguinal and ventral hernia classifications of the european hernia society ( ehs ) and will be integrated into the eurahs database ( european registry of abdominal wall hernias).methodsseveral members of the ehs board and invited experts gathered for 2 days to discuss the development of an ehs classification of ph .
the discussions were based on a literature review and critical appraisal of existing classifications.resultsthe classification proposal is based on the ph defect size ( small is 5 cm ) and the presence of a concomitant incisional hernia ( cih ) .
four types were defined : type i , small ph without cih ; type ii , small ph with cih ; type iii , large ph without cih ; and type iv , large ph with cih .
in addition , the classification grid includes details about whether the hernia recurs after a previous ph repair or whether it is a primary ph .
clinical validation is needed in the future to assess if the classification allows us to differentiate the treatment strategy and if the classification impacts outcome in these different subgroups.conclusiona classification of ph divided into subgroups according to size and cih was formulated with the aim of improving the ability to compare different studies and their results . | Introduction
Materials and methods
Results
Currently existing classifications
Purpose of the classification
Format of the classification
Definition of a parastomal hernia
Variables for classification
Discussion
Choice of variables
Classification table
How to use a classification
Conclusions |
zimbabwe is in sub - saharan africa which is at the epicenter of the human immune deficiency virus ( hiv ) epidemic . according to unaids the prevalence of hiv in zimbabwe
has decreased to about 1 in 10 adults ( 2012 ) from a high one of almost 1 in 4 in 2002 . while the decline is commendable hiv infection still remains a major problem in zimbabwe with 14.3% of adults being hiv positive .
the high disease burden of hiv has necessitated a rapid increase in the use of highly active antiretroviral therapy ( haart ) . as of 2012
, over 476 thousand hiv - infected zimbabweans were on haart compared to only 8000 in 2003 . in the zimbabwe national program , first line drug combinations include a dual combination of tenofovir / tdf / disoproxil fumarate ( gilead sciences , usa ) ; a nucleoside reverse transcriptase inhibitor ( nrti ) and lamivudine/3tc/2,3 dideoxy-3-thiacytidine ( glaxosmithkline and pfizer , uk ) , an nrti and a triple combination of tenofovir , lamivudine with nevirapine / xr / viramune ( boehringer ingelheim , usa ) a non - nucleoside reverse transcriptase inhibitor ( nnrti ) [ 3 , 4 ] . in the event of treatment failure the patients
are treated with second line drugs including zidovudine / azt ( company ) an nrti ; didanosine / ddi / videx ( bristol - myers squibb co , usa ) , an nrti together with lopinavir and ritonavir ; protease inhibitors ( pis ) also known as kaletra / aluvia ( abbot laboratories ) .
haart has reduced both the morbidity and mortality of hiv - infected people due to aids .
however haart is reported to have adverse side effects , one of which is bone mineralization .
changes in serum levels of biochemical markers of bone metabolism have been shown elsewhere in experimental and clinical studies [ 57 ] .
a number of studies from various parts of the world have reported that haart may have effects on bone metabolism via vitamin d and/or parathyroid hormone .
this has been linked to the greater risk of developing fractures in hiv - infected patients on haart .
evidence has also been shown in some studies linking current use of haart to low levels of vitamin d : calcidiol ( 25-hydroxycholecalciferol ) .
calcidiol is most commonly determined in measurements of vitamin d status because of its longer half - life than the active form of vitamin d : calcitriol ( 1,25 cholecalciferol ) .
osteopenia and osteoporosis are conditions involving the weakening of bones which differ in the degree to which bones weaken .
osteopenia and osteoporosis are common manifestations in haart - experienced patients and are both due to low bone mineral density . in a recent study of a large number of hiv - infected participants , 53.7% of the patients had osteopenia whilst 26.8% had osteoporosis [ 14 , 15 ] .
who recommends use of bone mineral density as a marker of bone disorders like osteopenia and osteoporosis .
a number of studies such as the one by de socio et al . have reported changes in bone density accompanied by changes in serum levels of phosphate and alkaline phosphate in hiv - infected participants before and after antiretroviral therapy [ 18 , 19 ] .
a european study showed that tenofovir increases bone turnover and decreases bone mineral density in treated hiv - infected adults .
results in a us study showed that protease inhibitors increase the incidence of osteopenia and osteoporosis in men .
tenofovir , a drug recently introduced to zimbabwe 's first line treatment , has been associated with osteomalacia , low serum levels of phosphate , and elevated alkaline phosphate in a swiss study . a nigerian study provided evidence for an elevation in albumin levels due to haart .
this is in contradiction to southern india study that showed that 84% of patients on art had low levels of albumin ( < 28
there is no published evidence for the bone effect of prescribed first and second lines haart regimens on zimbabweans .
the objective of this study was to provide evidence of changes in serum bone profiles , if any , in a zimbabwean population of women using currently prescribed haart regimens and compare them to a similar group of hiv - infected women who are not yet on haart ( table 2 ) .
the broad objective was to find a noninvasive and cheap method of detecting changes in bone metabolism in hiv - infected and haart - experienced patients in our resource - limited settings .
parirenyatwa group of hospitals is a group of public and teaching hospitals found in the capital city of zimbabwe .
the group of hospitals are referral hospitals servicing casualties from harare city centre and its environs , together with referred cases from a number of clinics around harare and other zimbabwean provinces and districts .
the clientele attending the parirenyatwa opportunistic infections ( oi ) clinic , the site of our study , is diverse in terms of geographical location , but many are from low - income groups .
those participants who were on haart were taking a combination of tenofovir , lamivudine and nevirapine for the first line treatment and zidovudine , didanosine , and lopinavir / ritonavir for second line treatment .
we sequentially recruited 40 hiv - infected women , aged 18 to 40 years who had been on first line haart for more than 6 months and consented to be part of our study .
40 hiv - infected women who were haart - nave were matched for age with the 40 consenting haart - experienced women .
all the women had no evidence of critical illness at the time of the study . permission to work with the parirenyatwa oi clinic was sought from the clinical director of parirenyatwa group of hospitals , whilst ethical clearance was given by the joint research ethics committee of the parirenyatwa group of hospitals and university of zimbabwe ( jrec ) after they were satisfied that the research protocol was ethically sound .
participants gave written consent after being informed fully about their role , risks , and benefits in the study and being satisfied that their identities would be protected using anonymous numerical identifiers on all documents and specimen containers .
consider
( 1)n=[(z/2+z1)2(p1p2)2][p1(1p1)+(1p2 ) ] ,
where n = minimum sample size , z = test statistic ( at 5% ) , p1 = proportion with desired characteristic ( 0.05 ) , z/2 = 1.96 , z1 , p1 = 0.63 , p2 = 0.28,n = ( ( 1.96 + 0.84)/(0.630.84))(0.63(1 0.63 ) + 0.28(1 0.28 ) ) = 27.14 = 28,final n = 28 + refusal rate ( refusal rate = 15% of n),n = 28 + 12.17 = 40.17 .
n = ( ( 1.96 + 0.84)/(0.630.84))(0.63(1 0.63 ) + 0.28(1 0.28 ) ) = 27.14 = 28 , final n = 28 + refusal rate ( refusal rate = 15% of n ) , n = 28 + 12.17 = 40.17 .
therefore overall minimum sample size = 80 ( 40 on haart and 40 haart - nave ) .
blood was drawn into plain tubes by a phlebotomist at the clinic during patients ' routine visits .
serum was aliquoted into 2 ml cryotubes and stored at 20c for up to 20 days .
serum samples were thawed once at room temperature , and analysis was carried out on a bs120 mindray chemistry analyzer .
the chemistry analyzer was calibrated , and then controls and samples were assayed for total calcium , magnesium , phosphate , and albumin . corrected calcium was calculated for participants with low albumin levels .
the mean assayed values for the female patients on haart ( together with the normal reference ranges ) were : total calcium 6.92 mg / dl ( reference range 8.809.50 mg / dl ) , magnesium 1.78 mg / dl ( reference range 1.462.68 mg / dl ) , phosphate 5.10 mg / dl ( reference range 1.805.10 mg / dl ) and albumin 2.87 mg / dl ( reference 2.805.30 mg / dl ) .
the means of the haart - nave women were ; total calcium 8.40 mg / dl , magnesium 2.55 mg / dl , phosphate 5.10 mg / dl and albumin 3.25 mg / dl .
there was no significant difference between total calcium levels in patients on haart and haart - nave patients .
however , the values of calcium for the two groups in our study fall below the normal range .
this contradicts with studies done in america where elevation in serum calcium levels in women on antiretroviral therapy including tenofovir was linked to an increase in bone loss .
our results seem to be in agreement with a different set of studies described in india that reported lower levels of the active form of vitamin d ( calcitriol ) , resulting in reduced intestinal calcium absorption .
their report , as we observed , described a decrease in serum calcium levels after haart initiation .
it becomes essential to measure levels of vitamin d in future studies , in order to answer the important question of whether haart affects bone metabolism via vitamin d. there were other interesting differences in serum bone profiles of the women in our study .
magnesium and albumin levels were within normal ranges for both groups of women , but the haart - experienced had lower magnesium and albumin levels than the haart - nave patients .
our findings for magnesium do not however agree with two studies : a brazilian study that showed hypomagnesaemia occurring in 29% of patients on antiretroviral therapy and a study done in nigeria that showed an elevation in serum albumin , months after antiretroviral therapy initiation .
our results for albumin do correlate with the findings of a study carried out in southern india , in which serum albumin levels were lower after antiretroviral therapy .
phosphate levels were elevated in haart - nave patients , and their levels were above the normal range whilst the haart - experienced women have on average phosphate levels that fall within normal ranges .
our study contradicts with studies which showed a link between use of tenofovir and hypophosphatemia and studies done in america that showed a decrease in serum phosphate due to reduced renal retention .
it is important to improve this study by increasing the number of study sites , increasing the power by enlarging the sample size , and also measuring the levels of vitamin d ( calcidiol or calcitriol ) .
the results of this and future studies will be used to advocate for change in practice in treatment of hiv - infected women on haart .
clinicians and decision makers may have to consider giving patients on haart vitamin d supplements to avoid weakening of bones in zimbabweans on haart .
another study involving both men and women is also necessary in order to determine what serum bone profiles changes may be happening in men due to hiv infection and/or haart .
is serum bone profiling a potentially noninvasive , inexpensive method that can be used routinely to detect changes in bone metabolism in the hiv infected patients in our resource - limited setting ?
this study shows evidence of changes in serum bone profiles . a larger study that also aims to determine association between serum bone profiles and measurement of the who gold standard ( mineral bone density ) may help answer that question . | antiretroviral therapy inhibits hiv replication , maintains health , and preserves life .
however , both antiretroviral therapy and hiv infection have been reported to have short- and long - term effects on bone metabolism .
a cross - sectional study was performed to compare serum bone profiles in hiv positive patients on highly active antiretroviral therapy and compare them to therapy - nave patients .
serum levels of calcium , magnesium , phosphate , and albumin were measured in 40 female participants on highly active antiretroviral therapy , recruited sequentially from parirenyatwa opportunistic infections clinic , harare , zimbabwe .
the 40 women were matched for age with 40 antiretroviral therapy - nave women .
magnesium , phosphate , and albumin levels were significantly higher in the therapy - nave than in therapy - experienced patients .
there was no statistically significant difference in calcium levels of the two groups of women .
evidence from this study suggests that highly active antiretroviral therapy lowers levels of magnesium , phosphate , and albumin but has no effect on levels of serum calcium . | 1. Introduction
2. Materials and Methods
3. Results
4. Conclusion |
a male patient ( 165 cm in height , 61 kg and 62-year - old ) was transferred to our hospital because of the chief complaint of back pain .
the back pain had developed approximately 2 months previously without specific trauma , and the area around the left buttock was most painful .
the pain worsened while standing up and turning around , and it was improved while lying down .
there were no findings of radicular pain , costovertebral tenderness or spinal tenderness , and the muscle strength of both low extremities was grade 5 , which was normal .
the patient was hospitalized for the evaluation of renal function and treatments because of the elevated cpr .
the patient had been hospitalized at the a hospital for back pain 2 months previously and bulging discs ( l3/4 , l4/5 ) were detected by lumbar magnetic resonance imaging ( fig .
1 ) . hypoxia and fever had developed during the hospitalization ; atypical pneumonia was suspected and he had received treatment .
nonetheless , the pain and other symptoms had not improved and so he was transferred to the b hospital .
he was diagnosed with possible scrub typhus , doxycycline was prescribed and the fever subsided and he was discharged after one week . at that hospital , he was diagnosed as suffering from chronic renal failure caused by glomerulonephritis .
the back pain was diagnosed as l4 - 5 facet pain and so a lumbar median branch block was performed . after he initially improved 10 - 20% for 3 days , the back pain recurred and persisted until the time of transfer to our hospital . for his past medical history ,
the vital signs of the patient at the time of transfer were a blood pressure of 115/90 mmhg , a pulse rate of 68 beats / min , a respiratory rate of 18 breaths / min and the body temperature was 36.4. the blood test of the patient showed that the number of leucocytes and the crp level were normal , and the esr was elevated to 49 mm / hr . first , a diagnostic epidural block was performed using a c letter type image intensifier ( oec 9800 plus , ge medical system , usa ) .
epidural block in the left l 4 - 5 interlaminar space was performed and 10cc of 0.125% ropivacaine and 20 mg tamceton were injected . the next day after the epidural block ,
since the symptoms of the patient and the findings of the previously performed lumbar mri did not concur , magnetic resonance imaging was performed again after 2 days .
a paravertebral abscess and findings of infective spondylitis were detected on the lumbar magnetic resonance imaging ( fig .
an aspiration culture test was performed for the abscess and salmonella group d was cultured .
the patient was finally diagnosed with salmonella spondylitis , and ceftriaxone was administered according to the results of the antibiotic sensitivity test .
the symptoms of the patient and the results of the hs - crp then showed a tendency to improve . during the administration of antibiotics , there was persistent deterioration of the kidney function and uremia symptoms developed , and so hemodialysis was performed . despite the administration of appropriate antibiotics , the patient showed intermittent fever and a trend for increased pain .
mri follow - up was performed 4 weeks after the administration of antibiotics , and the abscess was shown to have increased in size .
afterward , at that hospital , the patient was treated with a combination of ciprofloxacin and ceftriaxone without surgery for 4 weeks , and then he was again transferred to our hospital because it is located in his hometown .
thirteen weeks after the administration of antibiotics , his back pain was much improved ( vnrs : 1/10 ) and he was able to walk . on the blood test , the hs - crp level was 0.34 mg / dl .
on the lumbar mri , the abscess showed improvement and so the antibiotics were terminated . the patient is currently under follow - up observation at our outpatient clinic ( fig .
when a patient is transferred from another department for pain , the patient is examined during the mid course of disease , and so it is difficult to understand the overall problems of the patient . for our patient ,
nonetheless , his fever was diagnosed as possible atypical pneumonia and scrub typhus . after taking various antibiotics and anti - inflammatory agents ,
the blood culture test was negative and so the diagnosis of back pain was delayed . at the time of transfer , his back pain was severe , but any fever was not detected . on the blood test results ,
the leukocyte count and hs - crp level showed normal findings and this made it difficult to suspect infection .
furthermore , bulging discs were detected on the lumbar mri that was previously performed and a diagnostic epidural block was then done .
an epidural block can suppress selective pain pathways ; hence , it is frequently used for the diagnosis and treatment of acute and chronic pain .
however , the symptoms were not improved after the lumbar epidural block ; lumbar mri was performed again and infective spondylitis as well as a psoas abscess were shown .
an aspiration test was performed on the paravertebral abscess , salmonella group d was cultured , and the man was diagnosed with salmonella spondylitis .
it has been reported that salmonella bacteria is the causative bacteria in less than 1% of the cases of hematogenous spondylitis and it rarely causes spondylitis in humans .
it develops in the spine in the order of the lumbar vertebras and the thoracic vertebras .
the risk factors are sickle cell anemia , hemoglobinopathies , underlying bone diseases , chronic liver diseases , connective tissue diseases , malignant tumors , the use of steroids , old age , diabetes , etc . .
it has been reported that in sickle cell anemia patients , more than 70% of the spondylitis is caused by salmonella , and it has rarely reported in patients without sickle cell anemia [ 5 - 7 ] . in patients with normal immune function ,
the major symptoms of salmonella spondylitis are back pain ( 100% ) , fever ( 75% ) , elevation of the esr and elevated c - reactive protein levels ( crp ) .
an elevation of the leukocyte count has not been consistently reported and the blood culture was positive in approximately 75% of patients [ 5 - 7 ] .
nonetheless , the diagnosis of fever varied and several antibiotics were administered resulting in the alteration of the typical findings , and so the diagnosis became difficult . in patients with salmonellosis , the symptomatic period has widely varied from 10 days to 12 years , and it is on average 8 weeks . it has been reported that after the first infection with salmonella , the infection may remain as the latent form for a long time , and when the function of reticular endothelial cells is deteriorated , it may become activated and consequently , it may secondarily induce metastatic infection in the bone several months or several years after acute salmonellosis .
low signal intensity on t1wi and high signal intensity on t2wi were shown as the typical pattern of mri . nevertheless , negative mri findings during the initial period of disease have been reported .
hence , for cases that infective spondylitis is suspected clinically according to the blood tests , it is recommended to perform mri at a minimum interval of 2 weeks .
our patient also did not show special findings , except bulging discs , on the lumbar mri during the initial period , and spondylitis was shown on the mri performed again after 2 months .
we can speculate that the incubation period for salmonella is long , and so our patient was shown to be negative on the mri taken during the early symptomatic period .
so , if the symptoms of a patient persist or are vague , then a re - work up process may be required .
salmonella spondylitis can be diagnosed by culture tests of blood , feces , bone , abscess , etc . .
fifty - two percent of the reported cases were diagnosed by tissue culture of bone or abscess , 48% of the cases were diagnosed by blood culture and the fecal or urine culture tests were shown to be positive in 36% and 23% of the cases , respectively . for our case ,
the blood culture test was negative because the patient took antibiotics for an unknown fever .
however , salmonella was identified on the abscess culture test and so the patient was diagnosed . in regard to complications , paravertebral abscess is present in 39% of the cases , epidural abscess is present in 4% , abscess in the spleen is present in 2% and infective aortic aneurysm is present in 28% .
salmonella is a common causative bacteria for inducing infectious aortic aneurysm and it induces spondylitis at the adjacent spine .
when the aorta or spine is infected first , the septic embolus is lodged in the vasa vasorum and the infection travels along the outside of the adjacent blood vessels to the adjacent organs ; infectious aortic aneurysm and spondylitis occur simultaneously in many cases . in our patient 's case ,
surgery was performed for a ruptured aortic aneurysm 10 months prior to the diagnosis of salmonella spondylitis .
considering the long incubation period of salmonella , the ruptured aortic aneurysm may have been due to salmonella .
in addition , pneumonia and subacute renal failure may be complications of salmonella bacteremia . spondylitis accompanied with abscess in the psoas muscle is a common complication of salmonella bacteremia , which was also observed in our case .
salmonella is classified to subgroups according to the surface antigens , and particularly depending on the o antigen , it is classified into the a to e group . in the korean reports ,
salmonella spondylitis was primarily caused by the d group , and this was also true for our patient .
the primary treatment is appropriate antibiotics based on the results of the culture test and also appropriate drainage of any abscess in the adjacent organs .
surgical treatments are required for the cases with osseous instability , neurological deficits , clinical unresponsiveness to antibiotics , refractory infection and the failure of biopsy to provide a firm diagnosis .
the length of the treatment period is still controversial , but more than a minimum of 4 weeks is required .
improvement of the clinical symptoms and reduction of the c - reactive protein values are the major indexes of the treatment response .
if the infection is not improved after 4 weeks of treatment , then an epidural abscess should be suspected , and repeat imaging is useful for the patients who improve without drainage treatment despite the presence of a big abscess , and termination of antibiotic treatments should then be considered .
salmonella spondylitis responds well to the appropriate antibiotics and it is completely cured in 76% of the patients . on the other hand , in approximately 17% , the condition appears to progress to chronic spondylitis .
the prognosis has been shown to be good for young patients who are without preceding factors .
this patient was also a patient without preceding factors and he improved with only antibiotic treatment . in conclusion ,
our case was a patient with back pain that persisted for longer than 2 months .
the lumbar mri was negative in the initial period and since antibiotics were administered for fever , the diagnosis of salmonella spondylitis was delayed . assessing the comprehensive disease history and performing a diagnostic nerve block are necessary for the patients who are transferred from another department .
if the treatment effects are atypical , then more comprehensive tests are required for making the diagnosis . | salmonella spondylitis is a rare illness , and it generally occurs in patients who have already had sickle cell anemia , and it is even rarer in patients who are without sickle cell anemia .
a 61-year - old male patient was hospitalized for the evaluation of his renal function and then treatment was started for his back pain .
his back pain had developed about 2 months previously without any specific trauma .
only a bulging disc was detected on the initial lumbar mri .
regarding his fever , it was diagnosed as possible atypical pneumonia , scrub typhus , etc . , and
multiple antibiotic therapy was administered . at the time of transfer ,
the leucocytes and hs - crp were normal and the esr was elevated .
a diagnostic epidural block was performed for his back pain , but his symptoms were not improved .
lumbar mri was performed again and it showed findings of infective spondylitis .
salmonella d was identified on the abscess culture and so he was diagnosed as suffering from salmonella spondylitis .
after antibiotic treatment , his back pain was improved and the patient was able to walk . | Case Report
Discussion |
cerebral palsy is a clinical syndrome where permanent disorders in development of posture
and movement are caused by non - progressive disturbances occurring in the brain of fetus or
infant producing activity limitation , and is frequently accompanied by disorders in
sensation , cognition , communication , perception , and conduct as well as seizure , etc1 .
since the cerebral palsy has diversified
characteristics in muscle tone and form of movement disorder due to brain damages2 , it can be classified into spastic type
( 6070% ) , dyskinetic or athetoid type ( 2030% ) , ataxic type depending on the predominant
abnormal movement3 .
thus , movement
disorders as a function of diversified types of children with cerebral palsy induce
secondary complications and functional activity limitations related to skeletal muscles
system , and also affect respiratory function4 , 5 .
whereas normal respiration requires normal functions of nervous system , respiratory
muscles , and costovertebral joint , the children with cerebral palsy have weak muscular
strength of the whole body including respiratory muscles , and fail to properly remove airway
secretions due to spasm so that abnormal respiratory functions such as pneumonia ,
atelectasis , epipahryngitis , etc .
also , pulmonary functions are reduced as
abnormal respiration methods such as shallow breathing , reverse breathing pattern of
children with cerebral palsy over a long period shorten respiratory muscles , and induce
stiffness in costovertebral joint to limit thoracic cage mobility8 . therefore , although the children with cerebral palsy do not
have practical problems with lung , weakening of respiratory muscles due to neurological
damages causes reduction in thoracic cage compliance , ventilator failure , degradation in
airway clearance capacity leading to a decrease in lung volume , resulting in long - term
hospitalization or mortality increase due to respiratory diseases7 , 9 , 10 . according to the recent studies , the children with
cerebral palsy are exposed to not only pulmonary function disorders but practically risks of
pulmonary diseases6 , 11 , and many previous studies stated that the correlation between
motor function disorders and respiratory functions was high12,13,14 . since respiratory muscles are essential to functional body movement and contribute to air
inflow and discharge of the lung , ventilation function is reduced so as to obstruct lung s
gas exchange when such pump action is weakened15 .
therefore , to improve respiratory functions important for heart
and lung capacities , training for respiratory muscles is also as important as in other
skeletal muscles .
respiratory training improves not only the muscle strength and endurance
but also the sense of wellbeing in daily living16 , and may affect changes in maximal inspiratory pressure and maximal
expiratory pressure17 , 18 .
therefore , functions of respiratory muscles can be
evaluated through mechanical measurement of maximal inspiratory pressure and expiratory
pressure in the state of biting a mouthpiece with lips to prevent escape of air held inside
the mouth . according to the previous studies , measurement of maximal inspiratory pressure
and expiratory pressure
was said to have more value in evaluating the function of
respiratory muscles while measurement of pulmonary function is very important for clinical
usefulness19 , 20 .
therefore , the purpose of this study was to determine differences in respiratory function
and pressure among three groups of children with cerebral palsy as a predominant abnormal
movement which included spastic type , dyskinetic type , and ataxic type .
it was also
conducted to provide clinically more useful basic data concerning where to put the emphasis
in conducting respiratory training as a predominant abnormal movement in order to prevent
worsening of pulmonary function of the children with cerebral palsy .
the present study was conducted to compare differences in respiratory function and pressure
among three groups of spastic type , dyskinetic type , and ataxic type , and was approved in
advance by the bioethics committee of dong - eui university ( irb no .
forty - three children with cerebral palsy as the study subjects were divided by stratified
random sampling into three groups of spastic type , dyskinetic type , and ataxic type .
the
detailed selection criteria for the subjects were first , the children of 513 years of age
having been diagnosed as cerebral palsy by specialized doctors in the department of
rehabilitation medicine / neurology ( neurosurgery ) ; secondly , the children in i iii levels
according to the gross motor function classification system ; thirdly , the children capable
of task perform per directions given by the investigator and of appropriate communication .
first of all ,
subject consent for voluntary participation was received after a sufficient
explanation was given to the study subjects and the guardians ( legal representative )
concerning study objectives and methods , risks or inconveniences . for reliability of the measurement results , respiratory function and pressure of the
children with cerebral palsy
were measured by the same inspector using spirometer pony fx
( cosmed ltd . ,
italy ) equipment , and the subject s custodian ( legal agent ) was always made to
observe . after checking first that health state of the children with cerebral palsy was
satisfactory ,
the inspector conducted repeated education to ensure that measurement methods
were sufficiently recognized allowing accurate performance .
the cerebral palsy child stared
at the front sitting on a chair having back rest in the most convenient clothes for
activity , and participated in the measurement of respiratory function and pressure . for respiratory function
, the best measurement result was selected after repetition of more
than 3 times so as to have no coughing , no air leaks , no false start , etc .
according to the
guideline by american thoracic society ( ats ) ( 1991 ) .
after having the subject breathe air in
and out most deeply and rapidly following normal respiration for 34 times as in daily
living , forced vital capacity ( fvc ) , forced expiratory volume at one second ( fev1 ) , and peak
expiratory flow ( pef ) were measured .
respiratory pressure was measured after sufficient rest
was taken following the test on respiratory function . with a mouthpiece bitten
so as to
prevent escape of air by maximum adherence to the lips , maximum expiration and inspiration
was enforced after usual respiration . for the maximal inspiratory pressure ,
the subject was
made to continue inspiration most deeply and rapidly for more than 2 seconds until the
signal sound is heard at the same time as attaching the nose plugs upon maximum expiration
so as to be close to residual volume . for the maximal expiratory pressure ,
the subject was
made to continue expiration most deeply and rapidly for more than 2 seconds until the signal
sound is heard at the same time as attaching the nose plugs upon maximum inspiration so as
to be close to the total lung capacity .
the data collected in the present study was analyzed by using spss 22.0 ( ibm corp .
, usa )
for windows program , with the significant level for statistical verification set to be
0.05 . as the general characteristics for the study subjects , frequency and descriptive
statistics were calculated , and parametric method was implemented after checking for
normality of the measured variables through kolmogorov - smirnov analysis .
to compare
differences in respiratory function and pressure among three groups of spastic type ,
dyskinetic type , and ataxic type as a predominant abnormal movement forms , one - way anova was
conducted , and bonferroni analysis was used for post - hoc .
general characteristics and medical history of the study subjects are shown in table 1table 1.general characteristics and medical history of the subjects ( mean sd)variancesmean sdspastic ( n=28)dyskinetic ( n=9)ataxic ( n=6)general characteristicsgender ( boys / girls)13/155/44/2age ( years)7.61 2.787.44 2.888.33 1.86height ( cm)114.6 15.8120.9
16.0120.5 11.9weight ( kg)22.7 8.224.2 7.123.2 6.3medical historydelivery ( nsvd / c - sec / induced delivery)16/9/22/4/34/3/2pregnancy week ( weeks)34.0 3.937.8 3.632.0 2.8birth weight ( g)2,352.1 564.62,991.1 626.72,045.7 490.5incubator care ( weeks)7.9 13.91.7 2.77.3 5.6nsvd : normal spontaneous vaginal delivery , c - sec : cesarean section .
no significant differences in the variables of general characteristic and
medical history were observed among three groups ( p<0.05 ) .
the analysis results for
comparison of averages of respiratory function and pressure among three groups of spastic
type , dyskinetic type , and ataxic type as a predominant abnormal movement of the children
with cerebral palsy are presented in table
2table 2.the comparison of respiratory function and pressure in the different
groupsvariancesmean sdspastic ( n=28)dyskinetic ( n=9)ataxic ( n=6)respiratory functionfvc ( l)*1.63 0.101.40 0.121.06 0.12fev1 ( l)*1.56 0.081.28 0.141.06 0.19pef ( l / sec)*2.79 0.272.39 0.482.01 0.33respiratory pressuremip ( cmh2o)*30.55 5.5237.90 3.4524.39 3.44mep ( cmh2o)40.85 9.5238.71 7.4238.73 10.40*p<0.05 .
fvc : forced vital capacity , fev1 : forced expiratory volume in one second , pef : peak
expiratory flow , mip : maximal inspiratory pressure , mep : maximal expiratory
pressure .
significant difference between spastic type and dyskinetic type ,
significant difference between spastic type and ataxic type ,
significant difference between dyskinetic type and ataxic type . in the respiratory function
, there were significant differences among three
groups in all of forced vital capacity , forced expiratory volume at one second , and peak
expiratory flow ( p<0.01 ) .
according to the post - hoc results , the forced vital capacity
and the forced expiratory volume at one second showed a significant difference between
spastic type and dyskinetic type , between spastic type and ataxic type , and between
dyskinetic type and ataxic type , respectively .
although the peak expiratory flow showed no
significant differences between spastic type and dyskinetic type , and between spastic type
and ataxic type , it showed a significant difference only between dyskinetic type and ataxic
type . for respiratory pressure ,
the maximal inspiratory pressure had significant differences
among three groups ( p<0.01 ) , although the maximal expiratory pressure had no significant
difference . according to the post - hoc results
, significant differences were observed between
spastic type and dyskinetic type , between spastic type and ataxic type , and between
dyskinetic type and ataxic type .
nsvd : normal spontaneous vaginal delivery , c - sec : cesarean section * p<0.05 .
fev1 : forced expiratory volume in one second , pef : peak
expiratory flow , mip : maximal inspiratory pressure , mep : maximal expiratory
pressure .
significant difference between spastic type and dyskinetic type ,
significant difference between spastic type and ataxic type ,
significant difference between dyskinetic type and ataxic type
although the brain damage itself is not a direct cause producing respiratory problems of
the cerebral palsy8 , the children with
cerebral palsy showed much lower values in not only general respiratory function but also
respiratory muscle strength which is very closely related to self - care activities and social
adaptiveness in daily living when compared with normal children21 . in a study of comparing respiratory function and pressure
for the children with cerebral palsy according to the gross motor function classification
system
, the children with cerebral palsy with low motor function were found to exhibit
relatively unsatisfactory pulmonary capacity and weakening of respiratory muscles11 .
also , even for the children with cerebral
palsy of spastic type , it was stated that significant differences existed in trunk
expansion , respiratory muscle strength , and pulmonary function depending the invasive part
for diplegia and hemiplegia22 , and that
muscle strength of respiratory muscles of the children with cerebral palsy should be
considered for establishment of intervention plans to improve functions in daily living ,
since it had positive correlations with self - management in activities of daily living and
performance level for social function23 .
however , since diversified clinical problems are revealed due to weakening of respiratory
muscles and damages to coordination exercise in the case of children with cerebral palsy ,
there is much difficulty in evaluation of respiratory capacity so that multi - faceted studies
are not being realized7 .
therefore , it is
considered clinically as a quite necessary study to find differences in respiratory function
and pressure after classification of the children with cerebral palsy showing diversified
qualitative movement characteristics in muscle tone and motion pattern according to the
predominant abnormal movement into three groups of spastic type , dyskinetic type , and ataxic
type . in the spastic type of cerebral palsy with high muscle tone ,
immature diaphragm respiration
occurs upon expiration due to stiff ribs and lack of spine mobility with rib cage not
expanding in front / rear , left / right , up / down directions , as a result of which forced vital
capacity and forced expiratory volume at one second were reduced .
also , since the maximal
inspiratory pressure is difficult to maintain due to the delay in diaphragm contraction , the
children with cerebral palsy of spastic type is considered to have attempted shallow and
rapid breathing . as repetition of such irregular respiration periods disables inspiration
for a long time , abilities to maintain peak expiratory flow and maximal expiratory pressure
the ataxic type showing fluctuation of muscle tone and involuntary movement is incapable of
having a fixed posture with a tendency of the control of coordination exercise being
difficult upon inspiration and expiration of thoracic and abdomen parts .
namely , since the
abdomen muscle is unconsciously activated whereas the thoracic muscle is mainly used for
auxiliary purpose in the ataxic type , other muscle groups are active with expiration when
one muscle group is engaged in inspiration action . in this way , unsynchronized movements
induced in abdominal muscles , diaphragm and thoracic muscles produce shallow , rapid and
uncoordinated respiration , while a platy upper rib cage and a small rib cage as a whole with
the sternum lowered and the lower rib flared in the shape of morning glory are formed .
the
ataxic type showed generally higher measured values for respiratory function and pressure
than the ataxic type although it had lower average values for forced vital capacity , forced
expiratory volume at one second and peak expiratory flow than the spastic type .
this
suggests that the spastic type has relatively better respiratory function and pressure than
the ataxic type since excessive co - contraction of the trunk helps stability although the
spastic type has insufficient selective movement due to high muscle tone whereas the ataxic
type has instability due to insufficient co - contraction of the trunk making respiration
difficult .
also , since the children of ataxic type has rapid and irregular respiration
occurring together with vocalization , they are characterized by speaking while inspiring or
momentarily producing explosive sounds .
the maximal expiratory pressure is considered to
have the lowest value as it is difficult to continuously produce sounds although the maximal
inspiratory pressure was shown to be the highest among three groups .
the ataxic type has a lower capacity to maintain the posture against gravity since the
muscle tone as a whole is in the lower state than the normal .
also , since very shallow
inspiration is observed due to the lack of co - contraction of trunk muscle , it is considered
that general respiration function and pressure were shown to be the lowest compared with the
spastic type and the dyskinetic type . in the present study , the ataxic type was observed to
have a higher maximal expiratory pressure than the dyskinetic type , which is considered
attributable to the long stretched pronunciation when the child of ataxic type speaks . in the present study , respiratory function of the children with cerebral palsy
was observed
to show significant differences among three groups in all of forced vital capacity , forced
expiratory volume at one second , and peak expiratory flow , with the ataxic type showing the
lower values than the spastic type as well as the dyskinetic type .
also , although all
measured values of maximal expiratory pressure and respiratory pressure were similar for
three groups , the ataxic type showed the lowest maximal inspiratory pressure compared with
the dyskinetic type and the spastic type as in the respiratory function .
therefore ,
pediatric physical therapists could be provided with important clinical information in
understanding the differences in respiratory function and pressure for the children with
cerebral palsy showing predominantly abnormal movement as a diverse qualitative
characteristics of the muscle tone and movement patterns , and in planning intervention
programs for improvement of respiratory capacity . | [ purpose ] the purpose of this study was to determine differences in respiratory function
and pressure among three groups of children with cerebral palsy as a predominant abnormal
movement which included spastic type , dyskinetic type , and ataxic type .
[ subjects and
methods ] forty - three children with cerebral palsy of 513 years of age in i
iii levels
according to the gross motor function classification system , the study subjects were
divided by stratified random sampling into three groups of spastic type , dyskinetic type ,
and ataxic type . for reliability of the measurement results , respiratory function and
pressure of the children with cerebral palsy
were measured by the same inspector using
spirometer pony fx ( cosmed ltd . ,
italy ) equipment , and the subject s guardians ( legal
representative ) was always made to observe .
[ results ] in the respiratory function , there
were significant differences among three groups in all of forced vital capacity , forced
expiratory volume at one second , and peak expiratory flow . for respiratory pressure ,
the
maximal inspiratory pressure had significant differences among three groups , although the
maximal expiratory pressure had no significant difference .
[ conclusion ] therefore ,
pediatric physical therapists could be provided with important clinical information in
understanding the differences in respiratory function and pressure for the children with
cerebral palsy showing predominantly abnormal movement as a diverse qualitative
characteristics of the muscle tone and movement patterns , and in planning intervention
programs for improvement of respiratory capacity . | INTRODUCTION
SUBJECTS AND METHODS
RESULTS
DISCUSSION |
in 2010 , there were an estimated 35.6 million people in the world suffering from dementia .
this is an increasing problem ; 65.7 million dementia cases are expected by 2030 and 115.4 million by 2050 .
this growing problem presents a pressing need for ad treatments . repetitive transcranial magnetic stimulation ( rtms )
is a noninvasive technique that has been used as a treatment for several major neurological and psychotic disorders such as parkinson 's disease , depression , and schizophrenia in the last decade ; it is currently being investigated as a treatment for ad .
the process of applying rtms involves a rapidly varying magnetic field , which can be used to modulate the firing of neurons on the outer surface of the brain .
it has been shown that rtms can either stimulate or inhibit cortical areas within the focal area of the coil [ 3 , 4 ] .
often , rtms treatments can be separated into two groups : high - frequency rtms ( 1020 hz ) and low - frequency rtms ( 1 hz ) .
the high - frequency rtms is generally considered to be more excitatory , while the low - frequency rtms is inhibitory , although this may vary between individuals .
the mechanism through which rtms affects the brain is thought to be long - term potentiation / depression ( ltp / ltd ) .
there have been a number of studies investigating rtms as a treatment for cognitive decline in ad .
a comprehensive review of these studies can be found in [ 7 , 8 ] .
these papers conclude that there is promise for the use of rtms to treat ad , but that further study is required .
specifically , action and object naming has been shown to improve during rtms treatments [ 9 , 10 ] , auditory sentence comprehension is improved up to eight weeks after rtms treatment , high - frequency rtms can improve cognitive skills in patients for up to 3 months , and rtms combined with cognitive training produces long - lasting improvements in a variety of cognitive measures .
while these results are promising , they are still preliminary , and much further research is needed to confirm their results .
the purpose of this paper is to discuss the complications of comorbid depression on investigations of rtms as a treatment for ad .
the prevalence of comorbid depression among dementia patients has been reported as 19% in one study and up to 68% in another . while some previous studies explicitly excluded depressed patients [ 911 ] , others did not [ 12 , 13 ] perhaps due to lack of subjects excluding the comorbid syndrome . in order to properly understand the effects of rtms on ad patients ,
in the studies of rtms treatments for ad patients , the dorsolateral prefrontal cortex ( dlpfc ) has been commonly used as the stimulation site [ 912 ] , although at least one study also stimulated other brain regions . due to its interconnectedness with other brain regions
this region coordinates functions with the rest of the brain , knows where specific information is stored , and can assess when information is needed .
the dlpfc also helps to shift between tasks and therefore has a role in working memory .
further , it has a role in choice and decision - making . in early dementia
, there are often problems with both working memory and adaptive decision - making , leading to the conclusion that the dlpfc is affected by dementia .
the most common application of rtms clinically is for treatment of major depression . as with ad , the dlpfc
this is because in depressed patients there is often a decrease in glucose uptake and blood flow in the left dlpfc , and by stimulating the left side or inhibiting the right side , the activity on both sides of the brain is equalized , producing antidepressant effects .
a review published in 2011 suggested the optimal specifications for the use of rtms as a treatment for depression .
these specifications are very similar to those used in the rtms studies to treat ad ( see table 2 ) .
the motor threshold intensities used to treat dementia vary from 90% to 110% , similar to the suggested 90%120% intensity range for depression .
the suggested frequency for depression treatment is 520 hz , and frequencies of 10 hz and 20 hz [ 912 ] have been used for dementia treatment . for depression , 5 treatments per week for 29 weeks are recommended .
the studies for dementia have implemented similar treatment schedules , including 5 sessions per week for one week , 24 weeks , and 6 weeks , occasionally with maintenance treatments and follow - up assessments [ 11 , 12 ] . due to similar rtms treatment protocols , antidepressant effects
for instance , in a comparative study of high - frequency and low - frequency rtms for ad patients , high - frequency rtms yielded significant improvements in the geriatric depression scale , in addition to improvements in the mini - mental state examination and instrumental daily living activity scale . in three of the five studies considered in this paper [ 911 ] ,
patients with major depression were excluded , and therefore the positive effects were likely not caused by the antidepressant nature of the treatments . in a study that incorporated cognitive training ,
these cases were mild and controlled by medication , and 4 of these patients were in remission from their depression .
a comparative study between high - frequency and low - frequency rtms as a treatment for ad did not specify the inclusion or exclusion of depressed patients , but the authors noted that approximately 40% of ad patients experienced depressive symptoms .
furthermore , one of the rating scales used for that study was the geriatric depression scale ( gds ) , and the patients improved in the gds as a result of treatments .
five studies which apply rtms to patients with alzheimer 's disease have been conducted [ 913 ] and are described below .
the first studies [ 9 , 10 ] considered the effects of rtms on action and object naming , while the third considered the effects on language production and comprehension .
another study aimed to treat ad using rtms combined with cognitive training , and the fifth study investigated the cognitive improvements associated with rtms . in a study in 2006 , rtms was applied to 15 patients with mild - to - moderate cognitive decline ( probable dementia ) , and the effects were assessed by testing object and action naming during stimulation .
the results showed that action naming performance was better during both left and right dlpfc stimulation compared to the sham stimulation .
there was no significant increase in the performance seen for object naming . in a follow up
study in 2008 by the same group , rtms was applied to 24 ad patients : 12 with moderate - to - severe ad , and 12 with mild ad .
the results showed that rtms application to the dlpfc improved both action and object naming for moderate and severe ad patients but improved only action naming for mild ad patients . the same group conducted a further study to assess whether rtms caused cognitive improvements in language production and/or comprehension in ad patients , and also to observe whether or not the improvements persisted after stimulation .
ten patients with probable moderate ad , and without major depression , were recruited and separated into two groups : one receiving 2 weeks of treatment and the other receiving 4 weeks of treatment .
the study also found that the patients with 4 weeks of treatment did not show significantly higher improvements than patients with 2 weeks of treatment . in a recent study ,
high - frequency rtms was applied in conjunction with cognitive training ( cog ) , with the goal of treating ad patients .
this treatment ( rtms - cog ) was applied to 8 patients with probable early or moderate ad .
the trial consisted of daily treatments ( 5 days per week ) for 6 weeks , followed by maintenance sessions ( 2 days per week ) for 3 months .
six brain regions were stimulated : broca and wernicke , right and left dlpfc , and right and left parietal somatosensory association cortex ( r - psac , l - psac ) .
the brain areas were stimulated separately , 3 regions per day , every other day . the results showed a significant improvement in ad assessment scale - cognitive ( adas - cog ) scores after the 6 weeks of treatments .
it should also be noted that 6 of the 8 patients had a history of depression , although 4 of these were in remission . in another recent study ,
another group carried out a comparison of high - frequency ( 20 hz ) and low - frequency ( 1 hz ) rtms in probable ad patients applied bilaterally over the dlpfc .
forty - five patients diagnosed with probable ad ( 32 mild to moderate , 13 severe ) were randomly separated into 3 groups : 15 patients received high - frequency treatments ( 20 hz ) , 15 patients received low - frequency treatments ( 1 hz ) , and 15 received sham treatments .
depressed patients were not explicitly excluded ; however , measures of depression were evaluated during the study .
assessments took place before and after the treatment plan , in addition to 1 month and 3 months after the last session .
the results showed a significant improvement in the mini - mental state examination ( mmse ) , instrumental daily living activity scale ( iadl ) , and geriatric depression scale ( gds ) for high - frequency treatments with moderate - to - mild ad patients .
the high - frequency rtms treatment yielded significantly more improvement in all rating scales compared to the low - frequency rtms treatment and sham treatment .
a comparison summary of the rtms protocols for the five aforementioned studies can be found in table 1 .
there is some concern that the beneficial results observed in ad patients undergoing rtms treatments are due to the antidepressant effects of rtms .
as outlined in the previous section , the use of rtms to treat depression is very similar to the protocol used to treat ad .
therefore , it is likely that for patients with comorbid depression the depression was treated during rtms sessions .
however , some of the aforementioned studies excluded patients with major depression [ 911 ] , which may address this concern .
several studies have considered the frequency of comorbid depression and dementia and the relationship between the two symptoms .
a recent study conducted in dutch psychogeriatric nursing home wards found that , out of 496 psychogeriatric residents , 96 ( or 19% ) were found to have comorbid depression and dementia ( stages 26 ) .
another study followed 670 outpatients with probable ad and found that 26% of the patients had major depression , 26% had minor depression , and 48% were not depressed .
a comparison of depression patients with reversible cognitive impairment ( rci ) and with no cognitive impairment ( nci ) found that , within 57 years , 71.4% of the rci group developed dementia , compared to only 18.2% of the nci individuals .
( rci describes depressed patients who are first diagnosed with dementia but , upon treating for depression , show significant cognitive improvement . )
the authors suggest that chronic depression may lead to dementia because of its effects on the brain ( vascular effects , excessive release of corticosteroids , and hippocampal deterioration ) .
another study following 1,239 older individuals ( baseline age 55.5 18.8 years ) found that the risk of developing dementia increased by 87% for participants who had experienced 1 episode of elevated depressive symptoms ( eds ) over the years of followup ( median of 24.7 years ) , and nearly doubled for participants who had experienced 2 or more eds .
as noted by the authors , these results support the hypothesis that , in some cases of major depression , there is an excessive release of glucocorticoid ( a type of corticosteroid ) , causing overstimulation of hippocampal glucocorticoid receptors , leading to the death of neurons in the hippocampus .
further , a study of 949 framingham heart study participants found that , over a 17-year follow - up period , 164 participants developed dementia ( 136 cases of ad ) . among those depressed at baseline ,
21.6% had developed dementia , compared to 16.6% of the participants who were not depressed at the baseline .
the authors propose that chronic inflammatory changes associated with depression may increase the likelihood of developing dementia and ad .
vascular factors may also play a role , as well as lifestyle factors associated with depression .
from the five studies that have applied rtms to ad patients , it seems clear that high - frequency rtms applied to the dlpfc presents a possible treatment tool for ad .
more studies should be conducted with larger populations to verify the results of these studies , and take into consideration the antidepressant effects of rtms and how they may be causing the observed cognitive improvements . in particular ,
care should be taken in all future studies to separate the results from patients with depression or a history of depression from other results .
this will ensure that any confounding factors relating to cognitive improvements from the treatment of depression are fully understood .
in addition , it seems likely that some cases of depression may lead to dementia later in life .
positive results have been found using rtms as a treatment for both depression and dementia patients with similar application techniques .
therefore , treating dementia patients with rtms may not only improve cognitive abilities , but also have antidepressant effects for those who are suffering from comorbid depression .
in addition , it is possible that by also treating the depressive symptoms of dementia patients , further damage to the brain from depressive effects could be slowed . in order for these exciting possibilities to be explored , we should ensure that we fully understand both the cognitive and antidepressant potential of rtms . | with an ever - increasing population of alzheimer 's disease ( ad ) patients worldwide , a noninvasive treatment for ad is needed . in this paper , the application of repetitive transcranial magnetic stimulus ( rtms ) as a treatment for patients with probable ad is compared to the application of rtms as a treatment for depression .
comorbidity of depression and dementia is discussed , as well as possible links between the two diseases .
the possible confounding antidepressant effects of rtms on cognitive improvements in ad patients are discussed . | 1. Introduction
2. Similarities in rTMS Protocols for Treatment of Dementia and Depression
3. rTMS Study Protocols and Results
4. Comorbidity of Depression and Dementia
5. Conclusion |
trisomy 21 ( also referred to as down syndrome ) is the most frequent chromosomal abnormality at birth .
it affects approximately one in every 800 newborns 1 . in france , prenatal diagnosis is always suggested when indicated by ultrasound findings and maternal serum marker assays .
about 92% of cases of down syndrome are due to the presence of an extra , free chromosome 21 in all cells , whereas 23% are due to mosaicism and 56% are due to unbalanced heterologous or homologous acrocentric rearrangements ( of which rob(14;21 ) and rob(21;21 ) are the most common ) . around 70% of rob(14;21 ) rearrangements are de novo , and this value is over 95% for rob(21;21 ) 2,3 .
prenatal diagnosis of recurrent down syndrome due to unbalanced , de novo homologous acrocentric rearrangement is rare . here
, we report on an exceptionally rare case : a recurrent rea(21;21 ) down syndrome that was probably caused by maternal germ - line cell mosaicism of the rearrangement . a 27-year - old woman
( gravida 2 para 1 ) requested a prenatal diagnosis after the detection of increased nuchal translucency in the fetus .
their first pregnancy had been uneventful and the infant ( a girl ) was healthy .
chorionic villus sampling at 13 weeks of gestation ( w.g . ) revealed an abnormal karyotype , with a rearrangement between two chromosomes 21 ( compatible with a rob(21;21 ) event ) on the 16 metaphases analyzed .
karyotyping enabled us to diagnose down syndrome in a female fetus ( 46,xx,+21,rob(21;21)(q10;q10 ) ) . following a request by the couple
given that ( 1 ) the parents ' first child was healthy , ( 2 ) the parental karyotypes ( in blood lymphocytes ) were normal , and ( 3 ) the vast majority of rob(21;21 ) are de novo , the subsequent genetic counseling was reassuring with regard to future pregnancies .
the patient requested a prenatal diagnosis because of increased nuchal translucency and distended jugular lymphatic sacs .
chorionic villus sampling at 13 w.g . revealed rob(21;21 ) down syndrome , with a 46,xy,+21,rob(21;21)(q10;q10 ) karyotype on the 15 metaphases analyzed .
the pregnancy was subsequently terminated . in order to determine the parental origin of this apparently recurrent rob(21;21 ) , we performed a microsatellite marker analysis ( focusing on two shorts tandem repeats : the d21s11 and penta d loci on chromosome 21 ) in the fetus and parents .
this showed that the rearrangement involving chromosomes 21 was an isochromosome 21 of maternal origin , rather than a rob(21;21 ) ( fig.1 ) . with a view to detecting potential low - grade mosaicism in peripheral blood cells from the mother ,
we performed fish analysis ( focusing on dscr1 locus on 21q22 ) of 1000 interphase nuclei ; all were normal .
representative electrophoretograms ( using the microsatellite markers d21s11 and penta d ) for the couple and the aborted male and female fetuses , suggesting an i(21q ) of maternal origin in the first ( female ) fetus and the second ( male ) fetus . considering the area under the curve , the electrophoretograms with the d21s11 marker revealed ( 1 ) a maternal duplication of allele 28 and a paternal allele 33.2 in the female fetus , and ( 2 ) a maternal duplication of allele 28 and a paternal allele 29 in the male fetus .
the area under curve for the penta d marker shows ( 1 ) a maternal duplication of allele 11 and a paternal allele 12 in the female fetus , and ( 2 ) the presence of three alleles in the male fetus ( a paternal allele 13 , a maternal allele 11 and an allele 12 whose origin can not be proven but which is very probably maternal , in view of the results for the d21s11 marker ) .
the results of these microsatellite marker analyses suggest that the i(21q ) is of maternal origin in both fetuses .
the karyotypes of the two aborted fetuses were thus determined to be 46,xx , i(21)(q10 ) and 46,xy , i(21)(q10 ) , respectively .
what mechanism led to the maternally confined mosaicism ? and what genetic counseling should be given to the couple 's healthy daughter ?
as mentioned in the introduction , about 95% of rob(21;21 ) translocations arise de novo 4 .
an isochromosome 21 ( i(21q ) ) is derived from replication of a single chromosome 21 , whereas a homologous rob(21;21 ) involves translocation between two different homologous chromosomes 21 .
conventional cytogenetic analysis is unable to distinguish between rob(21;21 ) and i(21q ) , and so the use of molecular assays of microsatellite markers is required . in the literature ,
most of the initial reports of rob(21;21 ) down syndrome feature an i(21q ) 5 .
found that 17 of 19 cases were i(21q ) , with roughly equivalent maternal ( n = 10 ) and paternal ( n = 9 ) inheritance .
when additionally considering four previous studies , 32 of 36 cases were found to be i(21q ) 57 .
again , the frequencies of maternally inheritance ( n = 17 ) and paternal inheritance ( 15 ) were equivalent .
kovaleva and shaffer 8 later analyzed published cases of rea(21;21 ) down syndrome and found that the prevalence of mosaicism among the parents was unusually high .
however , the recurrence rate for de novo rea(21;21 ) ( rob(21;21 ) or i(21q ) ) down syndrome is reportedly low .
9 studied 112 families in which the child 's down syndrome was caused by a de novo t(gq;gq ) event .
this event was a 21q21q translocation in 77 families , and none of the couples had a second pregnancy affected by down syndrome .
however , steinberg et al . identified three couples ( one mother and two fathers ) with low - grade mosaicism for rea(21;21 )
translocation down syndrome in blood samples and an additional couple in which the mother carried a pericentric inversion of chromosome 21 .
given that four of the 112 couples ( 3.6% ) had an abnormal karyotype , the researchers estimated the risk recurrence to be between 2% and 3.6% .
caution should be exercised when counseling that the recurrence risk of this event is remote . a few reports on couples experiencing recurrent de novo rea(21;21 ) down syndrome have demonstrated that mosaicism for rea(21;21 ) in the skin or ovaries of one parent was combined with normal or low - level mosaicism in blood lymphocytes 9 ( table1 ) .
reports of apparent de novo der(21;21 ) , parental mosaicism and the presence or absence of recurrence with regard to our present case ( with a healthy child born 2 years before the first i(21q ) event , the recurrence of a maternally inherited i(21q ) , and normal peripheral lymphocyte karyotypes in both parents ) , what advice should be given ?
since the occurrence of another fetus with the same karyotype can not be ruled out , preimplantation genetic screening may provide this couple with the certitude that a baby will be free of down syndrome .
even though we did not study the woman 's ovarian tissue , the features of the present case suggest the existence of germ - line cell mosaicism with at least three different oocyte populations : those containing a chromosome 21 ( giving rise to normal offspring ) , those containing an i(21q ) ( responsible for recurrent i(21q ) down syndrome ) , and those lacking a chromosome 21 ( responsible for the four miscarriages due to monosomy 21 ) .
however , the couple 's healthy daughter may have resulted from the rescue of an initial i(21q ) down syndrome zygote ( and thus will require careful genetic counseling ) or the rescue of a monosomy 21 .
one possible explanation for the occurrence of the maternal i(21q ) is the reduplication of one of the chromosomes 21 , forming a second trisomic cell line with an isochromosome ( 46,xx , i(21q),+21 ) .
subsequent rescue of the trisomy would have generated a third , balanced cell line with the isochromosome ( 45,xx , i(21q ) ) . in view of the present case and
the literature data , the vast majority of apparently de novo cases of rea(21;21 ) feature an i(21q ) with maternal or paternal inheritance .
recurrence of rea(21;21 ) down syndrome does not therefore appear to be such a rare event , with at least 14 recurrences in 105 reported 9 and documented cases ( table1 ) , that is to say an incidence of 13.3% .
we consider that ( 1 ) the previously reported recurrence rate of 2% is a marked underestimation and ( 2 ) that clinical practice and genetic counseling should be revised accordingly .
when parental mosaicism is evidenced by high - quality cytogenetic analyses , one can even question whether the first - reported cases of rea(21;21 ) in parents with an apparently normal karyotype were truly de novo . in line with kovaleva and shaffer 's report 8
, we recommend performing a dna microsatellite marker analysis as soon as rea(21;21 ) down syndrome is detected ; this should enable one to distinguish between a true rob(21;21 ) and an i(21q ) .
when an i(21q ) is detected , extensive cytogenetic analysis of at least 500 cells ( from a variety of tissues , if possible ) might enable the detection of low - grade parental mosaicism and thus the provision of appropriate genetic counseling for an inherited rearrangement . | key clinical messagewe report a rare case of recurrent trisomy 21 caused by an isochromosome 21q and what is very likely to be maternal germ - line cell mosaicism . over 90% of cases of rob(21;21 ) reported in the literature
are due to an isochromosome 21q , with a risk of recurrence of more than 10% . | Introduction
Conflicts of Interest |
sepsis is a major cause of mortality and morbidity and its incidence is increasing . despite the major social impact of sepsis ,
inflammation is ubiquitous during the course of critically ill septic patients and may be modulated by several patient 's particularities , such as age , gender , and comorbidities [ 35 ] .
nevertheless , the extend by which each patient characteristic impacts the inflammatory response is unclear . body mass index is an important prognostic factor in general population and is associated with inflammation [ 6 , 7 ] .
for example , it has been suggested that obesity might be associated with improved prognosis in critically ill patients ( the so - called obesity paradox ) , although reasons for this are unclear [ 8 , 9 ] .
it has been hypothesized that changes in bmi may alter the host response to the pathogen and inflammatory response , thereby influencing the course of critical illness and therefore prognosis , but evidence available is conflicting . on the other hand , underweight patients may also display higher inflammation on specific clinical conditions , suggesting that the interplay between bmi and inflammation may be complex and nonlinear .
we therefore performed an explanatory analysis to evaluate the association between bmi and serum levels of several cytokines measured at icu admission .
our initial hypothesis was that bmi would be associated with serum levels of several inflammatory markers .
the subset of septic patients of a unicentric cohort of critically ill patients was used for this analysis .
this study is a subset analysis of a previous study that evaluated the association between components of acid - base status and inflammation in critically ill patients .
the study was approved by local ethical committee and is part of a larger project that aims to evaluate inflammation in critically ill patients ( institutional approval number 1207/99 ) .
methods , including sample time and cytokine analysis , have been described elsewhere . in brief , blood sample for cytokine analysis was collected in the morning following icu admission .
the 87 patients included in the main original study were consecutively admitted patients during the study period that fulfilled inclusion criteria and that were admitted from sunday afternoon until early friday morning , as it was technically not possible to process blood samples during weekends .
cytokine analysis was performed using milliplex technology ( merck , genese diagnostics , darmstadt , germany ) .
the following cytokines were included in this analysis : epidermal growth factor ( egf ) ; vascular endothelial growth factor ( vegf ) ; eotaxin ; fibroblast growth factor 2 ( fgf2 ) ; granulocyte macrophage colony - stimulating factor ( gmcsf ) ; granulocyte colony - stimulating factor ( gcsf ) ; fractalkine ; interferon alpha and gamma ( ifn and ifn ) ; interleukin ( il ) 1 ( il1 ) ; il1 ; il1 receptor antagonist ( il1ra ) ; il2 ; il3 ; il4 ; il5 ; il6 ; il7 ; il8 ; il9 ; il10 ; il12p40 ; and il12p70 ; il13 ; il15 ; il17 ; monocyte chemoattractant proteins ( mcp ) 1 and 3 ( mcp1 and mcp3 ) ; macrophage inflammatory protein ( mip ) 1 ( mip1 ) and macrophage inflammatory protein 1 ( mip1 ) ; tumor necrosis factor ( tnf ) ( tnf ) and tumor necrosis factor ( tnf ) .
c - reactive protein ( crp ) levels were also evaluated as a global marker of inflammation . in order to evaluate the association and impact of a body mass index , a generalized additive model ( gam )
saps3 score was added to the model in order to account for multiple possible confounders , such as illness severity and age .
the main advantage of gam is that no inference is made a priori regarding the type of link between predictors and outcome variable .
gam output provides p value for the association between each predictor and the variable of interest , as well as a graphical plot of variable values versus smooth terms and degrees of freedom .
both saps3 and bmi were added as smooth terms on gam models . the smoothing parameter estimating method was gcv ( generalized cross validation ) criterion .
when an association between cytokine and bmi was found , we further assessed the effects of adding other relevant variables to the model , specifically , gender , pulmonary source of infection , and diabetes .
from the original 87 patients included in the main study , 41 patients were admitted due to sepsis .
thirty - three of those patients had weight measured and were therefore elected for analysis .
we considered only weight values that were collected in the ward and/or emergency department before icu admission or a body weight measured at icu admission using a weighting machine .
bmi was similar in hospital survivors and nonsurvivors ( 26.1 6.2 versus 23.8 5.1 ; p = 0.256 ) .
kernel density plot for bmi stratified by hospital discharge status is shown in figure 1 .
the most common sources of infection were lungs ( 33% ) , bloodstream ( 9% ) , and soft tissue ( 12% ) .
most patients ( 73% ) required vasopressors and close to half ( 42% ) had acute kidney injury .
cytokine levels and results for gam analysis are shown in table 2 and in figures 2 , 3 , and 4 .
as shown in table 2 , egf , vegf , il4 , il5 , and il13 were associated with bmi .
illness severity , as assessed by saps3 score , was associated with gcsf , il1ra , il6 , il8 , il15 , mcp1 , and crp levels .
the plots for bmi versus the smoothed coefficient for its association with cytokine levels are shown in figures 24 .
the y - axis should be interpreted as how changes in bmi affect the mean value of the y - axis ( i.e , cytokine value ) , with positive values meaning an increase and negative values a decrease . in brief , bmi over 30 kg / m was associated with higher egf and vegf levels ( figure 2 ) . for egf , the lower values were found for bmi between 25 and 30 kg / m ( overweight patients ) .
the association between bmi and il4 , il5 , and il13 levels had a similar pattern ( figures 3 and 4 ) , with higher interleukin values for low ( < 20 kg / m ) and high ( above 30 kg / m ) bmi values , with a plateau between 20 and 30 kg / m .
additional models controlling for gender , pulmonary source of infection , and diabetes were built for egf , vegf , il4 , il5 , and il13 .
, the effects of bmi remained even when other variables were added to the model ( plots not shown ) .
vegf values were higher in female gender and when the lungs were the infection source .
in this subgroup analysis , we found that egf , vegf , il4 , il5 , and il13 are related to body mass index in a nonlinear way .
for interleukin values , the association followed a u shape distribution , with lower values found in the range of patients with normal weight and overweight .
we obtained high vegf values , similar to other reports of vegf levels in patients with septic shock .
since endothelial dysfunction appears to be involved in the pathogenesis of organ failure , higher vegf levels may be necessary to repair the endothelium after an infectious insult .
our data suggests that even when illness severity is taken into account , vegf levels tend to be higher in obese patients than in nonobese individuals , which may reflect a higher previous value in this population , as reported in , or an increase in the stimulus to endothelial repair in obese patients . il4 and il13 are anti - inflammatory cytokine that increase in sepsis and may play important roles in immune regulation [ 1719 ] .
il13 blockade in experimental sepsis has been shown to decrease survival and increase the expression of inflammatory cytokines .
suggested that in septic children lower il13 values were associated with worst prognosis , although no association between the levels of other cytokines and il13 was found .
the presence of higher values of il4 and il13 in obese patients may suggest that obesity is associated with a more anti - inflammatory cytokine expression during critical illness .
the association between bmi and cytokine levels was largely unaltered when gender , presence for diabetes , and pulmonary source of infection were added to the model ( table 3 ) , suggesting that the findings are robust even when other variables are accounted for in the statistical model .
the association between female gender and higher vegf values has been suggested in animal models and may be mediated by estrogen [ 22 , 23 ] .
the association between pulmonary source of infection and higher vegf values has been suggested in other scenarios , such as exacerbations of cystic fibrosis , hypoxia , and hantavirus infections .
first , and more importantly , we used a limited number of patients which limits our conclusions and the external validity of the analysis .
only six patients had a bmi above 30 kg / m , which may limit our conclusions regarding higher bmi values .
second , we only evaluated cytokine levels at admission and we are therefore unable to evaluate if bmi would result in a different inflammation profile over time ; additionally , time elapsed between icu admission and blood sample was variable since blood was drawn in the morning after icu arrival .
third , we have no data regarding the previous evolution of the patient before icu precise elapsed time .
fourth , obesity may be associated with higher background values of some inflammatory mediators which could affect the results .
finally , we are unable to address if changes in immune function associated with bmi have prognostic significance in critically ill patients . |
introduction .
inflammation is ubiquitous during sepsis and may be influenced by body mass index ( bmi ) .
we sought to evaluate if bmi was associated with serum levels of several cytokines measured at intensive care unit admission due to sepsis .
methods .
33 septic patients were included .
an array of thirty - two cytokines and chemokines was measured using milliplex technology .
we assessed the association between cytokine levels and bmi by generalized additive model that also included illness severity ( measured by saps 3 score ) ; one model was built for each cytokine measured .
results .
we found that levels of epidermal growth factor , vascular endothelial growth factor , and interleukins 4 , 5 , and 13 were associated with bmi in a complex , nonlinear way , independently of illness severity .
higher bmi was associated with higher levels of anti - inflammatory interleukins .
conclusion .
bmi may influence host response to infection during critical illness .
larger studies should confirm these findings . | 1. Introduction
2. Methods
3. Results
4. Discussion
5. Conclusion |
previous research has clearly demonstrated that cognitive change in old age does not occur in a homogenous manner for all individuals [ 13 ] .
a number of predictors of cognitive change in old age have been identified , such as education , hypertension , objective indices of health and cardiovascular disease , and apolipoprotein e .
regular engagement in different types of activities may also influence cognitive change . more specifically , according to the use it or lose it
hypothesis , regular engagement in different activities may buffer age - related decline in cognitive functioning .
a number of studies have found that general lifestyle activity engagement ( often operationalized as the combination of intellectual , social , and physical activities ) is associated with cognitive change [ 68 ] and that decline in activity in older age is associated with decline in cognitive functioning .
in addition to general activity , other studies have specifically targeted the association of physical activity with cognitive change .
indeed , a growing body of the literature highlights the potential benefits of physical activity on the structure and function of the brain [ 9 , 10 ] .
the first line of evidence for the relationship between physical activity and cognition comes from a number of cross - sectional studies demonstrating that physically active older adults have higher cognitive performance and functioning compared with less active older adults [ 11 , 12 ] .
however , the evidence derived from these cross - sectional studies is limited , as it is not .
longitudinal studies may be viewed as the second line of evidence , offering valuable information on the relationship between physical activity and cognition across time .
several prospective , longitudinal studies provide evidence for the association of physical activity with cognitive functioning [ 1320 ] .
these studies have generally shown that higher physical activity at baseline is associated with less decline in cognitive functioning over time , offering support for the notion that regular physical activity may buffer against future cognitive decline .
however , results from these longitudinal studies are inconclusive and several critical questions remain .
the longitudinal studies described above may test two different classes of hypotheses regarding the relationship of lifestyle variables , such as physical activity and cognitive change .
the first type of hypothesis stipulates that the level of physical activity is related to subsequent cognitive change .
the majority of the abovementioned studies have targeted this first class of hypothesis , examining a stable change hypothesis by looking at how physical activity at baseline predicts change in cognitive functioning . the second class of hypothesis instead examines the relationship between concomitant change in activity and change in cognition .
in contrast to the baseline effect of activity , this hypothesis deals with the concept of intraindividual change and associations among intraindividual rates of change , providing a more dynamic perspective .
for example , positive changes ( increases ) in physical activity across time may be hypothesized to contribute to a less negative change ( less decline ) in cognitive functioning , whereas a negative change in activity ( decreased activity ) would be expected to be related to faster cognitive decline with age .
mackinnon and colleagues used a latent growth curve modeling approach to examine how change in overall activity ( defined as a composite of physical activity , rest , interest and hobby related , and planned activities ) , rather than physical activity , was related to change in health and cognitive performance .
they found substantial correlations between rates of change in activity and cognitive and health measures , and it was concluded that decline in mental and physical activity in older age is paralleled by decline in cognitive functioning and health
. however , decline in cognitive functioning was still evident for participants who were stable in their level of activity across time , suggesting that maintenance of activity may not be enough to protect from cognitive decline .
unfortunately , few previous studies have actually targeted the hypothesis of whether there are associations among rates of individual change in physical activity and cognitive functioning in long - term observational studies of aging individuals .
van gelder and colleagues found that men who decreased their physical activity duration or intensity also demonstrated a stronger decline in overall cognition ( measured by the mini mental state examination ) compared with men who maintained their activity duration and intensity .
first , only change in one global measure of cognitive functioning was used , rather than several different measures that may capture more diverse and complex relationships of cognitive ability with activity change . moreover , in the study , change in physical activity was categorized in terms of quality ( change / no change ) rather than quantity ( how much change ) .
finally , the analyses were based on between - group comparisons and therefore did not target relationships of within - person changes in physical activity and cognition .
bielak and colleagues , however , used random effects models to examine how level and change in physical activity were related to level ( within - person mean ) and inconsistency ( within person standard deviation across trials ) of cognitive speed at baseline and change in level and inconsistency .
although physical activity at baseline was related to mean cognitive speed in some tasks , there were no associations between change in physical activity and change in cognitive speed .
moreover , a recent study using bivariate dual - change - score models to analyze data from the victoria longitudinal study found that changes in physical activity influenced changes in verbal speed and episodic memory .
however , they also found that changes in cognition influenced changes in activity , thus supporting a dual - coupling model or a reciprocal relationship between physical activity change and change in cognition .
although previous longitudinal studies have resulted in increased understanding of how physical activity at one point ( baseline ) may predict future cognitive performance , or change in cognitive performance , they have generally not helped us understand the more complex and dynamic characteristics of the longitudinal relationship between physical activity and cognition .
for example , is there an association between within - person change in physical activity and within - person changes in cognitive functioning when taking into account the change in cognition due to time ? or , put differently , do persons demonstrate lower cognitive scores ( relative to their within - person trajectory over time ) on occasions when they also report less physical activity ?
relative to a cross - sectional analysis that compares individuals to other similar aged individuals , the answers to these questions afford relevant insight into the more complex and dynamic patterns of associations between changes in physical activity and cognitive functioning within individuals across time .
another question that has not been properly addressed by previous longitudinal studies is if physical activity , or change in activity , has similar effects across different cognitive domains and/or tests . from previous experimental work using randomized controlled trial designs , there is support for the notion that physical activity training has the strongest effect on executive control processes and working memory , supporting the selective - improvement hypothesis .
however , as the majority of previous longitudinal studies of the relations between physical activity and cognition have included a single measure of cognition ( often mmse ) rather than different tests and domains , the theoretically , as well as practically , important question of whether changes in physical activity may relate more strongly to changes in some cognitive domains relative to others remains unresolved .
an essential step for the sound cumulative development of this body of knowledge is the reproduction and extension of research findings across independent longitudinal studies that focus on observed within - person change .
although most previous longitudinal studies have found that physical activity is protective against age - related cognitive decline , the findings are disparate and far from clear .
moreover , previous studies have typically used data from one population ( e.g. , adults ranged from 5594 in age ) and one design ( e.g. , 3 waves of measurements over a 6-year period ) , leaving the generalization of the results highly contingent on sample specific - characteristics .
differences between studies in terms of sample , design , measures , and analytical approach make it difficult to compare results across studies and to derive more general conclusions of the meaning of these results .
therefore , there is a clear need for more coordinated integrative data analyses that use data from different samples with different measures , but examine these data with the same research question and the same analytic approach .
using a coordinated analysis approach for cross - study comparisons and synthesis of independent results has the potential to bring new relevant information to the field of cognitive change and physical activity .
the purpose of the present study is to investigate the longitudinal associations of physical activity with four domains of cognition ( i.e. , reasoning ( executive function ) , episodic memory , fluency , and semantic knowledge ) in older adults using a coordinated approach with data from four independent longitudinal studies : long beach longitudinal study ( lbls ) , the seattle longitudinal study ( sls ) , the victoria longitudinal study ( vls ) , and the origins of variance in the oldest - old : octogenarian twins study ( octo - twin ) .
more specifically , the following research questions were examined : is physical activity at baseline associated with cognition at baseline?is baseline physical activity associated with the rate of change in cognition?are occasion - specific changes in physical activity associated with occasion - specific changes in cognition , controlling for change in cognition due to time alone ?
is physical activity at baseline associated with cognition at baseline ? is baseline physical activity associated with the rate of change in cognition ?
are occasion - specific changes in physical activity associated with occasion - specific changes in cognition , controlling for change in cognition due to time alone ?
this research , initiated as a partnership between the advanced psychometric methods workshop series ( mungas et al .
, nia conference grant ) and the integrative analysis of longitudinal studies on aging ( ialsa ) network [ 25 , 26 ] , brought workshop participants together with researchers from four ialsa member studies .
these studies were specifically selected based on their collection of cognitive , physical , and social activity data along with a range of cognitive functioning measures over multiple occasions held in common across the four studies .
while the activity and cognitive functioning variables are not always identical , the subsets of variables in each study were chosen based on the rationale that they tapped similar domains at the construct level ( e.g. , fluid reasoning ( gf ) , crystallized knowledge ( gc ) , short - term memory ( gsm , ) and long - term storage and retrieval ( glr ; category fluency ) . in some cases
the measures are the same , but more often they differ , providing opportunities for both strict and conceptual replication .
the octo - twin study is comprised of the oldest - cohort of the swedish twin registry aged 80 and older at the time of first examination . beginning in 199193 , the longitudinal design included a maximum of five measurement occasions at 2-year intervals .
individuals with a dementia diagnosis at baseline ( n = 98 ) were excluded from the initial sample of 702 participants .
approximately 20% of the sample was lost to follow up at each wave ( 10% per year ) , but most of this attrition was due to death .
reasoning was assessed using block design . in this task , participants were presented with red and white blocks and instructed to reproduce the design shown on a card using these blocks within a predetermined time limit .
memory was assessed using immediate recall of the prose recall test , in which participants were presented with a brief , 100-word story that had a humorous element .
amount of information recalled was coded in a manner similar to the scoring of story units in the wechsler memory scale logical memory test .
semantic knowledge was assessed using the swedish version of the information task , in which participants provided responses to factual knowledge questions .
raw scores were transformed into t - scores with a mean of 50 and standard deviation of 10 to facilitate comparisons across measures .
respondents were asked , at each of the five waves , the following : are you presently doing or have you previously done anything special to train your body or keep your body fit ? the possible responses were no ( 0 ) , yes , to some extent ( 1 ) , or
the participants gave one reply for their present physical activity status and one in regards to their previous status .
physical activity change scores were computed by subtracting baseline activity from each follow - up activity measure .
the lbls was initiated in 1978 when participants were recruited from the family health plan health maintenance organization ( hmo ) , mainly including residents of long beach and orange county .
the ethnic composition of the older group ( 98% caucasian ) was similar to the 65 + population for the area based on the 1970 census .
panel 2 , initiated in 1992 , included 633 individuals from the same hmo ( 64 were excluded due to frank dementia or serious sensory or neurological problems ) . in order to include the same measures as those in the seattle longitudinal study , lbls panel 1 ( n = 106 ) and panel 2 ( n = 631 ) data from 1994 to 2003 , excluding participants younger than age 55 in 1994 ( n = 541 ) , were used in the current analysis . during this period ,
reasoning was based on a composite score of the letter and number series tests from the schaie - thurstone adult mental abilities test ( stamat ; . in this task , participants viewed a series of letters ( e.g. , a b c c b a d e f f ) and were asked to identify the next letter in the series from alternate choices by extracting the rule that governed the series .
participants were given six minutes to complete as many of the 30 items as possible .
fluency was assessed using word fluency , in which participants wrote down as many words as possible that begin with the letter s during a five - minute period according to predetermined rules .
these rules included no proper names and no addition of endings to words that the participant had already provided ( e.g. , sit ,
memory was measured using immediate written recall of a 20-item noun list that participants had studied for 3.5 minutes .
participants were provided with 50 target words and asked to select the synonym from four choice alternatives .
performance was based on total correct responses provided in a five - minute period .
a composite score was created by summing the number of physical activities ( e.g. , walking , outdoor hobbies , etc . ) that included one or more hours of these activities per week .
activity change variables were computed by subtracting the activity measure in 1994 from activity in 1994 , 1997 , 2000 , and 2003 .
the sls is a long - running longitudinal study initiated by k. warner schaie , who first recruited members of a local health maintenance organization in 1956 .
current analyses used up to four waves of sls data from 19842005 , which include an expanded set of measures that also overlapped with the long beach study . only participants
baseline was defined as each participant 's first study visit , and time was measured in all analyses as years in study ( coded as 0 , 7 , 14 , and 21 ) .
see table 3 for sls participant characteristics over the four waves of data analyzed here .
reasoning was assessed with the word series test from the schaie - thurstone adult mental abilities test ( stamat ; ) . in this task , participants were provided with a printed word series that was ordered according to an inherent rule . the participant 's task was to select , from multiple - choice options , the next word in the series consistent with that rule .
total score was based on number of correct responses to the 30 trials completed in 6 minutes . as in lbls ,
fluency was indexed by performance on the word fluency test from the primary mental abilities test and memory by the verbal list - learning task .
semantic knowledge was assessed with the test of advanced vocabulary from the educational testing service ( ets ) , in which participants identified synonyms for printed words from five choices .
the total score was derived from the number of correct responses provided within 4 minutes to the 36-itemtest .
the methodology described in the lbls method portion of this paper was used in order to generate roughly equivalent indices of physical activity . following this methodology ,
a composite physical activity measure was created by summing dichotomized test responses from a modified version of the life complexity scale , resulting in a four - item physical activity composite ( playing sports , walking , fitness , and outdoor hobbies ) .
activity change was computed by subtracting baseline activity from each follow - up activity measure .
the victoria longitudinal study began in 198687 with a sample of 484 community residing volunteers . using a longitudinal sequential design , second and third independent samples began in 1992 - 93 ( n = 530 ) and 2001 - 2002 ( n = 550 ) .
to date , sample 1 has been tested on seven occasions ( over 18 years ) , sample 2 on five ( over 12 years ) , and sample 3 on two occasions ( over 6 years ) .
participants in all three samples were recruited between the ages of 55 and 85 years .
data from seven waves of sample 1 and five waves of sample 2 were included in the current investigation .
approximately 20% of the sample was lost to follow up at each wave , or 10% per year .
reasoning was indexed by letter series . in this task , participants were presented with a series of letters and asked to identify the next letter in the sequence based on the rule that governed the sequence .
fluency was measured by performance on a similarities task , in which participants were presented with target words and asked to write as many words as possible with the same or nearly the same meaning during a 6-minute period .
memory was indexed based on free recall of a 30-item noun list comprised of five semantic categories .
participants were given two minutes to study the words and then five minutes to recall them .
semantic knowledge was assessed using a 54-item recognition vocabulary test adapted from the ets kit of factor referenced tests .
the physical activity measure was derived from a subset of four items from the vls- activity lifestyle questionnaire ( vls - alq ; ) .
these items indexed the physical activities of gardening , jogging , sailing , and tennis . for each item , participants indicated the frequency of engagement in that activity over the past two years on a scale from 0 to 9 ( i.e. , never , less than once a year , about once a year , 2 or 3 times a year , about once a month , 2 or 3 times a month , about once a week , 2 or 3 times a week , and daily ) . in order to examine the effects of physical activity on cognition , a series of multilevel models was fit with time varying covariates using multilevel mixed - effects regression in stata ( statacorp , 2011 ) , the restricted maximum likelihood estimator ( reml ) , and an unstructured covariance matrix .
separate models were fit for each of the four cognitive measures ( reasoning , fluency ( except octo - twin ) , memory , and semantic knowledge ) and for each of the four studies . in order to improve ease of interpretation of our results , age ,
education , and activity measures were mean centered to the baseline mean of each measure in the sample so that the intercept and linear slope terms could be interpreted as the expected value for an individual at the mean age , education , and respective activity level at baseline .
octo - twin participants were modeled as nested within their twin pair and in vls we controlled for enrolment cohort .
our goal was to build a common model for comparisons across all outcomes for the four longitudinal studies .
this common model was not necessarily the optimal model for each of the 16 cognition - physical activity combinations .
an initial 19-term model included all ten two - way interactions that included activity , change in activity or time , and three 3-way interactions of time and activity with age , sex , or education .
however , several terms were not significant for most of the studies and outcomes and so were trimmed to facilitate model interpretation .
first , the 3-way interactions were eliminated , then the interactions with change in activity .
this resulted in a final model that included 12 terms summarized in table 5 for separate cognitive constructs of reasoning , memory , semantic knowledge , and fluency .
our significance criterion of p < 0.05 shaped the familywise alpha rate within each study , however our focus was on the repetition of results across studies , which we used to minimize the potential impact of chance associations .
we did not implement formal meta - analytic techniques as they require identical measures and a larger number of studies .
between - person age differences are seen at the first occasion of measurement for all memory , reasoning , and fluency tests , with older adults performing less well .
semantic knowledge results are less consistent , with older adults performing less well in lbls and octo - twin , but better in vls . at baseline ,
lbls and sls women scored higher than men of the same age on all measures , except for semantic knowledge .
for the reference individuals ( men with sample average baseline age and years of education ) , within - person declines were seen over time in all cognitive abilities and all samples except sls ( the youngest ) , where the relationship , as in lbls and vls , depended on age .
older individuals declined faster on all vls , sls , and lbls measures except lbls immediate memory .
no clear pattern was identified in regards to differential decline related to sex or education .
higher physical activity at baseline was associated with higher scores on reasoning and memory in octo - twin and vls and fluency in sls .
the association between physical activity score at baseline and cognitive score did not differ by age .
however , there was some indication that the relation between physical activity and cognition differed by education . for semantic knowledge in lbls and
sls the association with physical activity at baseline was stronger for people with less education . in terms of associations with cognitive decline ,
higher physical activity score at baseline was related only to less decline on fluency in vls and sls . however , we found a consistent pattern of positive relationships between time - specific changes in physical activity and time - specific changes in cognition beyond those expected by the estimated linear trajectories in the four studies .
more specifically , after controlling for the trend in cognitive functioning over time , time - specific changes in physical activity change were related to cognitive fluctuations in the following cognitive domains : ( a ) reasoning in all four studies ; ( b ) fluency in two ( vls and sls ) of three studies ; ( c ) memory in two studies ( octo - twin and vls ) ; ( d ) semantic knowledge in one study ( octo - twin ) .
using data from four longitudinal studies of aging , the present study examined the relationship between physical activity and cognitive functioning at three different levels : ( a ) cross - sectionally ; ( b ) longitudinally using physical activity as predictor of cognitive change ; ( c ) longitudinally using change in physical activity as a time - varying covariate to predict change in cognition , adjusting for the normative development ( effect of time ) in cognition . on the cross - sectional level , higher
physical activity at baseline was associated primarily with higher scores on reasoning and fluency , generally supporting previous studies demonstrating that physically active older adults have higher cognitive performance and functioning compared with less active older adults [ 11 , 12 ] .
although relevant , these well - known and well - documented findings contribute little to a deeper understanding of the likely very complex relationship between activity and cognition .
the second level of analysis addressed more theoretically relevant and interesting longitudinal associations and the question of whether physical activity at baseline is associated with cognitive change . from a broader perspective , this research question is also linked to the use it or lose it
hypothesis [ 5 , 21 ] , generally proposing that physical activity may buffer against future cognitive decline .
a number of prospective studies have found support for this notion [ 1320 ] , offering preliminary support for the longitudinally beneficial and buffering effect of physical activity on cognitive decline . a general limitation in many of these previous prospective studies
, however , is that they have examined the association between physical activity and a broad global measure of cognition ( typically mmse ) , thereby proving an incomplete picture of the potentially diverse longitudinal associations between different cognitive domains and physical activity . as a consequence ,
these previous studies generally have not answered the theoretically and practically relevant question what cognitive domains most benefit from physical activity ? . in the present study four
different domains were examined , representing a broader spectrum of cognitive abilities , ranging from the more crystallized knowledge - based domain of semantic knowledge to more fluid or process - based factors of reasoning , fluency , and memory .
higher baseline physical activity was associated with less fluency decline in two of three studies .
thus , the preliminary answer to the question what cognitive domain benefits most from physical activity , based on the results of the present study , is fluency , which is one of the more process - based / fluid domains .
however , it should be mentioned that for most cognitive domains across the four studies , we did not find support for the protective effect of baseline levels of physical activity on cognitive decline . aside from the more stationary change relationships typically investigated in previous studies ( how level of physical activity at baseline relates to change in cognition ) , we also targeted more dynamic associations between changes in physical activity and changes in cognitive functioning by using change in physical activity from baseline as a time - varying covariate in longitudinal multilevel models .
the time - varying covariate model used in this study examined occasion - specific intraindividual relations between physical activity and cognition , after controlling for individual rates of change over time .
such time - specific associations between fluctuations in activity and cognition have rarely been examined and may be highly relevant to understanding how to prescribe exercise and how to design and implement interventions including physical activity to optimize effects on cognition . as associations of change and time - specific fluctuations are of key importance in the analyses and interpretation of intervention studies , the results of studies like the present one may offer new relevant information both from a scientific as well as from an applied perspective .
variation in physical activity was associated with variation in reasoning in all four studies and in fluency in two of three studies .
hence , although evidence for the association of between - person differences in baseline physical activity with subsequent cognitive change was generally weak across domains , aside from fluency , support for the notion that change in physical activity covaries with fluctuations in cognition is much more robust across studies .
these results are inline with previous work , indicating that physical activity may specifically moderate the decline in cognitive domains that is typically associated with aging . moreover , from a broader perspective , the stronger associations across time of physical activity with more fluid cognition may be linked to the hypothesis that exercise and aerobic fitness training results in selective improvement in executive control processes and working memory .
although the cognitive tests used in the present study to measure reasoning and fluency were derived from a psychometric tradition of psychological testing and do not map well onto more recent conceptualizations of executive processing , they do share some of these features , being a more fluid measure of cognition .
an obvious limitation of the current study is the observational nature of the longitudinal designs , making inferences in terms of cause and effect irresolvable .
the notion that decline in cognition leads to decline in physical activity is equal in validity to the interpretation that a decline in physical activity leads to a decline in cognition , that the relationship is reciprocal , or that both are a result of some third variable .
recent studies provide evidence for not only the reciprocal relationship across time between physical activity and mental health in older adults , but also for the reciprocal relationship between physical activity and cognition .
another limitation is the problem associated with using different tests in different studies to tap the same cognitive domains .
as noted earlier , the studies were selected because they shared similar measures of activity and cognition . moreover , single cognitive tests are always imperfect markers of a cognitive domain . therefore , a general feature of the integrated analytical approach in the present study , where data and tests from four different studies are used to answer the same research question , is the risk of heterogeneity in terms of how well the different tests indicate the higher order construct they should measure . as a result ,
when patterns of results are not consistent across studies , additional questions , testable in future research , are raised with respect to the source of these differences .
it is , for example , interesting to note that for octo - twin , in which physical activity was operationalized as the extent to which persons saw themselves as purposefully keeping their body fit , baseline activity was associated with cognitive functions more consistently than were the physical activity measures in the other studies .
the apparent importance of physical activity , however , may also be due to the more advanced age of this sample . in situations where the studies with identical measures agree with each other , but
not the remaining studies , for example , where neither sls nor lbls shows associations between memory performance and either baseline or change in activity , but octo - twin and vls do , we may draw conclusions that something about the measurement is important . in contrast ,
lbls and sls fluency results do not agree , suggesting instead that some detail relevant to the sampling , retest interval , or other study characteristic may be relevant . on the other hand , when patterns of results do show consistency across studies that have used different measures to tap the same underlying construct , such as the association of change in activity with change in reasoning and fluency , these differences become a major strength , as the reliability of the conclusions drawn is considerably strengthened compared with traditional analysis of a single dataset .
moreover , in contrast with the more specific measurement of cognition , the physical activity variables used in the current analyses were broad and self - reported and did not differentiate aerobic from strength or resistance training . combining objective measures of physical activity with more specific multi - item , self - report instruments would likely provide future studies with a more robust base for the analysis of the association of change in activity with change in cognition .
the dynamic associations between physical activity and cognitive functioning underscore the broader question of associations between biological and cognitive aging .
also , the effect of intraindividual change in physical activity on cognitive functioning ( adjusting for the trend in cognition ) raises the question of what drives , or causes , these relationships across time ? these dynamic associations with the more fluid cognitive domains may be mediated , or explained , by a number of factors , such as physical resources ( sleep , energy / fatigue , appetite , pain , or drug / medication use ) , disease states ( hypertension , diabetes , and cvd ) , and mental resources ( chronic stress , depression , and self - efficacy ) . more specifically , a number of physiological mediators , such as aerobic fitness , hormones , lipid profiles , cerebral blood flow , blood pressure , neurotransmitters , and neurotrophins have all been identified as potential mediators in physical activity - cognition relationships .
although intuitively appealing and quite frequently investigated , the hypothesis of physical activity leading to improved cognition via increased aerobic fitness ( the cardiovascular fitness hypothesis ) is not , however , supported by meta - analyses [ 24 , 42 ] .
thus , although single mediation models are theoretically attractive , and may fit data to some extent , the more complete pathways explaining why physical activity and cognition seem to change together more likely include multiple mediators and complex micromediational chains , that also may vary in strength and validity across individuals and groups .
nevertheless , increasing knowledge about what precise mechanisms are active ingredients in the effects of physical activity on cognition constitutes a vital step towards the development of appropriate physical activity intervention designs to test these specific models of mediation and the effects of physical activity and exercise on cognition in experimentally controlled trials .
the major strength of the present study is the ability to elucidate consistent patterns of complex associations across time through coordinated analyses of data from four longitudinal studies .
contrary to previous research based on analyses of single samples , which are limited by the specific characteristics of the sample and data , we instead used a coordinated and integrated analytical approach and framework [ 25 , 26 ] to examine the same research question in data from four longitudinal studies , thereby making the conclusions less vulnerable to study specific characteristics .
as such , the present study is unique ( in particular considering the choice of analytical approach ) and may pave the way for similar collaborative projects where the same research question and analytical approaches are used to answer relevant questions simultaneously across different studies linked to the association of lifestyle , physical activity , and cognitive functioning .
the four studies included afford considerable heterogeneity in terms of age ( ranging from mean age of 67 in sls to 83 in octo - twin ) , number of available waves of measurement ( four in sls and lbls to seven in vls ) , years of followup ( 8 years in octo - twin to 21 years in sls ) , years between measurements ( every 2 years in octo - twin to every 7 year in sls ) , and cultural background ( scandinavia to north - america ) .
yet , as discussed above , a surprisingly clear pattern emerged across studies in the relation of change in activity to fluctuations in cognition .
thus , in terms of capacity to identify patterns of associations from a larger and broader perspective and to be able to generalize results and conclusions , the present study brings reproduced evidence to the field as well as to practitioners working with health related behavior , lifestyle , and cognition in elderly .
based on the results in the present study , the main message is that change in activity , and not only previous or current level of activity , seems to matter and may play a significant role in the pursuit of maintaining benign nondecreasing trajectories of cognition along the path of cognitive aging . | the present study used a coordinated analyses approach to examine the association of physical activity and cognitive change in four longitudinal studies .
a series of multilevel growth models with physical activity included both as a fixed ( between - person ) and time - varying ( within - person ) predictor of four domains of cognitive function ( reasoning , memory , fluency , and semantic knowledge ) was used .
baseline physical activity predicted fluency , reasoning and memory in two studies .
however , there was a consistent pattern of positive relationships between time - specific changes in physical activity and time - specific changes in cognition , controlling for expected linear trajectories over time , across all four studies .
this pattern was most evident for the domains of reasoning and fluency . | 1. Introduction
2. Methods
3. Results
4. Discussion |
the antiepileptic agent phenytoin ( pht ) has a narrow range of effective blood concentrations and nonlinearity pharmacokinetics .
therefore , the monitoring of its blood concentration ( therapeutic drug monitoring , tdm ) is essential for ensuring a proper dosage and successful treatment .
because pht is primarily metabolized by the enzymes cytochrome p450 ( cyp ) 2c9 and cyp2c19 , caution must be taken with regard to the fluctuations of the blood levels of pht when administered in combination with other medications that induce or inhibit these enzymes .
for example combination therapy with fluoropyrimidine anticancer drugs and pht are known to increase the blood levels of pht and the risk of intoxication [ 3 , 4 , 5 , 6 ] .
the compound drug s-1 , composed of a combination of tegafur - gimeracil - oteracil potassium , is no exception , and , in japan , there have recently been a number of reports on drug interactions due to the combined use of s-1 and pht [ 7 , 8 ] . in these cases
also , the s-1 treatment schedule , including periods of daily administration and interrupted by periods of rest , complicates the interpretation of its interaction with pht . in at least 1 case ,
the elevated blood levels of pht persisted even after the oral administration of s-1 had ceased , indicating that caution is also needed during the s-1 rest period .
unfortunately , reports on the long - term monitoring of the variations in the blood levels of pht during the combined s-1 and pht treatment and a thorough understanding of their interaction are lacking .
the objective of this study was to describe the interactive effects of pht and s-1 using long - term therapeutic drug monitoring of pht . through regular
monitoring of blood levels of pht , we were able to conduct a pharmacokinetic analysis and describe the nature of interaction between these 2 drugs .
the patient was a 72-year - old man with a height of 157.2 cm , a body weight of 54.3 kg , and a body surface area of 1.535 m. he had been continuously treated with orally administered pht 130 mg / day ( 1.3 g / day of aleviatin 10% powder ) for more than 20 years to prevent symptomatic epilepsy ; he had never had a seizure during this time . in march 2010
, he complained of upper abdominal discomfort , underwent an endoscopic examination of the upper digestive tract , and was diagnosed with gastric cancer .
a pylorogastrectomy was performed at the department of digestive surgery , fukui university hospital , and on june 9 , 2010 , he began outpatient postoperative chemotherapy with an oral administration of s-1 ( 80 mg / day ) .
one course of treatment consisted of a 28-day period of medication and a 14-day off - drug period . during chemotherapy treatment ,
the patient continued taking other prescribed medication ( pravastatin sodium , magnesium oxide , digestive enzyme complexes , itopride and sennoside ) .
samples of the patient 's blood were taken at every consultation and used to monitor changes in blood concentrations of pht during the course of s-1 chemotherapy .
after obtaining the patient 's informed consent , pht concentrations were measured using an automated immunoassay .
the initial concentration ( prior to s-1 administration of pht ) was 6.0 g / ml . the pht concentration had not increased at day 14 , but on day 28 , an increase was observed ; by day 84 ( day 14 of rest , during the second course of treatment ) , pht had surpassed the toxic level ( 20 g / ml ; 22.9 g / ml ) . at this time ,
the patient complained of light - headedness and falls , but the third course of treatment was started without reducing the pht dosage , and the blood concentration of pht remained at a toxic level ( 24.1 g / ml at day 10 of rest during the third course of treatment , and 23.7 g / ml at day 14 of rest during the third course of treatment ) .
the samples were also analyzed to determine blood counts and bioindicators of liver and kidney function ( total bilirubin , aspartate and alanine aminotransferase , serum creatinine , and serum albumin ) .
initial values were as follows : total bilirubin 0.4 mg / dl , aspartate aminotransferase 15 iu / l , alanine aminotransferase 11 iu / l , serum creatinine 0.81 mg / dl and serum albumin 4.0 g / dl .
changes in these values were not associated with variations in the blood levels of pht .
regarding symptoms , falls continued , and at the beginning of the fourth course of treatment , the doses of pht were reduced from 130 mg / day to 100 mg / day . as a result , at day 7 of rest during the fourth course of treatment , the blood levels of pht decreased to 10.4 g / ml , and the symptoms ceased .
while the blood concentrations of pht continued to fluctuate after the dosage was reduced to 100 mg / day and remained higher than those found before the initiation of s-1 therapy , they never reached toxic levels .
however , the sixth course of the treatment was postponed for 2 weeks due to leukopenia . as a result ,
the blood concentration of pht on the day before the initiation of the sixth course was 4.0 g / ml , lower than the effective blood concentration . because the blood concentration was low , physicians increased the dosage of pht to 130 mg / day
. the concentration of pht at the start of the seventh course was not measured , but the symptoms of light - headedness and falls returned .
thereafter , the dosage of pht was not modified again , but the blood concentration of pht decreased to 10.8 g / ml at day 15 of the seventh course of treatment .
while a number of reports on the drug interactions between pht and fluoropyrimidine drugs have already been published , most of them reported having performed a tdm after the appearance of symptoms of intoxication with pht .
also , there have been few reports on the monitoring of the blood concentrations of pht from the time of the initiation of the combined treatment . here , we performed tdm from the initiation of s-1 treatment .
although the blood levels of pht were found to increase after the initiation of the combined treatment , the concentrations of pht varied in a complicated manner within the effective levels . as a result , it became difficult to determine when to reduce the dosage of pht or to discontinue its administration , and consequently , the patient developed symptoms of intoxication .
however , the results provided insights into the nature of the interaction , with regards to the timing of the increase and the decrease in the blood levels of pht as well as the schedule of s-1 administration . besides s-1
liver function , renal function , and serum albumin levels have been cited as factors affecting the blood levels of pht [ 9 , 10 ] , but these do not appear to be responsible for elevated pht levels in our patient as bioindicators ( liver function total bilirubin , aspartate and alanine aminotransferase ; renal function serum creatinine and serum albumin ) of these 3 factors .
therefore , the increase in the blood levels of pht found here was considered to be a result of interactions between s-1 and pht .
although the mechanism of interaction between pht and fluoropyrimidine drugs , such as s-1 , remain unclear , in vitro studies using human liver microsomal fractions have shown that 5-fu , a metabolite of tegafur , does not directly impair the metabolism of pht . meanwhile , in rats , the administration of 5-fu for several consecutive days has been shown to result in decreased expression and activity of cyp2c11 , the equivalent of the human cyp2c9 [ 12 , 13 ] .
in addition , gunes et al . reported that cyp2c9 activity decreased in patients treated with 5-fu .
based on these results , the interaction between pht and fluoropyrimidine drugs appear to involve an indirect inhibition of pht metabolism . in our study , the patient 's blood concentrations of pht reached toxic levels at day 84 after the initiation of s-1 therapy .
this is longer than the time required to reach similar levels in previous cases [ 7 , 8 ] .
however , the increase in the blood concentrations of pht had started at day 28 . in most cases involving
interactions between pht and s-1 , symptoms of pht toxicity have occurred 4 weeks after the initiation of the combined treatment , and , even in cases where the toxic symptoms developed after a longer period of time , the increases in blood levels of pht were first observed at 4 weeks .
the results of this study demonstrate that elevated blood levels of pht persisted for approximately 2 weeks after the administration of s-1 ceased . at day 42 of this study ( the 14th day of an s-1 rest period ) , the blood levels of pht were even higher than during the previous period of s-1 administration .
however , during a 28-day rest from s-1 therapy , in the fifth course of treatment , the blood levels of pht were lower than those measured during the fifth course of s-1 administration ; the low concentrations persisted even at day 10 of the sixth course of treatment .
these results suggest that with prolonged rest ( i.e. , the 4 weeks of rest experienced here ) from s-1 treatment , cyp enzymes may be restored to their original levels .
these results are similar to a case of interaction between pht and capecitabine ( a fluoropyrimidine drug like s-1 ) . in this study ,
the effects of capecitabine on the blood concentration of pht persisted until day 15 after capecitabine therapy ceased , but the inhibitory effect then disappeared in a time - dependent manner .
the above suggest that it takes more than 2 weeks until the effect of s-1 is manifested in the form of variations in the blood concentrations of pht , and that , when s-1 is administered for 4 weeks , the drug interaction persists for at least 2 weeks after cessation of treatment .
in addition , the interaction disappears or decreases to negligible levels at 4 weeks after cessation of the oral administration of s-1 . due to the complex interaction between pht and s-1 ,
determining the proper dosage of and establishing a treatment schedule for pht is a challenge .
because pht has a nonlinear pharmacokinetic behavior , its blood concentration can experience a rapid increase under the influence of s-1 .
however , if the administration of s-1 must be suspended for an extended period due to side effects such as leukopenia , the effect of s-1 on the metabolism of pht will disappear , and the pht dosage may become insufficient to maintain effective levels . therefore , when s-1 and pht are used in combination with each other , it would be preferable that pht be replaced with another antiepileptic agent that is not a substrate of cyp2c9 . in cases
where s-1 and pht must be used in combination , the possible occurrence of delayed interactions as well as the occurrence of a time lag between the period of combined administration of the drugs and the variations in the blood levels of pht , need to be taken into consideration ; tdm needs to be performed on a regular basis from the time of initiation of the combined treatment , and the doses of pht need to be adjusted accordingly .
there is no conflict of interest that may arise and affect the interpretation of this case report . | although combination therapy with the oral fluoropyrimidine anticancer drug s-1 and the anticonvulsant phenytoin ( pht ) is known to increase blood levels of pht and the risk of intoxication , reports on long - term monitoring of blood levels of pht during combined s-1 and pht treatment and a thorough understanding of their interaction are lacking .
this report aims to describe interactive effects of s-1 and pht through long - term therapeutic drug monitoring of pht .
a 72-year - old male had been prescribed oral pht ( 130 mg / day ) for over 20 years and started receiving s-1 therapy ( 80 mg / day for 4 weeks , followed by a 2-week rest ) as postoperative adjuvant chemotherapy for gastric cancer .
the blood pht level was continuously monitored . prior to receiving s-1 ,
the patient 's blood pht concentration was 6.0 g / ml , but it increased during s-1 therapy , reaching 22.9 g / ml on day 84 ( during a rest period of second cycle s-1 therapy ) . after reducing his pht dosage to 100 mg / day , it never reached toxic levels ( 4.010.4 g / ml ) .
it was difficult to keep blood pht concentrations constant because of the time lag between the period of combined use of s-1 and pht and the timing of manifestation and disappearance of the drug interaction .
the dips probability scale indicated a highly probable interaction between s-1 and pht .
we conclude that , when s-1 and pht are used concurrently , occurrence and disappearance time of their interaction need to be predicted to maintain an effective and safe pht concentration . | Introduction
Case Report
Discussion
Disclosure Statement |
levetiracetam [ ( s)-alpha - ethyl-2-oxo-1-pyrrolidine acetamide ] ( lev ) is a second generation anticonvulsant approved by the european medicines agency ( ema ) and/or the u.s .
food and drug administration ( fda ) for the following : 1 ) monotherapy treatment of partial seizures , with or without secondary generalization ( ema ) ; 2 ) adjunctive treatment of partial seizures , with or without secondary generalization ( fda / ema ) ; 3 ) adjunctive treatment of myoclonic seizures associated with juvenile myoclonic epilepsy ( fda / ema ) ; and 4 ) adjunctive treatment of primary generalized tonic clonic seizures associated with idiopathic generalized epilepsy ( fda / ema ) .
lev uniquely binds to synaptic vesicle protein 2a ( sv2a ) with resultant broad spectrum anticonvulsant activity .
a review of clinical trials demonstrated that lev was well tolerated with limited psychiatric adverse effects .
lev - induced psychiatric adverse effects are not dose - dependent . improved depression and anxiety
the pharmacokinetic , tolerability , psychiatric , and neuropsychological profiles of lev have led to it being studied for the off - label treatment of neurologic disorders ( parkinson 's disease , huntington 's disease , tardive dyskinesia , dystonia , multiple sclerosis ) , psychiatric disorders ( bipolar disorder , panic disorder , posttraumatic stress disorder , social anxiety , impulsive aggression , alcohol dependence , alcohol withdrawal , behavioral and psychological symptoms of dementia ) , and pain disorders ( migraine and neuropathic ) with mixed results .
lev - emergent suicidal behaviors ( ideation and attempt ) have been infrequently reported . in two studies ,
this case report presents what the authors believe to be the first instance of dose / concentration - dependent lev - induced de novo major depression with a near fatal suicide attempt following dose adjustment in a patient without prior psychiatric history and with long - term stability on lev .
a 66-year - old male with diabetes , diabetic neuropathy , hypertension , and past alcohol dependence with withdrawal features had two seizures following a traumatic brain injury with an intracranial hemorrhage in 2007 .
he remained seizure - free on lev 500 mg total daily dose until being admitted to an academic medical center ( amc ) on 4/22/2012 with elevated cpk ( 1731 u / l ) , hyperglycemia ( 428 mg / dl ) , hypocalcemia ( 6.9 mg / dl ) , anemia ( hemoglobin : 11.6 g / dl , hematocrit : 34.2% ) , and an undetectable blood alcohol level .
his admission lev blood level was 10.9 g / ml . routine eeg was normal , and head mri / ct revealed central and cortical atrophy , moderate small vessel ischemic disease , and old bilateral basal ganglia and right thalamic lacunar infarcts .
he was medically stabilized and discharged on lev 500 mg bid only to be readmitted on 8/3/2012 for recurrent seizures following lev noncompliance for one week . specifically , the patient ran out of his aed pending a mail - order prescription . his wife ( a health - care professional ) witnessed a tonic - clonic seizure of > 3 min in duration with postictal altered mental status . in the er , the medical staff witnessed a further tonic - clonic seizure of 90 s in duration for which the patient received lorazepam 4 mg iv and phenytoin 1000 mg iv . admission laboratories and diagnostics included the following abnormal results lev blood level : < 2.0 g / ml , wbc : 13.6 , hemoglobin : 11.7 g / dl , hematocrit : 35.5% , glucose : 426 mg / dl , sodium : 130 meq / l , potassium : 2.5 meq / l , chloride : 97 meq / l , total co2 : 20.3
meq / l , magnesium : 1.3 mg / dl , hgba1c : 11.9% , unchanged ct scan findings , and ekg with fist degree av block and prolonged qtc of 505 ms .
lev was increased to 1000 mg bid with a subsequent lev blood level of 32.9 g / ml . a routine eeg with photic stimulation performed 3 days after the presenting seizures revealed left temporal focal slowing ( theta and delta activity ) without epileptiform discharges .
the patient remained without further seizures on the increased lev , his postictal state cleared , and after medical stabilization , he was discharged to the home setting on lev 1000 mg bid .
prior to lev being increased to 1000 mg bid , this patient had no history of psychopathology excluding alcohol dependence with withdrawal seizures .
after lev was increased to 1000 mg bid , the wife described the patient discussing suicide and stating life is not worth living . within one month , he developed a complete vegetative affective cluster consistent with a de novo major depressive episode according to dsm - iv criteria , attempted a nearly fatal insulin overdose ( 80 units ) with field glucose of only 1mg / dl , and was seen in psychiatric consultation after admission to the same amc .
admission laboratories included the following abnormal results hemoglobin : 12.0 g / dl , hematocrit : 35.4% , potassium : 2.8 meq / l , calcium : 8.3 mg / dl , magnesium : 1.3 mg / dl , and hgba1c : 10.6% .
his alcohol blood level was 24.6 mg / dl with urine drug screen , salicylate level , and acetaminophen level all negative .
his admission lev blood level was 38.9 g / ml . a routine eeg with photic stimulation performed on the day of admission revealed mild , infrequent , independent , bilateral frontotemporal polymorphic delta activity without epileptiform discharges .
upon medical stabilization , discontinuation of lev , and initiation of oxcarbazepine 300 mg bid , the patient was transferred to an inpatient psychiatric unit and lost to follow - up .
this unique case raises a series of important points specifically related to this patient that should be considered in the general treatment of patients with lev and other aeds .
first , though lev - induced psychiatric adverse effects are not considered to be dose - related , this case suggests that dose - dependence may be a significant factor in developing affective disorders with suicidal behaviors .
the patient did not have any psychiatric features during a five - year period on lev 500 mg total daily dose with a mildly subtherapeutic blood level . even with lev increased to 1000 mg total daily dose ,
with lev increased to 2000 mg total daily dose and a high therapeutic blood level , the patient developed a de novo major depression and attempted a nearly fatal insulin overdose within one month of dose titration .
second , aed therapeutic drug monitoring with reference range and individual therapeutic range is important in the optimal clinical treatment of patients with epilepsy .
as there is a minimal and optimal threshold concentration for aed efficacy , this case suggests that the development of adverse events for specific aeds may also require a threshold concentration which can be within the reference range ( lev : 1246 g / ml ) .
third , literature addressing suicidal behavior associated with aeds in patients with epilepsy has focused on the significant increased risk of this behavior when there is a prior history of affective disorder .
this case clearly points out that an apparent lev - induced major depression with suicidal behavior may occur in the absence of prior affective disorder .
this is consistent with a recent study that did not find psychiatric history to be a significant predictor of either positive or negative lev - induced psychotropic effects .
fourth , the 2008 fda advisory that aeds are associated with significantly increased suicidal behaviors resulted in a series of studies attempting to address aed - specific suicidal behavior risk [ 1820 ] . conflicting findings from these studies are considered to be secondary to flaws in methodology , specifically controlling for prior suicidal behavior .
this suggests the need for appropriate psychiatric assessments in all patients treated with aeds such that meaningful data can be obtained .
this also supports the need for detailed case reports when suicidal behavior occurs following initiation of aed treatment . in this case
, there was no pre - lev history of psychiatric illness , impulsive aggressive behaviors , or suicidal behaviors excluding past alcohol dependence .
fifth , though the clinical trials revealed limited behavioral adverse effects , more recent studies emphasized aggressive behavior as an important negative psychotropic effect that may require lev discontinuation .
this patient did not have any aggressive behaviors on long - term lev 500 mg total daily dose or when increased to 1000 mg total daily dose , but rather the suicide attempt occurred at 2000 mg total daily dose .
sixth , a clinical model of suicidal behavior suggests that suicide is an impulsive aggressive act and that a critical risk factor for suicide is increased impulsive
aggressive trait with familial / genetic transmission of impulsive aggressive trait correlating to an increased suicide risk independent of psychopathology .
literature supports genetic neurotransmitter variants as etiological factors for impulsivity , suicidal behavior , alcoholism , and aggression .
though no genetic data are available for this patient , suicidal behaviors with aeds may be associated with a genetic predisposition independent of known psychiatric illness .
seventh , recent literature supports a bidirectional relationship among epilepsy , psychiatric disorders , and suicidality .
though this case describes a clear temporal relationship between lev dose titration and de novo major depressive episode with suicide attempt , the potential for epilepsy being the causative or predisposing factor must be considered .
further potential risk factors for the development of major depression and/or suicidal behaviors present in this case included basal ganglia and thalamic lacunar infarcts , traumatic brain injury with intracranial hemorrhage , and past alcohol dependence .
eighth , in the context of multiple potential risk factors for the development of de novo major depression with suicide attempt ( epilepsy , treatment with aed , lev titration , past alcohol dependence , traumatic brain injury with intracranial hemorrhage , basal ganglia and thalamic lacunar infarcts , and potential genetic predisposition ) , the probability of lev titration inducing the de novo major depression with associated near fatal suicide attempt was determined by the naranjo 's adverse reaction probability scale as probable ( scored as 5 ) .
there are specific limitations to this paper . as a case report ( n = 1 )
the patient did not have any psychiatric assessment done prior to and following the traumatic brain injury and initiation of lev to assess general psychopathology , affective disorders , and , specifically , impulsive aggression .
lev blood level was not obtained when the patient was on 1000 mg total daily dose .
finally , the patient was lost to clinical follow - up precluding determination of recurrent impulsive - aggressive behaviors or affective features after discontinuation of lev .
lev - induced suicidal behavior is an infrequent adverse effect noted in patients with a prior history of affective disorder .
the authors report an apparent dose / concentration - dependent lev - induced de novo major depressive episode with near fatal suicidal attempt in the absence of prior affective history following chronic stable treatment with lev .
clinicians should monitor affective features when treating patients with epilepsy with lev and other aeds , be cognizant of other potential additive risk factors for suicidal behaviors , and consider therapeutic drug monitoring to optimize therapeutic treatment .
further studies are required to address dose / concentration - dependent lev - induced psychiatric adverse effects . | levetiracetam ( lev ) is a novel antiepileptic drug ( aed ) approved for the adjunctive treatment of generalized and partial seizures .
lev has no clinically significant drug interactions and has limited adverse effects .
the psychiatric adverse effects of lev include de novo psychosis , affective disorder , and aggression .
lev - induced suicidal behavior has been reported infrequently with a past history of affective disorders .
the authors report an apparent dose / concentration - dependent lev - induced de novo major depression with near fatal suicide attempt in a patient without prior history of affective disorder .
psychiatric evaluation with emphasis on historic / current affective disorders , impulsive aggressive behaviors , and assessment of risk factors for suicidal behaviors is indicated in treating patients with epilepsy with lev .
clinicians should consider therapeutic drug monitoring to optimize therapeutic lev treatment . | Introduction
Method
Case
Discussion
Conclusions
Conflict of interest statement |
hereditary hemorrhagic telangiectasia ( hht ) , also known as rendu - osler - weber disease , is an autosomal dominant disorder characterized by atriovenous malformations ( avms ) and telangiectases in multiple organs .
the reported incidence of this disease is 1/10000 in north america but it varies between studies.1 ) the pathologic mechanism includes primary dilatation of postcapillary venules resulting in a direct connection between the arterial and venous systems , bypassing capillaries and finally forming arteriovenous shunts.2 ) the most common clinical features are nosebleeds and telangiectases on the lip , oral mucosa and hands .
high - output cardiac failure is a rare complication of hht3 ) usually caused by shunting of blood through avms in the liver .
we describe two cases of high output heart failure due to large hepatic avms , highlighting their importance in the differential diagnosis of heart failure syndromes .
a 68-year - old woman came to the hospital because of dyspnea { new york heart association ( nyha ) class 3}. on physical examination , the patient was puffy and anemic .
1 ) . her blood pressure was 100/70 mm hg , she had a heart rate of 94/min , and a respiratory rate of 22/min . cardiac examination revealed a midsystolic murmur along the sternal border and a bruit was audible over the epigastrium .
she stated that her family members ( her mother , one sister and one daughter ) also had suffered from recurrent epistaxis .
the laboratory work - up revealed hypochromic microcytic anemia ( hemoglobin 8.8 g / dl ) , normal liver function tests , and normal prothrombin time .
chest x - ray showed generalized cardiomegaly ( ct ratio 65% ) with increased pulmonary vascular markings and pulmonary edema ( fig .
2 ) . transthoracic echocardiogram showed a dilated hypercontractile left ventricle and a restrictive mitral inflow pattern ( mitral e to a ratio=1.3 , e / e=16.6 ) .
ct angiography of the abdomen showed a tortuous and dilated hepatic artery and near total replacement of liver parenchyma by engorged vascular structures with arteriovenous shunt formation ( fig .
cardiac output by right heart catheterization was 12.47 l / min , capillary wedge pressure was 22 mm hg and pulmonary artery pressure was 45/18 mm hg .
mri of the brain with contrast showed an aneurysm ( 7 mm ) in the right paraclinoid intracranial artery ( ica ) and was managed with guglielmi detachable coils ( microvention , aliso viejo , ca , usa ) .
after correction of anemia by iron supplements and treatment with angiotensin receptor blocker and diuretics , heart failure symptoms were significantly improved .
she had been diagnosed with liver cirrhosis and hypertensive heart failure 8 years previously and was intermittently managed with angiotensin receptor blocker and diuretics . from a young age
her blood pressure was 130/60 mm hg , she had a heart rate of 96/min , and a respiratory rate of 20/min . on physical examination , several telangiectases were found in both cheeks , and bounding pulses were palpated .
the liver tip was palpable below the right costal margin . a systolic murmur along the sternal border and a loud bruit over the whole upper abdomen
her laboratory work - up revealed hypochromic microcytic anema ( hemoglobin 10.6 g / dl ) , normal liver function tests , and normal prothrombin time .
chest x - ray showed generalized cardiomegaly ( ct ratio 65% ) and pulmonary edema .
transthoracic echocardiogram showed a dilated and hypertrophied left ventricle with hypercontractile left ventricular systolic function with signs of increased filling pressure and mitral inflow pattern ( e / a ratio=1.5 , deceleration time of mitral inflow e=157 msec , e / e'=12.8 ) . in order to identify the possible arteriovenous connection inside the abdomen ,
this showed a markedly engorged hepatic artery and vein with a fistulous connection between the two ( fig .
, the diagnosis of high output heart failure caused by extensive hepatic arteriovenous connections was made . for identifying the accompanying vascular abnormalities ,
chest ct angiography and cerebral mr angiography were performed and chest ct angiography showed a small avm in the right middle lobe of the lung ( fig .
4 ) . currently , her condition has been stabilized ; however , the possibility of liver transplantation in case heart failure becomes intractable has been explained to the patient .
a 68-year - old woman came to the hospital because of dyspnea { new york heart association ( nyha ) class 3}. on physical examination , the patient was puffy and anemic .
1 ) . her blood pressure was 100/70 mm hg , she had a heart rate of 94/min , and a respiratory rate of 22/min . cardiac examination revealed a midsystolic murmur along the sternal border and a bruit was audible over the epigastrium .
she stated that her family members ( her mother , one sister and one daughter ) also had suffered from recurrent epistaxis .
the laboratory work - up revealed hypochromic microcytic anemia ( hemoglobin 8.8 g / dl ) , normal liver function tests , and normal prothrombin time .
chest x - ray showed generalized cardiomegaly ( ct ratio 65% ) with increased pulmonary vascular markings and pulmonary edema ( fig .
2 ) . transthoracic echocardiogram showed a dilated hypercontractile left ventricle and a restrictive mitral inflow pattern ( mitral e to a ratio=1.3 , e / e=16.6 ) .
ct angiography of the abdomen showed a tortuous and dilated hepatic artery and near total replacement of liver parenchyma by engorged vascular structures with arteriovenous shunt formation ( fig .
cardiac output by right heart catheterization was 12.47 l / min , capillary wedge pressure was 22 mm hg and pulmonary artery pressure was 45/18 mm hg .
mri of the brain with contrast showed an aneurysm ( 7 mm ) in the right paraclinoid intracranial artery ( ica ) and was managed with guglielmi detachable coils ( microvention , aliso viejo , ca , usa ) .
after correction of anemia by iron supplements and treatment with angiotensin receptor blocker and diuretics , heart failure symptoms were significantly improved .
she had been diagnosed with liver cirrhosis and hypertensive heart failure 8 years previously and was intermittently managed with angiotensin receptor blocker and diuretics . from a young age
her blood pressure was 130/60 mm hg , she had a heart rate of 96/min , and a respiratory rate of 20/min . on physical examination ,
the liver tip was palpable below the right costal margin . a systolic murmur along the sternal border and a loud bruit over the whole upper abdomen
her laboratory work - up revealed hypochromic microcytic anema ( hemoglobin 10.6 g / dl ) , normal liver function tests , and normal prothrombin time .
chest x - ray showed generalized cardiomegaly ( ct ratio 65% ) and pulmonary edema .
transthoracic echocardiogram showed a dilated and hypertrophied left ventricle with hypercontractile left ventricular systolic function with signs of increased filling pressure and mitral inflow pattern ( e / a ratio=1.5 , deceleration time of mitral inflow e=157 msec , e / e'=12.8 ) . in order to identify the possible arteriovenous connection inside the abdomen ,
this showed a markedly engorged hepatic artery and vein with a fistulous connection between the two ( fig .
, the diagnosis of high output heart failure caused by extensive hepatic arteriovenous connections was made . for identifying the accompanying vascular abnormalities ,
chest ct angiography and cerebral mr angiography were performed and chest ct angiography showed a small avm in the right middle lobe of the lung ( fig .
4 ) . currently , her condition has been stabilized ; however , the possibility of liver transplantation in case heart failure becomes intractable has been explained to the patient .
hereditary hemorrhagic telangiectasia or osler - weber - rendu disease , characterized by telangiectases and avm in multiple organs is a rare disease with autosomal dominant transmission.4 ) the classic triad is recurrent epistaxis , mucocutaneous telangiectasia , and familial occurrence . the diagnosis of hht is confirmed if any three of the following four criteria are met : 1 ) recurrent epistaxis ; 2 ) multiple telangiectasias ; 3 ) presence of visceral lesions ( in the gastrointestinal tract , lung , liver , brain ) ; 4 ) first degree family history of hht.4 ) hepatic involvement in hht has been reported in 74% of patients with ct of the abdomen . but liver involvement tends to be asymptomatic in majority of cases and the frequency of symptomatic hepatic involvement is less than 10%.1 ) although heart failure secondary to the hyperdynamic circulatory situation caused by arteriovenous fistulas is a well - known clinical entity , the clinical presentation of heart failure is very rare in hht.3 ) the physiological mechanism in high output heart failure is of reduced systemic vascular resistance .
this leads to activation of the renin - angiotensin - aldosterone system , causing salt and water retention .
the shunting of blood through the avms , especially in the liver leads to maldistribution of cardiac output . in order to supply blood to vital organs , cardiac output
is increased with elevated stroke volume and heart rate , leading to high output heart failure .
a high cardiac output has been described as being > 8 l / min or a cardiac index > 3.9 l / min / m.5 ) right heart catheterization in our case 1 demonstrated a markedly increased cardiac output of 12.47 l / min .
reported cases of right - heart catheterization in patients with symptomatic hepatic avms have calculated shunts of 24% to 58% of the cardiac output.6 ) the echocardiography usually shows compensatory left ventricular dilatation and left ventricular hypertrophy , but preserved or high left ventricular systolic function .
5 ) high output heart failure could be presented as a diastolic dysfunction.7 ) echocardiographic findings in our cases were consistent with those of the previous reports .
in contrast to low output heart failure , clinical trial data regarding treatment of high output heart failure are lacking .
diuretics are the mainstay of treatment in high output heart failure , especially with symptoms of volume overload .
the patients in the two above mentioned cases were treated with angiotensin receptor blocker and diuretics .
there have been scattered experiences with transfemoral embolization,8 ) surgical ligation of the feeding vessels9 ) in symptomatic patients . however , in intractable patients , liver transplantation10 ) has been the standard treatment .
recently , treatment with bevacizumab11)-the anti - vascular endothelial growth factor has been reported to be effective in heart failure patients with hht by slowing the progression of vascular malformations .
cerebral avms are present in 5% to 23% of patients with hht with intracranial hemorrhage rates of 0.41% to 2% per year.1 ) but the association between intracerebral aneurysm and hht has not been reported in the literature .
thus , the possibility of an incidental coexistence of intracerebral aneurysm with hht is likely .
reported cases with cerebral involvement were managed by neurovascular surgery , embolotherapy , and stereotactic radiosurgery.12)13 ) the case of the woman with a cerebral aneurysm in the right paraclinoid ica was treated successfully with guglielmi detachable coils .
three hht genes ( endoglin , activin a receptor type ii - like 1 , smad4 ) have been identified to date , and several others are suspected.12 ) genetic studies were not performed in our cases due to economic problems .
when a proband is found , it is necessary to take a careful family history in order to detect possible hht in multiple relatives .
although the disease may be easily suspected when history and clinical manifestations are typical , there are some cases like those in our study that were initially misdiagnosed
. the most important first step towards managing hht is clinical suspicion of hht and early diagnosis by detailed history taking and physical examination , because the first presentation of this disease can be a critical condition such as massive hemoptysis , brain hemorrhage . in conclusion , we present here two patients of hht who presented with high output heart failure .
high output heart failure was controlled by medical management with some clinical improvement , but a careful follow - up may be necessary to detect developing cerebral or pulmonary avms
. clinical suspicion of hht based on detailed history taking and physical examination is essential for early detection and proper management of heart failure associated with hht . | high - output cardiac failure is a rare complication of hereditary hemorrhagic telangiectasia ( hht ) usually caused by shunting of blood through atriovenous malformations ( avms ) in the liver .
we describe two cases of high output heart failure due to large hepatic avms .
clinical suspicion of hht based on detailed history taking and physical examination is essential for early detection and proper management of heart failure associated with hht . | Introduction
Case
Case 1
Case 2
Discussion |
it is estimated that about india has about 2.09 million cases of people living with human immunodeficiency virus ( hiv)/aids in 2011 . even though the incidence of new cases has reduced over the past few years
thus , although the overall hiv adult prevalence in 2011 was 0.27% , in certain high - risk groups the estimated prevalence was very high .
for instance , in the year 20102011 , the prevalence was 2.67% in female sex workers was 2.67% , 4.43% in men who have sex with men , 7.14% in people who injected drugs , and 8.82% in male - to - female transgendered people .
the main route of transmission - unprotected sex - accounts for nearly 89% of the total new infections .
the second most common route of transmission , accounting for 5% of the cases is a parent to child transmission .
the first national aids control programme ( nacp ) in was launched in 1992 for prevention and control of hiv in india .
the prevention of parent to child transmission ( pptct ) was initiated in 2002 under nacp - ii .
the main components of the program were aimed at ( 1 ) primary prevention of hiv in women ; ( 2 ) avoid unintended pregnancies in hiv - infected women ; ( 3 ) prevent transmission of hiv infection to the baby ; and ( 4 ) support women and children living with hiv .
even though the initial treatment strategy was single dose nevirapine , the current recommendations include providing antiretroviral therapy ( art ) to all infected women ) .
in fact , the nacp has converged its program with the national health mission ( nhm ) to improve the reach to all pregnant women .
the current recommendations include an essential package for pptct services ; some of the components are : counseling ; family centric approach ; provision of art ; institutional delivery ; counseling and support post delivery ; follow - up and care of the baby ; and treatment of associated conditions ( such as sexually transmitted infections ) .
india , with more than 15,000 pptct centers , tests about 8.83 million women annually , and the program was integrated with the nhm to provide hiv testing services to all antenatal women .
however , only 53% of pregnant women use skilled child care , and the total estimated proportion of coverage of the pregnant women who have been tested for hiv was 23% in 2010 .
even though , there has been an improvement in women availing the integrated counselling and testing centres , studies have identified certain shortcomings such as low coverage of the pptct program , poor follow - up of the mother and baby , low proportion of institutional deliveries , inadequate counseling services , poor laboratory facilities , and resistance to medications .
the present study was designed to study the changes in serology and hiv testing behaviors over a 10-year period in a pptct center in a tertiary care center in india .
we also assessed the public health implications of these changes on the pptct program in the country .
the present study is a secondary analysis of clinical data collected at the antenatal clinic ( anc ) from 2002 to 2011 .
the study was conducted the mahatma gandhi mission 's medical college and hospital , aurangabad , maharashtra , india .
it is situated at a distance of about 350 km from the state capital mumbai and has experienced rapid urbanization over the past decade .
the hospital has all specialty and subspecialty departments and caters mostly to low - middle and low - income patients .
the pptct program at the mgm medical college and hospital was started in the year 2002 .
aurangabad was classified a category a ( > 1% prevalence in anc ) district based on the surveillance data . in concordance with the national aids control organisation ( naco ) program , we implemented the opt - out policy of hiv testing .
all women accessing antenatal care in the hospital were counseled about hiv testing using the group counseling method .
the posttest counseling was done in these women using one - to - one counseling technique .
all women were also asked to discuss hiv with their spouses and get them tested in the center .
these included various options - continuation of pregnancy or medical termination of pregnancy ( mtp ) . in women who opted for continuation of pregnancy , we offered them therapy according to the naco guidelines .
these included : single dose of nevirapine to the mother ; elective caesarean section with no milking of cord ; choice of feeding options ; a single dose of nevirapine to the baby ; and follow - up of all children in the hospital .
the key outcomes in our analysis were : ( 1 ) proportion of women who opted for hiv test ( total number of women who had an hiv test / total number of women who attended the anc ) and proportion of women who tested hiv positive ( total number of women who tested hiv positive / total number of women tested ) ; ( 2 ) proportion of male partners who came in for hiv test ( total number of male partners tested / total number of women tested ) and proportion who tested hiv positive ( proportion of male partners who tested hiv positive / total number of male partners tested ) ; and ( 3 ) proportion of women who opted for continuation of pregnancy or mtp ( total number of women who continued with the pregnancy or opted for mtp / total number of women who tested hiv positive ) .
we calculated the proportions and their 95% confidence intervals ( cis ) for each year and the trends were assessed using the chi - square test for trend .
data were analyzed using stata version 13 ( statacorp , college station , texas , usa ) .
the study was conducted the mahatma gandhi mission 's medical college and hospital , aurangabad , maharashtra , india .
it is situated at a distance of about 350 km from the state capital mumbai and has experienced rapid urbanization over the past decade .
the hospital has all specialty and subspecialty departments and caters mostly to low - middle and low - income patients .
the pptct program at the mgm medical college and hospital was started in the year 2002 .
aurangabad was classified a category a ( > 1% prevalence in anc ) district based on the surveillance data . in concordance with the national aids control organisation ( naco ) program , we implemented the opt - out policy of hiv testing .
all women accessing antenatal care in the hospital were counseled about hiv testing using the group counseling method .
the posttest counseling was done in these women using one - to - one counseling technique .
all women were also asked to discuss hiv with their spouses and get them tested in the center .
these included various options - continuation of pregnancy or medical termination of pregnancy ( mtp ) . in women who opted for continuation of pregnancy , we offered them therapy according to the naco guidelines .
these included : single dose of nevirapine to the mother ; elective caesarean section with no milking of cord ; choice of feeding options ; a single dose of nevirapine to the baby ; and follow - up of all children in the hospital .
the key outcomes in our analysis were : ( 1 ) proportion of women who opted for hiv test ( total number of women who had an hiv test / total number of women who attended the anc ) and proportion of women who tested hiv positive ( total number of women who tested hiv positive / total number of women tested ) ; ( 2 ) proportion of male partners who came in for hiv test ( total number of male partners tested / total number of women tested ) and proportion who tested hiv positive ( proportion of male partners who tested hiv positive / total number of male partners tested ) ; and ( 3 ) proportion of women who opted for continuation of pregnancy or mtp ( total number of women who continued with the pregnancy or opted for mtp / total number of women who tested hiv positive ) .
we calculated the proportions and their 95% confidence intervals ( cis ) for each year and the trends were assessed using the chi - square test for trend .
data were analyzed using stata version 13 ( statacorp , college station , texas , usa ) .
the total anc attendance over the 10-year period was 15901 ; thus , the total proportion of women who opted for hiv testing was 72.0% ( 95% ci : 70.773.4% ) .
the acceptance of test increased from 35.9% ( 95% ci : 31.740.4% ) in 2002 to the peak of 82.6% ( 95% ci : 78.686.8% ) in 2009 ; the trend was statistically significant ( chi - square for trend p < 0.001 ) [ figure 1 ] .
however , there was a reduction in the proportion from 2009 to 2011 [ figure 1 ] ; this trend was also statistically significant ( chi - square for trend p < 0.001 ) .
trends of the total antenatal attendance ( anc ) and proportion of women who opted for hiv testing , 2002 - 11 , aurangabad , india the overall hiv prevalence over the decade was 0.70% ( 95% ci : 0.550.87% ) .
the prevalence was as high as 1.11% ( 95% ci : 0.233.24% ) in 2002 .
it reduced over time : it was 0.86% ( 95% ci : 0.451.51% ) in 2006 and as low as 0.37% ( 95% ci : 0.120.87% ) in 2011 [ table 1 ] .
this reduction in proportion was statistically significant ( chi - square for trend p < 0.001 ) [ figure 2 ] . in the year 2002 ,
two of the three women who tested positive for hiv opted for mtp . however , the proportion of women who opted for mtp reduced over the 10-year period .
none of the women opted for mtp in the year 2011 [ figure 3 ] .
this reduction was statistically significant ( chi - square for trend , p = 0.001 ) . only one woman ( of three positive women ) opted for delivery in the year 2002 .
however , all hiv - infected women opted for delivery in the year 2011 [ figure 3 ] ; this trend was statistically significant ( p = 0.001 ) .
the hiv testing behaviours of women and spouses , and hiv serology in women , 2002 - 11 , aurangabad , india trends of the total antenatal women who opted for hiv test and proportion of women who were hiv infected , 2002 - 11 , aurangabad , india trends of the total antenatal women were hiv infected , and proportion of those who opted for medical termination of pregnancy and continuation of pregnancy , 2002 - 11 , aurangabad , india only 0.57% of male partners tested for hiv over this time period .
the proportion of male partners who opted for hiv testing was 0.73% ( 95% ci : 0.092.67% ) in 2002 .
there was a gradual reduction in this proportion over the 10-year period [ figure 4 ] .
the proportion of male partners who tested for hiv was as low as 0.22% ( 95% ci : 0.050.65% ) in 2011 ; this reduction was statistically significant ( chi - square for trend , p = 0.006 ) .
trends of the total antenatal women who opted for hiv test and proportion of spouses who tested for hiv , 2002 - 11 , aurangabad , india of the total 80 hiv - infected women , 48 have delivered .
of these , 27 children have completed their 18 months of follow - up ( until the end of 2011 ) ; all of these children tested negative for hiv .
thus , in our study , the prevalence of hiv among antenatal women reduced over the 10-year period .
though , a high proportion of antenatal women opted for hiv testing ; there was a decline in the proportion in the latter years .
in general , the trends of hiv prevalence have been similar to the overall state prevalence .
for instance , the sentinel surveillance data show that the hiv prevalence in the anc clinics in maharashtra was 1.15% in 2003 .
however , the proportion had reduced to 0.42% in the year 201011 . even though these findings are encouraging ,
an important area of concern is the reduction in the proportion of women who opted for hiv testing .
such reductions in the proportion of anc women opting for hiv test have also been reported from other parts of india .
the overall , however , of the proportion of women who opted for hiv testing was similar to that observed in other parts of the country .
it has been suggested that , though testing and management facilities are available in the pptct centers , many women experience discrimination by various stakeholders ( such as healthcare personnel , family members , and the larger community ) .
in addition , women may feel that hiv - positive status may bring shame to them or their family ; thus , they may be reluctant to undergo hiv test or access pptct services . though counselors address individual level stigma and discrimination , systematic discrimination in healthcare settings needs to be addressed by incorporating various components of stigma and discrimination in hiv - infected individuals and means to address them in the guidelines for pptct programs in india .
another important finding observed in this study is that all hiv - infected women opted for continuation of pregnancy in the latter years , whereas all hiv - infected women had opted for mtp in earlier years .
though some pregnancies in hiv - infected women may be unintended , it has also been observed that a high proportion of hiv women desires to have a child even if they already have children .
tibrewal and goswami found that hiv - infected women opted for mtp due to fear of transmission to the child .
thus , increased awareness about hiv , availability of treatment for prevention of transmission , and availability of treatment options ( including antiretroviral therapy ) through government program for hiv care of infected children may have contributed to this change .
other issues that determine choices about pregnancy are the duration of hiv infection , economic status , and support from the family members .
for instance , kanniappan et al . reported that women who were assured of family support and care of their infected children were more likely to opt to have a child .
thus , pregnancy related choice in hiv - infected women is as much a socioeconomic issue as it is a clinical issue ; these areas should form an important component of the pptct policy .
one of the most significant findings from our study was the poor attendance of the male partners in the pptct clinic .
less than 1% of male partners were tested in the pptct clinic ; the proportion had significantly reduced over the past 10 years .
though , low male involvement has been reported globally , none of these studies found the involvement to be as low as our study .
in general , hiv testing among male partners has been reported to be significantly higher in hiv - infected women and in those whose men who had tested for hiv earlier . a systematic review by morfaw et al .
found that reluctance to learn one 's hiv status and lack of time were two main barriers to access these services .
apart from these factors , cultural norms that pregnancy is only woman 's affair and assuming that one 's status is same as that of the partner were important factors that prevented men from attending the anc .
interestingly , knowledge about routes of hiv transmission and hiv testing facilities in government hospitals were found to be associated with a willingness to test by male partners .
in addition , women themselves may be disinclined to discuss hiv testing and hiv status with the male partners ; this may be due to fear of stigma , adverse labels , or domestic violence .
thus , effective programs ( such as couple counseling ) to encourage male participation should be designed and included in the pptct centers .
it was earlier pointed out that the indian pptct programs did not have specific strategies to include fathers in these centers .
though , a new strategy and policy document were released in 2013 , it still does have any specific guidelines or methods for involving men in the pptct centers .
it is quite possible that male partners may get tested at other sites ( such as private clinics ) ; but , there are no existing mechanisms to track these tests .
even the anc data collected for regular monitoring do not reflect the male attendance in these centers .
thus , the program strategies need to be upgraded to include male partners and truly make it a prevention of parent to child transmission .
we have not analyzed individual - level data , and the variables were group level or ecologic level analysis .
nonetheless , this study presents interesting trends over a 10-year period . to the best of our knowledge ,
the data analyzed in the study are from the longest follow - up period in an anc after the initiation of the pptct program in india .
the pptct program , which provides probably the only chance for many women to get tested for hiv , needs to move beyond the clinical components and improve the psychosocial and counseling components .
strategies to improve acceptance of testing in pregnant women should be included in the pptct guidelines .
in addition , even though focusing on the family is an important part of a package of essential services , there are no explicit guidelines on these .
our data highlight that men do not get tested - at least in the pptct program .
thus , lack of their inclusion is one of the main shortcomings of the program and needs to be strengthened - by having specific targeted interventions for them and including the male partners in all the mass media campaigns to make the program more effective . | objectives : the present study evaluated the changes in serology and human immunodeficiency virus ( hiv ) testing behaviors over a 10-year period in a center in india.methods:we used clinical data collected at the antenatal clinic from 2002 to 2011 .
the key outcomes were : ( 1 ) proportion of women who opted for hiv test and those who tested positive ; ( 2 ) proportion of male partners who came in for hiv test and those who tested positive ; and ( 3 ) proportion of women who opted for continuation of pregnancy or for medical termination of pregnancy.results:we tested 11,452 women for hiv over the 10-year period from 2002 to 2011 .
the proportion of women who opted for hiv testing was 72.0% ( 95% confidence interval [ ci ] : 70.773.4% ) .
the acceptance of test increased from 35.9% ( 95% ci : 31.740.4% ) in 2002 to the peak of 82.6% ( 95% ci : 78.686.8% ) in 2009 ( p
< 0.001 ) .
the overall hiv prevalence over the decade was 0.70% ( 95% ci : 0.550.87% ) .
the prevalence high at 1.11% ( 95% ci : 0.233.24% ) in 2002 and reduced to 0.37% ( 95% ci : 0.120.87% ) in 2011 ( p < 0.001 ) .
only 0.57% of male partners tested for hiv over this time period.conclusion:strategies to improve acceptance of testing in pregnant women should be included in the indian guidelines .
the male partners do not get tested .
thus , this component needs to be strengthened - by targeted interventions for male spouses - to make the program more effective . | INTRODUCTION
METHODS
Study site
Study procedures and population
Statistical analysis
RESULTS
DISCUSSION
CONCLUSION
Financial support and sponsorship
Conflicts of interest |
complex ventricular arrhythmia and death follows overt congestive heart failure ( chf ) , and it is one of the poor prognostic sign of acromegaly .
though prevalence of biventricular hypertrophy present in 90% of autopsied older and 20% of younger patients with acromegaly , presence of overt chf is less common . the estimated frequency of overt chf ranges from 1% to 4% in the literature
the literature on prevalence of overt chf and their outcomes is sparse and none from india till date and hence , this study was planned .
this is a retrospective analysis of hospital records of consecutive patients with acromegaly between 1996 and 2007 from the acromegaly registry of department of endocrinology , postgraduate institute of medical education and research , chandigarh , india .
records of the patients with the diagnosis of acromegaly and presence of overt heart failure were retrieved from the departmental acromegaly registry .
acromegaly was diagnosed based on elevated igf-1 compared to age and sex - matched normative data and/or failure to suppress growth hormone ( gh ) following 75 gm anhydrous glucose load in a patient with signs and symptoms suggestive of acromegaly .
these patients were treated as per the standard management of acromegaly including transnasal sphenoid surgery followed by medical and/or radiotherapy for persistent or recurred disease .
as per the departmental protocol and pre - operative assessment , all the patients with active acromegaly were subjected for ecg and echocardiography to rule out cardiomyopathy in accordance with standard guidelines .
patients diagnosed to have cardiomyopathy were followed up at regular interval at endocrine and cardiology clinics of the institute , and therapy for cardiomyopathy was decided by the cardiologist .
the diagnosis of overt congestive heart failure ( chf ) was based on clinical signs as described by framingham heart study group and the new york heart association ( nyha ) classification and echocardiography showing a left ventricular ejection fraction ( lvef ) of 45% .
detailed history , hormonal and radiological investigations and cardiovascular procedures , treatment modalities , and outcomes were recorded separately and analyzed .
m - mode , two - dimensional and pulsed doppler echocardiography were done by commercial ultrasound system using 2.5 mhz transducer in three to five consecutive cardiac cycles .
left ventricular end diastolic diameter end systolic diameter , interventricular septal thickness , left ventricular posterior wall thickness , and left ventricular ejection fraction ( lvef ) were recorded .
decision for cardiac catheterization and coronary angiography with left ventricular angiography were taken by the opinion of the cardiologist , and their data were analyzed by them ( rbv and ksr ) .
this is a retrospective analysis of hospital records of consecutive patients with acromegaly between 1996 and 2007 from the acromegaly registry of department of endocrinology , postgraduate institute of medical education and research , chandigarh , india .
records of the patients with the diagnosis of acromegaly and presence of overt heart failure were retrieved from the departmental acromegaly registry .
acromegaly was diagnosed based on elevated igf-1 compared to age and sex - matched normative data and/or failure to suppress growth hormone ( gh ) following 75 gm anhydrous glucose load in a patient with signs and symptoms suggestive of acromegaly .
these patients were treated as per the standard management of acromegaly including transnasal sphenoid surgery followed by medical and/or radiotherapy for persistent or recurred disease . as per the departmental protocol and pre - operative assessment ,
all the patients with active acromegaly were subjected for ecg and echocardiography to rule out cardiomyopathy in accordance with standard guidelines .
patients diagnosed to have cardiomyopathy were followed up at regular interval at endocrine and cardiology clinics of the institute , and therapy for cardiomyopathy was decided by the cardiologist .
the diagnosis of overt congestive heart failure ( chf ) was based on clinical signs as described by framingham heart study group and the new york heart association ( nyha ) classification and echocardiography showing a left ventricular ejection fraction ( lvef ) of 45% .
detailed history , hormonal and radiological investigations and cardiovascular procedures , treatment modalities , and outcomes were recorded separately and analyzed .
m - mode , two - dimensional and pulsed doppler echocardiography were done by commercial ultrasound system using 2.5 mhz transducer in three to five consecutive cardiac cycles .
left ventricular end diastolic diameter end systolic diameter , interventricular septal thickness , left ventricular posterior wall thickness , and left ventricular ejection fraction ( lvef ) were recorded .
decision for cardiac catheterization and coronary angiography with left ventricular angiography were taken by the opinion of the cardiologist , and their data were analyzed by them ( rbv and ksr ) .
a total of 150 patients were diagnosed to have acromegaly during the period of 11 years . of these
, 20 had evidences for left ventricular hypertrophy and/or left ventricular diastolic dysfunction ( 13.3% ) , 1 had lv systolic dysfunction due to previous coronary artery disease , and 6 patients had evidence of overt congestive heart failure ( 4% ) . out of 6 patients , in 4 patients , congestive heart failure ( chf ) was presenting manifestation of acromegaly and 2 developed chf during the course of the illness .
there were 5 males and 1 female with the mean age of 41 17.3 years ( range 24 - 50 years ) .
mean gh level following oral glucose load was 41 17.5 ng / dl ( range 12 - 64 ng / dl ) .
three patients were hypothyroid , and 2 were hypocortisolic at the time of diagnosis and were on replacement therapy .
mri showed macroadenoma ( size > 1 cm ) with evidence of apoplexy in 1 case ( case 3 ) , and 1 developed apoplexy during hospital admission ( case 4 ) . in 1 patient , pituitary was not separately visualized due to fibrous dysplasia involving sphenoid sinus ( case 5 ) .
four patients had chf at the time of presentation and 2 developed it during course of illness ( case- 2 and 6 ) .
four patients had nyha class iv dyspnea while 2 had class iii , left ventricular ejection fraction was 30 or less with echocardiographical features suggestive of global biventricular hypokinesia in all patients .
two patients had history of hypertension and controlled with medications , and 1 had diabetes who was on high dose of insulin ( 120 units / day ) to control his blood glucose .
data on coronary angiography was available in 3 cases , which showed dilated left ventricles with normal coronary arteries in all these cases [ figure 1 ] and confirmed by autopsy in 1 patient .
out of these 6 patients , the patient with fibrous dysplasia lost to follow up , 1 patient died before planned surgery , and 2 underwent transsphenoid surgery for removal of pituitary macroadenoma .
one patient , already underwent transfrontal surgery for pituitary macroadenoma 6 year back , had recurrence of disease and was presented to chf after 6 years , he was given somatostatin analogues in interim period and after stabilization of general condition , he underwent transphenoidal surgery ( case 2 ) .
another patient underwent tss 1 year back before he presented with chf , and he died before investigation and management was contemplated .
of 5 cases available for outcome analysis , only 1 patient is alive ( case 3 ) .
he was young with short duration of acromegaly and treated timely and did not have other risk factors like hypertension and diabetes , furthermore , his gh levels were lowest compared to other 5 patients after 75 gm oral glucose load . after trans - sphenoidal surgery , gh normalized , and at 3 month , left ventricular ejection fraction improved to 35% from 25% at baseline and furthermore , there was normalization of cardiac size on serial chest x - ray [ figure 2 ] .
three patients died of ventricular arrhythmias and 1 due to sepsis and csf over drainage from lumber drain .
one patient died of apoplexy followed by ventricular arrhythmia , and autopsy was performed in this case ( case 4 ) .
autopsy confirmed normal coronaries , severe concentric biventricular hypertrophy , myofibrillar necrosis , and interstitial fibrosis [ figure 3 ] .
hormonal , radiological , cardiovascular characteristics and outcomes of acromegaly patients with over congestive heart failure ( n=6 ) ( a ) coronary angiography showing normal epicardial coronaries and ( b ) left ventricular angiography showing dilated left ventricle ( a ) chest x - ray pa view showing cardiomegaly at the time of presentation ( b ) chest x ray pa view of same patient three months after transsphenoid surgery showing reduction of cardiac size ( a ) autopsy specimen of the heart showing the concentric left ventricular hypertrophy at apical slice .
( b ) low power photomicrograph of the left ventricle showing variation in the myofibre size with anisonucleosis and interstitial fibrosis .
( h and e , 20).(c ) low power photomicrograph of the heart in special stain to highlight the interstitial fibrosis , seen as bluish green .
we report 6 cases of overt congestive heart failure out of 150 cases of acromegaly ( 4% ) .
clinical symptoms and signs of heart failure were found in about 10% of newly diagnosed acromegaly , and they were characterized by normal systolic function implying high output failure .
however , the overt chf were reported as less than 1% in one study while another recent study estimated its prevalence as 4% .
our study finds prevalence of overt chf as 4% , which is in consonance with later study .
diabetes mellitus and systemic hypertension are independent risk for morbidity and mortality , and they aggravate the heart failure .
however , in present study , only 1 had diabetes and 2 had hypertension suggesting elevated gh is most important factor for overt chf .
normalization of gh and igf levels either with medical or surgical management have been shown to reverse the cardiac manifestation effectively and reduce morbidity and mortality .
somatostatin analogues normalize gh and igf-1 levels in 60 - 70% of cases and with short treatment of 1 - 3 months have been shown to reduce lv posterior and interventricular wall thickness , and more significant effect is achieved with long - term treatment .
we used somatostatin analogue in one patient to normalize gh and stabilization of chf before surgery .
biopsy and autopsy studies indicate that interstitial fibrosis is the main histological features that gradually impair architecture and function .
other histological features are increased extra cellular collagen deposition , myofibrillar derangement , and areas of lymphocytic infiltration gradually impairing whole architecture .
generally , coronary arteries remain uninvolved as is evident by normal epicardial coronaries in all our 3 patients who underwent angiography and 1 patient at autopsy .
echocardiography shows initial cardiac chamber enlargement followed by diastolic dysfunction and at the end , global hypokinesia with component of systolic dysfunction .
the cardiac function can be restored to normal with control of the disease . in all studies , diastolic dysfunction improved , but ejection fraction and exercise performance remained variable .
the prevalence of cardiac arrhythmias in acromegaly was reported between 3.7% in one study and 48% in another . in our study ,
the increased frequency is thought to be due to the abnormal remodeling of the ventricular wall .
this is the first study from india to examine prevalence of chf in large number of acromegaly patients with complete work up including angiography data and autopsy finding in one .
these are the strength of the study . however , retrospective nature and lack of comparative group are the limitations . in conclusion ,
overt chf is associated with high mortality and hence , this complication should be recognized at earliest and medical management to normalized cardiac function should be given utmost priority . | background : though cardiac involvement is common in acromegaly , overt congestive heart failure is uncommon.materials and methods : this is retrospective analysis of hospital record between 1996 and 2007 .
we analyzed records of 150 consecutive patients with acromegaly .
we included the patients with acromegaly those who had overt congestive heart failure either at presentation or during the course of illness for the present analysis .
the diagnosis of acromegaly and congestive cardiac failure were based on standard criteria.results:out of 150 patients with acromegaly , 6 patients had overt chf ( 4.0% ) , of which 4 presented with the features of chf and 2 developed during the course of illness .
three patients had hypertension and 1 had diabetes .
baseline echocardiography showed severe biventricular dysfunction and global hypokinesia in all .
angiography showed dilated hypokinetic left ventricle with normal coronaries in 3 , it was confirmed at autopsy in 1 .
three underwent trans - sphenoidal surgery , 1 received somatostatin analogue as primary treatment modality .
normalization of growth hormone and igf-1 led to improvement in cardiac function in 1 , 1 patient lost to follow up , and 4 died during the course of illness . in 1 patient ,
autopsy was performed and cardiac specimen revealed normal coronaries , concentric ventricular hypertrophy , and dilatation with myofibrolysis and interfascicular fibrosis.conclusion:prevalence of overt chf is 4% in present series .
overt chf carries poor prognosis and hence , this complication should be recognized at earliest , and medical management to normalized cardiac function should be given utmost priority . | I
M
Study design
Patient selection
Cardiology assessment
R
D |
to demonstrate a capsulorhexis technique using predominantly shearing forces with a cystotome on a virtual reality simulator and on a human eye .
our technique involves creating the initial anterior capsular tear with a cystotome to raise a flap .
the cystotome tip is tilted horizontally and is engaged on the flap near the leading edge of the tear .
the loose flap is constantly swept towards the centre so that it does not obscure the view on the tearing edge .
re - engage the needle to the tearing edge frequently to create a suitably sized continuous curvilinear capsulorhexis .
our technique has the advantage of reducing corneal wound distortion and subsequent anterior chamber collapse .
the capsulorhexis flap is moved away from the tear leading edge allowing better visualisation of the direction of tear .
this technique offers superior control of the capsulorhexis by allowing the surgeon to change the direction of the tear to achieve the desired capsulorhexis size .
to demonstrate a capsulorhexis technique using predominantly shearing forces with a cystotome on a virtual reality simulator and on a human eye .
our technique involves creating the initial anterior capsular tear with a cystotome to raise a flap .
the cystotome tip is tilted horizontally and is engaged on the flap near the leading edge of the tear .
the loose flap is constantly swept towards the centre so that it does not obscure the view on the tearing edge .
re - engage the needle to the tearing edge frequently to create a suitably sized continuous curvilinear capsulorhexis .
our technique has the advantage of reducing corneal wound distortion and subsequent anterior chamber collapse .
the capsulorhexis flap is moved away from the tear leading edge allowing better visualisation of the direction of tear .
this technique offers superior control of the capsulorhexis by allowing the surgeon to change the direction of the tear to achieve the desired capsulorhexis size .
the eyesi surgical simulator is a realistic training platform for surgeons to practice complex capsulorhexis techniques .
the shearing forces technique is a suitable alternative and in some cases a far better technique in achieving the desired capsulorhexis . | purpose : to demonstrate a capsulorhexis technique using predominantly shearing forces with a cystotome on a virtual reality simulator and on a human eye.method:our technique involves creating the initial anterior capsular tear with a cystotome to raise a flap .
the flap left unfolded on the lens surface .
the cystotome tip is tilted horizontally and is engaged on the flap near the leading edge of the tear .
the cystotome is moved in a circular fashion to direct the vector forces .
the loose flap is constantly swept towards the centre so that it does not obscure the view on the tearing edge.results:our technique has the advantage of reducing corneal wound distortion and subsequent anterior chamber collapse .
the capsulorhexis flap is moved away from the tear leading edge allowing better visualisation of the direction of tear .
this technique offers superior control of the capsulorhexis by allowing the surgeon to change the direction of the tear to achieve the desired capsulorhexis size.conclusions:the eyesi surgical simulator is a realistic training platform for surgeons to practice complex capsulorhexis techniques .
the shearing forces technique is a suitable alternative and in some cases a far better technique in achieving the desired capsulorhexis . | Protocol
Part 1 : Purpose:
Part 2 : Method:
Steps:
Part 3 : Results:
Discussion
Disclosures |
precise molecular control of protein glycosylation would advance the development of biopharmaceuticals as well as fundamental studies of glycosylation - dependent biological processes .
biological methods on their own have failed to achieve this long sought - after goal , as cellular biosynthetic pathways produce glycoproteins as a heterogeneous mixture of glycoforms .
glycoprotein structures with optimal bioactivity are difficult to identify from such complex mixtures and impossible to generate exclusively using conventional cell hosts .
the tools of synthetic biology have been harnessed to construct heterologous glycan biosynthetic pathways in simple host cells .
while these systems have produced glycoproteins that are globally modified with a single glycan type , no recombinant expression system can yet produce proteins with discrete glycans at individual sites and with complete homogeneity .
chemical synthesis is currently the only plausible approach to achieve homogeneously glycosylated proteins bearing tailored glycans at specific sites .
several groups have successfully combined frontier protein ligation techniques with chemical or enzymatic glycan and glycopeptide synthesis methods to construct glycoproteins that duplicate natural structures .
the valor of these efforts should not be underestimated since the difficulties inherent to glycan and protein syntheses amplify each other when both biopolymers coexist in the same synthetic target .
a more practical , though less biologically authentic , approach involves conjugating glycans to recombinant proteins via unnatural but synthetically tractable linkages .
site - specificity in the modification can be ensured by outfitting the protein with a noncanonical amino acid side chain capable of chemoselective ligation with an appropriately functionalized glycan .
we and others have explored the oxime - forming reaction of aminooxy glycans with peptide - associated aldehydes or ketones as a means of site - specific glycosylation .
this chemistry proceeds in mildly acidic aqueous buffers that are compatible with most proteins and poses little risk of side reactivity with endogenous protein or glycan functionalities . despite promising initial work
, however , the generality of the approach remains limited by two challenges : ( 1 ) the need for a practical means of introducing aldehydes or ketones into recombinant proteins using standard expression systems , and ( 2 ) a reliable route to synthesize higher - order aminooxy glycans .
the recently developed aldehyde tag methodology answers the first challenge , as it enables site - specific introduction of aldehyde - bearing formylglycine ( fgly ) residues into any recombinant protein of interest using conventional escherichia coli(32 ) or mammalian(33 ) expression systems .
the aldehyde tag is a five - residue consensus sequence ( cxpxr , where x is variable ) that is recognized by the formylglycine generating enzyme ( fge ) .
cotranslationally , fge oxidizes the genetically encoded cysteine residue to fgly , thereby providing a uniquely reactive site for chemical modification .
although fge is native to most cell types , coexpression of additional fge alongside a recombinant protein substrate ensures high cys - to - fgly conversion yields .
use of the aldehyde tag method simply requires cloning the consensus sequence into the protein s gene at the desired site of modification , followed by protein production in fge - expressing cells .
in addition to its practicality , the aldehyde tag method benefits from the resemblance of the fgly side chain to naturally glycosylated amino acid side chains .
most secreted and cell - surface vertebrate glycoproteins are modified at asn residues with n - glycans or at ser / thr residues with o - glycans ( figure 1a ) .
we envisioned oxime - linked glycoproteins deriving from conjugation of the fgly aldehyde with synthetic aminooxy glycans as illustrated in figure 1b .
protein linkages comprising fgly - derived oximes are close structural mimics of n - glycan linkages and just one atom longer than o - glycan linkages .
natural glycan linkages resemble the linkage produced by protein glycoengineering via the reaction of aminooxy sugars with the aldehyde tag .
( a ) linkages naturally found in the most abundant mammalian n- and o - linked glycan structures .
( b ) the linkage formed upon the reaction of an aminooxy glycan with the aldehyde of an fgly - containing protein .
the resulting oxime side chain bears high structural similarity to the natural glycoprotein attachments . to capitalize on the aldehyde tag as a tool for site - specific protein glycosylation
, we sought to answer the second challenge a practical and general route to synthesize complex aminooxy glycans . here
we report on the use of glycosyl n - pentenoyl hydroxamates as intermediates in the synthesis of higher - order aminooxy glycans .
these analogues function well in both chemical and enzymatic glycosylation reactions , enabling the efficient and high - yielding production of both simple and elaborated aminooxy glycans as substrates for protein conjugation .
the new synthetic approach , together with the aldehyde tag technology , enabled the generation of recombinant proteins modified site - specifically with homogeneous glycans .
in previous work , aminooxy glycosides were synthesized by displacement of a glycosyl halide with n - hydroxysuccinimide ( nhs ) or n - hydroxyphthalimide ( nhpht ) .
reaction yields were acceptable using monosaccharide substrates but , in our hands , fell precipitously with increasing glycan complexity . additionally , glycosylations of nhs and nhpht with other donors , such as glycosyl acetimidates and thioglycosides , were low yielding , even with monosaccharide substrates .
in addition to falling short as glycosyl acceptors , nhs and nhpht were inadequate aminooxy protecting groups . they were labile to basic and reductive conditions , which undermined their use during complex glycan synthesis .
moreover , we envisioned using one - pot multienzyme methods(39 ) to convert simple aminooxy glycans into more complex structures
. however , such reactions would require protection of the aminooxy group to avoid oxime formation with the latent aldehydes or ketones associated with free sugars .
the lability of the nhs and nhpht groups undermined our efforts to deprotect late - stage glycan intermediates without loss of the aminooxy protecting group .
reactions corresponding to entries 17 were conducted in ch2cl2 ( unless specified ) at 0 c , and those corresponding to entries 813 were performed at 20 c .
therefore , we sought to identify an alternative aminooxy protecting group that possessed better chemical stability overall but was readily removable under mild conditions that are compatible with free sugars .
ideally , the nucleophilicity of the masked aminooxy group would be superior to that of the n - hydroxyimides as well , thus enhancing reactivity as a glycosyl acceptor .
after screening a variety of options , we found the n - pentenoyl protecting group to be an excellent candidate .
originally introduced by fraser - reid and co - workers , the pentenoyl amide is stable to many reaction conditions and is removed by gentle treatment with aqueous iodine . despite its potential as a synthetic substrate , n - pentenoyl hydroxamic acid ( 1 , table 1 , also termed n - hydroxypentenamide , which we abbreviate nhpent ) has seldom been utilized in synthesis(43 ) and , to our knowledge , never as a masked aminooxy group . to determine the scope of compound 1 's reactivity as a glycosyl acceptor , we subjected it to glycosylation reactions using donor substrates that included glycosyl bromides and fluorides , thioglycosides , and glycosyl acetimidates ( table 1 ) .
the highest yields were obtained using glycosyl n - phenyl trifluoroacetimidates , as previously observed in the syntheses of glycosyl amides(44 ) and hydroxamates . by contrast , the less stable glycosyl trichloroacetimidates gave low yields in glycosylation reactions with 1 under similar conditions ( data not shown ) .
we anticipated that the mild conditions reported for cleavage of n - pentenoyl amides would be compatible with unprotected glycans . to confirm that such conditions can cleave n - alkoxypentenamides without harm to free sugars , we performed model reactions on the test substrate n - pentenoyl aminooxy lactose ( 15 , prepared from the known disaccharide aminooxy lactose(28 ) as shown in scheme s1 ) .
treatment of n - pentenoyl aminooxy lactose with 3 equiv of i2 in 1:1 tetrahydrofuran ( thf)/h2o as reported(41 ) resulted in iodocyclization of the nhpent group , but hydrolysis of the iodoimidate intermediate to afford the free aminooxy disaccharide was sluggish .
fortunately , the use of nonaqueous solvent mixtures and acid catalysis , as shown previously , alleviated this problem .
we identified the optimal deprotection conditions to be 3 equiv of i2 in wet mecn / meoh with 0.1% formic acid ( fa ) at room temperature , which afforded quantitative deprotection of n - pentenoyl aminooxy lactose in under 1 h. the utility of nhpent glycosides as substrates for complex aminooxy glycan synthesis was demonstrated with the construction of the trisaccharide lewis x ( gal1,4(fuc1,3)glcnac ) , a leukocyte and stem cell marker ( scheme 1 ) .
we began the synthesis with the coupling of known trichloroacetimidate 16 to thioglycoside 17 to generate the lactosamine precursor 18 following related , published routes .
as seen with similarly protected glucosamine derivatives , only glycosylation at the more reactive 4-hydroxyl of 17 was observed .
the fucose residue was introduced in the form of 19 , which was outfitted with a p - methoxybenzyl ( pmb ) ether at the 2-position to enhance cis - glycosylation .
similar to a previous report,(55 ) tfoh - catalyzed coupling of 19 with the free c-3 hydroxyl of 18 proceeded smoothly to afford 20 .
the pmb group was removed with 10% trifluoroacetic acid , thereby avoiding reductive or oxidative conditions that are incompatible with the pentenoyl and thioglycoside groups , and the 2-hydroxyl group of the fucose residue was acetylated to afford 21 .
motivated by the results in table 1 , we converted thioglycoside 21 to the corresponding glycosyl n - phenyl trifluoroacetimidate , 22 , for coupling with compound 1.(46 ) the glycosylation reaction was conducted with 1 equiv of tmsotf in dichloromethane at 20 c to afford n - hydroxypentenoyl trisaccharide 23 .
the troc protecting group was removed with zn in acidic mecn , and the amino group was acetylated .
notably , we observed no reduction of the n o bond during the zn reduction step , in sharp contrast to our previous experience with nhpth glycosides .
removal of the tbdps and acetyl groups of 24 proceeded in high yield and without damage to the n - hydroxypentenamide as well .
finally , aminooxy lewis x was obtained by treatment of 25 with i2 in acidic mecn / meoh .
enzymatic elaboration of synthetic core structures is an increasingly popular strategy for complex glycan assembly .
enzymes provide tight stereo- and regiochemical control and obviate the need for intermediate protecting group manipulations and harsh chemical conditions .
the impact of enzymatic glycosylation methods is most evident in cases where the chemical counterpart is notoriously difficult , such as in the addition of terminal sialic acid residues to a complex glycan.(57 ) given the biological importance of sialosides,(58 ) we sought to construct sialylated aminooxy glycans as substrates for glycoprotein engineering .
trisaccharides 29 and 30 ( scheme 3 ) , termed aminooxy 2,6- and 2,3-sialyllactose , respectively , were chosen as initial targets with which to evaluate the performance of nhpent glycosides as substrates for enzymatic sialylation .
we used the one - pot , three - enzyme system introduced by chen and co - workers to append sialic acid to n - pentenoyl aminooxy lactose ( 15 , scheme 2 ) .
this methodology allows for the in situ generation of costly cytidine 5-monophosphate ( cmp)-sialic acid from mannac , pyruvate , and cytidine 5-triphosphate ( ctp ) by the combined use of e. coli aldolase and a cmp - sialic acid synthase , nmcss.(61 ) in the same pot , bacterial -2,6-sialyltransferase ( pd2,6st ) or -2,3-sialyltransferase ( pmst1 ) transferred sialic acid to 15 , affording nhpent glycosides 27 and 28 , respectively , in excellent yields .
notably , free aminooxy glycans would not be viable substrates for this procedure , as the aminooxy group would undergo side reactions with free reducing sugars as well as pyruvate . finally , we employed our previously optimized deprotection conditions to obtain trisaccharides 29 and 30 ( scheme 3 ) . a higher level of complexity was embodied in the tetrasaccharide sialyl lewis x ( sia2,3gal1,4(fuc1,3)glcnac , abbreviated sle ) , a glycan known for its involvement in cancer progression and leukocyte homing .
we envisioned generating aminooxy - functionalized sle by chemical synthesis of an nhpent - modified disaccharide core , followed by enzymatic installation of the terminal sialic acid and fucose residues . toward this end ,
compound 18 was transformed into nhpent lactosamine derivative 33 by acetylation of its one free hydroxyl group , conversion of the thioglycoside to the n - phenyl trifluoroacetimidate , and glycosylation with compound 1 ( scheme 4 ) .
deprotection and n - acetylation gave n - acetyllactosamine nhpent glycoside 35 as a substrate for enzymatic glycosylation .
after purification by size exclusion chromatography , the fucose residue was installed using the one - pot , two - enzyme system described by wu and co - workers.(64 ) briefly , guanosine 5-diphosphate ( gdp)-fucose was generated in situ from adenosine triphosphate ( atp ) , guanosine 5-triphosphate ( gtp ) , and fucose by the bacteroides fragilis fucose kinase phosphorylase ( fkp ) .
finally , deprotection of 37 with i2 in acidic mecn / meoh gave aminooxy sle38 in 65% isolated yield . with a route to complex aminooxy glycans established , we sought to combine the synthetic sugars with recombinant aldehyde - tagged proteins as shown schematically in figure 2a .
as a protein substrate , we used a previously reported construct of the human growth hormone ( hgh ) that contains a c - terminal aldehyde tag as well as an n - terminal his tag .
the native protein is a well - established biotherapeutic used in the treatment of human developmental diseases among others .
site - specific chemical modification of hgh is a potential route to improving its pharmacokinetic properties .
indeed , an artificially glycosylated hgh variant was recently shown to have a prolonged serum half - life in mice.(69 ) generation of site - specifically glycosylated hgh .
( a ) aldehyde - tagged hgh was reacted with synthetic aminooxy glycans to yield the oxime - glycosylated conjugates .
( b ) western blot of aldehyde - tagged hgh ( lane 1 ) or the ca mutant ( lane 2 ) after reaction with aminooxy lactose s1 ( 5% mecn , 0.02% fa , 0.26 mg / ml aldehyde - tagged hgh , 1 mm s1 , 16 h , 37 c ) .
the blot was probed with sba - fitc ( top ) , and total protein was detected by ponceau stain ( bottom ) .
( c ) esi - ms spectrum of the crude reaction mixture showing ions in the 20 + and 21 + charge states .
ions corresponding to aldehyde - tagged hgh ( hgh ) and glycosylated hgh ( hgh+lac ) are shown with arrows .
( d ) western blot of aldehyde - tagged hgh ( lane 1 ) or the ca mutant ( lane 2 ) after reaction with aminooxy sle38 ( 50 mm nacit , ph 3.5 , 0.26 mg / ml aldehyde - tagged hgh , 1 mm 38 , 16 h , 37 c ) .
the blot was probed with an anti - slex antibody km93 followed by a horseradish peroxidase ( hrp)-conjugated secondary antibody ( top ) , and then stripped and reprobed with aal - biotin followed by a fitc - conjugated antibiotin antibody ( middle ) .
( e ) esi - ms spectrum of the sle crude reaction mixture showing ions in the 20 + and 21 + charge states .
ions corresponding to aldehyde - tagged hgh ( hgh ) and glycosylated hgh ( hgh+sle ) are shown with arrows .
we produced aldehyde - tagged hgh with > 95% cys - to - fgly conversion in e. coli with coexpression of the fge from mycobacterium tuberculosis.(32 ) the protein was purified by chromatography on ni - nta agarose and then reacted with aminooxy lactose ( s1 ) in 5% aqueous mecn with 0.02% fa ( ph 3.8 ) .
the formation of the lactose glycoconjugate was confirmed by western blot probing with the galactose - binding lectin , soybean agglutinin conjugated to fluorescein isothiocyanate ( sba - fitc ) ( figure 2b ) .
a control conjugation reaction using an hgh construct in which the cys residue required for the aldehyde installation was mutated to ala ( ca ) produced no sba - reactive product .
this result confirmed the necessity of the cys - derived fgly residue for site - specific chemical glycosylation with aminooxy lactose .
further , we analyzed the oxime conjugate by electrospray ionization mass spectrometry ( esi - ms ) ( figure 2c ) .
ions corresponding to glycosylated ( hgh+lac ) and unreacted ( hgh ) aldehyde - tagged hgh were observed , the relative intensities of which indicated a reaction yield of 81% .
the protein glycoconjugate was found to be highly stable when stored at 20 c , and < 10% hydrolysis of the conjugate was observed after 8 days at 4 c ( table s1 ) .
we performed a similar reaction using the more complex glycan aminooxy sle ( 38 ) .
the formation of the glycosylated hgh product was confirmed by western blot probing with a sle - specific antibody as well as with the fucose - binding lectin , aleuria aurantia lectin ( aal ) , conjugated to biotin ( figure 2d ) . using the above conjugation conditions ( 5% mecn , 0.02% fa ) , the yield of glycosylated hgh as determined by esi - ms was a modest 2025% .
however , use of a sodium citrate ( nacit ) buffer at ph 3.5 improved the conjugation efficiency to 64% . despite the acidity of the reaction buffer
, we did not detect any loss of the potentially labile sialic acid and fucose moieties or any damage to the aldehyde - tagged protein .
in summary , the facile generation of homogeneous glycoproteins was made possible by an improved route to aminooxy glycans featuring glycosyl n - pentenoyl hydroxamate intermediates , combined with the genetically encoded aldehyde tag .
the versatility of the aldehyde tag with respect to expression system , protein target , and site of aldehyde placement makes this approach broadly useful for protein glycoengineering . in principle
, multiple aldehyde tags can be introduced into a single protein , allowing for the production of multivalent glycoforms , a work currently in progress .
the method joins a growing toolkit for site - specific modification of proteins with synthetic glycans , which combined could produce myriad protein glycoforms with discrete glycans at different positions .
other chemoselective ligation reactions , such as azide alkyne cycloadditions and disulfide exchange reactions , have proven useful for modifying a single protein with multiple moieties.(19 ) oxime formation is orthogonal to these and other chemoselective ligation reactions ( thiol ene additions , olefin metathesis , suzuki couplings , etc . ) . exploring
the tandem and parallel use of these reactions for multiplexed protein modification is a subject of future interest .
a solution of disaccharide 18 ( 400 mg , 0.32 mmol ) in pyridine / ac2o ( 2:1 , v : v ; 4.5 ml ) was stirred for 3 h at room temperature under n2 . upon completion ,
the crude residue was purified by silica flash chromatography ( hex / etoac gradient ) to obtain fully protected disaccharide 31 as a white powder ( 400 mg , 97% ) : h nmr ( 500 mhz , cdcl3 ) 8.18 ( d , j = 7.4 hz , 2h ) , 8.07 ( d , j = 7.4 hz , 2h ) , 7.937.79 ( m , 6h ) , 7.687.49 ( m , 12h ) , 7.477.34 ( m , 5h ) , 7.337.19 ( m , 5h ) , 7.09 ( t , j = 7.5 hz , 2h ) , 7.03 ( t , j = 7.3 hz , 1h ) , 6.85 ( t , j = 7.7 hz , 2h ) , 6.69 ( d , j = 9.0 hz , 1h ) , 6.02 ( d , j = 2.9 hz , 1h ) , 5.81 ( dd , j = 10.1 , 8.2 hz , 1h ) , 5.58 ( dd , j = 10.4 , 3.1 hz , 1h ) , 5.50 ( t , j = 9.8 hz , 1h ) , 5.27 ( d , j = 8.0 hz , 1h ) , 5.11 ( d , j = 10.4 hz , 1h ) , 4.90 ( q , j = 12.1 hz , 2h ) , 4.74 ( dd , j = 11.2 , 4.6 hz , 1h ) , 4.554.39 ( m , 2h ) , 4.304.23 ( m , 1h ) , 4.09 ( q , j = 10.2 hz , 1h ) , 3.95 ( d , j = 11.2 hz , 1h ) , 3.77 ( d , j = 11.0 hz , 1h ) , 3.40 ( d , j = 9.7 hz , 1h ) , 2.24 ( s , 3h ) , 1.09 ( s , 9h ) ; c nmr ( 126 mhz , cdcl3 ) 171.54 , 166.00 , 165.56 , 165.32 , 164.45 , 154.59 , 136.05 , 135.67 , 135.29 , 133.70 , 133.52 , 133.33 , 133.17 , 132.91 , 131.69 , 130.86 , 130.25 , 129.84 , 129.77 , 129.74 , 129.51 , 129.13 , 128.77 , 128.69 , 128.41 , 128.29 , 128.22 , 128.16 , 127.78 , 126.74 , 100.10 , 95.78 , 85.76 , 78.61 , 77.41 , 74.52 , 74.18 , 73.61 , 72.02 , 71.43 , 69.90 , 68.22 , 61.95 , 60.96 , 54.87 , 26.76 , 21.24 , 19.35 ; hrms ( esi ) calcd for c67h65no16cl3ssi [ m+h]m / z = 1304.2853 , found 1304.2883 .
thioglycoside 31 ( 290 mg , 0.22 mmol ) was dissolved in acetone / ch2cl2/h2o ( 15:1:1 , v : v ; 6 ml ) , and n - iodosuccinimide ( nis ) ( 75 mg , 0.33 mmol ) was added while stirring at room temperature .
the reaction was monitored by thin - layer chromatography ( tlc ) ( 2:1 , hex / etoac ) , and n - bromosuccinimide was added in 2 equiv portions until the reaction was complete . upon full hydrolysis
, the resulting hemiacetal was diluted in ch2cl2 and washed sequentially with na2s2o3 solution , nahco3 solution , and brine .
the resulting residue was dissolved in ch2cl2 ( 3 ml ) and cs2co3 ( 150 mg , 0.44 mmol ) was added , followed by n - phenyl trifluoroacetimidoyl chloride ( 72 l , 0.44 mmol ) dropwise .
the reaction mixture was stirred for 12 h at room temperature under n2 , after which it was diluted with ch2cl2 , filtered , and concentrated under vacuum .
the crude residue was purified by silica chromatography to give the trifluoroacetimidate 32 as a yellow oil ( 267 mg , 87% ) : h nmr ( 500 mhz , cdcl3 ) 8.168.03 ( m , 4h ) , 7.877.68 ( m , 7h ) , 7.687.31 ( m , 14h ) , 7.19 ( dddd , j = 28.0 , 16.4 , 10.1 , 3.9 hz , 7h ) , 6.98 ( dt , j = 30.6 , 15.6 hz , 1h ) , 6.71 ( dd , j = 23.5 , 7.7 hz , 1h ) , 6.005.92 ( m , 1h ) , 5.835.73 ( m , 1h ) , 5.605.40 ( m , 1h ) , 5.33 ( t , j = 9.9 hz , 1h ) , 5.25 ( dd , j = 22.4 , 14.4 hz , 1h ) , 5.18 ( dt , j = 19.0 , 9.4 hz , 1h ) , 4.76 ( dt , j = 28.6 , 14.3 hz , 1h ) , 4.634.51 ( m , 2h ) , 4.474.35 ( m , 1h ) , 4.294.17 ( m , 1h ) , 4.13 ( dt , j = 13.7 , 7.1 hz , 1h ) , 4.053.69 ( m , 2h ) , 3.583.26 ( m , 1h ) ,
nmr ( 126 mhz , cdcl3 ) 173.12 , 166.12 , 165.51 , 165.50 , 164.72 , 154.46 , 136.03 , 135.47 , 133.88 , 133.84 , 133.62 , 133.45 , 133.35 , 130.54 , 130.02 , 129.92 , 129.88 , 129.70 , 129.58 , 129.17 , 129.03 , 128.87 , 128.73 , 128.55 , 128.44 , 128.36 , 127.96 , 100.52 , 95.48 , 74.75 , 73.37 , 73.24 , 72.20 , 71.66 , 69.90 , 68.23 , 62.14 , 60.53 , 54.23 , 26.90 , 20.97 , 19.50 .
a mixture of trifluoroacetimidate 32 ( 257 mg , 0.186 mmol ) and n - pentenoyl hydroxamic acid 1 ( 32 mg , 0.28 mmol ) was dried by coevaporation with anhydrous toluene and left under high vacuum . to the dried mixture was added 3 ms with stirring in ch2cl2 ( 4 ml ) for 1 h at room temperature under n2 .
the solution was cooled to 20 c , and tmsotf ( 34 l , 0.19 mmol ) was added dropwise .
the reaction was allowed to warm to room temperature over 1.5 h and was quenched with triethylamine , filtered , and concentrated under vacuum .
the resulting residue was purified by silica flash chromatography ( toluene / acetone gradient ) to obtain n - hydroxypentenoyl disaccharide 33 as a white solid ( 160 mg , 66% ) : h nmr ( 500 mhz , cdcl3 ) 8.45 ( s , 1h ) , 8.158.02 ( m , 4h ) , 7.837.74 ( m , 4h ) , 7.747.65 ( m , 4h ) , 7.60 ( dt , j = 21.6 , 6.4 hz , 2h ) , 7.547.36 ( m , 12h ) , 7.257.20 ( m , 2h ) , 7.207.16 ( m , 2h ) , 5.95 ( d , j = 3.2 hz , 1h ) , 5.825.69 ( m , 2h ) , 5.695.61 ( m , 1h ) , 5.48 ( dd , j = 10.3 , 3.2 hz , 1h ) , 5.20 ( t , j = 9.3 hz , 1h ) , 5.12 ( d , j = 8.0 hz , 1h ) , 5.01 ( d , j = 16.5 hz , 1h ) , 4.96 ( d , j = 10.3 hz , 1h ) , 4.86 ( d , j = 12.0 hz , 1h ) , 4.68 ( t , j = 9.1 hz , 2h ) , 4.53 ( d , j = 6.4 hz , 2h ) , 4.34 ( t , j = 9.3 hz , 1h ) , 4.17 ( t , j = 6.0 hz , 1h ) , 3.943.77 ( m , 3h ) , 3.27 ( d , j = 9.4 hz , 1h ) , 2.352.15 ( m , 4h ) , 2.12 ( s , 3h ) , 1.08 ( s , 9h ) ; c nmr ( 126 mhz , cdcl3 ) 171.32 , 170.85 , 166.00 , 165.51 , 165.43 , 165.21 , 164.72 , 136.58 , 136.08 , 136.06 , 136.02 , 135.95 , 135.48 , 135.44 , 133.81 , 133.51 , 133.46 , 133.43 , 133.29 , 130.54 , 130.15 , 130.09 , 130.04 , 129.98 , 129.93 , 129.85 , 129.65 , 129.49 , 128.91 , 128.83 , 128.68 , 128.64 , 128.60 , 128.45 , 128.41 , 128.32 , 128.11 , 127.85 , 127.77 , 115.81 , 100.22 , 95.41 , 75.63 , 74.87 , 74.71 , 73.14 , 71.91 , 71.50 , 69.83 , 68.08 , 62.01 , 60.64 , 54.00 , 53.53 , 28.98 , 26.86 , 20.95 , 19.42 ; hrms ( esi ) calcd for c66h67n2o18cl3si [ m+h]m / z = 1309.3296 , found 1309.3315 . to a solution of n - hydroxypentenoyl disaccharide 33 ( 140 mg , 0.11 mmol ) in 10%
fa / mecn ( 3 ml ) was added activated zn ( 500 mg ) , and the mixture was stirred for 3 h. the suspension was filtered to remove catalyst , concentrated under vacuum , and coevaporated with toluene to remove excess fa . the crude free amine was dissolved in anhydrous meoh ( 3 ml ) , followed by dropwise addition of ac2o ( 55 l , 0.54 mmol ) and n , n - diisopropylethylamine ( dipea ) ( 22 l , 0.13 mmol ) at 0 c under n2 .
after 1.5 h , the reaction was allowed to warm to room temperature , diluted with meoh , and concentrated under vacuum .
the resulting residue was purified by silica flash chromatography ( toluene / acetone gradient ) to give the n - acetylated disaccharide 34 as a white solid ( 97 mg , 77% ) : h nmr ( 500 mhz , cdcl3 ) 9.32 ( s , 1h ) , 8.138.03 ( m , 4h ) , 7.827.73 ( m , 4h ) , 7.727.67 ( m , 2h ) , 7.667.54 ( m , 6h ) , 7.527.45 ( m , 8h ) , 7.417.37 ( m , 2h ) , 7.23 ( t , j = 7.8 hz , 3h ) , 7.17 ( t , j = 7.8 hz , 2h ) , 6.19 ( d , j = 8.4 hz , 1h ) , 5.96 ( d , j = 3.1 hz , 1h ) , 5.825.69 ( m , 2h ) , 5.48 ( dd , j = 10.4 , 3.4 hz , 1h ) , 5.11 ( dd , j = 17.2 , 7.9 hz , 2h ) , 5.00 ( dd , j = 17.2 , 1.3 hz , 1h ) , 4.94 ( d , j = 10.2 hz , 1h ) , 4.60 ( d , j = 8.5 hz , 1h ) , 4.584.47 ( m , 2h ) , 4.36 ( t , j = 9.1 hz , 1h ) , 4.204.10 ( m , 2h ) , 3.88 ( q , j = 11.2 hz , 2h ) , 3.26 ( d , j = 9.4 hz , 1h ) , 2.382.15 ( m , 4h ) , 2.14 ( s , 3h ) , 2.02 ( s , 3h ) , 1.06 ( s , 9h ) ; c nmr ( 126 mhz , cdcl3 ) 172.53 , 171.81 , 170.88 , 166.04 , 165.46 , 164.88 , 137.93 , 136.75 , 136.06 , 135.74 , 135.43 , 133.81 , 133.56 , 133.43 , 133.40 , 131.23 , 130.58 , 130.15 , 129.94 , 129.89 , 129.85 , 129.54 , 129.11 , 128.98 , 128.82 , 128.73 , 128.65 , 128.52 , 128.41 , 128.30 , 128.26 , 127.78 , 125.38 , 115.62 , 102.03 , 100.27 , 75.89 , 72.99 , 72.35 , 71.86 , 71.59 , 69.83 , 68.17 , 62.07 , 60.56 , 52.23 , 32.87 , 29.04 , 26.82 , 23.35 , 21.53 , 21.03 , 19.41 ; hrms ( esi ) calcd for c65h68n2o17si [ m+h]m / z = 1177.4360 , found 1177.4396 . a solution of n - hydroxypentenoyl disaccharide 34 ( 94 mg , 0.080 mmol ) in thf ( 4 ml ) was cooled to 0 c , and tetrabutylammonium fluoride ( 1 m in thf , 160 l ) was added dropwise under n2 .
the mixture was allowed to warm to room temperature and stirred for 18 h , after which it was diluted with etoac and concentrated under reduced pressure .
the resulting residue was dissolved in meoh ( 4 ml ) , and naome ( 25% in meoh , 40 l ) was added dropwise with stirring at room temperature . after 8 h
, the reaction was neutralized with dowex 50w - x8 ( h ) and filtered to remove resin .
the crude product was concentrated under vacuum and purified by silica column chromatography ( 1025% meoh / ch2cl2 ) .
the purified residue was filtered to remove trace silica and lyophilized to yield the deprotected n - hydroxypentenoyl lacnac 35 as a white powder ( 32 mg , 84% ) : h nmr ( 500 mhz , d2o ) 5.80 ( ddt , j = 12.8 , 10.3 , 6.5 hz , 1h ) , 5.104.98 ( m , 2h ) , 4.75 ( d , j = 8.8 hz , 1h ) , 4.44 ( d , j = 7.8 hz , 1h ) , 3.983.92 ( m , 1h ) , 3.923.80 ( m , 3h ) , 3.773.66 ( m , 5h ) , 3.63 ( dd , j = 10.0 , 3.4 hz , 1h ) , 3.613.54 ( m , 1h ) , 3.50 ( dd , j = 9.8 , 7.9 hz , 1h ) , 2.32 ( dd , j = 13.1 , 6.5 hz , 2h ) , 2.282.21 ( m , 2h ) , 2.02 ( s , 3h ) ; c nmr ( 126 mhz , cdcl3 ) 174.72 , 172.85 , 136.46 , 115.89 , 103.79 , 102.82 , 77.78 , 75.33 , 75.06 , 72.45 , 72.22 , 70.91 , 68.51 , 61.00 , 59.77 , 52.90 , 31.72 , 28.81 , 22.18 ; hrms ( esi ) calcd for c19h32n2o12 [ m+h]m / z = 481.2028 , found 481.2036 . to n - pentenoyl aminooxy lacnac 35 ( 21 mg , 0.044 mmol ) were added n - acetylmannosamine ( 15 mg , 0.066 mmol ) , sodium pyruvate ( 24 mg , 0.22 mmol ) , and ctpna ( 37 mg , 0.066 mmol ) , and they were dissolved in h2o ( 3 ml ) .
a concentrated stock of tris - hcl buffer ph 8.5 with mgcl2 was added to a final concentration of 100 mm tris , 20 mm mgcl2 .
recombinant e. coli k12 sialic acid aldolase ( 4 u ) , neusserua meningitidis cmp - sialic acid synthetase ( 4 u ) , and pasteurella multocida -2,3-sialyltransferase ( 2 u ) were added , followed by h2o , to bring the volume to 4 ml .
the reaction mixture was incubated at 37 c for 2 h , followed by shaking at room temperature for 14 h. the reaction was monitored by tlc ( 4:2:1 etoac / meoh / h2o ) , and upon completion , calf alkaline phosphatase was added to remove remaining nucleotide phosphate . after further incubation at 37 c for 2 h ,
the reaction mixture was quenched with cold meoh ( 4 ml ) and incubated on ice for 20 min .
the mixture was centrifuged , precipitates were removed , and the solution concentrated under vacuum .
the resulting residue was passed through a biogel p-2 size exclusion column and eluted with ddh2o to obtain 36 ( 28.9 mg , 86% ) as a white , fluffy powder after lyophilization : h nmr ( 600 mhz , d2o ) 5.80 ( ddt , j = 16.9 , 10.3 , 6.6 hz , 1h ) , 5.094.99 ( m , 2h ) , 4.74 ( d , j = 8.8 hz , 1h ) , 4.52 ( d , j = 7.9 hz , 1h ) , 4.08 ( dd , j = 9.9 , 3.1 hz , 1h ) , 3.96 ( app d , j = 10.7 hz , 1h ) , 3.92 ( d , j = 3.0 hz , 1h ) , 3.883.79 ( m , 5h ) , 3.763.70 ( m , 3h ) , 3.693.64 ( m , 3h ) , 3.623.52 ( m , 5h ) , 2.73 ( dd , j = 12.4 , 4.6 hz , 1h ) , 2.31 ( dd , j = 13.5 , 6.7 hz , 2h ) , 2.24 ( app t , j = 7.0 hz , 2h ) , 2.02 ( s , 3h ) , 2.00 ( s , 3h ) , 1.77 ( t , j = 12.1 hz , 1h ) ; c nmr ( 151 mhz , d2o ) 175.00 , 174.73 , 173.83 , 172.51 , 136.54 , 115.87 , 103.81 , 102.54 , 99.79 , 77.73 , 75.46 , 75.16 , 75.08 , 72.87 , 72.20 , 71.74 , 69.34 , 68.31 , 68.08 , 67.45 , 62.57 , 61.01 , 59.81 , 59.42 , 52.91 , 51.67 , 39.62 , 31.73 , 28.81 , 22.19 , 22.01 ; hrms ( esi ) calcd for c30h49n3o20 [ m
z = 770.2837 , found 770.2812 . to a 5 ml solution of 100 mm tris buffer ( ph 7.5 ) containing 5 mm l - fucose ( 0.025 mmol ) , 5 mm mgso4 ( 0.025 mmol ) , 10 mm gtpna ( 0.05 mmol ) , and 10 mm atpna ( 0.05 mmol ) were added saccharomyces cerevisiae inorganic pyrophosphatase ( 40 u ) and b. fragilis fkp ( 4 u ) .
the mixture was incubated at 37 c for 2 h to preform gdp - fucose and monitored by tlc ( 2:1:1 iproh / acoh / h2o ) . to this
was added n - pentenoyl aminooxy sialoside 36 ( 5 mg , 0.07 mmol ) and h. pylori -1,3 fucosyltransferase ( 1 u ) , followed by incubation at room temperature for 16 h. the reaction was monitored by tlc ( 4:2:1 etoac / meoh / h2o ) , and upon completion , calf alkaline phosphatase was added to remove remaining nucleotide phosphate . after further incubation at 37 c for 2 h ,
the reaction mixture was quenched with cold meoh ( 5 ml ) and incubated on ice for 20 min .
the mixture was centrifuged , precipitates were removed , and the solution was concentrated under vacuum .
the resulting residue was passed through a biogel p-2 size exclusion column and eluted with ddh2o to obtain 37 ( 4.6 mg , 78% ) as a white , fluffy powder after lyophilization : h nmr ( 600 mhz , d2o ) 5.885.77 ( m , 1h ) , 5.06 ( dd , j = 26.6 , 14.1 hz , 3h ) , 4.81 ( app s , 1h ) , 4.51 ( d , j = 7.7 hz , 1h ) , 4.124.01 ( m , 2h ) , 3.97 ( dd , j = 20.8 , 10.7 hz , 2h ) , 3.923.82 ( m , 7h ) , 3.75 ( d , j = 12.5 hz , 1h ) , 3.703.55 ( m , 10h ) , 3.51 ( t , j = 8.7 hz , 1h ) , 2.792.70 ( m , 1h ) , 2.372.30 ( m , 2h ) , 2.302.22 ( m , 2h ) , 2.02 ( d , j = 4.1 hz , 6h ) , 1.78 ( t , j = 12.2 hz , 1h ) , 1.15 ( d , j = 6.1 hz , 3h ) ; c nmr ( 151 mhz , d2o ) 175.04 , 174.51 , 173.79 , 172.53 , 136.55 , 115.88 , 103.70 , 101.62 , 99.64 , 98.61 , 75.65 , 75.57 , 74.91 , 74.58 , 72.92 , 71.89 , 71.83 , 69.24 , 69.19 , 68.26 , 68.12 , 67.70 , 67.30 , 66.70 , 62.62 , 61.44 , 59.52 , 59.33 , 53.56 , 51.70 , 39.78 , 31.73 , 28.80 , 22.29 , 22.03 , 15.25 ; hrms ( esi ) calcd for c36h59n3o24 [ m
a solution of n - hydroxypentenoyl sle37 ( 4.2 mg , 0.0046 mmol ) in mecn / meoh / fa ( 3:1:0.001 , v : v ; 1.6 ml ) was stirred at room temperature with dropwise addition of i2 ( 0.014 mmol , 0.5 m solution in thf ) .
the mixture was heated to 35 c and stirred for 2 h , after which the reaction was quenched with the addition of aqueous nh4hco3 ( 500 mm ) and na2s2o3 ( 50 mm ) until the disappearance of color .
the solvent was removed under reduced pressure , and the remaining residue was purified by silica flash chromatography ( 4:2:1 etoac / meoh / h2o ) .
the purified product was dissolved in ddh2o and lyophilized to give the free aminooxy sle38 ( 2.5 mg , 65% ) as a white powder : h nmr ( 600 mhz , d2o ) 5.11 ( d , j = 4.0 hz , 1h ) , 4.72 ( d , j = 8.7 hz , 1h ) , 4.52 ( d , j = 7.8 hz , 1h ) , 4.09 ( dd , j = 9.9 , 3.0 hz , 1h ) , 4.04 ( dd , j = 14.8 , 4.7 hz , 1h ) , 3.98 ( dd , j = 18.7 , 9.6 hz , 2h ) , 3.943.92 ( m , 1h ) , 3.923.87 ( m , 5h ) , 3.86 ( dd , j = 13.6 , 6.3 hz , 2h ) , 3.78 ( app d , j = 2.8 hz , 1h ) , 3.703.63 ( m , 8h ) , 3.613.56 ( m , 3h ) , 3.553.51 ( m , 1h ) , 2.76 ( dd , j = 12.4 , 4.6 hz , 1h ) , 2.03 ( s , 6h ) , 1.80 ( t , j = 12.2 hz , 1h ) , 1.17 ( d , j = 6.6 hz , 3h ) ; c nmr ( 151 mhz , d2o ) 175.06 , 174.51 , 173.78 , 103.04 , 101.65 , 99.95 , 99.66 , 98.61 , 75.68 , 75.37 , 74.92 , 74.71 , 73.18 , 72.95 , 71.90 , 71.84 , 69.27 , 69.20 , 68.27 , 68.15 , 67.72 , 67.32 , 66.72 , 62.65 , 61.46 , 59.69 , 53.94 , 51.72 , 43.35 , 39.79 , 22.18 , 22.05 , 15.27 ; hrms ( esi ) calcd for c31h52n3o23 [ m
to a solution of 5% mecn , 0.02% fa , or 50 mm nacit , ph 3.5 , was added 0.26 mg / ml aldehyde - tagged protein and 1 mm aminooxy sugar .
the reaction was incubated at 37 c for 18 h , at which point the reaction was quenched with 4 protein loading dye and resolved by sds - page .
the protein was transferred to nitrocellulose and probed with anti - sialyl lewis x igm ( km93 , chemicon , 1:500 dilution ) followed by anti - mouse igm - hrp ( southern biotech , 1:10000 ) in 5% dry milk in phosphate - buffered saline/0.1% tween ( pbst ) .
the presence of galactose was probed with sba - fitc ( ey , 1:1000 dilution ) in 3% bovine serum albumin ( bsa)/pbst . for fucose analysis ,
the nitrocellulose was probed with aal - biotin ( ey labs , 1:1000 dilution ) followed by rabbit anti - biotin fitc ( abcam , 1:1000 ) in 3% bsa / pbst .
membranes were developed by chemiluminescence using the supersignal west pico kit ( thermo ) or scanned for fluorescence by a typhoon 9410 imaging system ( amersham ) . for mass spectrometry analysis ,
the protein was reacted in 5% mecn , 0.02% fa , or nacit at 1 mg / ml with 2 mm aminooxy sugar for 18 h at 37 c .
the reaction was quenched with 1 m tris buffer ph 8 , and the crude protein was purified by reversed - phase high - performance liquid chromatography ( plrp - s , polymer laboratories ) with elution in aqueous mecn . the multicharged peaks of the full length protein were obtained by esi - ms ( bruker / agilent esquire ) and identified by mass spectrometry analysis software . for stability analysis , the purified glycoconjugate was diluted to 10 m in pbs at ph 7.2 and stored at 20 or 4 c .
aliquots were taken at various time points and analyzed by matrix - assisted laser desorption / ionization mass spectrometry to determine the remaining glycoconjugate . | homogeneously glycosylated proteins are important targets for fundamental research and for biopharmaceutical development .
the use of unnatural protein glycan linkages bearing structural similarity to their native counterparts can accelerate the synthesis of glycoengineered proteins . here
we report an approach toward generating homogeneously glycosylated proteins that involves chemical attachment of aminooxy glycans to recombinantly produced proteins via oxime linkages .
we employed the recently introduced aldehyde tag method to obtain a recombinant protein with the aldehyde - bearing formylglycine residue at a specific site .
complex aminooxy glycans were synthesized using a new route that features n - pentenoyl hydroxamates as key intermediates that can be readily elaborated chemically and enzymatically .
we demonstrated the method by constructing site - specifically glycosylated variants of the human growth hormone . | Introduction
Results and Discussion
Conclusion
Experimental Section |
lower - extremity peripheral arterial disease ( pad ) is estimated to affect between 8 million and 10 million americans .
this prevalence is expected to increase , not only in the united states , but across the world as the population ages , cigarette smoking persists , and the epidemic of diabetes mellitus and obesity grows .
critical limb ischemia ( cli ) , the most advanced form of pad , is associated with a high risk of cardiovascular events , including major limb loss , myocardial infarction , stroke , and death [ 1,35 ] .
the likelihood of death has been reported to be as high as 20% within 6 months of cli diagnosis and surpasses 50% at 5 years post diagnosis .
these high mortality rates exceed those seen in any other pattern of occlusive disease , including patients with symptomatic coronary artery disease [ 8 , 9 ] , and reflect the severe systemic effects associated with a diagnosis of cli . to date , no pharmacologic or biologic therapy has demonstrated efficacy in reversing the circulatory impairment seen in patients with cli . therefore , if successful revascularization is not feasible , impaired quality of life , limb loss , and death have been the norm rather than the exception [ 10 ] .
the economic impact of this growing burden of pad is being experienced acutely in the united states and many other nations .
a study analyzing medicare data for 2001 found that $ 4.37 billion was spent on pad - related treatment . in total ,
pad - related treatment accounted for approximately 13% of all medicare part a and b expenditures for the pad - treated cohort , and 2.3% of all medicare part a and b annual spending .
the widespread adoption of endovascular procedures by multiple disciplines has significantly increased treatment options [ 6 , 11 ] .
this change in treatment paradigm has been driven by technological advances , as well as by the desire of patients and physicians to reduce procedural risk , albeit with potential tradeoffs of inferior durability and greater cost . between 1996 and 2006 ,
the number of endovascular lower - extremity interventions in the medicare population reportedly increased by 230% , whereas the number of bypass procedures decreased by 42% . despite the enormity of the patient population at risk and the multiple treatment options available , rigorous high - level evidence to support informed clinical decision making in patients with cli
there are few high - quality prospective studies and even fewer randomized controlled clinical trials . in this review ,
no clinical trials have been conducted , or are ongoing , that specifically address the role of diet modifications / supplements in the progression of cli.lipid abnormalities , including elevated total and low - density lipoprotein ( ldl ) cholesterol , decreased high - density lipoprotein cholesterol , and hypertriglyceridemia , are strongly associated with lower - extremity pad . as a result ,
low - cholesterol diets have been recommended for patients with cli .cigarette smoking is a strong predictor of lower - extremity pad , with a large number of epidemiologic studies establishing an increased incidence of pad in smokers compared with nonsmokers .
furthermore , the severity of pad tends to increase in a dose - dependent manner with the number of cigarettes smoked .
no clinical trials have been conducted , or are ongoing , that specifically address the role of diet modifications / supplements in the progression of cli .
lipid abnormalities , including elevated total and low - density lipoprotein ( ldl ) cholesterol , decreased high - density lipoprotein cholesterol , and hypertriglyceridemia , are strongly associated with lower - extremity pad . as a result ,
cigarette smoking is a strong predictor of lower - extremity pad , with a large number of epidemiologic studies establishing an increased incidence of pad in smokers compared with nonsmokers .
furthermore , the severity of pad tends to increase in a dose - dependent manner with the number of cigarettes smoked .
interventions directed at smoking cessation , or decreased usage , are critical . to date , no pharmacologic therapy has demonstrated efficacy in reversing the arterial occlusive lesions , or the resulting impaired perfusion , seen in patients with cli . the circulase trial ( mitsubishi pharma corp , tokyo , japan ) , published in 2006 , randomly assigned 379 cli patients with no revascularization option to receive lipo - ecraprost ( parenteral prostaglandin ) or placebo . the study treatment was found to confer no benefit ( or harm ) on the primary study end point , death or amputation above the ankle at 180 days .various reports have demonstrated that cardioprotective medications such as statins , -blockers , angiotensin - converting enzyme inhibitors , and antiplatelet agents are associated with a decreased cardiovascular event rate in patients with pad [ 1621 ] .
however , these studies have been conducted in heterogeneous populations , not specifically in patients with cli . in a retrospective analysis of 1404 cli patients who had undergone surgical revascularization ,
statins were demonstrated to confer a significant survival advantage at 1 year ( hazard ratio [ hr ] for mortality , 0.71 ; p = 0.03 ) .
however , optimum dosing and therapeutic targets ( eg , ldl cholesterol , c - reactive protein levels ) for statin therapy in pad patients are uncertain , and more clinical trials are needed to determine whether statins have direct beneficial effects in the peripheral circulation ( limb ) . in general ,
current recommendations for the use of cardioprotective medications in cli follow published general pad guidelines . to date , no pharmacologic therapy has demonstrated efficacy in reversing the arterial occlusive lesions , or the resulting impaired perfusion , seen in patients with cli .
the circulase trial ( mitsubishi pharma corp , tokyo , japan ) , published in 2006 , randomly assigned 379 cli patients with no revascularization option to receive lipo - ecraprost ( parenteral prostaglandin ) or placebo .
the study treatment was found to confer no benefit ( or harm ) on the primary study end point , death or amputation above the ankle at 180 days .
various reports have demonstrated that cardioprotective medications such as statins , -blockers , angiotensin - converting enzyme inhibitors , and antiplatelet agents are associated with a decreased cardiovascular event rate in patients with pad [ 1621 ] .
however , these studies have been conducted in heterogeneous populations , not specifically in patients with cli . in a retrospective analysis of 1404 cli patients who had undergone surgical revascularization , statins were demonstrated to confer a significant survival advantage at 1 year ( hazard ratio [ hr ] for mortality , 0.71 ; p = 0.03 ) . however , optimum dosing and therapeutic targets ( eg , ldl cholesterol , c - reactive protein levels ) for statin therapy in pad patients are uncertain , and more clinical trials are needed to determine whether statins have direct beneficial effects in the peripheral circulation ( limb ) . in general , current recommendations for the use of cardioprotective medications in cli follow published general pad guidelines .
these evolving technologies include balloon angioplasty , cryoplasty therapy ( boston scientific , natick , ma ) , stent / stent - graft placement , laser atherectomy , and mechanical atherectomy . beyond single - center case series demonstrating feasibility and technical success
these results often are difficult to interpret because of differences in patient selection , use of multiple therapeutic modalities , and variable end points with variable study durations .
a summary of several of the larger , recent series reporting outcomes of endovascular treatment for patients with cli is presented in table 1 .
table 1recent studies reporting outcomes in patients undergoing endovascular therapy for treatment of critical limb ischemiastudypatients , nstudy typeoutcome measure(s)event rate , % laird et al . , 2006 155multicenter seriesamputation - free survival ( 6 mo)82bosiers et al . , 2007 51multicenter seriesamputation - free survival ( 1 y)79derubertis et al . , 2008 184single - center serieslimb salvage ( 1 y)88.3primary patency ( 1 y)54 5primary patency ( 2 y)43 7giles et al . , 2008 176single - center seriesfreedom from restenosis , reintervention , or amputation ( 1 y)39freedom from restenosis , reintervention , or amputation ( 2 y)35primary patency ( 1 y)53primary patency ( 2 y)51limb salvage ( 3 y)84survival ( 1 y)81survival ( 3 y)54romiti et al . , 2008 meta - analysisprimary patency ( 1 y)58.1 4.6primary patency ( 3 y)48.6 8.0secondary patency ( 1 y)68.2 5.9secondary patency ( 3 y)62.9 11.0limb salvage ( 1 y)86.0 2.7limb salvage ( 3 y)82.4 3.4survival ( 1 y)87.0 2.1survival ( 3
y)68.4 5.5the transatlantic inter - society consensus document on management of peripheral arterial disease ( tasc ii ) , published in 2006 , was developed by an international working group charged with reviewing the literature and putting forth recommendations for the diagnosis and treatment of pad .
all recommendations were assigned a grade based on the level of available evidence to support that recommendation .
the working group recommended endovascular therapy as the first - line treatment method for patients with tasc a and b lesions .
of note , this recommendation received a grade c for evidence , which was defined as
evidence obtained from expert committee reports or opinions.no applicable studies of good quality.the basil ( bypass versus angioplasty in severe ischaemia of the leg ) trial , sponsored by the uk national institute of health research health technology assessment program , is the only randomized controlled trial ( rct ) comparing open surgical bypass with endovascular therapy in patients with severe limb ischemia ( sli ) due to infrainguinal disease ; therefore , it is worth considering in detail .
admit patients with chronic , potentially limb threatening , ischemia but who did not necessarily have ankle pressures less than 50 mmhg and thus did not strictly fulfill the requirements of the term cli .
it also is important to note that patients were eligible for basil if they were deemed suitable for either angioplasty or bypass and if they met the investigators criterion of grey area of clinical equipoise.the basil trial began enrollment in 1999 and randomly assigned 452 patients from 27 centers across scotland and england . in 2005
, the basil trialists reported an analysis of outcomes out to 2 years demonstrating no difference in overall survival or amputation - free survival by intention - to - treat analysis between surgical bypass and endovascular therapy , with surgery being more expensive in the short term .
however , post hoc analysis demonstrated that beyond 2 years , patients initially assigned to open bypass surgery had a significantly improved amputation - free survival ( adjusted hr , 0.37 ; 95% ci , 0.170.77 ; p = 0.008 ) and reduced all - cause mortality ( adjusted hr , 0.34 ; 95% ci , 0.170.71 ; p = 0.004 ) relative to angioplasty .
this finding of the basil trial was considered significant enough to warrant funding of an extension study , the results of which were reported recently [ 23,24,25,26,27 ] .
for the overall follow - up period ( mean follow - up , 3.1 years ; range , 15.7 years ) , there was no significant difference in overall survival or amputation - free survival by intention - to - treat analysis .
however , for patients surviving to 2 years post procedure ( 70% of the study cohort ) , initial randomization to open bypass was associated with significantly improved overall survival ( mean gain of 7.3 months ; p = 0.02 ) and a trend toward increased amputation - free survival ( mean gain of 5.9 months ; p = 0.06 ) .
the investigators also published the trial outcomes using an as - treated analysis [ 25 ] , an approach that accounts for early treatment crossovers but , importantly , sacrifices the power of randomization . in this analysis
, they found that among patients assigned to open surgery , those who received prosthetic grafts ( 25% of the surgical group ) experienced reduced amputation - free survival compared with those who received vein grafts ( p = 0.003 ) .
they also observed that patients who underwent bypass surgery after an initial failed angioplasty experienced significantly worse amputation - free survival than those who underwent bypass as the initial therapy ( p = 0.006 ) , suggesting a real potential downside to failed angioplasty in sli.the primary recommendations from the basil trial perhaps are best summarized by the authors in the following statement :
.sli patients predicted to live more than 2 years , and with a useable vein , should usually have bypass surgery first .
this is because the long term results of saphenous vein bypass surgery are good , the rate of balloon angioplasty failure is high , and the results of bypass surgery after failed balloon angioplasty are significantly worse than for bypass surgery .
however , patients expected to live less than 2 years , and those without a useable vein , should usually have balloon angioplasty first as they will not survive to reap the longer term benefits of surgery and the results of prosthetic bypass surgery are poor [ 25].there are several important limitations and controversies surrounding the application of the basil trial to current practice , yet this study stands as a seminal rct in the field of advanced limb ischemia and a basis for the design of future trials .
these evolving technologies include balloon angioplasty , cryoplasty therapy ( boston scientific , natick , ma ) , stent / stent - graft placement , laser atherectomy , and mechanical atherectomy . beyond single - center case series demonstrating feasibility and technical success
these results often are difficult to interpret because of differences in patient selection , use of multiple therapeutic modalities , and variable end points with variable study durations .
a summary of several of the larger , recent series reporting outcomes of endovascular treatment for patients with cli is presented in table 1 .
table 1recent studies reporting outcomes in patients undergoing endovascular therapy for treatment of critical limb ischemiastudypatients , nstudy typeoutcome measure(s)event rate , % laird et al . , 2006 155multicenter seriesamputation - free survival ( 6 mo)82bosiers et al . , 2007 51multicenter seriesamputation - free survival ( 1 y)79derubertis et al . , 2008 184single - center serieslimb salvage ( 1 y)88.3primary patency ( 1 y)54 5primary patency ( 2 y)43 7giles et al . , 2008 176single - center seriesfreedom from restenosis , reintervention , or amputation ( 1 y)39freedom from restenosis , reintervention , or amputation ( 2 y)35primary patency ( 1 y)53primary patency ( 2 y)51limb salvage ( 3 y)84survival ( 1 y)81survival ( 3 y)54romiti et al . , 2008 meta - analysisprimary patency ( 1 y)58.1 4.6primary patency ( 3 y)48.6 8.0secondary patency ( 1 y)68.2 5.9secondary patency ( 3 y)62.9 11.0limb salvage ( 1 y)86.0 2.7limb salvage ( 3 y)82.4 3.4survival ( 1 y)87.0
2.1survival ( 3 y)68.4 5.5 recent studies reporting outcomes in patients undergoing endovascular therapy for treatment of critical limb ischemia the transatlantic inter - society consensus document on management of peripheral arterial disease ( tasc ii ) , published in 2006 , was developed by an international working group charged with reviewing the literature and putting forth recommendations for the diagnosis and treatment of pad .
all recommendations were assigned a grade based on the level of available evidence to support that recommendation . the working group recommended endovascular therapy as the first - line treatment method for patients with tasc a and b lesions . of note , this recommendation received a grade c for evidence , which was defined as
evidence obtained from expert committee reports or opinions.no applicable studies of good quality .
the basil ( bypass versus angioplasty in severe ischaemia of the leg ) trial , sponsored by the uk national institute of health research health technology assessment program , is the only randomized controlled trial ( rct ) comparing open surgical bypass with endovascular therapy in patients with severe limb ischemia ( sli ) due to infrainguinal disease ; therefore , it is worth considering in detail .
admit patients with chronic , potentially limb threatening , ischemia but who did not necessarily have ankle pressures less than 50 mmhg and thus did not strictly fulfill the requirements of the term cli .
it also is important to note that patients were eligible for basil if they were deemed suitable for either angioplasty or bypass and if they met the investigators criterion of grey area of clinical equipoise .
the basil trial began enrollment in 1999 and randomly assigned 452 patients from 27 centers across scotland and england .
in 2005 , the basil trialists reported an analysis of outcomes out to 2 years demonstrating no difference in overall survival or amputation - free survival by intention - to - treat analysis between surgical bypass and endovascular therapy , with surgery being more expensive in the short term .
however , post hoc analysis demonstrated that beyond 2 years , patients initially assigned to open bypass surgery had a significantly improved amputation - free survival ( adjusted hr , 0.37 ; 95% ci , 0.170.77 ; p = 0.008 ) and reduced all - cause mortality ( adjusted hr , 0.34 ; 95% ci , 0.170.71 ; p = 0.004 ) relative to angioplasty .
this finding of the basil trial was considered significant enough to warrant funding of an extension study , the results of which were reported recently [ 23,24,25,26,27 ] . for the overall follow - up period ( mean follow - up , 3.1 years ; range , 15.7 years ) , there was no significant difference in overall survival or amputation - free survival by intention - to - treat analysis .
however , for patients surviving to 2 years post procedure ( 70% of the study cohort ) , initial randomization to open bypass was associated with significantly improved overall survival ( mean gain of 7.3 months ; p = 0.02 ) and a trend toward increased amputation - free survival ( mean gain of 5.9 months ; p = 0.06 ) .
the investigators also published the trial outcomes using an as - treated analysis [ 25 ] , an approach that accounts for early treatment crossovers but , importantly , sacrifices the power of randomization . in this analysis
, they found that among patients assigned to open surgery , those who received prosthetic grafts ( 25% of the surgical group ) experienced reduced amputation - free survival compared with those who received vein grafts ( p = 0.003 ) .
they also observed that patients who underwent bypass surgery after an initial failed angioplasty experienced significantly worse amputation - free survival than those who underwent bypass as the initial therapy ( p = 0.006 ) , suggesting a real potential downside to failed angioplasty in sli .
the primary recommendations from the basil trial perhaps are best summarized by the authors in the following statement :
.sli patients predicted to live more than 2 years , and with a useable vein , should usually have bypass surgery first .
this is because the long term results of saphenous vein bypass surgery are good , the rate of balloon angioplasty failure is high , and the results of bypass surgery after failed balloon angioplasty are significantly worse than for bypass surgery .
however , patients expected to live less than 2 years , and those without a useable vein , should usually have balloon angioplasty first as they will not survive to reap the longer term benefits of surgery and the results of prosthetic bypass surgery are poor [ 25 ] .
.sli patients predicted to live more than 2 years , and with a useable vein , should usually have bypass surgery first .
this is because the long term results of saphenous vein bypass surgery are good , the rate of balloon angioplasty failure is high , and the results of bypass surgery after failed balloon angioplasty are significantly worse than for bypass surgery .
however , patients expected to live less than 2 years , and those without a useable vein , should usually have balloon angioplasty first as they will not survive to reap the longer term benefits of surgery and the results of prosthetic bypass surgery are poor [ 25 ]
. there are several important limitations and controversies surrounding the application of the basil trial to current practice , yet this study stands as a seminal rct in the field of advanced limb ischemia and a basis for the design of future trials .
endovascular treatment of cli standard procedure(s)percutaneous angioplasty with or without adjunctive atherectomy ( mechanical or laser ) and with or without adjunctive stenting.contraindicationsrelative : low estimated glomerular filtration rate , anatomically unfavorable disease ( common femoral artery lesion , extensive calcification , long segment occlusions , severe popliteal and/or infrapopliteal disease).complicationsthrombosis , embolization , blue toe syndrome , amputation , loss of surgical target for bypass , access site complications ( hemorrhage , pseudoaneurysm , arteriovenous fistula ) , contrast nephropathy , and renal failure.special pointstechniques for endovascular treatment in the aortoiliac segment have become more standardized and durability more consistent for tasc a to tasc c disease ( absence of a long segment occlusion for a complete description of tasc criteria , please see norgren et al .
adequate treatment of the common and profunda femoris arteries is of primary importance in cli and may require a hybrid or fully open approach ( eg , femoral endarterectomy ) .
the role of covered stents in the aortoiliac segment is poorly defined . for infrainguinal therapy ,
several devices are available for different lesion anatomies and technical circumstances ( eg , best approach for complete total occlusions ) , but little evidence is available to support one over the other .
the benefit of routine use of nitinol stents in the superficial femoral artery is still under debate .
no rct data are available demonstrating a benefit for the use of stents in popliteal or distal vessels , or for the use of drug - eluting stents in lower - extremity vessels.cost/cost-effectivenessseveral cost - effectiveness analyses have been performed comparing endovascular therapy with open surgery in patients with cli [ 24 , 30 ] .
stoner et al . analyzed 381 femoropopliteal revascularization procedures ( open bypass , n = 183 ; endovascular , n = 198 ) performed for claudication and cli . in the subset of patients with cli , they reported an initial cost saving with endovascular therapy ( $ 7176 vs $ 13,277 ; p < 0.001 ) . however , during the 1-year study period , the patients who were treated with endovascular therapy went on to require reinterventions , so this cost saving ultimately was lost at 1 year . similarly , in the cost - effectiveness study that accompanied the basil trial , no significant difference was seen , as the survival , hospital costs , and health - related quality - of - life differences were minimal between the surgical and endovascular study arms .
percutaneous angioplasty with or without adjunctive atherectomy ( mechanical or laser ) and with or without adjunctive stenting .
relative : low estimated glomerular filtration rate , anatomically unfavorable disease ( common femoral artery lesion , extensive calcification , long segment occlusions , severe popliteal and/or infrapopliteal disease ) .
thrombosis , embolization , blue toe syndrome , amputation , loss of surgical target for bypass , access site complications ( hemorrhage , pseudoaneurysm , arteriovenous fistula ) , contrast nephropathy , and renal failure .
techniques for endovascular treatment in the aortoiliac segment have become more standardized and durability more consistent for tasc a to tasc c disease ( absence of a long segment occlusion for a complete description of tasc criteria , please see norgren et al . [ 10 ] ) .
adequate treatment of the common and profunda femoris arteries is of primary importance in cli and may require a hybrid or fully open approach ( eg , femoral endarterectomy ) .
the role of covered stents in the aortoiliac segment is poorly defined . for infrainguinal therapy ,
several devices are available for different lesion anatomies and technical circumstances ( eg , best approach for complete total occlusions ) , but little evidence is available to support one over the other .
the benefit of routine use of nitinol stents in the superficial femoral artery is still under debate .
no rct data are available demonstrating a benefit for the use of stents in popliteal or distal vessels , or for the use of drug - eluting stents in lower - extremity vessels .
several cost - effectiveness analyses have been performed comparing endovascular therapy with open surgery in patients with cli [ 24 , 30 ] .
stoner et al . analyzed 381 femoropopliteal revascularization procedures ( open bypass , n = 183 ; endovascular , n = 198 ) performed for claudication and cli . in the subset of patients with cli , they reported an initial cost saving with endovascular therapy ( $ 7176 vs $ 13,277 ; p < 0.001 ) .
however , during the 1-year study period , the patients who were treated with endovascular therapy went on to require reinterventions , so this cost saving ultimately was lost at 1 year . similarly , in the cost - effectiveness study that accompanied the basil trial , no significant difference was seen , as the survival , hospital costs , and health - related quality - of - life differences were minimal between the surgical and endovascular study arms .
open surgical bypass using autogenous vein traditionally has been the gold - standard revascularization technique for patients with cli due to infrainguinal disease .
however , this paradigm is evolving as new endovascular technologies are being developed , used , and tested.aortofemoral bypass using prosthetic conduit is a standard surgical approach for extensive ( eg , tasc d ) aortoiliac disease or in the setting of failed prior endovascular therapy .
expected operative mortality is approximately 3% and durability is excellent ( 85%90% patency at 5 years and beyond).as noted earlier , adequate treatment of disease in the common and deep femoral arteries ( eg , endarterectomy and/or patch angioplasty ) at the time of either inflow or outflow reconstruction is of primary importance for the long - term fate of the limb in cli patients.two rcts examining novel cli treatments ( gene therapy and prostaglandin therapy ) , a multicenter prospectively maintained vascular registry , and one rct comparing balloon angioplasty with surgical bypass in patients with cli ( basil ) have provided a wealth of high - quality outcomes data pertaining to vein bypass surgery in patients with cli .
several authors have used the information contained in these surgical cli datasets to further our understanding of risk stratification and outcome prediction [ 22,3339,40 ] , quality of life , disparities in care , reintervention rates and the associated outcomes , and resource utilization .both basil and prevent iii ( piii ) challenge the nihilistic paradigms about mortality rates in patients with cli : 85% of piii patients survived beyond 1 year , and 70% of basil patients survived longer than 2 years .
these data suggest that cli patients may be done a tremendous disservice if the selection of their therapies is founded on the concept that all cli patients carry a substantial mortality risk that warrants a short - term approach.a recent meta - analysis in patients with cli undergoing infrainguinal bypass demonstrated 5-year primary patency , secondary patency , and limb salvage rates of 63% , 71% , and 78% , respectively .
recently , a working group under the auspices of the society for vascular surgery used pooled data from the piii , basil , and circulase studies to develop expected outcomes for vein bypass surgery as the relevant standard for comparing new devices .
this group endorsed a set of three safety and six efficacy objective performance goals for cli based on the pooled data from these surgical controls [ 40 ] .
table 2suggested end point definitions for revascularization in critical limb ischemia and expected event rates for open bypass surgeryend pointdefinitionevent rate , % ( 95% ci)safety outcomes ( 30 d)macemyocardial infarction , stroke , or death ( any cause)6.2 ( 4.78.1)maleabove - ankle amputation of the index limb or major reintervention ( new bypass graft , jump / interposition graft revision , or thrombectomy / thrombolysis)6.1 ( 4.67.9)amputationabove - ankle amputation of the index limb1.9 ( 1.13.1)efficacy outcomes ( 1 y)perioperative death or maleperioperative death ( 30 d ) or any male76.9 ( 74.079.9)amputation - free survivalabove - ankle amputation of the index limb or death ( any cause)76.5 ( 73.779.5)reintervention , amputation , or stenosisany reintervention , above - ankle amputation of the index limb , or stenosis46.5 ( 42.351.2)reintervention or amputationany reintervention or above - ankle amputation of the index limb61.3 ( 58.064.9)limb salvagefreedom from above - ankle amputation88.9 ( 86.791.1)survivalfreedom from death ( any cause)85.7 ( 83.388.1)reported by the society for vascular surgery working group for the development of objective performance goals for evaluating catheter - based treatment . data are pooled from prospective trials of vein bypass surgery in critical limb ischemia .
additional data are available at http://www.criticallimb.org/.all rates are freedom from event.mace major adverse cardiovascular events , male major adverse limb eventsgiven the relative high - risk nature of the cli patient population , as well as the variety of available treatment options , the ability to use preprocedure variables to predict a given outcome has become increasingly important .
several recent advances have been made in an attempt to improve individual patient risk prediction at the time of initial patient evaluation .
the piii cli risk score is an easy - to - use risk stratification model developed to predict amputation - free survival in cli patients undergoing open infrainguinal surgical bypass .
this prediction tool was derived from the cohort of patients who underwent autogenous vein bypass for cli in the context of the piii randomized trial .
the piii cli risk score was then validated both internally , using the trial cohort , and externally , using a multicenter retrospective cohort of patients ( total n = 3286 ) . in this study , the piii cli risk score was found to be a highly reliable and simple tool for stratifying cli patients selected to undergo bypass surgery into low- , medium- , and high - risk categories . at the time of a patient s initial presentation , five easily obtainable binary variables may be used to provide patients and providers with a valid estimate of the likelihood of amputation - free survival at 1 year after surgical revascularization .
these variables are dialysis dependency , tissue loss , advanced age , advanced coronary artery disease , and low hematocrit .
numerous key publications have identified predictors of specific outcomes in case series of patients with cli ( table 3 ) . when looked at comprehensively , it becomes clear that patency and limb salvage outcomes are , for the most part , linked to characteristics of the bypass graft ( ie , type of conduit ) and the specific patient anatomy ( ie , adequacy of runoff score ) .
in contrast , mortality and functional outcomes appear to be more influenced by systemic comorbidities , preoperative medications , and physiologic characteristics .
table 3recent studies identifying independent predictors for select outcomes in patients with critical limb ischemiastudypatients , nstudy typeinclusion criterionprimary outcome measuresignificant predictorsrobinson et al . , 2009 1646single - center seriesbypass surgery for cli or claudicationpatencyhigh - risk conduit , cli , smoking , age 65 y , african american , femaleschanzer et al . , 2007 1404multicenter rctbypass surgery for clipatencygraft diameter , graft length , non single segment gsv , popliteal artery originbradbury et al .
, 2010 452multicenter rctbypass surgery and angioplasty for slideathage , mi , stroke , tissue loss , ankle pressure , number of detectable ankle pressures , creatinine , smoking , bmi , bollinger score , diabetesgoodney et al .
, 2010 2036multicenter registrybypass surgery for cli or claudicationdeathchf , diabetes , cli , absence of single - segment gsv , age > 80 y , dialysis , emergent procedureschanzer et al . , 2008 1404multicenter rctbypass surgery for clideathstatin therapy , age 75 y , cad , ckd stage 4/5 , tissue lossowens et al .
, 2007 456single - center seriesbypass surgery for cli or claudicationdeathage , ckd stage 4/5schanzer et al .
, 2009 1166multicenter registrybypass surgery for cliamputation - free survivalage 75 y , dialysis , tissue loss , anemia , advanced cadschanzer et al .
, 2008 1404multicenter rctbypass surgery for cliamputation - free survivalage 75 y , dialysis , tissue loss , anemia , advanced cadbiancari et al . , 2007 3925multicenter registrybypass surgery for cliamputation - free survivaldiabetes , cad , foot gangrene , urgent operationgoodney et al . , 2009
[ 34 , 35]2036multicenter registrybypass surgery for cli or claudicationamputation or loss of secondary patencyage 4049 y , nonambulatory preoperatively , dialysis , diabetes , cli , composite vein grafts , tarsal bypass target , nursing home preoperativelyrossi et al . , 2003 468single - center seriesbypass surgery for cli or claudication or aneurysmamputationgender , nonautologous conduit , redo bypasstoursarkissian et al .
, 2002 124single - center seriesbypass surgery for cli or claudicationamputationangiographic score , foot score , diabetesalback et al .
, 1998 132single - center seriesbypass surgery for cli or claudicationamputationad hoc grading system of outflow arteriessimons et al .
, 2010 1457multicenter registrybypass surgery for cliclinical failure ( persistent symptoms and/or amputation ) despite bypass patencydialysis , preoperative ambulation with assistance , history of cabg or pcigoodney et al .
, 2009 1400multicenter registrybypass surgery for cli or claudicationambulatory failurenonambulatory preoperatively , cli , age 70 y , postoperative mi , postoperative amputationtaylor et al . , 2006 1000single - center seriesbypass surgery for cliambulatory deterioration / failurefemale , diabetes , renal insufficiency , dementia , homebound preoperatively , postoperative amputationnguyen et al .
, 2006 1404multicenter rctbypass surgery for clidecreased improvement in quality of lifediabetes , postoperative graft - related eventtaylor et al .
, 2006 1000single - center seriesbypass surgery for clinon - independent livingage 70 y , ulceration , previous stroke , dementia , nonambulatory , postoperative amputationbmi body mass index , cabg coronary artery bypass grafting , cad coronary artery disease ; chf congestive heart failure , ckd chronic kidney disease , cli critical limb ischemia , gsv great saphenous vein , mi myocardial infarction , pci percutaneous coronary intervention , rct randomized controlled trial , sli severe limb ischemia open surgical bypass using autogenous vein traditionally has been the gold - standard revascularization technique for patients with cli due to infrainguinal disease
. however , this paradigm is evolving as new endovascular technologies are being developed , used , and tested .
aortofemoral bypass using prosthetic conduit is a standard surgical approach for extensive ( eg , tasc d ) aortoiliac disease or in the setting of failed prior endovascular therapy .
expected operative mortality is approximately 3% and durability is excellent ( 85%90% patency at 5 years and beyond ) . as noted earlier , adequate treatment of disease in the common and deep femoral arteries ( eg , endarterectomy and/or patch angioplasty ) at the time of either inflow or outflow reconstruction is of primary importance for the long - term fate of the limb in cli patients .
two rcts examining novel cli treatments ( gene therapy and prostaglandin therapy ) , a multicenter prospectively maintained vascular registry , and one rct comparing balloon angioplasty with surgical bypass in patients with cli ( basil ) have provided a wealth of high - quality outcomes data pertaining to vein bypass surgery in patients with cli .
several authors have used the information contained in these surgical cli datasets to further our understanding of risk stratification and outcome prediction [ 22,3339,40 ] , quality of life , disparities in care , reintervention rates and the associated outcomes , and resource utilization .
both basil and prevent iii ( piii ) challenge the nihilistic paradigms about mortality rates in patients with cli : 85% of piii patients survived beyond 1 year , and 70% of basil patients survived longer than 2 years .
these data suggest that cli patients may be done a tremendous disservice if the selection of their therapies is founded on the concept that all cli patients carry a substantial mortality risk that warrants a short - term approach .
a recent meta - analysis in patients with cli undergoing infrainguinal bypass demonstrated 5-year primary patency , secondary patency , and limb salvage rates of 63% , 71% , and 78% , respectively .
recently , a working group under the auspices of the society for vascular surgery used pooled data from the piii , basil , and circulase studies to develop expected outcomes for vein bypass surgery as the relevant standard for comparing new devices .
this group endorsed a set of three safety and six efficacy objective performance goals for cli based on the pooled data from these surgical controls [ 40 ] .
table 2suggested end point definitions for revascularization in critical limb ischemia and expected event rates for open bypass surgeryend pointdefinitionevent rate , % ( 95% ci)safety outcomes ( 30 d)macemyocardial infarction , stroke , or death ( any cause)6.2 ( 4.78.1)maleabove - ankle amputation of the index limb or major reintervention ( new bypass graft , jump / interposition graft revision , or thrombectomy / thrombolysis)6.1 ( 4.67.9)amputationabove - ankle amputation of the index limb1.9 ( 1.13.1)efficacy outcomes ( 1 y)perioperative death or maleperioperative death ( 30 d ) or any male76.9 ( 74.079.9)amputation - free survivalabove - ankle amputation of the index limb or death ( any cause)76.5 ( 73.779.5)reintervention , amputation , or stenosisany reintervention , above - ankle amputation of the index limb , or stenosis46.5 ( 42.351.2)reintervention or amputationany reintervention or above - ankle amputation of the index limb61.3 ( 58.064.9)limb salvagefreedom from above - ankle amputation88.9 ( 86.791.1)survivalfreedom from death ( any cause)85.7 ( 83.388.1)reported by the society for vascular surgery working group for the development of objective performance goals for evaluating catheter - based treatment . data are pooled from prospective trials of vein bypass surgery in critical limb ischemia .
additional data are available at http://www.criticallimb.org/.all rates are freedom from event.mace major adverse cardiovascular events , male major adverse limb events suggested end point definitions for revascularization in critical limb ischemia and expected event rates for open bypass surgery reported by the society for vascular surgery working group for the development of objective performance goals for evaluating catheter - based treatment . data are pooled from prospective trials of vein bypass surgery in critical limb ischemia .
mace major adverse cardiovascular events , male major adverse limb events given the relative high - risk nature of the cli patient population , as well as the variety of available treatment options , the ability to use preprocedure variables to predict a given outcome has become increasingly important .
several recent advances have been made in an attempt to improve individual patient risk prediction at the time of initial patient evaluation .
the piii cli risk score is an easy - to - use risk stratification model developed to predict amputation - free survival in cli patients undergoing open infrainguinal surgical bypass .
this prediction tool was derived from the cohort of patients who underwent autogenous vein bypass for cli in the context of the piii randomized trial .
the piii cli risk score was then validated both internally , using the trial cohort , and externally , using a multicenter retrospective cohort of patients ( total n = 3286 ) . in this study ,
the piii cli risk score was found to be a highly reliable and simple tool for stratifying cli patients selected to undergo bypass surgery into low- , medium- , and high - risk categories . at the time of a patient s initial presentation ,
five easily obtainable binary variables may be used to provide patients and providers with a valid estimate of the likelihood of amputation - free survival at 1 year after surgical revascularization .
these variables are dialysis dependency , tissue loss , advanced age , advanced coronary artery disease , and low hematocrit .
numerous key publications have identified predictors of specific outcomes in case series of patients with cli ( table 3 ) . when looked at comprehensively , it becomes clear that patency and limb salvage outcomes are , for the most part , linked to characteristics of the bypass graft ( ie , type of conduit ) and the specific patient anatomy ( ie , adequacy of runoff score ) .
in contrast , mortality and functional outcomes appear to be more influenced by systemic comorbidities , preoperative medications , and physiologic characteristics .
table 3recent studies identifying independent predictors for select outcomes in patients with critical limb ischemiastudypatients , nstudy typeinclusion criterionprimary outcome measuresignificant predictorsrobinson et al . , 2009 1646single - center seriesbypass surgery for cli or claudicationpatencyhigh - risk conduit , cli , smoking , age 65 y , african american , femaleschanzer et al . , 2007 1404multicenter rctbypass surgery for clipatencygraft diameter , graft length , non single segment gsv , popliteal artery originbradbury et al . ,
2010 452multicenter rctbypass surgery and angioplasty for slideathage , mi , stroke , tissue loss , ankle pressure , number of detectable ankle pressures , creatinine , smoking , bmi , bollinger score , diabetesgoodney et al .
, 2010 2036multicenter registrybypass surgery for cli or claudicationdeathchf , diabetes , cli , absence of single - segment gsv , age > 80 y , dialysis , emergent procedureschanzer et al . , 2008 1404multicenter rctbypass surgery for clideathstatin therapy , age 75 y , cad , ckd stage 4/5 , tissue lossowens et al .
, 2007 456single - center seriesbypass surgery for cli or claudicationdeathage , ckd stage 4/5schanzer et al .
, 2009 1166multicenter registrybypass surgery for cliamputation - free survivalage 75 y , dialysis , tissue loss , anemia , advanced cadschanzer et al . , 2008 1404multicenter rctbypass surgery for cliamputation - free survivalage 75 y , dialysis , tissue loss , anemia , advanced cadbiancari et al .
, 2007 3925multicenter registrybypass surgery for cliamputation - free survivaldiabetes , cad , foot gangrene , urgent operationgoodney et al . , 2009
[ 34 , 35]2036multicenter registrybypass surgery for cli or claudicationamputation or loss of secondary patencyage 4049 y , nonambulatory preoperatively , dialysis , diabetes , cli , composite vein grafts , tarsal bypass target , nursing home preoperativelyrossi et al . , 2003 468single - center seriesbypass surgery for cli or claudication or aneurysmamputationgender , nonautologous conduit , redo bypasstoursarkissian et al .
, 2002 124single - center seriesbypass surgery for cli or claudicationamputationangiographic score , foot score , diabetesalback et al .
, 1998 132single - center seriesbypass surgery for cli or claudicationamputationad hoc grading system of outflow arteriessimons et al .
, 2010 1457multicenter registrybypass surgery for cliclinical failure ( persistent symptoms and/or amputation ) despite bypass patencydialysis , preoperative ambulation with assistance , history of cabg or pcigoodney et al .
, 2009 1400multicenter registrybypass surgery for cli or claudicationambulatory failurenonambulatory preoperatively , cli , age 70 y , postoperative mi , postoperative amputationtaylor et al . , 2006 1000single - center seriesbypass surgery for cliambulatory deterioration / failurefemale , diabetes , renal insufficiency , dementia , homebound preoperatively , postoperative amputationnguyen et al .
, 2006 1404multicenter rctbypass surgery for clidecreased improvement in quality of lifediabetes , postoperative graft - related eventtaylor et al . , 2006 1000single - center seriesbypass surgery for clinon - independent livingage 70 y , ulceration , previous stroke , dementia , nonambulatory , postoperative amputationbmi body mass index , cabg coronary artery bypass grafting , cad coronary artery disease ; chf congestive heart failure , ckd chronic kidney disease , cli critical limb ischemia , gsv great saphenous vein , mi myocardial infarction , pci percutaneous coronary intervention , rct randomized controlled trial , sli severe limb ischemia recent studies identifying independent predictors for select outcomes in patients with critical limb ischemia bmi body mass index , cabg coronary artery bypass grafting , cad coronary artery disease ; chf congestive heart failure , ckd chronic kidney disease , cli critical limb ischemia , gsv great saphenous vein , mi myocardial infarction , pci percutaneous coronary intervention , rct randomized controlled trial , sli severe limb ischemia surgical treatment of cli standard procedure(s)lower - extremity bypass grafting with or without femoral endarterectomy , with or without adjunctive inflow ( aortoiliac ) treatment .
the preferred graft conduit for infrainguinal bypass is autogenous saphenous vein followed by other autogenous venous conduits .
prosthetic or other nonautogenous conduits should be considered significantly inferior secondary choices for infrainguinal bypass in the cli patient.contraindicationsunacceptable surgical risk ( eg , multiple comorbidities , advanced age ) , advanced tissue loss on weight - bearing surface , nonambulatory status , no identifiable target vessel with runoff to ankle / foot .
relative contraindications : lack of adequate - quality autogenous vein conduit for infrageniculate bypass , poor - quality target vessel , extensive infection or necrosis compromising graft or vessel coverage.special pointsthe inflow artery must have uncompromised hemodynamics , and arterial outflow should be continuous to the ankle and foot .
vein graft origin ( saphenous vein is superior to all other venous conduits for infrainguinal reconstruction ) , graft diameter , and graft length all are key variables influencing short - term and long - term patency . reversed , nonreversed , or in situ vein configurations all are effective , and the choice is dictated primarily by surgeon preference and anatomic circumstances.cost/cost-effectivenesssee cost / cost - effectiveness under endovascular treatment of cli . lower - extremity bypass grafting with or without femoral endarterectomy , with or without adjunctive inflow ( aortoiliac ) treatment . the preferred graft conduit for infrainguinal
prosthetic or other nonautogenous conduits should be considered significantly inferior secondary choices for infrainguinal bypass in the cli patient .
unacceptable surgical risk ( eg , multiple comorbidities , advanced age ) , advanced tissue loss on weight - bearing surface , nonambulatory status , no identifiable target vessel with runoff to ankle / foot .
relative contraindications : lack of adequate - quality autogenous vein conduit for infrageniculate bypass , poor - quality target vessel , extensive infection or necrosis compromising graft or vessel coverage . the inflow artery must have uncompromised hemodynamics , and arterial outflow should be continuous to the ankle and foot .
vein graft origin ( saphenous vein is superior to all other venous conduits for infrainguinal reconstruction ) , graft diameter , and graft length all are key variables influencing short - term and long - term patency . reversed , nonreversed , or in situ vein configurations all are effective , and the choice is dictated primarily by surgeon preference and anatomic circumstances .
see cost / cost - effectiveness under endovascular treatment of cli .
although hyperbaric therapy commonly is used for nonhealing wounds , its efficacy has not yet been established in patients with cli .
it may be of limited utility in patients in whom revascularization is not technically feasible or for those who have failed all previous revascularization attempts.spinal cord stimulation has been proposed as an alternative to primary amputation in cli patients with ischemic rest pain who are not amenable to revascularization .
this technique requires the implantation of a subcutaneous pulse generator that stimulates electrodes at the l3-l4 level .
although this technique has not enjoyed widespread use , a recent meta - analysis did demonstrate significant pain reduction and an 11% reduced amputation rate compared with medical therapy alone .
the role for this therapy presently is unclear.intermittent pneumatic compression in patients with cli is another proposed therapy for augmenting distal arterial oxygen delivery in those who are not amenable to revascularization .
preliminary investigations have demonstrated increased muscular , collateral , and skin blood flow in patients receiving compression therapy . furthermore , a small study comparing cli patients receiving compression therapy (
n = 24 ) with those receiving optimal medical management ( n = 24 ) did demonstrate that compression therapy was associated with improved wound healing , limb salvage , and transcutaneous oximetry .
although hyperbaric therapy commonly is used for nonhealing wounds , its efficacy has not yet been established in patients with cli .
it may be of limited utility in patients in whom revascularization is not technically feasible or for those who have failed all previous revascularization attempts .
spinal cord stimulation has been proposed as an alternative to primary amputation in cli patients with ischemic rest pain who are not amenable to revascularization .
this technique requires the implantation of a subcutaneous pulse generator that stimulates electrodes at the l3-l4 level .
although this technique has not enjoyed widespread use , a recent meta - analysis did demonstrate significant pain reduction and an 11% reduced amputation rate compared with medical therapy alone .
intermittent pneumatic compression in patients with cli is another proposed therapy for augmenting distal arterial oxygen delivery in those who are not amenable to revascularization .
preliminary investigations have demonstrated increased muscular , collateral , and skin blood flow in patients receiving compression therapy .
n = 24 ) with those receiving optimal medical management ( n = 24 ) did demonstrate that compression therapy was associated with improved wound healing , limb salvage , and transcutaneous oximetry .
new revascularization strategies for cli patients not amenable to either endovascular or surgical revascularization are being explored .
based on an increased mechanistic understanding of angiogenesis and arteriogenesis , novel therapeutic approaches including molecular , genetic , and cell - based treatments have entered the clinical trial phase .in the piii study , published in 2006 , 1404 cli patients undergoing bypass surgery were randomly assigned to receive edifoligide ( a dna molecule that inhibits cell cycle gene expression and was hypothesized to reduce neointimal hyperplasia ) or placebo .
the study treatment was found to confer no benefit or harm on either the primary study end point of time to index graft reintervention or major amputation or the secondary end points of all - cause graft failure , significant graft stenosis , amputation / reintervention - free survival , and nontechnical primary graft patency .several gene therapy rcts using hepatocyte growth factor , fibroblast growth factor , and vascular endothelial growth factor [ 5355 ] have been carried out in an attempt to activate the angiogenesis pathway .
the authors demonstrated improvement in their primary study end point ( improvement in the angiographic indices 3 months after vascular endothelial growth factor gene transfer ) . in a phase 2 double - blind rct , intramuscular injection of hepatocyte growth factor plasmid in 104 cli patients demonstrated safety , and transcutaneous oxygen levels increased at 6 months in the high - dose group .
reported a european phase 1/2 rct examining a plasmid - based fibroblast growth factor gene delivery approach in 125 cli patients ; there was no significant difference in the primary end point ( ulcer healing ) , but amputation - free survival was improved .
larger rcts are required in the field , but significant challenges in study design , recruitment , and costs have slowed progress in this area.cell therapy is a regenerative medical approach for cli aimed at enhancing angiogenesis .
cell therapy trials to date have included relatively few patients compared with gene therapy trials .
autologous cells of various sources ( eg , peripheral blood , bone marrow , adipose tissue ) and cell type ( endothelial progenitors , mesenchymal stem cells , peripheral blood mononuclear cells ) have been used in phase 1/2 investigations in cli . bone marrow
mononuclear cells injected into the gastrocnemius and intra - arterial infusion of circulating blood - derived progenitor cells both have been associated with improvements in prespecified primary end points .
there are several ongoing studies in this area.drug-eluting balloons and stents have undergone limited evaluation in the lower - extremity circulation to date .
recent reports of superficial femoral artery angioplasty using a paclitaxel - coated balloon have shown encouraging results [ 5860 ] , and further trials are planned in the cli population .
no data are available yet on the utility of these technologies for cli.bioresorbable stents offer the potential to prevent recoil post angioplasty , improve remodeling , and eliminate the long - term inflammatory response to the implant .
an initial trial of a bioresorbable stent for infrapopliteal disease in cli patients failed to show any significant benefit .
new revascularization strategies for cli patients not amenable to either endovascular or surgical revascularization are being explored .
based on an increased mechanistic understanding of angiogenesis and arteriogenesis , novel therapeutic approaches including molecular , genetic , and cell - based treatments have entered the clinical trial phase . in the piii study , published in 2006 , 1404
cli patients undergoing bypass surgery were randomly assigned to receive edifoligide ( a dna molecule that inhibits cell cycle gene expression and was hypothesized to reduce neointimal hyperplasia ) or placebo .
the study treatment was found to confer no benefit or harm on either the primary study end point of time to index graft reintervention or major amputation or the secondary end points of all - cause graft failure , significant graft stenosis , amputation / reintervention - free survival , and nontechnical primary graft patency .
several gene therapy rcts using hepatocyte growth factor , fibroblast growth factor , and vascular endothelial growth factor [ 5355 ] have been carried out in an attempt to activate the angiogenesis pathway .
the authors demonstrated improvement in their primary study end point ( improvement in the angiographic indices 3 months after vascular endothelial growth factor gene transfer ) . in a phase 2 double - blind rct , intramuscular injection of hepatocyte growth factor plasmid in 104 cli patients demonstrated safety , and transcutaneous oxygen levels increased at 6 months in the high - dose group .
reported a european phase 1/2 rct examining a plasmid - based fibroblast growth factor gene delivery approach in 125 cli patients ; there was no significant difference in the primary end point ( ulcer healing ) , but amputation - free survival was improved .
larger rcts are required in the field , but significant challenges in study design , recruitment , and costs have slowed progress in this area .
cell therapy trials to date have included relatively few patients compared with gene therapy trials .
autologous cells of various sources ( eg , peripheral blood , bone marrow , adipose tissue ) and cell type ( endothelial progenitors , mesenchymal stem cells , peripheral blood mononuclear cells ) have been used in phase 1/2 investigations in cli . bone marrow
mononuclear cells injected into the gastrocnemius and intra - arterial infusion of circulating blood - derived progenitor cells both have been associated with improvements in prespecified primary end points .
drug - eluting balloons and stents have undergone limited evaluation in the lower - extremity circulation to date .
recent reports of superficial femoral artery angioplasty using a paclitaxel - coated balloon have shown encouraging results [ 5860 ] , and further trials are planned in the cli population .
bioresorbable stents offer the potential to prevent recoil post angioplasty , improve remodeling , and eliminate the long - term inflammatory response to the implant .
an initial trial of a bioresorbable stent for infrapopliteal disease in cli patients failed to show any significant benefit .
no clinical trials have been conducted , or are ongoing , that specifically address the role of diet modifications / supplements in the progression of cli.lipid abnormalities , including elevated total and low - density lipoprotein ( ldl ) cholesterol , decreased high - density lipoprotein cholesterol , and hypertriglyceridemia , are strongly associated with lower - extremity pad . as a result ,
low - cholesterol diets have been recommended for patients with cli .cigarette smoking is a strong predictor of lower - extremity pad , with a large number of epidemiologic studies establishing an increased incidence of pad in smokers compared with nonsmokers .
furthermore , the severity of pad tends to increase in a dose - dependent manner with the number of cigarettes smoked .
no clinical trials have been conducted , or are ongoing , that specifically address the role of diet modifications / supplements in the progression of cli .
lipid abnormalities , including elevated total and low - density lipoprotein ( ldl ) cholesterol , decreased high - density lipoprotein cholesterol , and hypertriglyceridemia , are strongly associated with lower - extremity pad . as a result ,
cigarette smoking is a strong predictor of lower - extremity pad , with a large number of epidemiologic studies establishing an increased incidence of pad in smokers compared with nonsmokers .
furthermore , the severity of pad tends to increase in a dose - dependent manner with the number of cigarettes smoked .
to date , no pharmacologic therapy has demonstrated efficacy in reversing the arterial occlusive lesions , or the resulting impaired perfusion , seen in patients with cli .
the circulase trial ( mitsubishi pharma corp , tokyo , japan ) , published in 2006 , randomly assigned 379 cli patients with no revascularization option to receive lipo - ecraprost ( parenteral prostaglandin ) or placebo .
the study treatment was found to confer no benefit ( or harm ) on the primary study end point , death or amputation above the ankle at 180 days .various reports have demonstrated that cardioprotective medications such as statins , -blockers , angiotensin - converting enzyme inhibitors , and antiplatelet agents are associated with a decreased cardiovascular event rate in patients with pad [ 1621 ] .
however , these studies have been conducted in heterogeneous populations , not specifically in patients with cli . in a retrospective analysis of 1404 cli patients who had undergone surgical revascularization ,
statins were demonstrated to confer a significant survival advantage at 1 year ( hazard ratio [ hr ] for mortality , 0.71 ; p = 0.03 ) .
however , optimum dosing and therapeutic targets ( eg , ldl cholesterol , c - reactive protein levels ) for statin therapy in pad patients are uncertain , and more clinical trials are needed to determine whether statins have direct beneficial effects in the peripheral circulation ( limb ) .
in general , current recommendations for the use of cardioprotective medications in cli follow published general pad guidelines . to date , no pharmacologic therapy has demonstrated efficacy in reversing the arterial occlusive lesions , or the resulting impaired perfusion , seen in patients with cli .
the circulase trial ( mitsubishi pharma corp , tokyo , japan ) , published in 2006 , randomly assigned 379 cli patients with no revascularization option to receive lipo - ecraprost ( parenteral prostaglandin ) or placebo .
the study treatment was found to confer no benefit ( or harm ) on the primary study end point , death or amputation above the ankle at 180 days .
various reports have demonstrated that cardioprotective medications such as statins , -blockers , angiotensin - converting enzyme inhibitors , and antiplatelet agents are associated with a decreased cardiovascular event rate in patients with pad [ 1621 ] .
however , these studies have been conducted in heterogeneous populations , not specifically in patients with cli . in a retrospective analysis of 1404 cli patients who had undergone surgical revascularization ,
statins were demonstrated to confer a significant survival advantage at 1 year ( hazard ratio [ hr ] for mortality , 0.71 ; p = 0.03 ) .
however , optimum dosing and therapeutic targets ( eg , ldl cholesterol , c - reactive protein levels ) for statin therapy in pad patients are uncertain , and more clinical trials are needed to determine whether statins have direct beneficial effects in the peripheral circulation ( limb ) . in general ,
current recommendations for the use of cardioprotective medications in cli follow published general pad guidelines .
these evolving technologies include balloon angioplasty , cryoplasty therapy ( boston scientific , natick , ma ) , stent / stent - graft placement , laser atherectomy , and mechanical atherectomy . beyond single - center case series demonstrating feasibility and technical success
these results often are difficult to interpret because of differences in patient selection , use of multiple therapeutic modalities , and variable end points with variable study durations .
a summary of several of the larger , recent series reporting outcomes of endovascular treatment for patients with cli is presented in table 1 .
table 1recent studies reporting outcomes in patients undergoing endovascular therapy for treatment of critical limb ischemiastudypatients , nstudy typeoutcome measure(s)event rate , % laird et al . , 2006 155multicenter seriesamputation - free survival ( 6 mo)82bosiers et al . , 2007 51multicenter seriesamputation - free survival ( 1 y)79derubertis et al . , 2008 184single - center serieslimb salvage ( 1 y)88.3primary patency ( 1 y)54 5primary patency ( 2 y)43 7giles et al . , 2008 176single - center seriesfreedom from restenosis , reintervention , or amputation ( 1 y)39freedom from restenosis , reintervention , or amputation ( 2 y)35primary patency ( 1 y)53primary patency ( 2 y)51limb salvage ( 3 y)84survival ( 1 y)81survival ( 3 y)54romiti et al . , 2008 meta - analysisprimary patency ( 1 y)58.1 4.6primary patency ( 3 y)48.6 8.0secondary patency ( 1 y)68.2 5.9secondary patency ( 3 y)62.9 11.0limb salvage ( 1 y)86.0 2.7limb salvage ( 3 y)82.4 3.4survival ( 1 y)87.0
2.1survival ( 3 y)68.4 5.5the transatlantic inter - society consensus document on management of peripheral arterial disease ( tasc ii ) , published in 2006 , was developed by an international working group charged with reviewing the literature and putting forth recommendations for the diagnosis and treatment of pad .
all recommendations were assigned a grade based on the level of available evidence to support that recommendation .
the working group recommended endovascular therapy as the first - line treatment method for patients with tasc a and b lesions . of note , this recommendation received a grade c for evidence , which was defined as
evidence obtained from expert committee reports or opinions.no applicable studies of good quality.the basil ( bypass versus angioplasty in severe ischaemia of the leg ) trial , sponsored by the uk national institute of health research health technology assessment program , is the only randomized controlled trial ( rct ) comparing open surgical bypass with endovascular therapy in patients with severe limb ischemia ( sli ) due to infrainguinal disease ; therefore , it is worth considering in detail .
admit patients with chronic , potentially limb threatening , ischemia but who did not necessarily have ankle pressures less than 50 mmhg and thus did not strictly fulfill the requirements of the term cli .
it also is important to note that patients were eligible for basil if they were deemed suitable for either angioplasty or bypass and if they met the investigators criterion of grey area of clinical equipoise.the basil trial began enrollment in 1999 and randomly assigned 452 patients from 27 centers across scotland and england . in 2005 ,
the basil trialists reported an analysis of outcomes out to 2 years demonstrating no difference in overall survival or amputation - free survival by intention - to - treat analysis between surgical bypass and endovascular therapy , with surgery being more expensive in the short term .
however , post hoc analysis demonstrated that beyond 2 years , patients initially assigned to open bypass surgery had a significantly improved amputation - free survival ( adjusted hr , 0.37 ; 95% ci , 0.170.77 ; p = 0.008 ) and reduced all - cause mortality ( adjusted hr , 0.34 ; 95% ci , 0.170.71 ; p = 0.004 ) relative to angioplasty .
this finding of the basil trial was considered significant enough to warrant funding of an extension study , the results of which were reported recently [ 23,24,25,26,27 ] . for
the overall follow - up period ( mean follow - up , 3.1 years ; range , 15.7 years ) , there was no significant difference in overall survival or amputation - free survival by intention - to - treat analysis .
however , for patients surviving to 2 years post procedure ( 70% of the study cohort ) , initial randomization to open bypass was associated with significantly improved overall survival ( mean gain of 7.3 months ; p = 0.02 ) and a trend toward increased amputation - free survival ( mean gain of 5.9 months ; p = 0.06 ) .
the investigators also published the trial outcomes using an as - treated analysis [ 25 ] , an approach that accounts for early treatment crossovers but , importantly , sacrifices the power of randomization . in this analysis
, they found that among patients assigned to open surgery , those who received prosthetic grafts ( 25% of the surgical group ) experienced reduced amputation - free survival compared with those who received vein grafts ( p = 0.003 ) .
they also observed that patients who underwent bypass surgery after an initial failed angioplasty experienced significantly worse amputation - free survival than those who underwent bypass as the initial therapy ( p = 0.006 ) , suggesting a real potential downside to failed angioplasty in sli.the primary recommendations from the basil trial perhaps are best summarized by the authors in the following statement :
.sli patients predicted to live more than 2 years , and with a useable vein , should usually have bypass surgery first .
this is because the long term results of saphenous vein bypass surgery are good , the rate of balloon angioplasty failure is high , and the results of bypass surgery after failed balloon angioplasty are significantly worse than for bypass surgery .
however , patients expected to live less than 2 years , and those without a useable vein , should usually have balloon angioplasty first as they will not survive to reap the longer term benefits of surgery and the results of prosthetic bypass surgery are poor [ 25].there are several important limitations and controversies surrounding the application of the basil trial to current practice , yet this study stands as a seminal rct in the field of advanced limb ischemia and a basis for the design of future trials .
these evolving technologies include balloon angioplasty , cryoplasty therapy ( boston scientific , natick , ma ) , stent / stent - graft placement , laser atherectomy , and mechanical atherectomy .
beyond single - center case series demonstrating feasibility and technical success , a paucity of high - level data precludes critical evaluation of these technologies .
these results often are difficult to interpret because of differences in patient selection , use of multiple therapeutic modalities , and variable end points with variable study durations .
a summary of several of the larger , recent series reporting outcomes of endovascular treatment for patients with cli is presented in table 1 .
table 1recent studies reporting outcomes in patients undergoing endovascular therapy for treatment of critical limb ischemiastudypatients , nstudy typeoutcome measure(s)event rate , % laird et al . , 2006 155multicenter seriesamputation - free survival ( 6 mo)82bosiers et al . , 2007 51multicenter seriesamputation - free survival ( 1 y)79derubertis et al . , 2008 184single - center serieslimb salvage ( 1 y)88.3primary patency ( 1 y)54 5primary patency ( 2 y)43 7giles et al . , 2008 176single - center seriesfreedom from restenosis , reintervention , or amputation ( 1 y)39freedom from restenosis , reintervention , or amputation ( 2 y)35primary patency ( 1 y)53primary patency ( 2 y)51limb salvage ( 3 y)84survival ( 1 y)81survival ( 3 y)54romiti et al . , 2008 meta - analysisprimary patency ( 1 y)58.1 4.6primary patency ( 3 y)48.6 8.0secondary patency ( 1 y)68.2 5.9secondary patency ( 3 y)62.9 11.0limb salvage ( 1 y)86.0 2.7limb salvage ( 3 y)82.4 3.4survival ( 1 y)87.0
2.1survival ( 3 y)68.4 5.5 recent studies reporting outcomes in patients undergoing endovascular therapy for treatment of critical limb ischemia the transatlantic inter - society consensus document on management of peripheral arterial disease ( tasc ii ) , published in 2006 , was developed by an international working group charged with reviewing the literature and putting forth recommendations for the diagnosis and treatment of pad .
all recommendations were assigned a grade based on the level of available evidence to support that recommendation .
the working group recommended endovascular therapy as the first - line treatment method for patients with tasc a and b lesions . of note
evidence obtained from expert committee reports or opinions.no applicable studies of good quality .
the basil ( bypass versus angioplasty in severe ischaemia of the leg ) trial , sponsored by the uk national institute of health research health technology assessment program , is the only randomized controlled trial ( rct ) comparing open surgical bypass with endovascular therapy in patients with severe limb ischemia ( sli ) due to infrainguinal disease ; therefore , it is worth considering in detail .
admit patients with chronic , potentially limb threatening , ischemia but who did not necessarily have ankle pressures less than 50 mmhg and thus did not strictly fulfill the requirements of the term cli .
it also is important to note that patients were eligible for basil if they were deemed suitable for either angioplasty or bypass and if they met the investigators criterion of grey area of clinical equipoise .
the basil trial began enrollment in 1999 and randomly assigned 452 patients from 27 centers across scotland and england .
in 2005 , the basil trialists reported an analysis of outcomes out to 2 years demonstrating no difference in overall survival or amputation - free survival by intention - to - treat analysis between surgical bypass and endovascular therapy , with surgery being more expensive in the short term .
however , post hoc analysis demonstrated that beyond 2 years , patients initially assigned to open bypass surgery had a significantly improved amputation - free survival ( adjusted hr , 0.37 ; 95% ci , 0.170.77 ; p = 0.008 ) and reduced all - cause mortality ( adjusted hr , 0.34 ; 95% ci , 0.170.71 ; p = 0.004 ) relative to angioplasty .
this finding of the basil trial was considered significant enough to warrant funding of an extension study , the results of which were reported recently [ 23,24,25,26,27 ] . for
the overall follow - up period ( mean follow - up , 3.1 years ; range , 15.7 years ) , there was no significant difference in overall survival or amputation - free survival by intention - to - treat analysis .
however , for patients surviving to 2 years post procedure ( 70% of the study cohort ) , initial randomization to open bypass was associated with significantly improved overall survival ( mean gain of 7.3 months ; p = 0.02 ) and a trend toward increased amputation - free survival ( mean gain of 5.9 months ; p = 0.06 ) .
the investigators also published the trial outcomes using an as - treated analysis [ 25 ] , an approach that accounts for early treatment crossovers but , importantly , sacrifices the power of randomization . in this analysis
, they found that among patients assigned to open surgery , those who received prosthetic grafts ( 25% of the surgical group ) experienced reduced amputation - free survival compared with those who received vein grafts ( p = 0.003 ) .
they also observed that patients who underwent bypass surgery after an initial failed angioplasty experienced significantly worse amputation - free survival than those who underwent bypass as the initial therapy ( p = 0.006 ) , suggesting a real potential downside to failed angioplasty in sli .
the primary recommendations from the basil trial perhaps are best summarized by the authors in the following statement :
.sli patients predicted to live more than 2 years , and with a useable vein , should usually have bypass surgery first .
this is because the long term results of saphenous vein bypass surgery are good , the rate of balloon angioplasty failure is high , and the results of bypass surgery after failed balloon angioplasty are significantly worse than for bypass surgery .
however , patients expected to live less than 2 years , and those without a useable vein , should usually have balloon angioplasty first as they will not survive to reap the longer term benefits of surgery and the results of prosthetic bypass surgery are poor [ 25 ] .
.sli patients predicted to live more than 2 years , and with a useable vein , should usually have bypass surgery first .
this is because the long term results of saphenous vein bypass surgery are good , the rate of balloon angioplasty failure is high , and the results of bypass surgery after failed balloon angioplasty are significantly worse than for bypass surgery .
however , patients expected to live less than 2 years , and those without a useable vein , should usually have balloon angioplasty first as they will not survive to reap the longer term benefits of surgery and the results of prosthetic bypass surgery are poor [ 25 ] .
there are several important limitations and controversies surrounding the application of the basil trial to current practice , yet this study stands as a seminal rct in the field of advanced limb ischemia and a basis for the design of future trials .
endovascular treatment of cli standard procedure(s)percutaneous angioplasty with or without adjunctive atherectomy ( mechanical or laser ) and with or without adjunctive stenting.contraindicationsrelative : low estimated glomerular filtration rate , anatomically unfavorable disease ( common femoral artery lesion , extensive calcification , long segment occlusions , severe popliteal and/or infrapopliteal disease).complicationsthrombosis , embolization , blue toe syndrome , amputation , loss of surgical target for bypass , access site complications ( hemorrhage , pseudoaneurysm , arteriovenous fistula ) , contrast nephropathy , and renal failure.special pointstechniques for endovascular treatment in the aortoiliac segment have become more standardized and durability more consistent for tasc a to tasc c disease ( absence of a long segment occlusion for a complete description of tasc criteria , please see norgren et al . [ 10 ] ) .
adequate treatment of the common and profunda femoris arteries is of primary importance in cli and may require a hybrid or fully open approach ( eg , femoral endarterectomy ) .
the role of covered stents in the aortoiliac segment is poorly defined . for infrainguinal therapy ,
several devices are available for different lesion anatomies and technical circumstances ( eg , best approach for complete total occlusions ) , but little evidence is available to support one over the other .
the benefit of routine use of nitinol stents in the superficial femoral artery is still under debate .
no rct data are available demonstrating a benefit for the use of stents in popliteal or distal vessels , or for the use of drug - eluting stents in lower - extremity vessels.cost/cost-effectivenessseveral cost - effectiveness analyses have been performed comparing endovascular therapy with open surgery in patients with cli [ 24 , 30 ] .
stoner et al . analyzed 381 femoropopliteal revascularization procedures ( open bypass , n = 183 ; endovascular , n = 198 ) performed for claudication and cli . in the subset of patients with cli , they reported an initial cost saving with endovascular therapy ( $ 7176 vs $ 13,277 ; p < 0.001 ) . however , during the 1-year study period , the patients who were treated with endovascular therapy went on to require reinterventions , so this cost saving ultimately was lost at 1 year . similarly , in the cost - effectiveness study that accompanied the basil trial , no significant difference was seen , as the survival , hospital costs , and health - related quality - of - life differences were minimal between the surgical and endovascular study arms .
percutaneous angioplasty with or without adjunctive atherectomy ( mechanical or laser ) and with or without adjunctive stenting .
relative : low estimated glomerular filtration rate , anatomically unfavorable disease ( common femoral artery lesion , extensive calcification , long segment occlusions , severe popliteal and/or infrapopliteal disease ) .
thrombosis , embolization , blue toe syndrome , amputation , loss of surgical target for bypass , access site complications ( hemorrhage , pseudoaneurysm , arteriovenous fistula ) , contrast nephropathy , and renal failure .
techniques for endovascular treatment in the aortoiliac segment have become more standardized and durability more consistent for tasc a to tasc c disease ( absence of a long segment occlusion for a complete description of tasc criteria , please see norgren et al . [ 10 ] ) .
adequate treatment of the common and profunda femoris arteries is of primary importance in cli and may require a hybrid or fully open approach ( eg , femoral endarterectomy ) .
the role of covered stents in the aortoiliac segment is poorly defined . for infrainguinal therapy ,
several devices are available for different lesion anatomies and technical circumstances ( eg , best approach for complete total occlusions ) , but little evidence is available to support one over the other .
the benefit of routine use of nitinol stents in the superficial femoral artery is still under debate .
no rct data are available demonstrating a benefit for the use of stents in popliteal or distal vessels , or for the use of drug - eluting stents in lower - extremity vessels .
several cost - effectiveness analyses have been performed comparing endovascular therapy with open surgery in patients with cli [ 24 , 30 ] .
stoner et al . analyzed 381 femoropopliteal revascularization procedures ( open bypass , n = 183 ; endovascular , n = 198 ) performed for claudication and cli . in the subset of patients with cli , they reported an initial cost saving with endovascular therapy ( $ 7176 vs $ 13,277 ; p < 0.001 ) .
however , during the 1-year study period , the patients who were treated with endovascular therapy went on to require reinterventions , so this cost saving ultimately was lost at 1 year .
similarly , in the cost - effectiveness study that accompanied the basil trial , no significant difference was seen , as the survival , hospital costs , and health - related quality - of - life differences were minimal between the surgical and endovascular study arms .
open surgical bypass using autogenous vein traditionally has been the gold - standard revascularization technique for patients with cli due to infrainguinal disease .
however , this paradigm is evolving as new endovascular technologies are being developed , used , and tested.aortofemoral bypass using prosthetic conduit is a standard surgical approach for extensive ( eg , tasc d ) aortoiliac disease or in the setting of failed prior endovascular therapy .
expected operative mortality is approximately 3% and durability is excellent ( 85%90% patency at 5 years and beyond).as noted earlier , adequate treatment of disease in the common and deep femoral arteries ( eg , endarterectomy and/or patch angioplasty ) at the time of either inflow or outflow reconstruction is of primary importance for the long - term fate of the limb in cli patients.two rcts examining novel cli treatments ( gene therapy and prostaglandin therapy ) , a multicenter prospectively maintained vascular registry , and one rct comparing balloon angioplasty with surgical bypass in patients with cli ( basil ) have provided a wealth of high - quality outcomes data pertaining to vein bypass surgery in patients with cli .
several authors have used the information contained in these surgical cli datasets to further our understanding of risk stratification and outcome prediction [ 22,3339,40 ] , quality of life , disparities in care , reintervention rates and the associated outcomes , and resource utilization .both basil and prevent iii ( piii ) challenge the nihilistic paradigms about mortality rates in patients with cli : 85% of piii patients survived beyond 1 year , and 70% of basil patients survived longer than 2 years .
these data suggest that cli patients may be done a tremendous disservice if the selection of their therapies is founded on the concept that all cli patients carry a substantial mortality risk that warrants a short - term approach.a recent meta - analysis in patients with cli undergoing infrainguinal bypass demonstrated 5-year primary patency , secondary patency , and limb salvage rates of 63% , 71% , and 78% , respectively .
recently , a working group under the auspices of the society for vascular surgery used pooled data from the piii , basil , and circulase studies to develop expected outcomes for vein bypass surgery as the relevant standard for comparing new devices .
this group endorsed a set of three safety and six efficacy objective performance goals for cli based on the pooled data from these surgical controls [ 40 ] .
these outcomes are summarized in table 2 .
table 2suggested end point definitions for revascularization in critical limb ischemia and expected event rates for open bypass surgeryend pointdefinitionevent rate , % ( 95% ci)safety outcomes ( 30 d)macemyocardial infarction , stroke , or death ( any cause)6.2 ( 4.78.1)maleabove - ankle amputation of the index limb or major reintervention ( new bypass graft , jump / interposition graft revision , or thrombectomy / thrombolysis)6.1 ( 4.67.9)amputationabove - ankle amputation of the index limb1.9 ( 1.13.1)efficacy outcomes ( 1 y)perioperative death or maleperioperative death ( 30 d ) or any male76.9 ( 74.079.9)amputation - free survivalabove - ankle amputation of the index limb or death ( any cause)76.5 ( 73.779.5)reintervention , amputation , or stenosisany reintervention , above - ankle amputation of the index limb , or stenosis46.5 ( 42.351.2)reintervention or amputationany reintervention or above - ankle amputation of the index limb61.3 ( 58.064.9)limb salvagefreedom from above - ankle amputation88.9 ( 86.791.1)survivalfreedom from death ( any cause)85.7 ( 83.388.1)reported by the society for vascular surgery working group for the development of objective performance goals for evaluating catheter - based treatment . data are pooled from prospective trials of vein bypass surgery in critical limb ischemia .
additional data are available at http://www.criticallimb.org/.all rates are freedom from event.mace major adverse cardiovascular events , male major adverse limb eventsgiven the relative high - risk nature of the cli patient population , as well as the variety of available treatment options , the ability to use preprocedure variables to predict a given outcome has become increasingly important .
several recent advances have been made in an attempt to improve individual patient risk prediction at the time of initial patient evaluation .
the piii cli risk score is an easy - to - use risk stratification model developed to predict amputation - free survival in cli patients undergoing open infrainguinal surgical bypass .
this prediction tool was derived from the cohort of patients who underwent autogenous vein bypass for cli in the context of the piii randomized trial .
the piii cli risk score was then validated both internally , using the trial cohort , and externally , using a multicenter retrospective cohort of patients ( total n = 3286 ) . in this study , the piii cli risk score was found to be a highly reliable and simple tool for stratifying cli patients selected to undergo bypass surgery into low- , medium- , and high - risk categories . at the time of a patient s initial presentation ,
five easily obtainable binary variables may be used to provide patients and providers with a valid estimate of the likelihood of amputation - free survival at 1 year after surgical revascularization .
these variables are dialysis dependency , tissue loss , advanced age , advanced coronary artery disease , and low hematocrit .
numerous key publications have identified predictors of specific outcomes in case series of patients with cli ( table 3 ) .
when looked at comprehensively , it becomes clear that patency and limb salvage outcomes are , for the most part , linked to characteristics of the bypass graft ( ie , type of conduit ) and the specific patient anatomy ( ie , adequacy of runoff score ) .
in contrast , mortality and functional outcomes appear to be more influenced by systemic comorbidities , preoperative medications , and physiologic characteristics .
table 3recent studies identifying independent predictors for select outcomes in patients with critical limb ischemiastudypatients , nstudy typeinclusion criterionprimary outcome measuresignificant predictorsrobinson et al . , 2009 1646single - center seriesbypass surgery for cli or claudicationpatencyhigh - risk conduit , cli , smoking , age 65 y , african american , femaleschanzer et al . , 2007 1404multicenter rctbypass surgery for clipatencygraft diameter , graft length , non single segment gsv , popliteal artery originbradbury et al . , 2010 452multicenter rctbypass surgery and angioplasty for slideathage , mi , stroke , tissue loss , ankle pressure , number of detectable ankle pressures , creatinine , smoking , bmi , bollinger score , diabetesgoodney et al . , 2010 2036multicenter registrybypass surgery for cli or claudicationdeathchf , diabetes , cli , absence of single - segment gsv , age > 80 y , dialysis , emergent procedureschanzer et al . , 2008 1404multicenter rctbypass surgery for clideathstatin therapy , age 75 y , cad , ckd stage 4/5 , tissue lossowens et al .
, 2007 456single - center seriesbypass surgery for cli or claudicationdeathage , ckd stage 4/5schanzer et al .
, 2009 1166multicenter registrybypass surgery for cliamputation - free survivalage 75 y , dialysis , tissue loss , anemia , advanced cadschanzer et al . , 2008 1404multicenter rctbypass surgery for cliamputation - free survivalage 75 y , dialysis , tissue loss , anemia , advanced cadbiancari et al . , 2007 3925multicenter registrybypass surgery for cliamputation - free survivaldiabetes , cad , foot gangrene , urgent operationgoodney et al . , 2009
[ 34 , 35]2036multicenter registrybypass surgery for cli or claudicationamputation or loss of secondary patencyage 4049 y , nonambulatory preoperatively , dialysis , diabetes , cli , composite vein grafts , tarsal bypass target , nursing home preoperativelyrossi et al . , 2003 468single - center seriesbypass surgery for cli or claudication or aneurysmamputationgender , nonautologous conduit , redo bypasstoursarkissian et al .
, 2002 124single - center seriesbypass surgery for cli or claudicationamputationangiographic score , foot score , diabetesalback et al .
, 1998 132single - center seriesbypass surgery for cli or claudicationamputationad hoc grading system of outflow arteriessimons et al . , 2010 1457multicenter registrybypass surgery for cliclinical failure ( persistent symptoms and/or amputation ) despite bypass patencydialysis , preoperative ambulation with assistance , history of cabg or pcigoodney et al . , 2009 1400multicenter registrybypass surgery for cli or claudicationambulatory failurenonambulatory preoperatively , cli , age 70 y , postoperative mi , postoperative amputationtaylor et al .
, 2006 1000single - center seriesbypass surgery for cliambulatory deterioration / failurefemale , diabetes , renal insufficiency , dementia , homebound preoperatively , postoperative amputationnguyen et al . , 2006 1404multicenter rctbypass surgery for clidecreased improvement in quality of lifediabetes , postoperative graft - related eventtaylor et al .
, 2006 1000single - center seriesbypass surgery for clinon - independent livingage 70 y , ulceration , previous stroke , dementia , nonambulatory , postoperative amputationbmi body mass index , cabg coronary artery bypass grafting , cad coronary artery disease ; chf congestive heart failure , ckd chronic kidney disease , cli critical limb ischemia , gsv great saphenous vein , mi myocardial infarction , pci percutaneous coronary intervention , rct randomized controlled trial , sli severe limb ischemia open surgical bypass using autogenous vein traditionally has been the gold - standard revascularization technique for patients with cli due to infrainguinal disease .
however , this paradigm is evolving as new endovascular technologies are being developed , used , and tested .
aortofemoral bypass using prosthetic conduit is a standard surgical approach for extensive ( eg , tasc d ) aortoiliac disease or in the setting of failed prior endovascular therapy .
expected operative mortality is approximately 3% and durability is excellent ( 85%90% patency at 5 years and beyond ) . as noted earlier , adequate treatment of disease in the common and deep femoral arteries ( eg , endarterectomy and/or patch angioplasty ) at the time of either inflow or outflow reconstruction is of primary importance for the long - term fate of the limb in cli patients .
two rcts examining novel cli treatments ( gene therapy and prostaglandin therapy ) , a multicenter prospectively maintained vascular registry , and one rct comparing balloon angioplasty with surgical bypass in patients with cli ( basil ) have provided a wealth of high - quality outcomes data pertaining to vein bypass surgery in patients with cli .
several authors have used the information contained in these surgical cli datasets to further our understanding of risk stratification and outcome prediction [ 22,3339,40 ] , quality of life , disparities in care , reintervention rates and the associated outcomes , and resource utilization . both basil and prevent iii ( piii ) challenge the nihilistic paradigms about mortality rates in patients with cli : 85% of piii patients survived beyond 1 year , and 70% of basil patients survived longer than 2 years .
these data suggest that cli patients may be done a tremendous disservice if the selection of their therapies is founded on the concept that all cli patients carry a substantial mortality risk that warrants a short - term approach .
a recent meta - analysis in patients with cli undergoing infrainguinal bypass demonstrated 5-year primary patency , secondary patency , and limb salvage rates of 63% , 71% , and 78% , respectively .
recently , a working group under the auspices of the society for vascular surgery used pooled data from the piii , basil , and circulase studies to develop expected outcomes for vein bypass surgery as the relevant standard for comparing new devices .
this group endorsed a set of three safety and six efficacy objective performance goals for cli based on the pooled data from these surgical controls [ 40 ] .
table 2suggested end point definitions for revascularization in critical limb ischemia and expected event rates for open bypass surgeryend pointdefinitionevent rate , % ( 95% ci)safety outcomes ( 30 d)macemyocardial infarction , stroke , or death ( any cause)6.2 ( 4.78.1)maleabove - ankle amputation of the index limb or major reintervention ( new bypass graft , jump / interposition graft revision , or thrombectomy / thrombolysis)6.1 ( 4.67.9)amputationabove - ankle amputation of the index limb1.9 ( 1.13.1)efficacy outcomes ( 1 y)perioperative death or maleperioperative death ( 30 d ) or any male76.9 ( 74.079.9)amputation - free survivalabove - ankle amputation of the index limb or death ( any cause)76.5 ( 73.779.5)reintervention , amputation , or stenosisany reintervention , above - ankle amputation of the index limb , or stenosis46.5 ( 42.351.2)reintervention or amputationany reintervention or above - ankle amputation of the index limb61.3 ( 58.064.9)limb salvagefreedom from above - ankle amputation88.9 ( 86.791.1)survivalfreedom from death ( any cause)85.7 ( 83.388.1)reported by the society for vascular surgery working group for the development of objective performance goals for evaluating catheter - based treatment . data are pooled from prospective trials of vein bypass surgery in critical limb ischemia .
additional data are available at http://www.criticallimb.org/.all rates are freedom from event.mace major adverse cardiovascular events , male major adverse limb events suggested end point definitions for revascularization in critical limb ischemia and expected event rates for open bypass surgery reported by the society for vascular surgery working group for the development of objective performance goals for evaluating catheter - based treatment . data are pooled from prospective trials of vein bypass surgery in critical limb ischemia .
mace major adverse cardiovascular events , male major adverse limb events given the relative high - risk nature of the cli patient population , as well as the variety of available treatment options , the ability to use preprocedure variables to predict a given outcome has become increasingly important .
several recent advances have been made in an attempt to improve individual patient risk prediction at the time of initial patient evaluation .
the piii cli risk score is an easy - to - use risk stratification model developed to predict amputation - free survival in cli patients undergoing open infrainguinal surgical bypass .
this prediction tool was derived from the cohort of patients who underwent autogenous vein bypass for cli in the context of the piii randomized trial .
the piii cli risk score was then validated both internally , using the trial cohort , and externally , using a multicenter retrospective cohort of patients ( total n = 3286 ) . in this study ,
the piii cli risk score was found to be a highly reliable and simple tool for stratifying cli patients selected to undergo bypass surgery into low- , medium- , and high - risk categories . at the time of a patient s initial presentation ,
five easily obtainable binary variables may be used to provide patients and providers with a valid estimate of the likelihood of amputation - free survival at 1 year after surgical revascularization .
these variables are dialysis dependency , tissue loss , advanced age , advanced coronary artery disease , and low hematocrit .
numerous key publications have identified predictors of specific outcomes in case series of patients with cli ( table 3 ) .
when looked at comprehensively , it becomes clear that patency and limb salvage outcomes are , for the most part , linked to characteristics of the bypass graft ( ie , type of conduit ) and the specific patient anatomy ( ie , adequacy of runoff score ) .
in contrast , mortality and functional outcomes appear to be more influenced by systemic comorbidities , preoperative medications , and physiologic characteristics .
table 3recent studies identifying independent predictors for select outcomes in patients with critical limb ischemiastudypatients , nstudy typeinclusion criterionprimary outcome
measuresignificant predictorsrobinson et al . , 2009 1646single - center seriesbypass surgery for cli or claudicationpatencyhigh - risk conduit , cli , smoking , age 65 y , african american , femaleschanzer et al . , 2007 1404multicenter rctbypass surgery for clipatencygraft diameter , graft length , non single segment gsv , popliteal artery originbradbury et al . ,
2010 452multicenter rctbypass surgery and angioplasty for slideathage , mi , stroke , tissue loss , ankle pressure , number of detectable ankle pressures , creatinine , smoking , bmi , bollinger score , diabetesgoodney et al .
, 2010 2036multicenter registrybypass surgery for cli or claudicationdeathchf , diabetes , cli , absence of single - segment gsv , age > 80 y , dialysis , emergent procedureschanzer et al .
, 2008 1404multicenter rctbypass surgery for clideathstatin therapy , age 75 y , cad , ckd stage 4/5 , tissue lossowens et al . , 2007 456single - center seriesbypass surgery for cli or claudicationdeathage , ckd stage 4/5schanzer et al .
, 2009 1166multicenter registrybypass surgery for cliamputation - free survivalage 75 y , dialysis , tissue loss , anemia , advanced cadschanzer et al .
, 2008 1404multicenter rctbypass surgery for cliamputation - free survivalage 75 y , dialysis , tissue loss , anemia , advanced cadbiancari et al . , 2007 3925multicenter registrybypass surgery for cliamputation - free survivaldiabetes , cad , foot gangrene , urgent operationgoodney et al . , 2009
[ 34 , 35]2036multicenter registrybypass surgery for cli or claudicationamputation or loss of secondary patencyage 4049 y , nonambulatory preoperatively , dialysis , diabetes , cli , composite vein grafts , tarsal bypass target , nursing home preoperativelyrossi et al . , 2003 468single - center seriesbypass surgery for cli or claudication or aneurysmamputationgender , nonautologous conduit , redo bypasstoursarkissian et al .
, 2002 124single - center seriesbypass surgery for cli or claudicationamputationangiographic score , foot score , diabetesalback et al .
, 1998 132single - center seriesbypass surgery for cli or claudicationamputationad hoc grading system of outflow arteriessimons et al .
, 2010 1457multicenter registrybypass surgery for cliclinical failure ( persistent symptoms and/or amputation ) despite bypass patencydialysis , preoperative ambulation with assistance , history of cabg or pcigoodney et al .
, 2009 1400multicenter registrybypass surgery for cli or claudicationambulatory failurenonambulatory preoperatively , cli , age 70 y , postoperative mi , postoperative amputationtaylor et al . , 2006 1000single - center seriesbypass surgery for cliambulatory deterioration / failurefemale , diabetes , renal insufficiency , dementia , homebound preoperatively , postoperative amputationnguyen et al .
, 2006 1404multicenter rctbypass surgery for clidecreased improvement in quality of lifediabetes , postoperative graft - related eventtaylor et al . , 2006 1000single - center seriesbypass surgery for clinon - independent livingage 70 y , ulceration , previous stroke , dementia , nonambulatory , postoperative amputationbmi body mass index , cabg coronary artery bypass grafting , cad coronary artery disease ; chf congestive heart failure , ckd chronic kidney disease , cli critical limb ischemia , gsv great saphenous vein , mi myocardial infarction , pci percutaneous coronary intervention , rct randomized controlled trial , sli severe limb ischemia recent studies identifying independent predictors for select outcomes in patients with critical limb ischemia bmi body mass index , cabg coronary artery bypass grafting , cad coronary artery disease ; chf congestive heart failure , ckd chronic kidney disease , cli critical limb ischemia , gsv great saphenous vein , mi myocardial infarction , pci percutaneous coronary intervention , rct randomized controlled trial , sli severe limb ischemia surgical treatment of cli standard procedure(s)lower - extremity bypass grafting with or without femoral endarterectomy , with or without adjunctive inflow ( aortoiliac ) treatment .
the preferred graft conduit for infrainguinal bypass is autogenous saphenous vein followed by other autogenous venous conduits .
prosthetic or other nonautogenous conduits should be considered significantly inferior secondary choices for infrainguinal bypass in the cli patient.contraindicationsunacceptable surgical risk ( eg , multiple comorbidities , advanced age ) , advanced tissue loss on weight - bearing surface , nonambulatory status , no identifiable target vessel with runoff to ankle / foot .
relative contraindications : lack of adequate - quality autogenous vein conduit for infrageniculate bypass , poor - quality target vessel , extensive infection or necrosis compromising graft or vessel coverage.special pointsthe inflow artery must have uncompromised hemodynamics , and arterial outflow should be continuous to the ankle and foot .
vein graft origin ( saphenous vein is superior to all other venous conduits for infrainguinal reconstruction ) , graft diameter , and graft length all are key variables influencing short - term and long - term patency . reversed , nonreversed , or in situ vein configurations all are effective , and the choice is dictated primarily by surgeon preference and anatomic circumstances.cost/cost-effectivenesssee
lower - extremity bypass grafting with or without femoral endarterectomy , with or without adjunctive inflow ( aortoiliac ) treatment . the preferred graft conduit for infrainguinal
prosthetic or other nonautogenous conduits should be considered significantly inferior secondary choices for infrainguinal bypass in the cli patient .
unacceptable surgical risk ( eg , multiple comorbidities , advanced age ) , advanced tissue loss on weight - bearing surface , nonambulatory status , no identifiable target vessel with runoff to ankle / foot .
relative contraindications : lack of adequate - quality autogenous vein conduit for infrageniculate bypass , poor - quality target vessel , extensive infection or necrosis compromising graft or vessel coverage . the inflow artery must have uncompromised hemodynamics , and arterial outflow should be continuous to the ankle and foot .
vein graft origin ( saphenous vein is superior to all other venous conduits for infrainguinal reconstruction ) , graft diameter , and graft length all are key variables influencing short - term and long - term patency . reversed , nonreversed , or in situ vein configurations all are effective , and the choice is dictated primarily by surgeon preference and anatomic circumstances .
although hyperbaric therapy commonly is used for nonhealing wounds , its efficacy has not yet been established in patients with cli .
it may be of limited utility in patients in whom revascularization is not technically feasible or for those who have failed all previous revascularization attempts.spinal cord stimulation has been proposed as an alternative to primary amputation in cli patients with ischemic rest pain who are not amenable to revascularization .
this technique requires the implantation of a subcutaneous pulse generator that stimulates electrodes at the l3-l4 level .
although this technique has not enjoyed widespread use , a recent meta - analysis did demonstrate significant pain reduction and an 11% reduced amputation rate compared with medical therapy alone .
the role for this therapy presently is unclear.intermittent pneumatic compression in patients with cli is another proposed therapy for augmenting distal arterial oxygen delivery in those who are not amenable to revascularization .
preliminary investigations have demonstrated increased muscular , collateral , and skin blood flow in patients receiving compression therapy .
n = 24 ) with those receiving optimal medical management ( n = 24 ) did demonstrate that compression therapy was associated with improved wound healing , limb salvage , and transcutaneous oximetry .
although hyperbaric therapy commonly is used for nonhealing wounds , its efficacy has not yet been established in patients with cli .
it may be of limited utility in patients in whom revascularization is not technically feasible or for those who have failed all previous revascularization attempts .
spinal cord stimulation has been proposed as an alternative to primary amputation in cli patients with ischemic rest pain who are not amenable to revascularization .
this technique requires the implantation of a subcutaneous pulse generator that stimulates electrodes at the l3-l4 level .
although this technique has not enjoyed widespread use , a recent meta - analysis did demonstrate significant pain reduction and an 11% reduced amputation rate compared with medical therapy alone .
intermittent pneumatic compression in patients with cli is another proposed therapy for augmenting distal arterial oxygen delivery in those who are not amenable to revascularization .
preliminary investigations have demonstrated increased muscular , collateral , and skin blood flow in patients receiving compression therapy .
furthermore , a small study comparing cli patients receiving compression therapy ( n = 24 ) with those receiving optimal medical management ( n = 24 ) did demonstrate that compression therapy was associated with improved wound healing , limb salvage , and transcutaneous oximetry .
new revascularization strategies for cli patients not amenable to either endovascular or surgical revascularization are being explored .
based on an increased mechanistic understanding of angiogenesis and arteriogenesis , novel therapeutic approaches including molecular , genetic , and cell - based treatments have entered the clinical trial phase .in the piii study , published in 2006 , 1404 cli patients undergoing bypass surgery were randomly assigned to receive edifoligide ( a dna molecule that inhibits cell cycle gene expression and was hypothesized to reduce neointimal hyperplasia ) or placebo .
the study treatment was found to confer no benefit or harm on either the primary study end point of time to index graft reintervention or major amputation or the secondary end points of all - cause graft failure , significant graft stenosis , amputation / reintervention - free survival , and nontechnical primary graft patency .several gene therapy rcts using hepatocyte growth factor , fibroblast growth factor , and vascular endothelial growth factor [ 5355 ] have been carried out in an attempt to activate the angiogenesis pathway .
, the authors demonstrated improvement in their primary study end point ( improvement in the angiographic indices 3 months after vascular endothelial growth factor gene transfer ) . in a phase 2 double - blind rct , intramuscular injection of hepatocyte growth factor plasmid in 104 cli patients demonstrated safety , and transcutaneous oxygen levels increased at 6 months in the high - dose group .
nikol et al . reported a european phase 1/2 rct examining a plasmid - based fibroblast growth factor gene delivery approach in 125 cli patients ; there was no significant difference in the primary end point ( ulcer healing ) , but amputation - free survival was improved .
larger rcts are required in the field , but significant challenges in study design , recruitment , and costs have slowed progress in this area.cell therapy is a regenerative medical approach for cli aimed at enhancing angiogenesis .
cell therapy trials to date have included relatively few patients compared with gene therapy trials .
autologous cells of various sources ( eg , peripheral blood , bone marrow , adipose tissue ) and cell type ( endothelial progenitors , mesenchymal stem cells , peripheral blood mononuclear cells ) have been used in phase 1/2 investigations in cli .
bone marrow mononuclear cells injected into the gastrocnemius and intra - arterial infusion of circulating blood - derived progenitor cells both have been associated with improvements in prespecified primary end points .
there are several ongoing studies in this area.drug-eluting balloons and stents have undergone limited evaluation in the lower - extremity circulation to date .
recent reports of superficial femoral artery angioplasty using a paclitaxel - coated balloon have shown encouraging results [ 5860 ] , and further trials are planned in the cli population .
no data are available yet on the utility of these technologies for cli.bioresorbable stents offer the potential to prevent recoil post angioplasty , improve remodeling , and eliminate the long - term inflammatory response to the implant .
an initial trial of a bioresorbable stent for infrapopliteal disease in cli patients failed to show any significant benefit .
new revascularization strategies for cli patients not amenable to either endovascular or surgical revascularization are being explored .
based on an increased mechanistic understanding of angiogenesis and arteriogenesis , novel therapeutic approaches including molecular , genetic , and cell - based treatments have entered the clinical trial phase . in the piii study , published in 2006 , 1404
cli patients undergoing bypass surgery were randomly assigned to receive edifoligide ( a dna molecule that inhibits cell cycle gene expression and was hypothesized to reduce neointimal hyperplasia ) or placebo .
the study treatment was found to confer no benefit or harm on either the primary study end point of time to index graft reintervention or major amputation or the secondary end points of all - cause graft failure , significant graft stenosis , amputation / reintervention - free survival , and nontechnical primary graft patency .
several gene therapy rcts using hepatocyte growth factor , fibroblast growth factor , and vascular endothelial growth factor [ 5355 ] have been carried out in an attempt to activate the angiogenesis pathway .
in one study , the authors demonstrated improvement in their primary study end point ( improvement in the angiographic indices 3 months after vascular endothelial growth factor gene transfer ) . in a phase 2 double - blind rct , intramuscular injection of hepatocyte growth factor plasmid in 104 cli patients demonstrated safety , and transcutaneous oxygen levels increased at 6 months in the high - dose group .
reported a european phase 1/2 rct examining a plasmid - based fibroblast growth factor gene delivery approach in 125 cli patients ; there was no significant difference in the primary end point ( ulcer healing ) , but amputation - free survival was improved .
larger rcts are required in the field , but significant challenges in study design , recruitment , and costs have slowed progress in this area .
cell therapy trials to date have included relatively few patients compared with gene therapy trials .
autologous cells of various sources ( eg , peripheral blood , bone marrow , adipose tissue ) and cell type ( endothelial progenitors , mesenchymal stem cells , peripheral blood mononuclear cells ) have been used in phase 1/2 investigations in cli .
bone marrow mononuclear cells injected into the gastrocnemius and intra - arterial infusion of circulating blood - derived progenitor cells both have been associated with improvements in prespecified primary end points .
drug - eluting balloons and stents have undergone limited evaluation in the lower - extremity circulation to date .
recent reports of superficial femoral artery angioplasty using a paclitaxel - coated balloon have shown encouraging results [ 5860 ] , and further trials are planned in the cli population .
bioresorbable stents offer the potential to prevent recoil post angioplasty , improve remodeling , and eliminate the long - term inflammatory response to the implant .
an initial trial of a bioresorbable stent for infrapopliteal disease in cli patients failed to show any significant benefit . | opinion statementcritical limb ischemia ( cli ) , defined as chronic ischemic rest pain , ulcers , or gangrene attributable to objectively proven arterial occlusive disease , is the most advanced form of peripheral arterial disease .
traditionally , open surgical bypass was the only effective treatment strategy for limb revascularization in this patient population .
however , during the past decade , the introduction and evolution of endovascular procedures have significantly increased treatment options . in a certain subset of patients for whom either surgical or endovascular revascularization may not be appropriate , primary amputation remains a third treatment option .
definitive high - level evidence on which to base treatment decisions , with an emphasis on clinical and cost effectiveness , is still lacking .
treatment decisions in cli are individualized , based on life expectancy , functional status , anatomy of the arterial occlusive disease , and surgical risk . for patients with aortoiliac disease
, endovascular therapy has become first - line therapy for all but the most severe patterns of occlusion , and aortofemoral bypass surgery is a highly effective and durable treatment for the latter group . for infrainguinal disease
, the available data suggest that surgical bypass with vein is the preferred therapy for cli patients likely to survive 2 years or more , and for those with long segment occlusions or severe infrapopliteal disease who have an acceptable surgical risk .
endovascular therapy may be preferred in patients with reduced life expectancy , those who lack usable vein for bypass or who are at elevated risk for operation , and those with less severe arterial occlusions .
patients with unreconstructable disease , extensive necrosis involving weight - bearing areas , nonambulatory status , or other severe comorbidities may be considered for primary amputation or palliative measures . | Introduction
Treatment
Diet and lifestyle
Pharmacologic treatment
Interventional procedures
Surgery
Other treatments
Emerging therapies |
the european union ( eu ) is committed to improving the health of its ageing population , with growing initiatives to promote active and healthy ageing ( supplementary figure s1 ) .
its preferred measure is healthy life years ( hly ) , the average remaining years spent free of activity limitation .
health expectancies , of which hly is one , were developed to assess whether increases in life expectancy ( le ) are due to improvements in medical technology , which keep the old and frail alive ( resulting in an expansion of morbidity ) , or because the onset and progression of disabling diseases are being postponed ( compression of morbidity ) .
as well as assessing the relationship between le and hly historically , the compression of morbidity concept can be used prospectively to set hly targets , e.g. the european innovation partnership on active and healthy ageing ( eipon - aha ) target , which seeks to increase hly at birth by 2 years during the next 10 years , averaging 2.4 months per year .
if achieved , disability would be compressed at the eu level , as projected le increases , at 1.9 years ( men ) and 1.5 years ( women ) ( supplementary table s1 ) , are less than the eipon - aha target of 2 years . although the eipon - aha target is generally supported , especially among those fearing that broader welfare may be sacrificed for economic growth , there are concerns that an eu - wide target ignores disparities between member states .
these are large in 2005 , the gaps in hly at age 50 years were a remarkable 14.5 years for men and 13.7 years for women , exceeding gaps in le at age 50 years ( men : 9.1 years ; women : 6.1 years ) .
eurostat projections assume a convergence hypothesis that envisages the le gap across the eu27 reducing between 2010 and 2020 , by 1.6 years for men and 1 year for women ( supplementary table s1 ) , though this is a stronger assumption than the 0.9 years ( men ) and 0.2 years ( women ) projected during the same period by the united nations .
nevertheless , though the eu , as a whole , is currently projected to reach the target , male le is projected to exceed 2 years for nine countries and female le for four countries ( supplementary table s1 ) .
we assess whether the eipon - aha target is attainable for the eu27 as a whole and what effect this will have on individual countries and the health gaps between them .
first , we examine how le and hly has changed during the past 5 years in the eu27 countries .
then we project the changes in hly forward from 201020 under various scenarios to investigate ( i ) the scope to achieve the target for the eu27 as a whole and in its constituent countries and ( ii ) the impact on disparities in hly between countries .
to document previous trends in le and hly , we obtained values of hly and le at birth from the eurohex website ( www.eurohex.eu ) , these being identical to values from eurostat .
hly are calculated by sullivan s method in which the age- and sex - specific prevalence of the health state is applied to a standard life table . for hly ,
the underlying health state question is the global activity limitation indicator ( gali ) , included in the eu statistics of income and living conditions survey ( see supplementary material for the exact form of the gali ) .
although some countries began data collection in 2004 , hly were only available for all 25 pre-2007 eu countries ( eu25 ) since 2005 .
overall hly trends are complicated because some countries made substantial changes to the gali question used to calculate hly , particularly between 2007 and 2008 .
consequently , to explore preliminary trends further , we concentrated on the six countries ( belgium , france , greece , ireland , slovenia and uk ) where the gali question was essentially unchanged between 2005 and 2009 , but also included romania , which had retained the same question since eu accession in 2007 .
values were also included for countries involved in the pilot phase in 2004 ( belgium , france , greece and ireland ) to provide longer time series . to assess trends , we estimated annual change in hly , le and the proportion of remaining life spent healthy ( hly / le ) and 95% confidence intervals from the country and sex - specific linear regression models . further details of methods , including sample size and non - response rates for the eu statistics of income and living conditions 2009 , are given in supplementary material .
we then estimated hly in 2010 in each country by multiplying eurostat projections of le in 2010 by the ratio hly / le obtained either from country- and sex - specific linear regression models of hly / le on year ( seven countries retaining same hly question ) or extrapolating the average of hly / le in 2008 and 2009 to 2010 ( 20 countries and eu27 ) . full details of methods are in the online supplementary material . projecting hly / le rather than hly ensured that hly could not exceed le . to assess the validity of these assumptions ,
we compared projected 2010 hly with preliminary true values for 20 countries and found close agreement . the mean difference ( men and women ) between the predicted and actual 2010 hly was 0.2 years , and 84% of the values were within 1.5 years , although the limits of agreement ( 3.4 to 3.7 years ) were somewhat wider .
hly values for eu27 were the average of hly values for the individual countries weighted according to population size .
reducing inequalities is a key concern for the eu ; therefore , the other three scenarios explored relevant implications , first alone ( scenario 2 ) , then in combination with the eipon - aha target for each country ( scenario 3 ) and finally in combination with the requirement that each country s gain in hly was at least at the level of le gains during the period , thus avoiding expansion of disability ( scenario 4 ) . in all three inequality scenarios , we considered two reductions : a 50% gap reduction between countries with the highest and lowest values for 10 years , equating to eliminating the hly gap in 20 years ( a ) , and a 30% reduction for the 10 years , thus eliminating the hly gap in around 33 years ( b ) .
in 2005 , male le in the eu25 was 75.9 years , and female le was 81.9 years ( supplementary figure s2 ) . between 200509 , le for the eu25 increased steadily , by just over 1 year or 3.0 months per year for men , and by 1.0 years or 2.4 months per year for women .
le increased least in denmark ( 0.6 years for women ) and ireland ( 0.1 years for men ) and most in cyprus ( 2.7 years for women ) and latvia ( 2.8 years for men ) .
differential gains in le narrowed the gap in le from 13.2 years in 2005 to 11.9 years in 2009 for men but a small increase for women from 7.3 years in 2005 to 7.6 years in 2009 . in 2005 ,
male hly at birth for the pre-2007 eu25 was 61.0 years , 80% of remaining life .
female hly was greater , at 62.3 years , though women could expect to live less of their remaining life healthy ( 76% ) .
similar levels of hly for men and women contrast with women s higher overall le and therefore co - occur with a greater number of years with disability [ unhealthy life years ( uhly ) ] ( supplementary figure s2 ) .
in contrast to the increase in le for men and women between 2005 and 2009 , hly showed little change : for men an increase of 0.3 years or 0.8 months per year and for women a decrease of 0.4 years or 1.0 months per year .
as the eipon - aha target equates to 2.4 months increase per year , it was not reached for the eu25 overall during the period 200509 . turning to the restricted set of countries with consistent wording of the gali question , even here , real increases in le at birth from 200409
were not universal ( supplementary table s2 ) . during this period , romania ( both sexes ) and ireland ( men ) had no significant increase in le , and romanian men had a significant decrease in hly .
significant increases in hly were observed in belgium ( both sexes ) , and for men in ireland , slovenia and the uk , all were equating to increases of at least 2 hly for 10 years . in slovenia , the hly increase was also accompanied by a significant increase in the proportion of remaining life spent healthy .
projections of hly at birth are presented in table 1 ( men ) and table 2 ( women ) . in 2010 ,
the gap between countries in male hly was estimated to be 17.5 years ( from slovakia 52.6 years to sweden 70.1 years ) and in female hly 18.9 years ( from slovakia 52.7 years to malta 71.5 years ) .
hly projections between 2010 and 2020 were explored under four main scenarios ( tables 1 and 2 ) .
scenario 1 assumed that recent annual changes in hly ( previously calculated ) would continue for the whole period .
eu27 hly at birth then increases by 1.4 years ( men ) and 0.5 years ( women ) , failing to reach the 2-year eipon - aha target , although it would be reached in nine countries for male hly but only one country ( belgium ) for female hly .
crucially , the hly gap between countries would increase further to 18.3 years ( men ) and 19.5 years ( women ) by 2020 .
table 1hly at birth in 2010 , current annual increase in hly and projected increase in hly between 2010 and 2020 under various scenarios for eu27 countries , malescountryprojected increase in hly at birth between 2010 and 2020hly 2010scenario1 : current trends prevailscenario 2 : reduction of hly gaps byscenario 3 : hly increase 2 years for country and reduction in hly gaps byscenario 4 : no increase in uhly for country and reduction in the hly gaps bya:50%b:30%a:50%b:30%a:50%b:30%slovakia52.61.88.85.310.87.310.26.7latvia52.92.28.65.210.67.210.06.6estonia54.52.17.84.79.86.79.26.1hungary55.52.17.34.49.36.48.75.8germany56.71.26.74.08.76.08.15.4lithuania56.72.56.74.08.76.08.15.4finland58.41.45.93.57.95.57.34.9poland58.72.15.73.47.75.47.14.8portugal58.81.45.73.47.75.47.14.8austria58.91.25.63.47.65.47.04.8romania59.52.25.33.27.35.26.74.6slovenia61.18.14.52.76.54.75.94.1czechrepublic61.31.74.42.66.44.65.84.0denmark61.91.34.12.56.14.55.53.9netherlands62.21.14.02.46.04.45.43.8bulgaria62.42.33.82.35.84.35.23.7france62.61.23.82.35.84.35.23.7italy62.91.23.62.25.64.25.03.6ireland63.41.93.42.05.44.04.83.4spain63.61.33.32.05.34.04.73.4cyprus64.61.32.71.64.73.64.13.0belgium64.78.02.71.64.73.64.13.0luxembourg64.91.32.61.64.63.64.03.0uk65.01.02.61.54.63.54.02.9greece66.12.22.01.24.03.23.42.6malta69.41.50.30.22.32.21.71.6sweden70.11.20.00.02.02.01.41.4eu2761.31.44.42.66.44.65.84.0a : hly2010 values based on 200809 values.b : hly2010 values based on 2004/200509 values .
table 2hly at birth in 2010 , current annual increase in hly and projected increase in hly between 2010 and 2020 under various scenarios for eu27 countries , femalescountryprojected increase in hly at birth between 2010 and 2020hly 2010scenario1 : current trends prevailscenario 2 : reduction of hly gaps byscenario 3 : hly increase 2 years for country and reduction in hly gaps byscenario 4 : no increase in uhly for country and reduction in the hly gaps bya:50%b:30%a:50%b:30%a:50%b:30%slovakia52.71.39.45.711.47.710.97.2latvia55.41.58.14.810.16.89.66.3portugal56.91.07.34.49.36.48.85.9germany57.81.06.94.18.96.18.45.6hungary58.31.66.64.08.66.08.15.5estonia58.51.36.53.98.55.98.05.4finland58.81.06.43.88.45.87.95.3austria60.01.05.83.57.85.57.35.0netherlands60.11.05.73.47.75.47.24.9denmark60.71.35.43.37.45.36.94.8lithuania61.01.55.33.27.35.26.84.7slovenia61.00.35.33.27.35.26.84.7romania61.15.25.23.17.25.16.74.6italy61.90.94.82.96.84.96.34.4france62.62.74.52.76.54.76.04.2poland62.81.44.42.66.44.65.94.1czechrepublic63.01.34.32.66.34.65.84.1spain63.00.84.32.66.34.65.84.1belgium64.39.13.62.25.64.25.13.7ireland64.81.73.42.05.44.04.93.5luxembourg65.01.23.32.05.34.04.83.5cyprus65.51.13.01.85.03.84.53.3unitedkingdom66.01.62.81.74.83.74.33.2bulgaria66.01.82.81.74.83.74.33.2greece66.70.52.41.54.43.53.93.0sweden69.31.21.10.73.12.72.62.2malta71.51.30.00.02.02.01.51.5eu2761.90.54.82.96.84.96.34.4a : hly2010 values based on 200809 values.b : hly2010 values based on 2004/200509 values .
hly at birth in 2010 , current annual increase in hly and projected increase in hly between 2010 and 2020 under various scenarios for eu27 countries , males a : hly2010 values based on 200809 values .
hly at birth in 2010 , current annual increase in hly and projected increase in hly between 2010 and 2020 under various scenarios for eu27 countries , females a : hly2010 values based on 200809 values .
b : hly2010 values based on 2004/200509 values . under scenario 2a , eliminating the hly gap in 20 years would result in gains for the next decade of 4.4 hly for eu27 men ( table 1 ) and 4.8 hly for eu27 women ( table 2 ) , more than double the eipon - aha target .
for slovakia , which currently has the lowest hly at birth for men and women , this means an increase of 9 hly ( male hly : 8.8 , female hly : 9.4 ) during the decade , substantially more than the increase of under 2 hly ( male hly : 1.8 , female hly : 1.3 ) expected if recent annual changes continue ( scenario 1 ) .
if the goal of eliminating the hly gap in a 20-year period was relaxed , then the eipon - aha target could be achieved by a 2123% reduction in the gap over the next 10 years , in women and men , respectively , with more realistic increases for slovakia ( male hly : 4.0 , female hly : 3.3 ; data not shown ) , although now the gap would only be closed in 45 years .
moreover , with this reduction , the eipon - aha target would be achieved by under half of the countries ( male : 13 countries , female : 5 countries ) .
scenario 3 therefore added the constraint that each country also had to achieve the eipon - aha target of an increase in 2 hly during the decade resulting in slovakia needing to achieve even greater increases of 11 hly ( male hly : 10.8 , female hly : 11.4 ) or more than one hly per year . for scenario 4 , in addition to closing the gap for the same periods as scenarios 2 and 3 , projected increases in le were included by requiring that the number of remaining years spent unhealthy ( le - hly ) did not increase .
in 2005 , male le in the eu25 was 75.9 years , and female le was 81.9 years ( supplementary figure s2 ) . between 200509 , le for the eu25 increased steadily , by just over 1 year or 3.0 months per year for men , and by 1.0 years or 2.4 months per year for women .
le increased least in denmark ( 0.6 years for women ) and ireland ( 0.1 years for men ) and most in cyprus ( 2.7 years for women ) and latvia ( 2.8 years for men ) .
differential gains in le narrowed the gap in le from 13.2 years in 2005 to 11.9 years in 2009 for men but a small increase for women from 7.3 years in 2005 to 7.6 years in 2009 . in 2005 ,
male hly at birth for the pre-2007 eu25 was 61.0 years , 80% of remaining life .
female hly was greater , at 62.3 years , though women could expect to live less of their remaining life healthy ( 76% ) .
similar levels of hly for men and women contrast with women s higher overall le and therefore co - occur with a greater number of years with disability [ unhealthy life years ( uhly ) ] ( supplementary figure s2 ) .
in contrast to the increase in le for men and women between 2005 and 2009 , hly showed little change : for men an increase of 0.3 years or 0.8 months per year and for women a decrease of 0.4 years or 1.0 months per year .
as the eipon - aha target equates to 2.4 months increase per year , it was not reached for the eu25 overall during the period 200509 . turning to the restricted set of countries with consistent wording of the gali question , even here , real increases in le at birth from 200409
were not universal ( supplementary table s2 ) . during this period , romania ( both sexes ) and ireland ( men ) had no significant increase in le , and romanian men had a significant decrease in hly .
significant increases in hly were observed in belgium ( both sexes ) , and for men in ireland , slovenia and the uk , all were equating to increases of at least 2 hly for 10 years . in slovenia , the hly increase was also accompanied by a significant increase in the proportion of remaining life spent healthy .
projections of hly at birth are presented in table 1 ( men ) and table 2 ( women ) . in 2010 ,
the gap between countries in male hly was estimated to be 17.5 years ( from slovakia 52.6 years to sweden 70.1 years ) and in female hly 18.9 years ( from slovakia 52.7 years to malta 71.5 years ) .
hly projections between 2010 and 2020 were explored under four main scenarios ( tables 1 and 2 ) .
scenario 1 assumed that recent annual changes in hly ( previously calculated ) would continue for the whole period . eu27
hly at birth then increases by 1.4 years ( men ) and 0.5 years ( women ) , failing to reach the 2-year eipon - aha target , although it would be reached in nine countries for male hly but only one country ( belgium ) for female hly .
crucially , the hly gap between countries would increase further to 18.3 years ( men ) and 19.5 years ( women ) by 2020 .
table 1hly at birth in 2010 , current annual increase in hly and projected increase in hly between 2010 and 2020 under various scenarios for eu27 countries , malescountryprojected increase in hly at birth between 2010 and 2020hly 2010scenario1 : current trends prevailscenario 2 : reduction of hly gaps byscenario 3 : hly increase 2 years for country and reduction in hly gaps byscenario 4 : no increase in uhly for country and reduction in the hly gaps bya:50%b:30%a:50%b:30%a:50%b:30%slovakia52.61.88.85.310.87.310.26.7latvia52.92.28.65.210.67.210.06.6estonia54.52.17.84.79.86.79.26.1hungary55.52.17.34.49.36.48.75.8germany56.71.26.74.08.76.08.15.4lithuania56.72.56.74.08.76.08.15.4finland58.41.45.93.57.95.57.34.9poland58.72.15.73.47.75.47.14.8portugal58.81.45.73.47.75.47.14.8austria58.91.25.63.47.65.47.04.8romania59.52.25.33.27.35.26.74.6slovenia61.18.14.52.76.54.75.94.1czechrepublic61.31.74.42.66.44.65.84.0denmark61.91.34.12.56.14.55.53.9netherlands62.21.14.02.46.04.45.43.8bulgaria62.42.33.82.35.84.35.23.7france62.61.23.82.35.84.35.23.7italy62.91.23.62.25.64.25.03.6ireland63.41.93.42.05.44.04.83.4spain63.61.33.32.05.34.04.73.4cyprus64.61.32.71.64.73.64.13.0belgium64.78.02.71.64.73.64.13.0luxembourg64.91.32.61.64.63.64.03.0uk65.01.02.61.54.63.54.02.9greece66.12.22.01.24.03.23.42.6malta69.41.50.30.22.32.21.71.6sweden70.11.20.00.02.02.01.41.4eu2761.31.44.42.66.44.65.84.0a : hly2010 values based on 200809 values.b : hly2010 values based on 2004/200509 values .
table 2hly at birth in 2010 , current annual increase in hly and projected increase in hly between 2010 and 2020 under various scenarios for eu27 countries , femalescountryprojected increase in hly at birth between 2010 and 2020hly 2010scenario1 : current trends prevailscenario 2 : reduction of hly gaps byscenario 3 : hly increase 2 years for country and reduction in hly gaps byscenario 4 : no increase in uhly for country and reduction in the hly gaps bya:50%b:30%a:50%b:30%a:50%b:30%slovakia52.71.39.45.711.47.710.97.2latvia55.41.58.14.810.16.89.66.3portugal56.91.07.34.49.36.48.85.9germany57.81.06.94.18.96.18.45.6hungary58.31.66.64.08.66.08.15.5estonia58.51.36.53.98.55.98.05.4finland58.81.06.43.88.45.87.95.3austria60.01.05.83.57.85.57.35.0netherlands60.11.05.73.47.75.47.24.9denmark60.71.35.43.37.45.36.94.8lithuania61.01.55.33.27.35.26.84.7slovenia61.00.35.33.27.35.26.84.7romania61.15.25.23.17.25.16.74.6italy61.90.94.82.96.84.96.34.4france62.62.74.52.76.54.76.04.2poland62.81.44.42.66.44.65.94.1czechrepublic63.01.34.32.66.34.65.84.1spain63.00.84.32.66.34.65.84.1belgium64.39.13.62.25.64.25.13.7ireland64.81.73.42.05.44.04.93.5luxembourg65.01.23.32.05.34.04.83.5cyprus65.51.13.01.85.03.84.53.3unitedkingdom66.01.62.81.74.83.74.33.2bulgaria66.01.82.81.74.83.74.33.2greece66.70.52.41.54.43.53.93.0sweden69.31.21.10.73.12.72.62.2malta71.51.30.00.02.02.01.51.5eu2761.90.54.82.96.84.96.34.4a : hly2010 values based on 200809 values.b : hly2010 values based on 2004/200509 values .
hly at birth in 2010 , current annual increase in hly and projected increase in hly between 2010 and 2020 under various scenarios for eu27 countries , males a : hly2010 values based on 200809 values .
hly at birth in 2010 , current annual increase in hly and projected increase in hly between 2010 and 2020 under various scenarios for eu27 countries , females a : hly2010 values based on 200809 values .
b : hly2010 values based on 2004/200509 values . under scenario 2a , eliminating the hly gap in 20 years would result in gains for the next decade of 4.4 hly for eu27 men ( table 1 ) and 4.8 hly for eu27 women ( table 2 ) , more than double the eipon - aha target . for slovakia , which currently has the lowest hly at birth for men and women ,
this means an increase of 9 hly ( male hly : 8.8 , female hly : 9.4 ) during the decade , substantially more than the increase of under 2 hly ( male hly : 1.8 , female hly : 1.3 ) expected if recent annual changes continue ( scenario 1 ) .
if the goal of eliminating the hly gap in a 20-year period was relaxed , then the eipon - aha target could be achieved by a 2123% reduction in the gap over the next 10 years , in women and men , respectively , with more realistic increases for slovakia ( male hly : 4.0 , female hly : 3.3 ; data not shown ) , although now the gap would only be closed in 45 years . moreover , with this reduction , the eipon - aha target would be achieved by under half of the countries ( male : 13 countries , female : 5 countries ) .
scenario 3 therefore added the constraint that each country also had to achieve the eipon - aha target of an increase in 2 hly during the decade resulting in slovakia needing to achieve even greater increases of 11 hly ( male hly : 10.8 , female hly : 11.4 ) or more than one hly per year . for scenario 4 , in addition to closing the gap for the same periods as scenarios 2 and 3 , projected increases in le
were included by requiring that the number of remaining years spent unhealthy ( le - hly ) did not increase .
we have previously reported large inequalities in health across the eu in 2005 when the hly indicator was first introduced .
we have examined trends between 2005 and 2009 both within countries and overall , and we are the first to show that , far from diminishing , inequalities have persisted . indeed ,
although le at birth for the eu increased by 1 year for men and women between 2005 and 2009 , hly increased by less than half a year for men and decreased by almost half a year for women . by applying projections of current trends in different scenarios
, we explored the extent to which individual countries and the eu27 as a whole might reach the eipon - aha target of increasing hly at birth by 2 years by 2020 .
we found that if recent trends continue , the eipon - aha target could be met by several countries , predominantly eastern european ones including estonia , latvia , lithuania and hungary , despite le in these countries being projected to increase more than in western european countries . on the other hand , france ( women ) and romania ( both sexes ) are unlikely to meet the target , as , extrapolating recent trends , they will lose rather than gain hly in the next decade .
overall , the eipon - aha target would not be reached by the eu27 as a whole , and more critically , hly inequalities would increase further .
as le at birth is expected to increase by 22.5 years every decade in low mortality countries , increasing hly at birth by 2 years is a minimum to avoid expansion of uhly at the european level .
nevertheless , this strategy will not automatically reduce the existing hly gaps between countries ; therefore , this
average target should be accompanied by a second one , focussed on reducing the hly disparities .
our other scenarios looked at the impact of reducing the gaps alone , alongside an increase of 2 hly for each country and finally together with no increase in uhly .
the large gains in hly , of between 0.5 and one hly per year during the decade , required by the baltic and eastern european countries for ultimate elimination of hly gaps in 20 or 30 years would only be reached by one country , i.e. slovenia . to obtain hly in 2010
, we assumed that the proportion of remaining life spent healthy in most countries would remain at the average of 2008 and 2009 values .
this is an obvious limitation but a standard approach , not unrealistic when compared with preliminary 2010 hly values for 20 countries .
when time series are available for these countries , we can replace this assumption by the empirical trends , as we have already done for the seven countries with available data .
a further limitation is that , for these seven countries , the time series were too short to adequately estimate anything other than a linear trend , but again longer time series will enable the linear trend assumption to be tested .
we concentrated on the effect of reducing the overall gap , which will depend strongly on outliers .
nevertheless , our findings appear relatively robust , as , at least with the scenario of continued current trends , the interquartile range for predicted hly in 2010 for men is 16.2 years , 1.3 years less than the overall gap , and would still increase , to 16.8 years , by 2020 . an inevitable limitation of analyses such as these is that they must predict the future on the basis of past knowledge ; although the future will be different , it is difficult to know in what way .
consequently , this article looks at the implications of achieving certain objectives while recognizing that there are many factors that can not be taken into account to determine whether they can be achieved .
though short - term effects on mortality have been shown ( increased suicides but reduced traffic deaths ) , it is much more difficult to identify long - term effects on morbidity or mortality .
one possibility that must be considered is whether the substantial gains in survival at older ages seen in recent decades , and thought to be driven largely by improvements in the management of chronic disorders , such as hypertension and its complications , particularly in older patients , will continue given policies of austerity reducing access to health care in some countries .
finally , particular caution must be exercised in relation to projections for two of the baltic states , latvia and lithuania , which experienced transient declines in le during the period 200407 , followed by rapid increases , causing difficulties when calculating our baseline scenario .
increasing hly by 2 years and reducing gaps will require action on many fronts as well as measures designed to address both the level and distribution of hlys .
there is growing recognition of the imperative to address socio - economic inequalities in health at both national and international levels , which include housing quality , access to health care , unemployment , work conditions as well as education , perhaps the most often cited determinant of health and one we have shown to account for some of the variation in hly across the eu25 .
socio - economic inequalities in health across the eu25 have been estimated to account for 20% of the total cost of health care and 15% of the total costs of social security benefits .
policies must also address factors that predominantly cut lives short prematurely , such as deaths from injuries and violence or smoking and those that leave people alive but disabled , such as poor diet , obesity and inadequate physical activity .
a particular priority will be to reduce exposure to risk factors in middle age , and especially smoking , coupled with policies that help people to remain confident and engaged with life , factors shown to correlate with successful ageing .
these considerations highlight the importance of comprehensive health improvement strategies , reaching from the underlying determinants of health to responses to established disease .
conditions such as cognitive impairment and cardiovascular disease impact on both disability and mortality , others ( arthritis and visual impairment ) affect disability only , whereas cancer predominantly affects mortality .
countries need to consider the balance between investment in life - saving medical interventions , rehabilitation for disabling conditions or prevention ( of both disabling and fatal conditions ) , as the former could result in increased le but with a likelihood of increased disability prevalence .
an important barrier to reducing the health gaps across the eu is the lack of evidence of what works in narrowing inequalities .
a recent systematic review found little evidence , apart from some , albeit not strong , in the areas of housing and work conditions .
population laboratory for international comparative research , which should be fully exploited alongside the more systematic diffusion of successful national interventions to other countries as recently highlighted by futurage .
the prime concern for both the lisbon strategy and its successor europe 2020 is to create sustainable economic growth in europe .
global target , like the eipon - aha target , moves attention from inter - country differences and , alongside the current economic crisis with its winners and losers , is likely to increase health inequalities .
the eu , in accordance with the goal of health 2020 of reducing health inequalities , should urgently invest in research to monitor , understand and close the unacceptable level of health inequalities across european countries .
the joint action ehleis is co - funded by the european commission , ( grant number dg sanco 20102301 ) , the french ministry of health and the french national solidarity fund for autonomy ( cnsa ) .
the funding source had no role in the study design ; in the collection , analysis and interpretation of data ; in the writing of the report ; or in the decision to submit the paper for publication , although eurostat is responsible for data collection .
key points
the eu is committed to active and healthy ageing , but its target for hly applies to the eu as a whole and assumes convergence across countries.on the basis of recent trends , the eu target will not be achieved , and inter - country disparities will widen further.achievement of the eu target will require action on many fronts but especially to reduce health inequalities.to be effective , policies must be based on evidence of what works , although that evidence is currently limited .
the eu is committed to active and healthy ageing , but its target for hly applies to the eu as a whole and assumes convergence across countries.on the basis of recent trends , the eu target will not be achieved , and inter - country disparities will widen further.achievement of the eu target will require action on many fronts but especially to reduce health inequalities.to be effective , policies must be based on evidence of what works , although that evidence is currently limited .
the eu is committed to active and healthy ageing , but its target for hly applies to the eu as a whole and assumes convergence across countries . on the basis of recent trends , the eu target will not be achieved , and inter - country disparities will widen further .
achievement of the eu target will require action on many fronts but especially to reduce health inequalities . to be effective ,
policies must be based on evidence of what works , although that evidence is currently limited . | background : the european innovation partnership on active and healthy ageing seeks an increase of two healthy life years ( hly ) at birth in the eu27 for the next 10 years .
we assess the feasibility of doing so between 2010 and 2020 and the differential impact among countries by applying different scenarios to current trends in hly .
methods : data comprised hly and life expectancy ( le ) at birth 200409 from eurostat .
we estimated hly in 2010 in each country by multiplying the eurostat projections of le in 2010 by the ratio hly / le obtained either from country and sex - specific linear regression models of hly / le on year ( seven countries retaining same hly question ) or extrapolating the average of hly / le in 2008 and 2009 to 2010 ( 20 countries and eu27 ) . the first scenario continued these trends with three other scenarios exploring different hly gap reductions between 2010 and 2020 .
results : the estimated gap in hly in 2010 was 17.5 years ( men ) and 18.9 years ( women ) . assuming current trends continue , eu27 hly increased by 1.4 years ( men ) and 0.9 years ( women ) , below the european innovation partnership on active and healthy ageing target , with the hly gap between countries increasing to 18.3 years ( men ) and 19.5 years ( women ) . to eliminate the hly gap in 20 years
, the eu27 must gain 4.4 hly ( men ) and 4.8 hly ( women ) in the next decade , which , for some countries , is substantially more than what the current trends suggest .
conclusion : global targets for hly move attention from inter - country differences and , alongside the current economic crisis , may contribute to increase health inequalities . | Introduction
Methods
Results
Past trends in LE and HLY 200509
Projections of HLY 201020
Discussion
Supplementary Data
Funding |
the tongue is an epithelial sac filled with muscles and connective tissue ; these muscles can be controlled willfully and are generally referred to as skeletal muscles or voluntary striated muscles , which are divided into intrinsic and extrinsic muscles ( brand and isselhard , 2003 ) .
in addition , the tongue has various functions : preservation of the position of the teeth and expression of feelings , speech , swallowing , and mastication .
however , there has been relatively few neuroimaging and neurophysiological studies focusing on the functions of the tongue .
there are several problems with studying somatosensory ( tactile ) processing of the tongue in humans .
the first problem is the choice of a stimulator that can stimulate the tongue while the subject is under a scanning coil or electrodes without causing noise or technical problems .
the second problem is that it is extremely difficult to fix the stimulator on the tongue stably , since the tongue itself is made of soft tissue and is convex in shape .
the third problem is that tactile stimulation in this area frequently triggers the vomiting reflex .
taking these problems into consideration , ingenuity is required to record the brain activity associated with somatosensory processing of the tongue , and some researchers have developed devices , which are introduced in later sections , to solve these problems .
recently , several non - invasive recording methods have been used to measure human brain activity . among these
are methods based on neurophysiology , including electroencephalography ( eeg ) , magnetoencephalography ( meg ) , and methods based on neuroimaging , including functional magnetic resonance imaging ( fmri ) and positron emission tomography ( pet ) .
eeg is indispensable for examining the neural activities in the human brain and offers a high temporal resolution on the order of milliseconds .
eeg technology captures fluctuations in the electrical voltage of the brain through electrodes placed on the scalp in accordance with the standardized guidelines of the international 10 - 20 system ( jasper , 1958 ) .
eeg data also represent changes in the potential differences between different points on the human scalp and the electric field potentials that arise from excitatory and inhibitory postsynaptic potentials .
meg offers several theoretical advantages over eeg in localizing cortical sources ( brain dipoles ) because the magnetic fields recorded on the scalp are less affected by volume currents and anatomical homogeneity .
meg also permits the spatial and temporal localization of excited cortical areas on the order of millimeters and milliseconds ( reviewed in hari et al . , 2000 ;
fmri , which measures the blood oxygenation level - dependent ( bold ) signal , has been used not only as a tool for mapping brain activity but also as a means of studying the dynamics of neural networks by tracking fmri response characteristics across various spatial and temporal scales ( logothetis et al . , 2001 ) .
pet has been used to measure regional cerebral blood flow ( rcbf ) with the intravenous radioactively labeled water ( h2 o ) bolus technique ( decety et al . ,
these recording methods have been used to clarify somatosensory processing of the tongue in humans . in this review article , we examine recent non - invasive research showing the brain activity for somatosensory processing related to the tongue . to our knowledge ,
no systematic review of the scientific literature on somatosensory processing of the tongue is available despite much research .
we argue that combining and reviewing non - invasive research will provide new insights because neurophysiological and neuroimaging methods have limitations when it comes to brain activity .
we focus on three broad areas ; primary somatosensory cortex ( si ) , secondary somatosensory cortex ( sii ) , and neuroimaging data .
neurophysiological studies using eeg and meg have helped to clarify the temporal dynamics of the tongue si ( ishiko et al . , 1980 ; altenmller et al . , 1990 ; karhu et al . , 1991 ; nakamura et al . ,
the evaluation of time - locked eeg and meg following somatosensory stimulation ( i.e. , somatosensory - evoked potentials , seps ; somatosensory - evoked magnetic fields , sefs ) constitutes one of the most useful methods for investigating the human somatosensory system .
these studies showed si activity in the postcentral gyrus , which is consistent with the homunculus reported by penfield and boldrey ( 1937 ) .
one major problem with seps and sefs is that the peak latency of the primary response has not been consistent .
for instance , there is general agreement that si responds after about 20 ms to electrical stimulation of the median nerve or finger ( hari et al . , 1993 ; mauguire et al . , 1997 ;
however , the response time to stimulation of the tongue ranges widely from 10 to 55 ms ( table 1 ) .
in addition , some studies reported activity in si contralateral to the stimulation ( nakamura et al . , 1998 ; maloney et al .
2004 ) , whereas others found activity in both sis ( ishiko et al . , 1980 ; altenmller et al .
, 1990 ; karhu et al . , 1991 ; disbrow et al . , 2003 ; maezawa et al . , 2008 ; sakamoto et al . , 2008a ; tamura et al . , 2008 ) .
the peak latency of the primary response after tongue stimulation in previous studies ( eeg and meg ) .
contr , contralateral hemisphere to the stimulation ; ipsil , ipsilateral hemisphere to the stimulation .
as mentioned in the introduction , there might be several reasons why consistent results have not been recorded for tongue somatosensory stimulation .
( 1980 ) , who were the first to investigate seps elicited by stimulating the tongue , applied mechanical stimulation to the right anterior region of the tongue as it protruded slightly from the mouth .
the striking surface of the probe was square and flat with an area of 1 mm .
its striking strength , in terms of tension developed while tapping the tongue , was found to be 10 g. altenmller et al .
( 1990 ) used a modified eeg ear clip electrode ( 5 mm in diameter ) located on either side of the tip of the tongue with the cathode on the upper and the anode on the lower side and vice versa . to avoid synchronous electrical stimulation of the oral mucosa and the lips ,
( 1991 ) used a hand - made clip electrode consisting of two ag plates ( diameter = 5 mm ) , and delivered current to the anterior left side of the tongue .
the outside of the electrode was insulated to avoid synchronous stimulation of the oral mucosa .
the tongue was held relaxed inside the mouth which was slightly opened to allow leads to come out between the upper and lower teeth .
nakamura et al . ( 1998 ) used an air - puff - derived tactile stimulator , which provides a light , superficial pressure stimulus to the skin .
the area of contact by the circular rubber bladder was 1 cm in diameter , and the intensity of the mechanical stimulation was 40 g / cm .
maloney et al . ( 2000 ) used pairs of thin , stainless steel disk electrodes on modified mandibular or maxillary acrylic splints , similar to orthodontic retainers .
the mandibular splint electrodes were oriented to make contact with the under surface of the tongue along the course of the right and left lingual nerves and the maxillary splint electrodes were oriented to make contact with the hard palate bilaterally along the course of the palatine nerves . in the meg study of disbrow et al .
( 2003 ) , stimuli consisting of pneumatically driven mechanical taps were applied to the tongue with a balloon diaphragm 1 cm in diameter .
the diaphragm was placed as far from the midline as possible , near the edge of the tongue .
( 2004 ) used a clip electrode with a 5-mm interelectrode distance , which was attached to the tongue mucosa 510 mm from the lingual edge .
three points on the dorsum of the tongue were stimulated in the following order : ( 1 ) the right side ( 2 cm from the tip of the tongue , 1 cm from the edge ) , ( 2 ) the left side ( symmetric to the right side ) , and ( 3 ) the midline ( 1 cm from the tip of the tongue ) . before recordings were made , the three points were marked with crystal violet .
a pair of epoxy resin - coated platinum pin electrodes ( 0.4 mm in diameter ) was used for stimulation . in the meg study of tamura et al .
( 2008 ) , the device used for stimulation was modified from braille cells for the visually impaired .
it consisted of a piezoelectric element and stimulus pins pushed out ( 0.7 mm/0.4 ms ) by application of a direct current to the piezoelectric element to produce tactile stimulation of the area targeted .
eight stimulus pins were aligned , with a gap of 2.4 mm between each .
more recently , we fabricated an intraoral device for each individual using hydrophilic vinyl silicone impression material ( exafast / putty type , gc , japan ) , and recorded sefs ( sakamoto et al . , 2008a ) ( figure 1a ) .
the subject bit bilaterally into the exafast , which was mixed uniformly and formed into two blocks .
the jaws of the subjects were positioned based on centric occlusion and opened about 8 mm between the upper and lower teeth to make a small space that was important to build the electrode for stimulating the tongue .
these blocks were used to create a space from the right to left central incisor teeth to allow relaxation of the tongue , and to keep the jaw in a mandibular rest position .
then , we made four holes , which passed from the buccal to lingual side of the device , positioned on the lingual cusp of the canine teeth and the distal - lingual cusp of the second molar teeth of the mandible bilaterally .
next , we made a concentric bipolar electrode , which could be set in each hole ( figure 1b ) .
this electrode has a cathode consisting of a silver wire ( 1.0 mm in diameter ) and a cylindrical anode consisting of stainless steel ( 3.5 mm in diameter and a gap between the anode and cathode of about 0.9 mm ) . to extend the line ,
the silver wire ( 0.2 mm in diameter ) was fixed with tin solder to the cathode and anode .
this electrode was easily attached and detached , but very stable during the experiments ( figure 1b ) .
sefs were recorded by using these devices , and compared following stimulation of the right and left postero - lateral parts of the tongue , and right and left antero - lateral parts .
six components , termed 1 m , 2 m , 3 m , 4 m , 5 m , and 6 m , respectively , were found within 130 ms of the stimulation ( figure 2 ) .
these activities were detected in hemispheres both contralateral and ipsilateral to the stimulation , and estimated to be located around the tongue si ( figure 3 ) .
the latency of the contralateral hemisphere was significantly shorter than that of the ipsilateral hemisphere for all components , independent of the area stimulated .
there was no significant difference of coordinates in the somatotopic representation between antero - lateral and postero - lateral parts of the tongue .
some anatomical studies reported that the somatotopic representation in the tongue si differed between anterior and posterior parts ( manger et al .
this discrepancy between anatomical studies and our finding should be related to the limitation of spatial resolution in meg .
the electrode 's position was determined on the right and left antero - lateral margins and the postero - lateral margins of the tongue around foliate papillae by using the device .
( b ) the surface structure of the concentrated bipolar electrode used to stimulate the tongue . adopted from sakamoto et al .
grand averaged meg signals for the right anterior ( ra ) stimulation of the tongue .
( a ) the sef waveforms over 204 planar coils from the top of the head .
( b ) an enlarged waveform recorded in the left centrotemporal areas , which was framed by a square in ( a ) .
these ecds were estimated to lie around the posterior wall of the central sulcus , corresponding to the tongue si .
red , yellow , green , blue , white , and orange circles indicate the ecds of 1 m , 2 m , 3 m , 4 m , 5 m , and 6 m , respectively .
taking previous studies of seps and sefs into consideration , the peak latency of the primary response would be obtained within 20 ms after stimulating the tongue , and in some reports , true primary cortical response might be missing , because of the difference of stimulating device .
in addition , the orientation of equivalent current dipole ( ecd ) , which was estimated in meg studies , is also listed in table 1 , and some studies showed the inferior - posterior direction ( karhu et al . , 1991 ; nakamura et al . , 1998 ; nakahara et al .
all these studies indicated the primary response at more than 20 ms . on the other hand , tamura et al .
( 2008a ) showed the primary response within 20 ms , and the superior - anterior or inferior - anterior directions ( sakamoto et al .
after stimulating median nerve , the primary response was recorded at about 20 ms , and the ecd demonstrated anterior direction ( karhu et al . , 1991 ; wasaka et al . , 2003 ; huttunen et al . ,
several previous studies also have provided evidence that the primary response obtained within 20 ms indicated anterior direction after stimulating face and oral regions , such as buccal ( tamura et al . , 2008 ) , lip ( tamura et al . , 2008 ) , and hard palatine ( bessho et al . , 2007 ) .
therefore , we inferred that the true primary response , which was recorded within 20 ms after stimulation of the tongue , should show the anterior direction in ecd , and the second and sequential responses show the posterior direction . as a characteristic of somatosensory processing of the tongue , neural activation was found in contralateral and ipsilateral hemispheres to the stimulation .
for example , meg studies showed that the difference of the latency between the contralateral and ipsilateral hemisphere was about 1 ms for p40 m in maezawa et al .
( 2008 ) , 1 ms for 1 m ( 14 ms ) in tamura et al .
( 2008 ) , 1 ms for 1 m ( 19 ms ) component in sakamoto et al .
( 2003 ) reported that the second peak at 30 ms was the largest and most consistent response in the ipsilateral hemisphere and was used for additional analysis .
the 10- and 55-ms peaks were reduced or absent in the ipsilateral responses , and there were no significant differences for contralateral vs. ipsilateral latency of activation ( range of means = 31.739.5 ms ) .
on the other hand , in previous meg studies using median nerve stimulation , the cortical response from si was rarely recorded , and the characteristic of somatosensory processing of the hand differed from that of the tongue .
( 1995 ) reported dipolar field distributions over the ipsilateral si in 5 of the 10 subjects after median nerve stimulation , and three subjects showed the response at 140150 ms after stimulation , one at 80100 ms , and one at 290300 ms . in the somatosensory processing of the tongue , we considered that ipsilateral projection from contralateral hemisphere was irrelevant to the corpus callosum , and there was ipsilateral direct projection via an uncrossed ascending pathway from the trigemino - thalamic tract to si .
secondary somatosensory cortex is located in the parietal operculum in the upper bank of the sylvian fissure .
its existence has been known since early cortical stimulation studies during epileptic surgery ( schnitzler and ploner , 2000 ) .
in addition to the tongue si , the neural activities and the somatotopic representation of the tongue sii should be clarified . compared with si , sii has been speculated to serve a higher level of cognitive function in somatosensory processing , such as attention , decision - making , object recognition , and the integration of nociceptive and non - nociceptive inputs ( mima et al . , 1998 ; steinmetz et al . , 2000 ;
inui et al . , 2004 ; nakata et al . , 2004 ; wasaka et al . ,
the notion that sii is higher than si in hierarchy was proposed on the basis of their anatomical relationships : si sends projections to sii , while sii projects back to the superficial layers of si ( see a review , iwamura , 1998 ) .
studies in monkeys also showed that a unilateral lesion of sii impaired tasks of tactile learning and retention ( ridley and ettlinger , 1976 , 1978 ; garcha and ettlinger , 1978 ) , and patients with lesions of sii had tactile agnosia ( caselli , 1993 ) .
thus , investigating the neuronal activities of the tongue sii is important to understand the characteristics of somatosensory processing of the tongue , based on several aspects such as source location , source orientation , functional features and comparison with other somatic sii responses ( schnitzler et al . , 1999 ) . to our knowledge
( 2003 ) showed the responses of the tongue sii after stimulating the edge of the tongue .
they also recorded the lip sii , but did not compare the latency , location , and strength of brain responses directly and statistically between them . in our study , we used individual intraoral devices and a concentric bipolar electrode , and recorded sefs after stimulating four body sites , the left antero ( la ) and postero ( lp ) lateral margins of the tongue , left median nerve at the wrist ( hand ) , and left tibial nerve at the ankle ( foot ) ( sakamoto et al . , 2008b ) .
neural activities were recorded from bilateral sii in both hemispheres after the four sites were stimulated .
the activity of the tongue sii was recorded 80110 ms after the stimulation ( figure 4 ) .
the tongue sii for la and lp was located close to the hand sii and significantly more anterior than the foot sii , and there was no significant difference in the location of dipoles between the la and lp areas of the tongue sii ( figure 5 ) .
the tongue sii was located very close to the hand sii , and significantly apart from the foot sii , showing a more anterior location than the foot sii ( figure 6 ) .
these findings concerning the locations of ecds for sii imply the existence of an antero - posterior and infero - superior arrangement of the body surface in sii , which was consistent with some previous studies using meg ( maeda et al . , 1999 ; nguyen et al . , 2005 ) , fmri ( del gratta et al . , 2000 , 2002 ; disbrow et al . , 2000 ; ruben et al . , 2001 ) , and monkeys ( burton and carlson , 1986 ; krubitzer et al . , 1986 ; cusick et al . ,
a rough somatotopic representation exists within sii regions , that is , the face , upper limb , and lower limb are located from the lateral to medial region in this order .
the mean peak latencies of the tongue sii for la and lp were significantly shorter in the hemisphere contralateral to the stimulation than the ipsilateral hemisphere .
these findings indicated that the tongue areas occupied a small region in sii with insufficient spatial separation to differentiate anterior from posterior areas even using meg which has a higher spatial resolution than eeg .
meg signals for the left anterior ( la ) stimulation of the tongue in a representative subject .
the upper figure shows the sef waveforms over 204 planar coils from the top of the head .
lower - left figures indicate enlarged waveforms recorded in three areas , a , b , and c. lower - right figures show each magnetic field pattern at 43.8 , 106.7 , and 115.5 ms , respectively .
the patterns are shown on the sensor array viewed from right ( si and csii ) and left ( isii ) .
comparison between a ( si ) and b ( csii ) revealed clearly different field distributions and that the ecd of a ( si ) was directed posteriorly , while the ecds of b ( csii ) were directed superiorly .
l , left ; r , right ; a , anterior ; p , posterior ; si , primary somatosensory cortex ; csii , secondary somatosensory cortex contralateral to the stimulation ; isii , secondary somatosensory cortex ipsilateral to the stimulation .
( a ) ecd locations for la , lp , hand and foot superimposed on 2d mr images in two representative subjects . source locations of subject 1 are superimposed on the coronal plane and those of subject 2 , on the axial plane .
the ecds for bilateral sii responses were located in the upper bank of the sylvian fissure in the left and right hemispheres .
( b ) schematic drawing of spatial relationships of the ecds for sii among each stimulation point .
la and lp are located most lateral , anterior and inferior , while the ecd for foot is located most medial , posterior , and superior .
each part of the tongue is stimulated with a protrusion by a protruded movement of the tongue .
la , left antero - lateral stimulation ; lp , left postero - lateral stimulation ; ra , right antero - lateral stimulation ; rp , right postero - lateral stimulation .
recently , several neuroimaging studies using fmri and pet have reported human brain activities evoked by somatosensory stimulation of the tongue , to clarify its somatotopic representation ( sakai et al . , 1995 ; pardo et al . , 1997 ; miyamoto et al
2009 ) . as compared with research on somatosensory processing of the hand and foot ,
a typical electrical stimulation can not be performed during fmri recordings , when the tongue area is stimulated , because a magnetic body must not be put into the mr gantry .
thus , some ingenuity is needed to stimulate the tongue . in an fmri study , sakai et al .
( 1995 ) stimulated the tip of the tongue from the medial side to the right side ( 2-cm long ) using a cotton swab ( stick diameter , 2 mm ) with a 30-g bending force and 10-g / mm bending pressure , and compared the cortical activation with toes and fingertips .
they showed the cortical activation , which was located on the contralateral postcentral gyrus , and organized medially - to - laterally in the order of toes , fingertips , and tongue tip .
( 1997 ) stimulated the right or left side of the protruding tongue at a rate of 1 hz with a wooden stick , and rcbf was measured using pet .
stimulation of the right side of the tongue produced a contralateral response in si , while left side stimulation activated bilateral si .
miyamoto et al . ( 2006 ) , who used fmri , made a long stick with a grooved rubber at its tip .
the stick used for stimulation was fixed on a table that was set on both edges of the scanner bed to avoid it touching the subject 's body .
the stick was allowed to rotate around its long axis to minimize the possibility of touching the surrounding structures .
the oscillating movement of the stick provided oscillating strokes of ~5 mm at the contact zone .
the anterior part of the tongue , 1 cm to the right of the midline , was stimulated .
stimulation was provided by the same well - trained experimenter to minimize the variability of stimuli across the subjects .
they identified the somatotopic representation of the lips , teeth and tongue in si , and examined the rostro - caudal changes in the somatotopic organization in si in terms of the overlap between each sensory representation . in the rostral portion of the postcentral gyrus ,
the representation of teeth was located significantly superior to that of the tongue and inferior to that of the lip , consistent with the classical sensory homunculus
proposed by penfield , while this somatotopic representation became unclear in the middle and caudal portions of postcentral gyrus .
the overlap between each representation in the middle and caudal portions of the postcentral gyrus was significantly greater than that in the rostral portion of the postcentral gyrus .
( 2009 ) also used fmri , and delivered somatosensory stimulation to either side of the tongue at a constant frequency of 2 hz with acrylic balls ( diameter : 8 mm ) attached to the ends of two plastic sticks ( inner cylinders ) that were incorporated in two plastic tubes ( outer cylinders ) stabilized at the occlusal surface of the bilateral posterior regions of the splint .
the proximal end of the 100-cm extension was attached to the inner cylinders of the mandibular splint , while the distal end was equipped with a stopper at 15 mm , which allowed constant displacement of the acrylic balls against the posterior edge of the tongue on each side . with this set - up
, a well - trained experimenter could stimulate a specific targeted region without touching surrounding structures .
they investigated whether the pattern of hemispheric cortical activation by tactile tongue stimulation differed , with special attention to the preferred chewing side .
as the results , the number of activated voxels in s1 contralateral to the preferred chewing side was significantly greater than that in s1 contralateral to the non - preferred chewing side . in our mri study , we compared the brain activities following stimulation of the postero - lateral part of the tongue with those following stimulation of the antero - lateral part ( sakamoto et al . , 2010 ) .
to stimulate different areas of the tongue , we fabricated an intraoral device , which was the same as used in meg studies ( sakamoto et al .
in addition , the jaws of the subject were positioned based on centric occlusion and opened about 5 mm between the upper and lower teeth to make a small space that was important to build the projection for stimulating the tongue .
these blocks were used to create a wide space from the right to left canine teeth to allow comfortable frontal movement of the tongue .
then , we made four grooves on the lingual side of this device , which were positioned on the lingual cusp of the first premolar of the lower jaw and the distal - lingual cusp of the second molar of the lower jaw bilaterally .
the projection has an elliptical shape and is 3 mm in diameter and 3 mm in height .
this projection is easily attached and detached , but very stable during experiments . as a control task
, the subjects were required to perform the tongue - protruding movement while no projection was set on the device . in the other four tasks ,
the projection was set at four positions to stimulate specific areas of the tongue : the left antero - lateral , left postero - lateral , right antero - lateral , and right postero - lateral areas ( figure 6 ) . in each task , only one projection was set for the target area . after each session
, this projection was replaced with another groove ; which was attached and detached by the operator out of the mr gantry . to investigate only the somatosensory - related activation by removing the motor - related activation and somatosensory - related activation for the device and/or intraoral structures ,
we analyzed subtraction images obtained from the contrasts as follows : the task in which the projection was on the left antero - lateral of the tongue ( left antero - lateral ) minus non - projection task ( control ) ( la ) , left postero - lateral minus control ( lp ) , right antero - lateral minus control ( ra ) , and right postero - lateral minus control ( rp ) .
stimulation of the left and right postero - lateral parts of the tongue induced significant activity in the si and brodmann area 40 ( ba 40 ) in the right hemisphere and the anterior cingulate cortex ( acc ) ( figure 7 ) . in contrast ,
the activated region in si was significantly larger following stimulation of the posterior than anterior part .
these results indicate that a clear difference exists in somatosensory processing between stimulation of the antero - lateral and postero - lateral parts of the tongue , and the right hemisphere is dominant for the stimulation of both antero - lateral and postero - lateral areas . as anatomical data in humans , the anterior two - thirds of the tongue
are innervated by the afferent fibers that travel in a branch of the trigeminal nerve ( v ) called the lingual nerve .
the posterior one - third of the tongue is innervated by the afferent fibers that travel in the lingual branch of the glossopharyngeal nerve ( ix ) ( kandel et al .
therefore , the antero - lateral part of the tongue should be innervated by the trigeminal nerve , but the postero - lateral part may be innervated by both the trigeminal and glossopharyngeal nerves , which may underlie the clear differences in brain activities , although the border of the innervation zone and pattern between the trigeminal nerve and the glossopharyngeal nerve is vague and unclear anatomically .
fitzgerald and law ( 1958 ) reported a connection between the lingual nerve and hypoglossal nerve in the tongue . in their study , the peripheral parts of the lingual and hypoglossal nerves were dissected in forty human specimens obtained from 25 adult subjects .
we speculate that the same connection is formed between the lingual nerve and glossopharyngeal nerve .
doty et al . ( 2009 ) also suggested that branches of the glossopharyngeal nerve extend anteriorly beyond the sulcus terminalis and circumvallate papillae , with extensions occurring along the lateral lingual margin anterior to the foliate papillae .
in addition , anastomoses were identified between the glossopharyngeal nerve and the lingual nerve , raising the possibility of functional interactions between the trigeminal nerve and the glossopharyngeal nerve .
this notion was supported by a recent anatomical study ( zur et al . , 2004 ) . based on these findings
, we inferred that the activated region in si was larger following stimulation of the posterior than anterior part .
the figures around si areas were enlarged for all conditions . using the statistical parametric mapping 2 ( spm2 , wellcome department of cognitive neurology , london , uk ) template ,
areas showing an increase in bold - signal are superimposed on a 3d - rendered standard brain .
although our statistical threshold was p < 0.001 ( uncorrected ) , the threshold was lowered to p < 0.05 ( uncorrected ) for this figure for display purposes .
neural activation in the anterior cingulate cortex ( acc ) overlaid on an anatomically normalized mri . only lp and rp stimulation produced these activities .
the threshold is p < 0.001 ( uncorrected ) in lp and p < 0.005 ( uncorrected ) , respectively .
in addition to si , ba 40 immediately lateral to si was activated during the postero - lateral stimulation .
we assumed that the activation of ba 40 included neuronal activation associated with visceral sensation following the stimulation of the posterior tongue .
previous studies demonstrated that the cortical representation of visceral organs differs from that of the somatosensory system , using fmri ( aziz et al . , 2000 ;
; eickhoff et al . , 2006 ; ladabaum et al . , 2007 ) , and meg ( schnitzler et al . , 1999 ) .
for instance , hobday et al . ( 2001 ) observed activation in the inferior part of si and ba 40 following visceral rectal stimulation , but only in si following somatic anal stimulation .
( 2007 ) , who recorded brain activity following gastric distension , found no evidence of activation of s1 , but found activation in a broad region of ba 40 .
taking these studies into consideration , it is likely that ba 40 was activated following visceral stimulation , but more studies will be necessary to determine the relationship between the neural activity of ba 40 and visceral sensation and to clarify the characteristics of this area with respect to tongue stimulation . in general , the acc plays an important role in sensory , motor , cognitive , and emotional information ( bush et al . , 2000 ) and pain processing ( schnitzler and ploner , 2000 ; vogt , 2005 ; qiu et al . , 2006 ) .
our results demonstrated that the acc was activated only during the postero - lateral stimulation .
2001 ) noted that the acc was activated by visceral stimulation , not by somatic stimulation , and it appears that their results are consistent with our findings .
thus , we considered that our acc activation reflected the attributions of the viscera , because the viscera have a complex peripheral nervous system that allows for a wide variety of autonomic functions ( ness and gebhart , 1990 ) .
our fmri results showed a cortical representation in the right hemisphere , but not left hemisphere .
by contrast , in our meg studies ( sakamoto et al . , 2008a , b ) and neuroimaging studies ( pardo et al . , 1997 ; minato et al . ,
there are three possible explanations for the discrepancy between our neuroimaging findings and some previous studies including our own meg studies .
that is , as several neuroimaging studies already showed ( perlmutter et al . , 1987 ; fox and applegate , 1988 ; naito et al . , 2005 ;
) , the brain 's response should be stronger in the right hemisphere than the left for somatosensory processing .
indeed , our method of stimulation may be unable to elicit clear activation in the left hemisphere , compared to general electrical stimulation .
if so , it might be difficult to detect the response in the left hemisphere .
some neuroimaging studies have also provided evidence that activation of the sensorimotor cortex representing the oral and facial regions during volitional swallowing and mastication showed left hemispheric preference ( martin et al .
, 2004 , 2007 ; shinagawa et al . , 2004 ) . from these studies , there is a possibility that active movement of the tongue affects si activity in the left hemisphere .
indeed , many studies have investigated somatosensory - motor integration by recording seps during voluntary movement .
characteristically , the amplitudes of short - latency components are attenuated , while those of long - latency are enhanced ( giblin , 1964 ; kakigi , 1986 ; hoshiyama and sheean , 1998 ; rossini et al . , 1999 ; valeriani et al . , 2001 ; nakata et al . , 2003 )
this gating effect has been also researched by recording sefs , and similar results were found regarding the cortical responses .
that is , the early responses generated from si were attenuated during voluntary movement , whereas the late responses in sii were strengthened ( rossini et al .
, 1995 , 1997 ; huttunen et al . , 1996 ; forss and jousmki , 1998 ; lin et al . , 2000
such modulation also occurred in an fmri study ( hinkley et al . , 2007 ) .
the present study showed the human brain 's response after stimulation of the tongue . because of technical difficulty in stimulating the tongue ,
researchers have had to make special devices to clarify the neural mechanisms for somatosensory processing . in the somatotopic representation of si ,
the face and oral regions as well as the hand area occupied larger regions ( penfield and boldrey , 1937 ) , indicating an important role in the human somatosensory system .
first , extant studies have focused mainly on the earliest component of seps / sefs , generated from area 3b in si .
they did not analyze other components , which were recorded on stimulation of the hand , such as the p25 , n35 , p45 , n60 , and frontal n30 ( nakata et al .
second , the characteristics of the tongue sii should be clarified because few studies have investigated the neural mechanisms involved ( see responses from secondary somatosensory cortex ) .
we believe that our findings provide valuable information on the neural mechanisms relating to the oral and maxillofacial regions .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | we review research on somatosensory ( tactile ) processing of the tongue based on data obtained using non - invasive neurophysiological and neuroimaging methods . technical difficulties in stimulating the tongue , due to the noise elicited by the stimulator ,
the fixation of the stimulator , and the vomiting reflex , have necessitated the development of specialized devices . in this article , we show the brain activity relating to somatosensory processing of the tongue evoked by such devices .
more recently , the postero - lateral part of the tongue has been stimulated , and the brain response compared with that on stimulation of the antero - lateral part of the tongue .
it is likely that a difference existed in somatosensory processing of the tongue , particularly around primary somatosensory cortex , brodmann area 40 , and the anterior cingulate cortex . | Introduction
Responses from Primary Somatosensory Cortex
Responses from Secondary Somatosensory Cortex
Neuroimaging Studies
Conclusion
Conflict of Interest Statement |
the differential diagnosis of mediastinal masses includes primary lung cancer , metastatic cancer , neurogenic tumor , cysts and infections.12 the bronchogenic cysts are the most common cystic lesions of the mediastinum.3 in some cases , these lesions could mimic solid masses.4 most patients with posterior mediastinal cysts are asymptomatic , and the cysts are discovered incidentally during other imaging studies .
the possible symptoms include chest pain , cough , dyspnea and dysphagia.356 the differentiation between a solid and cystic lesion by the imaging modalities available , such as computed tomography ( ct ) , magnetic resonance imaging ( mri ) and endoscopic ultrasonography ( eus ) , is not always easy.47 eus has provided a minimally invasive approach to the diagnosis of benign mediastinal cysts.8 in the largest retrospective study done to date , it has been demonstrated that a hypoechoic eus pattern does not exclude the diagnosis of a cyst.8 our report describes two cases of intramural bronchogenic cysts and reviews the role of eus in dealing with such cases .
an 80-year - old female was admitted to our hospital due to retrosternal pain , fever , coughing and weight loss of 20 pounds in a month .
a eus - guided fine needle aspiration ( fna ) of this lesion was indicated .
2 ) showed a paraesophageal anechoic round mass with a starry - sky pattern , negative doppler and posterior acoustic enhancement .
the follow - up showed good evolution and diminution of the cyst size 1 month later in the radiological control . a computed tomography - scan showing a mediastinal paraesophageal mass .
endoscopic ultrasonography with a linear array ultrasound endoscope showed an anechoic round mass with a starry - sky pattern and the needle inside the lesion .
a 42-year - old male was referred to our institution due to a submucosal lesion in the distal third of the esophageal wall .
it had a homogenous , hypoechoic aspect , with well defined borders , posterior acoustic enhancement , and measured 5 cm in its largest diameter .
the patient was discharged on the same day without treatment of antibiotics , and no infectious complications were observed during follow - up .
the lesion was homogenous , hypoechoic , with well defined borders and posterior acoustic enhancement .
an 80-year - old female was admitted to our hospital due to retrosternal pain , fever , coughing and weight loss of 20 pounds in a month .
a eus - guided fine needle aspiration ( fna ) of this lesion was indicated .
2 ) showed a paraesophageal anechoic round mass with a starry - sky pattern , negative doppler and posterior acoustic enhancement .
the follow - up showed good evolution and diminution of the cyst size 1 month later in the radiological control . a computed tomography - scan showing a mediastinal paraesophageal mass .
endoscopic ultrasonography with a linear array ultrasound endoscope showed an anechoic round mass with a starry - sky pattern and the needle inside the lesion .
a 42-year - old male was referred to our institution due to a submucosal lesion in the distal third of the esophageal wall .
it had a homogenous , hypoechoic aspect , with well defined borders , posterior acoustic enhancement , and measured 5 cm in its largest diameter .
the patient was discharged on the same day without treatment of antibiotics , and no infectious complications were observed during follow - up .
the lesion was homogenous , hypoechoic , with well defined borders and posterior acoustic enhancement .
an 80-year - old female was admitted to our hospital due to retrosternal pain , fever , coughing and weight loss of 20 pounds in a month .
a eus - guided fine needle aspiration ( fna ) of this lesion was indicated .
2 ) showed a paraesophageal anechoic round mass with a starry - sky pattern , negative doppler and posterior acoustic enhancement .
the follow - up showed good evolution and diminution of the cyst size 1 month later in the radiological control . a computed tomography - scan showing a mediastinal paraesophageal mass .
endoscopic ultrasonography with a linear array ultrasound endoscope showed an anechoic round mass with a starry - sky pattern and the needle inside the lesion .
a 42-year - old male was referred to our institution due to a submucosal lesion in the distal third of the esophageal wall .
it had a homogenous , hypoechoic aspect , with well defined borders , posterior acoustic enhancement , and measured 5 cm in its largest diameter .
the patient was discharged on the same day without treatment of antibiotics , and no infectious complications were observed during follow - up .
the lesion was homogenous , hypoechoic , with well defined borders and posterior acoustic enhancement .
about 46% to 67% of all mediastinal lesions are malignant.910 reported accuracy of diagnosis for malignant lesions in the mediastinum is only about 83%.11 therefore , it is important to perform a good evaluation of these lesions to avoid unnecessary surgical procedures .
bronchogenic cysts originate from the aberrant development of the ventral primitive foregut during embryonic development .
they share a similar developmental background with esophageal duplication cysts.34612 about 85% percent of bronchogenic cysts arise in the mediastinum in close relationship to the trachea , main bronchi , and carina .
occasionally , bronchogenic cysts become engulfed in the growing esophagus.13 eus can accurately distinguish a solid from a cystic lesion , and with fna it 's possible to collect materials from suspicious or atypical lesions.8 in comparison with the other imaging modalities ( ct and mri ) , eus is better at differentiating solid from cyst lesions.214 ct and mri may misdiagnosed a cystic duplication lesion as a solid lesion in about 70% of cases.2 the feature that distinguishes a cyst in eus is a round or tubular anechoic structure with a negative doppler signal and posterior acoustic enhancement.1 sometimes in eus examinations , bronchogenic cysts may resemble smooth muscle tumors and gastrointestinal stromal tumors ( gist ) due to their round or oval shape with well - defined borders and homogeneous and hypoechoic internal echo pattern .
the echogenicity can be attributed to the mucoid content of the cyst.8 in the first case , weight loss , fever and an apparent mediastinal solid lesion on ct raised the possibility of a lymphoma . the starry - sky pattern on eus probably correlated with the mucoid content of the cyst .
the lesion was hypoechoic and apparently with its origin at the fourth layer , raising the possibility of a gist .
mediastinal cyst biopsy is not always necessary and the literatures report cases of severe infection after eus - fna.81516 the use of antibiotics before and after the procedure has already been evaluated in small clinical studies with promising results.214 however , another study shows infectious complication after eus - fna despite the use of a prophylactic antibiotic.17 at the moment , there is no consensus regarding antibiotic prophylaxis use before eus - fna . in our cases ,
just the first patient received antibiotics and none of them had infectious complications after eus - fna .
there is little description in the literature about the macroscopic appearance of the material obtained from eus - fna .
the macroscopic appearance of the material collected from bronchogenic cysts with eus - fna was often described to be like mucoid / mucinous,3811 grayish white mucus,2 thick , brownish fluid,16 or yellowish fluid.14 in our cases , both patients had a mucous content in the material obtained by eus - fna .
bronchogenic cysts could be managed conservatively and/or by surgery depending on the clinical aspects of patients with this problem.18 finally , there is also controversy in the literature regarding the need to perform eus drainage of the cyst content . based on the infection risk related to eus - fna , some studies favored drainage,14 but not all of them.28 in our two cases , we did not perform eus drainage and the patients did not develop infectious complications related to eus - fna . in conclusion ,
they are rarely mediastinal lesions , which can explain the lack of more satisfying clinical trials and of more useful guidelines to assist physicians .
current literatures are still controversial about some points such as the need of eus - fna , eus - drainage and the use of antibiotic prophylaxis during interventional eus ( fna or drainage ) . | the differentiation between a solid and cystic lesion is not always easy .
eus has provided a minimally invasive approach to the diagnosis of benign mediastinal cysts .
our report describes two cases of intramural bronchogenic cysts and reviews the role of eus in dealing with such cases .
we conclude that the bronchogenic cysts are still a challenge despite evolution of the imaging studies . | INTRODUCTION
CASE REPORTS
None
Case 1
Case 2
DISCUSSION |